sign in sign up
<<
Home , Acinic cell carcinoma

Modern Pathology (2011) 24, 1169–1176 & 2011 USCAP, Inc. All rights reserved 0893-3952/11 $32.00 1169

Analysis of MYB expression and MYB-NFIB gene fusions in adenoid cystic and other salivary

Louis B Brill II1,4, William A Kanner1,4, Andre´ Fehr2,4, Ywonne Andre´n2, Christopher A Moskaluk1, Thomas Lo¨ning3,Go¨ran Stenman2 and Henry F Frierson Jr1

1Department of Pathology, University of Virginia Health System, Charlottesville, VA, USA; 2Cancer Center Sahlgrenska, Department of Pathology, The Sahlgrenska Academy at University of Gothenburg, Gothenburg, Sweden and 3Institut fu¨r Pathologie, Albertinen-Krankenhaus, Hamburg, Germany

Recent studies have shown that the recurrent t(6;9)(q22–23;p23–24) translocation in results in a novel fusion of the MYB proto-oncogene with the transcription factor gene NFIB. To determine the frequency of this finding, we used RT-PCR assays of the MYB and MYB-NFIB fusion transcripts, and immunohistochemistry for the MYB protein, to study adenoid cystic and other epithelial tumors of the salivary , and head and neck region. MYB-NFIB fusion transcript was detected in 25 of 29 (86%) frozen adenoid cystic carcinoma tumor samples, and in 14 of 32 (44%) formalin-fixed paraffin-embedded adenoid cystic carcinoma tumor specimens. In contrast, the MYB-NFIB fusion was not expressed in non-adenoid cystic carcinoma neoplasms of the head and neck, confirming the high specificity of the MYB-NFIB fusion. Adenoid cystic carcinomas from various anatomic sites, including salivary , sinonasal cavity, tracheobronchial tree, larynx, breast, and vulva were repeatedly fusion-positive, indicating that adenoid cystic carcinomas located in different anatomic sites not only have important morphologic features in common, but also probably evolve through activation of the same molecular pathways. Studies of the expression of MYB revealed that 89% of the tumors, including both fusion-positive and fusion-negative cases, overexpressed MYB RNA. Similarly, 82% of adenoid cystic carcinomas stained positive for MYB protein, compared with 14% of non-adenoid cystic carcinoma neoplasms, indicating that MYB immunostaining may be useful for the diagnosis of adenoid cystic carcinoma, but that neoplasms sometimes in the differential diagnosis are also labeled. The latter are, however, fusion-negative. In summary, our studies show that MYB activation through gene fusion or other mechanisms is a major oncogenic event in adenoid cystic carcinoma occurring at various anatomic sites. In addition to being a diagnostically useful biomarker for adenoid cystic carcinoma, MYB and its downstream effectors are also novel potential therapeutic targets. Modern Pathology (2011) 24, 1169–1176; doi:10.1038/modpathol.2011.86; published online 13 May 2011

Keywords: adenoid cystic carcinoma; gene fusion; immunohistochemistry; MYB; NFIB; salivary gland

Adenoid cystic carcinoma is one of the most the sinonasal tract, tracheobronchial tree, breast, common malignant salivary gland neoplasms, yet vulva, and skin.3,4 In adenoid cystic carcinoma of its signature oncogenic event was not defined until salivary glands, there is no sex predilection, and the recently.1,2 Adenoid cystic carcinoma usually arises age distribution is wide. The tumors of the head in the major and minor salivary glands, but also may and neck have a proclivity for perineural invasion, develop in a wide range of other locations including leading to a common clinical complaint of facial pain. Although typically slow growing, adenoid cystic carcinomas frequently metastasize and there 3–6 Correspondence: Dr HF Frierson Jr, MD, University of Virginia is poor long-term survival. The histopathologic Health System, Department of Pathology, PO Box 800214, 1215 differential diagnosis for adenoid cystic carcinoma Lee Street, Office 3036, Charlottesville, VA 22908-0214, USA. arising in the head and neck includes pleomorphic E-mail: [email protected] , monomorphic adenoma, polymorphous 4These authors contributed equally to this work. Received 9 March 2011; revised and accepted 5 April 2011; low-grade , and basaloid squamous published online 13 May 2011 cell carcinoma, among others. www.modernpathology.org MYB-NFIB in adenoid cystic carcinomas 1170 LB Brill II et al

By histopathology and immunohistochemistry, anti-MYB antibody in the histopathologic differen- the neoplastic cells of adenoid cystic carcinoma tial diagnosis. show both myoepithelial and ductal differentiation, with positivity for p63, S100 protein, smooth muscle actin, and cytokeratins.7 Typically, the more periph- Materials and methods eral cells of tumor nests and glands show myo- Tumor Material epithelial differentiation, and there is abundant production of extracellular matrix and basement We reviewed the Surgical Pathology archives and membrane components, especially in the cribriform those of the Adenoid Cystic Carcinoma Tumor pattern. Adenoid cystic carcinoma is also usually Registry at the University of Virginia for adenoid positive for KIT, which is most frequently absent in cystic carcinoma from all anatomic sites, and for neoplasms in the differential diagnosis.8,9 other salivary neoplasms. FFPE tumor material from Cytogenetically, adenoid cystic carcinoma is 68 cases of adenoid cystic carcinoma, and 113 non- characterized by a tumor-type specific t(6;9) adenoid cystic carcinoma neoplasms of the head (q22–23;p23–24) translocation found as the sole and neck was selected for molecular and/or im- anomaly in a subgroup of tumors.10–13 Recently, we munohistochemical analyses (Table 1). Of the 68 showed that this translocation generates a fusion of adenoid cystic carcinomas, clinical information was the MYB proto-oncogene to the transcription factor available for all but three of the patients. A total gene NFIB.1 In the resulting MYB-NFIB fusion of 53 tumors were from the aerodigestive tract; of oncogene, which is highly overexpressed in adenoid these, 15 were located in the minor salivary glands, cystic carcinoma, the 30 part of MYB, including 13 in the , nine in the trachea/ several target sites for negatively regulating micro- bronchus, eight in the sinonasal cavity, four in the RNAs, is replaced by the last coding exon(s) of NFIB. submandibular gland, and four in the larynx. The predicted MYB-NFIB fusion protein retains the Adenoid cystic carcinomas at other anatomic sites DNA-binding and transactivation domains of wild included four that arose in the breast, three in the type MYB, and is therefore expected to activate vulva, two in the lacrimal gland, and four were MYB target genes.1,2 In our original study, we found metastases. In all, 20 adenoid cystic carcinomas the MYB-NFIB fusion in six of six adenoid cystic arose in men, whereas 45 were from women. The age carcinomas with t(6;9) translocations, and in an range was 23–77 years. additional five cases from which cytogenetic In addition, we had access to FFPE tumor material information was not available, suggesting that the for RT-PCR analysis from eight adenoid cystic fusion may be a useful biomarker for adenoid cystic carcinomas, of which two were located in the major carcinoma, and that deregulation of MYB along with salivary glands, three in the trachea/bronchus, and its target genes are key oncogenic events in adenoid one each in the larynx, breast, and vulva. cystic carcinoma.1 Two subsequent studies found Moreover, fresh frozen tumor material was avail- the MYB-NFIB fusion or MYB-translocations in able for RT-PCR and qPCR analysis from 29 cases of about one-third and two-thirds, respectively, of adenoid cystic carcinoma, of which 23 were located salivary adenoid cystic carcinomas.14,15 In contrast, non-adenoid cystic carcinoma salivary neoplasms Table 1 Summary of immunohistochemical staining for MYB in were negative for the MYB-NFIB fusion. Interest- adenoid cystic carcinoma of various anatomic sites, as well as ingly, Mitani et al14 noted increased MYB expres- other selected neoplasms of the head and neck sion in 17 of 20 adenoid cystic carcinomas with the Diagnosis MYB IHC MYB IHC MYB-NFIB fusion, but also in 14 of 20 fusion- (À) (+) negative adenoid cystic carcinomas. Taken together, these initial studies clearly demonstrate that MYB Adenoid cystic carcinoma 12 56 activation is a hallmark of adenoid cystic carcinoma, but that the true frequency of the MYB-NFIB fusion Non-adenoid cystic carcinoma 97 16 is still unclear. In order to shed additional light on Acinic cell carcinoma 15 1 Basaloid 1 4 this issue, we have now performed a combined 3 1 molecular and immunohistochemical study of ade- Basal cell adenocarcinoma 2 1 noid cystic carcinomas and non-adenoid cystic Carcinoma ex 3 0 carcinoma salivary neoplasms with the following Epithelial-myoepithelial carcinoma 2 1 aims: to study the frequency of the MYB-NFIB fusion 8 1 Monomorphic adenoma 3 1 in both formalin-fixed paraffin embedded (FFPE) Pleomorphic adenoma 12 1 and frozen adenoid cystic carcinoma tumors derived Polymorphous low-grade 13 2 from various anatomic sites; to study the expression adenocarcinoma of MYB by quantitative real-time PCR (qPCR) Salivary adenoma, NOS 0 1 Salivary adenocarcinoma, NOS 1 0 in fusion-positive and fusion-negative adenoid 16 2 cystic carcinomas; and to study the expression of Warthin tumor 18 0 MYB protein by immunohistochemistry, and deter- mine the value of a commercially available Abbreviation: NOS, not otherwise specified.

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas LB Brill II et al 1171 in the major or minor salivary glands, three in the MYB primer MYB-1925F-50GCACCAGCATCAGAA sinonasal cavity, two in the trachea/bronchus, and GATGA30 (located in exon 14) and the NFIB primer one in the larynx. The study was approved by the NFIB-1197R-50CCGGTAAGATGGGTGTCCTA30 (located local ethics committees. in exon 9). Tumors that were negative for these transcript variants were also analyzed for expression Immunohistochemistry of chimeric transcripts consisting of MYB exon 12 fused to NFIB exon 9, using the MYB primer MYB- Zinc formalin-fixed or neutral buffered formalin- 1693F-50GCAGGATGTGATCAAACAGG30 (located fixed paraffin-embedded tissue sections were cut in exon 12) and the NFIB primer NFIB-1197R- and incubated with anti-MYB rabbit monoclonal 50CCGGTAAGATGGGTGTCCTA30 (located in antibody (clone EP769Y;1:200 dilution; Epitomics exon 9). The MYB and NFIB exons were numbered Inc., Burlingame, CA, USA) using a DAKO (Carpin- as described elsewhere.1 As positive control, ade- teria, CA, USA) autostainer after pressure cooker noid cystic carcinomas with known MYB-NFIB antigen retrieval for 30 s. The antibody recognizes a fusion transcript variants were used.1 Each PCR synthetic peptide corresponding to residues near the reaction was repeated in triplicate. PCR products N-terminus of human MYB. The avidin-biotin- were gel-purified and sequenced using an ABI immunoperoxidase technique was used. Diamino- PRISM 310 Genetic Analyzer (Applied Biosystems, benzidine was the chromogen, and sections were Foster City, CA, USA). The resulting sequences were counterstained with hematoxylin. MYB immunos- analyzed using the BLAST tool provided by the taining was considered positive if greater than 5% of National Center for Biotechnology Information tumor cells displayed strong nuclear immunoreac- (http://www.ncbi.nlm.nih.gov). tivity. All cases were reviewed by three pathologists (LB, WK, HF). Quantitative Real-Time PCR Analysis RT-PCR and Nucleotide Sequence Analyses qPCR analysis was performed on frozen adenoid Total RNA was extracted from 29 frozen adenoid cystic carcinomas using the AB 7500 Fast Real-time cystic carcinoma tumor samples and normal salivary PCR system (Applied Biosystems), as previously 16 gland tissue (three cases), using the TRIzol reagent described. MYB expression was analyzed using (Invitrogen, Carlsbad, CA, USA) and RNeasy Mini the TaqMan Gene Expression assay for MYB exons kit (Qiagen, Valencia, CA, USA). DNase-treated 1-2 (Hs00920554_m1) (Applied Biosystems). All (DNA-free Ambion, Austin, TX, USA) total RNA samples were assayed in triplicate. The relative was subsequently converted to cDNA, using the expression levels of MYB in tumor and normal SuperScript First-Strand Synthesis System (Invitro- salivary gland samples were calculated with SDS gen) adenoid cystic carcinoma, according to the Software v2.0.1 (Applied Biosystems) using the 17 manufacturer’s manual. Total RNA was also comparative Ct method, with the house- extracted from five 10 mm sections obtained from keeping genes 18S (Hs99999901_s1) or GAPDH paraffin blocks of 32 adenoid cystic carcinomas, and (Hs99999905-m1) as endogenous controls, and 18 non-adenoid cystic carcinoma neoplasms of the cDNA from normal salivary gland tissue as head and neck. The sections were deparaffinized calibrator. in xylene, and RNA was isolated using the RNeasy FFPE kit (Qiagen). RNAs were subsequently converted to cDNA using the SuperScript First- Results Strand Synthesis System (Invitrogen) with random Expression of MYB-NFIB and MYB Transcripts in hexamer primers, as recommended by the manufac- Adenoid Cystic Carcinoma and Non-adenoid Cystic turer. As controls for intact RNA and cDNA, RT-PCR Carcinoma Tumors reactions for expression of ACTB (b-actin) or GAPDH were performed on all cDNAs. To study the expression of the MYB-NFIB fusion in The MYB-NFIB fusion transcripts were amplified adenoid cystic carcinoma, we screened a series of 61 by direct or nested PCR. Primer sequences for adenoid cystic carcinomas from different anatomic analysis of cDNAs prepared from frozen tumor sites (29 frozen and 32 FFPE tumor samples), and 18 tissues were as previously described.1 All cDNAs non-adenoid cystic carcinoma neoplasms of the prepared from FFPE tumor material were screened head and neck by RT-PCR. The results are summar- for the most common MYB-NFIB fusion transcript ized in Table 2. Using primers located in MYB exons variants, that is, MYB exon 14 fused to NFIB 5, 6 or 12, and in NFIB exon 9, we were able to exons 8c or 9, respectively. Touchdown PCR was identify one or more chimeric MYB-NFIB transcript performed using the MYB primer MYB-1910F-50A variants in 25 of 29 (86%) frozen adenoid cystic GCTCCGTTTTAATGGCADENOID CYSTIC CAR carcinoma tumor samples (Figure 1). Four cases CINOMA30 (located in exon 14) and the NFIB primer were repeatedly negative for the MYB-NFIB fusion. NFIB-1096R-50GGGTATAAATGCCTGCCGTT30(located Using primers located in MYB exons 12 or 14, and in exon 8c), and direct PCR was performed using the NFIB exons 8c or 9, we detected chimeric MYB-NFIB

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas 1172 LB Brill II et al

Table 2 MYB-NFIB fusion status in 61 adenoid cystic carcinomas verified by nucleotide sequence analysis. The from various anatomic sites, and in 18 non-adenoid cystic composition of the MYB-NFIB transcripts identified carcinoma neoplasms of the head and neck was in agreement with previously published data Diagnosis MYB-NFIB fusion (not shown). In contrast, none of the 18 non-adenoid status (by tissue cystic carcinoma neoplasms of the head and neck fixation) expressed MYB-NFIB fusion transcripts (Table 2). Analysis of adenoid cystic carcinomas derived from FFPE FF various anatomic sites revealed that tumors from most sites were repeatedly fusion-positive, includ- + À + À ing the major and minor salivary glands (21/30), sinonasal cavity (5/7), trachea/bronchus (7/12), Adenoid Cystic Carcinoma 14 18 25 4 larynx (2/5), breast (2/4), and vulva (2/3). Salivary gland 2 5 19 4 Breast 2 2 0 0 To study the frequency of MYB overexpression, Larynx 1 3 1 0 we performed qPCR analysis of a series of 28 frozen Sinonasal cavity 2 2 3 0 adenoid cystic carcinoma samples from the aero- Trachea/Bronchus 5 5 2 0 digestive tract, including 24 fusion-positive and four Vulva 2 1 0 0 fusion-negative cases. As demonstrated in Figure 2, Non-adenoid cystic carcinoma 018 MYB was highly overexpressed in 25 of 28 (89%) Acinic cell carcinoma 0 1 adenoid cystic carcinomas relative to normal sali- Basaloid squamous cell carcinoma 0 6 vary gland tissue. Of the 24 fusion-positive tumors, Basal cell adenocarcinoma 0 1 22 had high MYB expression levels, and one of four Epithelial-myoepithelial carcinoma 0 1 Monomorphic adenoma 0 4 fusion-negative tumors had low MYB expression Pleomorphic adenoma 0 1 levels. The remaining three fusion-negative adenoid Polymorphous low-grade adenocarcinoma 0 2 cystic carcinomas had high MYB expression levels, Salivary duct carcinoma 0 2 comparable to those seen in the majority of fusion- positive tumors. Abbreviations: FF, fresh frozen; FFPE, formalin-fixed paraffin- embedded.

Immunohistochemical Staining of MYB Protein in Adenoid Cystic Carcinoma and Non-adenoid Cystic Carcinoma Tumors The results of the immunohistochemical staining of MYB are summarized in Table 1, and illustrated in Figure 3a–e. Overall, 56 of 68 (82%) adenoid cystic carcinomas stained positive for MYB (Figure 3a). There was no difference in MYB staining adenoid cystic carcinoma according to anatomic site of the tumors, or clinical features of the patients. The staining was entirely nuclear, and occurred in tubular, cribriform, and solid types. There was no difference in staining adenoid cystic carcinoma according to the grade of adenoid cystic carcinoma. However, in adenoid cystic carcinoma with tubular Figure 1 RT-PCR analyses of MYB-NFIB fusion transcripts in adenoid cystic carcinoma. (a) Detection of MYB-NFIB fusion differentiation, the inner epithelial cells typically transcripts in frozen tumor tissues from 10 adenoid cystic lacked MYB, whereas the outer myoepithelial cells carcinomas, using primers located in MYB exon 5 and NFIB exon were MYB positive (Figure 3b). In adenoid cystic 9. Note that multiple bands corresponding to alternatively spliced carcinoma positive for MYB, the number of labeled MYB and/or NFIB exons are detected in several tumors. (b) Detection of MYB-NFIB fusion transcripts in FFPE tumor cells varied, and, at times, the stained nuclei tissues from 24 adenoid cystic carcinomas, and two non-adenoid showed a peculiar zonal distribution in which the cystic carcinomas (acinic cell carcinoma and basal cell adeno- outer millimeter of tumor cell nuclei in tissue carcinoma), using primers located in MYB exon 14 and NFIB exon sections were stained, whereas the inner nuclei 9. Size markers, positive ( þ ) control (fusion-positive adenoid lacked positivity (Figure 3e). Also of note was the cystic carcinoma), and negative (À) control (H20). GAPDH and ACTB were used as internal controls to test for intact RNA and absence of MYB in areas of tumor necrosis (Figure cDNA. 3c), which occurred in some non-adenoid cystic carcinoma neoplasms. Of the non-adenoid cystic carcinoma tumors, transcripts in 14 of 32 (44%) FFPE adenoid cystic 16 of 113 (14%) were positive for MYB. These carcinoma tumor samples (data not shown). The comprised four of five basaloid squamous cell identity of the chimeric transcript variants identi- carcinomas (Figure 3c), three of nine monomorphic fied in both frozen and FFPE tumor samples was /basal cell adenomas/salivary gland

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas LB Brill II et al 1173

observed between salivary gland and breast adenoid cystic carcinomas, despite their well-known differ- ence in clinical behavior.18 Importantly, we also found that the MYB-NFIB fusion occured in adenoid cystic carcinomas from various anatomic sites. In addition to salivary gland, we found the fusion in adenoid cystic carcinomas located in the sinonasal cavity, tracheobronchial tree, larynx, breast, and vulva. These results, together with our previous observations,1 further support the notion that adenoid cystic carcinomas located in different anatomic sites not only have important morphologic features in common, but also Figure 2 qPCR analysis of the expression of MYB in 28 fusion- chiefly evolve through activation of the same positive ( þ ) and fusion-negative (À) adenoid cystic carcinoma molecular pathways. The well-known difference in samples (grey bars), compared with normal salivary gland tissue biological behavior between adenoid cystic carcino- (white bars). mas originating from different anatomic sites, for example salivary gland and breast, is thus not likely to be associated with the MYB-NFIB fusion, but adenoma, not otherwise specified (Figure 3d), two is rather due to other currently unknown genetic of 15 polymorphous low-grade , alterations or to organ-specific differences in cellu- two of 18 salivary duct carcinomas, and one each of lar milieu and anatomy. acinic cell carcinoma, basal cell adenocarcinoma, The frequency of the MYB-NFIB fusion in salivary mucoepidermoid carcinoma, epithelial-myoepithe- and non-salivary adenoid cystic carcinomas has lial carcinoma, and pleomorphic adenoma. RT-PCR varied in the earlier investigations. In our original analysis of MYB positive non-adenoid cystic carci- study,1 we found the MYB-NFIB fusion in six of six tumors revealed that they were negative for adenoid cystic carcinomas with t(6;9) transloca- the MYB-NFIB fusion (Table 2). The sensitivity and tions, and in an additional five cases from which specificity of MYB immunostaining for adenoid cytogenetic data were not available (four of which cystic carcinoma were 82 and 86%, respectively were adenoid cystic carcinomas of the breast). (Po0.001). Subsequently, Mitani et al14 found the MYB-NFIB Scattered normal lymphocytes in various tissues fusion in a much lower frequency corresponding to were positive for MYB. In the breast, occasional approximately one-third of primary and metastatic normal myoepithelial cells and perilobular stromal salivary adenoid cystic carcinomas. More recently, cells labeled for the protein. MYB was not seen in West et al,15 using the method of fluorescence in situ acinar or ductal of normal salivary hybridization, presented evidence indicating that glands. 65% of salivary adenoid cystic carcinomas were positive for the MYB-NFIB fusion or had transloca- tions of MYB, not necessarily involving NFIB. Discussion Although the latter figure is in agreement with our finding of MYB-NFIB fusion positivity in 64% of In this investigation, we have used a combination of salivary and non-salivary adenoid cystic carcino- molecular and immunohistochemical methods to mas, the discrepancy seen in the detection of the study the frequency of MYB-NFIB fusion and MYB fusion transcript between our frozen and FFPE expression in adenoid cystic carcinoma occurring tissue samples suggests that the true frequency of at various anatomic sites. Although the overall this genetic change in adenoid cystic carcinoma frequency of MYB-NFIB fusion was 64% (39/61), is higher. Although FFPE samples may not be as we found a marked difference in the detection of optimal as frozen specimens, ours is the first study the fusion transcript between our frozen (86%) and demonstrating the utility of FFPE tumor material for FFPE (44%) tissue specimens. We believe that the RT-PCR analysis of the expression of MYB-NFIB in degradation and chemical cross-linking of RNA that adenoid cystic carcinoma. occurs with formalin fixation and paraffin embed- We also studied the frequency of MYB over- ding likely resulted in the lower rate of MYB-NFIB expression in both fusion-positive and fusion- fusion in the fixed samples. In addition, in these negative adenoid cystic carcinomas using qPCR. cases, we only tested for the most common MYB- Overall, 89% of the tumors overexpressed MYB NFIB transcript variants. In contrast, the MYB-NFIB RNA relative to normal salivary gland, including fusion was not expressed in non-adenoid cystic 22 of 24 fusion-positive tumors, and 3 of 4 fusion- carcinoma neoplasms of the head and neck, con- negative tumors. These observations, together with firming the high specificity of the MYB-NFIB fusion recent data from two independent studies,14,15 for adenoid cystic carcinoma.1,2,14,15 Of note, no further emphasize the significance of MYB as a difference in MYB-NFIB fusion expression was major oncogene in the pathogenesis of adenoid

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas 1174 LB Brill II et al

Figure 3 (a) Strong nuclear MYB immunoreactivity was typically observed in adenoid cystic carcinoma. (b) Staining was often restricted to non-luminal tumor cells in tubular foci. (c) This basaloid squamous cell carcinoma is positive for MYB, but staining is absent in areas of necrosis. (d) This monomorphic adenoma stains positive for MYB in some of the centers of tumor nests, whereas the peripheral palisades of cells are negative. (e) MYB immunostaining sometimes showed a peripheral pattern, presumably due to slower formalin fixation, and a short half-life of the MYB protein.

cystic carcinoma. The finding of high MYB expres- NFIB or represent novel mechanisms is currently sion levels in fusion-negative tumors also indicates unknown. However, preliminary RACE (rapid that other mechanisms of MYB activation may exist. amplification of cDNA ends) analysis of a fusion- Whether these involve fusion partners other than negative adenoid cystic carcinoma with high MYB

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas LB Brill II et al 1175 expression failed to reveal a new MYB fusion cells.19,24 The murine MYB homolog has been shown partner (unpublished data). Our results also suggest to be highly expressed in embryonic salivary gland that a subset of adenoid cystic carcinoma may be tissue.25 The normal NFIB gene product is a member truly fusion-negative and/or do not overexpress of the NFI gene family,26,27 but its mechanistic MYB. Detailed analysis of such non-MYB-driven importance, when it occurs as a partner to MYB in adenoid cystic carcinomas will be important in adenoid cystic carcinoma, is unknown. Interest- order to identify novel genes and mechanisms ingly, Stenman28 previously identified NFIB as a involved in the molecular pathogenesis of these fusion partner with HMGA2 in salivary pleomorphic neoplasms. adenomas with t(9;12) translocations/insertions.27 In our study, we found that 56/68 (82%) of The overall domain structure of the HMGA2-NFIB adenoid cystic carcinoma occurring at various fusion resembles that of MYB-NFIB in that the anatomic sites stained positive for MYB protein. In C-terminal end of NFIB is linked to the DNA- the study by Mitani et al,14 17 of 20 (85%) salivary binding domains of the transcription factor HMGA2, adenoid cystic carcinoma that had the MYB-NFIB resulting in high expression levels of HMGA2-NFIB fusion stained positive for MYB, whereas 25 of 41 fusion transcript and protein. These findings raise (61%) fusion-negative adenoid cystic carcinoma the question of whether NFIB in both fusion types also labeled for the protein. Using a different may contribute stabilizing or regulatory elements to antibody from that used by us and Mitani et al,14 these transcription factors. West et al15 found that 65% (24 of 37) of adenoid In summary, the present and previous studies cystic carcinoma were strongly positive. It should be demonstrate that MYB activation through gene noted that we used a lower threshold for positivity fusion or other mechanisms is a major oncogenic than the investigators of these two earlier studies. event in tumors with typical adenoid cystic carci- It is of interest that in the tubular type of adenoid noma histology, regardless of the site of tumor cystic carcinoma, the inner ductal layer of cells origin. In addition to being a new diagnostically typically lacked MYB, whereas the outer myoe- useful biomarker for adenoid cystic carcinoma, MYB pithelial layer showed strong MYB positivity. This and its downstream effectors are also potential finding was also observed by Mitani et al.14 The therapeutic targets. Future studies aiming at identi- molecular mechanism for this staining pattern is fying the transcriptional targets of MYB-NFIB and unknown. The peculiar zonal staining pattern for MYB in adenoid cystic carcinoma will therefore be MYB in some cases, in which positive nuclei were crucial in order to develop new potent therapies that limited to the peripheral 1 mm of tissue sections, may improve the survival of patients affected by this may indicate that MYB is very sensitive to formalin often fatal disease. fixation and degrades quickly. It should be noted that normal MYB has a short half life of approxi- mately 30 min,19 but the stability of the MYB-NFIB fusion protein is unknown. Acknowledgements Although the histopathologic diagnosis of the cribriform variant of adenoid cystic carcinoma does This study was supported in part by the Swedish not usually pose a dilemma, there is some overlap of Society, IngaBritt and Arne Lundbergs the tubular and solid variants with other neoplasms Research Foundation, BioCARE—a National Strate- of the head and neck. Our study shows that analyses gic Research Program at University of Gothenburg, of the expression of MYB transcripts and/or protein and the Adenoid Cystic Carcinoma Research by RT-PCR and immunohistochemistry would assist Foundation. in the diagnosis of adenoid cystic carcinoma, but would not completely exclude other neoplasms in Disclosure/conflict of interest the differential diagnosis. In addition, a subset of adenoid cystic carcinomas are fusion-negative and The authors declare no conflict of interest. lack MYB immunoreactivity, and there are also non- adenoid cystic carcinoma tumors that stain positive for MYB. However, as shown in this study, the latter cases are fusion-negative. References The MYB portion of the MYB-NFIB fusion has a deleted 30-UTR, that normally contains the target 1 Persson M, Andren Y, Mark J, et al. Recurrent fusion of sequences for miR-15a, miR-16, and miR-150, which MYB and NFIB transcription factor genes in carcino- negatively regulate MYB activity.20–23 This provides mas of the breast and head and neck. Proc Natl Acad a constitutively active stimulus to genes variously Sci USA 2009;106:18740–18744. 2 Stenman G, Andersson MK, Andren Y. New tricks from involved in cell cycle regulation, apoptosis, angio- an old oncogene: gene fusion and copy number genesis, and adhesion. The normal MYB gene alterations of MYB in human cancer. Cell Cycle product is most prominently expressed in non- 2010;9:2986–2995. terminally differentiated cells, with decreasing 3 Nascimento AG, Amaral AL, Prado LA, et al. Adenoid expression observed in non-mitotically active cystic carcinoma of salivary glands. A study of 61 cases

Modern Pathology (2011) 24, 1169–1176 MYB-NFIB in adenoid cystic carcinomas 1176 LB Brill II et al

with clinicopathologic correlation. Cancer 1986;57: 16 Persson F, Winnes M, Andre´nY,et al. High-resolution 312–319. array CGH analysis of salivary gland tumors reveals 4 Barnes L, Eveson JW, Reichart P, et al. eds. World fusion and amplification of the FGFR1 and PLAG1 Health Organization Classification of Tumours. Pathol- genes in ring chromosomes. Oncogene 2008;27: ogy and Genetics of Head and Neck Tumours. IARC 3072–3080. Press: Lyon, 2005, p 430. 17 Livak KJ, Schmittgen TD. Analysis of relative gene 5 Perzin KH, Gullane P, Clairmont AC. Adenoid cystic expression data using real-time quantitative PCR carcinomas arising in salivary glands: a correlation and the 2(-DD C(T)) method. Methods 2001;25: of histologic features and clinical course. Cancer 1978; 402–408. 42:265–282. 18 Marchio C, Weigelt B, Reis-Filho JS. Adenoid cystic 6 Spiro RH, Huvos AG, Strong EW. Adenoid cystic carcinomas of the breast and salivary glands (or carcinoma: factors influencing survival. Am J Surg ‘The strange case of Dr Jekyll and Mr Hyde’ of exo- 1979;138:579–583. crine gland carcinomas). J Clin Pathol 2010;63: 7 Azumi N, Battifora H. The cellular composition of 220–228. adenoid cystic carcinoma. An immunohistochemical 19 Ramsay RG, Gonda TJ. MYB function in normal and study. Cancer 1987;60:1589–1598. cancer cells. Nat Rev Cancer 2008;8:523–534. 8 Holst VA, Marshall CE, Moskaluk CA, et al. KIT 20 Xiao C, Calando DP, Galler G, et al. MiR-150 controls B protein expression and analysis of c-kit gene mutation cell differentiation by targeting the transcription factor in adenoid cystic carcinoma. Mod Pathol 1999;12: c-Myb. Cell 2007;131:146–159. 956–960. 21 Chung EY, Dews M, Cozma D, et al. c-Myb oncoprotein 9 Penner CR, Folpe AL, Budnick SD. C-kit expression is an essential target of the dleu2 tumor suppressor distinguishes salivary gland adenoid cystic carcinoma microRNA cluster. Cancer Biol Ther 2008;7: from polymorphous low-grade adenocarcinoma. Mod 1758–1764. Pathol 2002;15:687–691. 22 Lin YC, Kuo MW, Yu J, et al. c-Myb is an evolutionary 10 Stenman G, Sandros J, Dahlenfors R, et al. 6q- and loss conserved miR-150 target and miR-150/c-Myb interac- of the Y chromosome—two common deviations in tion is important for embryonic development. Mol Biol malignant human salivary gland tumors. Cancer Genet Evol 2008;25:2189–2198. Cytogenet 1986;22:283–293. 23 Zhao H, Kalota A, Jin S, et al. The c-myb proto- 11 Higashi K, Jin Y, Johansson M, et al. Rearrangement oncogene and microRNA-15a comprise an active of 9p13 as the primary chromosomal aberration in autoregulatory feedback loop in human hematopoietic adenoid cystic carcinoma of the respiratory tract. cells. Blood 2009;113:505–516. Genes Chromosomes Cancer 1991;3:21–23. 24 Oh IH, Reddy EP. The myb gene family in cell growth, 12 Nordkvist A, Mark J, Gustafsson H, et al. Non-random differentiation and apoptosis. Oncogene 1999;18: chromosome rearrangements in adenoid cystic carci- 3017–3033. noma of the salivary glands. Genes Chromosomes 25 Visel A, Thaller C, Eichele G. GenePaint.org: an atlas Cancer 1994;10:115–121. of gene expression patterns in the mouse embryo. 13 Mitelman F, Johansson B, Mertens F, eds. Mitelman Nucleic Acids Res 2004;32:D552–D556. Database of Chromosome Aberrations and Gene 26 Qian F, Kruse U, Lichter P, et al. Chromosomal Fusions in Cancer. http://cgap.nci.nih.gov/Chromo localization of the four genes (NFIA, B, C, and X) for somes/Mitelman 2011. the human transcription factor nuclear factor I by 14 Mitani Y, Li J, Rao PH, et al. Comprehensive analysis of FISH. Genomics 1995;28:66–73. the MYB-NFIB gene fusion in salivary adenoid cystic 27 Geurts JM, Schoenmakers EF, Roijer E, et al. Identifica- carcinoma: incidence, variability and clinicopatholo- tion of NFIB as recurrent translocation partner gene gical significance. Clin Cancer Res 2010;16:4722–4731. of HMGIC in pleomorphic adenomas. Oncogene 1998; 15 West RB, Kong C, Clarke N, et al. MYB expression and 16:865–872. translocation in adenoid cystic carcinoma and other 28 Stenman G. Fusion oncogenes and tumor type speci- salivary gland tumors with clinicopathologic correla- ficity–insights from salivary gland tumors. Semin tion. Am J Surg Pathol 2011;35:92–99. Cancer Biol 2005;15:224–235.

Modern Pathology (2011) 24, 1169–1176