VHL and Hypoxia Regulated Genes in Sympatho-Adrenal Cell Lineage Development and Disease

Home , Gonad

Institut für Anatomie und Zellbiologie Abteilung für Molekulare Embryologie der Albert-Ludwigs Universität, Freiburg i. Br

VHL and Hypoxia regulated genes in sympatho-adrenal cell lineage Development and Disease

Erlangung des Medizinischen Doktorgrades der Medizinischen Fakultät der Albert- Ludwigs- Universität Freiburg i. Br vorgelegt 2016 von Tehani Ali Omer Elfaitwri geborn in Benghazi, Libya

Name der Dekanin: Frau Prof. Dr. Kerstin Krieglstein 1. Gutachter: Prof. Dr. Kerstin Krieglstein 2. Gutachter: Prof. Dr. med. Jochen Seufert Jahr der promotion: 2016.

Dedicated to the spirit of my dear father

, Ali Omer,

Who was the main supporter throughout the study period and died during the working of this thesis

Table of contents

Abstract ...... I Zusammenfassung...... II List of abbreviations ...... III 1. Introduction ...... 1 1.1 Neural crest cells ...... 1 1.2 Development of the SA lineage, specification and differentiation ...... 3 1.2.1 Signaling molecules involved in the specification and differentiation of the SA cell lineage ..... 3 1.2.2 Transcription factors that govern the development of SA cells ...... 4 1.2.3 Diversification of SA cells into sympathetic neuron and chromaffin cells ...... 6 1.2.4 The Adrenal medulla and the biosynthesis of catecholamines ...... 8 1.3 Von Hippel Lindau gene (VHL) ...... 9 1.3.1 PVHL functions and interactions ...... 9 1.3.2. The VHL disease ...... 12 1.3.3 Phenotype genotype correlation ...... 13 1.3.4 VHL and Pheochromocytoma ...... 14 1.4 Hypoxia regulated genes ...... 15 1.4.1 Hypoxia inducible factors (HIFs) ...... 15 1.4.2 Delta like 1 homologue (Dlk-1) ...... 18 1.5. Aim of the study ...... 20 2. Materials and Methods ...... 21 2.1 Materials ...... 21 2.1.1 Reagents ...... 21 2.1.2. Solutions and buffers ...... 22 Table. 2.1.3 Enzymes ...... 28 Table. 2.1.4 Nucleotide sequences of primers used in ISH probes ...... 29 Table. 2.1.5 Primary antibodies ...... 29 Table. 2.1.6 Secondary antibody ...... 30 Table. 2.1.7 Kits ...... 30 2.1.8 Equipment ...... 31

2.2 Methods ...... 31 2.2.1 Experimental animals...... 31 2.2.2 Genotyping of transgenic mice ...... 32 2.2.3 Tissue preparation and Embedding ...... 32 2.2.4 Histological stains ...... 32 a). Immunohistochemistry (IHC) ...... 32 b). Double Immunofluorescences for analysis proliferation and apoptosis in VHL KO mice ...... 33 c). TdT dUTP Nick End Labeling (TUNNEL) assay ...... 33 2.2.5 In Situ Hybridization ...... 34 a). In Situ ribo-probe preparation ...... 34 b). C-DNA synthesis ...... 34 c). Gene amplification ...... 35 d). PCR Thermal cycling ...... 35 e). Agarose gel electrophoresis ...... 36 f). purification of DNA (plasmid preparation) ...... 36 g). Ligation and cloning PCR product with pGEM-T vector system...... 37 h). Transformation of plasmid ...... 37 i). Plasmid isolation and purification (Miniprep. Protocol) ...... 37 j). Restriction of the plasmids ...... 38 k). Plasmid purification by Nucleospin and PCR clean up ...... 38 l). In vitro transcription ...... 39 m). In Situ Hybridization ...... 39 2.2.6 Combined in situ hybridization and immunohistochemistry ...... 40 2.2.7 Statistical analysis and procedures ...... 41 3. Results ...... 42 3.1 Spatiotemporal pattern of HIF-2α and DLK1 mRNA during SA development ...... 42 a). HIF-2α mRNA expression during SA development ...... 42 b). In Situ Hybridization analysis of DLK1 mRNA expression in sympatho- adrenal cells ...... 48 c). HIF-2α is downstream of Phox2b ...... 53

3.2 Phenotypical abnormality in the sympathetic ganglion and the adrenal medulla of VHL deficient mouse embryos ...... 55 a). Decreased number of SA cells in VHL-deficient mouse embryos ...... 55 b). Chromaffin cells in VHLDBHCre mice show a massive reduction of PNMT expression ...... 61 c). Expression of DLK1 and HIF-2α mRNA in the sympatho-adrenal cells of VHLDBHCre mice ...... 64 d). VEGF mRNA expression is enhanced in adrenal medulla and sympathetic ganglia of VHL KO mice ...... 66 e). No cell death in VHLDBHCre sympathetic ganglia at E18.5 embryos ...... 67 f). No change in (Phospho-Histone H3 (ser10) PH3 labeled cells in VHLDBHCre mice was detected . 67 4. Discussion and conclusion ...... 70 4.1 Expression of DLK-1 and HIF-2α in the SA lineage and their putative function ...... 70 4.2 Role of VHL in SA cells development and disease ...... 72 5. References ...... 75 6.Acknowledgements ...... 92

Abstract

VHL and Hypoxia regulated genes in sympatho- adrenal cell lineage Development and Disease Abstract Cells of the sympatho-adrenal (SA) cell lineage develop from neural crest cells (NCCs). Abnormal development of SA cells has been linked to various tumors, including neuroblastoma (NB), and Pheochromocytoma (PCC). In humans mutations of the Von Hippel Lindau tumor suppressor gene (VHL), a negative regulator of hypoxia inducible factors, is one of the major causes of PCC development. .

Mammalian embryos develop within a hypoxic environment, under the influence of hypoxia inducible factors (HIFs). HIFs have been linked to various diseases, including NB, due to their impact on cellular differentiation. Delta like homolog 1 (DLK-1) is another gene implicated in neuroblastoma, which is hypoxia regulated and lies downstream of HIF system. However, the main role of VHL and hypoxia-inducible factors during normal development of SA cells is unclear up to date.

The aim of the current study was to investigate the in vivo role of VHL on the normal development of SA cells and to investigate, whether the loss of VHL function leads to SA derived tumor development as pheochromocytoma. For this reason the VHL gene was conditionally eliminated in SA cells by cre- recombinase under the dopamine B hydroxylase (DBH) promoter. Surprisingly my data revealed a decrease of the number of the catecholaminergic cells in the area of sympathetic ganglia and chromaffin cells of VHL deficient mice by the end of the fetal period. In addition a significant reduction of the adrenaline producing enzyme (PNMT) positive cells was observed in the adrenal medulla. My data point to a possible role of VHL in the maintenance of a catecholaminergic phenotype in SA cells/ and or their survival as well as the acquisition of specific chromaffin traits. In parallel, I have investigated the exact spatiotemporal expression pattern of hypoxia-inducible factors (HIFs), which comprise the main targets of VHL, as well as DLK-1 in wildtype and VHL- deficient SA mice. In Situ Hybridization analysis showed that HIF-2α and DLK-1 are expressed in early sympathetic neurons and maintained in adrenal medulla and OZ throughout embryonic development. Thus, both genes could be involved in timing neurogenesis and or promoting the acquisition of endocrine traits in chromaffin cells.

I Zusammenfassung

Die Bedeutung von VHL und Hypoxie regulierten Genen während der Entwicklung der sympathoadrenalen Linie

Die Zellen der sympathoadrenalen (SA) Linie entstehen aus Neuralleistenzellen, Fehlentwicklungen von SA-Zellen stehen mit der Entstehung von Tumoren wie dem Neuroblastom oder dem Phäochromozytom. Beim Menschen gehören Mutation des Von- Hippel-Lindau Tumorsupressorgens (VHL), einem negativen Regulator der Hypoxie- induzierbaren Faktoren (HIFs), zu den Ursachen für die Entstehung eins Phäochromozytoms.

Säugerembryos entwickeln sich in einer sauerstoffarmen Umgebung unter der Einwirkung von Hypoxie-induzierbaren Faktoren. Hypoxie-induzierbare Faktoren sind aufgrund ihres Einflusses auf die zelluläre Differenzierung mit Tumorerkrankungen wie beispielsweisem dem Neuroblastom assoziiert. Delta-like 1 Homolog (DLK-1) ist ebenfalls in hypoxiereguliertes Protein, das mit dem Neuroblastom in Verbindung gebracht wurde. Bis jetzt ist jedoch nur wenig über die Funktion von VHL, HIFs und DLK-1 während der normalen Entwicklung von SA Zellen bekannt.

Ziel der vorliegenden Studie war es, die physiologische Bedeutung von VHL für die Entwicklung von SA Zellen zu untersuchen und zu klären, ob das Fehlen von VHL während der Entwicklung die Bildung eines adrenalen Tumors zur Folge hat. Zu diesem Zweck wurden konditionale DBHcre-VHL Mausmutanten analysiert. Überraschenderweise zeigte sich bei diesen Tieren zum Ende der Fetalperiode eine Reduktion der Zahl katecholaminerger Zellen in den sympathischen Ganglien und im Nebennierenmark. Zusätzlich konnte eine spezifische Reduktion der Phenylethanolamine N-methyltransferase (PNMT) positiven Zellen im Nebennierenmark beobachtet werden. Meine Daten deuten darauf hin, dass VHL für die Aufrechterhaltung eines katecholaminergen Phänotyps bei SA Zellen sowie für den Erwerb spezifischer Merkmale chromaffiner Zellen eine Rolle spielt und/oder für das Überleben dieser Zellen wichtig ist.

Daneben habe ich das exakte spatiotemporale Expressionsmuster von HIF-2α und DLK-1 in SA-Zellen während der Entwicklung von Wildtyp- und VHL-defizienten Mausembryos untersucht. Meine Daten zeigen dass HIF-2α und DLK-1 in frühen sympathischen Neuronen exprimiert werden und in chromaffinen Zellen während der gesamten Embryonalentwicklung nachweisbar sind. Diese Ergebnisse sind im Einklang mit der Hypothese, dass beide Gene das Timing der Neurogenese sowie den Erwerb chromaffiner Merkmale beeinflussen konnte.

II List of abbreviations .

List of abbreviations

ABC Avidin Biotin complex ADAM17 A Disintegrin And Metalloproteinase 17 AEC 3-Amino-9-ethylcarbazol AG Adrenal gland AP Alkaline phosphatase AP-α Activating protein -α ARNT Aryl hydrocarbon nuclear translocator BCIP 5-bromo-4-chloro-indolyl-phosphatase bHLH- family Basic helix loop helix family BMP Bone morphogenic protein CNS Central nervous system C-TAD C-terminal transactivation domain DA Dorsal aorta DAB 3, 3’- diaminobenzidine substrate DAPI 4’.6-diamidino-2-phenylindole Dar Donkey anti rabbit Das Donkey anti sheep DBH Dopamine β hydroxylase DEPC Diethylpyrocarbonate DIG Dioxygenin DLK-1 Delta like-1 DRG Dorsal root galnglia E Embryonic day ECM Extracellular matrix EDTA Ethylenediaminetetra-acetic acid EGF Epidermal growth factor EGLN Egl nine homologe ENS Enteric nervous system

III List of abbreviations .

EPAS1 Endothelial PAS domain protein FA-1 Fetal antigen 1 FIH Factor inhibiting HIF GLUT1 Glucose transporter-1 GR Glucocorticoid receptor HAND2 Heart and neural crest derivatives expressed protein-2 HB Heamangioblastoma HIF-α Hypoxia inducible factors –α HIF-β Hypoxia inducible factors –β HRE Hypoxia responsive element HS Horse serum ID-2 DNA binding protein inhibitor IF Immunofluorescence IHC Immunohistochemistry INSM-1 Insulinoma associated protein-1 IPAS Inhibitory PAS (Per/Arnt/Sim) domain ISH In Situ Hybridization JUN Jun proto-oncogen Kb Kilobase kDa Kilodalton KO Knockout MASH1 Mammalian achaete-scute homologue-1 MEN2 Multiple endocrine neoplasia type 2 M- MLVRT Molony Murine Leukemia Virus Reverse Transcriptase mRNA Messenger ribonucleic acid NA Nor adrenaline NB Neuroblastoma NBT\BCIP Nitro-blue tetrazolium chloride \ 5-bromo-4-chloro-3’- indolyphosphate p-toluidine NCCs Neural crest cells

IV List of abbreviations .

NDS Normal donkey serum NF-68 Neurofilament-68 NF-1 Neurofibromatosis type 1 NGF Nerve growth factor NHS Normal horse serum NLS Normal lamb serum NT Neural tube N-TAD N-terminal transactivation domain OCT-4 Octamer- binding transcription factor- 4 ODD Oxygen dependent domain OZ Organ Of Zuckerkandel P300 Histone acetyltransferase PAS Per-ARNT-Sim family PBS Phosphate buffer saline PC12 Pheochromocytoma cell line-12 PCC Pheochromocytoma PDGF-β Platelate derived growth factor- β PFA Paraformaldehyde PGL Paraganglioma PH3 Anti- histone-3 (Phospho S10) PHD3 Prolyl hydroxylase-3 Phox2b Paired-like homeobox-2b PKC A typical protein kinase-C PNMT Phenylethanolamine N-methyltransferase PNS Peripheral nervous system Pref-1 Pre-adipocyte factor-1 PTEN Phosphatase and tensin homologue pVHL Von Hippel Lindau products Rbx1 Ring box protein-1 RCC Renal Cell Carcinoma

V List of abbreviations .

RET Receptor tyrosine kinase rpm Revolutions per minute RT Room temperature SA cell Sympatho-adrenal cell SCG Superior cervical ganglia SDHB Succinate dehydrogenase subunit B SDHC Succinate dehydrogenase subunit C SDHD Succinate dehydrogenase subunit D Sg Sympathetic ganglia SF-1 Steroidogenic factor-1 SIF Small intensely fluorescent siRNA Small interfering RNA SNS Sympathetic nervous system SOX10 SRY-related HMG-box T Temperature TACE Tumor necrosis factor alpha converting enzyme TNF-α TdT enzyme Terminal deoxynucleotidyl transferase TFs Transcription factors TGF- α Transforming growth factor- α TGF-β Transforming growth factor-β TH Tyrosine hydroxylase TUNEL TdT dUTP nick end labeling analysis VBCC VHL, Elongin B and C Complex VEGF Vascular endothelial growth factor VHL Von Hippel Lindau WT Wild type X Times (Concentration) Xg G- force

VI Introduction

1. Introduction 1.1.Neural crest cells Neural crest cells (NCCs) are a transient cell population that emerges at the dorsal edge of neural tube during embryogenesis. Under the influence of a complex molecular signaling cascade NCCs start to delaminate and separate from the dorsal part of neural tube (Sela- Donenfeld and Kalcheim, 1999) occurs at about the 6-somite stage in mice (E8.0~8.5 embryonic day) or around HH stage 9 (E2.0) in chick embryos (Gammill et al., 2006). Following their delamination NCCs undergo an epithelial-to mesenchymal transition (Ahlstrom and Erickson, 2009; Duband, 2010) and then they migrate along stereotypical pathways to form a wide array of derivatives depending on their site of origin and the locations to which they migrate. Pre-migratory neural crest cells express ‘neural crest specifier’ genes such as Snail-2 and FoxD3 ( for review see Meulemans and Bronner-Fraser, 2004; Sauka-Spengler and Bronner- Fraser, 2008). They are also characterized by the expression of Sox10, a member of the SOX (SRY-related HMG-box) family of transcription factor. Its expression is initiated in pre- migratory neural crest cells (Aoki et al., 2003; Pusch et al., 1998; Southard-Smith et al., 1998) and maintained in migratory neural crest cells. Later it is downregulated upon neuronal differentiation, but maintained in differentiated glial cells (Bondurand et al., 1998; Kuhlbrodt et al., 1998) (Aoki et al., 2003; Herbarth et al., 1998; Pusch et al., 1998; Young et al., 2003). Sox10 is required for the maintenance of multipotency of NCCs and the initial development of sympathetic ganglia and the adrenal gland (Britsch et al., 2001; Kelsh, 2006; Potzner et al., 2010; Reiprich et al., 2008; Southard-Smith et al., 1998; Wilson et al., 2005). Therefore in this study, we have chosen Sox10 as an early marker of neural crest cells.

According to their origin and developmental potential NCCs can be grouped as cranial, trunk, cardiac and vagal neural crest cells.

Cranial NCCs arise anterior to somite 5 and form many of the craniofacial cartilages and bones as well as neurons and glial cells of cranial ganglia, as the inferior ganglion of glossopharyngeal and vagal nerve (Cordero et al., 2011; Kulesa et al., 2010; O’Rahilly and Müller, 2007).

The vagal NCCs originating in the neck region levels colonize the intestine to give rise to the ganglia and neuronal cells of the enteric nervous system (ENS), which control intestinal peristalsis (Burns and Le Douarin, 2001).

1 Introduction

Trunk-derived NCCs arise posterior to somite 4 and produce three types of populations according to their migratory pathway. NCCs migrate ventrolateral, passing through the anterior parts of the somatic mesoderm; some of them remain within the somite to form the dorsal root ganglia (DRG).

Others travel through the developing sclerotome and aggregate in the vicinity of the dorsal aorta (DA) to form cells of the SA lineage around embryonic day E10 in the mouse or at E2.5 in the chick (Goridis and Rohrer, 2002; Loring and Erickson, 1987). At the DA SA cells are instructed to develop catecholaminergic and neuronal traits by local environmental and intrinsic cues. They start to express markers like the catecholamine synthesizing enzymes tyrosine hydroxylase (TH) and dopamine- β- hydroxylase (DBH) (Cochard et al., 1978; Ernsberger et al., 1995, 2000), as well as neuronal markers including neurofilament (NF), superior cervical ganglion- 10 (SCG10) and neuron specific tubulin (Cochard and Paulin, 1984; Groves et al., 1995; Lumb and Schwarz, 2015; Schneider et al., 1999; Sommer et al., 1995). Thereafter precursor cells embark on a further migration to their final destinations, where they develop into mature sympathetic neurons, small intensely fluorescent (SIF) cells and endocrine chromaffin of the adrenal medulla and extra-adrenal chromaffin cells of the organ of Zuckerkandl (OZ) (Anderson and Axel, 1986; Anderson et al., 1991; Huber, 2006; Loring and Erickson, 1987). The third group of trunk NCCs follows the dorsolateral pathway between ectoderm and dermomyotom and later move into the epidermis to form pigment cells (melanocytes) (Fig.1).

2 Introduction

Fig.1: migratory pathways of neural crest cell derivatives during early embryonic development. NNCs; neural crest cells, NT; neural tube, DA; dorsal aorta, Not; notochord, DRG; dorsal root ganglia; DL, dorsolateral, VL; ventrolateral.

1.2 Development of the SA lineage, specification and differentiation

1.2.1 Signaling molecules involved in the specification and differentiation of the SA cell lineage

The instruction of NC cells to develop into SA precursors is triggered by regional secreted and intrinsic factors (for review see Rohrer, 2011).

Bone morphogenetic proteins (BMP) are members of the TGF-β superfamily, which are expressed by smooth muscle cells in the wall of the dorsal aorta of avian (BMP- 4/ 7) (Reissmann et al., 1996) and mouse embryos (BMP-2/4) (Reissmann et al., 1996; Saito et al.,

3 Introduction

2012; Schneider et al., 1999;Shah et al., 1996). They are considered to play a central role in the specification of SA cells.

This was shown by treatment of chick embryos with the BMP antagonist noggin, which abolished the differentiation of sympathetic neurons. In response to BMP- 4/7 a trans-regulatory network of transcription factors is activated that governs the differentiation of NC cells into SA cells (for review see (Huber, 2006; Rohrer, 2011). These include MASH-1, Phox2a/b, GATA- 2/3 and HAND2 (Guillemot and Joyner, 1993; Guillemot et al., 1993; Howard et al., 2000; Lim et al., 2000; Lucas et al., 2006; Moriguchi et al., 2006; Pattyn et al., 1997, 1999, 2006; Reissmann et al., 1996; Tsarovina et al., 2004; Wildner et al., 2008) (for review see Huber et al., 2009). Most of these transcription factors act downstream of BMP-2/4/7 (Lo et al., 1998; Reissmann et al., 1996; Schneider et al., 1999; Shah et al., 1996).

In addition to BMPs other environmental signals derived from the ventral region of the neural tube and the notochord have been implicated in SA cell specification (Groves et al., 1995; Stern et al., 1991).

1.2.2 Transcription factors that govern the development of SA cells

The transcription factors MASH-1, Phox2a, Phox2b, HAND2, GATA-2/3, and INSM1 have been implicated as important regulators of the development of sympathetic neurons and adrenal medullary chromaffin cells from neural crest cells. Gene expression studies have revealed that the expression of Cash1 (the chick homologue of MASH-1) precedes that of Phox2a, HAND2 and the zinc finger protein GATA2. (Ernsberger et al., 1995, 2000; Howard et al., 2000; Takashi Moriguchi, 2007; Tsarovina et al., 2004). Loss of the biological functions of any of these factors leads to a severe impairment of the development of SA cells (Guillemot et al., 1993; Lim et al., 2000; Moriguchi et al., 2006; Pattyn et al., 1999; Tsarovina et al., 2004).

The homeodomain transcription factor Paired- like homeobox- 2b (Phox2b) is expressed in all noradrenergic neurons of the central and peripheral nervous system, including sympathetic, parasympathetic and enteric ganglia (Pattyn et al., 1997; Tiveron et al., 1996). It is one of the earliest SA-specific transcription factors. Sympathetic neurons of Phox2b deficient mice assemble at the correct site near the dorsal aorta, but they fail to express markers indicative of

4 Introduction noradrenergic and neuronal differentiation and lack all other components of the SA-specific transcription factor network, with the exception of MASH-1 (for review see Rohrer, 2011). At E13.5 sympathetic ganglia of Phox2b deficient mice have completely disappeared (Pattyn et al., 1999). Likewise, chromaffin progenitors of Phox2b mutant mice invade the adrenal gland but fail to undergo further differentiation (Huber et al., 2005). Overexpression of Phox2b in neural crest cells of developing chick embryos produce ectopic sympathetic neurons (Stanke et al., 1999). Together these data indicate that Phox2b is a master regulator of SA cell development, which regulates the expression of other transcription factors operating in the SA lineage and is required for all aspects of sympathetic neuron and chromaffin cell differentiation.

MASH-1, the mammalian member of the Achaete/ Scute family of basic helix-loop-helix (bHLH) genes, is transiently expressed in the progenitors of specific neuronal and non-neuronal cell populations, including SA progenitors (Guillemot and Joyner, 1993; Guillemot et al., 1993; Lo et al., 1991). In SA cell development MASH-1 expression starts immediately after the formation of the primary sympathetic chain near the DA. Its expression is maintained at high levels until embryonic day E13 (Ernsberger et al., 1995; Huber et al., 2002; Lo et al., 1991), but downregulated afterwards. (Morikawa et al., 2005). In developing adrenal chromaffin cells MASH-1 expression is down-regulated two days later at E16.5 (Huber et al., 2002). Initial studies of MASH-1 deficient mice have indicated that in the absence of MASH-1 the development of neuronal and endocrine SA cells is arrested at an early stage and that their catecholaminergic differentiation is impaired (Guillemot et al., 1993; Hirsch et al., 1998; Sommer et al., 1995, Huber et al., 2002). Therefore it was speculated that MASH-1 is required to promote the transition of neuroblast-like progenitors to a more mature stage (Sommer et al., 1995). However, a later study suggested that lack of MASH-1 leads to a delay rather than to an arrest of neuronal differentiation ( Pattyn et al., 2006), pointing to a role of MASH-1 in the timing of neurogenesis. Thus, MASH-1 facilitates differentiation, but in contrast to Phox2b, it may not be involved in cell fate specification.

As mentioned above apart from Phox2b and MASH-1 a variety of other Transcription factors with distinct but overlapping functions are required for the correct development of SA cells.

5 Introduction

1.2.3 Diversification of SA cells into sympathetic neuron and chromaffin cells

Around E11.5 in mouse embryos SA progenitors segregate spatially at the dorsal aorta and the presumptive chromaffin cells migrate from the dorsal aorta towards the adrenal anlage (Fig. 2). Originally, it was proposed that the progenitors of chromaffin cells are issued from the pool of catecholaminergic sympathetic neuron progenitors that have differentiated at the dorsal aorta from pluripotent neural crest cells (Anderson, 1993; Anderson and Axel, 1986; Anderson et al., 1991).

However, later studies suggested that the pool of neural crest derived cells at the dorsal aorta is heterogeneous (Ernsberger et al., 2005) and that chromaffin cells are generated from neural crest derived cells that still lack catecholaminergic characteristics, when they invade the adrenal anlage (for review see Huber, 2006). This argues against the existence of a direct bi-potential catecholaminergic progenitor for chromaffin cells and sympathetic neurons. Nevertheless, the progenitors of both cell types share a virtually identical transcriptional network and a vast variety of common markers during their early development. In addition recent in vivo on chick embryos confirmed that both cell types share a common progenitor at least at the pre-migratory neural crest level (Shtukmaster et al., 2013).

Mature sympathetic neurons and chromaffin cells still share many characteristics including the catecholamine-synthesizing enzymes tyrosine-hydroxylase and dopamine-β-hydroxylase, but as endocrine and neuronal cells, they are also distinct in many ways. Chromaffin cells lack neurites and they release catecholamines as hormones into the blood stream, while sympathetic neurons release noradrenalin as a neurotransmitter via axon terminals (for detailed review see Unsicker et al., 2013, Huber, 2014). Apart from their lack of neurites chromaffin cells are best characterized and distinguished from sympathetic neurons by the presence of numerous large chromaffin vesicles, where they store catecholamine hormones along with Chromogranin A and other substances (Langley and Grant, 1999) . A subpopulation of chromaffin cells in addition expresses PMNT, an enzyme required to convert noradrenalin into adrenaline (Goldstein et al., 1972).

Up to date it is not clear, which signals specifically promote the acquisition of endocrine features in the SA lineage. For decades, it was believed that local environmental signals provided by the adrenal cortex, which is not neural crest derived but develops from the mesoderm, are required for the differentiation of SA cells progenitors into chromaffin cells. In vitro studies suggested that

6 Introduction glucocorticoids are the essential adrenocortical cues that promote the differentiation of SA cells into chromaffin cells. It was proposed that glucocorticoid signaling promotes chromaffin cells differentiation by the downregulation of neuronal genes and the induction of PNMT (Anderson and Axel, 1986; Bohn et al., 1981; Doupe et al., 1985; Michelsohn and Anderson, 1992; Unsicker et al., 1978; Wurtman and Axelrod, 1966).

Fig.2. SA cells segregation. NT: neural tube, no: notochord, da: dorsal aorta, 1ry sg: primary sympathetic ganglion, SA precursor cells: sympatho- adrenal precursor cells, AM: adrenal medulla, AG: adrenal gland.

More recent in vivo studies in mice lacking the glucocorticoid receptor gene (GR) do not support this previous hypothesis, since chromaffin cells develop phenotypically almost normally in GR deficient mice, with the exception of the lack of the adrenaline-producing enzyme (PNMT). Hence, glucocorticoids are not essential for most aspects of chromaffin cell development, but are important for their adrenergic differentiation (Finotto et al., 1999). In addition glucocorticoid-

7 Introduction signaling has been shown to be important for the postnatal survival of chromaffin cells (Parlato et al., 2009; Schober et al., 2013).

Further studies on mice deficient for the nuclear orphan receptor steroidogenic factor 1 (SF-1), which lack an adrenal cortex and gonads, have revealed that even the adrenal cortex is dispensable for the specification of an endocrine fate in chromaffin cells, but it is required for PNMT induction and for the regulation of chromaffin cell numbers (Gut et al., 2005).

Since neither glucocorticoid signaling nor the adrenal cortex appear to be required for most aspects of specific chromaffin cell differentiation, the mechanisms that generate chromaffin cells from SA progenitors remain unclear.

1.2.4 The Adrenal medulla and the biosynthesis of catecholamines

The adrenal gland consists of two functionally and developmentally distinct endocrine tissues: the cortex, which produces steroid hormones such as glucocorticoids and mineralocorticoids and the adrenal medulla, which produces the catecholamines noradrenaline and adrenaline.

The adrenal medulla is the core of the adrenal gland and it contains apart from the endocrine catecholamine secreting chromaffin cells sustentacular cells and neurons. Adrenaline and noradrenaline are produced by two separate populations of chromaffin cells referred to as adrenergic and noradrenergic chromaffin cells (Díaz-Flores et al., 2008). Both cell types express TH and DBH, while only the adrenergic chromaffin cells express the adrenaline-synthesizing enzyme PMNT. The biosynthesis pathway for these hormones starts with the conversion of the amino acid L- tyrosine to dihydroxy-phenylalanine (DOPA) by the rate limiting enzyme tyrosine hydroxylase (TH). DOPA is then converted into dopamine within the cytosol by DOPA decarboxylase, then dopamine β- hydroxylase (DBH) produces noradrenaline from dopamine. Finally noradrenalin is converted to adrenaline by phenyl ethanolamine N methyl transferase methylated (PNMT) (Fig.3). These hormones are synthesized and packaged along with other secreted substances into chromaffin vesicles. (Klein and Ojamaa, 1992).

8 Introduction

Ultrastructurally these vesicles vary in their size; adrenaline storing granules are between 50–350 nm in diameter depending on the species (in mouse 170–350 nm), whereas noradrenaline granules have a larger diameter (185–495 nm in mouse).

Fig.3. Biosynthesis pathway of Adrenaline and Noradrenaline. (Goridis and Rohrer, 2002)

1.3 Von Hippel Lindau gene (VHL) 1.3.1 PVHL functions and interactions The Von Hippel Lindau (VHL) tumor suppressor gene, which is located on the short arm of chromosome 3 (Seizinger et al., 1988, 1991), has been linked to a variety of human tumors including the adrenal medullary tumor pheochromocytoma. It is part of a complex with ubiquitin

9 Introduction ligase E3 activity that is involved in the oxygen dependent degradation of hypoxia-inducible factors (HIFs), which in turn mediate the cellular response to low oxygen levels (Kaelin, 2004; Koh and Powis, 2012; Rankin and Giaccia, 2008). VHL has been shown to be ubiquitously expressed in embryonic and adult tissues on both the mRNA and the protein level (Kessler et al., 1995) (Richards et al., 1996) (Los et al., 1996) (Corless et al., 1997) (Iliopoulos and Kaelin, 1997). Loss of pVHL function leads to the stabilization of HIF-proteins (Krieg et al., 2000; Maxwell et al., 1999; Pollard et al., 2006) and thus to the induction of hypoxia-inducible mRNAs like vascular endothelial growth factor (VEGF) and platelet derived growth factor (PDGF) (Iliopoulos et al., 1996; Krieg et al., 2000; Rankin et al., 2008). Mouse knockout studies have revealed that complete loss of pVHL function is lethal between E10.5-12.5 due to disturbed vascular development of the placenta. (Gnarra et al., 1997), Conditional inactivation of VHL in specific cell types have been carried out to identify the impact of pVHL on embryonic and postnatal cellular development (Haase et al., 2001) (Ma et al., 2003) and to elucidate its role in cell proliferation, differentiation and survival (Haase et al., 2001) (Biju et al., 2004) (Rankin et al., 2005) (Seagroves et al., 2010). Most studies have focused on the biological functions of pVHL in tumor development and on its interaction with other proteins.

The best-known binding proteins are the transcription elongation factors Elongin B and C, which regulate the elongation by RNA polymerase II. They form a multimeric complex so-called VBC referred to pVHL and Elongin C/ B (Fig. 4) (Kishida et al., 1995) (Duan et al., 1995) (Kibel et al., 1995) (Fig 4). Via Elongin B pVHL interacts with Clu2 a member of the Cullin family of proteins (Pause et al., 1997) (Lonergan et al., 1998) and the ring finger protein Rbx1 (Kamura et al., 1999). This complex has ubiquitin ligase activity and is required for the proteasomal degradation of hypoxia inducible factors (HIFs) (Kondo et al., 2002).

The function of VHL as a tumor suppressor is at least in part due to its ability to regulate HIF stability (Iliopoulos et al., 1996; Kondo et al., 2002, 2003; Rankin et al., 2008; Zimmer et al., 2004), but it has also been linked to other putative cellular mechanisms. PVHL has been shown to bind fibronectin, an extracellular glycoprotein ubiquitously expressed during embryogenesis (for review Singh et al., 2010). The VHL and fibronectin complex is involved in the assembly of the extra cellular matrix (ECM) that is disorganized in some VHL-mutation associated tumors as clear renal cell carcinomas (Ohh et al., 1998).

10 Introduction

Fig.4. The interaction between HIF1 α and β domain of pVHL. Schematic showing the components of VBC complex and demonstrates the interaction between HIF 1 α sequence (blue) with the β domain of pVHL (red). (Min et al., 2002)

Furthermore, pVHL is believed to regulate neuronal cell death. During neuronal development sympathetic neuron precursors cells undergo cell death once the target- derived nerve growth factor (NGF) becomes limiting (Deckwerth and Johnson, 1993; Edwards and Tolkovsky, 1994). Lack of NGF results in the upregulation of the activator protein (AP1) family member JUN-C and the downregulation of JUN-B followed by apoptosis (Estus et al., 1994) (Ham et al., 1995) (Palmada et al., 2002) (Lee et al., 2005). In vitro studies have indicated that NGF-deprived PC12 cells (a sympatho-adrenal cell line derived from pheochromocytoma), which have been used as an in vitro model of developing sympathetic neurons, show enhanced survival following pVHL inactivation in a JUNB dependent manner (Lee et al., 2005) (Nakamura and Kaelin, 2006). Thus pVHL might be involved in the regulation of neuronal apoptosis after NGF withdrawal through a JUNB dependent mechanism (Lee et al., 2005). Furthermore studies have indicated that prolyl hydroxylase enzymes (PHDs), which are induced by HIFs (del Peso et al., 2003) (Marxsen et al., 2004) are implicated in enhanced neuronal survival following VHL inactivation (Lee et al., 2005).

In addition the VHL gene has been shown to have a critical role in the cell cycle exit that may also be linked to VHL mediated tumorigenesis. (Pause et al., 1998).

11 Introduction

1.3.2. The Von Hippel-Lindau disease

The Von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited genetic condition that was described in 1936 by Dr. Von Hippel and Lindau (Maher et al., 2011). It has an estimated incidence of 1 in 36,000 individuals (Maher et al., 1991).

Bi-allelic inactivation of VHL tumor suppressor gene on the short arm of chromosome (3p25.3) is known to be the most common cause of VHL disease development (Seizinger et al., 1988) (Latif et al., 1993). Patients with VHL disease typically inherit a normal and a mutant allele of VHL and are referred to as germline VHL+/- heterozygotes. The phenotype of VHL disease appears once the patients loses or inactivates the normal allele (Crossey et al., 1994a) (Iliopoulos and Kaelin, 1997). This leads to the development of various types of malignant and benign tumors such as central nervous system (cerebellar, spinal) tumors, retinal hemangioblastomas, clear renal cell carcinomas (RCC), pheochromocytomas (PCC), pancreatic neuroendocrine tumors, pancreatic cysts, endolymphatic sac tumors and epididymal papillary cystadenomas (Kaelin and Maher, 1998) (Fig. 5).

Most of these tumors are highly vascularized due to the enhanced expression of vascular endothelial growth factor (VEGF), a major target of HIFs (Acker et al., 2005) (Giatromanolaki et al., 2006) (Holmquist-Mengelbier et al., 2006) (Rankin et al., 2008). (Iliopoulos et al., 1996).

12 Introduction

Fig.5. Tumors associated VHL disease.

1.3.3 Phenotype genotype correlation The VHL disease is categorized into clinical subgroups depending on the type of VHL mutation and the phenotype. This classification is useful in prognosis of VHL cases and for future protection (Ong et al., 2007). The phenotype of VHL disease is classified according to the absence (Type 1) or presence (Type 2) of pheochromocytoma (Koch et al., 2002). Type 1A patients have retinal and CNS hemangioblastoma, but a very low risk of pheochromocytoma (PCC). VHL mutations that have been associated with this group are either nonsense or frameshift mutations, which lead to a truncated pVHL (Friedrich, 2001). The second group of type 1 VHL disease is called type 1B and it is characterized by retinal and CNS heamangioblastoma and low risk of renal cell carcinoma (RCC) (Cascón et al., 2007).

Introduction

The majority of patients with PCC have VHL missense mutation and are classified as type 2VHL disease. This type is subdivided into further subgroups, either type 2A, 2B or 2C depending on the presence or absence RCC. (Chen et al., 1995) (Woodward and Maher, 2006) (Table 1). In Type 1, 2A and 2B VHL disease the VHL mutations lead to an upregulation of HIFs, while VHL mutations in type 2C individuals with PCC are believed to act in a HIFα independent manner (Clifford et al., 2001).

VHL mutation Regulation of HIF Associated tumors

Type 1A Nonsense/ frame shift Upregulation of HIF HB (VHL loss) RCC Low risk of PCC Type 2A Missense mutation Upregulation of HIF HB PCC Low RCC Type 2B Missense mutation Upregulation of HIF HB PCC High risk RCC Type 2C Missense mutation Downregulation of Only PCC HIF Table 1. Subcategories of VHL disease caused by different mutations in the human VHL gene. (Kim and Kaelin, 2004).

1.3.4 VHL and Pheochromocytoma

Pheochromocytomas (PCC) are rare chromaffin cell derived tumors (Hoehner et al., 1998), either within the adrenal medulla or in extra adrenal chromaffin tissue, where they are referred to as paraganglioma (Opocher and Schiavi, 2011). More than 90% of the paraganglioma are located in the retroperitoneum and 30% of these are in the organ of Zuckerkandl (Altergott et al., 1985).

Introduction

PCC are typically associated to high serum levels of adrenaline and noradrenaline (Eisenhofer et al., 1999, 2001). However, one of the phenotypic features of PCC associated to VHL disease is the lack of adrenergic traits within the tumor tissue (Eisenhofer et al., 2004) (Tischler, 2008).

In humans hereditary pheochromocytomas are associated with diverse genetic disorders including VHL disease, neurofibromatosis type 1 (NF1), multiple endocrine neoplasia type 2 (MEN2), and hereditary paraganglioma syndrome (PGL) due to mutations of genes encoding succinate dehydrogenase (SDH) (Brannan et al., 1994) (Maher and Eng, 2002) (Bryant et al., 2003). These autosomal dominant diseases have been linked to the inactivation of tumor suppressor genes as the VHL and NF1 gene or the activation of the proto-oncogene RET gene (MEN2) and SDH (B, C or D) (Vogel et al., 1995) (Baysal et al., 2000) (Astuti et al., 2001) (Nakamura and Kaelin, 2006).

A higher incident of PCC was found in patients who have VHL missense mutations than in those who have a large deletion or truncating mutations (Maher et al., 1996) (Crossey et al., 1994b) (Richards et al., 1994). Moreover at the molecular level VHL mutations associated to PCC can ubiqitinate HIF- α (Clifford et al., 2001) (Hoffman et al., 2001). Yet, the pathogenetic mechanisms underlying VHL-associated PCC is not well understood. Currently the essential role of VHL in PCC development is under discussion.

1.4 Hypoxia regulated genes

1.4.1 Hypoxia inducible factors (HIFs)

Hypoxia inducible factors are heterodimeric basic helix loop helix transcription factors that belong to the Per-ARNT-Sim (PAS) family (Wang et al., 1995). They are heterodimers consisting of alpha and beta subunits. The stability of the alpha subunits (HIF-α) is regulated in an O2 dependent manner. Thus it has an essential role in the cellular response to low oxygen levels (Hogenesch et al., 1997) (Wenger, 2002).

In contrast, the 91–94 kD beta subunit (HIF-β), also named as Aryl hydrocarbon nuclear translocator (ARNT) (Wang et al., 1995), is stable in an O2 independent manner (Wang and

Introduction

Semenza, 1995) (Zagórska and Dulak, 2004) (Wang and Semenza, 1993) (Li et al., 1996) (Kallio et al., 1997).

Up to date three isoforms of HIF- α are known:, HIF-1α, HIF-2α and HIF-3α (Hogenesch et al., 1997) (Wenger, 2002). They partially differ in their structure and physiological functions.

HIF-1α and HIF-2α genes are located on two different chromosomes. The HIF-1α gene is located on chromosome 14 q 21-24 (Semenza et al., 1996), while the HIF-2α gene, also named endothelial PAS domain protein 1 (EPAS1), is located on the short arm of chromosome 2 (Tian et al., 1997).

HIF-1α mRNA is ubiquitously expressed in cells and tissues, unlike HIF-2α and HIF-3α that have a restricted expression pattern. HIF2α was localized in highly vascularized organs including heart, lung, retina, the endothelial cell lining of blood vessels and developing cells of the SA lineage (Tian et al., 1997) (Ema et al., 1997) (Flamme et al., 1997) (Wiesener et al., 2003) (Keith et al., 2011), whereas HIF3α is expressed in lung, heart, adult thymus, Purkinje cells of the cerebellum and in corneal epithelium of the eye (Makino et al., 2001). HIF3α-2 is one of the HIF3α isoforms, known as inhibitory PAS (Per/Arnt /Sim) domain protein (IPAS), which have a negative impact on the HIF1α and HIF2α regulated gene transcription (Makino et al., 2001) (Jang et al., 2005) (Heikkilä et al., 2011).

The close similarity between HIF1α and HIF2α in their biochemical characteristics and their regulatory mechanisms were described frequently. Structurally both possess four domains. The first crucial domain is the bHLH domain, which binds to a DNA sequence known as hypoxia responsive element (HRE) to regulate the transcription of the target genes (Tian et al., 1997). The Per-AHR ARNT-Sim homology (PAS) domain is required for dimerization with HIF-ß in the nucleus to transcribe specific target genes (Tian et al., 1997). The third essential domain is an oxygen dependent degradation domain (ODD). It contains two different proline residues (P402, P564) in HIF1α and (P405, P531) in HIF2α. Those are hydroxylated by prolyl hydroxylase domain–containing enzymes 3 (PHD3) under normoxic conditions resulting in the VHL- dependent proteasomal degradation of the HIF-α subunits. All HIF-α isoforms are ubiquitinated by pVHL (Maynard et al., 2003). Furthermore there are two trans-activational domains known as TAD (with C-terminal C-TAD or with N-terminal called N-TAD), which are important for target gene specificity and regulation, respectively (for review Loboda et al., 2010).

Introduction

HIF1α and HIF2α are predominantly regulated on the protein level in an oxygen dependent manner (Tian et al., 1997) (Kaelin and Ratcliffe, 2008) (Koh and Powis, 2012), while little is known about regulation of HIF3α with reference to oxygen levels.

Under normoxic conditions HIF-α units have a short life time (Huang et al., 1996), due to the pVHL dependent ubiqitinylation and subsequent proteasomal degradation (Maxwell et al., 1999) (Cockman et al., 2000) (Yu et al., 2001) (Ivan et al., 2001) (Masson et al., 2001) (Min et al., 2002). Under hypoxic conditions HIF-α isoforms cannot be hydroxylated by PHD and thus escape degradation. HIF-α subunits then move to the nucleus and dimerize with HIF-β subunits to form a transcriptionally active complex that bind with hypoxia responsive element (HRE) DNA sequence, to transactivate specific hypoxia target genes (Fig.6). Its target genes include VEGF, erythropoietin and GLUT-1, Octamer- binding transcription factor- 4 (OCT4) (Covello et al., 2006) and TGF- α (Raval et al., 2005) that are necessary for a biological cellular adaptation to the surrounding situation.

Fig.6. O2 dependent regulation of HIF-α. Diagram shows binding of HIF-α with HIF-β (ARNT) dimer to HRE sequence of specific target genes within nucleus under hypoxic condition. (Erbel et al., 2003).

Introduction

In vitro studies have pointed to a role of hypoxia in the regulation of catecholamine synthesis and secretion in SA cells (Cheung, 1989) (Donnelly and Doyle, 1994) (Kumar et al., 1998). In this context, in vivo studies have shown that HIF2α deficient embryos die by day 16.5. It was assumed that this was caused by low catecholamine levels due to a developmental defect or dysfunction of the OZ (source of catecholamine during fetal development) (Tian et al., 1998). Studies on neuroblastoma cells have shown that knockdown of HIF2α leads to a downregulation of genes associated with undifferentiated neural crest cells like NOTCH, ID2 and HES-1 and an upregulation of neural differentiation markers (Pietras et al., 2009). Moreover, HIF2α has been shown to regulate the expression of OCT4 (octamer-binding transcription factor 4) a transcription factor known to be important for the maintenance of pluripotency (Covello et al., 2006). However, the physiological role of HIF2α in developing SA cells is still unclear.

1.4.2 Delta like- 1 homologue (DLK-1)

Delta Like-1 (DLK-1) is a paternally imprinted gene, located on human chromosome 14q32 (Gubina et al., 1999) and mouse chromosome 12 (E Gubina, 2000). It belongs to the Delta- Notch-Serrate family of signaling molecules that are involved in cell fate determination in many tissues during development (Kopan and Ilagan, 2009).

Analysis of the amino acid sequences indicated that the DLK-1 gene encodes a transmembrane epidermal growth factor (EGF)-like protein that possesses a N- terminal signal sequence, six EGF-like repeats in the extracellular domain, a transmembrane domain and a short C- terminal intracellular tail (Smas et al., 1994) (Smas et al., 1997).

DLK-1 is known under various names, including PG2 (Helman et al., 1987), fetal antigen 1 (FA- 1), and Pre-adipocyte factor-1 (Pref-1) (Smas and Sul, 1993).

Due to alternative splicing DLK-1 exists in soluble and membrane bound isoforms. The soluble form of DLK-1 with a molecular weight of 50 KDa can be produced by cleavage at the extracellular domain by ADAM metallopeptidase domain 17 (ADAM17), also called Tumor Necrosis Factor Alpha Converting Enzyme (TACE) (Smas et al., 1997) (Wang and Sul, 2006). It has been shown to accumulate in the amniotic fluid where it is referred to as (FA-1), which acts as a growth factor during development. In addition, it has a role in adipogenesis.

Introduction

The second variant of DLK-1 is membrane-bound (55 KDa), which lacks the proteolytic cleavage site (Smas et al., 1994). Interaction of soluble and membrane bound DLK-1 has been shown to regulate neurogenesis in the subventricular zone (Ferrón et al., 2011).

DLK-1 mRNA has been reported to be widely expressed at embryonic day 8.5 in mouse embryos (Smas and Sul, 1993). Its expression was detected in variety of developing endocrine tissues including pituitary, pancreas and within discrete clusters of cells in the developing adrenal gland, lung, liver, salivary gland, tongue and many mesodermally derived tissues. From E16.5 onwards, its expression is down-regulated in most tissues but persists after birth in the pituitary, the adrenal medulla, and in skeletal muscle (Smas and Sul, 1993) (Jensen et al., 1993) (Yevtodiyenko and Schmidt, 2006) (Falix et al., 2013).

In human DLK-1 has been implicated in hepatoblast proliferation (Tanimizu et al., 2003), hematopoiesis (Moore et al., 1997) and inhibition of mature adipocyte formation (for review see Laborda, 2000).

DLK-1 mRNA and protein have been shown to be induced by hypoxia in a HIF-α dependent manner (Kim et al., 2009). DLK-1 is expressed in many neuroendocrine tumors including neuroblastoma (NB) (Cooper et al., 1990) (Van Limpt et al., 2003) and it maintains stemness of these tumor cells (Kim et al., 2009) (Begum et al., 2012). Furthermore in vitro study showed that inhibition of DLK-1 enhances NB cells differentiation (Begum et al., 2012).

Aim of the study

1.5 Aim of the study

The neural crest derived sympatho-adrenal (SA) cell lineage, which gives rise to sympathetic neurons of the autonomic nervous system, provides an intriguing model system to investigate principle developmental mechanism like neuronal and endocrine cell fate specification. Profound knowledge on the development of SA cells is also of clinical interest, since abnormal development of SA cells leads to various diseases, including neuroblastoma, the most common cancer in infancy. VHL associated pheochromocytoma, a tumor of the adrenal medulla, may at least in part be caused by disturbed development of SA cells, including deficits in the regulation of ontogenetic cell death. Hypoxia and hypoxia-inducible factors, the major targets of VHL, have also been implicated in SA tumor development. However, the physiological function of VHL and hypoxia-inducible factors during normal development of SA cells is not understood up to date.

The purpose of this study was to investigate the in vivo role of VHL on the normal development of SA cells and to investigate, whether the loss of VHL function leads to SA derived tumor development as pheochromocytoma. For this reason the VHL gene was conditionally eliminated in SA cells by cre- recombinase under the dopamine β- hydroxylase (DBH) promoter. In addition the precise spatiotemporal expression pattern of hypoxia- regulated genes, including HIF2α and DLK-1 in developing sympatho-adrenal cells of normal and VHL deficient mouse embryos should be determined as a step forward towards understanding the physiological function of these genes.

Materials and Methods

2. Materials and Methods 2.1 Materials 2.1.1 Reagents

AEC Sigma–Aldrich (A5754) Agarose powder GENAXXON bioscience (M3044.500) Ampicillin Roth (K029.1) Aqua Tex Merk (1.08562.0050) Blocking reagent Roche (109676) BSA factor V Sigma (A 7906) Chloroform Merk (2447) Citric acid Sigma (C7129) DAB Sigma (D5905) DAPI Bizol (SBA-o1oo-20) Dextran sulfate Sigma (D8906) 100 bp DNA ladder GeneRuler Thermo Scientific (SM0321) EDTA Sigma (E5134) Ethanol Sigma Alderich (32205) Ficoll PM 400 Sigma (F4375) Formamide Roth (6749.2) KCl (Potassium chloride) Sigma (P9541) KH2PO4 (Potasium dihydrogen orthophosphate) Sigma (P5379) 37% HCL Roth (4625.1) 30%Hydrogen peroxidase solution Sigma- Alderich, Steinheim Horse serum Gibco (26050) Isopropanol Fischer Scientfic (P\ 7500\17) Lamb serum Gibco (16070) LB medium (Luria/Miller) Roth (X968.1) Levamisol Sigma (L-9756) Maleic acid Sigma (M0375) Magnesium chloride (MgCl2) Merck (1.05833) Methanol VWR International, Dermstadt Na Cl (Sodium chloride) Sigma (S7653)

Materials and Methods

Na Citrate (Sodium citrate) Sigma (S4641) Na2HPO4 (Sodium phosphate dibasic) Merck (1.06586) Na OH (Sodium hydroxide) Merck (1.06498) NBT/BCIP Stock solution Roche (11681451001) NDS\ NGS AbD Serotec A Bio- Rad company, puchheim OCT freezing medium Sakura Finetek PFA Merck (1.04005) Polyvinylpyrrolidone (PVP40) Sigma (PVP40) RNAse inhibitor Roche (03335399) Sucrose Carl Roth Gmbil (4621-1) Tissue Teck Sakura finetek Tris Base Sigma (T6066) Tris HCl Sigma (T5941) TritonX100 Sigma-Aldrich t-RNA Sigma (P6750) Trypsin 0.25% Invitrogen (25200072) Tween 20 Sigma (P1379) Yeast- RNA Sigma (R6750)

2.1.2. Solutions and buffers

AEC substrate

Acetate buffer 5ml AEC in DMSO/ Triton 1ml 30%Hydrogen peroxide 10μl Distilled water 95ml

Agarose gel

Agarose powder 1.2 gm 1X TAE buffer 120 ml The solution was melted in microwave for 2 min until the powder completely dissolved.

Materials and Methods

AP buffer

1M Tris, PH 9,5 40 ml 1M Mg CL2 20 ml 5M Na CL 8ml Tween-20 400 μl Levamisol 96 mg Sterile distilled water 400 ml Stored at -20°C.

Box buffer

Formamide 10 ml 20XSSC 2ml Distilled water 8ml

Citrate buffer (0.1 M, pH 6.0)

0.1M citrate acid 21gm H2O2 1L

Denhardt’s 100X

Ficoll PM Type 400 10gm Polyvinylpyrolidine ( PVP40) 10 gm BSA factor V 10 gm DEPC H2O to 500 ml

DEPC-H2O

0.1 % DEPC 1ml Distilled H2O 1L Mixed overnight then sterilized by autoclave.

Materials and Methods

50 % Dextran sulfate

Dextran sulfate 6, 25 gm DEPC-H2O 12.5 ml

0.5 M EDTA PH 8.0

EDETA 18.61gm NaOH 2gm Distilled H2O To 100ml. autoclaved

Hybridization buffer

10X Salt 3ml 100X Denhardts 150 μl Yeast RNA stock solution 3 ml 50% Dextran 6ml Formamide 15ml DEPC- H2O to 30ml Mixed on magnetic stirrer at 60 C, stored at -20°C.

LB medium

Standard nutrient broth 25 gm Distilled water 1 L

5X loading buffer with Gel Red

Standard loading buffer 6X 100 μl Gel Red 300X 2 μl Distilled water to 120 μl

Materials and Methods

Gel Red 300X

10000X Gel Red 3 μl Distilled water 97 μl

Maleic acid buffer MAB (5X), PH 7.5

100 Mm maleic acid 2 9.02g 150 mM NaCl 21.91g NaOH pellets 18g Distilled water 450 ml

M-MLVRT 5X Reaction buffer

Tris-HCL PH 8.3 250 mM Kcl 375mM MgCl2 15mM DTT 50Mm

10% NDS or 10% NGS

Normal serum (according to species) 5 ml 1XPBT 45 ml

1.5% NDS /PBT (PH 7.4)

Normal Serum 0.75ml PBT 49.25 ml

4% Paraformaldehyde solution: (4 % PFA, pH= 7, 4)

Paraformaldehyde 4gm 1X PBS 1 L Heated on water bath at 70 °C until dissolved, then the solution was cooled and filtrated. Stored at 4°C.

Materials and Methods

Phosphate buffer solution: (10X PBS) (1L, pH= 7, 2-7, 4)

Na2HPO4x2H2O 11.5 gm Na CL 80 gm KH2Po4 2gm KCL 2gm Distilled H2O 1 L

1XPBT: PH 4.7

1X PBS 1L 0.2% Triton X100 2ml

30% Sucrose

Sucrose 30 gm 1XPBS 100 ml

10X SALT

Tris (Base) 7.7 g NaCl 53.9 g Na2H2PO4 3.55g NaHPO4 4.45g 0.5 M EDTA PH8.0 50 ml Distilled H2O to 500ml

20XSSC (stock solution) PH 7.0

Nacl 175.3 g Na- Citrate 88.2gm DEPC-H2O to 1L Adjust PH to 7.0 by adding few drops of Na OH, sterilized by autoclave.

Materials and Methods

Standard I medium (SOC medium)

2% tryptone 10mM Mg CL2 0.5%YEAST 10mM NaCL 10mM MgSO4 2.5 mM KCL 20mM glucose Extract

TE Buffer (Tris- EDTA buffer) PH 8.0 (10Mm Tris, 1Mm EDTA)

1 M Tris PH 8.0 5ml 0.5 M EDTA PH 8.0 1 ml DEPC- H2O To 500 ml Autoclaved.

1 M Tris PH 8.0

2M Tris HCL 56.28ml 2M Tris Base 43.72 ml Distilled H2O to 200 ml

2M Tris base

Tris Base 242.2 Distilled water to 1L

1M Tris, PH 9.5

2M Tris HCL 5ml 2M Tris Base 95 ml Distilled H2O to 200ml Adjust PH to 9.5 with 37% HCL, sterilized by autoclave.

Materials and Methods

Wash buffer

Formamide 300ml 20X SCC 30ml Tween 20 600 micro Distilled H2O to 600 ml.

Yeast RNA stock solution

Yeast- RNA 250 mg DEPC- H2O 25ml Stored at -20C.

Table 2.1.3 Enzymes

Name Supplier (Catalog. No)

DNAse I recombinant for plasmid transcription Roche (04 716 728 001) Sac II restricted enzyme For DLK-1, HIF2α probe Fermntas ER0201 SP6 RNA polymerase for DLK-1, HIF2 α Roche 108 10274 001 PST I restricted enzyme for VEGF Fermntas ER0611 T7 RNA polymerase for VEGF Roche 10881767 001

Materials and Methods

Table. 2.1.4 Nucleotide sequences of primers used in ISH probes

Name Orientation Sequences (5’- 3’) Supplier

Mouse DLK-1 Sense CTCTTGCTCCTGCTGGCTGCTTT Metabion (01216B3-1135F11) Mouse DLK-1 Antisense AGGGGTACAGCTGTTGGTTG Metabion (01216B3-1135G11) Mouse HIF2α Sense GAGGGTTTCATTGCTGTGGT Metabion (20615B3-9641A05) Mouse HIF2α Antisense GAATCCAGGGCATGGTAGAA Metabion (20615B3-9641B05) Mouse VEGF Sense TCCAACTTCTGGGCTCTTCT Metabion (20615B3-9641E05) Mouse VEGF Antisense TCGCTGGTAGACATCCATGA Metabion (20615B3-9641F05)

Table. 2.1.5 Primary antibodies

Name Source Type Dilution Company Catalog. No

TH Sheep Polyclonal 1:500 Millipore 1542 Phox2b Rabbit 1:400 Gift from Dr.Goridis Anti-Caspase-3 Rabbit Monoclonal 1:200 Cell signaling 9664s PH3 Rabbit Polyclonal 1:1000 Millipore 06-570 Anti Digoxigenin Sheep Polyclonal 1:1500 Roche 11093274 910 AP TH Rabbit Polyclonal 1:1000 Millipore AB152

Materials and Methods

Table. 2.1.6 Secondary antibody Name Source Dilution Supplier

Alexa Fluor 594 Das 1:400 Dianova 713-585-147 Alexa Fluor 488 Dar 1:400 Dianova 711-545-152 Biotinylated donkey anti sheep Das 1:400 Dianova 713-065-147 Streptavidin CY2 DaR-CY2 1:1000 Dianova 016-220-084 Streptavidin CY3 DaR- CY3 1:500 Dianova 711-165-152

2.1.7 Kits

Name Company (Catalog number)

ABC Kit Vector Laboratories (SP-2001) ApopTag Fluorescein In Situ Apoptosis Detection Millipore s7110 Kit life technology (R0192) dNTP mix 10 Mm Promega (9PIM317) Go taq DNA polymerase kit promega (9PIM170) M-MLVRT kit MACHEREY- NAGEL (740410. 50) Nucleobond Xtra plasmid purification MACHEREY- NAGEL (74069. 50) Nucleospin Gel and PCR clean up Macherey Nagel (740609.50) PCR clean up kit Qiagen (19046) Plasmid buffer (P1, P2, P3) set Promega (A1360) pGEM- T and pGEM- T Easy vector system Roche (118 14427 001) Quick spin RNA column Roche (11 277 073 910) RNA DIG labelling mix

Materials and Methods

2.1.8 Equipment:

Instrument Supplier Type

Centrifuge for plasmid isolation Eppendorf 5804R Centrifuge for PCR samples Eppendorf 5804R Cryostat Leica 3050 Incubator for ISH Hermett Incubator for culture plates MWG-Biotech MK-II Microscope Zeiss Axioplan 2 Shaker Heidolph instruments polymax 1040 Spectrophotometer Peqlab Nanodrop1000 Thermo cycler Eppendorf Master Cycler Thermomixer Comfort Eppendorf Vortex Heidolph instruments Water bath GFL Gesellshaft fur labortechnik mbH

2.2 Methods

2.2.1 Experimental animals

This study was carried out by using wild type mice (black sex) embryos between the embryonic days (9.5 to 18.5), in order to identify the spatiotemporal expression pattern of the DLK-1 and HIF-2α mRNA in the sympatho- adrenal cell lineage. Likewise I have used conditional VHL knockout mice at different embryonic stages to analyze the effect of pVHL on the development of SA cell lineage (sympathetic neuron of autonomic nervous system and chromaffin cell of adrenal medulla), and to find out whether loss of VHL in SA cells leads to pheochromocytoma (chromaffin cells tumor) development. Furthermore, I have investigated the vivo role of the VHL in the expression of selected oxygen regulated genes as HIF-2α, DLK-1, and VEGF in SA cells.

Materials and Methods

2.2.2 Genotyping of transgenic mice

With a view to know the role of the pVHL on sympatho-adrenal cell lineage development of mouse embryos, we have generated conditional VHL knockout mice that allow inactivation of VHL by Cre/ loxp mediated recombination. The genomic VHL was flanked by loxp sites to generate floxed VHL- transgenic mice referred as (VHLflox/flox) (Haase et al., 2001). The VHLflox/flox mice were bred to DBHCre - transgenic mice (Lemberger et al., 2007) that express the Cre-recombinase under control of the dopamine B hydroxylate (DBH) tissue specific promoter to generate (DBHCre: VHLflox/flox) animals. In this work, I used this symbol (VHLDBHCre) to refer to the VHL knockout (KO) mice. The embryos with VHLflox/+, DBHCre were used as control mouse embryos.

2.2.3. Tissue preparation and Embedding Embryos were obtained by cesarean section, rinsed with phosphate buffer saline (PBS, PH 7.4), and fixed for overnight at 4°C in 0.1M PBS containing 4% Paraformaldehyde (PFA). Fixed embryos were rinsed three times in PBS for 30 minutes, and then cryopreserved in 15% Sucrose \ PBS overnight at 4°C. Later, immersed in 30% Sucrose and kept at 4°C overnight. The embryos were transferred to an embedding mold containing OCT tissue (freezing medium), and frozen on box containing liquid nitrogen. Later stored at -20°C until further process.

Finally, embryos were transversally sectioned at 10μm thickness and collected on Superfrost TM slides. Slides were stored at -20°C until further processed.

2.2.4 Histological stains a). Immunohistochemistry (IHC)

Cryo- sections were dried at room temperature (RT) for 30 minutes and washed once for 10 minutes in 1XPBS (PH7.4). Sections were incubated at RT with endogenous peroxidase by using 30% H2O2 in Methanol for 30 minutes, rinsed in 1XPB three times for 5 minutes each. Before immunostaining, sections were incubated with 0.1 M citrate buffer solution (pH= 6) in a microwave (at 600 Watt) for 2-6 minutes for antigen retrieval. To enhance the permeability of the cells and block the non-specific protein –protein interaction, sections were blocked

Materials and Methods

with 10% normal serum/1XPBS /0.2% Triton X100 (PH7.4) according to the secondary antibodies for 1 hour.

Sections were incubated with primary antibody (see Table. 2.1.5) diluted in 1.5% NDS/PBS overnight at 4°C. After rinsing with 1XPBT they were incubated with secondary antibody (see Table 2.1.6) diluted in 1.5% NS/PBS for 2 hours at RT, then Avidin-Biotin complex components of ABC kit were used for 45 minute to block the nonspecific binding of endogenous biotin and to avoid a high background . Finally staining was visualized by AEC- substrate. After 15 minute, the sections were rinsed with aqua distilled water then slides were mounted with Aqua Tex and analyzed with a bright field (Axioplan2, Zeiss) microscope. b). Double Immunofluorescences for analysis proliferation and apoptosis in VHL KO mice To detect positive mitotic and apoptotic cells in tissues I have done double IF staining. Frozen sections stored at -20°C were taken out and air-dried for 30 minute. Prior to incubation with the antibodies, sections were blocked with 10% NDS /PBT for 1hour to reduce the background, then incubated overnight at 4°C with primary antibodies mixture diluted in 10% NDS. The mixture was composed of (sheep.TH 1:500 and rabbit. PH3 1:1000) for proliferative analysis, (sheep.TH and rabbit-anti-cleaved caspase-3 1:200) to detect the apoptotic cells. Thereafter, Sections were washed twice in PBS for 5 minutes each, the reaction was undertaken with a second antibody mixture composed of donkey anti- sheep (Das) Alexa Fluor 594 1:400 in 1.5% NDS /PBT dilution used to label TH expressing cholinergic cells, then stained with CY2 conjugated Streptavidin at 1:1000 in PBS for 45 minute. Between all incubation steps, sections were extensively washed with PBT buffer and mounted with Fluoromount- G containing DAPI for staining the cell’s nucleus. Then the sections were visualized under the fluorescence microscope (Zeiss microscope, Germany). c). TdT dUTP Nick End Labeling (TUNEL) assay To label apoptotic cells within the sympathetic ganglia and adrenal medulla of E18.5 VHL KO and control mice, TUNEL assay was performed by using Apo Tag Fluorescein In Situ Apoptosis Detection Kit. 10 μm thick cryo-sections were dried at RT for 30 minute and washed once for 5minutes in PBS. To permeabilize the cells, slides were incubated in pre-cooled jar containing Ethanol/acetic acid at ratio 2:1 for 5 minutes at RT, a further washing in PBS for 5 minutes was done.

Materials and Methods

Later 150μl of Equilibration buffer was added on each slide for 3 minutes at RT, and then slides were covered with plastic sterile coverslip to spread reagents over all the area. Afterwards coverslips were removed and sections were incubated with 105μl of working solution (terminal deoxy nucleotidyl transferase (TdT) Enzyme diluted in reaction buffer at ratio 1: 2) for 2 hour at 37°C, then placed in jar containing stop\ wash buffer for 10 minutes. After washing three times in PBS, the tissues were incubated for 1 hour in a humidified chamber at RT with anti- Digoxigenin antibody that is conjugated to fluorescein and diluted with blocking solution. Thereafter, the slides were rinsed in PBT for 30 minute and incubated with primary antibody (rabbit TH, biotin 1:1000 in 1.5% NDS) overnight at RT. On the second day, sections were washed with PBT, incubated with (Alexa 488, Dar 1:400 in PBS) for 2hours at RT. After rinsing with PBT, they were further incubated with Streptavidin CY3 (1: 500) for 45 minute, then washing in PBT. Finally mounted with Fluoro-mount containing DAPI.

2.2.5 In Situ Hybridization (ISH) a). In Situ ribo-probe preparation

In this work, we have prepared In Situ Digoxigenin (DIG)-labeled RNA complimentary sequences in order to detect endogenous transcripts of the specific mRNA sequence of interest in embryonic mice.

Candidate genes DLK-1 HIF2α VEGF

b). C-DNA synthesis

RNA was extracted from E14.5 embryonic mice tissues by Trizol reagent; c-DNA was synthesized from RNA molecules by using M-MLVRT reverse transcriptase, as described in the protocol. In sterile RNase free centrifuge tube was added:

Component Quantity

Template RNA 2 µg (1 µl)

Materials and Methods

Random primer 0.5 µg ( 2 µl)

The mixture was heated to 70 °C for 5 minutes to melt secondary structure within the template, and annealing primer with the template was achieved by adding:

Component Quantity

M-MLV 5X reaction buffer 8 µl d-NTPs 2 µl Ribonuclease inhibitor 0.5 µl M-MLV reverse transcriptase 2µl Nuclease free water to 40 µl

Reaction mix was incubated at 37°C for 2hr; RNase free water containing cDNA was stored at -20°C. c). Gene amplification

Genes of interest were amplified by Go Taq DNA polymerase Kit. Firstly master mix reaction was prepared then the appropriate volumes of the reaction were dispensed into small nuclease-free micro- centrifuge Eppendorf tubes, eventually the primers (Table 2.1.4) and cDNA samples were added separately.

Component Concentration Volume/ sample 5X Colorless Go Taq Reaction buffer 1X (1.5 mM MgCl2)2 10 µl MgCl2 25mM 3 µl dNTP mix 10mM 2 µl Go Taq DNA polymerase 5µ/ µl 0,5 µl cDNA template > 0.5µg/ 50 µl 2 µl Upstream primer 0.1-1.0 µM 0.5 µl Downstream primer 0.1-1.0 µM 0.5 µl RNase free H2O To 50 µl

Materials and Methods

d). PCR Thermal cycling

The PCR reactions were occupied in PCR Thermal cycler and PCR was performed according to cycling protocol:

Step Temperature Time No. of cycle Initial denaturation 94 °C 3 min 1 cycle Denaturation 94°C 1 min Annealing 56 °C 1 min 39 cycle Extension 72 °C 1 min Final extension 72 °C 10 min 1 cycle Hold 8°C Indefinite 1 cycle

e). Agarose gel electrophoresis

To visualize PCR products, PCR products was added to 5X loading dye (1: 5), after mixing by pipetting, the products were loaded into wells of 1.5% agarose gel. 100bp DNA ladder (Invitrogen) was also loaded to determine the size of interested genes that normalized to the housekeeping gene (GAPDH). The agarose run at 120V.

f). Purification of DNA (plasmid preparation)

After running the PCR products in gel electrophoresis, the size of DNA fragments in kilobase (Kb) were visualized as bands. Gel containing desired products were cut out and placed into nuclease free tubes.

DNA was extracted from agarose gel slice according to PCR clean up and gel extraction protocol (Nucleospin Gel and PCR clean up), it carried out after weighing the gel slice containing the PCR products. 200μl NTI binding buffer was added for each 100 mg of gel (<2%), incubated for 10 minutes at 50 °C until the gel slice is dissolved. The samples were then loaded in Nucleospin Gel and PCR clean up columns placed into 2ml collection tubes centrifuged at 11.000Xg for 30 seconds, and washed two time by adding 700μl of the Ethanolic buffer NT3 and centrifuged at 11.000xg for 30 seconds. Thereafter, the columns were transferred into new sterile Eppendorf tubes, 20μl NE elution buffer was added, and

Materials and Methods

incubated 10 minute at TR, ultimately cleaned and pure DNA were eluted after centrifugation for 1minute at 11.000xg.

g). Ligation and cloning PCR product with pGEM-T vector system

PGEM-T vector system was used for ligation. The ligation reactions were set up as follows and subsequently incubated for 1 hour at RT.

Reagents Ligation reaction Positive control 2Xligation buffer 5 µl 5 µl PGEMT-T vector (50 ng) 1 µl 1 µl T4 DNA ligase 1 µl 1 µl PCR product 3 µl - Control insert DNA - 2 µl Deionized water - 1 µl

h). Transformation of plasmid

For transformation, DH5α Z- competent E.Coli cells (Zymo Research) at -80 °C were taken out and thawed on ice. 50μl of thawed competent cells were added to the 3μl of each ligation mixtures in 1.5 ml sterile Eppendorf tubes and mixed by tapping, the mixtures were incubated on ice for 30 minutes. Later 125μl of antibiotic free LB medium was added to the cell-plasmid mixture and incubated 30-45 minute at 37°C with gentle shaking 300 rpm. Afterwards 100μl of the mixture containing bacteria was spread onto pre-warmed (37°C) culture plates containing ampicillin and incubated at 37°C for overnight for colonies to grow.

A single colony from the culture plate was picked and inoculated in a 5ml LB medium containing ampicillin. Medium containing the bacterial colony were grown over night at 37°C and on a shaker (200rpm).

i). Plasmid isolation and purification (Miniprep. Protocol)

For purify and isolate plasmid from E-coli bacteria Nucleobond Xtra mini/ midi kit was used. 2ml of LB medium containing ampicillin was transferred to 2ml Eppendorf tube, cells were

Materials and Methods

pelleted by centrifuging (Eppendorf 5804R) at maximum speed for 1min at 4°C, supernatant was discarded. Pelleted bacteria was re-suspended completely in 300μl of re-suspension buffer (P1) by vortex, later 300μl of P2 was added, afterward other 300μl of P3 re-suspension buffer was added and mixed by inverted several times. The reaction was centrifuged at maximum speed for 20 minute at 4°C. Supernatant was transferred to new Eppendorf tube and precipitated by using an equal amount of Isopropanol, collecting pellet containing plasmid DNA was achieved after centrifugation step for 30 minute at 12.000rpm at 4°C and discarding the supernatant. At RT, DNA pellet was rinsed two times with 70% ethanol, in between centrifugation at 12.000rpm for 10 minutes at 4°C. Ethanol was discarded and the DNA pellet was allowed to dry at RT and suspended in RNase free water. Isolated plasmid was stored at -20°C overnight.

j). Restriction of the plasmids

To choose appropriate plasmids for linearization, Plasmids containing the desired insert were digested by using the appropriate restriction enzymes (Table. 2.1.3) (Sac II was used for HIF2 α and DLK-1 RNA probes, PST I was for VEGF RNA probe preparation). Restriction digest reaction was prepared as described below.

Reagent Quantity 10XBuffer 3μl Restriction enzyme 0.5μl DNA plasmid 5 μg RNase free water To 30μl

Mixture was incubated in Thermomixer at 37°C for 2-4 hours, and then stored at -20°C overnight. To confirm that the plasmid cDNA is cut properly, 2µL of linearized DNA of each sample with 3 µL 5x loading buffer and 8µL water were run in 1.5% agarose gel at 120V for ~ 1 hour.

k). Plasmid purification by Nucleospin and PCR clean up

Materials and Methods

DNA Plasmids were purified according to NucleoSpin Gel PCR clean up kit. By adding RNase free water to the linearized plasmid, subsequent the double amount of NTI buffer was added and loaded onto provided column and centrifuged for 30 seconds at 11.000g the flow- through was decanted. Afterward washing twice with NT3 buffer was done and followed by centrifugation at 12.800rpm for 30 seconds. Following discarding flow through, the column was transferred into new sterile Eppendorf tube where NE buffer was added and incubated for 10 minutes at RT. Eventually, DNA probe template was eluted after centrifugation at 12.800rpm 1minutes and stored in -20°C overnight.

l). In vitro transcription

In Situ RNA probes were transcribed from linearized DNA plasmids as described below, T7 or SP6 RNA-polymerases were used to in vitro transcribe the sequences and making sense, antisense probes according to the orientation of the insert; opposite to the mRNA sequences makes an antisense RNA that is complementary to the mRNA.

Reagent Volume DEPC-H2O 7.5μl Transcription buffer 2μl DIG RNA labeling mix 2μl RNase inhibitor 0.5μl RNA polymerase (SP6, T7) 2μl Digested DNA probe 6μl

After 2-hour incubation at 37°C, 1μl of 10 mg/ ml t-RNA and 2μl of RNase free DNase I were added to in vitro transcription reaction for DNA templates degradation into single nucleotides, and incubated again for 15 minute at 37°C. In Situ RNA probes were purified using the Quick spin column, the columns were placed into sterile Eppendorf tubes and transcribed samples were loaded into columns and centrifuged at 3.800rpm for 4 minutes. Finally, in situ RNA probes were stored at -20°C for further ISH processing.

m). In Situ Hybridization (ISH)

Materials and Methods

10μm thick cryo-sections were dried at RT for 30 minute and In Situ Hybridization was performed by using DIG- labeled RNA probes. ISH was performed in RNase free conditions and all the solutions for ISH were prepared using DEPC water. Frozen DIG labelling RNA probes were thawed on ice and diluted with Tris- EDTA buffer at one-tenth ratio, 1.5μl of each diluted probes were added in 150μl of hybridization buffer and heat inactivated at 70°C for 10 minutes in thermomixer instrument. Hybridization buffer containing probes were added onto slides that covered with sterile coverslip, placed in humidified chamber with box buffer and incubated in hybridize incubator at 68°C overnight. In this work, I used variety of RNA probes in order to localize SA specific tissues and to detect the pattern of candidate mRNA expression. The used RNA antisense probes are mouse DLK-1, mouse HIF2α and mouse VEGF were carried out as the previous section. In addition, mouse DBH (Tiveron et al., 1996), mouse Phox2b (Pattyn et al., 1997), mouse MASH-1 (Guillemot and Joyner, 1993), mouse NF68 (Huber et al., 2002), mouse Sox10, mouse TH (Zhou et al., 1995) and mouse PNMT (Cole et al., 1995), DBH probe was used as a positive control for each specimen . One day later, Post hybridization washes were performed with immersing the cuvette containing slides three times in wash buffer at 70°C in water bath for 30 minute each. Further two washing with 1X MABT for 30 minute at RT to avoid nonspecific hybridization and high background. Sections were blocked with blocking reagent (1.2ml lamb serum: 4.8ml MABT), in case IHC follows ISH experiment; hoarse serum was used as a blocking reagent. Afterwards sections were incubated with sheep Anti-Digoxigenin-AP conjugated to alkaline phosphatase diluted in blocking reagent at 1:1500, to detect Digoxigenin- labeled RNA at RT overnight. On the third day, slides were washed in 1x MABT buffer at RT, then three time in filtered AP-buffer for 7 minutes for each. To detect the DIG-labeled RNA probes; 15μl of Nitro-blue tetrazolium chloride in combination with 5-bromo-4-chloro-3’-indolyphosphate p-toluidine (NBT/BCIP) substrate was added to 1.5 ml filtered AP-buffer, 135μl of coloring solution was used on each slide overnight. After 24 hour, slides were washed in PBS 4 times for ~ 1hour, then mounted with Aquatex and examined by bright field (Zeiss) microscope.

2.2.6 Combined In Situ Hybridization and immunohistochemistry

Materials and Methods

For simultaneous detection of mRNA sequences and protein products in the same tissue section, I have performed a combination of In Situ Hybridization (ISH) and immunohistochemistry (IHC) experiments. ISH was done as described previously except in some cases; when I used anti sheep TH antibody in IHC, the sections were blocked with heat inactivated normal horse serum (1.2ml horse serum: 4.8ml MABT) instead of the lamb serum. The other steps were achieved as described before. After 24hours of colour reaction slides were washed in PBS 4 times for 10 minutes each. Then IHC was performed starting with treating the slides with hydrogen peroxide, followed by PBS washes. The remaining the steps were described earlier.

2.2.7 Statistical analysis and procedures Sections used for counting covered the entire superior cervical ganglion (SCG) and adrenal medulla area, starting with the first appearance of DBH positive cells in those areas, extending to the most caudal parts. Every tenth section was analyzed for measuring the intensity of average area using the image J program. The data are expressed as means ± standard error of the mean SEM. Two-group analysis was assessed using Student’s t-test. Values of p<0.05 were considered as statistically significant. All statistical analyses were performed using the GraphPad Prism6 software (GraphPad Software Inc.)

Results

3. Results

3.1 Spatiotemporal pattern of HIF-2α and DLK-1 mRNA during SA development

In order to determine the spatiotemporal expression pattern of HIF-2α and DLK-1 mRNA, In Situ Hybridization was performed for adjacent tissue sections of wild–type mouse embryos (WT) aged between embryonic 9.5 and 18.5 day. a). HIF-2α mRNA expression during SA development HIF-2α mRNA is known to have a restricted expression pattern in tissues and organs during embryogenesis (Tian et al., 1997; Wiesener et al., 2003). To determine the precise in vivo spatiotemporal expression pattern of HIF-2α mRNA in developing sympathetic ganglia and adrenal chromaffin medullary cells In Situ Hybridization was carried out. As shown in (Fig.7) at E9.5 the first Sox10-positive neural crest cells have assembled at the dorsal aorta (Fig 7- A, B) and some of them have initiated the expression of Phox2b (Fig 7- C, D). These cells do not express HIF-2α yet (Fig 7- G, H). By E10.5 the primordia of sympathetic ganglia have formed at the dorsal aorta and they express HIF-2α mRNA at high levels (Fig 8- D). Most of the HIF-2α positive cells are also TH-immunoreactive (Fig 8- E). Later in development the HIF-2α expression is downregulated in sympathetic ganglia and becomes restricted to a small subpopulation of ganglionic cells (Fig 11- I. 12-C, E). In developing adrenal chromaffin cells, HIF-2α mRNA expression is detectable by E11.5 (Fig 10- C), when the first chromaffin cell progenitors have invaded the adrenal anlage. Its expression continues at least until embryonic day 13.5, as seen by ISH (Fig 13- D). After this age, we could not detect a strong HIF-2α ISH signal in TH-immunoreactive cells of the adrenal medulla (Fig 16- B, D).

Results

E9.5 Wild type mice

Fig.7. DLK-1 and HIF-2α expression at the dorsal aorta of E9.5 mouse embryos. Transverse adjacent sections of E9.5 mouse embryos were analyzed for DLK-1 and HIF-2α mRNA expression by In Situ Hybridization. Neither DLK-1 (E, F) nor HIF-2α (G, H) could be observed in the few neural crest derived cells at the dorsal aorta. These cells are positive for Sox10 (A, B) and a small sub-population expresses Phox2b (C, D) (red arrows) in near adjacent sections. So, somite; NT, neural tube; da, dorsal aorta.

Results

E 10.5 Sympathetic ganglion

Fig. 8. Expression of DLK-1 and HIF-2α mRNA in developing sympathetic ganglia. At E10.5 DLK-1 (B) and HIF-2α (D) are expressed in the developing sympathetic ganglia that were identified by Sox10 ISH (A) (red arrow). (C, E) Adjacent sections were analyzed for DLK-1 and HIF-2α mRNA expression by ISH (blue) and for TH protein (red) by immunohistochemistry. The insert photos in (C, E) show a higher magnification of the sympathetic ganglion. da, dorsal aorta; sg, sympathetic ganglion.

In contrast, in the extra-adrenal chromaffin cells of the Organ of Zuckerkandl HIF-2α mRNA, appears at E11.5 (Fig 11- I, J) and increases during development (Fig 14- D). HIF-2α expression is maintained in the Organ of Zuckerkandl at high levels until E16.5 (Fig 17- C). At E18.5, briefly before birth, the expression level of HIF-2α is declines to low levels in the Organ of Zuckerkandl (Fig 19- C).

Results

E10.5 Adrenal gland

Fig. 9. DLK-1 mRNA expression in the developing adrenal gland: The expression of DLK-1 (D) was compared with that of Sox10 (A), Phox2b (B) and SF-1 (C) as a marker of presumptive adrenal cortical cells (ag, red arrow) by ISH on transverse cryo-sections of E10.5 wild type mouse embryos in near adjacent section. At this stage DLK-1 (D) positive cells were detected in the area of the developing adrenal cortex (ag) (red arrow). Note that the Sox10 and Phox2b positive cells of the SA (A) lineage have not yet invaded the adrenocortical anlage. da, dorsal aorta; ag, adrenal gland; go, gonad; sg, sympathetic ganglia. Scale bar 100 µm.

Together my findings show that HIF-2α is transiently expressed at early stages of sympathetic ganglion development, while adrenal and in particular extra-adrenal chromaffin cells maintain HIF-2α expression for a much longer period of time.

Results

E11.5 Adrenal gland

Fig.10. DLK-1 and HIF-2α mRNA expression in the developing adrenal gland. Transverse adjacent sections of E11.5 mouse embryos were hybridized with TH, DLK- 1 and HIF-2α antisense probes. At this developmental stage both DLK-1(B) and HIF-2α (C) signals are detectable in developing adrenal medullary cells that are positive for TH mRNA expression ( the red demarcated area) (A). D, E: Neighboring sections were analyzed for the expression of DLK-1 and HIF-2α mRNA (blue) by ISH and for TH (red) by IHC; most of the adrenal medullary cells that express DLK-1 and HIF-2α co- express TH protein. da, dorsal aorta; sg, sympathetic ganglion.

Results

E11.5 Organ of Zuckerkandel OZ

Fig.11. DLK-1 and HIF-2α mRNA expression in the developing Organ of Zuckerkandl at E11.5. DLK-1 (E, F) and HIF-2α (I, J) mRNAs are expressed in extra- adrenal chromaffin cells (OZ) that were detected by TH (A, B) and Phox2b (C, D). At this developmental stage, both mRNAs are only detectable in few scattered cells within sympathetic ganglia (red demarcated area (I). (G, H) DLK1-ISH (blue) followed by IHC against TH (red), most of the DLK-1 positive extra- adrenal chromaffin cells are positive for TH. da, dorsal aorta; sg, sympathetic ganglion; OZ, organ of Zuckerkandl.

Results

E13.5 Superior Cervical Ganglion

Fig.12. DLK-1 and HIF-2α mRNA expression in the developing superior cervical ganglion. By embryonic day 13.5 DLK-1 (B) and HIF-2α (C) mRNAs are only faintly expressed in the developing SCG (red demarcated area), which was identified by Phox2b– ISH in a parallel section (A). D, E: ISH for DLK-1 and HIF-2α mRNA (blue) followed by IHC for TH (red) shows that DLK-1 and HIF-2α expression can only be detected in very few cells within the ganglion.

b). In Situ Hybridization analysis of DLK-1 mRNA expression in sympatho- adrenal cells In parallel to the HIF-2α mRNA expression analysis we examined the spatiotemporal expression pattern of DLK-1, which has been shown be regulated by hypoxia (Kim et al., 2009) and is known to be widely expressed during mouse embryogenesis (Falix et al., 2013). Using ISH, we could visualize DLK-1 mRNA expressing cells in the area of primary sympathetic ganglia at E10.5 in wild type mouse embryo (Fig 8- B). The majority of DLK-1 mRNA expression cells co-express TH as shown in (Fig 8- C). At E9.5 DLK-1 expression could not be detected in the first few neural crest derived cells that have aggregated at the dorsal aorta by this developmental stage. (Fig 7- E, F).

Results

From E11.5 onwards DLK-1 expression is downregulated in sympathetic cells (Fig 11- E, G. 12-B. 15-B), although at E18.5 very few scattered DLK-1 expression cells could be observed in the suprarenal ganglia (Fig 18- B, D). In the developing adrenal gland, we could observe DLK-1 expression from E10.5 onwards. At this developmental stage the area of DLK-1 expression appeared to correspond to the SF-1- positive area that marks the adrenal cortex (Fig 9- C, D). Then, from E11.5 onwards, its expression becomes increasingly restricted to the adrenal medulla. The expression of DLK-1 is maintained in the adrenal medulla throughout embryonic development (Fig10- B. 13- C. 16- A. 18- B).

E13.5 Adrenal gland

Fig.13. ISH analysis of DLK-1 and HIF-2α mRNA expression in the developing adrenal gland. At E13.5, DLK-1 (C) and HIF-2α (D) mRNAs are expressed in the developing adrenal medullary cells, which is identified by TH (A) and Phox2b (B) mRNA expression using ISH. da, dorsal aorta; sg, sympathetic ganglion; AG, adrenal gland.

Results

E13.5 Organ of Zuckerkandl

Fig.14. DLK-1 and HIF-2α mRNA expression in the Organ of Zuckerkandl. In E13.5 mouse embryos, DLK-1 (B) and HIF-2α (D) mRNAs are expressed in area of the OZ. In nearby sympathetic ganglia only a few scattered cells express HIF-2α and DLK-1 (but not in the sympathetic neurons that are positive for TH signals(A) (red arrow). (C, E): most of the extra- adrenal chromaffin cells that express DLK-1 and HIF-2α (blue) are co-localized with TH protein (red). da, dorsal aorta; sg, sympathetic ganglion.

High levels of the DLK-1 mRNA expression were observed in the area of the Organ of Zuckerkandl (OZ) from embryonic day 11.5 onwards at least until the end of the fetal period (Fig 11-E, F. 14- B, 17-B, 19- B).

Results

E16.5 Superior Cervical Ganglion

Fig.15. Expression of DLK-1 and HIF-2α mRNA in the developing superior cervical ganglion (SCG). Transverse neighboring sections of E16.5 mouse embryos hybridized with TH, DLK-1 and HIF-2α mRNA probe, DLK1 (B) and HIF-2α (C) mRNAs are downregulated in the developing SCG (red demarcated area). TH mRNA expression (A) shows the position of the SCG in a near adjacent section.

E16.5 Adrenal gland

Fig.16. ISH on transverse cryo- sections of the developing adrenal gland. (A) Strong DLK-1 expression was detected in adrenal medullary cells of E16.5 mouse embryo, while no clear HIF-2α ISH signal was detectable (red demarcated area) (B). C, D: ISH for DLK-1 and HIF-2α mRNA (blue) followed by IHC for TH (red) show that most of the TH positive adrenal medullary cells are also positive for DLK-1. HIF-2α however is only expressed in a few scattered cells of the suprarenal ganglion.

Results

E16.5 Organ of Zuckerkandl

Fig. 17. DLK-1 and HIF-2α mRNA expression in the developing organ of Zuckerkandl (E16.5 day). ISH shows diffuse positive DLK-1 (B) and HIF-2α (C) staining at the OZ area that localized by TH staining (A) (red demarcated area). da, dorsal aorta; OZ, Organ of Zuckerkandl.

E18.5 Adrenal gland

Fig.18. Expression pattern of DLK-1 and HIF-2α mRNA in the developing adrenal gland of mouse embryos. By E18.5, adrenal medullary and suprarenal ganglionic were detected by ISH for DBH mRNA (A); DLK-1 is highly expressed in the adrenal medulla (B) but in the suprarenal ganglia, restricted to a few cells. HIF-2α mRNA is very faint in the adrenal medulla as shown by ISH in an adjacent section (the red demarcated area) (C). D, E: ISH for DLK-1 and HIF-2α mRNA (blue) followed by IHC for TH protein (red), DLK- 1mRNA expression is largely co- localized with TH protein in the adrenal medulla. Srg, suprarenal ganglia.

Results

E18.5 Organ of Zuckerkandl

Fig.19. DLK-1 and HIF-2α mRNA expression in developing extra- adrenal chromaffin cells (OZ). ISH on cryo-sections of the E18.5 Organ of Zuckerkandl (OZ). DLK-1 mRNA is highly expressed in the OZ (B), while HIF-2α mRNA is only weakly expressed (demarcated area) (C). TH ISH was used to detect the OZ in a neighboring section (A). D, E: ISH for DLK-1 and HIF-2α mRNA (blue) followed by IHC for TH protein (red), DLK-1 is largely co- localized with TH protein in OZ. da, dorsal aorta.

c). HIF-2α is downstream of Phox2b: Phox2b is a master regulator of the development of sympatho-adrenal cells and it is upstream of all other known components of the transcription factor network that specifies these cells ((For review see Huber, 2006; Rohrer, 2011). The expression of MASH-1 is initiated independently of Phox2b in SA cells at the earliest stages of their development immediatly after the cells have aggregated at the dorsal aorta. To determine, whether the expression of HIF-2α mRNA is downstream of Phox2b and MASH1, I have examined HIF-2α mRNA expression in E11.5 Phox2b LacZ/ LacZ (Pattyn et al., 1999) and MASH 1 KO mice (Guillemot et al., 1993).

Results

The In Situ Hybridization results reveal that HIF-2α mRNA (Fig 20) is lacking at the sites of developing sympathetic ganglia primordia, that were identified by LacZ staining in near adjacent sections (not shown). In contrast, there is no dramatic change in HIF-2α mRNA expression between sympathetic ganglia of MASH1 KO mouse embryos and control littermates (Fig 21).

E11.5 Sympathetic ganglion Control

mice mice Phox2b LacZ/ LacZ LacZ Phox2b LacZ/

Fig.20. HIF-2α mRNA expression is downstream of Phox2b. Transverse adjacent sections of E11.5 Phox2b deficient and control mouse embryos hybridized with HIF-2α antisense probe. The HIF-2α mRNA expression is completely abolished in the sympathetic ganglion of Phox2b deficient mouse embryos (red demarcated area C, D) as compared to control mouse embryos (A, B). The area of the sympathetic ganglion was determined by LacZ staining on near adjacent sections. da, dorsal aorta; sg, sympathetic ganglion.

Results

Control MASH1 KO mice ganglion E11.5 Sympathetic

Fig.21. Expression of HIF-2α mRNA in MASH1 deficient mice. ISH for HIF-2α mRNA expression in developing sympathetic ganglia of E11.5 MASH1 deficient and control mouse embryos. HIF-2α mRNA expression appeared unaltered in sympathetic ganglion primordia of MASH1 KO mouse embryos (B) as compared to control littermates (A). The inserted images show a higher magnification of HIF-2α positive sympathetic ganglia. sg, sympathetic ganglion; da, dorsal aorta.

3.2 Phenotypical abnormality in the sympathetic ganglion and the adrenal medulla of VHL deficient mouse embryos a). Decreased number of SA cells in VHL-deficient mouse embryos The von Hippel-Lindau tumor suppressor is best known for its role in the oxygen dependent degradation of HIFs. In humans germline and somatic mutations of VHL are associated with various tumors, including pheochromocytoma. VHL-associated tumorigeneses may be HIF- dependent or HIF-independent (Li and Kim, 2011). In vitro studies have pointed to putative HIF-independent developmental functions of VHL in the sympatho-adrenal lineage, which included the regulation of cell death upon NGF-deprivation (Lee et al., 2005) . To study the overall functions of VHL during the development of the SA lineage, we crossed VHL floxed mice (VHLflox\flox) (Haase et al., 2001) and DBHCre transgenic mice (Lemberger et al., 2007). In these mice the VHL alleles are eliminated by cre–recombinase in catecholaminergic cells after they have initiated the expression of DBH (around E10.5 in SA cells). The mutant embryos were named VHLDBHCre mice. The loss of VHL-function is

Results

expected to result in a constitutive activation of its main targets the hypoxia-inducible factors. Thus, developmental defects observed in SA-cells of these embryos will represent HIF- dependent as well as HIF-independent functions of VHL. At embryonic day 11.5 the neural crest derived sympathetic neuron progenitors that have aggregated at the dorsal aorta seem to be normal in VHLDBHCre mouse embryos (Fig 22). They express Sox10 and early SA markers like Phox2b, MASH1, the neuronal marker NF68, the noradrenergic marker (TH) and also HIF-2α and DLK-1.

Control VHLDBHcre

E11.5 ganglion Sympathetic

Results

Fig.22. Conditional VHL inactivation has no a significant effect on the early development of SA cells. ISH for Sox10,

specific SA markers (Phox2b, MASH1, NF68, TH) and for DLK-1 and HIF-2α in adjacent sections of E11.5 control and VHLDBHCre mouse embryos showing no obvious changes in SA cell development of VHLDBHCre ( H, I, J, K, L, M, N) mouse embryos as compared with control littermates (A, B, C, D, E, F, G).

In contrast, ISH for DBH in the developing adrenal medulla and the superior cervical ganglia (SCG) of E16.5 mouse embryos reveal a reduction in the number of the catecholaminergic cells in VHLDBHCre mouse embryos (Fig 23- B, D) compared to control animals (Fig 23- A, C). However, the size of the sympathetic ganglion and adrenal medulla of VHLDBHCre mouse embryos appeared normal (Fig. 23 B,D), indicating a loss of DBH rather than a loss of cells at this developmental stage.

Results

Control VHLDBHCre Adrenal gland

Sympathetic ganglion ganglion Sympathetic

Fig.23. Decrease of the number of DBH-positive cells in the adrenal medulla and sympathetic ganglia of VHLDBHCre mouse embryos. ISH for DBH on transverse sections of E16.5 control (A, C) and VHLDBHcre mice (B,D), at level of the adrenal gland (A,B) and a sympathetic ganglion (C,D). srg, suprarenal ganglion.

Furthermore, we observed a marked decrease of the number of DBH positive cells in E18.5 VHL deficient sympathetic ganglia throughout all axial levels: lumbar, thoracic, stellate (data not shown), and superior cervical ganglia (SCG) as compared with control animals (Fig 24- A, F). At this age in addition the overall size of the sympathetic ganglia appeared to be reduced (Fig 24). A quantitative analysis revealed a significant reduction of the size of the areas of DBH expression (reduced to 5 % as compared to control values) and TH expression (reduced to 23 % as compared to control values) in the SCG of E18.5 VHLDBHCre mouse embryos in (Fig 24- K, L). In addition, the expression areas of other SA specific markers, like

Results

the transcription factor Phox2b and the neuronal marker NF68, appeared to be reduced to approximately the same extent (Fig 24- H, J), when compared with controls (Fig 24- C, E).

In Situ Hybridization for Sox10, a marker for neural crest and glial cells, showed no obvious difference between E18.5 VHLDBHCre and control mice in the areas of sympathetic ganglia (Fig 24- D, I) and the adrenal medulla (Fig 26- D, H). Together these findings indicate a loss of cells and/ or a loss of sympatho- adrenal markers in the sympathetic ganglia and the adrenal medulla of VHLDBHCre mouse embryos.

Control VHLDBHcre

E18.5 Superior Cervical Ganglion E18.5 Superior Cervical

Results

K L

8 4 C o n tro l V H L K O 6 3

4 2

T H + C e lls * DBH + Cells 2 1

* mean avarage area of SCG 0 mean avarage0 area of SCG Control VHL KO Control VHL KO

Fig.24. Decrease of the number of catecholaminergic cells in the sympathetic ganglia of E18.5 VHL deficient mice. Transverse neighboring cryo-sections of control and VHLDBHCre mouse embryos. The size of the SCG as seen by ISH of DBH (A, F), TH (B, G), Phox2b (C, H), Sox10 (D, I) and NF68 (E, J) mRNA expression, is reduced in the VHLDBHCre embryos (F, G, H, I, J) as compared to control mouse embryos (A, B, C, D, E). K, L: Quantification analysis of the DBH (K) and TH (L) positive area in SCG of VHL KO mice shows a significant reduction of the size of the area of DBH and TH expression. Data are presented as Mean± SEM. Every 10th section of the SCG from three embryos was quantified per genotype. P values derived from Students t-test are p<0.05.

Results

b). Chromaffin cells in VHLDBHCre mice show a massive reduction of PNMT expression In the adrenal medulla of VHL-deficient mice the area of DBH (Fig 25- A, D, G), TH (Fig 25- C, F, I) and Phox2b (Fig 26- B, F, I) expression was reduced in comparison to control litter mates to a roughly similar extent (44%+/- SEM, 39%+/-SEM, 36 %+-SEM, respectively). No obvious changes of the expression of neural crest marker Sox10 and the early transient SA marker MASH1was observed in the adrenal medulla of VHL deficient mouse embryos (Fig 26- G, H) as compared to control embryos (Fig 26- C, D). We next analyzed the area of Phenyl ethanolamine N methyl transferase (PNMT) expression, in the adrenal medulla of E18.5 VHL deficient mouse embryo and wildtype littermates. Interestingly, we observed that the size of the area of PNMT expression is reduced in the adrenal medulla of VHLDBHCre mice to a much greater extent (5% of control values) than that of the TH or DBH expression (Fig 25- B, E, H). This suggests that the adrenergic differentiation is specifically impaired in chromaffin cells of VHL-deficient mouse embryos or that the adrenergic subpopulation is specifically lost.

Results

E18.5 Adrenal gland Control

DBHCre VHL

G H

6 8 C o n tro l V H L K O 6 4 ** 4

2 DBH + Cells PNMT + Cells 2

*** mean avarage area of AG 0 mean avarage0 area of AG Control VHL KO Control VHL KO

* T H + C e lls 2 Fig.25. Reduction of catecholaminergic markers expression in the adrenal gland mean avarage0 area of AG DBHCre Control VHL KO of E18.5 VHL mouse embryos. . ISH on adjacent transverse sections of E18.5 mouse embryos shows a reduction of the number of chromaffin cells

Results

expressing DBH (A, D, G) and TH (C, F, I) in VHLDBHCre mice (D, F) in comparison to control littermates (A, C). The expression of the adrenergic marker enzyme PNMT is virtually abolished in the adrenal gland of VHLDBHCr mouse embryos (E) as compared to control littermates (B). G, H, I: Data are presented as mean± SEM. P values derived from Students t-test are p<0.05. n= three per genotype.

Results

Control VHLDBHCre

E18.5 Adrenal gland

I VHL deficient mice. ISH using antisense 4 C o n tro l probes for DBH (A,E) Phox2b (B, F), V H L K O MASH1 (C, G) and Sox10 (D, H) mRNA 3 on cryo-sections of the adrenal gland of VHLDBHCre mouse embryos (E,F, G, H) 2 *** and control littermates (A, B, C, D). (I) Quantitation analysis reveals a significant 1 Phox2b + Cells reduction in the size of the of Phox2b-

mean avarage area of AG positive area in the adrenal gland of E18.5 0 Control VHL KO VHL deficient mouse embryos as compared to wildtype littermates, data are Fig.26. Decrease of the number of the presented as mean± SEM. P values derived chromaffin cells expressing SA markers from student’s t-test p<0.05. srg, in the developing adrenal gland of E18.5 suprarenal ganglion.

Results

c). Expression of DLK-1 and HIF-2α mRNA in the sympatho-adrenal cells of VHLDBHCre mice: VHL is required for the degradation of HIF-α under normoxic conditions. Thus, the inactivation of VHL function in the SA lineage should result in increased levels of HIF-α protein. As expected HIF-1α immunoreactivity was not detected in the SA cells of wildtype mice, but was clearly visible in SA cells of VHL-deficient mouse embryos. Unfortunately, no reliable antibody for HIF-2α was available. We further tested, whether the expression of HIF-2α mRNA and DLK-1 mRNA, which is known to be regulated by hypoxia (Kaelin and Ratcliffe, 2008; Kim et al., 2009; Tian et al., 1997), is altered in sympathetic ganglia of E18.5 VHL deficient mice. The expression of DLK-1 and also that of HIF-2α mRNA appeared slightly enhanced in the sympathetic ganglia of VHL-deficient mouse embryos as compared to control littermates (Fig 27- B, F, C, G). No evident alteration of the expression level of HIF-2α and DLK-1 mRNA was observed in the adrenal medulla of VHL deficient mouse embryos (Fig 28- B, F, C, G).

Results

Control VHLDBHCre

E18.5 Superior Cervical Ganglion E18.5 Superior Cervical

Fig.27. Hypoxia regulated genes expression in the SCG VHL deficient mice. No evident changes in DLK-1 (B, F) and HIF-2α (C, G) mRNA expression in E18.5 SCG of VHLDBHCre mice (F, G) in contrast to control (B, C). While the expression of VEGF mRNA enhanced in VHLDBHCre (red demarcated area) (H) as compare with control (D).

Results

d). VEGF mRNA expression is enhanced in adrenal medulla and sympathetic ganglia of VHL KO mice: Vascular endothelial growth factor (VEGF) is one of the main targets of HIFs (Carroll and Ashcroft, 2006; Forsythe et al., 1996). An overexpression of vascular endothelial growth factor has been implicated in some highly vascularized VHL associated tumors, in which VEGF is responsible for angiogenesis (Gnarra et al., 1996; Iliopoulos et al., 1996). As expected, loss of VHL gene leads to an enhancement in the expression of VEGF mRNA in E18.5 chromaffin cells (Fig 28- D, H) and sympathetic ganglia (Fig 27- D, H) in comparison to control littermates as revealed by In Situ Hybridization.

E18.5 Adrenal gland

Control

DBHCre VHL

Fig.28. Expression of DLK-1 and HIF-2α mRNA in the adrenal gland of VHL deficient mice. ISH on neighboring sections shows reduced numbers of the DBH expressing chromaffin cells in E18.5 VHLDBHCre embryos (E) as compared to control littermates (A). No evident change between DLK-1 (B, F) and HIF-2α (C, G) mRNA expression in VHLDBHCre mice (F, G) and control littermates (B, C), The VEGF mRNA is enhanced in adrenal medullary chromaffin cells of VHL deficient mouse embryos (read demarcated area) (H) comparing with control (D).

Results

e). No cell death in VHLDBHCre sympathetic ganglia at E18.5 embryos The gene expression analysis has revealed a decrease of the numbers of catecholaminergic cells in the VHL deficient SA cell lineage at late embryonic ages (E16,5- E18,5). To investigate whether this reduction is caused by an enhancement of cell death TUNEL assay and double immunofluorescence staining for TH and cleaved caspase-3 were performed to detect apoptotic cells However, neither by TUNEL assay (not shown) nor by caspase-3 staining I could detect apoptotic cells in the adrenal gland (not shown) or in sympathetic ganglia of E18.5 VHL deficient mouse embryos (fig 29- D) and control littermates (Fig 29- B). The developing gut within the same sections was used as a positive control for activated Caspase-3 – immunostaining. (Fig 29- E, F). f). No change in (Phospho-Histone H3 (ser10) PH3 labeled cells in VHLDBHCre mice was detected: We subsequently investigated, whether impaired proliferation may be responsible for the reduction of the numbers of catecholaminergic cells of the SA-lineage. We employed the mitotic marker Phospho-Histone H3 (PH3) and performed TH/PH3 immunofluorescence double staining on sections of E18.5 VHL-deficient mouse embryos and control littermates. However, at this age only very few cells are proliferating in sympathetic ganglia (Fig 30). I could not see any apparent differences between the SCG of VHL KO and control embryos. Thus, earlier stages (E11.5, E13.5) have to be employed for a proliferation study. Unfortunately, this was not possible within the time frame of this thesis, since the required embryonic material was not available.

Results

E18.5 Superior Cervical Ganglion

Control

DBHCre VHL

Positive control of E18.5 VHL ( gut section)

Fig.29. Caspase-3 immunoreactivity could not be detected in sympathetic ganglia of E18.5 VHL deficient mouse embryos. Double immunofluorescence for TH (red) (A, C) and cleaved caspase- 3 (green) (B, D) in neighboring cryo- sections of E18.5 VHL deficient and control mice. No caspase positive cell (used as apoptotic marker) could be seen in the SCG of VHL deficient (D) and control animals (B) (white demarcated area). E, F: Gut transverse sections of an E18.5 VHL deficient embryo was used as a positive control for caspase- 3 staining (red arrows).

Results

E18.5 Superior Cervical Ganglion Control

DBHCre VHL

Fig.30. Double immunofluorescence staining for TH (red) and Phospho-Histone H3 (PH3, green) in E18.5 SCG VHL deficient and control embryos. Virtually no PH3 positive cells can be detected in the SCG ate this age in control (B) and VHLDBHCre (D) animals

Discussion and conclusion

4. Discussion and conclusion Sympathetic neurons of the autonomic nervous system and chromaffin cells of the adrenal medulla are both derived from the SA-lineage, a sub-lineage of the neural crest. The diversification of SA cell into sympathetic neurons and chromaffin cells provides an intriguing model system to understand principle developmental mechanisms underlying neuronal and endocrine differentiation. Both cell types share a similar set of transcription factors during their early development, including the pro-neural transcription factors MASH1 and Phox2b. Yet, the specific signals that promote the differentiation of SA cells into endocrine cells are not well understood (for review see Huber, 2006, 2014). In some aspects chromaffin cells resemble immature SA cells, as in contrast to sympathetic neurons they maintain the capacity to proliferate and to differentiate into neuron-like cells throughout life (Tischler et al., 1989; Unsicker, 1981). A comprehensive understanding of the development of the SA lineage is also of clinical interest as these cells are quite frequently the source of tumors, which derive either from developing SA cells or from adult chromaffin tissue. In the present work I analyzed the spatiotemporal expression pattern of HIF-2α and DLK-1, which have been linked to tumor development in various cells and I studied the role of VHL, which is a key regulator of HIF stability, during normal development of SA cells. Germline mutations of VHL in humans have been associated with the development of tumors in various organs, including the adrenal medulla. Yet, the mechanism underlying VHL associated pheochromocytoma and the role of hypoxia-inducible factors and hypoxia-regulated proteins in this context is not clear.

4.1 Expression of DLK-1 and HIF-2α in the SA lineage and their putative function Both DLK-1 and HIF-2α have been reported to be expressed in developing SA cells (Cooper et al., 1990; Falix et al., 2013; Tian et al., 1998; Van Limpt et al., 2003). HIF-2α is one of the mediators of the cellular response to low oxygen levels and DLK-1 has been reported to be downstream of HIFs. The impact of DLK-1 and HIF-2α on SA derived tumors has been extensively studied. However, little is known about their function and their exact spatiotemporal expression pattern during normal development of SA cells. DLK-1 mRNA has been reported to be widely expressed in variety of developing tissues. Later in development and throughout live it becomes restricted to specific tissues (Falix et al., 2013; Jensen et al., 1993; Yevtodiyenko and Schmidt, 2006). DLK-1 expression after embryogenesis has been in particular associated with endocrine tissues (Falix et al., 2013; Huber, 2014; Laborda, 2000).

71 Discussion and conclusion

The expression of HIF2α mRNA is restricted to specific tissues, in contrast to the ubiquitously expressed HIF-1α mRNA (Ema et al., 1997; Flamme et al., 1997; Tian et al., 1997). Its spatiotemporal expression pattern in the SA lineage of mouse embryos has so far only been analyzed indirectly by detecting LacZ expression in a mouse line, where HIF-2α was replaced by LacZ (Tian et al., 1998). I show here that DLK-1 and HIF-2α first become detectable in TH positive SA cells of E10.5 mouse embryos. My data further indicate that the expression of both is preceded by Phox2b. Moreover, the analysis of Phox2b deficient mouse embryos revealed that HIF-2α is downstream of Phox2b, while loss of MASH-1 did not affect HIF-2α expression. Both DLK-1 and HIF-2α are downregulated at E11.5 in sympathetic ganglia, where they become restricted to a small subpopulation of cells. In contrast, in chromaffin cells the expression of both DLk- 1 and HIF-2α is maintained beyond E11.5. HIF-2α expression persists in the adrenal medulla until E13.5 and in the Organ of Zuckerkandl until E16.5. The expression of DLK-1 is still detectable in the adrenal gland of E18.5 mouse embryos, where its expression is maintained throughout life (Jensen et al., 1993).

The spatiotemporal expression pattern of DLK-1 and HIF-2α points to a specific role of these genes for early events in sympathetic neuron differentiation. However, the present data do not suggest a physiological role of HIF-2α for the maintenance of an undifferentiated neural crest state, as in vitro studies on neuroblastoma cells had suggested (Jögi et al., 2002; Pietras et al., 2009). I show that HIF-2α is downstream of Phox2b, the master regulator of SA cell differentiation ( for review see Huber, 2006). Thus it is only initiated, when the cells have undergone a first differentiation step from a neural crest cells towards a SA cell. Most of the cells that express HIF-2α and DLK-1 at E10.5 are TH-positive, but some are still TH- negative. Thus DLK-1 and HIF-2α expression probably first appears between the initiation of Phox2b and TH expression. The brief expression period of HIF-2α and DLK-1 in the primary sympathetic chain suggests, that they may be required for the maintenance of an early transient neuroblast- like stage and thus regulate the timing of terminal neuronal differentiation in the SA lineage. This is compatible with in vitro results that show that downregulation of HIF-2α and DLK-1 leads to neuronal differentiation (Begum et al., 2012; Kim et al., 2009; Pietras et al., 2009). The similarity of the spatiotemporal expression pattern of both genes suggests that they act within a similar time frame. Interestingly, it has been shown that DLK-1 is downstream of HIF-1α and HIF-2α (Kim et al., 2009).

72 Discussion and conclusion

The expression of both genes is maintained for a longer period of time in developing chromaffin cells. Thus they may in addition be involved in enabling or promoting the acquisition of endocrine traits in chromaffin cells. It was in fact reported that hypoxia leads to a trans-differentiation of neuroblastoma cells to chromaffin cells, which was associated with the expression of HIF-2α (Hedborg et al., 2003, Hedborg et al., 2010). However, in the case of DLK-1, despite its specific expression in many endocrine tissues, its involvement in endocrine differentiation could not be shown up to date (Falix et al., 2013; Larsen et al., 1996; Tornehave et al., 1996).

HIF-2α is regulated on the protein level by the availability of oxygen, but the restricted expression pattern of its mRNA suggests, that its expression is also regulated on the mRNA level by certain signals. Unfortunately, HIF-2α immunostaining did not produce consistent results to study the expression of HIF-2α on a protein level. It should however be noted that hypoxia is a widespread phenomenon in the developing embryo (for review see Dunwoodie, 2009) up to approximately the age, when SA cells start to differentiate and initiate the expression of HIF-2α. Though the impact of hypoxia and HIfs for the development of certain organs including heart and Placenta (Abbott and Buckalew, 2000; Adelman et al., 2000; Compernolle et al., 2003; Cowden Dahl et al., 2005; Dunwoodie, 2009; Kozak et al., 1997) has been described, little is known on their role in the development and differentiation of neural crest. It has been shown that HIF-1α is required for the migration of neural crest cells (Barriga et al., 2013; Compernolle et al., 2003). Future specific gain and loss of function studies may clarify to which extend hypoxia and hypoxia inducible factors contribute to the differentiation and diversification of neural crest cells (Barriga et al., 2013).

4.2 Role of VHL in SA cells development and disease The VHL gene is known as a tumor suppressor gene and as a regulator of HIF-α degradation under normoxic conditions. Mutations or absence of this gene are associated with a variety of tumors, including clear renal cell carcinoma, hemangioblastomas and pheochromocytoma (Kaelin, 2007; Kaelin and Maher, 1998). In vitro studies on a PC12 cell line have suggested that cells of the SA-lineage show enhanced survival, when VHL expression is downregulated by siRNA (Lee et al., 2005). Thus it was suggested that pVHL is involved in the regulation of ontogenetic cell death within the sympatho-adrenal cell lineage and that this may at least in part be the cellular basis of VHL associated tumor development.

Discussion and conclusion

To study the in vivo function of VHL during SA development I analyzed conditional VHLDBHCre mice that inactivate VHL during the early differentiation of SA cells around E10.5. The presented data indicate that the early development of the SA cells is at least not overtly affected by the absence of the VHL gene. However, it should be noted that at this age the loss of VHL function in the conditional Knockouts that were employed may not have been complete. At later developmental stages I found that the numbers of cells expressing catecholaminergic markers like TH, DBH and Phox2b were reduced in the adrenal gland and sympathetic ganglia. At E16.5 the catecholaminergic cells were scattered within the adrenal medulla and the sympathetic ganglia, which appeared to be of roughly normal size. This may indicate that the cells have not disappeared by this age, but that they have lost catecholaminergic differentiation makers. It should be noted, that the loss of VHL creates a “pseudo- hypoxic” phenotype with enhanced HIF-activity, which has been reported to be associated with the dedifferentiation of cells, including neuroblastoma cells (Edsjö et al., 2007). At E18.5 the sympathetic ganglia and the adrenal medulla of VHL-deficient mouse embryos appeared massively reduced in size, indicating that the cells may have undergone cell death by this age. This is surprising, since the loss of VHL has been rather associated to enhanced survival and tumor development as stated before. However, I could not detect cell death within the sympathetic ganglia or the adrenal gland of VHL-deficient mouse embryos at E18.5 using TUNEL and activated caspase-3 staining. Alternatively, it may also be conceivable that the cells have dedifferentiated towards immature neural crest cells and undergone further migration. Future studies analyzing cell death at earlier stages and the usage of a LacZ Cre-Reporter for the identification of cells that have undergone DBH -Cre mediated recombination will help to shed light on this issue. While SA cells of VHL-deficient mice show clearly enhanced expression of VEGF, one of the best described downstream targets of HIFs (Iliopoulos et al., 1996; Levy et al., 1997), the expression of DLK-1, which has also been reported to be regulated by HIFs (Kim et al., 2009), did not appear to be enhanced. However, it should be noted that in the sympathetic ganglia of E18.5 VHL-deficient mice the percentage of cells expressing DLK-1 appeared indeed increased. Interestingly, chromaffin cells of E18.5 exhibited a massive reduction of PNMT-expression, which was much more pronounced than the loss of DBH and TH expressing cells. This observation suggests that VHL inactivation in DBH positive cells impairs the adrenergic differentiation of chromaffin cells or leads to a specific loss of the adrenergic population. It

Discussion and conclusion

should be noted that PNMT expression has been reported to absent in VHL-associated pheochromocytoma (Eisenhofer et al., 2004; Tischler, 2008). In summary, my current data suggest that complete absence of VHL does not promote the development of pheochromocytoma. Interestingly, based on human mutation phenotype- correlations it was indeed suggested that the complete loss of VHL-function might be incompatible with the generation of pheochromocytoma. It was speculated that absence of VHL leads to very high levels of HIF-2 protein, which may promote cell death rather than enhanced survival (Kaelin, 2005).

References

5. References: Abbott, B.D., and Buckalew, A.R. (2000). Placental defects in ARNT-knockout conceptus correlate with localized decreases in VEGF-R2, Ang-1, and Tie-2. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 219, 526–538.

Acker, T., Diez-Juan, A., Aragones, J., Tjwa, M., Brusselmans, K., Moons, L., Fukumura, D., Moreno- Murciano, M.P., Herbert, J.-M., Burger, A., et al. (2005). Genetic evidence for a tumor suppressor role of HIF-2alpha. Cancer Cell 8, 131–141.

Adelman, D.M., Gertsenstein, M., Nagy, A., Simon, M.C., and Maltepe, E. (2000). Placental cell fates are regulated in vivo by HIF-mediated hypoxia responses. Genes Dev. 14, 3191–3203.

Ahlstrom, J.D., and Erickson, C.A. (2009). The neural crest epithelial-mesenchymal transition in 4D: a tail of ultiple o-obligatory cellular mechanisms. Dev. Camb. Engl. 136, 1801–1812.

Altergott, R., Barbato, A., Lawrence, A., Paloyan, E., Freeark, R.J., and Prinz, R.A. (1985). Spectrum of catecholamine-secreting tumors of the organ of Zuckerkandl. Surgery 98, 1121–1126.

Anderson, D.J. (1993). Molecular control of cell fate in the neural crest: the sympathoadrenal lineage. Annu. Rev. Neurosci. 16, 129–158.

Anderson, D.J., and Axel, R. (1986). A bipotential neuroendocrine precursor whose choice of cell fate is determined by NGF and glucocorticoids. Cell 47, 1079–1090.

Anderson, D.J., Carnahan, J.F., Michelsohn, A., and Patterson, P.H. (1991). Antibody markers identify a common progenitor to sympathetic neurons and chromaffin cells in vivo and reveal the timing of commitment to neuronal differentiation in the sympathoadrenal lineage. J. Neurosci. Off. J. Soc. Neurosci. 11, 3507–3519.

Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y.-H., Credidio, C., and Saint-Jeannet, J.-P. (2003). Sox10 regulates the development of neural crest-derived melanocytes in Xenopus. Dev. Biol. 259, 19–33.

Astuti, D., Latif, F., Dallol, A., Dahia, P.L., Douglas, F., George, E., Sköldberg, F., Husebye, E.S., Eng, C., and Maher, E.R. (2001). Gene mutations in the succinate dehydrogenase subunit SDHB cause susceptibility to familial pheochromocytoma and to familial paraganglioma. Am. J. Hum. Genet. 69, 49–54.

Barriga, E.H., Maxwell, P.H., Reyes, A.E., and Mayor, R. (2013). The hypoxia factor Hif-α otols neural crest chemotaxis and epithelial to mesenchymal transition. J. Cell Biol. 201, 759–776.

Baysal, B.E., Ferrell, R.E., Willett-Brozick, J.E., Lawrence, E.C., Myssiorek, D., Bosch, A., van der Mey, A., Taschner, P.E., Rubinstein, W.S., Myers, E.N., et al. (2000). Mutations in SDHD, a mitochondrial complex II gene, in hereditary paraganglioma. Science 287, 848–851.

Begum, A., Kim, Y., Lin, Q., and Yun, Z. (2012). DLK1, delta-like 1 homolog (Drosophila), regulates tumor cell differentiation in vivo. Cancer Lett. 318, 26–33.

Biju, M.P., Neumann, A.K., Bensinger, S.J., Johnson, R.S., Turka, L.A., and Haase, V.H. (2004). Vhlh gene deletion induces Hif-1-mediated cell death in thymocytes. Mol. Cell. Biol. 24, 9038–9047.

References

Bohn, M.C., Goldstein, M., and Black, I.B. (1981). Role of glucocorticoids in expression of the adrenergic phenotype in rat embryonic adrenal gland. Dev. Biol. 82, 1–10.

Bondurand, N., Kobetz, A., Pingault, V., Lemort, N., Encha-Razavi, F., Couly, G., Goerich, D.E., Wegner, M., Abitbol, M., and Goossens, M. (1998). Expression of the SOX10 gene during human development. FEBS Lett. 432, 168–172.

Brannan, C.I., Perkins, A.S., Vogel, K.S., Ratner, N., Nordlund, M.L., Reid, S.W., Buchberg, A.M., Jenkins, N.A., Parada, L.F., and Copeland, N.G. (1994). Targeted disruption of the neurofibromatosis type-1 gene leads to developmental abnormalities in heart and various neural crest-derived tissues. Genes Dev. 8, 1019–1029.

Britsch, S., Goerich, D.E., Riethmacher, D., Peirano, R.I., Rossner, M., Nave, K.A., Birchmeier, C., and Wegner, M. (2001). The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev. 15, 66–78.

Bryant, J., Farmer, J., Kessler, L.J., Townsend, R.R., and Nathanson, K.L. (2003). Pheochromocytoma: the expanding genetic differential diagnosis. J. Natl. Cancer Inst. 95, 1196–1204.

Burns, A.J., and Le Douarin, N.M. (2001). Enteric nervous system development: analysis of the selective developmental potentialities of vagal and sacral neural crest cells using quail-chick chimeras. Anat. Rec. 262, 16–28.

Carroll, V.A., and Ashcroft, M. (2006). Role of hypoxia-inducible factor (HIF)-1alpha versus HIF-2alpha in the regulation of HIF target genes in response to hypoxia, insulin-like growth factor-I, or loss of von Hippel-Lindau function: implications for targeting the HIF pathway. Cancer Res. 66, 6264–6270.

Cascón, A., Escobar, B., Montero-Conde, C., Rodríguez-Antona, C., Ruiz-Llorente, S., Osorio, A., Mercadillo, F., Letón, R., Campos, J.M., García-Sagredo, J.M., et al. (2007). Loss of the actin regulator HSPC300 results in clear cell renal cell carcinoma protection in Von Hippel-Lindau patients. Hum. Mutat. 28, 613–621.

Chen, F., Kishida, T., Yao, M., Hustad, T., Glavac, D., Dean, M., Gnarra, J.R., Orcutt, M.L., Duh, F.M., and Glenn, G. (1995). Germline mutations in the von Hippel-Lindau disease tumor suppressor gene: correlations with phenotype. Hum. Mutat. 5, 66–75.

Cheung, C.Y. (1989). Direct adrenal medullary catecholamine response to hypoxia in fetal sheep. J. Neurochem. 52, 148–153.

Clifford, S.C., Cockman, M.E., Smallwood, A.C., Mole, D.R., Woodward, E.R., Maxwell, P.H., Ratcliffe, P.J., and Maher, E.R. (2001). Contrasting effects on HIF-1alpha regulation by disease-causing pVHL mutations correlate with patterns of tumourigenesis in von Hippel-Lindau disease. Hum. Mol. Genet. 10, 1029–1038.

Cochard, P., and Paulin, D. (1984). Initial expression of neurofilaments and vimentin in the central and peripheral nervous system of the mouse embryo in vivo. J. Neurosci. Off. J. Soc. Neurosci. 4, 2080–2094.

Cochard, P., Goldstein, M., and Black, I.B. (1978). Ontogenetic appearance and disappearance of tyrosine hydroxylase and catecholamines in the rat embryo. Proc. Natl. Acad. Sci. U. S. A. 75, 2986– 2990.

References

Cockman, M.E., Masson, N., Mole, D.R., Jaakkola, P., Chang, G.W., Clifford, S.C., Maher, E.R., Pugh, C.W., Ratcliffe, P.J., and Maxwell, P.H. (2000). Hypoxia inducible factor-alpha binding and ubiquitylation by the von Hippel-Lindau tumor suppressor protein. J. Biol. Chem. 275, 25733–25741.

Cole, T.J., Blendy, J.A., Monaghan, A.P., Krieglstein, K., Schmid, W., Aguzzi, A., Fantuzzi, G., Hummler, E., Unsicker, K., and Schütz, G. (1995). Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9, 1608– 1621.

Compernolle, V., Brusselmans, K., Franco, D., Moorman, A., Dewerchin, M., Collen, D., and Carmeliet, P. (2003). Cardia bifida, defective heart development and abnormal neural crest migration in embryos lacking hypoxia-inducible factor-1alpha. Cardiovasc. Res. 60, 569–579.

Cooper, M.J., Hutchins, G.M., Cohen, P.S., Helman, L.J., Mennie, R.J., and Israel, M.A. (1990). Human neuroblastoma tumor cell lines correspond to the arrested differentiation of chromaffin adrenal medullary neuroblasts. Cell Growth Differ. Mol. Biol. J. Am. Assoc. Cancer Res. 1, 149–159.

Cordero, D.R., Brugmann, S., Chu, Y., Bajpai, R., Jame, M., and Helms, J.A. (2011). Cranial neural crest cells on the move: their roles in craniofacial development. Am. J. Med. Genet. A. 155A, 270–279.

Corless, C.L., Kibel, A.S., Iliopoulos, O., and Kaelin, W.G. (1997). Immunostaining of the von Hippel- Lindau gene product in normal and neoplastic human tissues. Hum. Pathol. 28, 459–464.

Covello, K.L., Kehler, J., Yu, H., Gordan, J.D., Arsham, A.M., Hu, C.-J., Labosky, P.A., Simon, M.C., and Keith, B. (2006). HIF-2alpha regulates Oct-4: effects of hypoxia on stem cell function, embryonic development, and tumor growth. Genes Dev. 20, 557–570.

Cowden Dahl, K.D., Fryer, B.H., Mack, F.A., Compernolle, V., Maltepe, E., Adelman, D.M., Carmeliet, P., and Simon, M.C. (2005). Hypoxia-inducible factors 1alpha and 2alpha regulate trophoblast differentiation. Mol. Cell. Biol. 25, 10479–10491.

Crossey, P.A., Foster, K., Richards, F.M., Phipps, M.E., Latif, F., Tory, K., Jones, M.H., Bentley, E., Kumar, R., and Lerman, M.I. (1994a). Molecular genetic investigations of the mechanism of tumourigenesis in von Hippel-Lindau disease: analysis of allele loss in VHL tumours. Hum. Genet. 93, 53–58.

Crossey, P.A., Richards, F.M., Foster, K., Green, J.S., Prowse, A., Latif, F., Lerman, M.I., Zbar, B., Affara, N.A., and Ferguson-Smith, M.A. (1994b). Identification of intragenic mutations in the von Hippel- Lindau disease tumour suppressor gene and correlation with disease phenotype. Hum. Mol. Genet. 3, 1303–1308.

Deckwerth, T.L., and Johnson, E.M. (1993). Temporal analysis of events associated with programmed cell death (apoptosis) of sympathetic neurons deprived of nerve growth factor. J. Cell Biol. 123, 1207–1222.

Díaz-Flores, L., Gutiérrez, R., Varela, H., Valladares, F., Alvarez-Argüelles, H., and Borges, R. (2008). Histogenesis and morphofunctional characteristics of chromaffin cells. Acta Physiol. Oxf. Engl. 192, 145–163.

Donnelly, D.F., and Doyle, T.P. (1994). Developmental changes in hypoxia-induced catecholamine release from rat carotid body, in vitro. J. Physiol. 475, 267–275.

References

Doupe, A.J., Landis, S.C., and Patterson, P.H. (1985). Environmental influences in the development of neural crest derivatives: glucocorticoids, growth factors, and chromaffin cell plasticity. J. Neurosci. Off. J. Soc. Neurosci. 5, 2119–2142.

Duan, D.R., Humphrey, J.S., Chen, D.Y., Weng, Y., Sukegawa, J., Lee, S., Gnarra, J.R., Linehan, W.M., and Klausner, R.D. (1995). Characterization of the VHL tumor suppressor gene product: localization, complex formation, and the effect of natural inactivating mutations. Proc. Natl. Acad. Sci. U. S. A. 92, 6459–6463.

Duband, J.-L. (2010). Diversity in the molecular and cellular strategies of epithelium-to-mesenchyme transitions: Insights from the neural crest. Cell Adhes. Migr. 4, 458–482.

Dunwoodie, S.L. (2009). The Role of Hypoxia in Development of the Mammalian Embryo. Dev. Cell 17, 755–773.

Edsjö, A., Holmquist, L., and Påhlman, S. (2007). Neuroblastoma as an experimental model for neuronal differentiation and hypoxia-induced tumor cell dedifferentiation. Semin. Cancer Biol. 17, 248–256.

Edwards, S.N., and Tolkovsky, A.M. (1994). Characterization of apoptosis in cultured rat sympathetic neurons after nerve growth factor withdrawal. J. Cell Biol. 124, 537–546.

E Gubina, M.J.R.-H. (2000). Assignment of dlk (Dlk1) to mouse chromosome band 12E-F1 by in situ hybridization. Cytogenet. Cell Genet. 88, 322–323.

Eisenhofer, G., Lenders, J.W., Linehan, W.M., Walther, M.M., Goldstein, D.S., and Keiser, H.R. (1999). Plasma normetanephrine and metanephrine for detecting pheochromocytoma in von Hippel-Lindau disease and multiple endocrine neoplasia type 2. N. Engl. J. Med. 340, 1872–1879.

Eisenhofer, G., Walther, M.M., Huynh, T.T., Li, S.T., Bornstein, S.R., Vortmeyer, A., Mannelli, M., Goldstein, D.S., Linehan, W.M., Lenders, J.W., et al. (2001). Pheochromocytomas in von Hippel- Lindau syndrome and multiple endocrine neoplasia type 2 display distinct biochemical and clinical phenotypes. J. Clin. Endocrinol. Metab. 86, 1999–2008.

Eisenhofer, G., Huynh, T.-T., Pacak, K., Brouwers, F.M., Walther, M.M., Linehan, W.M., Munson, P.J., Mannelli, M., Goldstein, D.S., and Elkahloun, A.G. (2004). Distinct gene expression profiles in norepinephrine- and epinephrine-producing hereditary and sporadic pheochromocytomas: activation of hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome. Endocr. Relat. Cancer 11, 897–911.

Ema, M., Taya, S., Yokotani, N., Sogawa, K., Matsuda, Y., and Fujii-Kuriyama, Y. (1997). A novel bHLH- PAS factor with close sequence similarity to hypoxia-inducible factor 1alpha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc. Natl. Acad. Sci. U. S. A. 94, 4273–4278.

Erbel, P.J.A., Card, P.B., Karakuzu, O., Bruick, R.K., and Gardner, K.H. (2003). Structural basis for PAS domain heterodimerization in the basic helix–loop–helix-PAS transcription factor hypoxia-inducible factor. Proc. Natl. Acad. Sci. U. S. A. 100, 15504–15509.

Ernsberger, U., Patzke, H., Tissier-Seta, J.P., Reh, T., Goridis, C., and Rohrer, H. (1995). The expression of tyrosine hydroxylase and the transcription factors cPhox-2 and Cash-1: evidence for distinct inductive steps in the differentiation of chick sympathetic precursor cells. Mech. Dev. 52, 125–136.

References

Ernsberger, U., Reissmann, E., Mason, I., and Rohrer, H. (2000). The expression of dopamine beta- hydroxylase, tyrosine hydroxylase, and Phox2 transcription factors in sympathetic neurons: evidence for common regulation during noradrenergic induction and diverging regulation later in development. Mech. Dev. 92, 169–177.

Ernsberger, U., Esposito, L., Partimo, S., Huber, K., Franke, A., Bixby, J.L., Kalcheim, C., and Unsicker, K. (2005). Expression of neuronal markers suggests heterogeneity of chick sympathoadrenal cells prior to invasion of the adrenal anlagen. Cell Tissue Res. 319, 1–13.

Estus, S., Zaks, W.J., Freeman, R.S., Gruda, M., Bravo, R., and Johnson, E.M. (1994). Altered gene expression in neurons during programmed cell death: identification of c-jun as necessary for neuronal apoptosis. J. Cell Biol. 127, 1717–1727.

Falix, F.A., Tjon-A-Loi, M.R.S., Gaemers, I.C., Aronson, D.C., and Lamers, W.H. (2013). DLK1 Protein Expression during Mouse Development Provides New Insights into Its Function. Int. Sch. Res. Not. 2013, e628962.

Ferrón, S.R., Charalambous, M., Radford, E., McEwen, K., Wildner, H., Hind, E., Morante-Redolat, J.M., Laborda, J., Guillemot, F., Bauer, S.R., et al. (2011). Postnatal loss of Dlk1 imprinting in stem cells and niche-astrocytes regulates neurogenesis. Nature 475, 381–385.

Finotto, S., Krieglstein, K., Schober, A., Deimling, F., Lindner, K., Brühl, B., Beier, K., Metz, J., Garcia- Arraras, J.E., Roig-Lopez, J.L., et al. (1999). Analysis of mice carrying targeted mutations of the glucocorticoid receptor gene argues against an essential role of glucocorticoid signalling for generating adrenal chromaffin cells. Dev. Camb. Engl. 126, 2935–2944.

Flamme, I., Fröhlich, T., von Reutern, M., Kappel, A., Damert, A., and Risau, W. (1997). HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-inducible factor-1 alpha and developmentally expressed in blood vessels. Mech. Dev. 63, 51–60.

Forsythe, J.A., Jiang, B.H., Iyer, N.V., Agani, F., Leung, S.W., Koos, R.D., and Semenza, G.L. (1996). Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 16, 4604–4613.

Friedrich, C.A. (2001). Genotype-phenotype correlation in von Hippel-Lindau syndrome. Hum. Mol. Genet. 10, 763–767.

Gammill, L.S., Gonzalez, C., Gu, C., and Bronner-Fraser, M. (2006). Guidance of trunk neural crest migration requires neuropilin 2/semaphorin 3F signaling. Dev. Camb. Engl. 133, 99–106.

Giatromanolaki, A., Sivridis, E., Fiska, A., and Koukourakis, M.I. (2006). Hypoxia-inducible factor-2 alpha (HIF-2 alpha) induces angiogenesis in breast carcinomas. Appl. Immunohistochem. Mol. Morphol. AIMM Off. Publ. Soc. Appl. Immunohistochem. 14, 78–82.

Gnarra, J.R., Zhou, S., Merrill, M.J., Wagner, J.R., Krumm, A., Papavassiliou, E., Oldfield, E.H., Klausner, R.D., and Linehan, W.M. (1996). Post-transcriptional regulation of vascular endothelial growth factor mRNA by the product of the VHL tumor suppressor gene. Proc. Natl. Acad. Sci. U. S. A. 93, 10589– 10594.

Gnarra, J.R., Ward, J.M., Porter, F.D., Wagner, J.R., Devor, D.E., Grinberg, A., Emmert-Buck, M.R., Westphal, H., Klausner, R.D., and Linehan, W.M. (1997). Defective placental vasculogenesis causes embryonic lethality in VHL-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 94, 9102–9107.

References

Goldstein, M., Fuxe, K., and Hökfelt, T. (1972). Characterization and tissue localization of catecholamine synthesizing enzymes. Pharmacol. Rev. 24, 293–309.

Goridis, C., and Rohrer, H. (2002). Specification of catecholaminergic and serotonergic neurons. Nat. Rev. Neurosci. 3, 531–541.

Groves, A.K., George, K.M., Tissier-Seta, J.P., Engel, J.D., Brunet, J.F., and Anderson, D.J. (1995). Differential regulation of transcription factor gene expression and phenotypic markers in developing sympathetic neurons. Dev. Camb. Engl. 121, 887–901.

Gubina, E., Ruiz-Hidalgo, M.J., Baladrón, V., and Laborda, J. (1999). Assignment of DLK1 to human chromosome band 14q32 by in situ hybridization. Cytogenet. Cell Genet. 84, 206–207.

Guillemot, F., and Joyner, A.L. (1993). Dynamic expression of the murine Achaete-Scute homologue Mash-1 in the developing nervous system. Mech. Dev. 42, 171–185.

Guillemot, F., Lo, L.C., Johnson, J.E., Auerbach, A., Anderson, D.J., and Joyner, A.L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75, 463–476.

Gut, P., Huber, K., Lohr, J., Brühl, B., Oberle, S., Treier, M., Ernsberger, U., Kalcheim, C., and Unsicker, K. (2005). Lack of an adrenal cortex in Sf1 mutant mice is compatible with the generation and differentiation of chromaffin cells. Dev. Camb. Engl. 132, 4611–4619.

Haase, V.H., Glickman, J.N., Socolovsky, M., and Jaenisch, R. (2001). Vascular tumors in livers with targeted inactivation of the von Hippel-Lindau tumor suppressor. Proc. Natl. Acad. Sci. U. S. A. 98, 1583–1588.

Ham, J., Babij, C., Whitfield, J., Pfarr, C.M., Lallemand, D., Yaniv, M., and Rubin, L.L. (1995). A c-Jun dominant negative mutant protects sympathetic neurons against programmed cell death. Neuron 14, 927–939.

Hedborg, F., Ullerås, E., Grimelius, L., Wassberg, E., Maxwell, P.H., Hero, B., Berthold, F., Schilling, F., Harms, D., Sandstedt, B., et al. (2003). Evidence for hypoxia-induced neuronal-to-chromaffin metaplasia in neuroblastoma. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 17, 598–609.

Hedborg, F., Fischer-Colbrie, R., Ostlin, N., Sandstedt, B., Tran, M.G.B., and Maxwell, P.H. (2010). Differentiation in neuroblastoma: diffusion-limited hypoxia induces neuro-endocrine secretory protein 55 and other markers of a chromaffin phenotype. PloS One 5.

Heikkilä, M., Pasanen, A., Kivirikko, K.I., and Myllyharju, J. (2011). Roles of the human hypoxia- inducible factor (HIF)-α aiats i the hpoia espose. Cell. Mol. Life “i. CML“ 68, 3885–3901.

Helman, L.J., Thiele, C.J., Linehan, W.M., Nelkin, B.D., Baylin, S.B., and Israel, M.A. (1987). Molecular markers of neuroendocrine development and evidence of environmental regulation. Proc. Natl. Acad. Sci. U. S. A. 84, 2336–2339.

Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K., Hermans-Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M., and Wegner, M. (1998). Mutation of the Sry-related Sox10 gene in Dominant megacolon, a mouse model for human Hirschsprung disease. Proc. Natl. Acad. Sci. U. S. A. 95, 5161– 5165.

References

Hirsch, M.R., Tiveron, M.C., Guillemot, F., Brunet, J.F., and Goridis, C. (1998). Control of noradrenergic differentiation and Phox2a expression by MASH1 in the central and peripheral nervous system. Dev. Camb. Engl. 125, 599–608.

Hoehner, J.C., Hedborg, F., Eriksson, L., Sandstedt, B., Grimelius, L., Olsen, L., and Påhlman, S. (1998). Developmental gene expression of sympathetic nervous system tumors reflects their histogenesis. Lab. Investig. J. Tech. Methods Pathol. 78, 29–45.

Hoffman, M.A., Ohh, M., Yang, H., Klco, J.M., Ivan, M., and Kaelin, W.G. (2001). von Hippel-Lindau protein mutants linked to type 2C VHL disease preserve the ability to downregulate HIF. Hum. Mol. Genet. 10, 1019–1027.

Hogenesch, J.B., Chan, W.K., Jackiw, V.H., Brown, R.C., Gu, Y.Z., Pray-Grant, M., Perdew, G.H., and Bradfield, C.A. (1997). Characterization of a subset of the basic-helix-loop-helix-PAS superfamily that interacts with components of the dioxin signaling pathway. J. Biol. Chem. 272, 8581–8593.

Holmquist-Mengelbier, L., Fredlund, E., Löfstedt, T., Noguera, R., Navarro, S., Nilsson, H., Pietras, A., Vallon-Christersson, J., Borg, A., Gradin, K., et al. (2006). Recruitment of HIF-1alpha and HIF-2alpha to common target genes is differentially regulated in neuroblastoma: HIF-2alpha promotes an aggressive phenotype. Cancer Cell 10, 413–423.

Howard, M.J., Stanke, M., Schneider, C., Wu, X., and Rohrer, H. (2000). The transcription factor dHAND is a downstream effector of BMPs in sympathetic neuron specification. Dev. Camb. Engl. 127, 4073–4081.

Huang, L.E., Arany, Z., Livingston, D.M., and Bunn, H.F. (1996). Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its alpha subunit. J. Biol. Chem. 271, 32253–32259.

Huber, K. (2006). The sympathoadrenal cell lineage: specification, diversification, and new perspectives. Dev. Biol. 298, 335–343.

Huber, K. (2014). Segregation of neuronal and neuroendocrine differentiation in the sympathoadrenal lineage. Cell Tissue Res. 359, 333–341.

Huber, K., Brühl, B., Guillemot, F., Olson, E.N., Ernsberger, U., and Unsicker, K. (2002). Development of chromaffin cells depends on MASH1 function. Dev. Camb. Engl. 129, 4729–4738.

Huber, K., Karch, N., Ernsberger, U., Goridis, C., and Unsicker, K. (2005). The role of Phox2B in chromaffin cell development. Dev. Biol. 279, 501–508.

Huber, K., Kalcheim, C., and Unsicker, K. (2009). The development of the chromaffin cell lineage from the neural crest. Auton. Neurosci. Basic Clin. 151, 10–16.

Iliopoulos, O., and Kaelin, W.G. (1997). The molecular basis of von Hippel-Lindau disease. Mol. Med. 3, 289–293.

Iliopoulos, O., Levy, A.P., Jiang, C., Kaelin, W.G., and Goldberg, M.A. (1996). Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein. Proc. Natl. Acad. Sci. U. S. A. 93, 10595– 10599.

References

Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A., Asara, J.M., Lane, W.S., and Kaelin, W.G. (2001). HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 292, 464–468.

Jang, M.S., Park, J.E., Lee, J.A., Park, S.G., Myung, P.K., Lee, D.H., Park, B.C., and Cho, S. (2005). Binding and regulation of hypoxia-inducible factor-1 by the inhibitory PAS proteins. Biochem. Biophys. Res. Commun. 337, 209–215.

Jensen, C.H., Teisner, B., Højrup, P., Rasmussen, H.B., Madsen, O.D., Nielsen, B., and Skjødt, K. (1993). Studies on the isolation, structural analysis and tissue localization of fetal antigen 1 and its relation to a human adrenal-specific cDNA, pG2. Hum. Reprod. Oxf. Engl. 8, 635–641.

Jögi, A., Øra, I., Nilsson, H., Lindeheim, A., Makino, Y., Poellinger, L., Axelson, H., and Påhlman, S. (2002). Hypoxia alters gene expression in human neuroblastoma cells toward an immature and neural crest-like phenotype. Proc. Natl. Acad. Sci. U. S. A. 99, 7021–7026.

Kaelin, W.G. (2004). The von Hippel-Lindau tumor suppressor gene and kidney cancer. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 10, 6290S – 5S.

Kaelin, W.G. (2005). The von Hippel-Lindau tumor suppressor protein: roles in cancer and oxygen sensing. Cold Spring Harb. Symp. Quant. Biol. 70, 159–166.

Kaelin, W.G. (2007). Von Hippel-Lindau disease. Annu. Rev. Pathol. 2, 145–173.

Kaelin, W.G., and Maher, E.R. (1998). The VHL tumour-suppressor gene paradigm. Trends Genet. TIG 14, 423–426.

Kaelin, W.G., and Ratcliffe, P.J. (2008). Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol. Cell 30, 393–402.

Kallio, P.J., Pongratz, I., Gradin, K., McGuire, J., and Poellinger, L. (1997). Activation of hypoxia- inducible factor 1alpha: posttranscriptional regulation and conformational change by recruitment of the Arnt transcription factor. Proc. Natl. Acad. Sci. U. S. A. 94, 5667–5672.

Kamura, T., Koepp, D.M., Conrad, M.N., Skowyra, D., Moreland, R.J., Iliopoulos, O., Lane, W.S., Kaelin, W.G., Elledge, S.J., Conaway, R.C., et al. (1999). Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284, 657–661.

Keith, B., Johso, R.“., ad “io, M.C. . HIFα ad HIFα: silig ialry in hypoxic tumor growth and progression. Nat. Rev. Cancer 12, 9–22.

Kelsh, R.N. (2006). Sorting out Sox10 functions in neural crest development. BioEssays News Rev. Mol. Cell. Dev. Biol. 28, 788–798.

Kessler, P.M., Vasavada, S.P., Rackley, R.R., Stackhouse, T., Duh, F.M., Latif, F., Lerman, M.I., Zbar, B., and Williams, B.R. (1995). Expression of the Von Hippel-Lindau tumor suppressor gene, VHL, in human fetal kidney and during mouse embryogenesis. Mol. Med. 1, 457–466.

Kibel, A., Iliopoulos, O., DeCaprio, J.A., and Kaelin, W.G. (1995). Binding of the von Hippel-Lindau tumor suppressor protein to Elongin B and C. Science 269, 1444–1446.

Kim, W.Y., and Kaelin, W.G. (2004). Role of VHL gene mutation in human cancer. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 22, 4991–5004.

References

Kim, Y., Lin, Q., Zelterman, D., and Yun, Z. (2009). Hypoxia-regulated delta-like 1 homologue enhances cancer cell stemness and tumorigenicity. Cancer Res. 69, 9271–9280.

Kishida, T., Stackhouse, T.M., Chen, F., Lerman, M.I., and Zbar, B. (1995). Cellular proteins that bind the von Hippel-Lindau disease gene product: mapping of binding domains and the effect of missense mutations. Cancer Res. 55, 4544–4548.

Klein, I., and Ojamaa, K. (1992). Clinical review 36: Cardiovascular manifestations of endocrine disease. J. Clin. Endocrinol. Metab. 75, 339–342.

Koch, C.A., Vortmeyer, A.O., Zhuang, Z., Brouwers, F.M., and Pacak, K. (2002). New insights into the genetics of familial chromaffin cell tumors. Ann. N. Y. Acad. Sci. 970, 11–28.

Koh, M.Y., and Powis, G. (2012). Passing the baton: the HIF switch. Trends Biochem. Sci. 37, 364–372.

Kondo, K., Klco, J., Nakamura, E., Lechpammer, M., and Kaelin, W.G. (2002). Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell 1, 237–246.

Kondo, K., Kim, W.Y., Lechpammer, M., and Kaelin, W.G. (2003). Inhibition of HIF2alpha is sufficient to suppress pVHL-defective tumor growth. PLoS Biol. 1, E83.

Kopan, R., and Ilagan, M.X.G. (2009). The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell 137, 216–233.

Kozak, K.R., Abbott, B., and Hankinson, O. (1997). ARNT-deficient mice and placental differentiation. Dev. Biol. 191, 297–305.

Krieg, M., Haas, R., Brauch, H., Acker, T., Flamme, I., and Plate, K.H. (2000). Up-regulation of hypoxia- inducible factors HIF-1alpha and HIF-2alpha under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss of function. Oncogene 19, 5435–5443.

Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I., and Wegner, M. (1998). Sox10, a novel transcriptional modulator in glial cells. J. Neurosci. Off. J. Soc. Neurosci. 18, 237–250.

Kulesa, P.M., Bailey, C.M., Kasemeier-Kulesa, J.C., and McLennan, R. (2010). Cranial neural crest migration: new rules for an old road. Dev. Biol. 344, 543–554.

Kumar, G.K., Overholt, J.L., Bright, G.R., Hui, K.Y., Lu, H., Gratzl, M., and Prabhakar, N.R. (1998). Release of dopamine and norepinephrine by hypoxia from PC-12 cells. Am. J. Physiol. 274, C1592– C1600.

Laborda, J. (2000). The role of the epidermal growth factor-like protein dlk in cell differentiation. Histol. Histopathol. 15, 119–129.

Langley, K., and Grant, N.J. (1999). Molecular markers of sympathoadrenal cells. Cell Tissue Res. 298, 185–206.

Larsen, J.B., Jensen, C.H., Schrøder, H.D., Teisner, B., Bjerre, P., and Hagen, C. (1996). Fetal antigen 1 and growth hormone in pituitary somatotroph cells. Lancet Lond. Engl. 347, 191.

Latif, F., Tory, K., Gnarra, J., Yao, M., Duh, F.M., Orcutt, M.L., Stackhouse, T., Kuzmin, I., Modi, W., and Geil, L. (1993). Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 260, 1317–1320.

References

Lee, S., Nakamura, E., Yang, H., Wei, W., Linggi, M.S., Sajan, M.P., Farese, R.V., Freeman, R.S., Carter, B.D., Kaelin, W.G., et al. (2005). Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial pheochromocytoma genes: developmental culling and cancer. Cancer Cell 8, 155–167.

Lemberger, T., Parlato, R., Dassesse, D., Westphal, M., Casanova, E., Turiault, M., Tronche, F., Schiffmann, S.N., and Schütz, G. (2007). Expression of Cre recombinase in dopaminoceptive neurons. BMC Neurosci. 8, 4.

Levy, A.P., Levy, N.S., Iliopoulos, O., Jiang, C., Kaplin, W.G., and Goldberg, M.A. (1997). Regulation of vascular endothelial growth factor by hypoxia and its modulation by the von Hippel-Lindau tumor suppressor gene. Kidney Int. 51, 575–578.

Li, M., and Kim, W.Y. (2011). Two sides to every story: the HIF-dependent and HIF-independent functions of pVHL. J. Cell. Mol. Med. 15, 187–195.

Li, H., Ko, H.P., and Whitlock, J.P. (1996). Induction of phosphoglycerate kinase 1 gene expression by hypoxia. Roles of Arnt and HIF1alpha. J. Biol. Chem. 271, 21262–21267.

Lim, K.C., Lakshmanan, G., Crawford, S.E., Gu, Y., Grosveld, F., and Engel, J.D. (2000). Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system. Nat. Genet. 25, 209–212.

Lo, L., Tiveron, M.C., and Anderson, D.J. (1998). MASH1 activates expression of the paired homeodomain transcription factor Phox2a, and couples pan-neuronal and subtype-specific components of autonomic neuronal identity. Dev. Camb. Engl. 125, 609–620.

Lo, L.C., Johnson, J.E., Wuenschell, C.W., Saito, T., and Anderson, D.J. (1991). Mammalian achaete- scute homolog 1 is transiently expressed by spatially restricted subsets of early neuroepithelial and neural crest cells. Genes Dev. 5, 1524–1537.

Loboda, A., Jozkowicz, A., and Dulak, J. (2010). HIF-1 and HIF-2 transcription factors--similar but not identical. Mol. Cells 29, 435–442.

Lonergan, K.M., Iliopoulos, O., Ohh, M., Kamura, T., Conaway, R.C., Conaway, J.W., and Kaelin, W.G. (1998). Regulation of hypoxia-inducible mRNAs by the von Hippel-Lindau tumor suppressor protein requires binding to complexes containing elongins B/C and Cul2. Mol. Cell. Biol. 18, 732–741.

Loring, J.F., and Erickson, C.A. (1987). Neural crest cell migratory pathways in the trunk of the chick embryo. Dev. Biol. 121, 220–236.

Los, M., Jansen, G.H., Kaelin, W.G., Lips, C.J., Blijham, G.H., and Voest, E.E. (1996). Expression pattern of the von Hippel-Lindau protein in human tissues. Lab. Investig. J. Tech. Methods Pathol. 75, 231– 238.

Lucas, M.E., Müller, F., Rüdiger, R., Henion, P.D., and Rohrer, H. (2006). The bHLH transcription factor hand2 is essential for noradrenergic differentiation of sympathetic neurons. Dev. Camb. Engl. 133, 4015–4024.

Lumb, R., and Schwarz, Q. (2015). Sympathoadrenal neural crest cells: The known, unknown and forgotten? Dev. Growth Differ. 57, 146–157.

References

Ma, W., Tessarollo, L., Hong, S.-B., Baba, M., Southon, E., Back, T.C., Spence, S., Lobe, C.G., Sharma, N., Maher, G.W., et al. (2003). Hepatic vascular tumors, angiectasis in multiple organs, and impaired spermatogenesis in mice with conditional inactivation of the VHL gene. Cancer Res. 63, 5320–5328.

Maher, E.R., and Eng, C. (2002). The pressure rises: update on the genetics of phaeochromocytoma. Hum. Mol. Genet. 11, 2347–2354.

Maher, E.R., Iselius, L., Yates, J.R., Littler, M., Benjamin, C., Harris, R., Sampson, J., Williams, A., Ferguson-Smith, M.A., and Morton, N. (1991). Von Hippel-Lindau disease: a genetic study. J. Med. Genet. 28, 443–447.

Maher, E.R., Webster, A.R., Richards, F.M., Green, J.S., Crossey, P.A., Payne, S.J., and Moore, A.T. (1996). Phenotypic expression in von Hippel-Lindau disease: correlations with germline VHL gene mutations. J. Med. Genet. 33, 328–332.

Maher, E.R., Neumann, H.P., and Richard, S. (2011). von Hippel-Lindau disease: a clinical and scientific review. Eur. J. Hum. Genet. EJHG 19, 617–623.

Makino, Y., Cao, R., Svensson, K., Bertilsson, G., Asman, M., Tanaka, H., Cao, Y., Berkenstam, A., and Poellinger, L. (2001). Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression. Nature 414, 550–554.

Marxsen, J.H., Stengel, P., Doege, K., Heikkinen, P., Jokilehto, T., Wagner, T., Jelkmann, W., Jaakkola, P., and Metzen, E. (2004). Hypoxia-inducible factor-1 (HIF-1) promotes its degradation by induction of HIF-alpha-prolyl-4-hydroxylases. Biochem. J. 381, 761–767.

Masson, N., Willam, C., Maxwell, P.H., Pugh, C.W., and Ratcliffe, P.J. (2001). Independent function of two destruction domains in hypoxia-inducible factor-alpha chains activated by prolyl hydroxylation. EMBO J. 20, 5197–5206.

Maxwell, P.H., Wiesener, M.S., Chang, G.W., Clifford, S.C., Vaux, E.C., Cockman, M.E., Wykoff, C.C., Pugh, C.W., Maher, E.R., and Ratcliffe, P.J. (1999). The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271–275.

Maynard, M.A., Qi, H., Chung, J., Lee, E.H.L., Kondo, Y., Hara, S., Conaway, R.C., Conaway, J.W., and Ohh, M. (2003). Multiple splice variants of the human HIF-3 alpha locus are targets of the von Hippel- Lindau E3 ubiquitin ligase complex. J. Biol. Chem. 278, 11032–11040.

Meulemans, D., and Bronner-Fraser, M. (2004). Gene-regulatory interactions in neural crest evolution and development. Dev. Cell 7, 291–299.

Michelsohn, A.M., and Anderson, D.J. (1992). Changes in competence determine the timing of two sequential glucocorticoid effects on sympathoadrenal progenitors. Neuron 8, 589–604.

Min, J.-H., Yang, H., Ivan, M., Gertler, F., Kaelin, W.G., and Pavletich, N.P. (2002). Structure of an HIF- 1alpha -pVHL complex: hydroxyproline recognition in signaling. Science 296, 1886–1889.

Moore, K.A., Pytowski, B., Witte, L., Hicklin, D., and Lemischka, I.R. (1997). Hematopoietic activity of a stromal cell transmembrane protein containing epidermal growth factor-like epeat otifs. Po. Natl. Acad. Sci. U. S. A. 94, 4011–4016.

References

Moriguchi, T., Takako, N., Hamada, M., Maeda, A., Fujioka, Y., Kuroha, T., Huber, R.E., Hasegawa, S.L., Rao, A., Yamamoto, M., et al. (2006). Gata3 participates in a complex transcriptional feedback network to regulate sympathoadrenal differentiation. Dev. Camb. Engl. 133, 3871–3881.

Morikawa, Y., Dai, Y.-S., Hao, J., Bonin, C., Hwang, S., and Cserjesi, P. (2005). The basic helix-loop- helix factor Hand 2 regulates autonomic nervous system development. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 234, 613–621.

Nakamura, E., and Kaelin, W.G. (2006). Recent insights into the molecular pathogenesis of pheochromocytoma and paraganglioma. Endocr. Pathol. 17, 97–106.

Ohh, M., Yauch, R.L., Lonergan, K.M., Whaley, J.M., Stemmer-Rachamimov, A.O., Louis, D.N., Gavin, B.J., Kley, N., Kaelin, W.G., and Iliopoulos, O. (1998). The von Hippel-Lindau tumor suppressor protein is required for proper assembly of an extracellular fibronectin matrix. Mol. Cell 1, 959–968.

Ong, K.R., Woodward, E.R., Killick, P., Lim, C., Macdonald, F., and Maher, E.R. (2007). Genotype- phenotype correlations in von Hippel-Lindau disease. Hum. Mutat. 28, 143–149.

Opocher, G., and Schiavi, F. (2011). Functional consequences of succinate dehydrogenase mutations. Endocr. Pract. Off. J. Am. Coll. Endocrinol. Am. Assoc. Clin. Endocrinol. 17 Suppl 3, 64–71.

O’Rahill, R., ad Mülle, F. . The deelopet of the eual est i the hua. J. Aat. 211, 335–351.

Palmada, M., Kanwal, S., Rutkoski, N.J., Gustafson-Brown, C., Johnson, R.S., Wisdom, R., Carter, B.D., and Gufstafson-Brown, C. (2002). c-jun is essential for sympathetic neuronal death induced by NGF withdrawal but not by p75 activation. J. Cell Biol. 158, 453–461.

Parlato, R., Otto, C., Tuckermann, J., Stotz, S., Kaden, S., Gröne, H.-J., Unsicker, K., and Schütz, G. (2009). Conditional inactivation of glucocorticoid receptor gene in dopamine-beta-hydroxylase cells impairs chromaffin cell survival. Endocrinology 150, 1775–1781.

Pattyn, A., Morin, X., Cremer, H., Goridis, C., and Brunet, J.F. (1997). Expression and interactions of the two closely related homeobox genes Phox2a and Phox2b during neurogenesis. Dev. Camb. Engl. 124, 4065–4075.

Pattyn, A., Morin, X., Cremer, H., Goridis, C., and Brunet, J.F. (1999). The homeobox gene Phox2b is essential for the development of autonomic neural crest derivatives. Nature 399, 366–370.

Pattyn, A., Guillemot, F., and Brunet, J.-F. (2006). Delays in neuronal differentiation in Mash1/Ascl1 mutants. Dev. Biol. 295, 67–75.

Pause, A., Lee, S., Worrell, R.A., Chen, D.Y., Burgess, W.H., Linehan, W.M., and Klausner, R.D. (1997). The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins. Proc. Natl. Acad. Sci. U. S. A. 94, 2156–2161.

Pause, A., Lee, S., Lonergan, K.M., and Klausner, R.D. (1998). The von Hippel–Lindau tumor suppesso gee is euied fo ell le eit upo seu ithdaal. Po. Natl. Aad. “i. U. “. A. 95, 993–998. del Peso, L., Castellanos, M.C., Temes, E., Martin-Puig, S., Cuevas, Y., Olmos, G., and Landazuri, M.O. (2003). The von Hippel Lindau/hypoxia-inducible factor (HIF) pathway regulates the transcription of the HIF-proline hydroxylase genes in response to low oxygen. J. Biol. Chem. 278, 48690–48695.

References

Pietras, A., Hansford, L.M., Johnsson, A.S., Bridges, E., Sjölund, J., Gisselsson, D., Rehn, M., Beckman, S., Noguera, R., Navarro, S., et al. (2009). HIF-α aitais a udiffeetiated state i eual crest- like human neuroblastoma tumor-initiating cells. Proc. Natl. Acad. Sci. 106, 16805–16810.

Pollard, P.J., El-Bahrawy, M., Poulsom, R., Elia, G., Killick, P., Kelly, G., Hunt, T., Jeffery, R., Seedhar, P., Barwell, J., et al. (2006). Expression of HIF-1alpha, HIF-2alpha (EPAS1), and their target genes in paraganglioma and pheochromocytoma with VHL and SDH mutations. J. Clin. Endocrinol. Metab. 91, 4593–4598.

Potzner, M.R., Tsarovina, K., Binder, E., Penzo-Méndez, A., Lefebvre, V., Rohrer, H., Wegner, M., and Sock, E. (2010). Sequential requirement of Sox4 and Sox11 during development of the sympathetic nervous system. Dev. Camb. Engl. 137, 775–784.

Pusch, C., Hustert, E., Pfeifer, D., Südbeck, P., Kist, R., Roe, B., Wang, Z., Balling, R., Blin, N., and Scherer, G. (1998). The SOX10/Sox10 gene from human and mouse: sequence, expression, and transactivation by the encoded HMG domain transcription factor. Hum. Genet. 103, 115–123.

Rankin, E.B., and Giaccia, A.J. (2008). The role of hypoxia-inducible factors in tumorigenesis. Cell Death Differ. 15, 678–685.

Rankin, E.B., Higgins, D.F., Walisser, J.A., Johnson, R.S., Bradfield, C.A., and Haase, V.H. (2005). Inactivation of the arylhydrocarbon receptor nuclear translocator (Arnt) suppresses von Hippel- Lindau disease-associated vascular tumors in mice. Mol. Cell. Biol. 25, 3163–3172.

Rankin, E.B., Rha, J., Unger, T.L., Wu, C.H., Shutt, H.P., Johnson, R.S., Simon, M.C., Keith, B., and Haase, V.H. (2008). Hypoxia-inducible factor-2 regulates vascular tumorigenesis in mice. Oncogene 27, 5354–5358.

Raval, R.R., Lau, K.W., Tran, M.G.B., Sowter, H.M., Mandriota, S.J., Li, J.-L., Pugh, C.W., Maxwell, P.H., Harris, A.L., and Ratcliffe, P.J. (2005). Contrasting properties of hypoxia-inducible factor 1 (HIF-1) and HIF-2 in von Hippel-Lindau-associated renal cell carcinoma. Mol. Cell. Biol. 25, 5675–5686.

Reiprich, S., Stolt, C.C., Schreiner, S., Parlato, R., and Wegner, M. (2008). SoxE proteins are differentially required in mouse adrenal gland development. Mol. Biol. Cell 19, 1575–1586.

Reissmann, E., Ernsberger, U., Francis-West, P.H., Rueger, D., Brickell, P.M., and Rohrer, H. (1996). Involvement of bone morphogenetic protein-4 and bone morphogenetic protein-7 in the differentiation of the adrenergic phenotype in developing sympathetic neurons. Dev. Camb. Engl. 122, 2079–2088.

Richards, F.M., Crossey, P.A., Phipps, M.E., Foster, K., Latif, F., Evans, G., Sampson, J., Lerman, M.I., Zbar, B., and Affara, N.A. (1994). Detailed mapping of germline deletions of the von Hippel-Lindau disease tumour suppressor gene. Hum. Mol. Genet. 3, 595–598.

Richards, F.M., Schofield, P.N., Fleming, S., and Maher, E.R. (1996). Expression of the von Hippel- Lindau disease tumour suppressor gene during human embryogenesis. Hum. Mol. Genet. 5, 639–644.

Rohrer, H. (2011). Transcriptional control of differentiation and neurogenesis in autonomic ganglia. Eur. J. Neurosci. 34, 1563–1573.

Saito, D., Takase, Y., Murai, H., and Takahashi, Y. (2012). The dorsal aorta initiates a molecular cascade that instructs sympatho-adrenal specification. Science 336, 1578–1581.

References

Sauka-Spengler, T., and Bronner-Fraser, M. (2008). A gene regulatory network orchestrates neural crest formation. Nat. Rev. Mol. Cell Biol. 9, 557–568.

Schneider, C., Wicht, H., Enderich, J., Wegner, M., and Rohrer, H. (1999). Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons. Neuron 24, 861–870.

Schober, A., Parlato, R., Huber, K., Kinscherf, R., Hartleben, B., Huber, T.B., Schütz, G., and Unsicker, K. (2013). Cell Loss and Autophagy in the Extra-Adrenal Chromaffin Organ of Zuckerkandl are Regulated by Glucocorticoid Signalling. J. Neuroendocrinol. 25, 34–47.

Seagroves, T.N., Peacock, D.L., Liao, D., Schwab, L.P., Krueger, R., Handorf, C.R., Haase, V.H., and Johnson, R.S. (2010). VHL deletion impairs mammary alveologenesis but is not sufficient for mammary tumorigenesis. Am. J. Pathol. 176, 2269–2282.

Seizinger, B.R., Rouleau, G.A., Ozelius, L.J., Lane, A.H., Farmer, G.E., Lamiell, J.M., Haines, J., Yuen, J.W., Collins, D., and Majoor-Krakauer, D. (1988). Von Hippel-Lindau disease maps to the region of chromosome 3 associated with renal cell carcinoma. Nature 332, 268–269.

Seizinger, B.R., Smith, D.I., Filling-Katz, M.R., Neumann, H., Green, J.S., Choyke, P.L., Anderson, K.M., Freiman, R.N., Klauck, S.M., and Whaley, J. (1991). Genetic flanking markers refine diagnostic criteria and provide insights into the genetics of Von Hippel Lindau disease. Proc. Natl. Acad. Sci. U. S. A. 88, 2864–2868.

Sela-Donenfeld, D., and Kalcheim, C. (1999). Regulation of the onset of neural crest migration by coordinated activity of BMP4 and Noggin in the dorsal neural tube. Dev. Camb. Engl. 126, 4749–4762.

Semenza, G.L., Rue, E.A., Iyer, N.V., Pang, M.G., and Kearns, W.G. (1996). Assignment of the hypoxia- inducible factor 1alpha gene to a region of conserved synteny on mouse chromosome 12 and human chromosome 14q. Genomics 34, 437–439.

Shah, N.M., Groves, A.K., and Anderson, D.J. (1996). Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85, 331–343.

Shtukmaster, S., Schier, M.C., Huber, K., Krispin, S., Kalcheim, C., and Unsicker, K. (2013). Sympathetic neurons and chromaffin cells share a common progenitor in the neural crest in vivo. Neural Develop. 8, 12.

Singh, P., Carraher, C., and Schwarzbauer, J.E. (2010). Assembly of fibronectin extracellular matrix. Annu. Rev. Cell Dev. Biol. 26, 397–419.

Smas, C.M., and Sul, H.S. (1993). Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73, 725–734.

Smas, C.M., Green, D., and Sul, H.S. (1994). Structural characterization and alternate splicing of the gene encoding the preadipocyte EGF-like protein pref-1. Biochemistry (Mosc.) 33, 9257–9265.

Smas, C.M., Chen, L., and Sul, H.S. (1997). Cleavage of membrane-associated pref-1 generates a soluble inhibitor of adipocyte differentiation. Mol. Cell. Biol. 17, 977–988.

Sommer, L., Shah, N., Rao, M., and Anderson, D.J. (1995). The cellular function of MASH1 in autonomic neurogenesis. Neuron 15, 1245–1258.

References

Southard-Smith, E.M., Kos, L., and Pavan, W.J. (1998). Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat. Genet. 18, 60–64.

Stanke, M., Junghans, D., Geissen, M., Goridis, C., Ernsberger, U., and Rohrer, H. (1999). The Phox2 homeodomain proteins are sufficient to promote the development of sympathetic neurons. Dev. Camb. Engl. 126, 4087–4094.

Stern, C.D., Artinger, K.B., and Bronner-Fraser, M. (1991). Tissue interactions affecting the migration and differentiation of neural crest cells in the chick embryo. Dev. Camb. Engl. 113, 207–216.

Takashi Moriguchi, K.-C. @bullet (2007). Transcription Factor Networks Specify Sympathetic and Adrenal Chromaffin Cell Differentiation. Funct. Dev. Embryol. 1, 130–135.

Tanimizu, N., Nishikawa, M., Saito, H., Tsujimura, T., and Miyajima, A. (2003). Isolation of hepatoblasts based on the expression of Dlk/Pref-1. J. Cell Sci. 116, 1775–1786.

Tian, H., McKnight, S.L., and Russell, D.W. (1997). Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 11, 72–82.

Tian, H., Hammer, R.E., Matsumoto, A.M., Russell, D.W., and McKnight, S.L. (1998). The hypoxia- responsive transcription factor EPAS1 is essential for catecholamine homeostasis and protection against heart failure during embryonic development. Genes Dev. 12, 3320–3324.

Tischler, A.S. (2008). Pheochromocytoma and extra-adrenal paraganglioma: updates. Arch. Pathol. Lab. Med. 132, 1272–1284.

Tischler, A.S., Ruzicka, L.A., Donahue, S.R., and DeLellis, R.A. (1989). Chromaffin cell proliferation in the adult rat adrenal medulla. Int. J. Dev. Neurosci. 7, 439–448.

Tiveron, M.C., Hirsch, M.R., and Brunet, J.F. (1996). The expression pattern of the transcription factor Phox2 delineates synaptic pathways of the autonomic nervous system. J. Neurosci. Off. J. Soc. Neurosci. 16, 7649–7660.

Tornehave, D., Jensen, C.H., Teisner, B., and Larsson, L.I. (1996). FA1 immunoreactivity in endocrine tumours and during development of the human fetal pancreas; negative correlation with glucagon expression. Histochem. Cell Biol. 106, 535–542.

Tsarovina, K., Pattyn, A., Stubbusch, J., Müller, F., van der Wees, J., Schneider, C., Brunet, J.-F., and Rohrer, H. (2004). Essential role of Gata transcription factors in sympathetic neuron development. Dev. Camb. Engl. 131, 4775–4786.

Unsicker, K. (1981). Differentiation and transdifferentiation of adrenal chromaffin cells of the guinea pig. II. Adrenal medullary explants grown in tissue culture. Cell Tissue Res. 219, 339–353.

Unsicker, K., Krisch, B., Otten, U., and Thoenen, H. (1978). Nerve growth factor-induced fiber outgrowth from isolated rat adrenal chromaffin cells: impairment by glucocorticoids. Proc. Natl. Acad. Sci. U. S. A. 75, 3498–3502.

Unsicker, K., Huber, K., Schober, A., and Kalcheim, C. (2013). Resolved and open issues in chromaffin cell development. Mech. Dev. 130, 324–329.

References

Van Limpt, V.A.E., Chan, A.J., Van Sluis, P.G., Caron, H.N., Van Noesel, C.J.M., and Versteeg, R. (2003). High delta-like 1 expression in a subset of neuroblastoma cell lines corresponds to a differentiated chromaffin cell type. Int. J. Cancer J. Int. Cancer 105, 61–69.

Vogel, K.S., Brannan, C.I., Jenkins, N.A., Copeland, N.G., and Parada, L.F. (1995). Loss of neurofibromin results in neurotrophin-independent survival of embryonic sensory and sympathetic neurons. Cell 82, 733–742.

Wang, G.L., and Semenza, G.L. (1993). General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc. Natl. Acad. Sci. 90, 4304–4308.

Wang, G.L., and Semenza, G.L. (1995). Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 270, 1230–1237.

Wang, Y., and Sul, H.S. (2006). Ectodomain shedding of preadipocyte factor 1 (Pref-1) by tumor necrosis factor alpha converting enzyme (TACE) and inhibition of adipocyte differentiation. Mol. Cell. Biol. 26, 5421–5435.

Wang, G.L., Jiang, B.H., Rue, E.A., and Semenza, G.L. (1995). Hypoxia-inducible factor 1 is a basic- helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. U. S. A. 92, 5510–5514.

Wenger, R.H. (2002). Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia- inducible transcription factors, and O2-regulated gene expression. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 16, 1151–1162.

Wiesener, M.S., Jürgensen, J.S., Rosenberger, C., Scholze, C.K., Hörstrup, J.H., Warnecke, C., Mandriota, S., Bechmann, I., Frei, U.A., Pugh, C.W., et al. (2003). Widespread hypoxia-inducible expression of HIF-2alpha in distinct cell populations of different organs. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 17, 271–273.

Wildner, H., Gierl, M.S., Strehle, M., Pla, P., and Birchmeier, C. (2008). Insm1 (IA-1) is a crucial component of the transcriptional network that controls differentiation of the sympatho-adrenal lineage. Dev. Camb. Engl. 135, 473–481.

Wilson, M.E., Yang, K.Y., Kalousova, A., Lau, J., Kosaka, Y., Lynn, F.C., Wang, J., Mrejen, C., Episkopou, V., Clevers, H.C., et al. (2005). The HMG box transcription factor Sox4 contributes to the development of the endocrine pancreas. Diabetes 54, 3402–3409.

Woodward, E.R., and Maher, E.R. (2006). Von Hippel-Lindau disease and endocrine tumour susceptibility. Endocr. Relat. Cancer 13, 415–425.

Wurtman, R.J., and Axelrod, J. (1966). Control of enzymatic synthesis of adrenaline in the adrenal medulla by adrenal cortical steroids. J. Biol. Chem. 241, 2301–2305.

Yevtodiyenko, A., and Schmidt, J.V. (2006). Dlk1 expression marks developing endothelium and sites of branching morphogenesis in the mouse embryo and placenta. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 235, 1115–1123.

Young, H.M., Bergner, A.J., and Müller, T. (2003). Acquisition of neuronal and glial markers by neural crest-derived cells in the mouse intestine. J. Comp. Neurol. 456, 1–11.

References

Yu, F., White, S.B., Zhao, Q., and Lee, F.S. (2001). HIF-1alpha binding to VHL is regulated by stimulus- sensitive proline hydroxylation. Proc. Natl. Acad. Sci. U. S. A. 98, 9630–9635.

Zagórska, A., and Dulak, J. (2004). HIF-1: the knowns and unknowns of hypoxia sensing. Acta Biochim. Pol. 51, 563–585.

Zhou, Q.Y., Quaife, C.J., and Palmiter, R.D. (1995). Targeted disruption of the tyrosine hydroxylase gene reveals that catecholamines are required for mouse fetal development. Nature 374, 640–643.

Zimmer, M., Doucette, D., Siddiqui, N., and Iliopoulos, O. (2004). Inhibition of Hypoxia-Inducible Fato Is “uffiiet fo Goth “uppessio of VHL−/− Tuos NIH gat RCA5-06 (O. I.), Bertucci Fund for Urologic Malignancies (O. I.), David P. Foss Fund (O. I.), and VHL Family Alliance 2003 award (M. Z.). Mol. Cancer Res. 2, 89–95.

Acknowledgments

6. Acknowledgments

I would like to take this opportunity to express my gratitude to every person who has helped me during my project work.

Firstly, I would like to give my sincere thanks to Prof. Dr. Kerstin Krieglstein, Dean of Medical Faculty, University of Freiburg for giving me opportunity to work in her lab, through which I have learned many valuable lessons, which I will use throughout my career.

Heartfelt thanks to my supervisor Dr. Katrin Huber-Wittmer, for the precious advices and continuous support of my MD study and related research, and for giving me the freedom to work in my own way during my research. Thank you very much for critical reading of my dissertation.

Special thanks go to Prof. Dr. Klaus Unsicker for donating his time and encouragement.

I would like to thank Dr. Ekkehart Lausch, Uni-Kinder klinik Freiburg for providing me with VHL animals.

I would also like to acknowledge all past and present members of the laboratory; especially the excellent technicians Lidia Koschney, Ute Bauer, Ute Lausch and Ellen Gimbel for teaching me skillful techniques, Helmut Gerlach for the IT support.

I would also like to thank all of my colleagues in the Molecular Embryology Department especially my friend Manal Hussein for the enjoyment times that we spent at the institute.

For their love and constant support, I give many warm thanks to my family, especially the sprite of my mother and father, also my brothers who stood by my side throughout my staying in Germany.

For their endless patience and their love, (Maiar, Belal and Mehad), thank you my pops; you are the biggest blessing from Allah.

For the plainness of his mind, which helped me to find the missing keys for the closed doors, his love and incessant encouragement over the years, I wish to reserve a most special appreciation for my husband, Salah. Without my family's support and understanding, it would not have been possible to achieve my educational goal.

93 Acknowledgments

Finally, my special thanks and appreciation go to Ministry of Higher Education in Libya that gave me a scholarship for getting my Medical Doctorate from one of higher rank universities in Germany.

Tehani Elfaitwri

January 2016