Dynamics of Embryonic Stem Cell Differentiation Inferred from Single
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Genetic Screening Identifies a Component of the SWI/SNF Complex, Arid1b As a Senescence Regulator
A genetic screening identifies a component of the SWI/SNF complex, Arid1b as a senescence regulator Sadaf Khan A thesis submitted to Imperial College London for the degree of Doctor in Philosophy MRC Clinical Sciences Centre Imperial College London, School of Medicine July 2013 Statement of originality All experiments included in this thesis were performed by myself unless otherwise stated. Copyright Declaration The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives license. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the license terms of this work. 2 Abstract Senescence is an important tumour suppressor mechanism, which prevents the proliferation of stressed or damaged cells. The use of RNA interference to identify genes with a role in senescence is an important tool in the discovery of novel cancer genes. In this work, a protocol was established for conducting bypass of senescence screenings, using shRNA libraries together with next-generation sequencing. Using this approach, the SWI/SNF subunit Arid1b was identified as a regulator of cellular lifespan in MEFs. SWI/SNF is a large multi-subunit complex that remodels chromatin. Mutations in SWI/SNF proteins are frequently associated with cancer, suggesting that SWI/SNF components are tumour suppressors. Here the role of ARID1B during senescence was investigated. Depletion of ARID1B extends the proliferative capacity of primary mouse and human fibroblasts. -
Identification of the Genes Up- and Down-Regulated by the High Mobility Group A1 (HMGA1) Proteins: Tissue Specificity of the HMGA1-Dependent Gene Regulation
[CANCER RESEARCH 64, 5728–5735, August 15, 2004] Identification of the Genes Up- and Down-Regulated by the High Mobility Group A1 (HMGA1) Proteins: Tissue Specificity of the HMGA1-Dependent Gene Regulation Josefina Martinez Hoyos,1 Monica Fedele,1 Sabrina Battista,1 Francesca Pentimalli,1,2 Mogens Kruhoffer,3 Claudio Arra,4 Torben F. Orntoft,3 Carlo Maria Croce,2 and Alfredo Fusco1 1Dipartimento di Biologia e Patologia Cellulare e Molecolare e/o Istituto di Endocrinologia ed Oncologia Sperimentale del CNR, Facolta` di Medicina e Chirurgia di Napoli, Universita` degli Studi di Napoli “Federico II,” Naples, Italy; 2Kimmel Cancer Center, Jefferson Medical College, Philadelphia, Pennsylvania; 3Department of Clinical Biochemistry, Aarhus University Hospital, Aarhus, Denmark; and 4Istituto Dei Tumori Di Napoli “Fondazione Pascale,” Naples, Italy. ABSTRACT To identify the differentiation pathways in which HMGA1 is in- volved and to assess the role of the HMGA1 proteins in development, High mobility group A (HMGA) proteins are chromatinic proteins that we generated embryonic stem (ES) cells in which one or both hmga1 do not have transcriptional activity per se, however, by interacting with alleles are disrupted. We reported recently that hmga1Ϫ/Ϫ ES cells the transcription machinery, they regulate, negatively or positively, the expression of several genes. We searched for genes regulated by HMGA1 generate less T-cell precursors than do wild-type ES cells after in proteins using microarray analysis in embryonic stem (ES) cells bearing vitro-specific differentiation. Indeed, they preferentially differentiate one or two disrupted hmga1 alleles. We identified 87 transcripts increased to B cells, probably consequent to decreased IL-2 expression and and 163 transcripts decreased of at least 4-fold in hmga1؊/؊ ES cells. -
Core Transcriptional Regulatory Circuitries in Cancer
Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage. -
Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types. -
Repurposing of KLF5 Activates a Cell Cycle Signature During the Progression from a Precursor State to Oesophageal Adenocarcinoma DOI: 10.7554/Elife.57189
The University of Manchester Research Repurposing of KLF5 activates a cell cycle signature during the progression from a precursor state to oesophageal adenocarcinoma DOI: 10.7554/eLife.57189 Document Version Final published version Link to publication record in Manchester Research Explorer Citation for published version (APA): OCCAMS Consortium (2020). Repurposing of KLF5 activates a cell cycle signature during the progression from a precursor state to oesophageal adenocarcinoma. eLife, 9, 1-63. [e57189]. https://doi.org/10.7554/eLife.57189 Published in: eLife Citing this paper Please note that where the full-text provided on Manchester Research Explorer is the Author Accepted Manuscript or Proof version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version. General rights Copyright and moral rights for the publications made accessible in the Research Explorer are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Takedown policy If you believe that this document breaches copyright please refer to the University of Manchester’s Takedown Procedures [http://man.ac.uk/04Y6Bo] or contact [email protected] providing relevant details, so we can investigate your claim. Download date:11. Oct. 2021 RESEARCH ARTICLE Repurposing of KLF5 activates a cell cycle signature during the progression from a precursor -
A Preliminary Transcriptome Analysis Suggests a Transitory Effect of Vitamin D on Mitochondrial Function in Obese Young Finnish Subjects
ID: 18-0537 8 5 E Einarsdottir et al. Effect of vitamin D on gene 8:5 559–570 expression RESEARCH A preliminary transcriptome analysis suggests a transitory effect of vitamin D on mitochondrial function in obese young Finnish subjects Elisabet Einarsdottir1,2,3,†, Minna Pekkinen1,4, Kaarel Krjutškov2,5, Shintaro Katayama3, Juha Kere1,2,3,6, Outi Mäkitie1,4,7,8 and Heli Viljakainen1,9 1Folkhälsan Institute of Genetics, University of Helsinki, Helsinki, Finland 2Molecular Neurology Research Program, University of Helsinki, Helsinki, Finland 3Department of Biosciences and Nutrition, Karolinska Institutet, Huddinge, Sweden 4Children’s Hospital, University of Helsinki and Helsinki University Hospital, Helsinki, Finland 5Competence Centre on Health Technologies, Tartu, Estonia 6School of Basic and Medical Biosciences, King’s College London, Guy’s Hospital, London, United Kingdom 7Department of Molecular Medicine and Surgery and Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden 8Department of Clinical Genetics, Karolinska University Hospital, Stockholm, Sweden 9Department of Food and Environmental Sciences, University of Helsinki, Helsinki, Finland Correspondence should be addressed to H Viljakainen: [email protected] †(E Einarsdottir is now at Department of Gene Technology, Science for Life Laboratory, KTH-Royal Institute of Technology, Solna, Sweden) Abstract Objective: The effect of vitamin D at the transcriptome level is poorly understood, Key Words and furthermore, it is unclear if it differs between obese and normal-weight subjects. f vitamin D The objective of the study was to explore the transcriptome effects of vitamin D f gene expression supplementation. f obesity Design and methods: We analysed peripheral blood gene expression using GlobinLock f transcriptome oligonucleotides followed by RNA sequencing in individuals participating in a 12-week f mitochondrial function randomised double-blinded placebo-controlled vitamin D intervention study. -
Downloaded From
The MHC Class II Immunopeptidome of Lymph Nodes in Health and in Chemically Induced Colitis This information is current as Tim Fugmann, Adriana Sofron, Danilo Ritz, Franziska of October 2, 2021. Bootz and Dario Neri J Immunol published online 23 December 2016 http://www.jimmunol.org/content/early/2016/12/23/jimmun ol.1601157 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2016/12/23/jimmunol.160115 Material 7.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published December 23, 2016, doi:10.4049/jimmunol.1601157 The Journal of Immunology The MHC Class II Immunopeptidome of Lymph Nodes in Health and in Chemically Induced Colitis Tim Fugmann,* Adriana Sofron,† Danilo Ritz,* Franziska Bootz,† and Dario Neri† We recently described a mass spectrometry–based methodology that enables the confident identification of hundreds of peptides bound to murine MHC class II (MHCII) molecules. -
1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1
Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). -
A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution. -
Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.