Universidade Estadual De Campinas Instituto De Biologia

UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA

SUELLEN APARECIDA ZATTI

SISTEMÁTICA E DISTRIBUIÇÃO DE MIXOSPORÍDEOS (CNIDARIA: MYXOZOA) PARASITOS DE TUCUNARÉ (Cichla spp.) E DOURADA (Brachyplatystoma rousseauxii) NA BACIA AMAZÔNICA

SYSTEMATIC AND DISTRIBUTION OF MYXOSPOREANS (CNIDARIA: MYXOZOA) PARASITES OF TUCUNARÉ (Cichla spp.) AND DOURADA (Brachyplatystoma rousseauxii) IN THE AMAZON BASIN

CAMPINAS 2017

SUELLEN APARECIDA ZATTI

SISTEMÁTICA E DISTRIBUIÇÃO DE MIXOSPORÍDEOS (CNIDARIA: MYXOZOA) PARASITOS DE TUCUNARÉ (Cichla spp.) E DOURADA (Brachyplatystoma rousseauxii) NA BACIA AMAZÔNICA

SYSTEMATIC AND DISTRIBUTION OF MYXOSPOREANS (CNIDARIA: MYXOZOA) PARASITES OF TUCUNARÉ (Cichla spp.) AND DOURADA (Brachyplatystoma rousseauxii) IN THE AMAZON BASIN

Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Doutora em Biologia Animal, na área de Biodiversidade Animal.

Thesis presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor in Animal Biology, in the area of Animal Biodiversity.

ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA TESE DE DOUTORADO DEFENDIDA PELA ALUNA SUELLEN APARECIDA ZATTI E ORIENTADA PELO PROF. DR. EDSON APARECIDO ADRIANO.

Orientador: Prof. Dr. Edson Aparecido Adriano

CAMPINAS 2017

Campinas, 06 de outubro de 2017

COMISSÃO EXAMINADORA

Prof. Dr. Edson Aparecido Adriano (Presidente)

Prof. Dr. Eduardo Makoto Onaka

Profa. Dra. Márcia Mayumi Ishhikawa

Prof. Dr. Anderson Luis Alves

Prof. Dr. Adriano Cappellazzo Coelho

Os membros da Comissão Examinadora acima assinaram a Ata de Defesa, que se encontra no processo de vida acadêmica do aluno.

AGRADECIMENTOS

À Deus por me conceder o dom da vida, por colocar sonhos em meu coração e me dar força para conquistá-los. À minha família pelo amor e suporte. Especialmente à minha mãe Nice, que não me deixou desistir do doutorado ainda no começo frente as dificuldades de financiamento da pesquisa e bolsa. À minha avó Vita, que partiu neste meu último ano de doutorado, e que tanto cuidou de mim. À CAPES (Coordenação de Aperfeiçomento de Pessoal de Nível Superior), que concedeu a bolsa de Doutorado (2014/2017) e a bolsa de Doutoramento Sanduíche no Exterior (PDSE), que permitiu a condução de parte desta pesquisa na Oregon State University-OSU, Corvallis, OR, EUA (2015/2016) (BEX: 6729/2015-00). Ao Prof. Dr. Edson Adriano, pela orientação e suporte desde o Mestrado, pela oportunidade de estudar este grupo de organismos tão particular que me fez crescer imensamente como pesquisadora e por todas as oportunidades que me ofereceu, talvez a maior delas, a de trabalhar com organismos da Bacia Amazônica. Ao Prof. Dr. Antônio Augusto Mendes Maia (USP-Pirassununga), por todos esses anos de co-orientação, suporte e amizade. Obrigada por tudo, pelas longas conversas, pelas coletas, pelas várias ligações feitas para mim quando eu estava estagiando no exterior ou em Minas Gerais. Mais que um professor, ganhei um grande amigo, um exemplo que quero seguir! Aos professores, funcionários e alunos do Departamento de Biologia Animal da Unicamp. Em especial à Profa. Dra. Silmara Alegrette, pelo suporte em todas as fases desse doutorado, desde as mais difíceis. À Profa. Dra. Maura Franco pela confiança em abrir as portas do seu laboratório para que eu pudesse realizar minhas análises. À Profa. Dra. Marlene, umas das pessoas mais queridas que já encontrei neste meio acadêmico. Sempre disposta a me ajudar, me dar bons conselhos e a me fornecer todo o chocolate necessário nos dias que as “PCRs” insistiam em dar errado. Ao Prof. Dr. Danilo Miguel, pela amizade, torcida e pela confiança. Me senti muito honrada em ser sua aluna de estágio de docência, minha primeira experiência nesta área. Quero ser um dia uma professora como você.

Toda a minha gratidão aos professores, alunos e funcionários com os quais eu convivi e trabalhei no Department of Microbiology da Oregon State University, Oregon, Estados Unidos. Hoje posso me considerar uma pessoa privilegiada por ter realizado esse sonho que tinha desde que comecei minha carreira acadêmica. Foi difícil, era uma época de grande crise financeira no país, mas eu nunca desisti. À Profa. Dra. Jerri Bartholomew, umas das pesquisadoras mais importantes na minha área, por ter aberto as portas do seu laboratório para as minhas pesquisas, por todo carinho, incentivo, motivação e conhecimento e ao seu marido Dr. John pelo carinho e hospitalidade. Ao Dr. Stephen Atkinson pela orientação durante e após minha passagem pela OSU, por ter aceitado o desafio de me ajudar com minhas análises moleculares e filogenéticas, pelas longas discussões e comentários acerca da minha pesquisa, artigos e tese, pela enorme generosidade. Ao Prof. Dr. Maurício Laterça que tive o grande prazer de conhecer durante minha estadia na OSU e compartilhar o mesmo office, expectativas, alegrias e algumas “PBRs”. Obrigada por tudo, nunca esquecerei seus conselhos. À Dr. Sascha Hallett, Dr. Rich Holt, Dr. Julie Alexander, Ruth Milston-Clements, Sarah Vojnovich, Gema Alama Bermejo e Claire Katherine Howell. Thank you, guys, for sharing all yours experience with me, to be always so kind and helpful in all my moment in Corvallis and at OSU. It was one of the most memorable moments of my life and you have become everything easier! Hope to see you soon again! Aos amigos "brazilians" e “curva de rio” que conheci em Corvallis. Quando viajei não tinha expectativa de encontrar brasileiros pela cidade, mas Deus me presenteou com uma enorme família. Com vocês tudo era mais fácil, mesmo passar o Natal tão longe de nossas famílias. Muito obrigada, não poderia ter encontrado pessoas melhores! Leila, Déborah, Celinho, Lina, Bruno, Aninha e as gêmeas, André, Clarisse, Fernanda, Francine, Luciana, Mauro, Silvania, Gustavo, Rodrigo, Taynara, Carla, Dani, Rodrigo, Aninha Barros e Pedro. À Juliana Jordão, amiga desde a época da graduação. Obrigada Ju, pelo companheirismo, amizade vencida pela distância, pelo incentivo, por aquele abraço no aeroporto que nunca vou esquecer. Você reflete o verdadeiro significado da palavra amizade!

Uma pesquisa que envolve um extenso trabalho de campo, não poderia deixar de agradecer a todos que colaboraram com esse processo. Ao Dr. Lincon Corrêa, pela ajuda nas coletas e a todos os pescadores e moradores da região Amazônica que de alguma forma colaboraram para o desenvolvimento deste trabalho. Muito obrigada pela ajuda, recepção e por generosamente compartilharem tamanho conhecimento. Aos meus amigos pesquisadores da USP de Pirassununga, Dra. Márcia, Tiago, Juliana, Kássia, Gabriel e Júlio e à Dra. Isabel Müller, pela amizade e conselhos. Aos amigos que estão sempre a nos apoiar e levantar. Sabemos que as dificuldades neste nosso meio são enormes, as alegrias são muitas, mas muitas são as preocupações, dificuldades e frustrações. À turma de graduação da Universidade Federal de Alfenas, Bio 2006 barra 1 e às mestras da Unifesp, Camila Passos, Camila Uzam, Carina Uliam, Thábata, Tatiana e Valéria. À Vanessa Perdigão e Taís Bonatti, mais que amigas, vocês foram meu suporte dentro e fora da Unicamp. Muito obrigada pela torcida e carinho em cada momento. Sem o apoio e suporte diários de vocês eu não teria conseguido. Vocês são a melhor parte de Campinas. Ao César, pela ajuda com os softwares, amizade e conselhos, Gabriela, Júlia Molina, Diego e demais alunos do Departamento de Parasitologia, pela grande amizade compartilhada neste tempo de convívio. À minha amiga e roommate Juliana Lorensi (Ju), pela amizade sincera, pelo suporte e torcida em todos os momentos bons e difíceis (que foram muitos). Obrigada demais, você é parte de tudo isso! A todos que direta ou indiretamente contribuíram para que esse sonho se tornasse realidade. O grande aprendizado aqui, certamente não está nos resultados e nem nos artigos publicados, mas na persistência, resiliência e acreditar que vai dar tudo certo! “In the middle of difficulty lies opportunity”. Muito obrigada!

RESUMO

Myxozoa são cnidários caracterizados por possuírem esporos multicelulares. Até o presente momento, mais de 2.400 espécies foram descritas parasitando principalmente peixes e invertebrados aquáticos. Esse grupo de endoparasitos vem atraindo atenção de pesquisadores não somente pelas patologias e danos causados aos peixes de ambiente natural e de cultivo, mas também pela complexidade do seu ciclo biológico, simplificação morfológica e sua inigmática evolução a partir dos cnidários de vida livre. Com o recente avanço das técnicas de biologia molecular no estudo de taxonomia e sistemática destes organismos, divergências taxonômicas surgiram em relação às metodologias morfológicas tradicionais. Além disso, as análises filogenéticas com base em dados moleculares se mostram incongruentes com as classificações atuais, o que têm levado a importantes revisões taxonômicas do grupo. A Bacia Amazônica é a região com maior diversidade de peixes de água doce do mundo, porém os estudos de taxonomia de mixosporídeos na região são escassos e a maioria das pesquisas até aqui realizadas foram baseadas apenas em dados morfológicos. Dos peixes que compõem a ictiofauna da Bacia Amazônica, merecem destaque pela importância ecológica e econômica os cicliformes do gênero Cichla (tucunarés) e o siluriforme Brachyplatystoma rousseauxii (dourada). Estes são peixes que possuem em comum a ampla distribuição geográfica ao longo de toda a bacia e elevado valor comercial. Diante deste contexto, este trabalho teve como objetivo desenvolver estudos de taxonomia e distribuição, baseando-se em dados morfológicos e do sequenciamento de regiões do DNA ribossomal, de espécies de mixosporídeos encontradas parasitando duas espécies de Cichla spp. e B. rousseauxii em quatro rios da Bacia Amazônica: município de Santarém no Estado do Pará (rio Tapajós), município de Vitória do Jari no Estado do Amapá (rios Amazonas e Jari) e município de Manacapuru no Estado do Amazônas (rio Solimões). Em peixes do gênero Cichla foram descritas quatro novas espécies de mixosporídeos: Ceratomyxa n. sp. 1 foi encontrada na vesícula biliar e Henneguya n. sp. 1 nos filamentos branquiais de Cichla monoculus no rio Tapajós; Henneguya n. sp. 2 foi encontrada parasitando os filamentos branquiais de Cichla pinima no rio Tapajós e Henneguya n. sp. 3 encontrada na nadadeira também de C. monoculus, porém do rio Jari. Na dourada foi descrita uma nova espécie do gênero Ceratomyxa (Ceratomyxa n. sp. 2) parasitando a vesícula biliar em espécimes oriundas das três regiões da Bacia Amazônica

foco do estudo. Análises morfológicas e o sequenciamento do marcador 18S confirmaram que as amostras de Ceratomyxa n. sp. 2 oriundas das três diferentes regiões correspondem à mesma espécie. Os sequenciamentos da região ribossomal mais variável, ITS-1, mostraram que apesar da distância geográfica entre as regiões estudadas, não houve variação genética nas amostras das diferentes regiões, sugerindo que esta ausência de variabilidade pode estar relacionada com a extensa migração da dourada, que mantém o fluxo gênico dentro das populações do parasito. As análises filogenéticas mostraram que as espécies do gênero Ceratomyxa parasitas de peixes da Bacia Amazônica formam uma linhagem de água doce irmã ao clado composto pela grande maioria das espécies marinhas deste gênero. Este fato levantou a discussão sobre a importância da Amazônia na radiação das espécies do gênero Ceratomyxa e o possível papel das insurgências marinhas na diversificação e evolução do grupo.

Palavras-chave: Amazônia, Cichla monoculus, Cichla pinima, 18S rDNA, ITS-1

ABSTRACT

Myxozoa are cnidarians characterized by transmission via multicellular spores. Until now, more than 2,400 species have been described, parasitizing most commonly fish and aquatic invertebrates. This group have been attracted extensive attention not only due to the pathogenic potential of many species and damages that it may cause to its hosts in both wild and in aquacultures, but also by the complexity of its life cycle, morphological simplification and its inigmatic evolution from the free-living cnidarians. The advances in molecular biology tools and its uses in the systematic of Myxozoa in the past few years have revealed inconsistencies between molecular-based phylogenies and traditional morphology-based, which often lead to revision of the current taxonomy. The Amazon basin harbours the world's greatest diversity of freshwater fish in the world, but the taxonomic studies of myxosporids in that region is still in its initial stages. The most of the studies performed with Myxozoa in Amazon so far have been based only on comparative morphology. Cichla spp. (peacock bass) and Brachyplatystoma rousseauxii (goliath catfish) are one of the most ecologically and economically important fish from the Amazon basin. These fish have in common the wide geographic distribution throughout the basin and high commercial value. In this context, the main aim of the present study was to develop a taxonomy and species distribuition studies, based on morphological data and sequencing of ribosomal DNA, of new myxozoan species found to parasitize Cichla spp. and B. rousseauxii in four rivers of the Amazon basin: Pará State (Tapajós River); Amapá State (Amazonas and Jari rivers) and Amazonas State (Solimões River). A total of four new myxosporean species were described parasiting Cichla: Ceratomyxa n. sp. 1 was described from the gall bladder and Henneguya n. sp. 1 from the gill filaments of Cichla monoculus from Tapajós River; Henneguya n. sp. 2 was also found infecting the gill filaments but from C. pinima from Tapajós River, and Henneguya n. sp. 3 was described parasiting the fins of Cichla monoculus from Jari River. In goliath catfishes, Ceratomyxa n. sp. 2 was described infecting the gallbladder of specimes from three distinct areas of the Amazon basin. Morphology and 18S sequencing of Ceratomyxa n. sp. 2 from the three distinct localities were identical. ITS-1 sequencing showed absence of variability in the sequences of the isolates despite wide geographic separation of the collection localities. This suggested a high gene flow among the parasite populations as result of the fish host

migratory behavior. Phylogenetic analysis showed a basal position for the Amazonian freshwater Ceratomyxa lineage relative to the larger, fully marine clade. These findings raised the discussion of the importance of the Amazon in the radiation of species of the genus Ceratomyxa and the role of marine insurgencies in the diversification and evolution of the group.

Keywords: Amazon, Cichla monoculus, Cichla pinima, 18S rDNA, ITS-1

LISTA DE ILUSTRAÇÕES

Figura 1: Fotografias das espécies de Cichla spp. que ocorrem ao longo da Bacia Amazônica. Modificada de Willis et al. (2012)...... 32

Figura 2: Brachyplatystoma rousseauxii Castelnau, 1855 coletada no rio Tapajós, Santarém, Pará, outubro de 2014. Foto: Suellen Aparecida Zatti...... 34

Capítulo 1 Fig. 1. Light photomicrographs of plasmodia of Ceratomyxa n. sp. 1 parasite of the gallbladder of Cichla monoculus. A: elongated plasmodium with nucleus (large arrow) in the growth centre at the anterior pole (ap), early sporogonic stages (es) and mature myxospores (ms), and a narrow posterior pole (pp). B: young plasmodia. Note spherical early stages (sp) with nuclei (thin arrows) and elongated plasmodium (ep) with nucleus (large arrow) in the growth centre at the anterior pole (ap); no sporogonic stages are present. Bar = 25 µm. Stain = Giemsa...... 45

Fig. 2. Differential interference contrast (A) and brightfield (B) photomicrographs of unstained plasmodia of Ceratomyxa n. sp. 1. A: plasmodium with blunt anterior pole (ap), tapering posterior pole (pp) and containing early sporogonic stages (es). B: mature plasmodium showing growth centre at anterior pole (arrow, ap), early sporogonic stages (es) anteriorally, with mature myxospores (ms) towards the posterior pole (pp). Bars = 20 µm...... 46

Fig. 3. Light photomicrographs of myxospores of Ceratomyxa n. sp. 1. A and B: mature myxospores. Bar = 10 µm...... 47

Fig. 4. Schematic drawing of a mature myxospore of Ceratomyxa n. sp. 1 showing principal measured components SL: spore length, ST: spore thickness, PA: posterior angle. Bar = 10 µm...... 47

Fig. 5. Consensus phylogenetic tree of the ssrDNA sequences of Ceratomyxa n. sp. 1 and other Ceratomyxa species plus Palliatus indecorus and Myxodavisia bulani. GenBank accession numbers are shown after the taxon names. Nodal supports are indicated for maximum likelihood (ML) and maximum parsimony (MP), respectively, with a bootstrap of 1000 replicates. Branches with bootstrap ≤60% support are represented with "-" or are blank...... 50

Capítulo 2

Fig 1. Map of the myxozoan Ceratomyxa n. sp. 2 collection localities in the Amazon basin: Solimões River, Amazonas State; Tapajós River, Pará State and Amazon River, Amapá State. . 62

Fig 4. Schematic drawing of Ceratomyxa n. sp. 2 showing details of the principal measured components. SL: spore length, ST: spore thickness, VL: valves length, PA: posterior angle. Bar = 10 µm...... 67

Fig 5. Schematic representation of part of the ribosomal DNA of Ceratomyxa n. sp. 2, which shows locations of gene regions, PCR primers and the polymorphic loci represented by “Y”, ‘W” and “R”...... 70

Fig 6. Consensus maximum likelihood phylogenetic tree based on ssrDNA sequences of Ceratomyxa n. sp. 2, other Ceratomyxa spp. plus Palliatus indecorus and Myxodavisia bulani. Nodal supports are indicated for maximum likelihood (ML) and maximum parsimony (MP), respectively, with a bootstrap of 1000 replicates. Branches with bootstrap ≤70% support are blank. GenBank accession numbers are shown after taxon names...... 71

Capítulo 3

FIG. 1 Fresh spores in the light microscope using Nomarski differential interference contrast. A: Henneguya n. sp. 1 parasiting the gill filaments of Cichla monoculus from Tapajós River, Pará. B: Henneguya n. sp. 2 found to infecting the gill of Cichla pinima from Tapajós River, Pará. C: Henneguya n. sp. 3 parasite of the fins of Cichla monoculus from Jari River, Amapá. Bars=10 μm...... 89

FIG. 2 Mature spore drawing of the three new species described. A: Henneguya n. sp. 1 parasiting the gill filaments of Cichla monoculus from Tapajós River, PA. B: Henneguya n. sp. 2 found to infecting the gill of Cichla pinima from Tapajós River, PA. C: Henneguya n. sp. 3 parasite of the fins of Cichla monoculus from Jari River, AP. Bars=10 μm...... 90

FIG. 3 Consensus ML phylogenetic tree of the ssrDNA sequences of selected Myxobolus/Henneguya ssrDNA sequences. GenBank accession number is given in parenthesis. Nodal supports are indicated for maximum likelihood (ML) and maximum parsimony (MP), respectively, with a bootstrap of 1000 replicates. Weakly supported nodes (<70) are represented with dashes...... 95

LISTA DE TABELAS

Tabela 1: Lista das espécies de Cichla spp., autor e local de ocorrência, encontradas na Bacia Amazônica. Modificada de Kullander e Ferreira (2006)...... 33

Capítulo 2

Table 1 Comparison of morphometry of Ceratomyxa n. sp. 2 with Amazonian Ceratomyxa spp. with arcuate myxospores...... 68

Table 2 Pairwise identities of ssrDNA sequences from Ceratomyxa species described from Amazon basin fish hosts, adjusted for missing data. The upper triangular matrix shows the number of nucleotide differences; the lower triangular matrix shows the percentage nucleotide difference...... 74

Capítulo 3

TABLE 1 Comparison of the spores dimensions of all Henneguya species described from Amazon basin including range, site of infection, host and geographic region. TL: total spore length, BL: body length, AppL: caudal appendices length, W: width, T: thickness, L: polar capsules length, W: polar capsules width, NPF: number of polar filament coils, dashes: no data...... 93

TABLE 2 Pairwise genetic identity of the ssrDNA sequences from Henneguya species described in Cichla spp., adjusted for missing data. The upper triangular matrix shows the number of differences of nucleotides and the lower triangular matrix shows the differences in terms of percentage of nucleotides...... 94

SUMÁRIO

1. INTRODUÇÃO ...... 18

1.1 Myxozoa: aspectos gerais ...... 18

1.1.1 Origem e radiação do Subfilo Myxozoa ...... 19

1.1.2 Ciclo Biológico ...... 20

1.1.3 Patogenicidade ...... 21

1.1.4 Estudos de Myxozoa no Brasil ...... 23

1.1.5 Taxonomia e estudos evolutivos moleculares ...... 24

1.2 Bacia Amazônica ...... 29

1.3 Cichla spp. e Brachyplatystoma rousseauxii ...... 30

1.3.1 Cichla spp...... 31

1.3.2 Brachyplatystoma rousseauxii Castelnau, 1855 ...... 33

2. JUSTIFICATIVA...... 35

3. OBJETIVOS ...... 37

3.1 Gerais ...... 37

3.2 Específicos ...... 37

4. RESULTADOS ...... 38

CAPÍTULO 1 ...... 40 Amazon waters harbour na ancient freshwater Ceratomyxa lineage (Cnidaria: Myxosporea)

1. Introduction ...... 41

2. Material and Methods ...... 42

2.1. Sampling and morphological analysis...... 42

2.2 DNA extraction, amplification and sequencing ...... 42

2.3 Sequence assembly and phylogenetic analysis ...... 43

3. Results ...... 44

3.1 Morphological description and taxonomic summary...... 44

3.2 Molecular sequencing and phylogenetic analysis ...... 48

4. Discussion ...... 51

5. References ...... 53

CAPÍTULO 2 ...... 58 A lack of genetic diversity in Ceratomyxa n. sp. 2 (Cnidaria, Myxozoa) correlates with the migratory life history of its host, the Amazonian catfish Brachyplatystoma rousseauxii

1. Introduction ...... 59

2. Material and Methods ...... 61

2.1 Fish and parasite sampling ...... 61

2.2 Molecular studies ...... 62

2.3 Sequence assembly, alignment and phylogenetic analyses ...... 63

3. Results ...... 64

3.1 Morphological description and taxonomic summary...... 65

3.2 Molecular and phylogenetic analyses ...... 69

4. Discussion ...... 72

5. References ...... 75

CAPÍTULO 3 ...... 82 Morphology and ssrDNA-based phylogeny of three new Henneguya spp. (Cnidaria: Myxozoa) parasites of cichlids fish from Amazon basin, Brazil

1. Introduction ...... 83

2. Material and Methods ...... 84

2.1 Sampling and morphological analysis ...... 84

2.2 ssrDNA extraction, amplification and sequencing ...... 85

2.3 Sequencing assembly and phylogenetic analysis ...... 86

3. Results ...... 86

3.1 Taxonomic summary and morphological data ...... 87

3.2 Molecular and phylogenetic analysis ...... 90

3.3 Taxonomic affinities: ...... 91

4. Discussion ...... 96

5. References ...... 97

5. CONCLUSÕES GERAIS ...... 103

6. REFERÊNCIAS ...... 105

7. ANEXOS ...... 121

1. INTRODUÇÃO

1.1 Myxozoa: aspectos gerais

Myxozoa (mixozoários) são organismos microscópicos multicelulares, altamente especializados, formadores de esporos, endoparasitos obrigatórios de organismos aquáticos (Kent et al., 2001; Canning e Okamura, 2004; Lom e Dyková, 2006) e apenas recentemente reconhecidos como pertencentes ao Filo Cnidaria (Holland et al., 2010; Nesnidal et al., 2013; Chang et al., 2015; Takeuchi et al., 2015). Parasitam primariamente peixes, tanto de água doce como marinhos, mas também ocorrem em anfíbios e répteis, e, mais recentemente, aves e alguns mamíferos terrestres tem sido registrados como hospedeiros vertebrados. Oligoquetas, poliquetas e briozoários são os hospedeiros invertebrados destes organismos (Bartholomew et al., 2008; Friedrich et al., 2000; Dyjová et al., 2007; Prunescu et al., 2007; Székely et al., 2015).

São cerca de 2.400 espécies descritas, distribuídas em duas linhagens atualmente denominadas classes: Malacosporea Canning et al., 2000 (malacosporídeos) com apenas quatro espécies descritas é a linhagem que retém as características evolutivas mais primitivas do grupo, como a simetria radial, tecidos finos sob a forma de folhas epidérmicas e musculatura (Jiménez- Guri et al., 2007; Bartošová-Sojková et al., 2014; Okamura et al., 2015a). Myxosporea Bütschli, 1881, (mixosporídeos) é a linhagem derivada e a mais rica em espécies (Okamura et al., 2015a). Na evolução para o parasitismo, Myxozoa sofreu grande simplificação e miniaturização morfológica como adaptação a vida em ambientes altamente restritos dentro dos hospedeiros. Estas reduções alcançam níveis extremos em Myxosporea, com a perda total dos tecidos, no qual as espécies são formadas por poucas células que se desenvolvem no interior de estágios tróficos unicelulares denominados plasmódios e pseudoplasmódios (Okamura et al., 2015a).

Esses parasitos tem uma longa história de divergências em relação a sua taxonomia. Inicialmente foram classificados dentro do Reino Protista Haeckel, 1866 e assim permaneceram por mais de 100 anos, até que as primeiras análises ultraestruturais (Siddall et al., 1995) e moleculares (Smothers et al., 1994; Siddall et al., 1995; Schlegel et al., 1996) demonstraram a associação de Myxozoa com os metazoários. Os primeiros estudos moleculares e filogenéticos,

baseados no gene nuclear ribossomal 18S, posicionaram Myxozoa dentro dos Metazoa, como um grupo-irmão de Bilateria (Cavalier-Smith et al., 1996).

As primeiras hipóteses sobre a associação entre Myxozoa e Cnidaria foram fundamentadas pela presença de estruturas, os túbulos polares, que são responsáveis pelo ataque do parasito ao novo hospedeiro, consideradas homólogas aos nematocistos dos cnidários (Weill, 1938). Posteriormente, a presença de um gene análogo ao minicolágeno, que é responsável pela codificação de proteínas do nematocisto em Cnidária, observado no malacosporídeo Tetracapsuloides bryosalmonae Canning et al., 1999, deu grande suporte as hipóteses de relacionamentos evolutivo entre cnidários e Myxozoa (Holland et al., 2010).

Entretanto, a confirmação de que mixosporídeos são cnidários só foi possível após uma longa trajetória de estudos moleculares e filogenéticos (Holland et al., 2010; Nesnidal et al., 2013; Chang et al., 2015; Takeuchi et al., 2015), quando então Myxozoa passou a integrar o grande grupo de invertebrados cnidários. Porém, algumas questões ainda permanecem em aberto em relação a evolução desses parasitos, como por exemplo, o período evolutivo em que ocorreu a divergência de Myxozoa a partir de seus ancestrais cnidários de vida livre, para se tornarem parasitos morfologicamente tão simplificados e com um ciclo de vida extremamente complexo (Lom e Dyková, 2006; Okamura et al., 2015b).

1.1.1 Origem e radiação do Subfilo Myxozoa

O ancestral comum de mixosporídeos marinhos e de água doce pode ter explorado inicialmente peixes cartilaginosos como primeiros hospedeiros vertebrados (Kodádková et al., 2015). Essa hipótese é baseada no fato da utilização de elasmobrânquios como hospedeiros vertebrados pelas linhagens marinhas mais primitivas de Ceratomyxa (que é irmã a outros membros de linhagens marinhas) e pelos chloromixideos marinhos (que formam um grupo irmão do clado de água doce) (Kodádková et al., 2015). A radiação do grupo, além da enorme diversificação de espécies, habilitou esses organismos a explorarem os diferentes ambientes aquáticos (marinho e de água doce) e terrestres, expandindo além dos seus hospedeiros habituais, peixes, para parasitarem anfíbios (Eiras et al., 2005; Jirkú et al., 2006; Hartigan et al., 2011; Jirkú

e Bartosová-Sojková, 2014; Morsy et al., 2015), répteis (Eiras et al., 2005), aves (Bartholomew et al., 2008) e pequenos mamíferos (Friedrich et al., 2000; Dyková et al., 2007; Prunescu et al., 2007; Székely et al., 2015).

Como citado anteriormente, as espécies de mixozoários estão divididas entre as classes Malacosporea e Myxosporea, sendo a primeira composta por apenas 4 espécies distribuídas pelos gêneros Buddenbrockia (Schröder, 1910) e Tetracapsuloides Canning et al., 2000, enquanto a segunda é composta por cerca de 2.400 espécies distribuídas em 63 gêneros (Fiala et al., 2015a). Entre os fatores que podem ter possibilitado uma maior radiação em Myxosporea, citam-se a ocorrência dessas espécies em ambientes de água doce, marinho e terrestre, enquanto que até então, malacosporídeos foram reportados apenas em água doce, e a maior variedade de potenciais hospedeiros invertebrados disponíveis para Myxosporea, que é de aproximadamente 3.500 espécies de oligoquetos e 8.000 espécies de poliquetos (Ruppert et al., 2004), versus apenas 94 espécies de bryozoários de água doce, que são os hospedeiros invertebrados de Malacosporea (Massard e Geimer, 2008), bem como incorporação de diferentes tipos de hospedeiros vertebrados (peixes, anfíbios, répteis, aves e mamíferos) em mixosporídeos, sendo que malacosporídeos foram encontrados parasitando apenas peixes (Fiala et al., 2015b; Okamura et al., 2015a).

1.1.2 Ciclo Biológico

Entre as mais de 2.000 espécies de mixosporídeos conhecidas, apenas 52 tiveram seu ciclo biológico elucidado (Atkinson, 2011). Estudos envolvendo o ciclo biológico desses organismos são difíceis de conduzir e as primeiras pesquisas nesta área foram desenvolvidas por Wolf e Markiw (1984) e envolveram Myxobolus cerebralis Hofer, 1903, dada a sua importância econômica. Posteriormente, vários estudos mostraram o envolvimento de invertebrados no ciclo biológico de Myxozoa, que apresenta alternância entre dois hospedeiros: invertebrados (oligoquetos e poliquetos, na classe Myxosporea e briozoários de água doce, na classe Malacosporea), os quais são os hospedeiros definitivos, e vertebrados (peixes), que são hospedeiros intermediários. Em mixosporídeos, estes estudos mostram que os peixes são

infectados através do contato com os esporos (actinosporos) liberados na água junto com as fezes dos hospedeiros invertebrados. Ao contato com o hospedeiro susceptível, o túbulo polar é extrudado e ancora-se ao hospedeiro vertebrado. Os actinosporos contém células ameboides (esporoplasmas) que são as estruturas infectantes (Okamura e Gruhl, 2015). Uma vez liberado, o esporoplasma penetra no tecido do hospedeiro vertebrado e, através de migrações intercelulares, período em que se observa uma série de etapas de sucessivas divisões celulares, alcançam o tecido alvo da infecção (Kallert, 2006). Os mixosporos, que são os esporos produzidos durante a fase de desenvolvimento no vertebrado, são liberados na água via excreções, ruptura de cistos da pele e das brânquias, ou ainda depois da morte do peixe infectado (Wolf e Markiw, 1984; Gilbert e Granath, 2003; Bartholomew et al., 2006). No corpo d’água, os mixosporos podem permanecer infectivos por muitos anos (Okamura e Gruhl, 2015), e uma vez ingeridos, ao contato com o tecido epitelial do anelídeo, os túbulos polares são ejetados, as válvas que compõem os esporos se abrem e o esporoplasma ameboide é liberado, penetrando entre as células do tecido do epitelial intestinal, onde tipicamente se dá o desenvolvimento do parasita até a formação de actinosporos. Estes actinosporos, quando maduros, são liberados no lúmen do intestino e junto com as fezes, ou ainda após morte do anelídeo, contaminam os corpos d’água (Lom e Dyková, 1995; Dyková, 2006).

1.1.3 Patogenicidade

Nos últimos anos, os estudos relacionados a parasitos e patógenos de organismos aquáticos vem crescendo exponencialmente, principalmente em hospedeiros com grande potencial para o cultivo e comercialização, dada a grande importância econômica dessas atividades (Luque, 2004). Peixes, tanto de ambiente natural quanto de cultivo, são acometidos pelos mais diversos patógenos como vírus, bactérias, fungos e metazoários de diferentes taxa (Woo, 2006; Austin & Newaj-Fyzul, 2017). Parasitos, por exemplo, podem causar doenças em seus hospedeiros por vários mecanismos, seja por danos diretos que esses organismos geram aos tecidos e/ou órgãos, privação de nutrientes ou oxigênio, este último em caso de infecções branquiais, ou indiretamente, deixando o hospedeiro mais susceptível a infecções secundárias e predadores, restrição no crescimento, além da possibilidade de levar o animal à morte (Mehlhorn,

2001; Austin & Newaj-Fyzul, 2017). Embora peixes de ambiente natural são comumente acometidos por infecções parasitárias, sobre certas condições, algumas espécies de parasitos podem ameaçar o equilíbrio populacional (Rückert et al., 2008). Recentemente estudos envolvendo mixosporídeos têm aumentado consideravelmente, principalmente em relação às espécies com potencial de gerar impactos em peixes de maior valor econômico (Hallet et al., 2015). Infecções por mixosporídeos podem causar uma série de danos e prejuízos, tanto em ambiente natural quanto em sistemas de cultivo, e também podem ser um desafio ecológico para as populações de peixes com baixo estoque local ou ameaçadas de extinção, o que tem levado pesquisadores de todo o mundo a estudar sua diversidade e a compreender os impactos que podem causar às populações de peixes locais (Okamura et al., 2015a).

Estudos que envolvem patologias causadas por mixosporídeos mostram que as brânquias estão entre os órgãos mais acometidos (Molnár, 2002), provavelmente devido ao contato direto com o meio externo e por ser região com maior facilidade para liberação de esporos (Eszterbauer et al., 2013). Infecções e lesões nos tecidos branquiais podem causar déficit nas trocas gasosas e iônicas, comprometendo consideravelmente a saúde do animal (Roberts, 2001).

Dentre os mixosporídeos, 15 dos 63 gêneros são reconhecidos por albergar espécies patogênicas importantes (Lom e Dyková, 1995). Myxobolus cerebralis é uma das espécies mais conhecidas e estudadas. Parasito de salmonídeos da América do Norte e Europa, pode causar declínio nas populações dos hospedeiros, inclusive em ambiente natural (Feist et al., 2006). Os plasmódios, presentes principalmente em indivíduos jovens, quando alojados na cápsula auditiva, faz com que os hospedeiros apresentem distúrbios natatórios característicos, que torna a doença conhecida como doença do rodopio ou whirling disease (Pavanelli et al., 2002). Ceratonova shasta (Noble, 1950) (sinônimo: Ceratomyxa shasta), infecta o trato digestório de peixes salmonídeos da América do Norte, causando infecções crônicas e danos severos em populações de peixes de pisciculturas e ambientes naturais (Lom e Dyková, 1995). Outros exemplos incluem a espécie de malacosporídeo Tetracapsuloides bryosalmonae Canning et al. 1999 agente

etiológico da doença proliferativa dos rins, que é uma das patologias mais severas em salmonídeos (Kent e Hedrick, 1985); Myxobolus koi Kudo 1919 e Thelohanellus hovorkai Achmerov, 1960, patógenos comuns em carpas de sistema de cultivos na Europa e Ásia, causam disfunção respiratória, hemorragias e edemas que levam a morte dos peixes infectados (Yokoyama et al., 1997; 1998); entre várias outras espécies.

1.1.4 Estudos de Myxozoa no Brasil

No Brasil, aproximadamente 120 espécies de Myxosporea estão descritas parasitando peixes de diferentes espécies e grupos taxonômicos, em importantes bacias hidrográficas como, as bacias dos rios Amazonas, Paraná-Paraguai, Araguaia-Tocantins, São Francisco e Paraíba do Sul (Adriano e Oliveira, 2017). Algumas espécies também foram descritas parasitando peixes em ambientes de criação (Martins e Souza, 1997; Adriano et al., 2002; 2005a; b; Capodifoglio et al., 2015; 2016).

Algumas espécies encontradas em peixes da fauna brasileira têm se mostrado patogênicas ou com grande potencial para causar danos em seus hospedeiros, como por exemplo, Henneguya multiplasmodialis Adriano et al. 2012, encontrada infectando as brânquias de pintado e cachara de ambiente natural no Pantanal Mato-Grossense. O parasito teve seu desenvolvimento inicial no arco da brânquia, mas formou grandes cistos, divididos por uma rede de septos formada por tecido conjuntivo, que avançaram sobre os filamentos, sendo observado infiltrado inflamatório e aglomerado de club cells (Adriano et al., 2012).

De uma maneira geral, os estudos envolvendo a diversidade desses parasitos ainda são bastante escassos na América do Sul, em comparação com a grande diversidade de peixes de água doce dessa região, considerada a mais rica e diversa do planeta (Buckup et al., 2007), bem como diante da presença de grandes bacias hidrográficas e do alto consumo e criação de peixes de água doce nas diferentes regiões, principalmente no Brasil (SUFRAMA, 2003).

1.1.5 Taxonomia e estudos evolutivos moleculares

Nas últimas décadas, as ferramentas e técnicas de biologia molecular tem sido empregadas em diversos estudos da área de parasitologia de peixes como aliadas no diagnóstico de doenças, descrição de espécies e caracterização de isolados (Figueiredo et al., 2008). Não obstante, as técnicas de biologia molecular constituem uma aliada nos estudos de Myxozoa, principalmente no campo da caracterização e classificação das espécies (Atkinson et al., 2011). Fatores como a elevada radiação de alguns grupos, resultando em uma grande diversidade, a presença de poucos caracteres morfológicos de diagnose e a alta similaridade morfológica de algumas espécies ou mesmo gêneros, que é reflexo de convergências adaptativas, tornam essencial o emprego de técnicas moleculares em estudos taxonômicos de mixozoários (Fiala, 2006). O sequenciamento de DNA se popularizou nas últimas décadas, havendo um aumento exponencial de sequências depositadas em bancos de dados, o que é fundamental para comparação e estudos de filogenia (Atkinson et al., 2015). Atualmente, dados moleculares vêm sendo amplamente utilizados em conjunto com os dados morfológicos, morfométricos e biológicos dos mixozoários, permitindo uma maior acurácia na identificação das novas espécies, revisões taxonômicas de espécies e gêneros e também a elaboração de novas hipóteses filogenéticas do relacionamento entre as espécies do grupo (Fiala et al., 2015b).

Em pesquisas envolvendo o sequenciamento de DNA de mixozoários, a grande maioria dos dados disponíveis atualmente nos bancos de dados são referentes aos genes nucleares ribossomais (Atkinson et al., 2015). Os ribossomos são organelas de extremo valor biológico para os eucariotos, e consequentemente, tem sido foco de diversos estudos (Weider et al., 2005; Bik et al., 2013). O DNA ribosomal está organizado dentro dos núcleos das células em múltiplas cópias repetidas em tandem, no qual cada cópia é composta por genes mais conservados, do ponto de vista evolutivo (18S, 28S e 5.8S) e por regiões não codificadoras e que evoluem comparativamente a taxas mais elevadas, que são os espaçadores internos (ITS-1 e ITS-2) e externos transcritos (ETS), além dos espaços intergênicos (IGS) (Hillis e Dixon, 1991; Eickbush e Eickbush, 2007). Os genes 18S e 28S são extensivamente utilizados como marcadores moleculares em uma ampla gama de estudos de reconstrução filogenética, análise da diversidade

biológica, taxonomia e evolução genotípica (Hillis e Dixon, 1991; Mallatt et al., 2010; Bik et al., 2013).

O gene 18S transcreve para o rRNA que compõe a pequena subunidade ribossomal (SSU - do inglês small subunit ribosomal) e é o marcador molecular mais utilizado em estudos de mixozoários, bem como de outros taxa, com aplicações diversas, incluindo a caracterização genética a nível de espécie e estudos de filogenia molecular (Avise, 2004; Meyer et al., 2010). Em Myxozoa, o 18S varia de 1.000 a mais de 100.000 cópias por esporo (Hallett e Bartholomew, 2006), o que facilita o seu acesso e amplificação. Está região do rDNA é bastante útil em estudos filogenéticos do grupo por ser heterogênea, ou seja, possuir regiões conservadas e outras mais variáveis, facilitando a discriminação de taxa em diferentes níveis (Hillis e Dixon, 1991). Em mixosporídeos, a região SSU possui elevadas taxas de substituição nucleotídicas, o que significa uma rápida evolução deste gene no grupo comparado com outros Metazoa (Kent et al., 2001; Fiala, 2006; Bartošová et al., 2009).

Os primeiros estudos de filogenia molecular de Myxozoa utilizando o gene 18S foram realizados com o objetivo de definir a posição do grupo dentro de Metazoa (Smothers et al., 1994; Siddall et al., 1995; Schlegel et al., 1996). Desde então, este marcador vem sendo intensamente utilizado para esclarecer as relações entre as espécies e vem provando ser uma ferramenta confiável para estabelecer as relações filogenéticas dentro de Myxozoa (Kent et al., 2001; Fiala, 2006; Bartošová et al., 2013; Carriero et al., 2013; Bartošová-Sojková et al., 2014; Takeuchi et al., 2015). Em um levantamento feito no banco de dados NCBI (National Center for Biotechnology Information), de todas as sequências de Myxozoa depositadas, aproximadamente 80% correspondem a sequências do marcador SSU desses organismos.

Além do SSU, outros marcadores têm sido utilizados em estudos moleculares e filogenéticos de Myxozoa como o gene 28S que transcreve para o rRNA que compõe a grande subunidade ribossomal (LSU - do inglês large subunit ribosomal) (Whipps et al., 2004b; Whipps e Kent, 2006; Bartošová et al., 2009, 2013; Meng et al., 2011; Fiala et al., 2015c); ITS-1 (Andree et al., 1999; Henderson e Okamura, 2004; Whipps et al., 2004b, Whipps and Kent, 2006; Atkinson e Bartholomew, 2010a, b; Lodh et al., 2012; Woo et al., 2014); genes codificadores de

proteínas como HSP70 (Heat Shock Protein) (Whipps e Kent, 2006) e EF-2 (Elongation Fator-2) (Fiala e Bartošová, 2010; Bartosová-Sojková, 2014); além de estudos recentes utilizando os marcadores mitocondriais (Fiala et al., 2013; Takeuchi et al., 2015; Yahalomi et al., 2017).

LSU possui propriedades muito semelhantes à SSU, como a presença de regiões conservadas, além de 13 regiões altamente variáveis, e também vem sendo utilizado em estudos filogenéticos de Myxozoa, porém em menor escala (Fiala et al., 2015c). Bartosová et al. (2009) realizaram estudos para investigar as relações evolutivas dentro das linhagens de Myxosporea utilizando tanto o marcador SSU quando o LSU e observaram que filogenias geradas utilizando ambos marcadores isolados mais uma análise concatenada (SSU + LSU) eram congruentes e apresentaram resolução similar dos nós. O grande problema para quem trabalha com filogenia de Myxozoa está no fato do número limitado de sequências da LSU disponíveis no banco de dados NCBI, fazendo do SSU ainda a primeira escolha.

O marcador HSP70 foi utilizado para Myxozoa em um estudo filogeográfico de uma espécie do gênero Kudoa Meglitsch, 1947, realizado por Whipps e Kent (2006). HSP70 codificam proteínas chaves para processos metabólicos celulares, protegendo as células contra o estresse térmico e químico (Herrmann e Neupert, 2000), característica esta que o torna extremamente conservado em termos evolutivos (Martin e Burg, 2002). Ocorre em praticamente todos os organismos vivos, sendo muito utilizado para inferir a relação filogenética entre taxa divergentes (Rue et al., 2000; Sulaiman et al., 2000). As análises utilizando a sequência do gene HSP70 de Kudoa thyrsites Gilchrist, 1924, geraram ávores congruentes para aquelas geradas pelo uso dos genes ribossomais (SSU, LSU e ITS-1) e não gerou melhora na resolução dos nós considerados mais conflitantes dentro do grupo.

Elongation Fator-2 (EF-2) é um gene evolutivamente conservado, sendo responsável pela codificação de proteínas essenciais ao processo de síntese proteica (Rapp et al., 1990). O primeiro estudo desse marcador em Myxozoa foi realizado por Fiala e Bartošová (2010), que sequenciaram esse gene em doze espécies pertencentes a diferentes gêneros. Foram feitas análises filogenéticas comparando sequências concatenadas de SSU + LSU com EF-2. As duas filogenias geradas foram congruentes e apresentaram alto suporte dos nós. Posteriormente, Bartosová-

Sojková (2014) pela primeria vez sequenciaram o gene EF-2 de malacosporídeos e confirmaram que os agrupamentos filogenéticos obtidos utilizando sequências de SSU eram congruentes para aqueles obtidos utilizando-se sequências de LSU e EF-2.

De um modo geral, os marcadores não-ribossomais e codificadores de proteínas HSP70 e EF-2, bem como o LSU utilizados nos estudos filogenéticos acima citados suportam as reconstruções filogenéticas geradas pelos SSU e não geraram melhoria na resolução dos nós considerados mais divergentes (Whipps e Kent 2006; Fiala e Bartošová, 2010; Bartosová- Sojková 2014). Desta forma, estes estudos corroboram a utilização do SSU como um marcador confiável para estudos taxonômicos e evolutivos de Myxozoa.

Porém, em estudos que visam análises de variação intraespecífica, marcadores que possuem altas taxas de substituição garantem resultados mais precisos. Neste caso, uma das ferramentas moleculares empregadas é o sequenciamento da região intergênica ribossomal ITS-1, uma região não expressa do DNA nuclear, localizada entre os genes 18S e 5.8S. Esta região sofre menor pressão seletiva e já foi demonstrado possuir polimorfismos tanto no seu comprimento quanto na sua sequência, que são úteis na discriminação entre populações dentro de uma mesma espécie (Hillis e Dixon, 1991).

Nos estudos de Myxozoa, o ITS-1 tem sido utilizado para discriminar populações entre diferentes regiões geográficas (Whipps et al., 2004b) e também em estudos de determinação de genótipos (Atkinson e Bartholomew, 2010a, b). A maioria dos estudos focam em espécies economicamente importantes, com ampla distribuição geográfica e que causam danos aos seus hospedeiros de interesse comercial, como por exemplo as espécies M. cerebralis e C. shasta.

Andree et al. (1999) fizeram uma comparação entre as sequências do ITS-1 de amostras de M. cerebralis provenientes da Europa e dos Estados Unidos, com o objetivo de identificar potenciais diferenças genéticas entre as populações desse parasito nestes dois continentes. Os resultados não mostraram diferenças genéticas entre os isolados europeus e norte americanos, sugerindo que a introdução da espécie nos Estados Unidos, a partir da Europa, parece ter sido bem recente. Atkinson e Bartholomew (2010 a, b) utilizaram o marcador ITS-1

para estudar a espécie C. shasta, que parasita o intestino de salmões e truta arco-íris, simpátricas no Rio Klamath, costa Oeste dos Estados Unidos. Os autores encontraram variações genéticas intraespecíficas relacionadas aos hospedeiros e à localização geográfica dentro daquela bacia hidrográfica. Baseados na taxa de repetição da sequência (ATC)0-3 do ITS-1, os autores revelaram a existência de quatro diferentes genótipos: 0, I, II e III. O genótipo I foi detectado somente na região baixa do rio e é específico à espécie Oncorhynchus tshawytscha (Chinook salmon). Os genótipos II e III foram detectados tanto na região baixa como alta do rio. Enquanto que o genótipo II foi encontrado exclusivamente em Oncorhynchus mykiss (truta arco-íris), o III foi encontrado em ambas as espécies. Por último, o genótipo 0 foi encontrado em ambos os locais (baixo e alto rio), porém foi detectado apenas em amostras de água, não sendo possível determinar seu hospedeiro.

Takeuchi et al. (2015) sequenciaram pela primeira vez o genoma mitocondrial de mixozoários. Eles utilizaram as espécies Kudoa septempunctata Matsukane et al., 2010, Kudoa hexapunctata Yokoyama et al., 2014 e Kudoa iwatai Egusa e Shiomitsu, 1983 e compararam as sequências obtidas com o genoma mitocondrial de outros Metazoa. Os autores descreveram o genoma mitocondrial destas espécies como sendo circular, possuindo 15.500 a 19.500 pares de base. Os resultados, entretanto, mostraram discrepâncias entre as filogenias de Myxozoa geradas a partir dos genes mitocondriais com aquelas obtidas a partir de marcadores nucleares. Enquanto os estudos filogenéticos utilizando os marcadores ribossomais foram congruentes com vários outros estudos, que mostram o posicionamento de Myxozoa dentro de Cnidária (Jiménez-Guri et al., 2007; Chang et al., 2015), a filogenia baseada em genes mitocondriais posicionou as espécies de Kudoa como irmãs de Ctenophora, um grupo taxonomicamente distante de Myxozoa. No entanto, foi demonstrado que Myxozoa e Ctenophora possuem taxas evolutivas altas em relação aos demais Metazoa, o que faz com que os dois grupos se agrupem de modo ambíguo como irmãos. Isso é resultado de um fenômeno conhecido em filogenia como atração de ramos longos (Takeuchi et al., 2015). Mais recentemente, Yahalomi et al. (2017) realizaram o sequenciamento do genoma mitocondrial de Enteromyxum leei (Diamant et al., 1994), espécie conhecida por causar severas doenças intestinais em várias espécies de peixes marinho (Yanagida et al., 2015). Ao contrário do estudo anterior, o genoma mitocondrial desta espécie foi reportado como sendo

fragmentado em oito cromossomos circulares e não como uma única molécula circular. Segundo os autores, a presença de um genoma mitocondrial fragmentado é característica de parasitos que sobrevivem em condições ambientais desfavoráveis, o que pode ser o caso de Myxozoa (Yahalomi et al., 2017). Neste trabalho os autores sugeriram ainda que a estrutura circular dos cromossomos mitocondriais apoia o posicionamento de Myxozoa fora do Medusozoa (Chang et al., 2015), que possuem cromossomos lineares.

No tocante às relações evolutivas dentro dos mixozoários, existe uma separação clássica de linhagens: a linhagem marinha e a de água doce, que utilizam respectivamente poliquetas e oligoquetas como hospedeiros definitivos; linhagem de sphaerosporídeos, cujos hospedeiros definitivos ainda são desconhecidos; linhagem de malacosporídeos que possuem bryozoários como hospedeiro definitivo (Classe Malacosporea) e a linhagem terrestre (Fiala et al., 2015b). Enquanto Malacosporea radiou-se em ambientes de água doce, os clados mais primitivos dentro de Myxosporea, os sphaerosporídeos e os marinhos Chloromyxidium Mingazzini, 1890 e Bipteria Kovaleva et al., 1983 radiaram no ambiente marinho (Fiala et al., 2015b; Kodádková et al., 2015). A radiação no ambiente terrestre ocorreu primeiramente em anfíbios ao menos três vezes ao longo do tempo evolutivo, porém, nenhum ciclo de vida nestes vertebrados está elucidado, o que torna difícil a identificar o processo evolutivo em que ocorreu essa radiação (Kodádková et al., 2015).

1.2 Bacia Amazônica

A região Amazônica possui a mais extensa rede hídrica do planeta, com cerca de 700.000 km2 de extensão (Santos e Ferreira, 1999), cuja área de drenagem cobre cerca de um terço de todo o continente Sul Americano (Barthem et al., 2004). Aproximadamente 68% de sua área de drenagem situa-se em território brasileiro, sendo o restante distribuído por outros oito países: Peru, Colômbia, Equador, Bolívia, Venezuela, Guiana, Guiana Francesa e Suriname (Junk et al., 2011). Com exceção dos rios maiores, cujas nascentes se encontram nas montanhas andinas, quase todos os rios amazônicos são resultantes da junção de pequenos riachos que drenam a imensa floresta (Walker, 1991). Estimativas sugerem que toda a bacia possui de 6 a 7

mil afluentes interligados em rede, os quais proporcionam densa e heterogênea rede de rios que abrigam a grande biodiversidade aquática (Tundisi, 2003).

A Bacia Amazônica conta com aproximadamente 1.500 espécies de peixes descritas (Barthem e Fabré, 2004; Santos et al., 2006, Buckup et al., 2007), mas com estimativas de que este número possa atingir a mais de 3.000 espécies (Goulding e Barthem, 1997), sendo os membros das ordens Characiformes, Siluriformes e Gymnotiformes os mais comumente encontrados, seguido por representantes das famílias Cichlidae, Osteoglossidae, Cyprinodontidae e Poecillidae (Bayley e Petrere, 1989). Deste total, cerca de 200 espécies são exploradas para fins comerciais e de subsistência pelas populações locais (Petrere-Jr e Peixer, 2007).

A pesca é uma das atividades econômicas mais importantes da região Norte, sobretudo na região da Bacia Amazônica (Santos & Santos, 2005). De acordo com o último relatório estatístico da pesca, realizado pelo Ministério da Pesca e Aquicultura - MPA (2011), o Brasil produziu 1.264.765 toneladas de pescado em 2010. Na região Norte foram produzidas 326.128,3 toneladas, sendo que apenas 94.265,3 toneladas foram oriundas da pesca extrativista marinha e o restante é oriundo da água doce, com 137.144,5 toneladas, além das 94.578 toneladas oriundas da aquicultura (MPA, 2011).

Manaus é o maior centro produtor e consumidor de peixes da região, com o desembarque variando entre 22.000 e 35.000 toneladas por ano, sendo a produção destinada ao consumo local e exportação, tanto para outras regiões do país e também o exterior (Santos et al., 2006). Na análise da composição do pescado no mercado de Manaus e de outras cidades da Amazônia Central, pode-se observar o envolvimento de cerca de 100 espécies, mas aproximadamente 90% do total explorado se concentra numa dezena de espécies, com destaque para o tambaqui (Colossoma macropomum), o jaraqui (Semaprochilodus taeniurus), a matrinxã (Brycon amazonicus), o curimatã (Prochilodus nigricans), o pacu (Myleus spp.) e os tucunarés (Cichla spp.) (Santos et al., 2006), o que faz da sobre-explotação um problema sério na região (Barthem et al., 2004).

1.3 Cichla spp. e Brachyplatystoma rousseauxii

1.3.1 Cichla spp.

A família Cichlidae Bonaparte, 1840, pertence à ordem Cichliformes e é considerada uma das famílias de peixes com a maior diversidade, com aproximadamente 3.000 espécies descritas, distribuídas em 202 gêneros reconhecidos, as quais estão distribuídos pelas Américas Central e do Sul, Índia, Madagascar, Israel, Siria, Sri Lanka e África (Kocher, 2004; Nelson et al. 2016). Apesar de ser comparativamente menos diversos que os ciclídeos africanos, os ciclídeos neotropicais são variados tanto em morfologia quanto em padrões ecológicos e comportamentais (Nelson, 2006). Segundo Britiski (1972) uma característica marcante dos integrantes dessa família é a presença de uma linha lateral interrompida. Possuem estratégias reprodutivas altamente organizadas e duas formas de cuidado parental são reconhecidas: somente a fêmea possui cuidado parental carregando os ovos fertilizados na boca e o cuidado parental realizado tanto por fêmeas quanto por machos, estratégia esta comum em espécies monogâmicas (Nelson et al. 2016).

Os ciclídeos são conhecidos pelo grande sucesso evolutivo e pelas altas taxas evolutivas e de especiação, sendo o caso mais emblemático a radiação ocorrida em espécies de lagos na região leste africana, no qual mais de 2.000 espécies evoluíram apartir de um mesmo ancestral em um período de 10 milhões de anos (Kocher, 2004). Com a fragmentação da Gondwanna (entre 135 a 65 milhões de anos) dois grupos distintos teriam se formado: os ciclídeos africanos e os ciclídeos sulamericanos. A partir da América do Sul atingiram a América Central e sul da América do Norte (Murray, 2001).

As espécies do gênero Cichla, popularmente conhecidas como tucunarés, ou Peacock bass, são endêmicas da Bacia Amazônica e caracterizadas por possuírem três linhas pretas verticais na lateral do corpo e um ocelo localizado no pedúnculo caudal, sendo algumas espécies caracterizadas também pela presença de pontos brancos como Cichla pinima Kullander e Ferreira, 2006 e Cichla jariina Kullander e Ferreira, 2006 (Kullander e Ferreira, 2006). São piscívoros, com atividade diurna predominante, não realizam migrações e são considerados peixes importantes na estruturação e dinâmica ecossistêmica das comunidades aquáticas da América do Sul (Winemiller et al., 1997). São também importantes do ponto de vista econômico,

devido a qualidade da carne e principalmente por serem peixes utilizados em práticas de pesca esportiva, fato este que fez que com algumas espécies do gênero fossem introduzidas em outros países como nos Estados Unidos, por exemplo (Winemiller, 2001; Carvajal et al., 2005).

Kullander e Ferreira (2006) fizeram uma revisão do gênero e, baseados em caracteres morfológicos, identificaram 15 espécies (Figura 1), (Tabela 1), que são amplamente distribuídas nas bacias dos rios Amazonas, Oniroco e Tocantins, bem como em pequenos riachos que drenam a Guiana Francesa. A maioria das espécies são endêmicas a determinados rios ou regiões dentro da bacia, com exceção da espécie Cichla monoculus Agassiz, 1831 que possui uma ampla distribuição geográfica, ocorrendo em vários rios da região Amazônica (Kullander e Ferreira, 2006). Algumas espécies de tucunarés foram introduzidas em outras regiões do Brasil como nas bacias dos rios Paraná-Paraguai, Paraíba do Sul e Paraguaçu (Kullander e Ferreira, 2006).

Figura 1: Fotografias das espécies de Cichla spp. que ocorrem ao longo da Bacia Amazônica. Modificada de Willis et al. (2012).

Tabela 1: Lista das espécies de Cichla spp., autor e local de ocorrência da espécie tipo, encontradas na Bacia Amazônica. Modificada de Kullander e Ferreira (2006).

Espécie Local de ocorrência Cichla ocellaris Schneider, 1801 Bacia Amazônica, Rio Essequibio, Guiana Cichla temensis Humboldt, 1821 Rios Branco, Negro, Oniroco, Purus Cichla orinocensis Humboldt, 1821 Rios Negro e Oniroco Cichla monoculus Agassiz, 1831 Rios da Bacia Amazônica, Tapajós, Amazonas Cichla nigromaculata Jardine, 1843 Rio Negro Cichla intermedia Machado-Allison, 1971 Rio Casiquiare Cichla kelberi Kullander e Ferreira, 2006 Rio Tocantins Cichla pleizona Kullander e Ferreira, 2006 Rio Guaporé Cichla mirianae Kullander e Ferreira, 2006 Rio Tapajós (região alta) Cichla melaniae Kullander e Ferreira, 2006 Rio Xingu Cichla piquiti Kullander e Ferreira, 2006 Rio Tocantins Cichla thyrorus Kullander e Ferreira, 2006 Rio Trombetas Cichla jariina Kullander e Ferreira, 2006 Rio Jari Cichla pinima Kullander e Ferreira, 2006 Rio Curuá-Uma Cichla vazzoleri Kullander e Ferreira, 2006 Rio Trombetas

1.3.2 Brachyplatystoma rousseauxii Castelnau, 1855

Brachyplatystoma rousseauxii pertence à ordem Siluriformes e à família Pimelodidade, grupo de peixes conhecidos como bagres ou peixes de couro, devido ao aspecto de sua pele lisa. Conhecida porpularmente no Brasil como dourada ou goliath catfish em inglês, é um peixe de grande porte, cabeça achatada e prateada, caracterizada pela presença de barbilhões maxilares curtos e pela maxila e mandíbula de tamanhos iguais (Ferreira et al., 1998) (Figura 2). Possui ampla distribuição geográfica na Amazônia, sendo encontrada em sete países, Brasil, Bolívia, Colômbia, Equador, Guiana Francesa, Peru e Venezuela (Reis et al., 2003). Tem preferência por águas brancas, mas também pode ser encontrada em rios amazônicos de águas escuras, ocorrendo principalmente no canal dos rios (Lobato, 2009).

Uma das características mais marcantes da dourada é a longa migração relacionada ao seu ciclo de vida, que é considerada a maior entre todos os peixes de água doce (Petrere et al., 2005; Barthem et al., 2017). Segundo os estudos de Barthem e Goulding (1997), um único estoque genético da dourada realiza migrações para áreas geograficamente distintas de reprodução, criação e alimentação. A reprodução ocorre nas cabeceiras dos rios Solimões e Amazonas. Após a desova, as larvas e juvenis são carreados pela corrente até a região estuarina, área de criação da espécie. Passados cerca de dois a quatro anos, os indivíduos iniciam uma nova migração de cerca de 4.500 km, voltando às cabeceiras para desovar, completando assim o ciclo de vida. A área de alimentação dos pré-adultos e adultos inclui toda a área da Amazônia central, incluindo os principais tributários e as planícies de inundação (Barthem e Goulding, 1997).

A dourada é uma espécie de elevado valor comercial e em todas as regiões onde é pescada, está entre as espécies mais comercializadas e exportadas. Alguns levantamentos estimam que o total pescado dessa espécie por ano na Amazônia é de 14.486,1 toneladas, sendo que o Estado do Pará está entre os locais onde é mais comercializada (MPA, 2011). A sobre- explotação dessa espécie e de outros Siluriformes na região tem gerado reduções populacionais significativas e a pesca artesanal vem se tornando cada vez mais rara (Petrere et al., 2004).

Figura 2: Brachyplatystoma rousseauxii Castelnau, 1855 coletada no rio Tapajós, Santarém, Pará, outubro de 2014. Foto: Suellen Aparecida Zatti.

2. JUSTIFICATIVA

Em ambiente natural ou em sistemas de criação, peixes estão expostos a uma série de doenças causadas pelos mais diversos patógenos. Em relação às doenças parasitárias, destacam-se algumas espécies de mixosporídeos, as quais causam importantes doenças em peixes de pisciculturas, imprimindo consideráveis prejuízos econômicos, e, em algumas regiões, são responsáveis pelo declínio de populações naturais de peixes. A ausência de tratamentos eficazes para patologias causadas por esses organismos tem gerado diminuição na produtividade e elevando os custos de produção e o aumento dos investimentos na prevenção e no controle, como observado em locais onde ocorrem infecções por Myxobolus cerebralis, Ceratonova shasta, Enteromyxum leei, entre outros. Diante deste quadro, é imprescindível a elaboração de estratégias de manejo e de medidas profiláticas para evitar a introdução de espécies patogênicas no sistema de produção. Neste sentido, verifica-se a importância de conhecer a diversidade de mixosporídeos parasitos de peixes da fauna sul-americana, a sua distribuição em relação à fauna de hospedeiros desta região, bem como identificar as possíveis variações genética intraespecíficas nos mixosporídeos parasitos de peixes com apelo comercial e com potencial para o emprego na piscicultura.

A Bacia Amazônica é a região com maior diversidade de peixes do planeta e várias espécies têm grande importância na pesca extrativista, que é uma das principais atividades econômicas da região. Muitas dessas espécies são exportadas para as diferentes regiões do país e do mundo. Espécies como tambaqui (Colossoma macropomum), tucunarés (Cichla spp.), pirarucu (Arapaima gigas) e diversos bagres, entre eles a dourada (Brachyplatystoma rousseauxii), são ícones da produção pesqueira nacional, sendo que o tambaqui, a matrinxã (Brycon amazonicus), o pirarucu e algumas espécies de bagres já estão incorporadas à piscicultura nacional. Porém, informações a respeito da fauna parasitária dos peixes amazônicos ainda são bastante escassas, e como salientado acima, estas são essenciais para o controle sanitário.

Espécies do gênero Cichla são endêmicas da Bacia Amazônica, mas devido à sua grande aceitação pelo mercado consumidor, potencial econômico e principalmente devido ao importante papel na pesca esportiva, podem ser encontradas em pisciculturas de várias regiões do país e em países como Panamá, Porto Rico, Singapura e Estados Unidos. Outro destaque é a espécie B. rousseauxii, que está entre os peixes mais importantes na pesca extrativista da região. Contudo, são poucas as pesquisas voltadas aos estudos da taxonomia dos parasitos destes peixes, principalmente no que se refere aos mixosporídeos, havendo até aqui apenas um estudo publicado sobre estes parasitos em peixes do gênero Cichla e nenhum sobre a dourada.

Estudos moleculares de parasitos, além de proporcionar uma maior acurácia na identificação das espécies, permitem melhorar a compreensão das relações de especificidade entre parasitos e hospedeiros, bem como do padrão de distribuição geográfica das espécies ou cepas, o que abre perspectivas para o desenvolvimento de técnicas de manejos que busquem minimizar os efeitos dos patógenos. No caso de mixosporídeos, as análises moleculares têm se tornado fundamentais especialmente no campo da taxonomia. Devido a presença de poucos caracteres taxonômicos morfológicos disponíveis e a grande semelhança morfológica entre algumas espécies, pesquisadores da área lançam mão de técnicas moleculares visando dar maior confiabilidade taxonômica. As ferramentas de biologia molecular tem demonstrado também possuir um valor inestimável na elaboração de hipóteses evolutivas e na compreensão da origem e diversidade das espécies. Sendo a região Amazônica um local de grande diversidade de organismos aquáticos, filogenias moleculares podem revelar o impacto da história geológica local na especiação e na estrutura das populações, e assim, ajudar na compreensão da história evolutiva dos Myxozoa, até hoje considerada bastante controversia.

3. OBJETIVOS

3.1 Gerais

Esta pesquisa teve como objetivo principal descrever possíveis novas espécies de mixosporídeos encontradas parasitando peixes Cichla spp. e B. rousseauxii oriundos de três diferentes regiões da Bacia Amazônica, através da taxonomia morfológica e molecular.

3.2 Específicos - Avaliar, com base no marcador molecular ITS-1, o nível de variação genética intraespecífica de possíveis novas espécies de mixosporídeos encontradas neste estudo, considerando a distribuição geográfica e os hospedeiros envolvidos;

- Propor hipóteses filogenéticas moleculares sobre o posicionamento das novas espécies de mixosporídeos descritas parasitando espécies de Cichla spp. e B. rousseauxii em relação a outras espécies oriundas de diferentes regiões geográficas e diferentes hospedeiros;

- Propor hipóteses sobre o possível papel de eventos geológicos na Bacia Amazônica, mais especificamente as insurgências marinhas, na radiação dos mixozoários aqui encontrados, a partir de análises filogenéticas moleculares.

4. RESULTADOS

Os resultados desta tese foram dividos em três capítulos, onde são descritas novas espécies de mixosporídeos parasitos de duas espécies de Cichla spp. e dourada, coletadas no rio Tapajós, Pará, rio Amazonas e rio Jari, Amapá e rio Solimões, Amazonas.

No capítulo 1 é descrita uma nova espécie do gênero Ceratomyxa encontrada parasitando a vesícula biliar de espécimes de Cichla monoculus coletada no rio Tapajós, Pará. O estudo foi baseado em dados morfológicos dos plasmódios e esporos, afinidade pelo hospedeiro e órgão de tropismo e no sequenciamento do gene ribossomal 18S. Análises filogenéticas foram realizadas e assim foi possível identificar a posição da nova espécie em relação às demais espécies deste gênero.

O capítulo 2 relata, pela primeira vez, a ocorrência de uma espécie de mixosporídeo infectando espécimes de B. rousseauxii coletadas em três locais da Bacia Amazônica. Os estudos de taxonomia, baseados em dados morfológicos dos plasmódios e dos esporos, afinidade pelo hospedeiro e órgão de tropismo e no sequenciamento do gene ribossomal 18S, revelaram uma nova espécie pertencente ao gênero Ceratomyxa. Análises filogenéticas foram realizadas a partir de sequências do gene 18S visando identificar a posição filogenética da nova espécie e propor hipóteses evolutivas à cerca do posicionamento de todas as espécies de Ceratomyxa descritas na Amazônia em relação as demais espécies congêneras, em sua maioria de origem marinha. Utilizando sequências da região ITS-1, foi avaliada a existência de possíveis variações intra- específicas entre os isolados do parasito obtidos nos três locais de estudo, buscando correlacioná- las com a história de vida do hospedeiro.

No capítulo 3 são descritas três novas espécies do gênero Henneguya parasitando Cichla monoculos e Cichla pinima de duas diferentes regiões da Bacia Amazônica. O trabalho de identificação e descrição das espécies foi baseado em variáveis morfológicas e morfométricas, afinidade pelo órgão de infecção e hospedeiro e dados moleculares (sequenciamento do gene 18S). As sequências obtidas também foram utilizadas para identificar as relações filogenéticas

das espécies de Henneguya parasitas de Cichla spp. em relação à outras sequências de Myxobolus/Henneguya disponíveis no banco de dados GenBank.

CAPÍTULO 11

Amazonian waters harbour an ancient freshwater Ceratomyxa lineage (Cnidaria: Myxosporea)

ABSTRACT

A new species of Ceratomyxa parasitizing the gall bladder of Cichla monoculus, an endemic cichlid fish from the Amazon basin in Brazil, is described using morphological and molecular data. In the bile, both immature and mature myxospores were found floating freely or inside elongated plasmodia: length 304 (196 - 402) µm and width 35.7 (18.3 - 55.1) µm. Mature spores were elongated and only slightly crescent-shaped in frontal view with a prominent sutural line between two valve cells, which had rounded ends. Measurements of formalin-fixed myxospores: length 6.3 ± 0.6 (5.1 - 7.5) µm, thickness 41.2 ± 2.9 (37.1 - 47.6) µm, posterior angle 147º. Lateral projections slightly asymmetric, with lengths 19.3 ± 1.4 μm and 20.5 ± 1.3 μm. Two ovoids, equal size polar capsules, length 2.6 ± 0.3 (2 - 3.3) µm, width 2.5 ± 0.4 (1.8 - 3.7) µm, located adjacent to the suture and containing polar filaments with 3 - 4 turns. The small subunit ribosomal DNA sequence of 1605 nt was no more than 97% similar to any other sequence in GenBank, and together with the host, locality and morphometric data, supports diagnosis of the parasite as a new species, Ceratomyxa n. sp. 1. Maximum parsimony and maximum likelihood analyses showed that Ceratomyxa n. sp. 1 clustered within the marine Ceratomyxa clade, but was in a basally divergent lineage with two other freshwater species from the Amazon basin. Our results are consistent with previous studies that show Ceratomyxa species can cluster according to both geography and host ecotype, and that the few known freshwater species diverged from marine cousins relatively early in evolution of the genus, possibly driven by marine incursions into riverine environments.

Keywords: Myxozoa, Cichla monoculos, ssrDNA sequencing, freshwater environment, Amazon

1Artigo publicado na revista Acta Tropica, 2017 (formatação de acordo com as normas do periódico).

1. Introduction

Myxozoa is a diverse group of over 2,400 species (Bartošova-Sojková et al., 2014). They are now regarded as endoparasitic Cnidaria that have complex life cycles, which typically require an intermediate vertebrate host (mainly fish and rarely amphibians, reptiles, birds and mammals) and a definitive invertebrate host (annelids or bryozoans) (Kent et al., 2001; Canning and Okamura, 2004; Lom and Dyková, 2006; Bartholomew et al., 2008). The evolutionary affinities of the Myxozoa with the Cnidaria has been supported by the presence of polar capsules, which are analogous to cnidarian nematocysts (Weill, 1934; Siddall et al., 1995), and by molecular and phylogenetic studies (Jiménez-Guri et al., 2007; Holland et al., 2011; Nesnidal et al., 2013; Chang et al., 2015; Takeuchi et al., 2015). Unlike the majority of free-living cnidarian species, which are marine, myxozoans have experienced massive radiations in both marine and freshwater habitats, however their exact origin relative to free-living Cnidaria is still obscure and controversial (Lom and Dyková, 2006; Okamura and Gruhl, 2015). The genus Ceratomyxa Thélohan, 1892, is one of the most specious myxozoan groups, with more than 230 described taxa, representing about 8% of myxozoan biodiversity (Eiras, 2006; Gunter et al., 2009; Fiala et al., 2015a). Ceratomyxa species are found worldwide, and are mostly coelozoic in the gallbladders of a wide range of host fish; a few species are reported from other organs, including urinary bladder and renal tubules (Eiras, 2006). The overwhelming majority of known species are marine, and many of these from the North Atlantic (Gunter et al., 2009; Mackenzie and Kalavati, 2014; Fiala et al., 2015a). Nine species have been reported in anadromous and/or marine fishes that enter brackish-water lagoons and estuarine environments (Eiras, 2006; Froese and Pauly, 2009), and four species (three from the Amazon Basin) have been reported from freshwater fishes (Eiras, 2006; Azevedo et al., 2013; Mathews et al., 2016; Adriano and Okamura, 2016). Of these freshwater species, only Ceratomyxa amazonensis Mathews, Naldoni, Maia, Adriano, 2016, and Ceratomyxa vermiformis Adriano and Okamura, 2016, have ssrDNA sequence data available in the NCBI database (Mathews et al., 2016; Adriano and Okamura, 2016). In the present study, we describe a new freshwater Ceratomyxa species found parasitizing the gall bladder of peacock bass Cichla monoculus Agassiz, 1831, known as

tucunaré (in Portuguese), an economically important fish endemic to the Amazon basin (Batista and Petrere, 2003; Dos Santos et al., 2012). We used novel ssrDNA sequence data in combination with that of other Ceratomyxa spp. to explore the phylogenetic relationships between marine and freshwater species.

2. Material and Methods

2.1. Sampling and morphological analysis

Twenty-nine adult C. monoculus, length 33.3 (26 - 51) cm, were collected from the Tapajós River, Pará State, Brazil (02°20'214''S, 54°52' 890'' W) in October 2014 and March 2015. The catches were authorized by Brazilian Ministry of the Environment (SISBIO nº 44268- 4) and our methodology was approved by Ethics Committee on Animal Use of University of Campinas (CEUA/UNICAMP nº 3846-1). The fish were euthanized in a benzocaine solution (70 mgL-1), then necropsied and examined for myxosporeans. Bile samples containing parasites were fixed in formalin (10%) for measurements (Lom and Arthur, 1989) and in 100% ethanol for DNA sequencing. Thirty spores from one host fish were photographed with differential interference contrast using a Carl Zeiss Axio Imager A2 light microscope equipped with Axio Cam and AxioVision AxioVs 40V4.8.2 software. Measurements were taken following the guidelines of Lom and Arthur (1989) and expressed as mean with standard deviation and range. Descriptions of plasmodia use terminology of Adriano and Okamura (2016).

2.2 DNA extraction, amplification and sequencing

About 20 µl of ethanol-preserved bile was pelleted at 17,900 x g for 5 min and the ethanol removed. DNA was extracted from the pellet using a DNeasy® Blood & Tissue Kit (animal tissue protocol) (Qiagen Inc., California, USA) following the manufacturer's instructions. The product was eluted in 60 μl buffer AE. ssrDNA was amplified using a semi-nested PCR. The first round amplification targeted nearly the entire ssrDNA with primers 18E (CTGGTTGATTCTGCCAGT; Hillis and Dixon, 1991) and 18R (CTACGCAAACCTTGTTACG; Whipps et al., 2003), followed by a

second round with 18E and ACT1R (AATTTCACCTCTCGCTGCCA; Hallett and Diamant, 2001) and Myxigen4f (GTGCCTTGAATAAATCAGAG; Diamant et al., 2004) or novel primer MXATK2f (ACGCTTGCGAAGYGTGCCTT) with 18R. PCR was conducted in a 20 μl reaction volume, comprising: 1 μl template DNA (10 - 50 ng/μl), 1.25 U GoTaq Flexi polymerase (Promega, San Luis Obispo, California, USA), 0.2 μl mM each dNTPs, 0.50 μl each primer (10 pmol), 4 μl 5× GoTaq Flexi clear buffer, 2.4 μl MgCl2 (1.5 mM), 0.50 μl BSA, 0.4 μl Rediload dye (Invitrogen, Carisbad, California, USA) and 10.05 μl ultrapure water. PCR was performed on a PTC-200 Thermocycler (MJ Research Inc., Watertown, Massachusetts, USA) with initial denaturation at 95 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 120 s with first-round primers (or 60 s when using second round primers), following by a terminal extension at 72 °C for 2 min. Extraction and PCR controls were included. Amplicons were electrophoresed in a 1.5% agarose gel in Tris-borate- EDTA buffer (0.045 M Tris-borate, 0.001 M EDTA, pH 8.0) stained with SYBRsafe (Invitrogen By Life Technologies, Maryland, USA) alongside a 1 kb Plus DNA Ladder (Invitrogen By Life Technologies, Maryland, USA), then analyzed on a Compact Digimage System transilluminator (MajorScience, Saratoga, California, USA). PCR products were purified with QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's instructions, then sequenced in one direction only using the reverse primers. Sequencing reactions were performed using the BigDye 102 Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) in an ABI 3730 DNA 103 Analyzer (Applied Biosystems) at Oregon State University Center for Genomic Research and Biocomputing.

2.3 Sequence assembly and phylogenetic analysis

Sequences were visualized, assembled and edited using BioEdit 7.1.3.0 (Hall, 1999). Any ambiguous bases were interpreted using the corresponding chromatograms. A BLASTn search (Altschul et al., 1997) was conducted to confirm amplification of myxozoan DNA and to determine the closest relatives of the new Ceratomyxa species. For phylogenetic analysis, alignments were produced by ClustalW (Thompson et al., 1997) with default parameters, using sequences from other Ceratomyxa spp. plus Palliatus

indecorus Schulman and Kovalevá, Dubina, 1979, and Myxodavisia bulani Fiala, Hlavnicková, Kodádková, Freeman, Bartosová-Sojková and Atkinson, 2015, from the NCBI database. Taxon names and accession numbers are given in Figure 5. Trees were calculated from the sequence alignments using maximum likelihood (ML) and maximum parsimony (MP) analyses. ML was performed using PhyML version 3.0 (Guindon and Gascuel, 2003) implemented via a web server (http://www.atgc-montpellier.fr/phyml/; Guindon et al., 2010) using an automatic model selection. MP was computed in PAUP* v.4.0b10 (Swofford, 2001) employing a heuristic search with 10 repetitions of random sequence addition, the ACCTRAN-option, with tree bisection and reconnection branch swapping. Sphaeromyxa zaharoni (AY538662) and Myxidium ceccarellii (KJ499821) were used as outgroup taxa. Gaps were treated as missing data. In all analyses, bootstrap confidence was calculated using 1000 replicates. The trees were visualized using Figtree 1.3.1 (Rambaut, 2008) and annotated using Adobe Photoshop (Adobe Systems Inc., California, USA).

3. Results

3.1 Morphological description and taxonomic summary

Plasmodia at different stages of development were found free in the bile of C. monoculus. Early stage plasmodia were spherical, measured 9.6 (5.5 - 15.7) µm, had a nucleus, and did not contain visible sporogonic stages (Fig. 1B). Semi-mature plasmodia were elongated and asymmetric, had a blunt, nucleated anterior pole, narrow posterior; some had sporogonic stages within the posterior end (Figs. 1B, 2A). The dimensions of immature plasmodia were extremely variable, averaging 71.6 (22.1 - 188.1) µm in length and 8.9 (5.7 - 20.1) µm in width. Plasmodia that contained distinct myxospores were considered to be mature (Figs. 1A, 2B), and were elongate, length 304.2 (196 - 402) µm, width 35.7 (18.3 - 55.1) µm, with a blunt anterior pole within which early sporogonic stages were visible, tapering to a narrow posterior end. Sporogonic stages and myxospores showed a developmental gradient along the length of the plasmodium, with more mature myxospores towards the centre and posterior (Figs. 1A, 2B).

Fig. 1. Light photomicrographs of plasmodia of Ceratomyxa n. sp. 1 parasite of the gallbladder of Cichla monoculus. A: elongated plasmodium with nucleus (large arrow) in the growth centre at the anterior pole (ap), early sporogonic stages (es) and mature myxospores (ms), and a narrow posterior pole (pp). B: young plasmodia. Note spherical early stages (sp) with nuclei (thin arrows) and elongated plasmodium (ep) with nucleus (large arrow) in the growth centre at the anterior pole (ap); no sporogonic stages are present. Bar = 25 µm. Stain = Giemsa.

Myxospores elongate, with two valve cells slightly asymmetric, 19.3 ± 1.4 μm and 20.5 ± 1.3 μm thick, about a central suture (Figs. 3, 4). Formalin-fixed spore length 6.3 ± 0.6 (5.1 - 7.5) µm, thickness 41.2 ± 2.9 (37.1 - 47.6) µm and posterior angle 147º. Polar capsules ovoid and equal in size, length 2.6 ± 0.3 (2 - 3.3) µm, width 2.5 ± 0.4 (1.8 - 3.7) µm containing polar filaments with 3 - 4 turns around the longitudinal axis of the capsules (Fig. 4).

Fig. 3. Light photomicrographs of myxospores of Ceratomyxa n. sp. 1. A and B: mature myxospores. Bar = 10 µm.

Fig. 4. Schematic drawing of a mature myxospore of Ceratomyxa n. sp. 1 showing principal measured components SL: spore length, ST: spore thickness, PA: posterior angle. Bar = 10 µm.

Phylum: Cnidaria Verrill, 1865 Unranked Sub-phylum Myxozoa Grassé (1970) Class: Myxosporea Bütschli, 1881 Order: Bivalvulida Shulman, 1959 Family: Ceratomyxidae Doflein, 1899 Genus: Ceratomyxa Thélohan, 1892 Species: Ceratomyxa n. sp. 1 (Figs. 1 - 4).

Type host: Cichla monoculus Agassiz, 1831. Prevalence: 1 of 29 (3.4%). Type locality: Tapajós River, near the city of Santarém, Pará State, Brazil, (02°20'214''S, 54°52' 890'' W). Site of infection: Lumen of gall bladder. Type material: glass slides with fixed, stained spores (syntype) deposited in the Museum of Zoology “Adão José Cardoso” University of Campinas (UNICAMP), São Paulo, Brazil (accession numbers Zuec MYX 60 and MYX 61). The ssrDNA sequence was deposited in GenBank (accession number KU978813).

3.2 Molecular sequencing and phylogenetic analysis

We generated a partial ssrDNA sequence, length 1,605 nt. The BLASTn search showed that this sequence was not > 97% similar to any other myxozoan in the NCBI database. The ML and MP analyses used a General Time Reversible model of evolution (GTR+I). The phylogenetic tree showed two distinct lineages (Fig. 5). The small clade A comprised species that infect freshwater/amphidromous/brackish water fishes. Ceratomyxa n. sp. 1, C. amazonensis and C. vermiformis formed a well-supported subclade of parasites from freshwater Amazonic fishes, and sister to a branch that contains Ceratomyxa tunisiensis Thabet, Mansoura, Omar and Zouaria, 2015 and Ceratomyxa leatherjacketi Fiala, Hlavnicková, Kodádková, Freeman, Bartošova- Sojková and Atkinson, 2015. Myxodavisia bulani was the basal species in clade A. The larger

clade B was composed exclusively of species that parasitize marine fishes. There were two basal subclades B1 and B2, which comprised parasites of, respectively, deep water oceanic fishes, and of sharks and cod (Fig. 5).

4. Discussion

The spores of Ceratomyxa n. sp. 1 were compared primarily with other freshwater Ceratomyxa species (Eiras et al., 2006; Azevedo et al., 2013; Mathews et al., 2016; Adriano and Okamura 2016). Morphologically it resembles Ceratomyxa anguillae Tuzet and Ormières, 1957, a parasite of Anguilla anguilla from France, and Ceratomyxa microlepis Azevedo, Rocha, Casal, São Clemente, Matos, Al-Quraisky and Matos, 2015 parasitizing Hemiodus microlepis from the Amazon. However, myxospores of Ceratomyxa n. sp. 1 are much thicker than those of C. anguillae (41.2 versus 25-30 µm) and longer and thicker than C. microlepis (6.3 x 41.2 μm versus 5.2 x 35.5 μm). The elongated plasmodia of Ceratomyxa n. sp. 1. resemble those of C. vermiformis, but plasmodia of C. vermiformis were observed to be motile (Adriano and Okamura 2016), whereas we did not observe any motility in plasmodia of Ceratomyxa n. sp. 1. In comparison with known marine species (Eiras et al., 2006; Heiniger and Adlard, 2013), Ceratomyxa n. sp. 1 morphologically resembles Ceratomyxa augusta Meglitsch, 1960, parasitizing Hypoplectrodes semicintus and Helicolenus percoides, and Ceratomyxa rohdei Moser, Kent and Dennis, 1989, a parasite of Petroscrites fallax, both from the Pacific Ocean. However, Ceratomyxa n. sp. 1 is longer than both species (6.3 versus 5.5 µm for C. augusta and 4.6 µm for C. rohdei) and thinner (41.2 versus 42.1 µm for C. augusta and 43.3 µm for C. rohdei). The polar capsules of Ceratomyxa n. sp. 1 contain polar filaments with 3 - 4 turns while those from C. augusta have 5 - 7 and C. rohdei have 6 - 8 turns. Ceratomyxa n. sp. 1 was also genetically different to all other Ceratomyxa species in the NCBI database. An additional and notable feature of plasmodia of Ceratomyxa n. sp. 1 was their axial asymmetry, with a concentration of nuclei in a blunt, anterior pole and an anucleate, tapering, posterior pole (Fig. 1). Adriano and Okamura (2016) showed that plasmodia of a related Amazonian myxosporean, C. vermiformis, have an anterior pole with a concentration of nuclei, which is the growth center of the plasmodium, and a narrow, anucleate, posterior pole. We assume that the concentration of nuclei in the anterior pole of Ceratomyxa n. sp. 1 probably represents a similar growth centre, since we observed a gradient of spore development away from the pole, from early sporogonic stages to mature spores (Figs. 1B and 2B), which is very similar to C. vermiformis.

The systematics of genus Ceratomyxa has been somewhat controversial, as has the evolutionary context of Ceratomyxa spp. within the myxozoan “marine lineage” (Fiala et al., 2015a). Inclusion of freshwater taxa, C. amazonensis and C. vermiformis, has revealed a basally divergent lineage of Ceratomyxa/Myxodavisia/Palliatus species relative to the majority of marine Ceratomyxa species (Mathews et al., 2016; Adriano and Okamura, 2016). Our addition of Ceratomyxa n. sp. 1, further resolved the relationships among these basal taxa (clade "A"), and showed existence of an Amazonian freshwater Ceratomyxa lineage in both ML and MP analyses, sister to a branch composed of C. tunisiensis and C. leatherjacketi (Fig. 5). The relationship between basal clade A and the earliest diverging exclusively marine taxa in clade B had robust bootstrap support in both ML and MP analyses; relationships between the two most-basal marine sub-clades B1 and B2 were well supported only in the ML analysis, and future analyses should benefit from increased taxon sampling of novel Ceratomyxa species from primitive fish host groups. Clusters of Ceratomyxa species within the analyses correlate to differing degrees with host, locality and habitat (e.g. Gunter et al., 2009; Fiala et al., 2015a). Of the most basal taxa, the Amazon species share geography, habitat (freshwater) and two of three share the fish host family: Ceratomyxa sp. and C. amazonensis have cichlid fish hosts; C. vermiformis, parasitizes a serrasalmid fish. There are few apparent non-genetic characters to connect the other basal taxa in the Ceratomyxa clade: they are from taxonomically diverse marine fish hosts from widely separate geographic areas. The tendency of ceratomyxids from different geographic localities to group phylogenetically, has been observed previously, and makes higher level understanding of their evolutionary relationships difficult with current taxon sampling and genetic data (Gunter et al., 2009; Fiala et al., 2015a). Besides geography, clustering of the most basal species reflects some commonality of host habitat and biology, since three species were reported from freshwater hosts and another two from fish that are either amphidromous or can inhabit brackish water. These connections with freshwater distinguish at least some of the basal taxa from most other Ceratomyxa clades, which infect fully marine fish host species.

Recent molecular phylogenetic data from other myxozoan genera suggests broader correspondence between lineages and host environment (e.g. Fiala et al., 2015b) and demonstrates that these parasites have shifted between freshwater and marine environments on multiple occasions. Whether the free-living cnidarian ancestor of the Myxozoa was marine or freshwater is an ongoing discussion (e.g. Fiala et al., 2015b). The presence of freshwater Ceratomyxa within the broader marine lineage, exemplifies a shift between marine and freshwater hosts. Adriano and Okamura (2016) suggest that early Ceratomyxa species infected hosts associated with freshwater environments before they diversified and radiated into marine hosts. In this context, the environmental history of the Amazon basin would have supported host and parasite shifts between marine and freshwater environments during periods of marine incursion over the last 9 - 11 million years (Rasanen, et al., 1995; Webb, 1995; Stampar et al., 2012). Although additional sequences of Ceratomyxa species from freshwater hosts are needed to identify additional shared characters and phylogenetic patterns, the basal freshwater Ceratomyxa lineage in our analyses may represent a genetic relic of geologic events and host shifts in the Amazon basin. While the discovery of an additional, novel, Amazonian freshwater Ceratomyxa species, Ceratomyxa n. sp. 1, and its phylogenetic placement basally as sister taxon to two other Amazonian freshwater species, demonstrates that even early-divergent myxozoan taxa can have freshwater hosts, the presence of sister taxa that are fully marine confounds attempts to nominate a marine or freshwater origin for the group as a whole. Further sampling of freshwater Ceratomyxa spp., especially from the Amazon, is fundamental to advancing the understanding of the origins and species radiations in both the Ceratomyxa clade and myxozoans in general.

5. References

Adriano, E.A., Okamura, B., 2016. Motility, morphology and phylogeny of the plasmodial worm, Ceratomyxa vermiformis n. sp. (Cnidaria: Myxozoa: Myxosporea). Parasitol. doi:10.1017/S0031182016001852.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLASTn and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25, 3389–33902.

Azevedo, C., Rocha, S., Casal, G., São Clemente, S.C., Matos, P., Al-Quraishy, S., Matos E., 2013. Ultrastructural description of Ceratomyxa microlepis sp. nov. (Phylum Myxozoa): a parasite infecting the gall bladder of Hemiodus microlepis, a freshwater teleost from the Amazon River. Mem. Inst. Oswaldo Cruz 108, 150–154.

Bartholomew, J.L., Atkinson, S.D., Hallett, S.L., Lowenstine, L.J., Garner, M.M., Gardiner, C.H., Rideout, B.A., Keel, M.K., Brown, J.D., 2008. Myxozoan parasitism in waterfowl. J. Parasitol. 38, 1199–1207.

Bartošova-Sojková, P., Hrabcová, M., Peckova, A., Patra, S., Kodadkova, A., Jurajda, P., Tyml, T., Holzer, A.S., 2014. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. Int. J. Parasitol. 44, 565–577.

Batista, V.S., Petrere, M., 2003. Characterization of the commercial fish production landed at Manaus, Amazonas State, Brazil. Acta Amazonica 33, 53–66.

Canning, E.U., Okamura, B., 2004. Biodiversity and evolution of the Myxozoa. Adv. Parasitology 56, 43–131.

Chang, E.S., Neuhof, M., Rubinsteind, N.D., Diamante, A., Philippe, H., Huchon, D., Cartwright P., 2015. Genomic insights into the evolutionary origin of Myxozoa within Cnidaria. PNAS 112, 14912–14917.

Diamant, A., Whipps, C.M., Kent, M.L., 2004. A new species of Sphaeromyxa (Myxosporea: Sphaeromyxina: Sphaeromyxidae) in devil firefish, Pterois miles (Scorpaenidae), from the northern Red Sea: Morphology, ultrastructure, and phylogeny. J. Parasitol. 90, 1434–1442.

Dos Santos, C.H.S., De Sousa, C.F.S., Paula-Silva M.N., Val, A.L., Almeilda-Val, V.M.F., 2012. Genetic diversity in Cichla monoculus (Spix & Agassiz, 1931) populations: implications for management and conservation. Am. J. Environ. Sci. 8, 35–41.

Eiras, J.C., 2006. Synopsis of the species of Ceratomyxa Thélohan, 1892 (Myxozoa: Myxosporea: Ceratomyxidae). Syst. Parasitol. 65, 49–71.

Fiala I., Hlavnicková M., Kodádková A., Freeman M.A., Bartosová-Sojková P., Atkinson S.D. 2015a. Evolutionary origin of Ceratonova shasta and phylogeny of the marine myxosporean lineage. Mol. Phylog. Evol. 86, 75–89.

Fiala, I., Bartošová-Sojková, P., Okamura, B., Hartikainen, H., 2015b. Adaptive Radiation and Evolution Within the Myxozoa, in Okamura, B., Gruhl, A., Bartholomew, J.L. (Eds.), Myxozoan Evolution, Ecology and Development. Springer, Switzerland. pp. 69–84.

Fontes, I., Hallet, S.L., Mo, T.A. 2015. Comparative Epidemiology of Myxozoan Diseases, in Okamura, B., Gruhl, A., Bartholomew, J.L. (Eds.), Myxozoan Evolution, Ecology and Development. Springer, Switzerland. pp. 317–41.

Froese, R., Pauly, D. 2009. FishBase. http://www.fishbase.org (accessed 07.07.2016).

Guindon, S., Gascuel, O. 2003. A simple, fast and accurate algorithm to estimate large large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704.

Holland, J.W., Okamura, B., Hartikainen, H., Secombes, C.J., 2011. A novel minicollagen gene links cnidarians and myxozoans. Proc. Roy. Soc. Ser. B. 278, 546–553.

Jiménez-Guri, E., Philippe, H., Okamura, B., Holland, P.W.H., 2007. Buddenbrockia is a cnidarian worm. Science 317, 116–118.

Gunter, N.L., Whipps, C.M., Adlard, D.R., 2009. Ceratomyxa (Myxozoa: Bivalvulida): Robust taxon or genus of convenience? Int. J. Parasitol. 39, 1395–1405.

Hall, T.A., 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95– 98.

Hallett, S.L., Diamant, A., 2001. Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Dis. Aquat. Organ. 46, 197–212.

Heiniger, H., Adlard, R.D., 2013. Molecular identification of cryptic species of Ceratomyxa Thélohan, 1892 (Myxosporea: Bivalvulida) including the description of eight novel species from apogonid fishes (Perciformes: Apogonidae) from Australian waters. Acta Parasitol. 58, 342–360.

Hillis, D.M., Dixon, M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411–453.

Kent, M.L., Andree, K.B., Bartholomew. J.L., El-Matbouli, M., Desser, S.S., Devlin, R.H., Feist, S.W., Hedrick, R.P., Hoffmann, R.W., Khattra, J., Hallett, S.L., Lester, R.J., Longshaw, M., Palenzeula, O., Siddall, M.E., Xiao. C., 2001. Recent advances in our knowledge of the Myxozoa. J. Eukaryot. Microbiol. 48, 395–413.

Lom, J., Arthur, J.R., 1989. A Guideline for the Preparation of Species Description in Myxosporea. J. Fish Dis. 12, 151–156.

Lom, J., Dyková, I., 2006. Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol. 53, 1–36.

Mackenzie, K., Kalavati, C., 2014. Myxosporean parasites of marine fishes: their distribution in the world’s oceans. Parasitology 141, 1709–1717.

Mathews, P.D., Naldoni, J., Maia, A.A.M., Adriano, E.A., 2016. Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon. Parasitol. Res. 10.1007/s00436-016-5173-4.

Nesnidal, M.P., Helmkampf, M., Bruchhaus, I., El-Matbouli, M., Hausdorf, B., 2013. Agent of whirling disease meets orphan worm: phylogenomic analyses firmly place Myxozoa in Cnidaria. PLoS ONE 8, e54576.

Okamura, B., Gruhl, A., Reft, A.J., 2015. Cnidarian origins of Myxozoa, in: Okamura, B., Gruhl, A., Bartholomew, J.L. (Eds.), Myxozoan Evolution, Ecology and Development, Springer, Switzerland. pp. 45–68.

Rasanen, M.E., Linna, A.M., Santos, J.C.R., Negri, F.R., 1995. Late Miocene Tidal Deposits in the Amazonian Foreland. Basin. Science 269, 386–390.

Rambaut A., 2008. FigTree v1.1.1: Tree figure drawing tool. http:// tree.bio.ed.ac.uk/software/figtree/ (accessed: 06.06.2016).

Siddall, M.E., Martin, D.S., Bridge, D., Desser, S.S., Cone, D.K., 1995. The demise of a phylum of protists: phylogeny of Myxozoa and other parasitic cnidaria. J. Parasitol. 81, 961–967.

Swofford, D.L 2001. Paup*. Phylogenetic Studies Using Parsimony (* and other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

Stampar, S.N., Maronna, M.M., Vermeij, M.J.A., Silveira, F.L.D., Morandini, A.C., 2012. Evolutionary Diversification of Banded Tube-Dwelling Anemones (Cnidaria, Ceriantharia, Isarachnanthus) in the Atlantic Ocean. PLoS ONE 7, doi:10.1371/journal.pone.0041091.

Takeuchi, F., Sekizuka, T., Ogasawara, Y., Yokoyama, H., Kamikawa, R., Nozaki, T., Konishi- Sugita, Y., Ohnish, T., Kuroda, M., 2015. The mitochondrial genomes of a myxozoan genus Kudoa are extremely divergent in Metazoa. PLoS ONE: 10, doi: 10.1371/journal.pone.0132030.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Webb, S.D., 1995. Biological Implications of the Middle Miocene Amazon Seaway. Science 21, 361–362.

Weill, R., 1934. Contribution à l’étude des cnidaires et de leurs nématocystes. Trav. Sta. Zool. Wimereux. 10, 1–701.

Whipps, C.M., Adlard, R.D., Bryant, M.S., Lester, R.G.J., Findlay, V., Kent, M.L., 2003. First report of three Kudoa species from Eastern Australia: Kudoa thyrsites from Mahi mahi (Coryphaena hippurus), Kudoa amamiensis and Kudoa minithyrsites n. sp. from Sweeper (Pempheris ypsilychnus). J. Eukaryot. Microbiol. 50, 215–219.

CAPÍTULO 22

A lack of genetic diversity in Ceratomyxa n. sp. 2 (Cnidaria, Myxozoa) correlates with the migratory life history of its host, the Amazonian catfish Brachyplatystoma rousseauxii

SUMMARY

We describe a new freshwater myxosporean species Ceratomyxa n. sp. 2 from the gall bladder of the Amazonian catfish Brachyplatystoma rousseauxii; the first myxozoan recorded in this host. The new Ceratomyxa was described on the basis of its host, myxospore morphometry, ssrDNA, and ITS-1 sequences. Infected fish were sampled from Tapajós River, Pará State; Amazon River, Amapá State and Solimões River, Amazonas State. Immature and mature plasmodia were slender, tapered at both ends, and exhibited vermiform motility. The ribossomal sequences from parasite isolates from the three localities were identical, and distinct from all other Ceratomyxa sequences. No population-level genetic variation was observed, even in the typically more variable ITS-1 region. This absence of genetic variation in geographically distant parasite isolates suggests high gene flow among the parasite population. Maximum likelihood and maximum parsimony analyses placed Ceratomyxa n. sp. 2 sister to Ceratomyxa vermiformis in a subclade together with Ceratomyxa n. sp. 1 and Ceratomyxa amazonensis, all of which have Amazonian hosts. This subclade, together with other Ceratomyxa from freshwater hosts, formed an early divergent lineage. The position of the Amazonian, freshwater Ceratomyxa species may be evidence of host/parasite shifts between marine and freshwater environments facilitated by marine incursions into the Amazon basin in the Early Miocene.

Key words: Amazon basin, myxozoans, freshwater, goliath catfish, ssrDNA, ITS-1 sequencing

2Artigo submetido à revista Parasitology, 2017 (formatação de acordo com as normas do periódico).

1. Introduction

Myxozoans are a group of highly specialized endoparasites, characterized by morphologically reduced spores, and complex life cycles that involve both vertebrate (predominantly fish) and invertebrate (annelids or bryozoans) hosts (Kent et al., 2001; Lom and Dyková, 2006). With more than 2,400 described species (Bartošova-Sojková et al., 2014) they have adapted to hosts in freshwater, marine and terrestrial habitats, and this adaptability may have been crucial for their persistence and diversity. There is strong molecular, phylogenetic and structural evidence for the relationships between myxozoans and free-living Cnidaria (Jiménez- Guri et al., 2007; Takeuchi et al., 2015; Nesnidal et al., 2013) however, the mechanisms behind the transitions to parasitism, and subsequent radiation of these organisms remain obscure (Okamura et al., 2015). Ceratomyxa Thélohan, 1892, is the second largest myxozoan genus, with over 240 described species, most of which infect the gall bladders of marine teleosts (Eiras, 2006; Gunter et al., 2009; Gunter and Adlard, 2010; Fiala et al., 2015). Ceratomyxa myxospores are distinctly elongated, crescent-shaped or arcuate, with two shell valves and two subspherical polar capsules located at the spore apex, adjacent to a straight suture line (Lom and Dyková, 2006). Three other genera have morphologically similar myxospores: Myxodavisia Zhao, Zhou, Kent and Whipps, 2008 myxospores are distinguished from Ceratomyxa on the basis of having valve cell appendages (Zhao et al., 2008); Palliatus Shulman, Kovalevá and Dubina, 1979 spores have a membranous veil (Lom and Dyková, 2006); Meglitschia Kovaleva, 1988 was erected to encompass Ceratomyxa insolita Meglitsch, 1960, whose myxospores differ from other Ceratomyxa spp. by being highly arcuate, with large and elongated polar capsules. Available molecular data for Myxodavisia bulani Fiala, Kodádková, Freeman, Bartošova-Sojková and Atkinson, 2015, and Palliatus indecorus Schulman, Kovaleva and Dubina, 1979, demonstrate that these taxa cluster in a basal position within the “Ceratomyxa” lineage in ssrDNA-based phylogenetic studies (Fiala et al., 2015; Adriano and Okamura 2016; Cap. 1). Molecular data from additional taxa, particularly type species, is needed to better assess the validity of maintaining these groups as four distinct genera (Fiala et al., 2015; Adriano and Okamura 2016).

Within of the Ceratomyxa lineage, only six species have been described from strictly freshwater environments, and five of these are from the Amazon basin: C. mylei (syn. Meglitschia mylei) (Azevedo, Ribeiro, Clemente, Casal, Lopes, Al-Quraishy and Matos, 2011), C. microlepsis Azevedo, Rocha, Casal, São Clemente, Matos, Al-Quraishy and Matos, 2013, C. amazonensis Mathews, Naldoni, Maia and Adriano, 2016, C. vermiformis Adriano and Okamura, 2016, and Ceratomyxa sp. 1. (Cap. 1). One of these Amazonian species, C. vermiformis, has elongated plasmodial stages that exhibit coordinated, undulatory locomotion in the bile of its host. This form of worm-like movement is not known from any other myxosporean, but has been observed in myxoworm stages of taxa in class Malacosporea (Adriano and Okamura 2016). During a survey of Myxozoa of the Amazon basin, Brazil, we found a novel, freshwater Ceratomyxa species that parasitized the catfish Brachyplatystoma rousseauxii Castelnau, 1855 (Siluriformes: Pimelodidae). Known as “dourada” in Portuguese, this fish performs the longest strictly freshwater migration in the world, a journey of approximately 11,600 km (Barthem et al. 2017). Dourada spawns during varying periods of the year in the head waters of the Andean tributaries, and the larvae are transported downriver to the Amazon estuary in Brazil (Barthem and Goulding, 2007). Juveniles remain in the estuary region for around 1.5 - 2.0 years (Barthem and Goulding, 2007). Then, they move into the lower and middle Amazon using the river channels and floodplains as its nursery, where they may remain for a further year until migrate back into headwaters to spawn. There is some evidence of homing behavior as well an occurrence of distinct populations in different watersheds (Carvajal-Vallejos et al. 2014). We sampled dourada from three distant rivers in the basin, and based on morphological, ssrDNA, and ITS-1 sequencing identified the same novel Ceratomyxa species in each locality. ITS-1 analysis determined that the parasite has a uniform population structure despite geographic separation of samples, a feature we suggest is evidence of mixing of the parasite population over great distances due to the particular migratory behavior of its fish host.

2. Material and Methods

2.1 Fish and parasite sampling

Thirty B. rousseauxii were collected by net from three localities (GPS coordinates given in Results): N = 17 (average length 44 (34 - 59) cm) from the Tapajós River, Pará State, Brazil in October 2014 and March 2015; N = 1 (length 52 cm) from Amazonas River, Amapá State, Brazil in October 2015; and N = 12 (average length 77 (33 - 103) cm) from Solimões River, Manacapuru, Amazonas State in December 2015 (Fig. 1). The catches were authorized by the Brazilian Ministry of the Environment (SISBIO nº 44268-4), and the examination methodology was approved by the Ethics Committee on Animal Use, University of Campinas (CEUA/UNICAMP nº 3846). Fish were euthanized by overdose of benzocaine solution (70 mgL- 1) and necropsied. Gall bladders were removed, ruptured and bile samples examined under light microscope; samples that contained myxosporeans were subdivided and fixed in 10% neutral- buffered formalin for spore measurement (Lom and Arthur, 1989) and in 100% ethanol for DNA sequencing. A total of thirty myxospores from ten different plasmodia from a single host were photographed using a Carl Zeiss Axio Imager A2 light microscope equipped with Axio Cam and AxioVision AxioVs 40V4.8.2 software, using differential interference contrast. Measurements of formalin-fixed myxospores followed the general guidelines of Lom and Arthur (1989), and Gunter et al., (2009) for Ceratomyxa spp., with modifications suggested by Adriano and Okamura (2016) for strongly arcuate myxospores. We use the more structurally accurate term “polar tubule” instead of “polar filament” (Ben-David et al., 2016). Measurements were expressed as mean with standard deviation, with ranges reported in parentheses. Type myxospores were also air-dried onto glass slides, stained with Giemsa, and deposited in the Museum of Zoology “Adão José Cardoso” University of Campinas (UNICAMP), São Paulo, Brazil.

Fig 1. Map of the myxozoan Ceratomyxa sp. 2 collection localities in the Amazon basin: Solimões River, Amazonas State; Tapajós River, Pará State and Amazon River, Amapá State.

2.2 Molecular studies

DNA was extracted from 50 μl of infected bile preserved in ethanol. The sample was pelleted at 15,700 G for 10 min and the ethanol removed. DNA was extracted from the pellet using a DNeasy® Blood & Tissue Kit (animal tissue protocol) (Qiagen Inc., California, USA). ssrDNA was amplified using a semi-nested PCR. The first-round amplification targeted the entire ssrDNA with the universal primers 18E (CTGGTTGATTCTGCCAGT; Hillis and Dixon, 1991) and 18R (CTACGCAAACCTTGTTACG; Whipps et al., 2003). PCR was conducted in a 20 μl reaction volume, comprising: 1 μl template DNA (10 - 50 ng/μl), 1.25 μl GoTaq Flexi polymerase (Promega, San Luis Obispo, California, USA), 0.2 μl mM each dNTPs,

0.50 μl each primer (10 pmol), 4 μl 5× GoTaq Flexi clear buffer, 2.4 μl MgCl2 (1.5 mM), 0.50 μl BSA, 0.4 μl Rediload dye (Invitrogen, Carisbad, California, USA) and 10.05 μl ultrapure water. PCR was performed on a PTC-200 Thermocycler (MJ Research Inc., Watertown, Massachusetts, USA) with initial denaturation at 95 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 62 °C for 30 s (or 58 °C and 60 s with second-round primers), and 72 °C for 120 s, following by a terminal extension at 72 °C for 7 min. Semi-nested second-round PCR generated overlapping fragments using primers 18E and ACT1R (AATTTCACCTCTCGCTGCCA; Hallett and Diamant, 2001) and MXATK2f (ACGCTTGCGAAGYGTGCCTT, Cap. 1) with 18R. For the ITS-1 amplification, the first round was performed with the novel primer MYXATK3f (CATTTGAGGGCGTTAGTACTTG) paired with NC13R (GCTGCGTTCTTCATCGAT, Gasser et al., 1993) followed by a second round with ALL1F (GCGGCTTAATTTGACTCAACACGGG, Hallett et al., 2002) and NC13R. These primers produced fragments that extended from the ssrDNA through the ITS-1 and terminated in the 5.8S. The PCR protocol was the same as above, but with an annealing temperature of 60 ºC. All amplicons were electrophoresed in a 1.5% agarose gel with Tris-borate-EDTA buffer (0.045 M Tris-borate, 0.001 M EDTA, pH 8.0) stained with SYBRsafe (Invitrogen By Life Technologies, Maryland, USA) alongside a 1 kb Plus DNA Ladder (Invitrogen By Life Technologies, Maryland, USA), then analyzed on a Compact Digimage System transilluminator (Major Science, Saratoga, California, USA). Products from PCRs that produced a single bright band were purified with QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's instructions, then sequenced in both directions. Sequencing reactions were performed using a BigDye 102 Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) in an ABI 3730 DNA 103 Analyzer (Applied Biosystems) at the Oregon State University Center for Genome Research and Biocomputing.

2.3 Sequence assembly, alignment and phylogenetic analyses

Forward and reverse sequences were aligned by eye and assembled into consensus sequences using BioEdit (Hall, 1999). Chromatograms were examined for polymorphic loci (indicated by coincident peaks; we used an arbitrary visual threshold for recording secondary

peaks only if they were at least 50% of the height of the primary peak). Consensus sequences were searched using BLASTn (Altschul et al., 1997) with the GenBank database to identify the most closely-related taxa. Phylogenetic analyses were performed on an alignment of 81 ssrRNA sequences from related species, which included all available Ceratomyxa spp., P. indecorus and M. bulani, retrieved from NCBI database (accession numbers are indicated in the phylogenetic tree). Sequences were aligned with ClustalW (Thompson et al., 1997) using default parameters. Gaps were treated as missing data. Phylogenetic trees were calculated using maximum likelihood (ML) and maximum parsimony (MP) methods. The optimum evolutionary model for the dataset was obtained by the Akaike Information Criterion using jModelTest 0.1.1 (Posada, 2008), which identified GTR+I+G as the best-fit model. ML analysis was made using PhyML version 3.0 (Guindon and Gascuel, 2003) implemented via the web server (http://www.atgc- montpellier.fr/phyml/) (Guindon et al., 2010). MP was computed in PAUP* v.4.0b10 (Swofford, 2002) employing a heuristic search with 10 repetitions of random sequence addition, the ACCTRAN-option, with tree bisection and reconnection branch swapping. Basal myxosporean taxa Chloromyxum auratum (AY971521) and Chloromyxum clavatum (JQ793641) were used as outgroups. Bootstrap support was calculated using 1000 replicates for both methods. Trees were visualized using Figtree 1.3.1 (Rambaut, 2008) and annotated in Adobe Photoshop (Adobe Systems Inc., California, USA). Sequence divergence among all Ceratomyxa from Amazon were estimated using p-distance and distance (base pairs differences) methods in MEGA 7.0 (Kumar et al., 2016) using default parameters.

3. Results

Morphological, molecular and host data supported description of a new Ceratomyxa species, Ceratomyxa n. sp. 2. We found the parasite in gall bladders of B. rousseauxii at each of the three sample locations: 82% (14/17) from the Tapajós River, 100% (1/1) from the Amazon River and 50% (6/12) from the Solimões River; with an average prevalence of 70% (21/30).

Parasite plasmodia were elongated, and exhibited undulatory, worm-like locomotion, swimming freely in the bile.

3.1 Morphological description and taxonomic summary

Phylum: Cnidaria Verrill, 1865 Unranked Sub-phylum: Myxozoa Grassé 1970 Class: Myxosporea Bütschli, 1881 Order: Bivalvulida Shulman, 1959 Family: Ceratomyxidae Doflein, 1899 Genus: Ceratomyxa Thélohan, 1892

Ceratomyxa n. sp. 2 (Figs. 2 - 4).

Vegetative stages: Motile, elongated plasmodia at different stages of development were found swimming freely in the bile of B. rousseauxii. Immature plasmodia contained few sporogonic stages and no mature myxospores (Fig. 2A), average length 112 (72 - 134) μm and width 8.9 (4.6 - 11.8) μm. Mature plasmodia contained mature myxospores in their medial portion (Fig. 2B), length 181 (173 - 246) μm and width 11.4 (7.2 - 16.2) μm. Mature myxospores: strongly arcuate in side view, valve length 28 ± 3 (23 - 35) µm, spore length 4.4 ± 0.4 (3.3 - 5.7) µm, spore thickness 7.0 ± 0.5 (6 - 8) µm (Table 1). Two spherical, equal- sized and anterior polar capsules, 1.9 ± 0.3 (1.5 - 2.5) µm in diameter, each containing a polar tubule with 2 - 3 turns around the longitudinal axis of the capsules. Posterior angle measured 37° ± 3° (35° - 40°) (Figs. 3A, B). Type host: Brachyplatystoma rousseauxii (Siluriformes: Pimelodidae) Prevalence across the sites: 21 of 30 (70%). Type locality: Tapajós River, municipality of Santarém, Pará State, Brazil, (02°20'28''S, 54°52'

56''W). Other localities: Amazon River, municipality of Vitória do Jari, Amapá State

(01°08′17″S, 51°48′31″W) and Solimões River, municipality of Manacapuru, Amazonas State

(03°18′08″S, 60°28′ 00″W).

Site of infection: Lumen of gall bladder.

Type material: Glass slides with fixed, stained myxospores (syntype) were deposited in the Museum of Zoology “Adão José Cardoso” University of Campinas (UNICAMP), São Paulo, Brazil (Zuec MYX 65). Concatenated ssrDNA, ITS-1 and partial 5.8S sequences were deposited in the NCBI GenBank database (accession numbers: KY934182 from Tapajós River, KY934183, from Solimões River and KY934184 from Amazon River).

Fig 2. Light photomicrographs of plasmodia of Ceratomyxa n. sp. 2 from the gallbladder of Brachyplatystoma rousseauxii. A: immature plasmodium. Note the tapered ends (te) at both poles, and early sporogonic stages (es) in the medial region of the plasmodium (P). B: mature plasmodium showing mature myxospores (ms). Bars: 20 µm.

Fig 3. Light photomicrographs of Ceratomyxa n. sp. 2. A and B: mature myxospores. Bars = 10 µm.

Fig 4. Schematic drawing of Ceratomyxa n. sp. 2 showing details of the principal measured components. SL: spore length, ST: spore thickness, VL: valves length, PA: posterior angle. Bar = 10µm.

Table 1 Comparison of morphometry of Ceratomyxa n. sp. 2 with Amazonian Ceratomyxa spp. with arcuate myxospores.

Species STL LA SW ST PC PT Type host Locality *Ceratomyxa n. sp. 2 28 ± 3 24 ± 2 7 ± 0.5 4.4 ± 0.4 1.9 ± 0.3 2 - 3 B. rousseauxii Tapajós River, PA (This study) (23 – 35) (19 – 29) (6 – 8) (3.3 – 5.7) (1.5 – 2.5) Amazon River, AP Solimões River, AM *Ceratomyxa vermiformis 26 ± 2 18.8 ± 0.7 8.4 ± 0.4 5.4 ± 03 2.7 ± 0.1 3 - 4 C. macropomum Tapajós River, PA Adriano and Okamura, 2016 (22 – 29) (17.6 – 19.3) (7.9 – 9.3) (4.9 – 5.7) Amazon River, AP 17.5 ± 0.8 (16.4 – 18.3) Ceratomyxa mylei 24.6 ± 0.8 20.1 ± 0.7 8.7 ± 0.4 5.1 ± 0.3 2.1 ± 0.3 5 - 6 M. rubripinnis Lagoon of Sapuruá, AM (syn. Meglitschia mylei) Azevedo et al. 2011

SL VL SW ST PA **Ceratomyxa n. sp. 2 4.4 ± 0.4 28 ± 3 -- 7 ± 0.5 37 ° ± 3 ° (This study) (3.3 – 5.7) (23 – 35) (6 – 8) (35 ° – 40 °) **Ceratomyxa vermiformis 4.5 ± 0.2 23.7 ± 0.7 5.4 ± 03 8.4 ± 0.4 30.2 o ± 6.6 ° Adriano and Okamura, 2016 (4.2 – 4.8) (22.1 – 24.3) (4.9 – 5.7) (7.9 – 9.3) (22 o – 43 °) 21.9 ± 08 (20.6 – 23) *Measurements given in accordance with Azevedo et al. (2011) to compare with M. mylei. **Measurements given as for Ceratomyxa species based on Gunter et al. (2009) to compare with Ceratomyxa spp., as presented by Adriano and Okamura (2016). STL: spore total length; LA: length of appendices; SW: spore width, ST: spore thickness; SL: spore length; VL: valve length; PCs: polar capsule diameter; PT: polar tubule turns; PA: posterior angle. PA= Pará State; AP=Amapá State; AM=Amazonas State.

3.2 Molecular and phylogenetic analyses

We obtained partial rDNA sequences (18S - ITS-1 - 5.8S) for Ceratomyxa n. sp. 2 from each of the three localities: 1839 nt from Tapajós River, 1855 nt from Solimões River, and 1849 nt from Amazon River. The sequences were identical. The BLASTn search did not reveal any other sequence more than 94% similar to Ceratomyxa n. sp. 2. The ITS-1 region began approximately 1635 nt from the start of primer 18E and was about 165 nt long. At four positions - 1725, 1747, 1763 and 1809 nt - we observed ~50/50 mixtures of alleles as single nucleotide polymorphisms at the same positions in the Ceratomyxa n. sp. 2 sequences from the three rivers (Fig. 5). Phylogenetic analysis revealed two main clades, A and B (Fig. 6). The large clade A contains a subclade A1 of exclusively Ceratomyxa marine species, plus two small marine subclades, A2 which comprised Ceratomyxa sp. (DQ377699), Ceratomyxa synaphobranchi Fiala, Hlavnicková, Kodádková, Freeman, Bartošova-Sojková and Atkinson, 2015 and P. indecorus, both of which are parasites of deep water marine fish, and A3, which comprised parasites of sharks and cod. Ceratomyxa n. sp. 2 clustered in the smaller clade B at the base of the tree, together with C. vermiformis, C. amazonensis and Ceratomyxa n. sp. 1, which formed a subclade of species with exclusively freshwater Amazonian fish hosts. This subclade was sister to Ceratomyxa leatherjacketi Fiala, Hlavnicková, Kodádková, Freeman, Bartošova- Sojková and Atkinson, 2015 and Ceratomyxa tunisiensis Thabet, Mansoura, Omar and Zouaria, 2015, which together with M. bulani collectively formed an early-diverging within the marine myxosporean lineage (Fig. 6).

4. Discussion

We found a novel Ceratomyxa species, Ceratomyxa n. sp. 2 in the bile of an economically important Amazonian catfish, B. rousseauxii. This parasite is only the seventh known freshwater Ceratomyxa species, out of several hundred congeners with marine hosts. Parasite myxospores developed in the gall bladder and the myxospores are typical of Ceratomyxa spp., but morphologically these myxospores were strongly arcuate in frontal view, with extended valve cells characteristic of Meglitschia – a genus with otherwise limited morphological characters to distinguish it from Ceratomyxa, and unsupported by molecular data (Zhao et al., 2008; Adriano and Okamura, 2016). Accordingly, we compared the morphology of Ceratomyxa n. sp. 2 primarily with other freshwater Ceratomyxa spp. and then, with other congeners from marine/brackish hosts, guided by the species checklist of Eiras et al., (2006) and other recent taxonomic studies (Gunter et al., 2009; Azevedo et al., 2011; Azevedo et al., 2013; Fiala et al., 2015; Mathews et al., 2016; Adriano and Okamura 2016; Cap. 1). The strongly arcuate myxospores of Ceratomyxa n. sp. 2 resemble those of both C. vermiformis, a parasite of the Colossoma macropomum, and C. mylei, a parasite of Myleus rubripinnis; both hosts are serrasalmid fishes from the Amazon basin. However, Ceratomyxa n. sp. 2 myxospores differed morphometrically from these species, being longer, narrower and thinner, with smaller polar capsules and fewer turns of the polar tubules (Table 1). Both C. vermiformis and Ceratomyxa n. sp. 2 have elongated, motile plasmodia, which are unique in the Myxosporea. Morphologically, the plasmodia of C. vermiformis have a blunt end, which is also a growth pole (Adriano and Okamura, 2016), whereas Ceratomyxa n. sp. 2 has thin, tapering ends to its plasmodia. Although we observed early developmental stages in the medial region of plasmodia (Fig. 2), we did not observe a distinct growth pole in this species. Another Amazonian myxozoan, Ceratomyxa n. sp. 1, has elongated plasmodia, but these were not observed to be motile (Cap. 1). Ceratomyxa n. sp. 2 was distinct from most other Ceratomyxa species on the basis of its strongly arcuate spores and elongated valve cells. Those few species with arcuate spores, C. insolita, Ceratomyxa inconstans Jameson, 1929,

and Ceratomyxa sphairophora Davis, 1917, all differ in valve length and spore width compared with Ceratomyxa n. sp. 2 (Meglitsch 1960; Eiras et al., 2006). ssrDNA gene sequences have been used widely for phylogenetic analyses within the Myxozoa as it is sufficiently variable in this group to distinguish species. ssrDNA sequence data clearly distinguish Ceratomyxa n. sp. 2 from its congeners where data were available, and it was at least 5.2% different from its nearest relative, C. vermiformis (Table 2). Levels of interspecific genetic variation vary (Ferguson et al., 2008; Carriero et al., 2013), and Ceratomyxa species have been shown to differ by 2% to more than 20% (Gunter et al., 2009). The interspecific differences among Ceratomyxa spp. from the Amazon ranges from 2.4% (Ceratomyxa n. sp. 1 versus C. amazonensis) to 6.9% (Ceratomyxa n. sp. 2. versus C. amazonensis) (see Table 2). Unfortunately, there is no molecular data from the other Amazonian species C. mylei for comparison, but we consider the considerable morphological differences in plasmodia and spores discussed above, and the different specific host sufficient grounds for considering Ceratomyxa n. sp. 2 novel.

Species 1 2 3 4

1. Ceratomyxa n. sp. 2 - 92 109 109

2. Ceratomyxa vermiformis 5.2 - 82 74

3. Ceratomyxa n. sp. 1 6.8 5.1 - 38

4. Ceratomyxa amazonensis 6.9 4.7 2.4 -

ssrDNA is typically conserved within isolates of the same species, hence the neighboring, more variable internal transcribed spacer region (ITS-1) region has been used to identify intraspecific differences (strains/genotypes) (Whipps, 2006; Atkinson and Bartholomew, 2010a, b). Accordingly, after finding no ssrDNA differences between Ceratomyxa sp. 2 isolates, we sequenced its ITS-1 region. We identified a series of polymorphic loci (SNPs) in the ITS-1, which were evident as two mixed peaks at the same 4 locations in all sequence chromatograms. The absence of variability in the sequences in this known variable genome region was surprising, and is evidence that the parasite population is genetically uniform despite wide geographic separation of the collection localities: in a straight line, the Solimões River site is ~660 km from the Tapajós River, and around 1000 km from the Amazon River; the distance between Tapajós and the Amazon is ~370 km. Hence, by comparing the ITS-1 sequences of the parasite we hypothesized that this identity is evidence of high gene flow among the parasite populations. We consider that this gene flow is a result of the fish host’s exceptional freshwater migratory behavior: B. rousseauxii migrates across the Amazon basin, from the Andes foothills to the Amazon River estuary in Brazil, where fish mature before migrating back up river to complete their life cycle (Barthem and Goulding, 2007; Barthem et al., 2017). Pathogens and parasites are potentially carried with the fish along

this migration route and their populations mixed over great distances. In the case of Ceratomyxa n. sp. 2, geographical separation has apparently not lead to genetic population structure, and we hypothesize that this uniformity is maintained by parasite mixing via the migratory behavior of its fish host. The addition of Ceratomyxa n. sp. 2 to ML and MP phylogenetic analyses of Ceratomyxa species further supported existence of an Amazonian freshwater Ceratomyxa lineage (Adriano and Okamura, 2016; Mathews et al., 2016; Cap. 1). Ceratomyxa n. sp. 2 was shown to be a sister-species to the morphologically similar C. vermiformis, in a subclade that also contains Ceratomyxa n. sp. 1 and C. amazonensis. Those species together with C. tunisiensis, C. leatherjacketi and M. bulani formed a well-supported early divergent clade B (Fig. 6). This position for the Amazonian freshwater lineage sister to the larger, fully marine Ceratomyxa clade may be a genetic signal of historical marine incursions into the Amazon basin (Cap. 1). Massive movements of marine waters into the basin during the Early Miocene (Lovejoy et al., 1998) could have facilitated host/parasite shifts between marine and freshwater environments and influenced the phylogeny and biogeography of Amazonian freshwater species. Recent discoveries and DNA sequence analyses of novel Amazonian Ceratomyxa spp., have revealed the important basal position of these fresh water taxa within what had been regarded as a marine myxosporean group, and thereby contribute to broader speculation of myxozoan origins in freshwater versus marine hosts.

5. References

Adriano, E. A. and Okamura, B. (2016). Motility, morphology and phylogeny of the plasmodial worm, Ceratomyxa vermiformis n. sp. (Cnidaria: Myxozoa: Myxosporea). Parasitology 144, 158-168. doi: 10.1017/S0031182016001852.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLASTn and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-33902.

Atkinson, S. D. and Bartholomew, J. L. (2010a). Disparate infection patterns of Ceratomyxa shasta (Myxozoa) in rainbow trout Oncorhynchus mykiss and Chinook salmon Oncorhynchus tshawytscha correlate with ITS-1 sequence variation in the parasite. International Journal for Parasitology 40, 599-604. doi: 10.1016/j.ijpara.2009.10.010.

Atkinson, S. D. and Bartholomew, J. L. (2010b). Spatial, temporal and host factors structure the Ceratomyxa shasta (Myxozoa) population in the Klamath River basin. Infection, Genetics and Evolution 10, 1019-1026. doi: 10.1016/j.meegid.2010.06.013.

Azevedo, C., Rocha, S., Casal, G., São Clemente, S. C., Matos, P., Al-Quraishy, S. and Matos, E. (2013). Ultrastructural description of Ceratomyxa microlepis n. sp. (Phylum Myxozoa): a parasite infecting the gall bladder of Hemiodus microlepis, a freshwater teleost from the Amazon River. Memórias do Instituto Oswaldo Cruz 108, 150-154. doi: 10.1590/0074-0276108022013004.

Azevedo, C., Ribeiro, M., Clemente, S. C. S., Casal, G., Lopes, L., Matos, P., Al- Quraishy, A. S. and Matos, E. (2011). Light and ultrastructural description of Meglitschia mylei n. sp. (Myxozoa) from Myleus rubripinnis (Teleostei: Serrasalmidae) in the Amazon River system. Journal of Eukaryotic Microbiology 58, 525-528. doi: 10.1111/j.1550- 7408.2011.00583.x.

Barthem, R. B., Goulding, M, Leite, R. G., Cañas, C., Forsberg, B., Venticinque, E., Petry, P., Ribeiro, M.L.B., Chuctaya, J. and Mercado, A. (2017). Goliash catfish spawing in the far western Amazon confirmed by the distribution of mature adults, drifting larvae and migrating juveniles. Scientific Reports 7, 41784. doi: 10.1038/srep41784.

Barthem, R. B. and Goulding, M. (2007). Un Ecosistema Inesperado: La Amazonía Revelada Por La Pesca. Gráfica Biblos, Lima, Perú.

Bartošova-Sojková, P., Hrabcová, M., Pecková, A., Patra, S., Kodádková, A., Jurajda, P., Tyml, T. and Holzer, A. S. (2014). Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. International Journal for Parasitology 44, 565–577. doi: 10.1016/j.ijpara.2014.04.005.

Ben-David, J., Atkinson, S. D, Pollak, Y., Yossifon, G., Shavit, U., Bartholomew, J. L. and Lotan, T. (2016). Myxozoan polar tubules display structural and functional variation. Parasites & Vectors 9, 549. doi: 10.1186/s13071-016-1819-4.

Carvajal-Vallejos, F. M., Duponchelle, F., Desmarais, E., Cerqueira, F., Querouil, S., Nunez, J., Garcia, C. and Renno, J. F. (2014). Genetic structure in the Amazonian catfish Brachyplatystoma rousseauxii: influence of life history strategies. Genetica 142, 323-336. doi: 10.1007/s10709-014-9777-2.

Carriero, M. M., Adriano, E. A., Silva, M. R. M., Ceccarelli, P. S. and Maia, A. A. M. (2013). Molecular phylogeny of the Myxobolus and Henneguya genera with several new South American species. PLoS One 8, e73713. doi.org/10.1371/journal.pone.0073713.

Eiras, J. C. (2006). Synopsis of the species of Ceratomyxa Thélohan, 1892 (Myxozoa: Myxosporea: Ceratomyxidae). Systematic Parasitology 65, 49-71. doi:10.1007/s11230-006- 9039-5.

Ferguson, J. A., Atkinson, S. D., Whipps, C. M. and Kent, M. L. (2008). Molecular and morphological analysis of Myxobolus spp. of salmonid fishes with the description of a new Myxobolus species. Journal of Parasitology 94, 1322-1334. dx.doi.org/10.1645/GE-1606.1.

Fiala, I., Hlavnicková, M., Kodádková, A., Freeman, M. A., Bartosová-Sojková, P. and Atkinson, S. D. (2015). Evolutionary origin of Ceratonova shasta and phylogeny of the marine myxosporean lineage. Molecular Phylogenetic and Evolution 86, 75-89. doi: 10.1016/j.ympev.2015.03.004.

Gasser, R. B., Chilton, N. B., Hoste, H. and Beveridge, I. (1993). Rapid sequencing of rDNA from single worms and eggs of parasitic helminths. Nucleic Acids Research 21, 2525- 2526.

Guindon, S., and Gascuel, O. (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696-704.

Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk, W. and Gascuel, O. (2010). New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Systematic Biology 59, 307-21. doi: 10.1093/sysbio/syq010.

Gunter, N. L. and Adlard, R. D. (2010). The demise of Leptotheca Thélohan, 1895 (Myxozoa: Myxosporea: Ceratomyxidae) and assignment of its species to Ceratomyxa Thélohan, 1892 (Myxosporea: Ceratomyxidae), Ellipsomyxa Køie, 2003 (Myxosporea: Ceratomyxidae), Myxobolus Bütschli, 1882 and Sphaerospora Thélohan, 1892 (Myxosporea: Sphaerosporidae). Systematic Parasitology 75, 81-104. doi: 10.1007/s11230-009-9227-1.

Gunter, N. L. and Adlard, R. D. (2009). Seven new species of Ceratomyxa Thélohan, 1892 (Myxozoa) from the gall-bladders of serranid fishes from the Great Barrier Reef. Australia. Systematic Parasitology 73, 1–11. doi: 10.1007/s11230-008-9162-6.

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor andanalysis program for windows 95/98/NT. Nucleic Acids Symposium Series 41, 95-98.

Hallett, S. L. and Diamant, A. (2001). Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Diseases of Aquatic Organisms 46, 197-212.

Hallett, S. L., Atkinson, S. D. and El-Matbouli, M. (2002). Molecular characterization of two aurantiactinomyxon (Myxozoa) phenotypes reveals one genotype. Journal of Fish Diseases 25, 627-631.

Hillis, D. M. and Dixon, M. T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66, 411-453.

Jiménez-Guri, E., Philippe, H., Okamura, B. and Holland, P. W. H. (2007). Buddenbrockia is a cnidarian worm. Science 317, 116-118.

Kent, M. L., Andree, K. B., Bartholomew, J. L., El-Matbouli, M., Desser, S. S., Devlin, R. H., Feist, S. W., Hedrick, R. P., Hoffmann, R. W., Khattra, J., Hallett, S. L., Lester, R. J. G., Palenzeula, O., Siddall, M. E. and Xiao, C. (2001). Recent advances in our knowledge of the Myxozoa. Journal of Eukaryotic Microbiology 48, 395-413.

Kumar, S., Stecher, G. and Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular Biology and Evolution 33, 1870-1874. doi: 10.1093/molbev/msw054.

Lom, J. and Arthur, J. R. (1989). A guideline for the preparation of species descriptions in Myxosporea. Journal of Fish Diseases 12, 151-156. doi: 10.1111/j.1365- 2761.1989.tb00287.x.

Lom, J. and Dyková, I. (2006). Myxozoan genera: definition and notes on taxonomy, life- cycle terminology and pathogenic species. Folia Parasitologica 53, 1-36.

Lovejoy, N. R., Bermingham E. and Martin A. P. (1998). Marine incursion into South America. Nature 396, 421-422. doi: 10.1038/24757.

Mathews, P. D., Naldoni, J., Maia, A. A. M. and Adriano, E. A. (2016). Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon. Parasitology Research 383, doi: 10.1007/s00436-016-5173-4.

Meglitsch, P. A. (1960). Some Coelozoic Myxosporidia from New Zealand Fishes – General, and Family Ceratomyxidae. Transactions of the Royal Society of New Zealand 88, 265-356.

Nesnidal, M. P., Helmkampf, M., Bruchhaus, I., El-Matbouli, M. and Hausdorf, B. (2013). Agent of whirling disease meets orphan worm: phylogenomic analyses firmly place Myxozoa in Cnidaria. PLoS ONE 8, 6. doi.org/10.1371/journal.pone.0054576.

Okamura, B., Gruhl, A. and Bartholomew, J. L. (2015). An Introduction to Myxozoan Evolution, Ecology and Development. In Myxozoan evolution, ecology and development (ed.

Okamura, B., Gruhl, A. and Bartholomew, J. L.), pp.1-20. Springer International Publishing, Switzerland. doi:10.1007/978-3-319-14753-6_1.

Posada, D. (2008). jModelTest: Phylogenetic Model Averaging. Molecular Biology and Evolution 25, 1253-1256. doi: 10.1093/molbev/msn083.

Rambaut, A. (2008). FigTree v1.1.1: Tree figure drawing tool. http:// tree.bio.ed.ac.uk/software/figtree/ (accessed: 06.04.2017).

Swofford, D. L. (2002). Paup*. Phylogenetic Studies Using Parsimony (* and other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

Takeuchi, F., Sekizuka, T., Ogasawara, Y., Yokoyama, H., Kamikawa, R., Nozaki, T., Konishi-Sugita, Y., Ohnish, T. and Kuroda, M. (2015). The mitochondrial genomes of a myxozoan genus Kudoa are extremely divergent in Metazoa. PLoS ONE, 10. doi 10.1371/journal.pone.0132030.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882.

Whipps, C. M., Adlard, R. D., Bryant, M. S. and Kent, M. L. (2003). Two unusual myxozoans, Kudoa quadricornis n. sp. (Multivalvulida) from the muscle of godspotted trevally (Carangoides fulvoguttatus) and Kudoa permulticapsula n. sp. (Multivalvulida) from the muscle of Spanish mackerel (Scomberomorus commersoni) from the Great Barrier Reef, Australia. Journal of Parasitology 89, 168-173.

Whipps, C. M. and Kent, M. (2006). Phylogeography of the cosmopolitan marine parasite Kudoa thyrsites (Myxozoa: Myxosporea). Journal of Eukaryotic Microbiology 53, 364-373. doi: 10.1111/j.1550-7408.2006.00114.x.

Zhao, Y. J., Zhou, Y., Kent, M. L. and Whipps, C. M. (2008). Replacement of the preoccupied name Davisia Laird 1953 and description of a new myxozoan species

(Myxosporea: Sinuolineidae) from Sebastiscus marmoratus (Cuvier, 1829) in the East China Sea. Journal of Parasitology 94, 269-279. doi: 10.1645/GE-1232.1.

CAPÍTULO 33

Morphology and ssrDNA-based phylogeny of three new Henneguya spp. (Cnidaria: Myxozoa) parasites of cichlids fish from Amazon basin, Brazil

ABSTRACT

We describe three new Henneguya spp. (Myxobolidae) found parasitizing two species of Cichlid fish from the Amazon basin, Brazil: Henneguya n. sp. 1 infecting the gills filaments of Cichla monoculus; Henneguya n. sp. 2 in the gill filaments of Cichla pinima, both from Tapajós River, Pará State; and Henneguya n. sp. 3 in the fins of Cichla monoculus from Jari River, Amapá State. We based our descriptions on myxospore morphology and small subunit ribosomal DNA sequences, with a phylogenetic analysis of the three new Henneguya species in comparison with known relatives. Spores of the three species had similar morphology and morphometrics, but differed molecularly from 5% to 7.5%, and were no more than 94% similar to any other sequence in GenBank. Together with having distinct hosts, these data supported the diagnosis of the parasites as distinct, novel species. Maximum parsimony and maximum likelihood analyses showed that Henneguya n. sp. 1, Henneguya n. sp. 2, and Henneguya n. sp. 3 plus Henneguya paraensis formed a well-supported sub-clade composed of Henneguya parasites of Cichlids from the Amazon basin, in a lineage sister to those in pangasiid hosts. Our analysis was consistent with previous studies that suggest that aquatic environment (marine/brackish/fresh water) and vertebrate host group are the strongest correlates with phylogenetic signals in Myxobolidae.

Keywords: Amazon . Cichla monoculus . Cichla pinima. freshwater . ssrDNA sequencing

3Artigo a ser submetido à revista Parasitology Research, 2017 (formatação de acordo com as normas do periódico).

1. Introduction

Myxozoans are a species rich group of endoparasitic Cnidaria, which infects a wide range of vertebrate and invertebrate hosts worldwide (Lom and Dyková 2006; Bartošová-Sojková et al. 2014). They represent a major group of parasites in both wild and farmed fish with more than 2,400 nominal species, distributed in 63 genera, and classified mainly by spore morphology (Fiala et al. 2015; Okamura et al. 2015). Although most species do not cause disease, some are highly pathogenic and cause serious ecological and economic impacts to their host fish populations (Kent et al. 2001; Feist and Longshaw 2006; Feist, 2008). Despite recent efforts, knowledge about the diversity of myxozoan parasites in South America is still limited, especially in the Amazon basin, which possesses the world's richest and most diversified ichthyofauna (Reis et al. 2003), all of which are potential hosts of myxozoans. The genus Henneguya Thélohan, 1892, harbours more than 200 species, most commonly found in fresh water fish (Eiras et al. 2002; Eiras and Adriano 2012). Fifty-five Henneguya species have been described in Brazil, of which 16 were reported from Amazon basin fishes (Eiras et al. 2002; Eiras and Adriano 2012; Rocha et al. 2014; Videira et al. 2015; Mathews et al. 2016; Velasco et al. 2016). Only four species have been reported from cichlid fish in the Amazon: H. amazonica Rocha, Matos and Azevedo 1992, described infecting the gill lamellae of Crenicichla lepidota; H. aequidens Videira, Velasco, Azevedo, Silva, Gonçalves, Matos and Matos 2015, parasite of the gill filaments of Aequidens plagiozonatus; H. melini Mathews, Maia and Adriano 2016, parasiting the gill filaments of Corydoras melini, and H. paraensis Velasco, Videira, Nascimento, Matos, Gonçalves and Matos 2016, that infect the gill filaments of Cichla temensis. Given there are at least 180 additional cichlid species known from the Amazon Basin (FishBase), we hypothesized that there are many undescribed Henneguya species present in this system. Accordingly, we surveyed three species of Cichla, Cichla monoculus Agassiz, 1831, Cichla pinima Kullander and Ferreira, 2006, and Cichla jariina Kullander and Ferreira, 2006, from different areas in Amazon basin, Brazil, and herein describe three new Henneguya

species based on morphology and ssrDNA sequencing. Cichla are popularly known as tucunaré in Portuguese or peacock bass. These species are a non-migratory and endemic in Amazon (Kullander and Ferreira 2006) and are important as subsistence and commercial food resources as well in sport fishing (Willis et al. 2007; Freitas and Campos 2014). We also investigated the phylogenetic position of these new Henneguya within the large Myxobolus/Henneguya clade (Family Myxobolidae), and found that the new species clustered with the other known species from Amazonian cichlids as a well-supported sub-clade sister to Henneguya spp. in pangasiid hosts.

2. Material and Methods

2.1 Sampling and morphological analysis

Fifty-seven fish were collected by seine netting, and examined during this study. Twenty-nine C. monoculus, average length 33.3 [26-51] cm and twenty-two C. pinima, average length 32 [27.5-52] cm, were collected from the Tapajós River, Pará State in October 2014 and March 2015. Six C. monoculus, average length 28 [24-30] cm were collected from the Jari River, Amapá State in October 2015. The sampling was authorized by Brazilian Ministry of the Environment (SISBIO nº 44268-4). Fish were euthanized by benzocaine overdose (70 mgL−1), measured and necropsied. This research methodology was approved by Ethics Committee on Animal Use of University of Campinas (CEUA/UNICAMP nº 3846-1). Under a stereomicroscope, the organs were thoroughly inspected for the presence of myxozoan cysts. Individual cysts were excised and fixed in 10% neutral-buffered formalin for spore measurements (Lom and Arthur 1980) and 100% ethanol for ssrDNA sequencing. Spores (N = 30) were photographed using differential interference contrast and measured using a Carl Zeiss Axio Imager A2 light microscope equipped with an Axio Cam, and AxioVision AxioVs 40V4.8.2 software. Measurements followed guidelines of Lom and Arthur (1989); except that we use the term “polar tubule” instead of “polar filament”.

2.2 ssrDNA extraction, amplification and sequencing

The cysts preserved in 100% ethanol were mechanically ruptured on a microscopic slide under a cover slip, and the content washed into a 2 mL tube using ATL Buffer from the DNeasy® Blood & Tissue Kit (animal tissue protocol) (QIAGEN Inc., California, USA). Total DNA was extracted following the manufacturer's instructions. The partial ssrDNA was amplified using a two-round PCR. Initial amplification was performed using primers ERIB1 (ACCTGGTTGATCCTGCCAG) and ERIB10 (CTTCCGCAGGTTCACCTACGG) (Barta et al. 1997), followed by a second round using either primers ERIB1 and ACT1R (AATTTCACCTCTCGCTGCCA) (Hallett and Diamant, 2001) and Myxigen4f (GTGCCTTGAATAAATCAGAG) (Diamant et al. 2004) or the new primer MyxidF4 (GTTAAAACGCTCGTAGTTGG) with ERIB10. PCR was performed in 20 μl reaction volumes that comprising: 1 μl DNA (10 - 50 ng/μl), 1.25 U GoTaq Flexi polymerase (Promega, San Luis Obispo, California, USA), 0.2 μl mM each dNTPs, 0.50 μl each primer (10 pmol), 4 μl 5× GoTaq Flexi clear buffer, 2.4 μl

MgCl2 (1.5mM), 0.50 μl BSA, 0.4 μl Rediload dye (Invitrogen, Carisbad, California, USA) and ultrapure water. PCR cycling was performed on a PTC-200 Thermocycler (MJ Research Inc., Watertown, Massachusetts, USA) using a block preheated to 95 °C, and cycle conditions of: 95 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 90 s with first-round primers (or 60 s when using second round primers), following by a terminal extension at 72 °C for 5 min. Negative and positive controls were included. Amplicons were electrophoresed in a 1.5% agarose gel in Tris-EDTA buffer (0.045 M Tris, 0.001M EDTA, pH 8.0) stained with SYBRsafe (Invitrogen By Life Technologies, Maryland, USA) alongside a 1 kb Plus DNA Ladder (Invitrogen By Life Technologies, Maryland, USA) at 90 V for 40 min, and then analyzed on a Compact Digimage System transilluminator (MajorScience). Amplicons were purified using the QIAquick PCR Purification Kit (QIAGEN Inc., California, USA) according to the manufacturer's instructions. Amplicons were directly sequenced in both directions using BigDye 102 Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, California, USA) in an ABI 3730 DNA 103 Analyzer (Applied Biosystems,

California, USA) at Sequencing Facility, Center for Gene Research and Biotechnology, Oregon State University.

2.3 Sequencing assembly and phylogenetic analysis

Sequences were imported into BioEdit 7.1.3.0 (Hall, 1999) and aligned manually to produce consensus sequences. Chromatograms were checked to access the quality of the sequences and presence of any polymorphisms. A nucleotide BLASTn (Altschul et al. 1997) search was conducted to confirm amplification of myxozoan DNA. The 39 sequences with similarity >80% to the novel organisms were downloaded from NCBI genome database and used in the phylogenetic analyses. Sequences were initially aligned in ClustalW (Thompson, 1994) using default parameters. Sphaeromyxa zaharoni Diamant, Whipps and Kent 2004 (AY538662) and Chloromyxum leydigi Mingazzini, 1890 (AY604199) were chosen as outgroup in both methods. Maximum likelihood (ML) analysis was performed using PhyML version 3.0 implemented via the web server (http://www.atgc-montpellier.fr/phyml/) (Guindon et al. 2010). We used jModelTest 0.1 (Posada, 2008) to estimate the following model parameters: General Time Reversible substitution model (GTR+G+I) using Akaike Information Criteria with nucleotide frequencies of A= 0.2456, C= 0.1862, G= 0.2869, T= 0.2813; six rates of nucleotide substitution were calculated: A–C= 1.0826, A–G= 2.7506, A– T= 1.2115, C–G= 0.7339, C–T= 4.3363, G–T= 1.0000, and the alpha value of gamma distribution parameter was estimated to be 0.3930. Maximum parsimony (MP) analysis was performed using PAUP* v.4.0b10 (Swofford, 2002) employing a heuristic search with 10 repetitions of random sequence addition, the ACCTRAN-option, with tree bisection and reconnection branch swapping. Gaps were treated as missing data. Clade support was assessed by bootstrapping 1000 replicates. The trees were visualized using Figtree 1.3.1 (Rambaut, 2008) and edited using Adobe Photoshop (Adobe Systems Inc., California, USA). A genetic distance analysis was carried out for Henneguya parasites from cichlids using the p-distance model matrix in MEGA 7.0 (Kumar et al. 2016). Gaps and missing data were deleted.

3. Results

Plasmodia containing spores with morphological characteristics of the genus Henneguya were observed in 3.4% (1/29) C. monoculus and 45% (10/22) C. pinima caught in the Tapajós River and in 17% (1/6) C. monoculus collected in the Jari River.

3.1 Taxonomic summary and morphological data

Phylum: Cnidaria Verrill, 1865 Unranked Sub-phylum Myxozoa Grassé (1970) Class: Myxosporea Bütschli, 1881 Order: Bivalvulida Shulman, 1959 Family: Myxobolidae Thélohan, 1892 Genera: Henneguya Thélohan, 1892

Henneguya n. sp. 1 (Figs. 1A, 2A)

Type host: Cichla monoculus Agassiz, 1831, Perciformes, Cichlidae. Prevalence: 1of 29 (3.4%). Type locality: Tapajós River, near the city of Santarém, Pará State, Brazil. Coordinates: 02°20′03″S 54°52′33″W. Site of infection: Gill filaments. Type material: a glass slides with stained spores (syntype) has been deposited in the collection of the Museum of Zoology “Adão José Cardoso” of the State University of Campinas (UNICAMP), State of São Paulo, Brazil (accession numbers Zuec MYX - after journal acceptance). The ssrDNA sequence was deposited in GenBank database under accession number KY751401. Description of myxospores: Whitish, oval-shaped plasmodia up to 300 μm diameter, contained numerous mature and immature spores. Mature spores were ellipsoid in valvar view and biconvex in sutural view, total length 43.8 ± 4.1 (36.1 - 49.6) µm, body length 14 ± 0.8 (12.1 - 15.7) µm and width 6.1 ± 0.7 (4.9 - 7.8) µm. Each valve cell had a caudal projection,

length 28.1 ± 4.3 (19.6 - 35.6) µm. Two polar capsules, pyriform, at the anterior pole of the spore, equal in size, 3.4 ± 0.5 (2.5 - 4.6) µm long and 2.0 ± 0.3 (1.3 - 2.6) µm wide, with 3 - 4 turns of the polar tubule (Table 1).

Henneguya n. sp. 2 (Figs. 1B, 2B).

Type host: Cichla pinima Kullander & Ferreira, 2006, Perciformes, Cichlidae. Prevalence: 10 of 22 (45.4%). Type locality: Tapajós River, near the city of Santarém, Pará State, Brazil. Coordinates: 02°20′03″S 54°52′33″W. Site of infection: Gill filaments. Type material: a glass slides with stained spores (syntype) has been deposited in the collection of the Museum of Zoology “Adão José Cardoso” of the State University of Campinas (UNICAMP), State of Sao Paulo, Brazil under accession number Zuec MYX - after journal acceptance). The ssrDNA sequence was deposited in GenBank database under accession number KY751402. Description of myxospores: Several small and slight elongate plasmodia occurring within a single gill filament, each up to 200 μm diameter. Mature myxospores, total length 55.9 ± 3.9 (49.5 - 64.7) μm with an ellipsoidal spore body, length 15.9 ± 1.5 (13.5 - 19.7) μm, width 7.1 ± 0.9 (6 - 9.3) μm and thickness 5 ± 0.1 (4.8 - 5). Valve cells extended to equal-sized caudal processes, 39.8 ± 3.2 (36 - 46.5) μm long. Two polar capsules equal in size, pyriform, 4.3 ± 0.5 (3.4 - 5.0) μm long and 2.4 ± 0.3 (2 - 2.8) μm wide, with 4 - 5 turns of the polar tubule.

Henneguya n. sp. 3 (Figs. 1C, 2C)

Type host: Cichla monoculus Agassiz, 1831, Perciformes, Cichlidae. Prevalence: 1 of 6 (16.7 %). Type locality: Jari River, municipality of Vitória do Jari, (District of Jarilândia), Amapá State, Brazil. Coordinates: 01°07′29″S 51°59′42″W. Site of infection: soft tissue fins.

Type material: a glass slides with stained spores (syntype) has been deposited in the collection of the Museum of Zoology “Adão José Cardoso” State University of Campinas (UNICAMP), State of Sao Paulo, Brazil (accession numbers Zuec MYX - after journal acceptance). ssrDNA sequence was deposited in GenBank database under accession number KY751403. Description of myxospores: Small, round, whitish plasmodia, up to 500 µm diameter, in soft tissue of the fins of C. monoculus. Mature myxospores had thin, smooth walls with symmetric valves, total length 46.7 ± 1.5 (43.9 - 49.2) μm, spore body length 13.4 ± 0.7 (11.9 - 14.6) μm and width 6.5 ± 0.5 (4.9 - 7.3) μm. Valve cells extended to equal length caudal processes, 33.2 ± 1.7 (30.2 - 37) μm. The polar capsules, elongate obovoid, equal sized, length 4 ± 0.3 (3.4 - 4.3) μm, width 2 ± 0.1 (1.7 - 2.4) μm, containing polar tubules with 4 turns.

FIG. 2 Mature spore drawing of the three new species described. A: Henneguya n. sp. 1 parasiting the gill filaments of Cichla monoculus from Tapajós River, Pará. B: Henneguya n. sp. 2 found to infecting the gill of Cichla pinima from Tapajós River, Pará. C: Henneguya n. sp. 3 parasite of the fins of Cichla monoculus from Jari River, Amapá. Bars=10 μm.

3.2 Molecular and phylogenetic analysis

ssrDNA sequences were obtained from the Henneguya species: 1478 nt from Henneguya sp. 1 (GenBank accession number KY751401); 1932 nt from Henneguya n. sp. 2 (GenBank accession number KY751402) and 1951 nt from Henneguya n. sp. 3 (GenBank accession number KY751403). The sequences were not more than 94% similar to any other sequence in GenBank, and were all most similar to Henneguya paraensis (Velasco et al. 2016), with similarities of 94%, 92% and 94% respectively. A similarity matrix of the ssrDNA gene sequences comparing only Henneguya sequences from Cichla spp. showed that the smallest genetic distance was of 5% between Henneguya n. sp. 1 and H. paraensis, and the largest was 7.5%, between Henneguya n. sp. 2 and H. paraensis (Table 2).

ML and MP phylogenetic trees constructed for the selected Henneguya/Myxobolus sequences showed Henneguya n. sp. 1, Henneguya n. sp. 2 and Henneguya n. sp. 3 grouped with the previously described H. paraensis, in a well-supported sub-clade, which represented parasites of Cichla spp. This subclade was sister to that composed by Myxobolus pangasii Molnár, Székely, Mohamed and Shaharom-Harrison 2006, and Myxobolus hakyi Baska, Voronin, Eszterbauer, Müller, Marton and Molnár 2009, both parasites of Asian Pangasiidae fish (Fig. 3). The larger clade of Perciformes plus Pangasiidae had only low bootstrap values in both ML and MP analyses.

3.3 Taxonomic affinities:

The three new Henneguya species were compared with other species from the Amazon basin, and from freshwater fish from other regions, based on morphological and molecular data where available (Eiras et al. 2002; Eiras and Adriano 2012; Carriero et al. 2013; Moreira et al. 2013; Moreira et al. 2014; Naldoni et al. 2014; Rocha et al. 2014, Mathews et al. 2016).

• Henneguya n. sp. 1: considering only Amazonian species, Henneguya n. sp. 1 myxospores resemble those of H. paraensis, which also parasites a fish of the genus Cichla, except that Henneguya n. sp. 1 spores have shorter polar capsules and spore body width, longer spore body and fewer turns of the polar tubules (Table 1). ssrDNA sequences were 5% different (Table 2). In comparison with the two other novel species described herein, Henneguya n. sp. 1 differs from Henneguya n. sp. 2 by having smaller spore total length and caudal appendage length, and fewer polar tubules coils (Table 1), and having a genetic difference of 6.9% (Table 2). Compared with Henneguya n. sp. 3, Henneguya n. sp. 1 has only subtle morphological differences, as slighter smaller spore total length and appendages (Table 1), however, these species are 5.3% different in their ssrDNA. In the comparison with other Henneguya from different regions, Henneguya n. sp. 1 resembles morphologically the spores of Henneguya salmonicola Ward, 1919, a parasite of salmonid fishes in North America, but has a longer spore body (14.1 versus 12.4) and is narrower than H. salmonicola (6.1 versus 7.9 µm), and

differ at least 25% in ssrDNA sequence. The ssrDNA sequence of Henneguya n. sp. 1 did not match with any other myxosporean available in the GenBank database.

• Henneguya n. sp. 2: in comparison with other Henneguya described from the Amazon, Henneguya n. sp. 2 resembled Henneguya amazonica Rocha, Matos and Azevedo 1992, which also parasitizes gills of cichlid fish. However, the length of spore body and caudal appendences of Henneguya n. sp. 2 were shorter than those from H. amazonica, and its polar capsules were larger and wider (Table 2). In comparison with the other novel species described herein, Henneguya n. sp. 2 is larger in all dimensions than Henneguya n. sp. 3 (Table 2), and has a genetic difference of 7.1% (Table 1). Regarding Henneguya species from other geographical areas, Henneguya n. sp. 2 resembles Henneguya acuata Bond, 1939, a parasite of the esocid Esox masquinongy in North America. However, myxospores and polar capsules of H. acuata are longer, with more polar tubule coils than Henneguya n. sp. 2. There are no molecular data for H. acuata to inform the comparison. The ssrDNA sequence of Henneguya n. sp. 2 did not match with any other myxosporean available in the GenBank database.

• Henneguya n. sp. 3: compared to Amazonian species, this new species morphologically resembles Henneguya astyanax Vita, Corral, Matos and Azevedo 2003, but the spores of Henneguya sp. 3 are slightly shorter in spore body and polar capsules. Whereas H. astyanax parasitizes the gill filaments of a characid fish, Henneguya sp. 3 infects fins of a cichlid. Regarding the other Henneguya species, the new species resembles the spores of Henneguya garavelli Martins and Onaka 2006, a parasite of Cyphocharax nagelii, in Brazil. However, myxospores of Henneguya n. sp. 3 are wider, but with smaller polar capsules with more turns of the polar tubule. There are no molecular data on H. astyanax and H. garavelli to perform the genetic comparisons. The ssrDNA sequence of Henneguya n. sp. 3 did not match with any other myxosporean available in the GenBank database.

TABLE 1 Comparison of the spore’s dimensions of all Henneguya species described from Amazon basin including range, site of infection, host and geographic region. TL: total spore length, BL: body length, AppL: caudal appendices length, W: width, T: thickness, L: polar capsules length, W: polar capsules width, NPF: number of polar filament coils, dashes: no data.

Species Spore (μm) Polar capsules (μm) Type host and site of infection Type locality NPF TL BL AppL W T L W Henneguya n. sp. 1 43.8±4.1 (36.1-49.6) 14±0.8 (12.1-15.7) 28.1±4.3 (19.6-35.6) 6.1±0.7 (4.9-7.8) -- 3.4±0.5 (2.5-4.6) 1.98±0.3 (1.3-2.6) 3-4 Cichla monoculus, gill filaments Tapajós River, PA (this study) Henneguya n. sp. 2 55.9±3.9 (49.5-64.7) 15.9±1.5 (13.5-19.7) 39.8±3.2 (36-46.5) 7.1±0.9 (6-9.3) 5±0.1 (4.8-5.1) 4.3±0.5 (3.4-5) 2.4±0.3 (2-2.8) 4-5 Cichla pinima, gill filaments Tapajós River, PA (this study) Henneguya n. sp. 3 46.7±1.5 (43.9-49.2) 13.4±0.7 (11.9-14.6) 33.2±1.7 (30.2-37) 6.5±0.5 (4.9-7.3) -- 4±0.3 (3.4-4.3) 2±0.1 (1.7-2.4) 4 Cichla monoculus, fins Jari River, AP (this study) Henneguya paraensis 42.30±0.35 (41.65-42.95) 12.8±0.42 (12.38–13.22) 29.5±0.73 (28.77-30.23) 8.6±0.32 (8.18-8.92) -- 7.4±0.16 (6.67 -7.56) 2.6±0.08 (2.52–2.68) 5-7 Cichla temensis, gill filaments Tocantins River, PA (Velasco et al., 2016) Henneguya melini 40.8±0.3 (40.30-41.10) 15.5±0.20 (15.30-15.70) 25.30 ± 0.10 (25.2-25.4) 4.7±0.1 (4.6-4.8) -- 4.8±0.5 (4.3-5.3) 1.7±0.3 (1.4-2.0) 5-6 Corydoras melini, gill filaments Negro River, AM (Mathews et al., 2016) Henneguya aequidens 41±1.5 15±0.9 27±0.6 6±0.8 -- 3±0.3 3±0.3 4-6 Aequidens plagiozonatus, gill filaments Peixe Boi River, PA (Videira et al., 2015) Henneguya torpedo Brachyhypopomus pinnicaudatus, brain and 48.62±0.51 (48.3-48.9) 28.53±0.36 (28.3-30.1) 19.64±0.44 (19.2-19.9) 7.25±0.31(7.0-7.5) 3.06±0.2 (2.9-3.1) 6.41±0.26 (6.3-6.6) 1.84±0.19 (1.7-1.9) 5-6 Peixe Boi River, PA (Azevedo et al., 2011) spinal cord Henneguya arapaima 6.3±0.1(6.3-6.8) 51.6±3.4 (48.4-53.1) 14.2±0.8 (13.5-15.2) 38.3±2.9 (38.0-41.2) 5.7±0.5 (5.1-6.1) 4.9±0.2 (4.7-5.3) 6.5±0.2 (6.3-6.8) 5 Araipama gigas, gill arch and gall bladder Araguaia River, GO (Feijó et al., 2008) 6.3±0.1 (6.2-6.6) Henneguya rondoni 17.7 (16.9-18.1) 7 (6.8-7.3) 10.7 (10.3-11.0) 3.6 (3.0-3.9) 2.5 (2.2-2.8) 2.5 (2.2-2.8) 0.85 (0.79-0.88) 6-7 Gymnorhamphichthys rondoni, lateral nerves Amazonas River, PA (Azevedo et al., 2008) Henneguya rhamdia 50.0±1.8 13.1±1.1 36.9±1.6 5.2±0.5 -- 4.7±0.4 1.1±0.2 10-11 Rhamdia quelen, gill filaments Peixe Boi River, PA (Matos et al., 2005) Henneguya schtzodon 28.9 (27-30) 13.1 (12-14) 16.3 (15-17) 3.3 (3-4) -- 5.4 (5-6) 1.3 (1-1.5) 8-10 Schtzodon fasciatum, kidney Amazonas River, AM (Eiras et al., 2004) Henneguya friderici 33.8 (28.7-39.3) 10.4 (9.6-11.8) 23.3 (19.1-28.7) 5.7 (4.8-6.6) 4.9 4.9 (4.25-5.90) 2.1 (1.59-2.62) 7-8 Leporinus friderici, gills, gut, kidney, liver Amazonas River, PA (Casal et al., 2003) Henneguya astyanax 47.8±0.71 15.2±0.77 32.6±1.11 5.7±0.71 4.2±0.31 5.0±0.13 1.5±0.07 8-9 Astyanax keith, gill filaments Amazonas River, PA (Vita et al., 2003) Henneguya curimata 35.4 (34.2-36.1) 16.6 (16.0-17.4) 19.1 (18.3-19.9) 6.2 (5.8-6.6) -- 3.3±0.02 (2.7-3.6) 1.5±0.04 (1.1-1.9) 10-11 Curimata inormata, kidney Amazonas River, PA (Azevedo and Matos, 2002) Henneguya testicularis 27.5 (27.0-28.5) 14.0 (14.0-14.5) 13.5 (13.0-14.5) 6.5 (6.0-6.5) -- 9.0 (8.5-9.5) 2.0 (2.0-2.5) 12-13 Moenkhausia oligolepis, testicle Amazonas River, PA (Azevedo et al., 1997) Henneguya malabarica 28.3 (26.6-29.8) 12.6 (11.8-13.1) 17.1 (16.2-18.9) 4.8×3.6 -- 3.7 (3.0-4.3) 1.8 (1.6-2.2) 6-7 Hoplias malabaricus, gill filaments Estuarine region, PA (Azevedo and Matos, 1996) Henneguya adherens 32.3 (30.7-35.1) 12.4 (10.5-13.8) 20.5 (18.0-21.7) 5.8 (5.1-6.5) -- 3.1 (2.8-3.5) 1.2 (1.0-1.6) 3-4 Acestrorhynchus falcatus, gill filaments Amazonas River, AM (Azevedo & Matos, 1995) Henneguya amazonica 59.3±0.56 (55.0-65.9) 13.9±0.16 (11.50-14.90) 45.4±0.61 (41.7-52.1) 5.7±0.06 (5.2-6.3) -- 3.3±0.02 (2.7-3.6) 1.5±0.04 (1.1-1.9) 6 Crenlcichla lepldota, gill lamellae Amazonas River, AM (Rocha et al., 1992)

Species 1 2 3 4

1. Henneguya n. sp. 1 - 101 78 44 (C. monoculus) 2. Henneguya n. sp. 2 6.9 - 136 66 (C. pinima) 3. Henneguya n. sp. 3 5.3 7.1 - 45 (C. monoculus) 4. Henneguya paraensis 5.0 7.5 5.1 - (C. temensis)

4. Discussion

Three new species of myxosporeans of the genus Henneguya is here described infecting freshwater Perciformes hosts of the genus Cichla caught in Amazon basin. Henneguya n. sp. 1 and Henneguya n. sp. 3 were found infecting C. monoculus and Henneguya n. sp. 2 parasitizing C. pinima. So far, the report of myxosporeans infecting Cichla spp. was restrict to H. paraensis, parasite of the gills of C. temensis (Velasco et al., 2016) and Ceratomyxa n. sp. 1, from gallbladder of C. monoculus. Thus, this study expands critically the myxosporeans diversity from Cichla spp., that are economically important fish in the Amazon basin (Batista and Petrere, 2003). The phylogenetic analysis of Myxobolus/Henneguya more related with the three species described in this study, based on blast search, generated a tree with two primary branches. The smaller clade (A) consisted on exclusively freshwater species parasites from Siluriformes. The larger clade (B) further divided to compose lineages of parasites of different host orders/families from freshwater, brackish-water and marine. In the clade B1 that is composed exclusively by species parasites of freshwater host, Henneguya n. sp. 1, Henneguya n. sp. 2 and Henneguya n. sp. 3, together with H. paraensis formed a well-supported sub-clade composed by parasites of Amazonian freshwater Cicha spp. In this sub-clade, Henneguya n. sp. 3 that parasites the fins of C. monoculus appeared as the basal species, while Henneguya n. sp. 1 and Henneguya n. sp. 2, parasites of the gills of C. monoculus and C. pinima respectively, appeared as sister species. This subclade, although poorly supported, appeared as sister of branch composed by M. pangasii and M. bizerti, parasites of Asian pangasiids species. Together, these subclades appeared as sister of that composed by parasites of South American characiforms. The clustering of species parasites of Cichla spp., in a same branch corroborated some previous studies suggesting host affinity as phylogenetic signal (Fiala 2006; Ferguson et al., 2008, Carriero et al., 2013, Rocha et al., 2014). The host-parasite complexes composed by Henneguya n. sp. 1/C. monoculus and Henneguya n. sp. 2/C. pinima were reported coexisting in the Tapajós River, but a mixed infection of these parasites was not reported. On other hand, Henneguya n. sp. 3 was found to infecting C. monoculus in another region, in the Jari River, that is about 500 km in straight line

from the Tapajós River. Similarly, H. paraensis, was reported infecting C. temensis from the Tocantins/Araguaia basin (Velasco et al., 2016), that is around 350 and 600 km in straight line from the Jari River and Tapajós River, respectively, and has not been found in any Cichla spp. examined during this study. On other hand, Henneguya n. sp. 1 and Henneguya n. sp. 3 were found infecting C. monoculus, but this parasite have not been observed in cohabitation conditions in the environments studied. Though species of the genus Cichla are reported to be sedentary (Hoeinghaus et al. 2003), their distribution within Amazon basin can span relatively restricted ranges, in the case of C. pinima, endemic of Tapajós River, to wide-ranging C. monoculus, found throughout the basin (Kullander and Ferreira, 2006; Willis et al. 2007). This picture allows us some speculation about the possible co-evolution between Henneguya/Cichla drived by the host sedentary behavior and associated to the geographic peculiarity of the Amazon vastness. This hypothesis may be corroborated by the subtle difference morphologic and molecular observed among the species reported infecting Cichla spp. so far studied (Tables 1 and 2) as well and by the phylogenetic affinities showed in this study. The three species of Henneguya parasites of Cicha spp. described here plus H. paraensis share high morphological similarity and parasite hosts phylogenetically close, which in many cases it is impossible to distinguish them based only on morphological data. Accurate identification is especially problematic for very small organisms, with just few morphological diagnostic characters and for members of cryptic species complexes (Ferguson et al. 2008; Ye et al. 2012; Atkinson et al. 2015). Here, besides describe three new Henneguya species parasiting Cichla spp. from Amazon, which improve our knowledge on the myxozoan diversity in that region, this study also reinforces the importance of molecular analysis in the taxonomy of myxosporeans. Further study and molecular characterization of the myxobolid fauna infecting Cichlids and other fishes, particularly those from Amazon will help in our understanding in the species diversity, the host specificity and the evolutionary history of those parasites.

5. References

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLASTn and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 25:3389–3392

Atkinson SD, Bartošová-Sojková P, Whipps, CM, Bartholomew JL (2015) Approaches for Characterising Myxozoan Species. In: Okamura B, Gruhl A, Bartholomew JL (ed) Myxozoan Evolution, Ecology and Development, Springer International Publishing Switzerland, pp 111– 123

Barta JR, Martin DS, Liberator PA, Dashkevicz M, Anderson JW, Feighner SD, Elbrecht A, Perkins-Barrow A, Jenkins MC, Danforth HD, Ruff MD, Profous-Juchelka H (1997) Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J Parasitol 83:262–271

Bartošová-Sojková P, Hrabcová M, Pecková A, Patra, S, Kodadková A, Jurajda P, Tyml T, Holzer AS (2014) Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. Int J Parasitol 44:565–577. doi: 10.1016/j.ijpara.2014.04.005

Batista VS, Petrere M (2003) Characterization of the commercial fish production landed at Manaus, Amazonas State, Brazil. Acta Amazonica, 33:53–66

Carriero MM, Adriano EA, Silva MRM, Ceccarelli PS, Maia AAM (2013) Molecular phylogeny of the Myxobolus and Henneguya genera with several new South American species. PLoS One 8, e73713. doi.org/10.1371/journal.pone.0073713

Diamant A, Whipps CM, Kent ML (2004) A new species of Sphaeromyxa (Myxosporea: Sphaeromyxina: Sphaeromyxidae) in devil firefish, Pterois miles (Scorpaenidae), from the northern Red Sea: Morphology, ultrastructure, and phylogeny. J Parasitol 90:1434–1442. doi.org/10.1645/GE-336R

Eiras, J (2002) Synopsis of the species of the genus Henneguya Thélohan, 1892 (Myxozoa: Myxosporea: Myxobolidae). Syst Parasitol 52:43–54

Eiras J, Adriano EA (2012) A checklist of new species of Henneguya Thélohan, 1892 (Myxozoa: Myxosporea, Myxobolidae) described between 2002 and 2012. Syst Parasitol 83:95–104. doi: 10.1007/s11230-012-9374-7

Feist SW (2008) Myxozoan Diseases. In: Eiras JC, Segner H, Wahli T, Kapoor BG (eds) Fish diseases. Science Publishers, Enfield, pp 613–682

Feist SW, Longshaw M (2006) Phylum Myxozoa. In: Woo PTK (eds) Fish diseases and disorders: protozoan and metazoan infections, 2nd. CAB International, Oxfordshire, pp 230–296

Ferguson JA, Atkinson SD, Whipps CM, Kent ML (2008) Molecular and morphological analysis of Myxobolus spp. pf salmonids fishes with the description of a new Myxobolus species. J Parasitol 94:322–1334. doi.org/10.1645/GE-1606.1

Fiala I, Bartošová-Sojková, P, Okamura B, Hartikainen H (2015). Adaptive Radiation and Evolution Within the Myxozoa. In: Okamura B, Gruhl A, Bartholomew JL (ed), Myxozoan Evolution, Ecology and Development. Springer, Switzerland, pp 69–84

Freitas CEC, Campos CP (2014) Yield per recruit of the peacock bass Cichla monoculus (Spix and Agassiz, 1831) caught in Lago Grande at Manacapuru (Amazonas - Brazil). Braz J Biol 4:226–230

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst Biol 59:307–21

Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–8

Hallett SL, Diamant A (2001) Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillagoanalis (Sillaginidae) from the coast of Queensland, Australia. Dis Aquat Organ 46:197–212. doi:10.3354/dao046197

100

Hoeinghaus DJ, Layman CA, Arrington AD, Winemiller KO (2003) Movement of Cichla species (Cichlidae) in a Venezuelan floodplain river. Neotrop Ichthyol 1:121–126. dx.doi.org/10.1590/S1679-62252003000200006

Kent ML, Andree KB, Bartholomew JL, El-Matbouli M, Desser SS, Devlin RH, Feist SW, Hedrick RP, Hoffmann RW, Khattra J, Hallett SL, Lester RJ, Longshaw M, Palenzeula O, Siddall ME, Xiao C (2001). Recent advances in our knowledge of the Myxozoa. J Eukaryot Microbiol 48:395–413. doi: 10.1111/j.1550-7408.2001.tb00173.x

Kullander SO, Ferreira EJG (2006) A review of the South American cichlid genus Cichla, with descriptions of nine new species (Teleostei: Cichlidae). Ichthyol Explor Freshwaters 17:289–398

Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular Biology and Evolution 33, 1870–1874. doi: 10.1093/molbev/msw054

Lom J, Arthur JR (1989) A guideline for the preparation of species descriptions in Myxosporea. J Fish Dis 12:151–156

Lom J, Dyková I (2006) Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol 53:1–36

Mathews PD, Maia AA, Adriano EA (2016) Henneguya melini n. sp. (Myxosporea: Myxobolidae), a parasite of Corydoras melini (Teleostei: Siluriformes) in the Amazon region: morphological and ultrastructural aspects. Parasitol Res 115:3599-3604. doi: 10.1007/s00436- 016-5125-z

Moreira GSA, Adriano EA, Silva MRM, Ceccarelli PS, Maia AAM (2014) The morphological and molecular characterization of Henneguya rotunda n. sp., a parasite of the gill arch and fins of Salminus brasiliensis from the Mogi Guaçu River, Brazil. Parasitol Res 113:1703–1711. doi: 10.1007/s00436-014-3815-y

Moreira GSA, Adriano EA, Silva MRM, Ceccarelli PS, Maia AAM (2013) Morphology and 18S rDNA sequencing identifies Henneguya visibilis n. sp., a parasite of Leporinus obtusidens from Mogi Guaçu River, Brazil. Parasitol Res 113:81–90. doi: 10.1007/s00436-013-3629-3

101

Naldoni J, Maia AAM, Silva MRM, Adriano E (2014) Henneguya cuniculator sp. nov., a parasite of spotted sorubim Pseudoplatystoma corruscans in the São Francisco Basin, Brazil. Dis Aquat Organ 107:211–221. doi.org/10.3354/dao02685

Okamura B, Gruhl A, Bartholomew JL (2015) An Introduction to Myxozoan Evolution, Ecology and Development. In: Okamura B, Gruhl A, Bartholomew JL (ed) Myxozoan Evolution, Ecology and Development, Springer International Publishing Switzerland, pp 1–20

Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25:1253–1256. doi: 10.1093/molbev/msn083

Rambaut A (2008) FigTree v1.1.1: Tree figure drawing tool. http:// tree.bio.ed.ac.uk/software/figtree/ (accessed: 06.07.2017).

Reis RE, Kullander SO, Ferraris Jr. CJ (2003) Check List of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS. 742p

Rocha S, Casal G, Garci, P, Matos E, Al-Quraishy S, Azevedo, C (2014) Ultrastructure and phylogeny of the parasite Henneguya carolina sp. nov. (Myxozoa), from the marine fish Trachinotus carolinus in Brazil. Dis Aquat Organ 112:139–148. doi: 10.3354/dao02794

Swofford DL (2002) Paup*. Phylogenetic Studies Using Parsimony (* and other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. doi: 10.1111/j.0014- 3820.2002.tb00191.x

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–80

Ye LT, Li WX, Wu SG, Wang GT (2012) Supplementary studies on Henneguya doneci Schulman, 1962 (Myxozoa: Myxosporea) infecting the gill filaments of Carassius auratus gibelio (Bloch) in China: histologic, ultrastructural, and molecular data. Parasitol Res 110:1509– 1516. doi: 10.1007/s00436-011-2655-2

102

Velasco M, Videira M, Nascimento LCS, Matos P, Gonçalves EC, Matos E (2016) Henneguya paraensis n. sp. (Myxozoa; Myxosporea), a new gill parasite of the Amazonian fish Cichla temensis (Teleostei: Cichlidae): morphological and molecular aspects. Parasitol Res 115(5):177– 91787. doi: 10.1007/s00436-016-4916-6

Videira M, Velasco M, Azevedo R, Silva R, Gonçalves Matos P, Matos E (2015) Morphological aspects of Henneguya aequidens n. sp. (Myxozoa: Myxobolidae) in Aequidens plagiozonatus Kullander, 1984 (Teleostei: Cichlidae) in the Amazon region, Brazil. Parasitol Res 114:1159– 1162. doi: 10.1007/s00436-014-4295-9

Willis SC, Nunes MS, Montana CG, Farias IP, Lovejoy NR (2007) Systematics, biogeography, and evolution of the Neotropical peacock bases Cichla (Perciformes: Cichlidae). Mol Phy Evol 44:291–307. doi: 10.1016/j.ympev.2006.12.01

103

5. CONCLUSÕES GERAIS

Os resultados obtidos durante os estudos realizados para o desenvolvimento desta tese permitiram concluir que espécimes de Cichla monoculus, Cichla pinima e B. rousseauxii oriundas da Bacia Amazônica apresentaram infecção por espécies de mixosporídeos que ainda não haviam sido descritas na literatura. Exemplares de C. monoculus e B. rousseauxii são parasitados por duas novas espécies de Ceratomyxa encontradas na vesícula biliar dos peixes infectados, respectivamente Ceratomyxa n. sp. 1 e Ceratomyxa n. sp. 2. Além disso, este estudo possibilitou a descrição de três novas espécies do gênero Henneguya parasitas de Cichla spp. na Bacia Amazônica. Henneguya n. sp. 1 e Henneguya n. sp. 3 foram encontradas e descritas parasitando respectivamente as brânquias e as nadadeiras de C. monoculus no rio Tapajós, Pará e no rio Jari, Amapá, enquanto Henneguya n. sp. 2 foi descrita parasitando as brânquias de C. pinima no rio Tapajós, Pará. Ceratomyxa n. sp. 2 não apresentou variação genética intraespecífica no marcador ITS-1 nas três diferentes regiões da Bacia Amazônica em que foi encontrada, o que se sugerimos como consequência do padrão migratório do hospedeiro que pode estar facilitando o fluxo gênico entre as populações do parasito nas diferentes localidades. Por meio das análises filogenéticas para as espécies de Ceratomyxa, foi possível concluir que as espécies desse gênero encontradas em peixes amazônicos formam um clado irmão em relação às demais Ceratomyxa spp. parasitos de peixes marinhos. Em relação as espécies novas do gênero Henneguya aqui descritas, Henneguya n. sp. 1, Henneguya n. sp. 2 e Henneguya n. sp. 3 formaram um clado, junto com a espécie previamente descrita, Henneguya paraensis, de espécies de Henneguya parasitas de peixes ciclideos da Amazônia. Este estudo corroborou trabalhos anteriores mostrando que, para as espécies de mixosporídeos pertencentes a família Myxobolidae, o maior sinal filogenético que permite o agrupamento das espécies dentro das análises filogenéticas é a afinidade pelo parasito a um hospeiro. Por último, este estudo possibilitou a discussão de uma nova hipótese sobre o possível papel das insurgências marinhas ocorridas na Amazônia, na diversificação e radiação de mixosporídeos na região. Este estudo evidenciou a necessidade de se intensificar as pesquisas

104

envolvendo a descrição de novas espécies de Myxozoa na região além da realização de novos estudos moleculares e de filogenia a fim corroborar ou não esta hipótese.

105

6. REFERÊNCIAS

ABDALLAH, V. D.; AZEVEDO, R. K.; LUQUE, J. L.; DO BOMFIM, T. C. Two new species of Henneguya Thélohan, 1892 (Myxozoa, Myxobolidae), parasitic on the gills of Hoplosternum littorale (Callichthyidae) and Cyphocharax gilbert (Curimatidae) from the Guandu River, State of Rio de Janeiro, Brazil. Parasitologia Latino Americana, v. 62, p. 35–41, 2007.

ADRIANO, E. A.; ARANA, S.; CECCARELLI, P. C.; CORDEIRO, N. S. Light and scanning electron microscopy of Myxobolus porofilus sp. n. (Myxosporea: Myxobolidae) infecting the visceral cavity of Prochilodus lineatus (Pisces: Characiformes; Prochilodontidae) cultivated in Brazil. Folia Parasitologica, v. 49, p. 259–262, 2002.

ADRIANO, E. A.; ARANA, S.; CORDEIRO, N. S. An ultrastructural and histopathological study of Henneguya pellucida n. sp. (Myxosporea: Myxobolidae) infecting Piaractus mesopotamicus (Characidae) cultivated in Brazil. Parasite, v. 12, p. 221–227, 2005a.

ADRIANO, E. A.; ARANA, S.; CORDEIRO, N. S. Histophatology and ultrastructure of Henneguya caudalongula sp. n. infecting Prochilodus lineatus (Pisces: Prochilodontidae) cultivated in the state of São Paulo, Brazil. Memórias do Instituto Oswaldo Cruz, v. 100, p. 177–181, 2005b.

ADRIANO, E. A.; CARRIERO, M. M.; MAIA, A. A. M.; SILVA, M. R. M.; NALDONI, J.; CECCARELLI, P. S.; ARANA, S. Phylogenetic and host-parasite relationship analysis of Henneguya multiplasmodialis n. sp. infecting Pseudoplatystoma spp. in Brazilian Pantanal wetland. Veterinary Parasitology, v. 185, p. 110–120, 2012.

ADRIANO, E. A.; OLIVEIRA, O. M. P. Myxosporea in Catálogo Taxonômico da Fauna do Brasil. PNUD. Disponível em: . 2017. Acessado em 23 de maio de 2017.

ANDREE, K. B.; SZÉKELY, C.; MOLNÁR, K.; GRESOVIAC, S. J.; HEDRICK, R. P. Relationships among members of the genus Myxobolus (Myxozoa: Bilvalvidae) based on small subunit ribosomal DNA sequences. Journal for Parasitology, v. 85, p. 68–74, 1999.

106

ATKINSON, S. D.; BARTOSOVÁ-SOJKOVÁ, P.; WHIPPS, C. M.; BARTHOLOMEW, J. L. Approaches for Characterising Myxozoan Species. In: OKAMURA, B.; GRUHL, A.; BARTHOLOMEW, J. L.; (Ed.). Myxozoan evolution, ecology and development. Springer International Publishing Switzerland, 2015, p. 111–123.

ATKINSON, S. D.; BARTHOLOMEW, J. L. Disparate infection patterns of Ceratomyxa shasta (Myxozoa) in rainbow trout Oncorhynchus mykiss and Chinook salmon Oncorhynchus tshawytscha correlate with ITS-1 sequence variation in the parasite. International Journal for Parasitology, v. 40, p. 599–604, 2010a.

ATKINSON, S. D.; BARTHOLOMEW, J. L. Spatial, temporal and host factors structure the Ceratomyxa shasta (Myxozoa) population in the Klamath River basin. Infection, Genetic and Evolution, v. 10, p. 1019–1026, 2010b.

ATKINSON, S. D. Diversity, life cycles and population genetics of freshwater Myxozoa from the Pacific Northwest of North America. 220 f. Thesis (Doctor of Philosophy). School of Chemistry and Molecular Biosciences, University of Queensland, Australia, 2011.

AUSTIN, B.; NEWAJ-FYZUL, A. Diagnosis and Control of Fish and Shellfish Diseases. John Wiley & Sons Ltd, 2017, 320p.

AVISE, J. C. Molecular markers, natural history, and evolution. Sinauer Associates, Sunderland (Massachusetts), 2004.

BARTHEM, R. B.; CHARVET-ALMEIDA, P.; MONTAG, L. F. A.; LANNA, A. E. Amazon Basin. GIWA Regional assessment 40b. University of Kalmar, Kalmar, Sweden, 2004.

BARTHEM, R. B.; FABRÉ, N. N. Biologia e diversidade dos recursos pesqueiros da Amazônia. In: Ruffino, M. L. A pesca e os recursos pesqueiros na Amazônia brasileira. Manaus: ProVárzea/IBAMA, 2004 p. 17–62.

BARTHEM, R.; GOULDING, M. Os Bagres Balizadores: Ecologia, Migração e Conservação de Peixes Amazônicos. Sociedade Civil Mamirauá, MCT - CNPq, IPAAM. Brasilia, Brazil, 1997.

107

BARTHEM, R. B.; GOULDING, M.; LEITE, R. G.; CANAS, C.; FORSBERG, B.; VENTICINQUE, E.; PETRY, P.; RIBEIRO, M. L. B.; CHUCTAYA, J.; MERCADO, A. Goliash catfish spawing in the far western Amazon confirmed by the distribution of mature adults, drifting larvae and migrating juveniles. Science Reports, v. 7: 41784, 2017.

BARTHOLOMEW, J. L.; ATKINSON, S. D.; HALLETT, S. L. Involvement of Manayukia speciosa (Annelida: Polichaeta: Sabellidae) in the life cycle of Parvicapsula minicornis, a myxozoan parasite of pacific salmon. Journal of Parasitology, v. 92, p. 742–748, 2006.

BARTHOLOMEW, J. L.; ATKINSON, S. D.; HALLETT, S. L.; LOWENSTINE, L. J.; GARNER, M. M.; GARDINER, C. H.; RIDEOUT, B. A.; KEEL, M. K.; BROWN, J. D. Myxozoan parasitism in waterfowl. International Journal for Parasitology, v. 38, p. 1199– 1207, 2008.

BARTOSOVÁ, P. Phylogenetic analyses of myxosporeans based on the molecular data. Thesis, Faculty of Science, University of South Bohemia, České Budějovice, 2010.

BARTOSOVÁ, P.; FIALA, I.; HYPSA, V. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide an effective tool for their molecular phylogenetics. Molecular Phylogenetics and Evolution, v. 53, p. 81–93, 2009.

BARTOSOVÁ, P.; FIALA, I.; JIRKU, M.; HOLZER, A. S. Sphaerospora sensu stricto: taxonomy, diversity and evolution of a unique lineage of myxosporeans (Myxozoa). Molecular Phylogenetics and Evolution, v. 68, p. 93–105, 2013.

BARTOSOVÁ-SOJKOVÁ, P.; HRABCOVÁ, M.; PECKOVÁ, H.; PATRA, S.; KODÁDKOVÁ, A.; JURAJDA, P.; TYML, T.; HOLZER, A. S. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. International Journal for Parasitology, v. 44, p. 565–577, 2014.

108

BAYLEY, P. B.; PETRERE Jr.; M. Amazon Fisheries: Assessment methods, status and management options. In: DODGE, D. P. (Ed). Proceedings of the International Large River Symposium. Canadian Special Publication of Fisheries and Aquatic Sciences, 1989. p. 385–398.

BIK, H. M.; FOURNIER, D.; SUNG, W.; BERGERON, R. D.; THOMAS, W. K. Intra-Genomic Variation in the Ribosomal Repeats of Nematodes. PLoS ONE, 8: e78230, 2013.

BRITSKI, H. A. Peixes de água doce do estado de São Paulo: sistemática. In: Poluição e Piscicultura, Faculdade de Saúde Pública da USP-Instituto de Pesca da C.P.R.N. da Secretaria de Agricultura, 1972. p. 79–108.

BUCKUP, P. A.; MENEZES, N. A.; GHAZZI, M. S. Catálogo das espécies de peixes de água doce do Brasil. Rio Janeiro, Museu Nacional, 2007. 195p.

CANNING, E. U.; OKAMURA, B. Biodiversity and evolution of the Myxozoa. Advances in Parasitology, v. 56, p. 43–131, 2004.

CAPODIFOGLIO, K. R. H.; ADRIANO, E. A; MILANIN, T.; MAIA, A. A. M. Morphological, ultrastructural and phylogenetic analyses of Myxobolus hilarii n. sp. (Myxozoa, Myxosporea), a renal parasite of farmed Brycon hilarii in Brazil. Parasitology International, v. 65, p. 184–190, 2016.

CAPODIFOGLIO, K. R. H.; ADRIANO, E. A.; SILVA, M. R. M.; MAIA, A. A. M. Supplementary data of Henneguya leporinicola (Myxozoa, Myxosporea) a parasite of Leporinus macrocephalus from fish farms in the state of São Paulo, Brazil. Acta Parasitologica, v. 60, p. 451–458, 2015.

CARVAJAL, F.; VAN DAMME, P.; JEGÚ, M. Otras especies de peces comerciales de la cuenca del Río Iténez. In: VAN DAMME, P.; CARJAVAL, F. (Eds.), Recursos Pesqueros y pesca en los ríos Blanco y San Martín. Cuenca del Río Iténez, Beni, Bolivia, 2005.

CASAL, G.; MATOS, E.; AZEVEDO, C. Ultrastructural data on the life cycle stages of Myxobolus braziliensis n. sp., parasite of na Amazonian Fish. European Journal of Protistology, v. 32, p. 123–127, 1996.

109

CAVALIER-SMITH, M. T. E. P.; ALSOPP, E. E.; BOURY-ESNAULT, N.; VAVELET, J. Sponge phylogeny, animal monophyly, and the origin of the nervous system: 18S rRNA evidence. Canadian Journal of Zoology, v. 74, p. 2031–2045, 1996.

CHANG, E. S.; NEUHOF, M.; RUBINSTEIND, N. D.; DIAMANTE, A.; PHILIPPEF, H.; HUNCHONB, D.; CARTWRIGHTA, P. Genomic insights into the evolutionary origin of Myxozoa within Cnidaria. Pnas, v. 102, p. 14912–14917, 2015.

DYKOVÁ, I. Phylum Microspora. In: Woo, P. T. K. (Ed.). Fish diseases and disorders, Vol 1. Protozoan and metazoan infections, 2nd edn. CABI publishing, Wallingford, 2006, p. 205–229.

DYKOVÁ, I.; TYML, T.; FIALA, I.; LOM, J. New data on Soricimyxum fegati (Myxozoa) including analysis of its phylogenetic position inferred from the SSUrRNA gene sequences. Folia Parasitologica, v. 54, p. 272–276, 2007.

EICKBUSH, T. H.; EICKBUSH, D. G. Finely orchestrated movements: Evolution of ribosomal RNA genes. Genetics, v. 175, p. 477–485, 2007.

EIRAS, J. C. An overview on the myxosporean parasites in amphibians and reptiles. Acta Parasitologica, v. 50, p. 267–275, 2005.

ESZTERBAUER, E.; SIPOS, D.; FORRÓ, B.; BARTOSOVÁ, P.; HOLZER, A. S. Molecular characterization of Sphaerospora molnari (Myxozoa), the agent of gill sphaerosporosis in common carp (Cyprinus carpio carpio). Diseases of Aquatic Organisms, v. 104, p. 59–67, 2013.

FEIJÓ, M. M.; ARANA, S.; CECCARELLI, P. S.; ADRIANO, E. A. Light and scanning electron microscopy of Henneguya arapaima n. sp. (Myxozoa: Myxobolidae) and histology of infected sites in pirarucu (Arapaima gigas: Pisces: Arapaimidae) from the Araguaia River, Brazil. Veterinary Parasitology, v. 157, p. 59–64, 2008.

FEIST, S. W.; LONGSHAW, M. Phylum Myxozoa. In: Woo, P. T. K. (Eds.). Fish diseases and disorders. Protozoan and metazoan infections. Vol. 1, 2nd ed., CAB International, Oxfordshire, 2006, p. 230–296.

110

FERREIRA, M. E.; GRATTAPAGLIA, D. Introdução ao uso de marcadores moleculares em análise genética. Embrapa. Brasília, 1998.

FIALA, I.; BARTOSOVÁ-SOJKOVÁ, P.; WHIPPS, C. M. Classification and Phylogenetics of Myxozoa. In: OKAMURA, B.; GRUHL, A.; BARTOLOMEW, J. L. Myxozoan evolution, ecology and development. Springer International Publishing Switzerland, 2015a, p. 85–110.

FIALA, I.; BARTOSOVÁ-SOJKOVÁ, P.; OKAMURA, B.; HARTIKAINEN, H. Adaptive radiation and evolution within the Myxozoa. In: OKAMURA, B.; GRUHL, A.; BARTOLOMEW, J. L Myxozoan evolution, ecology and development, Springer International Publishing Switzerland. 2015b, p. 69–84.

FIALA, I.; HLAVNICKOVÁ, M.; KODADKOVÁ, A.; FREEMAN, M. A.; BARTOSOVÁ- SOJKOVÁ, P.; ATKINSON, S. D. Evolutionary origin of Ceratonova shasta and phylogeny of marine myxosporean lineage. Molecular Phylogenetics and Evolution, v. 86, p. 75–89, 2015c.

FIALA, I.; KYSLÍK, J.; CINKOVÁ, M.; BARTOSOVÁ, P. Analysis of mitochondrial genomic data reveals the phylogenetic placement of Myxozoa and Polypodium hydriforme within the medusozoan cnidarians. Abstracts of the 16th international conference on diseases of fish and shelfish, Tampere, Finland, 2013, p. 2–6.

FIALA, I.; BARTOSOVÁ, P. History of myxozoan character evolution on the basis of rDNA and EF-2 data. BMC Evolutionary Biology, v. 10, p. 228–241, 2010.

FIALA, I. The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis. International Journal for Parasitology, v. 36, p. 1521–1534, 2006.

FIGUEIREDO, H. C. P.; LEAL, C. A. G. Tecnologias aplicadas em sanidade de peixes. Revista Brasileira de Zootecnia, v. 37, p. 8–14, 2008.

FRIEDRICH, C.; INGOLIC, E.; FREITAG, B.; KASTBERGER, G.; HOHMANN, V.; SKOFITSCH, G.; NEUMEISTER, U.; KEPKA, O. A myxozoan-like parasite causing xenomas in the brain of the mole, Talpa europaea L., 1978 (Vertebrata, Mammalia). Parasitology, v. 121, p. 483–492, 2000.

111

GILBERT, M. A.; GRANATH Jr., W. O. Whirling disease od salmonid fish: life cycle, biology, and disease. Journal of Parasitology, v. 89, p. 658-667, 2003.

GOULDING, M.; BARTHEM, R. Ecologia, migração e conservação de peixes amazônicos. CNPq, Tefe, 1997.

GUNTER, N. L.; ADLARD, R. D. Bivalvulidan (Myxozoa: Myxosporea) parasites of damselfishes with description of twelve novel species from Australia’s Great Barrier Reef. Parasitology, v. 135, p. 1165–1178, 2008.

HALLETT, S. L.; BARTHOLOMEW, J. L. Application of a real-time PCR assay to detect and quantify the myxozoan parasite Ceratomyxa shasta in river water samples. Diseases of Aquatic Organisms, v. 71, p. 109–118, 2006.

HALLETT, S. L.; HARTINGAN, A.; ATKINSON, S. D. Myxozoans on the Move: Dispersal Modes, Exotic Species and Emerging Diseases. In: OKAMURA, B.; GRUHL, A.; BARTHOLOMEW, J. L. Myxozoan evolution, ecology and development, Springer International Publishing Switzerland, 2015, p. 343–362.

HARTIGAN, A.; FIALA, I.; DYKOVÁ, I.; JIRKU, M.; OKIMOTO, B.; ROSE, K.; PHALEN, D. N.; SLAPETA, J. A Suspected Parasite Spill-Back of Two Novel Myxidium spp. (Myxosporea) Causing Disease in Australian Endemic Frogs Found in the Invasive Cane Toad. PLoS ONE, v. 6: e18871, 2011.

HENDERSON, M.; OKAMURA, B. The phylogeography of salmonid proliferative kidney disease in Europe and North America. Proceedings of the Royal Society B Biological Sciences, v. 271, p. 1729–1736, 2004.

HERMANN, J. M.; NEUPERT, W. Protein transport into mitochondria. Current Opinion in Microbiology, v. 3, p. 210–214, 2000.

HILLIS, D. M.; DIXON, M. T. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology, v. 66, p. 411–453, 1991.

112

HOFFMANN, G. L. Intercontinental and transcontinental dissemination and transfaunation of fish parasites with emphasis on whirling disease (Myxosoma cerebralis). In: Snieszko, S.F. (Ed.). A symposium on diseases of fishes and shellfishes. American Fisheries Society Symposium, v. 5, p. 69–81, 1970.

HOLLAND, J. W.; OKAMURA, B.; HARTIKAINE, H.; SECOMBES, C. J. A novel minicollagen gene links cnidarians and myxozoans. Proceedings of the Royal Society B Biological Sciences, v. 278, p. 546–553, 2010.

JIMENEZ-GURI, E.; PHILIPPE, H.; OKAMURA, B.; HOLLAND, P. H. W. Buddenbrockia Is a Cnidarian Worm. Science, v. 317, p. 116–118, 2007.

JIRKÚ, M.; BARTOSOVÁ-SOJKOVÁ, P. Ultrastructure and localisation of late-sporogonic developmental stages of Sphaerospora ranae (Myxosporea: Sphaerosporidae). Folia Parasitologica (Praha), v. 61, p. 311–21, 2014.

JIRKÚ, M.; BOLEK, M. G.; WHIPPS, C. M.; JANOVY, J.; KENT, M. L.; MODRY, D. A new species of Myxidium (Myxosporea: Myxidiidae), from the western chorus frog, Pseudacris triseriata triseriata, and blanchard´ s cricket frog, Acris crepitans blanchardi (Hylidae), from eastern Nebraska: morphology, phylogeny, and critical comments on amphibian Myxidium taxonomy. Journal of Parasitology, v. 92, p. 611–619, 2006.

JUNK, W. J.; PIEDADE, M. T. F.; SCHÖNGART, J.; COHN-HAFT MADENEY, J. M.; WITTMANN, F. A Classification of Major Naturally-Ocurring Amazonian Lowland Wetlands. Wetlands. v. 31, p. 623–640, 2011.

KALLERT, D. M. Life cycle studies and transmission mechanisms of myxozoan parasites. Thesis (Science School). Universidade de Erlangen-Nuremberg, Baviera, German, 2006.

KENT, M. L.; ANDREE, K. B.; BARTHOLOMEW, J. L.; EL-MATBOULI, M.; DESSER, S. S.; DEVLIN, R. H.; FEIST, S. W.; HEDRICK, R. P.; HOFFMANN, R. W.; KHATTRA, J.; HALLETT, S. L.; LESTER, R. J. G.; PALENZUELA, O.; SIDDALL, M. E.; XIAO, C. Recent

113

advances in our knowledge of the Myxozoa. Journal of Eukaryotic Microbiology, v. 48, p. 395–413, 2001.

KENT, M. L.; HEDRICK, R. P. PKX, the causative agent of proliferative kidney disease (PKD) in Pacific salmonid fishes and its affinities with the Myxozoa. The journal of Protozoology, v. 32, p. 254–260, 1985.

KOCHER, T. D. Adaptive evolution and explosive speciation: the cichlid fish model. Nature, v. 5, p. 288–298, 2004.

KODÁDKOVÁ, A.; BARTOSOVÁ-SOJKOVÁ, P.; HOLZER, A. S.; FIALA, I. Bipteria vetusta n. sp. - an old parasite in an old host: tracing the origin of myxosporean parasitism in vertebrates. International Journal for Parasitology, v. 45, p. 269–276, 2015.

KULLANDER, S. O.; FERREIRA, E. J. G. A review of the South American cichlid genus Cichla, with descriptions of nine new species (Teleostei: Cichlidae). Ichthyological Exploration of Freshwaters Journal, v. 17, p. 289–398, 2006.

LOBATO, A. B. A exploração pesqueira dos grandes bagres migradores na região Amazônica e a responsabilidade do Estado por dano ambiental transfronteiriço. Dissertação de Mestrado. Universidade Estadual do Amazonas - UEA. Manaus, Amazonas, 2009.

LODH, N.; KERANS, B. L.; STEVENS, L. The Parasite that Causes Whirling Disease, Myxobolus cerebralis, is Genetically Variable Within and Across Spatial Scales. Journal of Eukaryotic Microbiology, v. 59, p. 80–87, 2012.

LOM, J.; DYKOVÁ, I. Myxosporea (Phylum Myxozoa). In: WOO, P. T. K. (Ed.). Fish Diseases and Disorders, Protozoan and Metazoan Infections. CAB International: Wallingford, Oxon, UK, 1995, p. 97–148.

LOM, J.; DYKOVÁ, I. Myxozoan genera: definition and notes on taxonomy, lifecycle terminology and pathogenic species. Folia Parasitologica, v. 53, p. 1–36, 2006.

114

LUQUE, J. L. Biologia, epidemiologia e controle de parasitos de peixes. In: XIII Congresso Brasileiro de Parasitologia Veterinária. Ouro Preto. Revista Brasileira de Parasitologia Veterinária, v. 13, p. 161–165, 2004.

MALLATT, J.; CRAIG, C. W.; YODER, M. J. Nearly complete rRNA genes assembled from across the metazoan animals: Effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction. Molecular Phylogenetics and Evolution, v. 55, p. 1–17, 2010.

MARTIN, A. P.; BURG, T. M. Perils of Paralogy: Using HSP70 Genes for Inferring Organismal Phylogenies. Systematic Biology, v. 51, p. 570–587, 2002.

MARTINS, M. L.; SOUZA, V. N. Henneguya piaractus n. sp. (Myxozoa: Myxobolidae), a gill parasite of Piaractus mesopotamicus Holmberg, 1887 (Osteichthyes: Characidae), in Brazil. Revista Brasileira de Biologia, v. 57, p. 239–245, 1997.

MASSARD, J. A.; GEIMER, G. Global diversity of bryozoans (Bryozoa or Ectoprocta) in freshwater: an update. Bulletim of Society Naturalle de Luxembourg, v. 109, p. 139–148, 2008.

MPA. Boletim estatístico da pesca e aquicultura 2011. IBAMA, Brasília, 2011. Disponível:http://www.icmbio.gov.br/cepsul/images/stories/biblioteca/download/estatistica/est_2 011_bol__bra.pdf, acessado em 19 de junho de 2017.

MEHLHORN, H. Encyclopedic Reference of Parasitology. Vol. 1: Biology, Structure, Function. Second Edition. Springer-Verlag Berlin Heidelberg, 2001, p. 463–547.

MENG, F.; YOKOYAMA, H.; SHIRAKASKI, S.; MURATA, O. Kudoa prunusi n. sp. (Myxozoa: Multivalvulida) from the brain of Pacific bluefin tuna Thunnus orientalis (Temminck & Schlegel, 1844) cultured in Japan. Parasitology International, v. 60, p. 90–96, 2011.

MEYER, A.; TODT, C.; MIKKELSEN, N. T.; LIEB, B. Fast evolving 18S rDNA sequences from Solenogastres (Mollusca) resist standard PCR amplification and give new insights into mollusk substitution rate heterogeneity. Evolutionary Biology, v. 10, p. 70–76, 2010.

115

MOLNÁR, K. Site preference of myxosporeans in the gill. Diseases of Aquatic Organisms, v. 48, p. 197–207, 2002.

MORSY, K.; SEMMLER, M.; AL-OLAYAN, E.; MEHLHORN, H. Testicular myxosporidiasis and ultrastructural characteristics of Myxobolus bufonis (Myxobolidae) infecting the Egyptian toad Bufo regularis (Bufonidae). A light and electron microscopic study. Parasitology Research, v. 114, p. 3989–3997, 2015.

MURRAY, A. M. The fossil record and biogeography of the Cichlidae (Actinopterygii, Labroidei). Biological Journal of the Linnean Society, v. 74, p. 517–532, 2001.

NELSON, J. S. Fishes of the world. 4rd Edition. John Wiley & Sons Inc. NY, USA, 2006.

NELSON, J. S.; GRANDE, T. C.; WILSON, M. V. H. Fishes of the world. 5rd Edition. John Wiley & Sons Inc. NY, USA, 2016.

NESNIDAL, M. P.; HELMKAMPF, M.; BRUCHHAUS, I.; EL-MATBOULI, M.; HAUSDORF, B. Agent of Whirling Disease Meets Orphan Worm: Phylogenomic Analyses Firmly Place Myxozoa in Cnidaria. PLoS ONE, v. 8: e54576, 2013.

OKAMURA, B.; GRUHL, A.; BARTHOLOMEW, J. L. An introduction to myxozoan evolution, ecology and development. In: OKAMURA, B.; GRUHL, A.; BARTHOLOMEW, J. L. Myxozoan evolution, ecology and development. Springer International Publishing Switzerland, 2015. p. 1–22.

OKAMURA, B.; GRUHL, A. Myxozoan affinities and route to endoparasitism. In: OKAMURA, B.; GRUHL, A.; BARTHOLOMEW, J. L. Myxozoan evolution, ecology and development. Springer International Publishing Switzerland, 2015, p. 23–44.

PAVANELLI, G. C.; EIRAS, J. C.; TAKEMOTO, R. M. Doenças de peixes. Profilaxia, diagnóstico e tratamento. Editora Universidade Estadual de maringá, 2002.

116

PETRERE, M.; BARTHEM, R. B.; CÓRDOBA, E. A.; GÓMEZ, B. C. Review of the large catfish fisheries in the upper Amazon and the stock depletion of piraíba (Brachyplatystoma filamentosum Lichtenstein). Reviews in Fish Biology and Fisheries, v. 14, p. 403–414, 2005.

PETRERE-JR, M.; PEIXER, J. (eds). O setor pesqueiro na Amazônia: análise da situação atual e tendências. Manaus: ProVárzea/IBAMA, 2007, p. 77–100.

PRUNESCU, C. C.; PRUNESCU, P.; PUCEK, Z.; LOM, J. The first finding of myxosporean development from plasmodia to spores in terrestrial mammals: Soricimyxum fegati gen. et sp. n. (Myxozoa) from Sorex araneus (Soricomorpha). Folia Parasitologica, v. 54, p. 59–164, 2007.

RAPP, G.; KLAUDINY, J.; HAGENDORFF, G.; LUCK, M. R.; SCHEIT, K. H. Complete sequence of the coding region of human elongation factor 2 (EF-2) by enzymatic amplification of cDNA from human ovarian granulosa cells. Biological Chemistry Hoppe-Seyler, v. 370, p. 1071–1085, 1990.

REIS, R. E.; KULLANDER, S. O.; FERRARIS, J. Check list of the freshwater of the south and central américa. EDIPUCRS. Porto Alegre, 2003.

ROBERTS, R. J. Fish Pathology. 3rd ed. Eds. RJ. Roberts WB. Saunders. London, 2001.

ROCHA, E.; MATOS, E.; AZEVEDO, C. Henneguya amazonica n. sp. (Myxozoa, Myxobolidae), Parasitizing the Gills of Crenicichla lepidota Heckel, 1840 (Teleostei, Cichlidae) from Amazon River. European Journal of Protistology, v. 28, p. 273–278, 1992.

RÜCKERT, S.; PALM, H. W.; KLIMPEL, S. Parasite fauna of seabass (Lates calcarifer) under mariculture conditions in Lampung Bay, Indonesia. Journal of Applied Ichthyology, v. 24, p. 321–327, 2008.

RUE, B. J.; WARD, T. J.; OXNER, C. R.; CONLEY, P. G.; BROWN, W. C.; RICE-FITCHT, A. C. Phylogenetic analysis with newly characterized Babesia bovis hsp70 and hsp90 provides strong support for paraphyly with hin the piroplasms. Molecular and Biochemical Parasitology, v. 109, p. 67–72, 2000.

117

RUPPERT, E. E.; FOX, R. S.; BARNES, R. D. Invertebrate zoology. A functional evolutionary approach, 7th edn. Thomson Brooks/Cole, Belmont, 2004.

SANTOS, G. M.; FERREIRA, E. J. G. Peixes da Bacia Amazônica. In: LOWE McCONNELLL, R. H. Estudos Ecológicos de Comunidades de Peixes Tropicais. Edusp, São Paulo, 1999.

SANTOS, G. M.; FERREIRA, E. J. G. ZUANNON, J. A. S. Peixes comerciais de Manaus. Manaus: Ibama/AM, ProVárzea, 2006, p. 144.

SANTOS, G. M., SANTOS, A. C. M. Sustentabilidade da pesca na Amazônia. Sustentabilidade da pesca na Amazônia. Estudos Avançados, v. 19, p. 165–182, 2005.

SCHLEGEL, M.; LOM, J.; STECHMANN, A.; BERNHARD, D.; LEIPE, D.; DYKOVÁ, I.; SOGIN, M. L. Phylogenetic analysis of complete small subunit ribosomal RNA coding region of Myxidium lieberkuehni: evidence that Myxozoa are Metazoa and related to the Bilateria. Archiv für Protistenkunde, v. 147, p. 1–9, 1996.

SIDDALL, M. E.; MARTIN, D. S.; BRIDGE, D.; DESSER, S. S.; CONE, D. K. The demise of a phylum of protists: phylogeny of the Myxozoa and other parasitic cnidaria. Journal of Parasitology, v. 81, p. 961–967, 1995.

SMOTHERS, J. F.; DOHLEN, C. D.; SMITH Jr.; L. H.; SPALL, R. D. Molecular evidence that the myxozoan protists are metazoans. Science, v. 265, p. 1719–1721, 1994.

SUFRAMA. Potencialidades Regionais: estudo de viabilidade econômica. Piscicultura. Sumário Executivo, 2003.

SULAIMAN, I. M.; MORGAN, U. M.; THOPSON, R. C.; LAL, A. A.; XIAO, L. Phylogenetic relationships of Cryptosporidium parasites based on the 70-kilodalton heat shock protein (HSP70) gene. Applied and Environmental Microbiology, v. 66, p. 2385–2391, 2000.

SZÉKELY, C.; CECH, G.; ATKINSON, S. D.; MOLNÁR, K.; EGYED, L.; GUBANYI, A. A novel myxozoan parasite of terrestrial mammals: description of Soricimyxum minuti sp. n.

118

(Myxosporea) in pygmy shrew Sorex minutus from Hungary. Folia Parasitologica, v. 62, 45, 2015.

TAKEUCHI, F.; SEKIZUKA, T.; OGASAWARA, Y.; YOKOYAMA, H.; KAMIKAWA, R.; INAGAKI, Y.; NOZOKI, T.; SUGITA-KONOSHI, Y.; OHNISHI, T.; KURPDA, M. The Mitochondrial Genomes of a Myxozoan Genus Kudoa Are Extremely Divergent in Metazoa. PLoS ONE, v. 10: e0132030, 2015.

TUNDISI, J. G. Água no século XXI: Enfrentando a escassez. São Carlos, RiMa, IIE, 2003.

WALKER, I. Algumas considerações sobre um programa de zoneamento da Amazônia. In: VAL, A. L.; FIGLIUOLO, R.; FELDBERG, E. (Eds.). Bases científicas para estratégias de preservação e desenvolvimento da Amazônia. v.1. INPA, Manaus, 1991.

WEIDER, L. J.; ELSER, J. J.; CREASE, T. J.; MATEOS, M.; COTNER, J. B.; MARKOW, T. A. The functional significance of ribosomal (r) DNA variations: Impacts on the Evolutionary Ecology of Organisms. Annual Review of Ecology, Evolution, and Systematics, v. 36, p. 219– 242, 2005.

WEILL, R. L. ‘interpretation des Cnidosporidies et Ia valeur taxonomique de Ieur cnidome. Leur cycle comparé ii Ia phase Iarvaire des Narcomeduses Cuninides. Travaux de la Station Zoologique de Wimereaux, v. 13, p. 727–744, 1938.

WILLIS, S. C.; MACRANDER, J.; FARIAS, I. P.; ORTI, G. Simultaneous delimitation of species and quantification of interspecific hybridization in Amazonian peacock cichlids (genus Cichla) using multi-locus data. BMC Evolutionary Biology, v. 12, p. 96, 2012.

WHIPPS, C. M.; KENT, M. L. Phylogeography of the cosmopolitan marine parasite Kudoa thyrsites (Myxozoa: Myxosporea). Journal of Eukaryotic Microbiology, v. 53, p. 364–373, 2006.

WHIPPS, C. M.; EL-MATBOULI, M.; HEDRICK, R. P.; BLAZER, V.; KENT, M. L. Myxobolus cerebralis internal transcribed spacer 1 (ITS-1) sequences support recent spread of the

119

parasite to North America and within Europe. Diseases of Aquatic Organisms, v. 60, p. 105– 108, 2004a.

WHIPPS, C. M.; GROSSEL, G.; ADLARD, R. D.; YOKOYAMA, H.; BRYANT, M. S.; MUNDAY, B. L.; KENT, M. L. Phylogeny of the multivalvulidae (Myxozoa: Myxosporea) based on comparative ribosomal DNA sequence analysis. Journal of Parasitology, v. 90, p. 618–622, 2004b.

WINEMILLER, K. O. Ecology of peacock cichlids (Cichla spp.) in Venezuela. Journal of Aquaculture and Aquatic Sciences, v. 9, p. 93–112, 2001.

WINEMILLER, K. O.; TAPHORN, D. C.; BARBARINO-DUQUE, A. The ecology of Cichla (Cichlidae) in two blackwater rivers of southern Venezuela. American Socienty of Ichthyologist, and Herpetologists, 1997. p. 690–696.

WOO, P. T. K. Fish Diseases and Disorders. Vol. 1: Protozoan and Metazoan Infections. Second edition. CAB International. Wallingford, 2006.

WOO, S. H.; SEO, J. S.; LEE, E. H. Discrimination and simultaneous detection of two myxozoan parasites belonging to genus Thelohanellus by multiplex polymerase chain reaction. Veterinary Parasitolology, v. 203, p. 212–216, 2014.

WOLF, K.; MARKIW, M. E. Biology contravenes taxonomy in the Myxozoa: new discoveries show alternation of invertebrate and vertebrate hosts. Science, v. 22, p. 1449–1452, 1984.

YAHALOMI, D.; HADDAS-SASSON, M.; RUNINSTEIN, N. D.; FELDSTEIN, T.; DIAMANT, A.; HUCHON, D. The Multipartite Mitochondrial Genome of Enteromyxum leei (Myxozoa): Eight Fast-Evolving Megacircles. Molecular Biology and Evolution, v. 34, p. 1551–1556, 2017.

YANAGIDA, T.; FREEMAN, M. A.; NOMURA, Y.; TAKAMI, I.; SUGIHARA, Y.; YOKOYAMA, H.; OGAWA, K. Development of a PCR-based method for the detection of enteric myxozoans causing the emaciation disease of cultured tiger puffer. Fish Pathology, v. 40, p. 23–28, 2005.

120

YOKOYAMA, H.; INOUE, D.; KUMAMARU, A.; WAKABAYASHI, H. Myxobolus koi (Myxozoa: Myxosporea) forms large-and small-type "cysts" in the gills of common carp. Fish Pathology, v. 32, p. 211–217, 1997.

YOKOYAMA, H.; LIYANAGE, Y. S.; SUGAI, A.; WAKABAYASHI, H. Hemorrhagic thelohanellosis of color carp caused by Thelohanellus hovorkai (Myxozoa: Myxosporea). Fish Pathology, v. 33, p. 85–89, 1998.

121

7. ANEXOS

7.1 Certificado do Comitê de Ética no uso de Animais CEUA/Unicamp

7.2 Autorização para atividades com finalidade científica (coletas) – SISBIO

123

7.3 Declaração de que a tese não infringe os dispositivos da lei nº 9610/98

As cópias de artigos de minha autoria ou de minha coautoria, já publicados ou submetidos para publicação em revistas científicas ou anais de congressos sujeitos a arbitragem, que constam da minha Dissertação/Tese de Mestrado/Doutorado, intitulada "SISTEMÁTICA E DISTRIBUIÇÃO DE MIXOSPORÍDEOS (CNIDARIA: MYXOZOA) PARASITOS DE TUCUNARÉ (Cichla spp.) E DOURADA (Brachyplatystoma rousseauxii) NA BACIA AMAZÔNICA", não infringem os dispositivos da Lei n.0 9.610/98, nem o direito autoral de qualquer editora.

Campinas, 6 de outubro de 2017

______Autor: Suellen Aparecida Zatti RG n° 14.460.996-MG

______Orientador: Prof. Dr. Edson Aparecido Adriano RG n° 18.015.128-9