Isolation and Characterization of Polymorphic Microsatellites for Silver Pomfret

Home , Pampus argenteus, Pomfret, Stromateidae

c Indian Academy of Sciences

ONLINE RESOURCES

Isolation and characterization of polymorphic microsatellites for silver pomfret

YU QIN, TIANJUN XU∗, RIXIN WANG and GE SHI∗

Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan 316000, People’s Republic of China

[Qin Y., Xu T., Wang R. and Shi G. 2012 Isolation and characterization of polymorphic microsatellites for silver pomfret. J. Genet. 91, e79–e81. Online only: http://www.ias.ac.in/jgenet/OnlineResources/91/e79.pdf]

Introduction liminary study on the genetic diversity of four geographic populations of silver pomfret by means of random ampli- Silver pomfret (Pampus argenteus) belonged to the fam- fied polymorphic DNA (RAPD) technique. They detected the ily Stromateidae is a benthopelagic fish species which was genetic diversity of silver pomfret is much lower than other extensively distributed along the coast from the Bohai Sea to marine fishes. Peng et al. (2009) found no difference between the South China Sea in China (Liu et al. 2002). It also occurs silver pomfret sampled in the Bohai Sea and East China Sea in the Indian Ocean, Arabian Gulf and North Sea (Davis using mitochondrial DNA techniques. Here, we describe the and Wheeler 1985). Pomfret together with Pseudosciaena development of 13 novel polymorphic microsatellite mark- crocea, Trichiurus haumela and Sepia used to be regarded ers of P. argenteus to provide more molecular information on as the four marine fishery products with the highest eco- this species. nomic output in China. Due to the strong market demand and the decline of other commercial fish resources, the silver pomfret has supported a major fishery in China dur- Materials and methods ing the past decades. However, since the 1990s, the natu- ral resources of silver pomfret in the East China Sea have Microsatellites enriched from genomic libraries were been destroyed because of technology which allows unrea- constructed following the process of fast isolation by ampli- sonable overfishing (Zheng 2003). Therefore relevant arti- fied fragment length polymorphism of sequences contain- ficial breeding techniques and P. argenteus reproductive ing repeats method (FIASCO, Zane et al. 2002). Briefly, biology have been studied in China and Kuwait since the total genomic DNA was isolated from the fin clips 1980s (Gong et al. 1989; Ni and Gong 1995; Al-Abdul-Elah of two individuals to construct a DNA pool. Genomic et al. 2001, 2002; Almatar et al. 2004; James and Almatar DNA was digested with MseI restriction enzyme and 2007; Shi et al. 2005;Zhaoet al. 2010). approximate 200–1000-bp fragments were purified and lig- ) Some information on silver pomfret life-history are well ated to adapters OligoA (5 -TACTCAGGACTCAT-3 and ) known. They have pelagic eggs and their breeding grounds OligoB (5 -GACGATGAGTCCTGAG-3 , then amplified ) are always located in estuaries and coastal water. Spawn- using MseI-N (5 -GATGAGTCCTGAGTAAN-3 . Further ing of P. argenteus occurs in the East China Sea from early the amplified products containing microsatellite sequences April to late May, but occurs later (from May to June) in the were enriched by hybridizing with (CA)15 biotin-labelled Yellow Sea (Shi et al. 2005;Zhaoet al. 2010). Moreover, probes. Microsatellite enrichment was separated using strep- nothing is known about the life-history connections or migra- tavidin magnetic beads according to Glenn and Schable tions between silver pomfret in the Yellow Sea and China (2005) with minor modifications. Finally, the separated frag- Sea (Zhao et al. 2011). We all know that genetic struc- ments were cloned into pMD19-T vectors (TaKaRa, Dalian, α ture is important for management and conservation. How- China) using ultracompetent Escherichia coli (DH5 ; ever, little information is available on the genetic structure Tiangen, Beijing, China). of silver pomfret. Meng et al. (2009) have performed a pre- Positive clones were screened by PCR with M13-F/M13- R, which appeared as single distinct bands on agarose ∗ For correspondence. E-mail: Ge Shi, [email protected]; Tianjun Xu, gels were randomly selected for sequencing on an ABI [email protected]. 3730 automated sequencer. The 130 sequenced clones, 54 Keywords. microsatellite; fisheries; genetic variation; silver pomfret; Pampus argenteus.

Journal of Genetics Vol. 91, Online Resources e79 Yu Qin et al. e H / o H 11 0.2650/0.7350 0.3055/0.6945 0 0.3011/0.6989 )Null ∗ ∗ ∗ P HWE ( NA , observed heterozygosity; HWE, Hardy–Weinberg equilibrium; and GenBank accession numbers of o H C) Repeat motif Size range (bp) ◦ ( a . T ) -3 Pampus argenteus , expected heterozygosity; e H R: CCACTAACGCATTATTGTGT R: GAGTAATCATCTTGCCATCTG R: AGGTGCTCAAGTGAACAG R: ATGGAAGATGGACTTACTGAG R: AGGACTATATCGGCCTAAAC R: GATGGAAGATGGACTTATTGAG R: GAGTAATACAACACAGTCAGTC R: CGATTGGTGGAACATCATC R: AATCATCATCATTCCTGAGC R: TGATGAGTCCTGAGTAATCA R: ACCCTGGTTGAGGAGGAG R: TGTGCCTATGTTACTGTGT R: CTGAGTAATAGCGGAACCA , effective number of alleles; A GenBank JQ307388 F: TTCCGATTTGCCTGTCTG 52 (AC)11 197–201 4 3.60 0.00232 JQ307389 F: CAGGTGCTCAAGTGAACAJQ307390 F: GATAGGTGCATGGGATAGGJQ307391 F: GTGTGTTTGTGGGTTTGAGJQ307392 54 F: CAACACAGTCAGTCTGCTAC 54JQ307393 F: TGTGTTTGTGGGTTTGAGAJQ307394 55 (CA)44 59 F: TATATGGTAGTCAGTCAGCAGJQ307395 (GT)23 F: AAGATCAACAGAGGCTGACJQ307396 51 58 (GT)36 F: GACAGACAGACAGACAGACGJQ307397 (AG)25 256–274 (CT)5CCCA(CT)16 F: CTATCACCTATCACTACCAAG 159–165 54JQ307398 56 (TG)41 4 F: TGGGTTACATGTGTGTCTATGJQ307399 202–220 189–193 4 57 3.15 235–239 F: GTATCTTCTGTAGCCTTCCAJQ307400 3.51 (GT)11 0.00053 10 52 4 F: TAATCATCGGCATGAGACA (CA)14 193–205 3 0.06168 8.14 3.20 (GT)38 55 2.71 0.10042 0.00000 0 7 175–185 (TG)21 57 0.77132 284–292 1 5.90 0.2729/0.7271 0 (CA)33 6 226–238 0.42176 0.1079/0.8921 5 5.62 0.3582/0.6418 (AC)15 172–190 0 4.13 7 0.04278 0.10996 0.1554/0.8446 129–133 5.59 10 1 3.51 0.26426 204–210 0 3 0.1638/0.8362 0.16283 0 0.2294/0.7706 9.23 4 0 0.1650/0.8350 0.17263 2.88 0.2729/ 0.7271 0.23365 0 0 0.0932/0.9068 0.3362/0.6638 Details of 14 polymorphic microsatellite loci in , number of alleles; Locus acc. no. Primer sequence (5 Table 1. Paar-YC-13 Paar-Y-8 Paar-Y-12 Paar-YC-59 Paar-YC-99 Paar-YC-37 Paar-YC-33 Paar-YC-57 Paar-Y-133 Paar-YC-14 Paar-Y-108 Paar-YC-34 Paar-Y-14 13 polymorphic microsatellite loci. *Signiﬁcant deviation from HWE. N

Journal of Genetics Vol. 91, Online Resources e80 Microsatellites for silver pomfret

(69%) sequences contained microsatellite fragments, and References all of them are no less than seven dinucleotide repeats. A total of 34 pairs of primers were designed using Primer Al-Abdul-Elah K. M., Almatar S., Abu-Rezq T. and James C. M. 2001 Development of hatchery technology for the silver pomfret Premier 5.0 software (http://www.premierbiosoft.com/ Pampus argenteus (Euphrasen): effect of microalgal species on primerdesign/index.html). larval survival. Aqua. Res. 32, 849–860. Polymorphism tests were performed on 30 individuals Al-Abdul-Elah K. M., Almatar S., Abu-Rezq T., James C. M. and from the populations of Zhoushan, Ninghai, Xiangshan, Yan- El-Dakour S. 2002 Development of hatchery techniques for the tai and Weihai. Six samples were collected from each pop- silver pomfret Pampus argenteus (Euphrasen). Asian Fish. Sci. 15, 107–121. ulation. PCR conditions were maintained as described by Almatar S. M., Lone K. P., Abu-Rezq T. S. and Yousef A. A. 2004 Panaud et al. (1996). Each PCR reaction was carried out Spawning frequency, fecundity, egg weight and spawning type of with a 15 μL reaction mixture containing 9.9 μL of steril- silver pomfret, Pampus argenteus (Euphrasen) (Stromateidae), in ized water, 1.5 μLof10× PCR buffer (containing 1.5 mM Kuwait waters. J. Appl. Ichthyol. 20, 176–188. Mg2+),1.2μL of 2.5 mM dNTPs, 0.6 μLoftheforward Davis P. and Wheeler A. 1985 The occurrence of Pampus argenteus μ μ (Euphrasen, 1788), (Osteichthyes, Perciformes, Stromateoidei, primer, 0.6 L of the reverse primer, 1 L of diluted DNA Stromateidae) in the North Sea. J. Fish Biol. 26, 105–109. template, and 0.1 μLof5UTaq DNA polymerase (Tiangen, Glenn T. C. and Schable N. A. 2005 Isolating microsatellite DNA Beijing, China). PCR products were separated on 8% dena- loci. Methods Enzymol. 395, 202–222. turing polyacrylamide gels and visualized by silver staining. Gong Q. X., Ni H. E., Li L. P. and Zheng C. J. 1989 On the change Denatured pBR322-DNA/MspI molecular weight marker of the ovary in annual cycle of silver pomfret Stromateoides argenteus from the East China Sea. J. Fish. China 13, 316– (Tiangen) was used as a size standard. 325. James C. M. and Almatar S. 2007 A breakthrough in the spawning of domesticated silve pomfret. Aqua. Asia-Pacific 3, 26–28. Results and discussion Liu J., Li C. S. and Li X. S. 2002 Phylogeny and biogeography of Chinese pomfret fishes (Pisces: Stromateidae). Stud. Mar. Sin. Of the 34 primer pairs, 13 loci were polymorphic in initial 44, 235–239. screens and were genotyped in the larger set of 30 individ- Meng Y. Y., Zhang L. Z., Zhao F., Shi Z.-H. and Zhuang P. 2009 uals (table 1). At each locus, all 30 individuals were suc- Prelimary study on the genetic diversity of four geographic pop- cessfully amplified. The characterization of these loci in P. ulations of silver pomfret (Pampus argenteus). Mar. Fish. 31, argenteus is summarized in table 1. N for each locus ranged 48–52. Ni H. E. and Gong Q. X. 1995 A study of individual fecundity of from 3 to 10, with an average of 5.46, while Ne ranged from silver pomfret Stromateoides argenteus from the East China Sea. 2.71 to 9.23 with an average of 4.71. Ho and He ranged from J. Zhejiang. Oce. Uni. 14, 118–122. 0.09 to 0.36 and 0.64 to 0.91, respectively. Significant devi- Panaud O., Chen X. and McCouch S. R. 1996 Development of ation from Hardy–Weinberg equilibrium (HWE) was found microsatellite markers and characterization of simple sequence at Paar-YC-13, Paar-Y-8, Paar-YC-33 and Paar-YC-59 after length polymorphism (SSLP) in rice (Oryza sativa L.). Mol. Gen. < Genet. 252, 597–607. Bonferroni correction (P 0.005, adjusted value), which Peng S., Shi Z., Hou J., Zhao F. and Zhang H. 2009 Genetic possibly was due to the presence of null alleles. Null alle- diversity of silver pomfret (Pampus argenteus) population from les were found in four loci (Paar-YC-13, Paar-Y-8, Paar- the China Sea based on mitochondrial DNA control region YC-33 and Paar-YC-57). Only in one locus, Paar-Y-8, stut- sequences. Biochem. Syst. Ecol. 37, 626–632. tering errors were found, but no evidence of allelic dropout Shi Z. H., Wang J. G., Gao L. J. and Lin J. Z. 2005 Advances on the studies of reproductive biology and artificial breeding tech- was found in any of the loci by analysis using the program nology in silver pomfret Pampus argenteus. Mar. Fish. 27, 246– Micro-Checker with Bonferroni correction (Van et al. 2004). 250. Additionally, there was no significant linkage found between Van O. C., Hutchinson W. F., Wills D. P. M. and Shipley P. all pairs of these 13 loci after Bonferroni correction, hence 2004 MICRO-CHECKER: software for identifying and correct- ing genotyping errors in mirosatellite data. Mol. Ecol. Notes 4, allelic variation at these loci were considered independent. In 535–538. a word, the eight significant polymorphic loci in P. argenteus Zane L., Bargelloni L. and Patarnello T. 2002 Strategies for will enable studies of the genetic variation, population struc- microsatellite isolation: a review. Mol. Ecol. 11, 1–16. ture, conservation genetics and molecular-assisted selective Zhao F., Shi Z. H. and Zhuang P. 2010 Advance on reproduc- breeding of this fish in future. tive biology and artificial breeding technology of silver pomfret, Pampus argenteus. Mar. Sci. 34, 90–96. Zhao F., Dong Y. H., Zhuang P., Zhang T., Zhang L. Z. and Shi Z. H. Acknowledgements 2011 Genetic diversity of silver pomfret (Pampus argenteus)in the Southern Yellow and East China Seas. Biochem. Syst. Ecol. This work was supported by Open Foundation from Ocean Fish- 39, 145–150. ery Science and Technology in the Most Important Subjects of Zheng Y. J. 2003 The biological re-sources and environment in Zhejiang (20110204) and Seeding Grants Program of Science and continental shelf of the East China Sea. Shanghai Science and Technology Commission Foundation of Zhejiang Province. Technology Press, Shanghai, China.

Received 23 December 2011, in revised form 5 March 2012; accepted 7 May 2012 Published on the Web: 27 July 2012

Journal of Genetics Vol. 91, Online Resources e81