DOCSLIB.ORG

Distinct Roles for CARMIL Isoforms in Cell Migration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Distinct Roles for CARMIL Isoforms in Cell Migration Washington University School of Medicine Digital Commons@Becker Open Access Publications 2009 Distinct roles for CARMIL isoforms in cell migration Yun Liang Washington University School of Medicine in St. Louis Hanspeter Niederstrasser Washington University School of Medicine in St. Louis Marc Edwards Washington University School of Medicine in St. Louis Charles E. Jackson Washington University School of Medicine in St. Louis John A. Cooper Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Liang, Yun; Niederstrasser, Hanspeter; Edwards, Marc; Jackson, Charles E.; and Cooper, John A., ,"Distinct roles for CARMIL isoforms in cell migration." Molecular Biology of the Cell.,. (2009). https://digitalcommons.wustl.edu/open_access_pubs/8256 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Molecular Biology of the Cell Vol. 20, 5290–5305, December 15, 2009 Distinct Roles for CARMIL Isoforms in Cell Migration Yun Liang, Hanspeter Niederstrasser, Marc Edwards, Charles E. Jackson, and John A. Cooper Department of Cell Biology and Physiology, Washington University, St. Louis, MO 63110 Submitted October 28, 2008; Revised October 6, 2009; Accepted October 14, 2009 Monitoring Editor: Yu-Li Wang Molecular mechanisms for cell migration, especially how signaling and cytoskeletal systems are integrated, are not understood well. Here, we examined the role of CARMIL (capping protein, Arp2/3, and Myosin-I linker) family proteins in migrating cells. Vertebrates express three conserved genes for CARMIL, and we examined the functions of the two CARMIL genes expressed in migrating human cultured cells. Both isoforms, CARMIL1 and 2, were necessary for cell migration, but for different reasons. CARMIL1 localized to lamellipodia and macropinosomes, and loss of its function caused loss of lamellipodial actin, along with defects in protrusion, ruffling, and macropinocytosis. CARMIL1-knock- down cells showed loss of activation of Rac1, and CARMIL1 was biochemically associated with the GEF Trio. CARMIL2, in contrast, colocalized with vimentin intermediate filaments, and loss of its function caused a distinctive multipolar phenotype. Loss of CARMIL2 also caused decreased levels of myosin-IIB, which may contribute to the polarity pheno- type. Expression of one CARMIL isoform was not able to rescue the knockdown phenotypes of the other. Thus, the two isoforms are both important for cell migration, but they have distinct functions. INTRODUCTION controversy as to their assembly, function, and turnover (Koestler et al., 2008; Lai et al., 2008). Cell migration is an essential element of many aspects of Regulation of barbed ends, their creation and capping, is animal cell biology, such as morphogenesis during develop- considered to be a key element controlling the architecture ment, immune response to disease, and chemotaxis (Ridley and force production of actin filament networks. Biochemi- et al., 2003; Vicente-Manzanares et al., 2005). In some settings, cally, free barbed ends can be created by nucleation from cell migration is a prominent component of disease, in- actin subunits de novo, by uncapping capped ends or by volved in the progression of malignant cancers and autoim- severing existing filaments. To create free barbed ends, the mune syndromes. Cell migration requires proper function of dendritic nucleation model proposes that activated Arp2/3 the cytoskeleton, with integration of the actin and microtu- complex binds to an existing mother filament, which nucle- bule and intermediate filament cytoskeletons. ates the formation of a new daughter filament with a free A migrating cell is generally polarized with broad actin- barbed end (Pollard, 2007). Other models propose that acti- rich lamellipodia at its leading edge. Lamellipodia contain vation of cofilin to sever filaments is a primary event that dense meshworks of actin filaments with their fast-growing, creates free barbed ends (van Rheenen et al., 2007) or that barbed ends of actin filaments oriented toward the direction inhibition of capping by proteins such as formins or Ena/ of migration, and polymerization at barbed ends provides VASP is critical (Applewhite et al., 2007; Le Clainche and the driving force pushing the plasma membrane forward (Le Carlier, 2008). Clainche and Carlier, 2008). Protrusions at the leading edge In this study, we investigated how CARMIL family pro- also include long thin structures termed filopodia or micro- teins function in cell migration. In particular, we compared spikes, which are composed of bundles of actin filaments the functions of the human CARMIL1 and 2 proteins, which that often appear to arise from the lamellipodial actin net- are expressed together in many cells and tissues. In migrat- work (Svitkina et al., 2003). Lamellipodia are often accom- ing cancer cells, we found both proteins to be important but panied by ruffles, which are wave-like structures that form with distinct nonoverlapping roles. CARMIL2 controls cell by protruding upward and then moving rearward, some- polarity and associates with vimentin intermediate fila- times resulting in macropinocytotic engulfment of extracel- ments, whereas CARMIL1 controls actin dynamics in lamel- lipodia, possibly through regulation of Rac1 via interaction lular fluid. The actin network of the leading edge contains with the guanine nucleotide exchange factor (GEF) Trio. many proteins, including Arp2/3 complex, cofilin, and cap- ping protein (CP). In vitro, a synthetic mix of these proteins can form branched networks of filaments, and the assembly MATERIALS AND METHODS of those networks can produce movement (Pollard, 2007). The structure, molecular nature, and dynamics of these net- Antibodies and Reagents work in cells is not understood well, with considerable Reagents and materials were from Sigma-Aldrich (St. Louis, MO) or Fisher Scientific (Pittsburgh, PA) unless stated otherwise. For CP, mouse mAb 3F2 specific for the C-terminus of beta2 and 5B12 recognizing alpha1 and alpha2 were used for immunoblots as described This article was published online ahead of print in MBC in Press (Developmental Studies Hybridoma Bank, University of Iowa; Schafer et al., (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08–10–1071) 1996). Rabbit pAb R26 against the C-terminus of beta2 was used for immu- on October 21, 2009. nostaining (Schafer et al., 1994). For CARMIL, chicken antibodies against a fragment of human CARMIL1 (538–1371) were produced by Dr. Ilgu Kang in Address correspondence to: John A. Cooper ([email protected]). our lab. Other antibodies and sources were as follows: VASP (rabbit pAb) 5290 © 2009 by The American Society for Cell Biology CARMIL in Cell Migration from Dr. Frank Gertler (MIT); Myosin 1E (rabbit pAb) from Drs. Mira Krendel 964, C2b 598-963, C3 594-954. CBR: C1 964-1078, C2b 964-1072, C3 955-1063. and Mark Mooseker (Yale University); ARPC2/p34 (rabbit pAb) and cortactin C-terminal region: C1 1079-1371, C2b 1073-1372, C3 1064-1372. The acidic (mouse mAb 4F11) from Upstate Millipore (Lake Placid, NY); VASP (rabbit, regions are located between residues 878-889, 899-911, and 937-955 in C1, pAb) from Calbiochem (La Jolla CA); giantin (rabbit, pAb) from Covance 874-905 and 929-945 in C2 and 889-903 in C3. The verprolin-like sequence (Madison, WI); Myosin-IIA and Myosin-II B (rabbit, pAbs) from Covance and is located between residues 702-735 of C1, 705-738 in C2 and residues Dr. Paul Bridgman (Washington University); paxillin (mouse, mAb) from 700-733 of C3. BD Bioscience (San Jose, CA); Trio (goat pAb) from Biotechnology (Santa Cruz, CA); and actin (mouse mAb C4), a gift from Dr. James Lessard Cell Culture, Transfection, and Knockdown (University of Cincinnati). Antibodies to ␣-tubulin (mouse, mAb), acety- lated tubulin (mouse, mAb), ␥-tubulin (mouse, mAb), and FLAG (mouse, Human HT-1080 cells (ATCC, Manassas, VA) and human embryonic kidney mAb) were from Sigma-Aldrich, as was FLAG M2 affinity beads. Anti- HEK293T cells were grown in DMEM (GIBCO BRL, Rockville, MD) supple- green fluorescent protein (GFP; rabbit, pAb), Dynabeads M-280 sheep mented with 10% calf serum (GIBCO) in an atmosphere containing 5% CO2. anti-rabbit IgG, and HRP- and Alexa-conjugated secondary antibodies Cells were transfected with FuGENE6 (Roche, Indianapolis, IN) or Lipo- were from Invitrogen (Carlsbad, CA). fectamine 2000 (Invitrogen) according to the manufacturer’s instructions. For overexpression, cells were fixed 48 h after transfection. To knock down human CARMIL1 and 2, we targeted the coding region cDNA Cloning and RT-PCR sequences ATGCCATTGTTCATCTGGAT and GCAAAGATGGCGAGAT- Human total RNA was purified from HeLa cells using an RNeasy kit (QIAGEN, CAAG, respectively. BLAST searches against the human genome revealed no Valencia, CA), and 30 ng was reverse-transcribed to first-strand cDNA using other targets. A scrambled sequence, CAGTCGCGTTTGCGACTGG, was Superscript (Invitrogen). Using this cDNA as template, PCR amplification with used as a control. Pairs of complementary oligonucleotides were annealed specific primer pairs (Supplemental Table S1) produced cDNA clones for full- and inserted into an short hairpin RNA (shRNA)-expression vector, pSUPER, length human CARMIL1 and 2. according to the manufacturer’s instructions
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Gene Correction for SCID-X1 in Long-Term Hematopoietic Stem Cells
    Corrected: Author correction; Author correction ARTICLE https://doi.org/10.1038/s41467-019-09614-y OPEN Gene correction for SCID-X1 in long-term hematopoietic stem cells Mara Pavel-Dinu1, Volker Wiebking 1, Beruh T. Dejene1, Waracharee Srifa1, Sruthi Mantri1, Carmencita E. Nicolas1, Ciaran Lee 2, Gang Bao2, Eric J. Kildebeck3, Niraj Punjya1,6, Camille Sindhu1, Matthew A. Inlay4, Nivedita Saxena1, Suk See DeRavin5, Harry Malech5, Maria Grazia Roncarolo1, Kenneth I. Weinberg1 & Matthew H. Porteus 1 1234567890():,; Gene correction in human long-term hematopoietic stem cells (LT-HSCs) could be an effective therapy for monogenic diseases of the blood and immune system. Here we describe an approach for X-linked sSevere cCombined iImmunodeficiency (SCID-X1) using targeted integration of a cDNA into the endogenous start codon to functionally correct disease- causing mutations throughout the gene. Using a CRISPR-Cas9/AAV6 based strategy, we achieve up to 20% targeted integration frequencies in LT-HSCs. As measures of the lack of toxicity we observe no evidence of abnormal hematopoiesis following transplantation and no evidence of off-target mutations using a high-fidelity Cas9 as a ribonucleoprotein complex. We achieve high levels of targeting frequencies (median 45%) in CD34+ HSPCs from six SCID-X1 patients and demonstrate rescue of lymphopoietic defect in a patient derived HSPC population in vitro and in vivo. In sum, our study provides specificity, toxicity and efficacy data supportive of clinical development of genome editing to treat SCID-Xl. 1 Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford University, Stanford, CA 94305, USA. 2 Department of Bioengineering, Rice University, Houston, TX 77030, USA.
    [Show full text]
  • Final Copy 2019 10 01 Hawo
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Haworth, Simon Title: The use of genetic data in dental epidemiology to explore the causes and consequences of caries and periodontitis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. The use of genetic data in dental epidemiology to explore the causes and consequences of caries and periodontitis Simon Haworth A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of PhD in the Faculty of Health Sciences, September 2019 Word count: 77,472 words 1 Abstract The major dental diseases are caries and periodontitis.
    [Show full text]
  • GWAS for Meat and Carcass Traits Using Imputed Sequence Level Genotypes in Pooled F2-Designs in Pigs
    INVESTIGATION GWAS for Meat and Carcass Traits Using Imputed Sequence Level Genotypes in Pooled F2-Designs in Pigs Clemens Falker-Gieske,*,1,2 Iulia Blaj,†,2 Siegfried Preuß,‡ Jörn Bennewitz,‡ Georg Thaller,† and Jens Tetens*,§ *Department of Animal Sciences, Georg-August-University, 37077 Göttingen, Germany, †Institute of Animal Breeding and Husbandry, Kiel University, 24118 Kiel, Germany, ‡Institute of Animal Husbandry and Breeding, University of § Hohenheim, 70599 Stuttgart, Germany, and Center for Integrated Breeding Research, Georg-August-University, 37077 Göttingen, Germany ORCID IDs: 0000-0001-9160-1909 (C.F.-G.); 0000-0002-8744-3415 (I.B.); 0000-0002-6782-2039 (G.T.); 0000-0001-5352-464X (J.T.) ABSTRACT In order to gain insight into the genetic architecture of economically important traits in pigs KEYWORDS and to derive suitable genetic markers to improve these traits in breeding programs, many studies have Genome wide been conducted to map quantitative trait loci. Shortcomings of these studies were low mapping resolution, association large confidence intervals for quantitative trait loci-positions and large linkage disequilibrium blocks. Here, study we overcome these shortcomings by pooling four large F2 designs to produce smaller linkage Whole genome disequilibrium blocks and by resequencing the founder generation at high coverage and the F1 generation sequencing at low coverage for subsequent imputation of the F2 generation to whole genome sequencing marker Imputation density. This lead to the discovery of more than 32 million variants, 8 million of which have not been Meat previously reported. The pooling of the four F2 designs enabled us to perform a joint genome-wide carcass association study, which lead to the identification of numerous significantly associated variant clusters on and production chromosomes 1, 2, 4, 7, 17 and 18 for the growth and carcass traits average daily gain, back fat thickness, traits meat fat ratio, and carcass length.
    [Show full text]
  • Genome-Wide Association Analysis in Humans Links Nucleotide Metabolism to Leukocyte Telomere Length
    ARTICLE Genome-wide Association Analysis in Humans Links Nucleotide Metabolism to Leukocyte Telomere Length Chen Li,1,3,85 Svetlana Stoma,2,3,85 Luca A. Lotta,1,85 Sophie Warner,2,85 Eva Albrecht,4 Alessandra Allione,5,6 Pascal P. Arp,7 Linda Broer,7 Jessica L. Buxton,8,9 Alexessander Da Silva Couto Alves,10,11 Joris Deelen,12,13 Iryna O. Fedko,14 Scott D. Gordon,15 Tao Jiang,16 Robert Karlsson,17 Nicola Kerrison,1 Taylor K. Loe,18 Massimo Mangino,19,20 Yuri Milaneschi,21 Benjamin Miraglio,22 Natalia Pervjakova,23 Alessia Russo,5,6 Ida Surakka,22,24 Ashley van der Spek,25 Josine E. Verhoeven,21 Najaf Amin,25 Marian Beekman,13 Alexandra I. Blakemore,26,27 Federico Canzian,28 Stephen E. Hamby,2,3 Jouke-Jan Hottenga,14 Peter D. Jones,2 Pekka Jousilahti,29 Reedik Ma¨gi,23 Sarah E. Medland,15 Grant W. Montgomery,30 Dale R. Nyholt,15,31 Markus Perola,29,32 Kirsi H. Pietila¨inen,33,34 Veikko Salomaa,29 Elina Sillanpa¨a¨,22,35 H. Eka Suchiman,13 Diana van Heemst,36 Gonneke Willemsen,14 Antonio Agudo,37 Heiner Boeing,38 Dorret I. Boomsma,14 Maria-Dolores Chirlaque,39,40 Guy Fagherazzi,41,42 Pietro Ferrari,43 Paul Franks,44,45 Christian Gieger,4,46,47 Johan Gunnar Eriksson,48,49,50 Marc Gunter,43 Sara Ha¨gg,17 Iiris Hovatta,51,52 Liher Imaz,53,54 Jaakko Kaprio,22,55 Rudolf Kaaks,56 Timothy Key,57 (Author list continued on next page) Leukocyte telomere length (LTL) is a heritable biomarker of genomic aging.
    [Show full text]
  • Additional File 1: SDS-PAGE Fractionation with Silver Staining of Bone Marrow Supernatant from Six Β- Thalassemia/Hb E Patients (P) and Four Donors (D)
    Additional file 1: SDS-PAGE fractionation with silver staining of bone marrow supernatant from six β- thalassemia/Hb E patients (P) and four donors (D). Uniprot KB P1 P2 P3 P4 P5 P6 D1 D2 D3 D4 CU025_HUMAN 6.53 5.98 5.59 6.25 7.38 8.09 6.8 5.81 7.81 6.94 CUL3_HUMAN 0 0 7.6 3.56 5.69 0 11.01 0 0 0 CUL4B_HUMAN 8.61 8.11 8.56 9.46 9.54 7.4 9.26 9 9.57 10.67 CUX2_HUMAN 1.8 6.51 2.99 5.02 2.29 1.98 2.74 2.61 2.11 2.8 CWC22_HUMAN 8.36 8.89 8.05 8.62 8.13 8.77 9.12 8.74 8.06 8.59 CYB5_HUMAN 5.78 9.72 5.26 9.47 0 5.77 0 9.68 0 10 D19L2_HUMAN 0 0 0 0 4.94 0 6.18 0 0 8.56 DAZP2_HUMAN 0 7.1 3.54 3.88 0 0 3.79 3.96 5.3 8.73 DCA15_HUMAN 7.53 7.25 7.02 6.11 9.86 7.84 5.82 3.91 6.34 6.15 DCD2C_HUMAN 5.71 6.39 5.29 6.49 8.37 9.08 5.91 6.57 7.8 0 DCLK2_HUMAN 9.4 9.82 8.48 10.6 0 0 9.76 8.47 0 0 DDX_HUMAN 9.65 9.54 9.63 9.79 9.78 9.82 9.68 9.78 9.96 9.86 DDX5_HUMAN 8.48 8.65 9.79 8.16 8.11 8.3 8.25 8.09 8.46 8.16 DGCR8_HUMAN 7.82 8.93 10.83 6.47 9.7 11.78 9.64 12.25 9.57 8.36 DHH_HUMAN 8.08 8.14 8.49 8.48 8.16 8.5 8.13 8.22 8.09 8.48 DHX30_HUMAN 7.53 6.29 6.37 5.6 0 0 10.08 6.27 0 0 DHX8_HUMAN 11.9 12.02 12.07 11.92 12.06 12.07 12.07 12.06 12.07 12.03 DLGP2_HUMAN 13.5 0 0 0 13.73 13.72 0 13.72 13.72 13.72 DMXL2_HUMAN 0 0 0 2.97 4.72 6.18 0 4.59 6.91 7.03 DNA2_HUMAN 5.51 4.76 3.47 3.31 3.68 4.53 3.67 5.95 4.11 6.19 DPOD3_HUMAN 0 8.42 0 0 0 8.19 0 0 0 8.86 DPYL4_HUMAN 6.11 4.67 3.91 7.93 6.53 9.88 7.66 2.81 5.1 4.63 DSCL1_HUMAN 0 0 0 7.25 0 7.07 0 0 0 7.87 DUS8_HUMAN 7.32 7.12 7.05 8.17 6.9 7.19 7.45 7.78 6.52 7.17 DYH17_HUMAN 6.25 0 5.34 0 4.32 7.65 6.05
    [Show full text]
  • The Fusion Gene Landscape in Taiwanese Patients with Non-Small Cell Lung Cancer
    cancers Article The Fusion Gene Landscape in Taiwanese Patients with Non-Small Cell Lung Cancer Ya-Sian Chang 1,2,3,4, Siang-Jyun Tu 2, Ju-Chen Yen 1, Ya-Ting Lee 1, Hsin-Yuan Fang 5 and Jan-Gowth Chang 1,2,3,6,7,* 1 Epigenome Research Center, China Medical University Hospital, Taichung 404332, Taiwan; [email protected] (Y.-S.C.); [email protected] (J.-C.Y.); [email protected] (Y.-T.L.) 2 Department of Laboratory Medicine, China Medical University Hospital, Taichung 404332, Taiwan; [email protected] 3 Center for Precision Medicine, China Medical University Hospital, Taichung 404332, Taiwan 4 Department of Medical Laboratory Science and Biotechnology, China Medical University, Taichung 404333, Taiwan 5 Department of Thoracic Surgery, China Medical University Hospital, Taichung 404332, Taiwan; [email protected] 6 School of Medicine, China Medical University, Taichung 404333, Taiwan 7 Department of Bioinformatics and Medical Engineering, Asia University, Taichung 41354, Taiwan * Correspondence: [email protected]; Tel.: +886-4-22052121 Simple Summary: Human cancer genomes show a variety of alterations, such as single base changes, deletions, insertions, copy number changes, and gene fusions. Analyzing fusion gene transcripts may yield a novel and effective approach for selecting cancer treatments. However, few comprehensive analyses of gene fusions in non-small cell lung cancer (NSCLC) patients have been performed. Here, we characterized the fusion gene landscape of NSCLC in a case study of Taiwanese lung cancer patients. We concluded that some fusion genes likely play driver roles in carcinogenesis, while others Citation: Chang, Y.-S.; Tu, S.-J.; Yen, act as passengers.
    [Show full text]
  • Identification of Potential and Novel Target Genes in Pituitary Prolactinoma by Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423732; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of potential and novel target genes in pituitary prolactinoma by bioinformatics analysis 1 2 3 4* Vikrant Ghatnatti , Basavaraj Vastrad , Swetha Patil , Chanabasayya Vastrad , Iranna Kotturshetti5 1. Dept of Endocrinology/Medicine, J N Medical College, Belagavi 590010, Karnataka, India. 2. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 3. Dept of Obstetrics and Gynaecology, J N Medical college, Belagavi 590010, Karnataka, India. 4. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India. 5. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron 562209, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India Abstract bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423732; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Pituitary prolactinoma is one of the most complicated and fatally pathogenic pituitary adenomas. Therefore, there is an urgent need to improve our understanding of the underlying molecular mechanism that drives the initiation, progression, and metastasis of pituitary prolactinoma. The aim of the present study was to identify the key genes and signaling pathways associated with pituitary prolactinoma using bioinformatics analysis. Transcriptome microarray dataset GSE119063 was acquired from Gene Expression Omnibus datasets, which included 5 pituitary prolactinoma samples and 4 normal pituitaries samples.
    [Show full text]
  • Supplemental Section
    Supplemental section Multi-omics profiling reveals key signaling pathways in ovarian cancer controlled by STAT3 Tiangong Lu, Armand Bankhead III, Mats Ljungman, and Nouri Neamati Figure legends Figure S1: Generation of STAT3 KO ovarian cancer cell lines using CRISPR-Cas9 genome editing. Cells were transfected with 3 different STAT3 gRNAs, Cas9 nuclease mRNA and cleavage selection vectors. Flow cytometry analysis of OFP-positive cells showing percentages for each guide RNA in (A). SKOV3, (B). OVCAR3, OVCAR8 and HEY cells using guide RNAs for the STAT3 gene 72 hours post-transfection. STAT3 protein expression for each gRNA was detected by Western blot. (C). No STAT3 protein expression was detected in single cell cloned STAT3 KO ovarian cancer cells. NFC = normalized fold change. Figure S2: Characterization of STAT3 KO ovarian cancer cell lines. (A). Migration capability of WT and STAT3 KO cells was determined by a wound-healing assay. Bars from each cell line indicate wound area at 0h and 24h in percentage normalized to control. (B). Cell viability of spheroids at Days 2, 4 and 6 of WT and STAT3 KO cells in 3D spheroid assay. Luminescence representing cell viability was measured using the CellTiter-Glo® 3D Cell Viability Assay. Error bars indicate mean ± SEM. and **p < 0.01, ***p < 0.001. Figure S3: STAT3 KO inhibits tumor growth in mouse xenograft models. Image of tumors in nude mice (n = 5) injected with SKOV3, HEY, OVCAR3 and OVCAR8 WT/ STAT3 KO cells. Figure S4: Overlap of Gene Set Enrichment Analysis (GSEA) enriched gene sets for STAT3 knockout in three ovarian cancer cell lines (A) Common gene sets are listed with gene sets enriched in SKOV3 multi-omic analysis highlighted in bold.
    [Show full text]
  • Roman Umn 0130E 18396.Pdf (2.096Mb Application/Pdf)
    Pharmacogenetic Investigations Using Community-Based Participatory Research to Address Health Disparities in Minnesota Hmong A Dissertation SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY Joseph Malak Roman IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Adviser: Robert J Straka, Pharm.D., F.C.C.P. August 2017 © Joseph Malak Roman 2017 Acknowledgements This dissertation would not have been completed unless I had the support from a multitude of individuals from the Experimental and Clinical Pharmacology (ECP) Department and the College of Pharmacy at the University of Minnesota. First and foremost, I’m beyond grateful to my advisor, Dr. Robert Straka, for all his support, guidance and patience that he offered me throughout my training. Looking back on where I started and who I’m today, professionally, I realize that my career development was the result of continuous feedback and ongoing assessment of my work during the graduate school. I also want to thank Dr. Kathleen Culhane-Pera for being an outstanding community collaborator and support to my success. Indeed, she is an example to look up to when working with special and underserved communities. Finally, I want to thank the Hmong board members for their important role in making the university-community partnership very successful, the GOUT-H study volunteers, the study participants and the ECP faculty and staff. iii Dedication This dissertation is dedicated to my dad and grandmother whom I miss dearly. iv Abstract Introduction: Pharmacogenomics is an approach to personalizing therapy to help patients achieve their therapeutic goals with the least possible adverse events.
    [Show full text]
  • Capping Protein Regulator and Myosin 1 Linker 3 Is Required for Tumor Metastasis
    Published OnlineFirst November 6, 2019; DOI: 10.1158/1541-7786.MCR-19-0722 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS Capping Protein Regulator and Myosin 1 Linker 3 Is Required for Tumor Metastasis Huan Wang1, Chao Wang2, Guang Peng2, Doudou Yu1, Xin-Gang Cui3,4, Ying-Hao Sun2, and Xiaojing Ma1,5 ABSTRACT ◥ Metastasis accounts for 90% of deaths caused by solid tumors, but protein, that are involved in actin cytoskeletal organization, which the multitude of mechanisms underlying tumor metastasis remains is required for cell polarization and focal adhesion formation. poorly understood. CARMIL1 and 2 proteins are capping protein Moreover, molecular pathway enrichment analysis reveals that lack (CP) interactants and multidomain regulators of actin-based mobil- of CARMIL3 leads to loss of cell adhesions and low CARMIL3 ity. However, CARMIL30s function has not been explored. Through expression in breast cancer patient specimens is implicated in bioinformatic metadata analysis, we find that high CARMIL3 epithelial–mesenchymal transition. We also find that CARMIL3 expression correlates with poor survival of patients with breast and sustains adherens junction between tumor cells. This is accom- prostate cancer. Functional studies in murine and xenograft tumor plished by CARMIL3 maintaining E-cadherin transcription down- models by targeted diminution of CARMIL3 expression or forced stream of HDACs through inhibiting ZEB2 protein level, also via expression demonstrate that CARMIL3 is vitally important for protecting b-catenin from ubiquitination-mediated degradation tumor metastasis, especially for metastatic colonization. Consistent initiated by the destruction complex. with a predominantly cell-intrinsic mode of action, CARMIL3 is also crucial for tumor cell migration and invasion in vitro.
    [Show full text]
  • Computational Methods for Studying Parent-Of-Origin Effects Via Reciprocal Mouse Crosses
    COMPUTATIONAL METHODS FOR STUDYING PARENT-OF-ORIGIN EFFECTS VIA RECIPROCAL MOUSE CROSSES Daniel G. Oreper A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in par- tial fulfillment of the requirements for the degree of Doctor of Philosophy in the Curriculum of Bioinformatics and Computational Biology Chapel Hill 2018 Approved by: Daniel Pomp Leonard McMillan Michael Love William Valdar Fernando Pardo-Manuel de Villena ©2018 Daniel G. Oreper ALL RIGHTS RESERVED ii ABSTRACT Daniel G. Oreper: Computational methods for studying parent-of-origin effects via reciprocal mouse crosses (Under the direction of William Valdar) Imprinted genes have been linked with diseases ranging from cancer, to metabolic syndromes, to psychiatric illness. For psychiatric illness in particular, numerous lines of evidence, both from human and mouse studies, suggest imprinted genes affect behavior along with brain development and function. Nonetheless, the effect of imprinted genes on most complex traits is not well characterized. Moreover, the architecture of environment-by-imprinting effects is even less well-understood. The lack of characterization is likely due to the general difficulty of observing “parent-of-origin effects” (POEs), which typically arise in mammals from maternal effects—or from imprinting. To study POE/environment-by-POE, we can employ a relatively neglected but maximally powerful POE- detection system: the reciprocal cross (RX). Towards this end, we develop and apply computational methods for designing and analyzing RX experiments. Here, these techniques are applied in the context of RXs of inbred lines of mice, with a focus on behavior—but these techniques could be similarly employed in any model organism subject to POE, and on any complex trait.
    [Show full text]