sign in sign up
<<
Home , Efflux (microbiology), Molecular binding

pathogens

Article Efflux MexAB-Mediated Resistance in P. aeruginosa Isolated from Patients with Healthcare Associated Infections

Rania M. Kishk 1,* , Mohamed O. Abdalla 2 , Abdullah A. Hashish 2 , Nader A. Nemr 3, Nihal El Nahhas 4, Saad Alkahtani 5, Mohamed M. Abdel-Daim 5,6 and Safaa M. Kishk 7

1 Department of Microbiology and , Faculty of , Suez Canal University, Ismailia 41522, Egypt 2 Department of Clinical Pathology, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt; [email protected] (M.O.A.); [email protected] (A.A.H.) 3 Endemic and Infectious Diseases, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt; [email protected] 4 Department of Botany, Faculty of Science, Alexandria University, Moharram baik, Alexandria 21515, Egypt; [email protected] 5 Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia; [email protected] (S.A.); [email protected] (M.M.A.-D.) 6 Department of , Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522, Egypt 7 Department of , Faculty of , Suez Canal University, Ismailia 41522, Egypt; [email protected] * Correspondence: [email protected]; Tel.: +20-1025-099-921

 Received: 24 March 2020; Accepted: 10 June 2020; Published: 15 June 2020 

Abstract: Today, one of the most important challenges for physicians is the adequate treatment of infections due to multidrug resistant organism (MDR). aeruginosa is considered an opportunistic organism causing different types of healthcare associated infections (HAIs). We aimed to investigate the MDR and pandrug resistance (PDR) rate in P. aeruginosa in our region and detect efflux-pump mexAB and the proposed binding interactions of five different categories of antimicrobial agents with the mexB pump. A total of 180 non-duplicated P. aeruginosa strains were isolated from patients with HAIs in the Suez Canal University Hospital. Phenotypically, minimum inhibitory concentration (MIC) was done for all MDR and PDR strains before and after addition of efflux pump inhibitor carbonyl cyanide m-chlorophenyl hydrazone (CCCP). Molecular detection of mexA and mexB genes was done by using polymerase chain reaction (PCR). Most of the isolated strains (126 strains) were MDR (70%); only 10 samples (5.5%) were PDR. MexA and mexB genes were detected in 88.2% (120 strains) and 70.5% (96 strains) of stains, respectively. All PDR strains (10 stains) carried both mexA and mexB genes. Efflux mexAB genes were detected in all MDR and PDR strains (136 strains). Molecular modeling studies were performed to investigate the modes of intermolecular binding interactions between the antimicrobial agents and mexB key amino acids that resulted in MDR and PDR. The current study reported high prevalence of MDR and PDR P. aeruginosa in patients with HAIs in the Suez Canal University Hospitals.

Keywords: efflux pump; MexAB; ; HAIs; Egypt; molecular modeling

1. Introduction One of the important pathogens reported in community and healthcare-associated infections (HAIs) is P. aeruginosa [1,2]. The emergence of pandrug-resistant (PDR) and multidrug-resistant strains

Pathogens 2020, 9, 471; doi:10.3390/pathogens9060471 www.mdpi.com/journal/pathogens Pathogens 2020, 9, 471 2 of 13

(MDR) in this organism is of considerable concern, as limited antimicrobial are effective against these resistant strains [1,3]. This phenomenon can be explained by the intrinsic resistance to many antimicrobials due to the presence of efflux transporters with low outer membrane permeability [4,5]. The extrusion of toxic compounds from the are promoted through these membrane-associated active transporters. These extruded compounds include [6–8]. MDR isolates display resistance to three categories of drugs used as anti-Pseudomonas, while all types of antibiotics show no effect in the treatment of PDR isolates [9]. Gram-negative bacteria have multidrug efflux systems named resistance-nodulation–cell division (RND) that are clinically significant. The RND-type multidrug efflux systems are not equally expressed in all Gram-negative bacteria. For example; mexAB-oprM, mexCD-oprJ, mexEF oprN and mexXY are more expressed in P. aeruginosa [10–12]. The RND-type efflux pump system composed of three-component systems. These three components systems are known as proton motive force (mexD, mexB, mexY and mexF), outer membrane factors (oprM, oprJ, oprN and OMF) and periplasmic membrane fusion (mexA, MFP, mexX, mexC and mexF)[11–14]. Overproduction of mexAB-oprM in P. aeruginosa plays a significant role in development of MDR strains [15]. Recent studies reported a relationship between mexXY system and aminoglycoside resistance in P. aeruginosa clinical isolates [16,17]. The most considerable mechanism of resistance is the upregulation of mexXY pump [18]. In cystic fibrosis, upregulation of mexXY pump seems to be the major contributing factor of P. aeruginosa isolates’ resistance to aminoglycosides [1]; (P) aeruginosa has been recognized as the foremost pathogen causing HAIs especially at surgical sites and burn wounds as it can colonize inside the injured tissues and flourishes in moist burn wound surfaces [19]. Efflux pump inhibition can be attained by interference with the regulatory mechanisms for the efflux pump expression, blocking of outer pores causing antibiotics efflux or changing the antibiotics structure chemically. Other mechanisms including disturbance of the efflux pump-components assembly or interference with the energy required for the pump activity [20,21]. Efflux pump inhibitors (EPIs) are important for a successful therapy and are used to decrease the level of resistance and increase the intracellular concentration of the therapeutic drugs. The main issue challenged in the production of the EPIs is their [22]. Carbonyl cyanide m-chlorophenylhydrazone (CCCP) was used as one of the EPIs for P. aeruginosa infections by its oxidative phosphorylation action which reduces the ATP production and increases the bacterial membrane permeability by interfering with proton motive force [23]. The X-ray crystallography of tripartite structures has not succeeded although the crystal structures of each components were identified [24]. Difficulty in drugs identification co-crystallized structures in MDR pumps may be due to multisite binding and drug oscillation between binding sites during transport [25]. There are two distinct pockets in MDR pumps for the multisite drug-binding: the proximal binding pocket (PBP) and distal binding pocket (DBP) [26]. In the DBP, there is a specific inhibitor-binding hydrophobic pit and it was reported the low-molecular-mass drugs (LMMDs) prefer binding to DBP [26]. MexAB has a broad substrate specificity and the binding mode of the studied antibiotics is still unclear, and none of the antibiotics under investigation have been tested by molecular . The present study aimed to investigate P. aeruginosa MDR and PDR rate and to detect the efflux pump mexAB genes as a possible mechanism involved in resistance in our region. Exploring the drug-bound structures of mexB from P. aeruginosa with five different categories of antimicrobial agents; cephalosporins (ceftazidime), aminoglycosides (gentamicin), monobactam (aztreonam), quinolone (ciprofloxacin) and β-lactam (imipenem) and comparing the binding modes with a high-molecular mass compound Lauryl Maltose Neopentyl Glycol (LMNG); which has a competitive inhibitory activity to mexB [27], helps in determining the key amino acids that are responsible for the resistant activity. Pathogens 2020, 9, 471 3 of 13

2. Results Pathogens 2020, 9, x FOR PEER REVIEW 3 of 13 A total of 180 non-duplicated P. aeruginosa were isolated from patients with HAIs in the Suez (25%),Canal intensive University care Hospital. units (ICU) Most of(20%), isolates neonatal were isolated intensive from care burn unit unit (NICU) (30%), surgical (12%), wardsurology (25%), departmentintensive (8%) care unitsand medicine (ICU) (20%), departments neonatal intensive(5%). The care highest unit (NICU)resistance (12%), was urologynoticed departmentagainst ciprofloxacin(8%) and medicine(70%), aztreonam departments (69%), (5%). cefepime The highest (68%), resistance ceftazidime was (68%), noticed gentamicin against ciprofloxacin (65%), imipenem(70%), aztreonam(62%) and (69%), meropenem cefepime (62%). (68%), ceftazidimeHalf strains (68%), were gentamicinresistant to (65%), amikacin imipenem (50%) (62%) and and tobramycinmeropenem (50%). (62%). The highest Half strains resistance were resistantamong MDR to amikacin strains was (50%) to andaztreonam tobramycin (93%) (50%). and cefepime The highest (91%)resistance (Figure1). among Out of MDR 180 strainsP. aeruginosa was to isolates, aztreonam 126 (93%)isolates and were cefepime MDR (70%) (91%) and (Figure only1). 10 Out (5.5%) of 180 wereP. PDR. aeruginosa isolates, 126 isolates were MDR (70%) and only 10 (5.5%) were PDR.

Antibiotic Resistance Pattern

Ciprofloxacin 50% 70% Aztreonam 50% 69% Cefepime 62% Ceftazidime 68% 62% Gentamicin Imepenem 65% 68% Meropenem Amikacin Tobramycin

FigureFigure 1. Antibiotic 1. Antibiotic resistance resistance pattern pattern of P. of aeruginosaP. aeruginosa isolatesisolates (No. (No. 180 strains). 180 strains).

We Wenoticed noticed that that MDR MDR strains strains (No.126) (No.126) were were isolated isolated from from the theburn burn units, units, surgical surgical wards, wards, ICU ICU andand NICU NICU (54.8%, (54.8%, 31.7%, 31.7%, 10.3%, 10.3%, 3.2%, 3.2%, respectively). respectively). Half Half of the of thePDR PDR strains strains were were isolated isolated from from the the burnburn unit unit (50%, (50%, 5 strains) 5 strains) and and surgical surgical wards wards (30%, (30%, 3 strains), 3 strains), the theremaining remaining 2 strains 2 strains were were isolated isolated fromfrom ICU. ICU. TheThe preliminary preliminary results results of ciprofloxacin of ciprofloxacin susceptibility susceptibility test, test, in MDR in MDR and and PDR PDR strains, strains, using using the the diskdisk agar agar diffusion diffusion method, method, showed showed that that 120 120isolates isolates (88.2%) (88.2%) were were resistant. resistant. MIC MIC for forciprofloxacin ciprofloxacin rangedranged from from 0.25 0.25 to to256 256 mg/L. mg/L. According According to to th thee established breakpointbreakpoint valuesvalues recommended recommended by by CLSI, the P. aeruginosa isolates with MIC 4 mg/L are considered as ciprofloxacin resistant. Nearly, all tested CLSI, the P. aeruginosa isolates with MIC≥ ≥ 4 mg/L are considered as ciprofloxacin resistant. Nearly, isolates were resistant to ciprofloxacin by MIC test (MIC 4 mg/L). By using CCCP as EPI, the MICs all tested isolates were resistant to ciprofloxacin by MIC test ≥(MIC ≥ 4 mg/L). By using CCCP as EPI, the ofMICs ciprofloxacin of ciprofloxacin for 100 for isolates 100 isolates (83.3%) (83.3% of the)ciprofloxacin of the ciprofloxacin resistant re isolatesistant decreasedisolate decreased (more than (more4-fold) than on 4-fold) the CCCP-supplemented on the CCCP-supplemented plate. In addition, plate. In in addition, other synergy in other tests synergy by using tests CCCP by andusing other CCCPantibiotics and other as antibiotics imipenem, as we imipenem, observed we a reduction observed in a MICreduction on addition in MIC CCCPon addition which CCCP proved which the role provedof e ffltheux role pumps of efflux in the pumps resistance in the to resistance these two to drugs these (twop = 0.001).drugs ( Onp = 0.001). the other On hand,the other there hand, was no theresignificant was no significant change in thechange MIC in of the cefotaxime MIC of cefotaxime and gentamicin and gentamicin for all the isolates for all afterthe isolates CCCP additionafter CCCP(p > addition0.005). (p > 0.005). MolecularMolecular detection detection of the of the 16s 16s , gene, mexAmexA andand mexBmexB genesgenes was was done done by PCRPCR toto allall MDR MDR and and PDR PDRisolates isolates (136 (136 stains). stains). All All strains strains were were positive positive for forPseudomonas Pseudomonas16S 16S gene gene (Figures ( Figure2 and 2; 3 ). FigureMexA 3).and MexAmexB andgenes mexB were genes detected werein detected 88.2% (120 in strains)88.2% (120 and 70.5%strains) (96 and strains) 70.5% of stains,(96 strains) respectively. of stains, Nearly, respectively.80 strains Nearly, (58.8%) 80 were strains carrying (58.8%) both weremexA carryingand mexBboth mexAgenes and including mexB genes all PDR including strains all (10 PDR stains), strainswhich (10 werestains), mostly which isolated were frommostly burn isolated and surgicalfrom burn departments and surgical (48.7% departments and 37.5%, (48.7% respectively). and 37.5%,On respectively). the other hand, On 56 the strains other (41.2%)hand, 56 were strains carrying (41.2%) either weremexA carryingor mexB eithergenes. mexAMost or mexB of them genes. were Mostisolated of them from were ICU, isolated NICU from and ICU, burn NICU units. and burn units. Regarding the antibiotic resistance, we found that the strains carrying both of mexA and mexB genes were more resistant than strains carrying only one gene (the results were statistically significant, p < 0.001). All ciprofloxacin and imipenem resistant strains carried at least one resistant gene.

Pathogens 2020, 9, 471 4 of 13

Regarding the antibiotic resistance, we found that the strains carrying both of mexA and mexB genes were more resistant than strains carrying only one gene (the results were statistically significant, Pathogens 2020, 9, x FOR PEER REVIEW 4 of 13 Pathogensp < 0.001). 2020, 9 All, x FOR ciprofloxacin PEER REVIEW and imipenem resistant strains carried at least one resistant gene.4 of 13

Figure 2. 16S gene in P. aeruginosa; Lane (L) shows 100-bp molecular size ladder, lane (P) is the FigureFigure 2. 2.16S16S gene gene in in P.P. aeruginosa;; LaneLane (L) (L) shows shows 100-bp 100-bp molecular molecular size size ladder, ladder, lane lane (P) is (P) the is positive the positive control, lane (N) is the negative control (E. coli), lanes 1 to 10 are the positive samples positivecontrol, control, lane (N) lane is the (N) negative is the controlnegative (E. control coli), lanes (E. 1coli to), 10 lanes are the 1 positiveto 10 are samples the positive carrying samples 16S gene carrying 16S gene (530 bp). carrying(530 bp). 16S gene (530 bp).

FigureFigure 3. MexA 3. MexA genegene in P. in aeruginosaP. aeruginosa; Lane; Lane (L) (L)shows shows 100-bp 100-bp molecular molecular size size ladder, ladder, lane lane (P) (P) is the is the Figure 3. MexA gene in P. aeruginosa; Lane (L) shows 100-bp molecular size ladder, lane (P) is the positivepositive control, control, lanes lanes 1 and 1 and 2 are 2 are the the positive positive samples samples carrying carryingmexA mexAgene gene (293 (293 bp). bp). positive control, lanes 1 and 2 are the positive samples carrying mexA gene (293 bp). MolecularMolecular modeling modeling results results showed showed that that the the position position and and binding binding interactions interactions of ofceftazidime, ceftazidime, Molecular modeling results showed that the position and binding interactions of ceftazidime, gentamicin,gentamicin, ciprofloxacin, ciprofloxacin, aztreonam aztreonam and and imipenem imipenem could could be beclosely closely replicated replicated as asobserved observed with with gentamicin, ciprofloxacin, aztreonam and imipenem could be closely replicated as observed with LMNGLMNG and and mexBmexB in inthe the crystal crystal structure structure PDB PDB 6IIA. 6IIA. The The five five different different categories categories of ofantimicrobial antimicrobial LMNG and mexB in the crystal structure PDB 6IIA. The five different categories of antimicrobial agentsagents were were bound bound to tothe the distal distal binding binding pocket, pocket, wh whereere they they were were inserted inserted into into the the inhibitor-binding inhibitor-binding agents were bound to the distal binding pocket, where they were inserted into the inhibitor-binding hydrophobichydrophobic pit pit showing showing that that both both the the antimicrobial antimicrobial drugs drugs and and the the competitive competitive inhibitory inhibitory LMNG LMNG hydrophobic pit showing that both the antimicrobial drugs and the competitive inhibitory LMNG hadhad almost almost the the same same binding binding interactions interactions in in the the DBP DBP ( (FiguresFigure 44 Figure–8). The 5 molecularFigure 6 Figure binding 7 Figure modes 8). can had almost the same binding interactions in the DBP ( Figure 4 Figure 5 Figure 6 Figure 7 Figure 8). Theillustrate molecular the binding role of mexB modesin canP. aeriogenosa illustrate theresistance role of tomexB the in studied P. aeriogenosa antibiotics. resistance to the studied The molecular binding modes can illustrate the role of mexB in P. aeriogenosa resistance to the studied antibiotics. antibiotics.

PathogensPathogens2020, 20209, 471, 9, x FOR PEER REVIEW 5 of 135 of 13 Pathogens 2020, 9, x FOR PEER REVIEW 5 of 13 Pathogens 2020, 9, x FOR PEER REVIEW 5 of 13

Figure 4. Three-dimensional image of the alignment of the crystal structures of Figure 4. Three-dimensional image of the alignment of the crystal structures of FiguremexB (yellow) 4. Three-dimensional co-crystallized imagewith LMNGof the alig(orange)nment (PDB of the 6IIA) crystal and structures ceftazidime of Figure 4. Three-dimensionalmexB (yellow) co-crystallized image of with the alignmentLMNG (orange) of the (PDB crystal 6IIA) structuresand ceftazidime of mexB (yellow) mexB(blue) (yellow)with co-crystallizedcomparable positioning with LMNG observed (orange) (PDBin the6IIA) inhibitor-binding and ceftazidime co-crystallized(blue) with LMNGwith comparable (orange) (PDB positioning 6IIA) and observed ceftazidime in (blue)the inhibitor-binding with comparable positioning (blue)hydrophobic with pitcomparable (green). Thepositioning carboxylic observed group wasin thedirected inhibitor-binding to the less observed in thehydrophobic inhibitor-binding pit (green). hydrophobic The carboxylic pit (green). group The was carboxylic directed groupto the was less directed to the hydrophobic partpit of(green). the active The site carboxylic (magenta). group was directed to the less less hydrophobichydrophobic part of the part active of the siteactive (magenta). site (magenta). hydrophobic part of the active site (magenta).

Figure 5. Three-dimensional image of the alignment of the crystal structures of Figure 5. Three-dimensional image of the alignment of the crystal structures of Figure 5. Three-dimensionalFiguremexB (yellow) 5. Three-dimensional co-crystallized image of image with the alignmentLMNGof the alig(orange)nment of the (PDB of crystalthe 6IIA) crystal structuresand structures gentamicin of ofmexB (yellow) mexB (yellow) co-crystallized with LMNG (orange) (PDB 6IIA) and gentamicin co-crystallizedmexB(blue) with (yellow) LMNGwith comparableco-crystallized (orange) (PDB positioning with 6IIA) LMNG and observed gentamicin(orange) (PDBin (blue) the6IIA) inhibitor-binding with and comparablegentamicin positioning (blue) with comparable positioning observed in the inhibitor-binding observed in the(blue)hydrophobic inhibitor-binding with pitcomparable (green). hydrophobic The positioninghydroxy pit and (green). observedthe amino The groupsin hydroxy the were inhibitor-binding and directed theamino to the groups were hydrophobic pit (green). The hydroxy and the amino groups were directed to the directed to thehydrophobicless less hydrophobic hydrophobic pit (green). part part of thThe ofe active thehydroxy active site and (magenta). site the (magenta). amino groups were directed to the less hydrophobic part of the active site (magenta). less hydrophobic part of the active site (magenta).

Figure 6. Three-dimensional image of the alignment of the crystal structures of mexB (yellow)

co-crystallized with LMNG (orange) (PDB 6IIA) and ciprofloxacin (blue) with comparable positioning observed in the inhibitor-binding hydrophobic pit (green). Pathogens 2020, 9, x FOR PEER REVIEW 6 of 13 Pathogens 2020, 9, x FOR PEER REVIEW 6 of 13

Figure 6. Three-dimensional image of the alignment of the crystal structures of Figure 6. Three-dimensional image of the alignment of the crystal structures of mexB (yellow) co-crystallized with LMNG (orange) (PDB 6IIA) and ciprofloxacin mexB (yellow) co-crystallized with LMNG (orange) (PDB 6IIA) and ciprofloxacin (blue) with comparable positioning observed in the inhibitor-binding Pathogens 2020, 9, 471(blue) with comparable positioning observed in the inhibitor-binding 6 of 13 hydrophobic pit (green). hydrophobic pit (green).

Figure 7. Three-dimensional image of the alignment of the crystal structures of Figure 7. Three-dimensional image of the alignment of the crystal structures of Figure 7. Three-dimensionalmexB (yellow) co-crystallized image of with the alignmentLMNG (orange) of the (PDB crystal 6IIA)structures and aztreonam of mexB (yellow) mexB (yellow) co-crystallized with LMNG (orange) (PDB 6IIA) and aztreonam co-crystallized(blue) with LMNGwith comparable (orange) (PDB positioning 6IIA) and observed aztreonam in (blue)the inhibitor-binding with comparable positioning (blue) with comparable positioning observed in the inhibitor-binding observed in thehydrophobic inhibitor-binding pit (green). hydrophobic pit (green). hydrophobic pit (green).

Figure 8. Three-dimensionalFigure 8. Three-dimensional image of image the alignmentof the alignment of the of crystalthe crystal structures structures of ofmexB (yellow) Figure 8. Three-dimensional image of the alignment of the crystal structures of co-crystallizedmexB with (yellow) LMNG co-crystallized (orange) (PDB with 6IIA) LMNG and imipenem(orange) (PDB (blue) 6IIA) with and comparable imipenem positioning mexB (yellow) co-crystallized with LMNG (orange) (PDB 6IIA) and imipenem (blue) with comparable positioning observed in the inhibitor-binding observed in the(blue) inhibitor-binding with comparable hydrophobic positioning pit (green).observed in the inhibitor-binding hydrophobic pit (green). hydrophobic pit (green). 3. Discussions

The3. Discussions emergence of Gram-negative MDR is considered a significant public health issue [28]. 3. Discussions The rapid rise of antibacterial resistance is still a major global health problem that can impair the The emergence of Gram-negative MDR is considered a significant public health issue [28]. The The emergence of Gram-negative MDR is considered a significant public health issue [28]. The antibacterialrapid rise agents’ of antibacterial effectiveness resistance and wastes is still the a emajorfforts global for developing health problem new drugs. that can Effl uximpair pumps the have rapid rise of antibacterial resistance is still a major global health problem that can impair the a greatantibacterial concern in agents’ emergence effectiveness of P. aeruginosa and wastesantibacterial the efforts for resistance developing [6,7 new,29]. drugs. Efflux pumps antibacterial agents’ effectiveness and wastes the efforts for developing new drugs. Efflux pumps Thehave present a great concern study aimed in emergence to study of the P. prevalenceaeruginosa antibacterial of MDR and resistance PDR P. aeruginosa[6,7,29]. and its relationship have a great concern in emergence of P. aeruginosa antibacterial resistance [6,7,29]. with the efflTheux present pump mexABstudy genesaimed asto astudy possible the factor prevalence involved of MDR in resistance and PDR in theP. aeruginosa Suez Canal and University its The present study aimed to study the prevalence of MDR and PDR P. aeruginosa and its Hospital,relationship Ismailia, with Egypt. the efflux Our pump datashowed mexAB genes high as prevalence a possible factor of MDR involved among in theresistance isolated in strainsthe Suez (70%), relationship with the efflux pump mexAB genes as a possible factor involved in resistance in the Suez Canal University Hospital, Ismailia, Egypt. Our data showed high prevalence of MDR among the and onlyCanal (5.5%) University of the Hospital, isolates wereIsmailia, PDR. Egypt. In concordance Our data showed with ourhigh results, prevalence a study of MDR from among Iran published the isolated strains (70%), and only (5.5%) of the isolates were PDR. In concordance with our results, a in 2016,isolated reported strains high (70%), MDR and rate only in (5.5%)P. aeruginosa of the isolisolatesates were (66%) PDR. from In burnsconcordance unit and with only our one results, strain a was

PDR (0.66%) [30]. We noticed increased rates of MDR and PDR in the burns unit (54.8% and 50%, respectively) followed by SSIs in surgical wards (31.7% and 30%, respectively). As a matter of fact, P. aeruginosa is the main pathogen causing burn infections and is considered as a major colonizer of burn wounds as the moist surfaces of burn wounds represents a favorable medium for its growth, and because of its ability to persist well in hospital environments [19]. The highest resistance was noticed against ciprofloxacin (70%), aztreonam (69%), cefepime (68%), ceftazidime (68%), gentamicin (65%), imipenem (62%) and meropenem (62%). A recent study in burn Pathogens 2020, 9, 471 7 of 13 centers of Tehran, Iran, reported high rate of resistance to ciprofloxacin, amikacin and gentamicin (over 85%) [31] which was higher than our findings. This difference may be due to different samples sources, as in our study, we collected specimens from all cases with HAIs not from burns unit only. Burns unit, as a critical care unit, is rich in bacteria with severe . This explains the high rates of MDR and PDR in burns unit in our study. We noticed that more than 80% of the MDR isolates were resistant to more than seven antibiotics and more than 60% of the isolates were resistant to more than ten antibiotics. In a similar study, Pellegrino et al. reported lower percentage to co-resistance to seven or ten antibiotics, at two different centers (nearly 32% and 40%, respectively) [32]. The lower resistance rate of that study compared to ours is expected as the antibiotic resistance rates has increased radically all over the world in the past few years. On the other hand, Delpano et al. reported higher antibiotic resistance compared to our study that 100% of the isolates were resistant to ciprofloxacin, tobramycin, gentamicin, cefepime, imipenem and meropenem [33]. Overexpression of efflux pumps could be the leading cause of MDR in bacteria as it leads to a decreased intracellular concentration of antibiotics and reduced susceptibility to antimicrobial agents due to continuous expelling of structurally unrelated drugs [34]. This explains the over representation of mexA and mexB genes (70.5% and 88.2%, respectively) in our study. We noticed that all PDR isolates were carrying both mexAB genes. This over-representation of mexAB genes is matched with the fact that the antibiotics that are substrates of the corresponding transporters are used usually in patient treatment plans. Molecular docking was done using the molecular operating environment (MOE) program, to investigate the intermolecular binding affinity between the studied antimicrobial agents and mexB which was one of the overexpressed efflux pumps in our study. This binding affinity is directly correlated to the antimicrobial resistance due to the efflux mechanisms which result in a decreased concentration of the antimicrobial agents intracellularly. Some of the key residues that had intermolecular bindings with all of the antimicrobial agents were Lys134, Gln46 and Gln176. For the cephalosporin ceftazidime, the 2-aminothiazol-4-yl group elongated parallel in the space above the inhibitor-binding pit, mimicking the LMNG positioning. The ceftazidime carboxylate formed strong ionic bonding with the basic amino acid Lys134. H-bonds were formed with Lys134, Gln46 and Gln176 in addition to arene-arene bindings between thiazole ring and Phe178 in the hydrophobic pit (FigurePathogens9). 2020, 9, x FOR PEER REVIEW 8 of 13

FigureFigure 9. 9Two-dimensional. Two-dimensional image image of of the the binding binding interactions interactions of ceftazidime of ceftazidime in the inmexB the activemexB siteactive site withwith Lys134, Lys134, Gln46, Gln46, Gln176, Gln176, Phe178Phe178 as as key key binding binding amino amino acids. acids.

TheThe aminoglycoside aminoglycoside gentamicin was was flexibly flexibly bound bound towards towards the exit the and exit the and entrance the entrance of DBP, of DBP, formingforming H-bonds H-bonds with with Arg128,Arg128, Lys134, Lys134, gln176 gln176 and and Arg620. Arg620. Arene–H Arene–H binding binding was also was formed also formed with with Phe615 (Figure 10). Phe615 (Figure 10).

Figure 10. Two-dimensional image of the binding interactions of gentamicin in the mexB active site with Lys134, Gln46, Gln176, Arg128, Arg620 and Phe615 as key binding amino acids.

The quinolone ciprofloxacin was mainly inserted in the inhibitor-binding pit and formed arene-arene bindings with Phe628 and Phe178, arene–H bindings with Phe610 and Phe178. H-bonds were also observed with Arg620 and Arg128 (Figure 11).

Pathogens 2020, 9, x FOR PEER REVIEW 8 of 13

Figure 9. Two-dimensional image of the binding interactions of ceftazidime in the mexB active site with Lys134, Gln46, Gln176, Phe178 as key binding amino acids.

The aminoglycoside gentamicin was flexibly bound towards the exit and the entrance of DBP, forming H-bonds with Arg128, Lys134, gln176 and Arg620. Arene–H binding was also formed with Pathogens 2020, 9, 471 8 of 13 Phe615 (Figure 10).

Figure 10. Two-dimensional image of the binding interactions of gentamicin in the mexB active site Figure 10. Two-dimensional image of the binding interactions of gentamicin in the mexB active site with Lys134, Gln46, Gln176, Arg128, Arg620 and Phe615 as key binding amino acids. with Lys134, Gln46, Gln176, Arg128, Arg620 and Phe615 as key binding amino acids. The quinolone ciprofloxacin was mainly inserted in the inhibitor-binding pit and formed The quinolone ciprofloxacin was mainly inserted in the inhibitor-binding pit and formed arene-arene bindings with Phe628 and Phe178, arene–H bindings with Phe610 and Phe178. H-bonds arene-arene bindings with Phe628 and Phe178, arene–H bindings with Phe610 and Phe178. H-bonds werePathogensPathogens also 2020 observed2020,, 99,, xx FORFORwith PEERPEER REVIEWArg620REVIEW and Arg128 (Figure 11). 99 ofof 1313 were also observed with Arg620 and Arg128 (Figure 11).

FigureFigureFigure 11. 1111.Two-dimensional. Two-dimensionalTwo-dimensional imageimage image ofof of thethe the bindingbinding binding interactionsinteractions interactions ofof ciprofloxacinciprofloxacin of ciprofloxacin inin thethe mexBinmexB the activeactivemexB sitesiteactive site withwithwith Phe628, Phe628,Phe628, Phe178, Phe178,Phe178, Phe610,Phe610, Arg620Arg620 Arg620 anan anddd Arg128Arg128 Arg128 asas key askey key bindingbinding binding aminoamino amino acids.acids. acids.

TheTheThe monobactam monobactammonobactam aztreonam aztreonamaztreonam was waswas flexibly flexiblyflexibly bound boundbound towards towardstowards thethethe exit exitexit and andand the thethe entrance entranceentrance of ofof DBP, DBP,DBP, forming H-bondsformingforming with H-bondsH-bonds Arg128, withwith Lys134, Arg128,Arg128, gln176,Lys134,Lys134, gln176,gln176, Gln46, GlGl Lys151,n46,n46, Lys151,Lys151, Ser87 Ser87Ser87 and Arg620.andand Arg620.Arg620. Arene–H Arene–HArene–H binding bindingbinding was also formedwaswas alsoalso with formedformed Phe610 withwith and Phe610Phe610 arene-arene andand arene-arene- bindingarenearene bindingbinding with Phe178 withwith Phe178Phe178 (Figure (Figure(Figure 12). 12).12).

Figure 12. Two-dimensional image of the binding interactions of aztreonam in the mexB active site with FigureFigure 1212.. Two-dimensionalTwo-dimensional imageimage ofof thethe bindingbinding interactionsinteractions ofof aztreonamaztreonam inin thethe mexBmexB activeactive sitesite Arg128,withwith Arg128,Arg128, Lys134, Lys134,Lys134, gln176, gln176,gln176, Gln46, GlnGln Lys151,46,46, Lys151,Lys151, Ser87, Ser87,Ser87, Arg620, Arg620,Arg620, Phe610 Phe610Phe610 and andand Phe178 Phe178Phe178 as asas keykey bindingbinding aminoamino amino acids. acids.acids.

Finally,Finally, thethe ββ-lactam-lactam imipenemimipenem formedformed H-bondsH-bonds withwith Lys134Lys134 andand Arg128Arg128 inin additionaddition toto arene–arene– HH bindingsbindings withwith Phe610Phe610 andand Phe628Phe628 inin thethe hydrophobichydrophobic pitpit (Figure(Figure 13).13).

Pathogens 2020, 9, x FOR PEER REVIEW 9 of 13

Figure 11. Two-dimensional image of the binding interactions of ciprofloxacin in the mexB active site with Phe628, Phe178, Phe610, Arg620 and Arg128 as key binding amino acids.

The monobactam aztreonam was flexibly bound towards the exit and the entrance of DBP, forming H-bonds with Arg128, Lys134, gln176, Gln46, Lys151, Ser87 and Arg620. Arene–H binding was also formed with Phe610 and arene-arene binding with Phe178 (Figure 12).

Figure 12. Two-dimensional image of the binding interactions of aztreonam in the mexB active site with Arg128, Lys134, gln176, Gln46, Lys151, Ser87, Arg620, Phe610 and Phe178 as key binding amino Pathogens 2020, 9, 471 9 of 13 acids.

Finally,Finally, the the β-lactamβ-lactam imipenem imipenem formed formed H-bonds H-bonds with with Lys134 Lys134 and and Arg128 Arg128 in in addition addition to to arene– arene–H H bindings withwith Phe610Phe610 andand Phe628Phe628 inin thethe hydrophobichydrophobic pitpit (Figure(Figure 1313).).

Figure 13. Two-dimensional image of the binding interactions of imipenem in the mexB active site with

Arg128, Lys134, Phe610 and Phe628 as key binding amino acids.

The limitation of this study: The presented data showed the presence of the genes in the genomes and provide no insight into the level of their expression. Further studies are needed to analyze conservation of the genes sequence in the genomes (their presence) of diverse clinical isolates and correlate it (their presence) with antibiotic resistance. Our study also did not discuss the correlation between the presence of single or both mexAB and MDR phenotype as we did not detect mexAB in non MDR isolates by PCR.

4. Materials and Methods This cross-sectional descriptive study was carried out during the period from January 2019 to December 2019. A total of 180 strains of P. aeruginosa were isolated from patients with Healthcare Associated Infections in the Suez Canal University Hospital. Samples were processed in microbiology laboratory, Faculty of Medicine, Suez Canal University.

4.1. Bacterial Isolation and Identification The collected samples were cultured on blood, MacConkey agar, cetrimide agar (Oxoid, UK) and Pseudomonas P agar media. Colonies were identified as P. aeruginosa by colony morphology, Gram stain and different biochemical reactions [35]; (P) aeruginosa ATCC 27853 was used as a reference strain. The isolates were preserved at 80 C in glycerol 15% in brain heart infusion broth (BHIB, Oxoid, − ◦ Basingstoke, UK) and then subculturing in BHIB at 37 ◦C for 24 h.

4.2. Antimicrobial Susceptibility Testing Antibiotic susceptibility testing was performed by Kirby–Bauer disk diffusion method and interpreted according to the Clinical Laboratory Standard Institute (CLSI) guidelines [36]. The antibiotics tested were ciprofloxacin, aztreonam, cefepime, tobramycin, ceftazidime, gentamicin, amikacin, imipenem and meropenem (Oxoid, Basingstoke, UK). Interpretation of susceptibility testing was performed according to CLSI [36]. Multidrug resistant organisms (MDR) were defined as non-susceptibility (i.e., resistant or intermediate) to at least one agent in at least 3 antimicrobial classes of the following 5 classes: cephalosporins (cefepime, ceftazidime), β-lactam/β-lactam β-lactamase inhibitor combination (piperacillin, piperacillin/tazobactam), carbapenems (imipenem, meropenem, doripenem), fluoroquinolones (ciprofloxacin or levofloxacin) or aminoglycosides (gentamicin, tobramycin or amikacin) (CDC, 2020). Otherwise, Pan-drug resistant (PDR) Pseudomonas expressed resistance to all antibiotics [9]. Pathogens 2020, 9, 471 10 of 13

4.3. Role of Efflux Pump in Antibiotic Resistance The MICs of ciprofloxacin, imipenem, ceftazidime and gentamicin were evaluated for all MDR and PDR P. aeruginosa isolates. Then, CCCP was added in a concentration of 10 µM to each Mueller-Hinton agar plates containing 0.5 to 128 µg/mL concentration of each antibiotic used. The CCCP final concentration in the Mueller-Hinton agar was 25 µg/mL. Then, MIC was repeated. A plate with CCCP and no antibiotics was used as control. The reduction in MIC at least 4-fold of any antibiotics with CCCP indicates the presence of efflux pump in isolates [37].

4.4. Molecular Detection of mexA and mexB Genes by PCR DNA extraction was done using Qiagen DNA Mini kit 51,304. We used primers for detection of 16s gene. PCR conditions were adjusted as described by Pirnay and his colleagues [38]. MexA and mexB genes were detected as described before [39]. The PCR products were analyzed by agarose gel electrophoresis on 1.5% agarose (w/vol.) containing 0.5-mg/mL ethidium bromide (Qiagen, Germany) using a 100-bp DNA ladder was used as the size marker (Roche, Germany). Reaction mixtures without a DNA template served as negative controls. All primers and product lengths are shown in Table1.

Table 1. Primers sequences used in this study.

Primer Sequence Amplified Product 16s gene Forward 5 ATGGAAATGCTGAAATTCGGC 3 • 0 0 530 bp Reverse • 50CTTCTTCAGCTCGACGCGACG 30 MexA gene Forward 5 CGACCAGGCCGTGAGCAAGCAGC3 • 0 0 293 bp Reverse • 50GGAGACCTTCGCCGCGTTGTCGC 30 MexB gene Forward 5 GTGTTCGGCTCGCAGTACTC 3 • 0 0 244 bp Reverse • 50AACCGTCGGGATTGACCTTG 30

4.5. Statistical Analysis All statistical analyses were performed using the statistical package for social sciences program (SPSS version 22 for windows). Statistical significance was considered at p-value 0.05. ≤ 4.6. Molecular Modeling and Docking Docking studies were performed using the molecular operating environment (MOE) software and mexB of P. aeruginosa co-crystallized with the LMNG (PDB 6IIA) [40,41]. All minimizations were done until an RMSD gradient of 0.01 kcal/mol/A was obtained. The MMFF94 forcefield and partial charges were automatically calculated. The alpha triangle placement was chosen to determine the poses. The free energy of binding from a given pose was estimated by the London ∆G scoring function. Refined results were rescored using the London ∆G scoring function. The output database dock file was created with different poses for each ligand and arranged according to the final score function (S).

5. Conclusions In conclusion, the current study recognized the high MDR and PDR P. aeruginosa rates in burn and wound samples obtained from the Suez Canal University Hospital. In all MDR and PDR isolated strains Efflux mexAB genes were detected. The studied binding interactions of different drug categories help in the molecular study of the mexB. The molecular modeling could show the key amino acids in Pathogens 2020, 9, 471 11 of 13 mexB that interact with several antimicrobials. The studied docking can give a promising investigation for a future treatment for the resistant P. aeruginosa strains.

Author Contributions: Conceptualization, R.M.K., M.O.A., A.A.H. and S.M.K.; methodology, R.M.K., N.A.N. and N.E.N.; software, S.M.K., M.M.A.-D. and A.A.H.; validation, R.M.K., N.A.N., N.E.N., S.A. and S.M.K.; formal analysis, R.M.K., M.M.A.-D., S.M.K. and A.A.H.; investigation, M.O.A., N.A.N., N.E.N., S.A. and S.M.K.; resources, R.M.K., N.A.N., S.A., M.M.A.-D. and N.E.N.; data curation, R.M.K., M.O.A., A.A.H., N.E.N. and S.M.K.; writing—original draft preparation, R.M.K., M.O.A., A.A.H., N.A.N. and S.M.K.; writing—review and editing, R.M.K., S.M.K., N.E.N., S.A., M.M.A.-D., M.O.A., A.A.H. and N.E.N. All authors have read and agreed to the published version of the manuscript. Funding: This work was funded by Researchers Supporting Project number (RSP 2020/26), King Saud University, Riyadh, Saudi Arabia. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Poole, K. Pseudomonas aeruginosa: Resistance to the max. Front. Microbiol. 2011, 2, 65. [CrossRef][PubMed] 2. Defez, C.; Fabbro-Peray, P.; Bouziges, N.; Gouby, A.; Mahamat, A.; Daures, J.P. Risk factors for multidrug-resistant P. aeruginosa nosocomial infection. J. Hosp. Infect. 2004, 57, 209–216. [CrossRef] [PubMed] 3. Fischbach, M.A.; Walsh, C.T. Antibiotics for emerging pathogens. Science 2009, 325, 1089–1093. [CrossRef] [PubMed] 4. Nikaido, H. Prevention of drug access to bacterial targets: Permeability barriers and active efflux. Science 1994, 264, 382–388. [CrossRef] 5. Hancock, R.E. Resistance mechanisms in P. aeruginosa and other nonfermentative gram-negative bacteria. Clin. Infect. Dis. 1998, 27, S93–S99. [CrossRef] 6. Li, X.Z.; Nikaido, H. Efflux-mediated in bacteria: An update. Drugs 2009, 69, 1555–1623. [CrossRef] 7. Blanco, P.; Hernando-Amado, S.; Reales-Calderon, J.; Corona, F.; Lira, F.; Alcalde-Rico, M.; Bernardini, A.; Sanchez, M.; Martinez, J. Bacterial Multidrug Efflux Pumps: Much More Than Antibiotic Resistance Determinants. Microorganisms 2016, 4, 14. [CrossRef] 8. El-Esawi, M.A.; Alaraidh, I.A.; Alsahli, A.A.; Ali, H.M.; Alayafi, A.A.; Witczak, J.; Ahmad, M. Genetic variation and alleviation of salinity stress in barley. 2018, 23, 2488. [CrossRef] 9. Falagas, M.E.; Koletsi, P.K.; Bliziotis, I.A. The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) and Pseudomonas aeruginosa. J. Med. Microbiol. 2006, 55, 1619–1629. [CrossRef] 10. Poole, K. Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect. 2004, 10, 12–26. [CrossRef] 11. Piddock, L.J. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 2006, 19, 382–402. [CrossRef][PubMed] 12. Lister, P.D.; Wolter, D.J.; Hanson, N.D. Antibacterial-resistant Pseudomonas aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009, 22, 582–610. [CrossRef][PubMed] 13. Llanes, C.; Hocquet, D.; Vogne, C.; Benali-Baitich, D.; Neuwirth, C.; Plesiat, P. Clinical strains of P. aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously. Antimicrob. Agents Chemother. 2004, 48, 1797–1802. [CrossRef][PubMed] 14. Yoneyama, H.; Maseda, H.; Kamiguchi, H.; Nakae, T. Function of the membrane fusion , MexA, of the MexA, B-OprM efflux pump in P. aeruginosa without an anchoring membrane. J. Biol. Chem. 2000, 275, 4628–4634. [CrossRef][PubMed] 15. Schweizer, H.P. Efflux as a mechanism of resistance to antimicrobials in P. aeruginosa and related bacteria: Unanswered questions. Genet. Mol. Res. GMR 2003, 2, 48–62. 16. Nikaido, H.; Pages, J.M. Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiol. Rev. 2012, 36, 340–363. [CrossRef] Pathogens 2020, 9, 471 12 of 13

17. Poole, K. Efflux-mediated antimicrobial resistance. In Antibiotic Discovery and Development; Springer: Berlin/Heidelberg, Germany, 2012; pp. 349–395. 18. Armstrong, E.S.; Miller, G.H. Combating evolution with intelligent design: The neoglycoside ACHN-490. Curr. Opin. Microbiol. 2010, 13, 565–573. [CrossRef] 19. Tsutsui, A.; Suzuki, S.; Yamane, K.; Matsui, M.; Konda, T.; Marui, E. Genotypes and infection sites in an outbreak of multidrug-resistant Pseudomonas aeruginosa. J. Hosp. Infect. 2011, 78, 317–322. [CrossRef] 20. Pagès, J.M.; Amaral, L. Mechanisms of drug efflux and strategies to combat them: Challenging the efflux pump of Gram-negative bacteria. Biochim. Biophys. Acta 2009, 1794, 826–833. [CrossRef] 21. Poole, K.; Lomovskaya, O. Can efflux inhibitors really counter resistance? Infect Dis. 2006, 3, 145–152. [CrossRef] 22. Mahamoud, A.; Chevalier, J.; Alibert-Franco, S.; Kern, W.V.; Pagès, J.M. Antibiotic efflux pumps in gram-negative bacteria: The inhibitor response strategy. J. Antimicrob. Chemother. 2007, 59, 1223–1229. [CrossRef][PubMed] 23. Fanélus, I.; Desrosiers, R.R. Mitochondrial uncoupler carbonyl cyanide M-chlorophenylhydrazone induces the multimer assembly and activity of repair protein L-isoaspartyl methyltransferase. J. Mol. Neurosci. 2013, 50, 411–423. [CrossRef][PubMed] 24. Jeong, H.; Kim, J.S.; Song, S.; Shigematsu, H.; Yokoyama, T.; Hyun, J.; Ha, N.C. Pseudoatomic Structure of the Tripartite Multidrug Efflux Pump AcrAB-TolC Reveals the Intermeshing Cogwheel-like Interaction between AcrA and TolC. Structure 2016, 24, 272–276. [CrossRef][PubMed] 25. Hirakata, Y.; Srikumar, R.; Poole, K.; Gotoh, N.; Suematsu, T.; Kohno, S. Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J. Exp. Med. 2002, 196, 109–118. [CrossRef] [PubMed] 26. Nakashima, R.; Sakurai, K.; Yamasaki, S.; Nishino, K.; Yamaguchi, A. Structures of the multidrug exporter AcrB reveal a proximal multisite drug-binding pocket. Nature 2011, 480, 565–569. [CrossRef] 27. Sakurai, K.; Yamasaki, S.; Nakao, K.; Nishino, K.; Yamaguchi, A.; Nakashima, R. Crystal structures of multidrug efflux pump MexB bound with high-molecular-mass compounds. Sci. Rep. 2019, 9, 1–9. [CrossRef] 28. Driscoll, J.A.; Brody, S.L.; Kollef, M.H. The epidemiology, pathogenesis and treatment of P. aeruginosa infections. Drugs 2007, 67, 351–368. [CrossRef] 29. Nehme, D.; Poole, K. Assembly of the MexAB-OprM multidrug pump of Pseudomonas aeruginosa: Component interactions defined by the study of pump mutant suppressors. J. Bacteriol. 2007, 189, 6118–6127. [CrossRef] 30. Khosravi, A.D.; Mohammadian, A. Efflux MexAB-mediated resistance in multidrug and pan-drug resistant strains of P. aeruginosa isolated from patients with burn and wound infections. Jundishapur J. Nat. Pharm. Prod. 2016, 11, e25352. [CrossRef] 31. Lari, A.R.; Alaghehbandan, R.; Akhlaghi, L. Burn wound infections and antimicrobial resistance in Tehran, Iran: An increasing problem. Ann. Burns Fire Disasters 2005, 18, 68. 32. Pellegrino, F.L.; Teixeira, L.M.; Carvalho Md Mda, G.; Aranha Nouer, S.; Pinto De Oliveira, M.; Mello Sampaio, J.L. Occurrence of a multidrug-resistant P. aeruginosa clone in different hospitals in Rio de Janeiro, Brazil. J. Clin. Microbiol. 2002, 40, 2420–2424. [CrossRef][PubMed] 33. Deplano, A.; Denis, O.; Poirel, L.; Hocquet, D.; Nonhoff, C.; Byl, B. Molecular characterization of an epidemic clone of panantibiotic-resistant Pseudomonas aeruginosa. J. Clin. Microbiol. 2005, 43, 1198–1204. [CrossRef] [PubMed] 34. Khosravi, A.D.; Mihani, F. Detection of metallo-beta-lactamase-producing P. aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn. Microbiol. Infect. Dis. 2008, 60, 125–128. [CrossRef][PubMed] 35. Forbes, B.A.; Sahm, D.F.; Weissfeld, A. Bailey and Scott’s Diagnostic Microbiology, 12th ed.; Mosby Elsevier: St Louis, MO, USA, 2007. 36. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 29th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2019. 37. Pumbwe, L.; Glass, D.; Wexler, H.M. Efflux pump overexpression in multiple-antibiotic-resistant mutants of Bacteroides fragilis. Antimicrob. Agents Chemother. 2006, 50, 3150–3153. [CrossRef] 38. Pirnay, J.-P.; De Vos, D.; Duinslaeger, L.; Reper, P.; Vandenvelde, C.; Cornelis, P. Quantitation of P. aeruginosa in wound biopsy samples: From bacterial culture to rapid ‘real-time’polymerase chain reaction. Crit. Care 2000, 4, 255. [CrossRef] Pathogens 2020, 9, 471 13 of 13

39. Xavier, D.E.; Picao, R.C.; Girardello, R.; Fehlberg, L.C.; Gales, A.C. Efflux pumps expression and its association with porin down-regulation and beta-lactamase production among P. aeruginosa causing bloodstream infections in Brazil. BMC Microbiol. 2010, 10, 217. [CrossRef] 40. Molecular Operating Environment (MOE), 2019.01; Chemical Computing Group ULC: Montreal, QC, Canada, 2019. 41. El-Esawi, M.A.; Al-Ghamdi, A.A.; Ali, H.M.; Alayafi, A.A.; Witczak, J.; Ahmad, M. Analysis of Genetic Variation and Enhancement of Salt Tolerance in French Pea (Pisum Sativum L.). Int. J. Mol. Sci. 2018, 19, 2433. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).