DOCSLIB.ORG

Foxo Limits Microtubule Stability and Is Itself Negatively

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Foxo Limits Microtubule Stability and Is Itself Negatively FOXO LIMITS MICROTUBULE STABILITY AND IS ITSELF NEGATIVELY REGULATED BY MICROTUBULE DISRUPTION by INNA NECHIPURENKO Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Advisor: Dr. Heather T. Broihier Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY May, 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of __________________________________________Inna Nechipurenko _______ candidate for the_____________________________degree*.Doctor of Philosophy (signed)___________________________________________Evan Deneris (chair of the committee) __________________________________________________Heather Broihier __________________________________________________Robert Miller __________________________________________________Peter Harte (date)___________________February 6, 2012 *We also certify that written approval has been obtained for any proprietary material contained therein. DEDICATION This work is dedicated to my mom, Anna Nechipurenko, whose unconditional love and continuous support made it possible. TABLE OF CONTENTS List of Tables………………………………………………………………………….3 List of Figures…………………………………………………………………………4 Acknowledgements…………………………………………………………………..6 List of Abbreviations………………………………………………………………....7 Abstract………………………………………………………………………………..10 Chapter 1: General Introduction Neuronal microtubules………………………………………………………12 Regulation of microtubule dynamics……………………………………….16 Drosophila neuromuscular junction………………………………………...22 FoxO transcription factors…………………………………………………...24 Aims of thesis…………………………………………………………………51 Figure 1.1…………………………………………………………………….. 54 Chapter 2: FoxO limits microtubule stability and is itself negatively regulated by microtubule disruption Abstract………………………………………………………………………..56 Introduction……………………………………………………………………56 Materials and Methods……………………………………………………….60 Results…………………………………………………………………………68 Discussion……………………………………………………………………..82 Figures…………………………………………………………………………88 Tables………………………………………………………………………….116 Chapter 3: General Discussion 1 FoxO proteins as regulators of neuronal morphogenesis………………..119 FoxO as a potential component of neuronal response to injury………...121 Possible roles of FoxO in regulating neuronal microtubule homeostasis during aging…………………………………………………………………..124 Conclusions…………………………………………………………………..127 Figure 3.1……………………………………………………………………..128 Appendix A Introduction…………………………………………………………………...130 Materials and Methods………………………………………………….…...131 Results………………………………………………………………………...132 Discussion…………………………………………………………………….135 Figures………………………………………………………………………...138 Tables………………………………………………………………………….142 Appendix B Introduction…………………………………………………………………...145 Materials and Methods……………………………………………………....145 Results………………………………………………………………………...147 Discussion…………………………………………………………………….149 Figures………………………………………………………………………...151 Bibliography…………………………………………………………………………155 2 LIST OF TABLES 2.S1 Average number of microtubule loops per NMJ 6/7 in abdominal segment 3 of foxO LOF mutants………………………………………………………116 2.S2 Mean fraction of terminal boutons/NMJ with strong, weak, or undetectable Ac-Tub staining in foxO LOF mutants……………………………………...117 2.S3 Mean fraction of terminal boutons/NMJ with strong, weak, or undetectable Ac-Tub staining in foxO GOF mutants……………………………………..118 A.1 Average number of ectopic Eve+ cells per VNC hemisegment of embryos raised at 25°C…………………………………………………………….......142 A.2 Average number of ectopic Eve+ cells per VNC hemisegment of embryos raised at 28°C………………………………………………………………...143 A.3 Average number of Eve+ U MNs and EL interneurons per VNC hemisegment of embryos raised at 28°C……………………..…………...144 3 LIST OF FIGURES 1.1 Basics of microtubule structure and dynamic behavior……………………54 2.1 FoxO is enriched in a subset of motorneuron nuclei………………………88 2.2 foxO mutants exhibit defects in MT organization.……………...…………..90 2.3 foxO genetically interacts with futsch………………………………………..92 2.4 foxO NMJs have expanded distribution of acetylated α-tubulin staining..94 2.5 foxO is required for synaptic vesicle cycling………………………………..96 2.6 FoxO overexpression drives NMJ overgrowth and MT destabilization….98 2.7 Overexpression of constitutively-nuclear FoxO severely disrupts MTs and bouton morphology……………………..……………………………………100 2.8 Genetic disruption of neuronal MTs drives sustained reduction in FoxO levels…………………………………………………………………………..102 2.9 Acute MT disruption negatively regulates FoxO protein levels………....104 2.10 FoxO decrease after acute MT damage is independent of Wnd and requires Akt…………………………………………………………………...106 2.S1 FoxO expression profile in wild-type L3 larval CNS………………………108 2.S2 foxO mutants display aberrant synaptic bouton morphology……………110 4 2.S3 α-Spectrin, FoxO, and p-Akt protein levels are effectively knocked down via RNAi……………..………………………………………………………...112 2.S4 Acute nocodazole application does not alter Fasciclin 2 staining at the NMJ.........................................................................................................114 3.1 Model of FoxO-dependent regulation of neuronal MT stability during development and in response to cytoskeletal stress……………………..128 A.1 FoxO GOF phenotype is sensitive to levels of signaling through the BMP and IIS pathways……………..………………………………………………138 A.2 FoxO expression in embryos and larvae is modulated by the BMP signaling pathway..…………………………………………………………..140 B.1 FoxO protein levels are upregulated following 2-hour nocodazole treatment………………………………………………………………………151 B.2 FoxO protein levels are increased in a highwire mutant after 30-minute nocodazole incubation……………………………………………………….153 5 ACKNOWLEDGEMENTS First, I would like to thank my thesis advisor Heather Broihier for her mentorship, enthusiasm for science, and accessibility. I greatly appreciate the guidance she has given me when I needed it in my graduate career, as well as the freedom she has allowed me to plan the experiments, test hypotheses, and write papers. Her lab provided an excellent environment for me to grow as a scientist, and her career advice was invaluable. I would also like to thank the members of my thesis committee – Evan Deneris, Robert Miller, and Peter Harte – for their valuable advice and fresh perspective on my project. I would also like to express my gratitude to the past and present members of the Broihier lab – Yi-Lan Weng, Rebecca James, Jim Sears, Nan Liu, and Chris Dejelo – they made the Broihier lab an intellectually stimulating and truly enjoyable environment to work in. I would like to especially acknowledge Crystal Miller for being a great colleague and friend during these six years. Most of all, I would like to thank Stephen Ostrowski, whose support and encouragement have been a source of strength and motivation during the second half of my graduate school career. Finally, I would not have accomplished this without the love and support of my family. 6 LIST OF ABBREVIATIONS A2 abdominal segment 2 A3 abdominal segment 3 Ac-Tub acetylated α-tubulin Agrp Agouti-related protein AR androgen receptor Aspm abnormal spindle-like microcephaly-associated BMP the bone morphogenetic protein CBP cAMP responsive element binding (CREB) binding protein Cdk1 cyclin-dependent kinase 1 CK1 casein kinase 1 CNS central nervous system COE Collier/Olf1/EBF Cpe Carboxypeptidase E CRMP Collapsing-Response-Mediator Protein DCX doublecortin dFXR Drosophila fragile X related DG dentate gyrus Dilp2 Drosophila insulin-like peptide 2 DmGluRA Drosophila metabotropic glutamate receptor A DRG dorsal root ganglia DYRK1 dual-specificity tyrosine-phosphorylated and regulated kinase 1 7 GAP-43 growth-associated protein-43 GOF gain-of-function HIF1 hypoxia-inducible factor 1 HSC hematopoietic stem cell IIS Insulin/IGF signaling JNK c-Jun N-terminal kinase K/D knock-down L1 first-instar larva L2 second-instar larva L3 third-instar larva LOF loss-of-function MAP microtubule-associated protein MN motorneuron MST1 mammalian Ste20-like kinase MT microtubule NB neuroblast NMJ neuromuscular junction Noc nocodazole Npy neuropeptide Y NSC neural stem cell O-GlcNAc O-linked β-N-acetylglucosamine p-Akt phospho-Akt PI3K phosphatidylinositol 3-kinase 8 POMC pro-opiomelanocortin PrxII Peroxiredoxin II PTM post-translational modification ROS reactive oxygen species SCF Skp1/Cul1/F-box SCG10 superior cervical ganglia neural-specific 10 protein SGK serum- and glucocorticoid inducible kinase SGZ subgranular zone SOD superoxide dismutase SVZ subventricular zone +TIPs MT plus-end tracking proteins TGFβ transforming growth factor β Txnip thioredoxin-interacting protein VNC ventral nerve cord 9 FoxO Limits Microtubule Stability and Is Itself Negatively Regulated by Microtubule Disruption Abstract by INNA NECHIPURENKO The assembly of neural circuits during development is coordinately governed by extrinsic and intrinsic mechanisms that control different aspects of neuronal differentiation. Transcription factors have emerged as critical regulators of general as well as specific traits of neuronal identity including polarization, migration, axon growth and guidance, dendrite morphology and targeting, and synaptogenesis. Identification of additional transcriptional regulators that mediate distinct aspects of neuronal morphogenesis together with their upstream regulatory pathways and downstream effectors is instrumental for defining mechanisms responsible for establishment of normal neuronal connectivity during development and perturbation thereof in disease. In this thesis,
Load more

Recommended publications
  • Lola Has the Properties of a Master Regulator of Axon-Target Interaction for Snb Motor Axons of Drosophila
    Developmental Biology 213, 301–313 (1999) Article ID dbio.1999.9399, available online at http://www.idealibrary.com on lola Has the Properties of a Master Regulator of Axon–Target Interaction for SNb Motor Axons of Drosophila Knut Madden, Daniel Crowner, and Edward Giniger1 Division of Basic Sciences, Program in Developmental Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109 The proper pathfinding and target recognition of an axon requires the precisely choreographed expression of a multitude of guidance factors: instructive and permissive, positive and negative, and secreted and membrane bound. We show here that the transcription factor LOLA is required for pathfinding and targeting of the SNb motor nerve in Drosophila. We also show that lola is a dose-dependent regulator of SNb development: by varying the expression of one lola isoform we can progressively titrate the extent of interaction of SNb motor axons with their target muscles, from no interaction at all, through wild-type patterning, to apparent hyperinnervation. The phenotypes we observe from altered expression of LOLA suggest that this protein may help orchestrate the coordinated expression of the genes required for faithful SNb development. © 1999 Academic Press Key Words: axon guidance; synapse specification; alternative splicing; transcription factor; cell adhesion. INTRODUCTION In each embryonic abdominal hemisegment, the motor fascicle of SNb (also known as ISNb) comprises the axons of As an axon projects toward its synaptic targets in vivo, it eight identified motoneurons that project dorsally out of encounters a series of guidance “choice points,” at each of the ventral nerve cord, along a reproducible trajectory, to which the axon can either continue growing, turn onto a yield a precise pattern of innervation of seven bodywall different substratum, or stop and form a synapse.
    [Show full text]
  • Nucleocytoplasmic Shuttling of Soluble Tubulin in Mammalian Cells
    Research Article 1111 Nucleocytoplasmic shuttling of soluble tubulin in mammalian cells Tonia Akoumianaki1, Dimitris Kardassis1,2, Hara Polioudaki1, Spyros D. Georgatos3,4 and Panayiotis A. Theodoropoulos1,* 1Department of Biochemistry, University of Crete, School of Medicine, 71 003 Heraklion, Greece 2Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology-Hellas, 71 110 Heraklion, Greece 3Stem Cell and Chromatin Group, The Laboratory of Biology, University of Ioannina School of Medicine, 45 110 Ioannina, Greece 4The Biomedical Institute of Ioannina, IBE/ITE, 45 110 Ioannina, Greece *Author for correspondence (e-mail: [email protected]) Accepted 17 December 2008 Journal of Cell Science 122, 1111-1118 Published by The Company of Biologists 2009 doi:10.1242/jcs.043034 Summary We have investigated the subcellular distribution and dynamics to recombinant, normally modified and hyper- of soluble tubulin in unperturbed and transfected HeLa cells. phosphorylated/acetylated histone H3. Tubulin-bound H3 no Under normal culture conditions, endogenous α/β tubulin is longer interacts with heterochromatin protein 1 and lamin B confined to the cytoplasm. However, when the soluble pool of receptor, which are known to form a ternary complex under in subunits is elevated by combined cold-nocodazole treatment and vitro conditions. Based on these observations, we suggest that when constitutive nuclear export is inhibited by leptomycin B, nuclear accumulation of soluble tubulin is part of an intrinsic tubulin accumulates in the cell nucleus. Transfection assays and defense mechanism, which tends to limit cell proliferation FRAP experiments reveal that GFP-tagged β-tubulin shuttles under pathological conditions. This readily explains why nuclear between the cytoplasm and the cell nucleus.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Drosophila Mef2 Is Essential for Normal Mushroom Body and Wing Development
    bioRxiv preprint doi: https://doi.org/10.1101/311845; this version posted April 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Drosophila mef2 is essential for normal mushroom body and wing development Jill R. Crittenden1, Efthimios M. C. Skoulakis2, Elliott. S. Goldstein3, and Ronald L. Davis4 1McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, MA, 02139, USA 2Division of Neuroscience, Biomedical Sciences Research Centre "Alexander Fleming", Vari, 16672, Greece 3 School of Life Science, Arizona State University, Tempe, AZ, 85287, USA 4Department of Neuroscience, The Scripps Research Institute Florida, Jupiter, FL 33458, USA Key words: MEF2, mushroom bodies, brain, muscle, wing, vein, Drosophila 1 bioRxiv preprint doi: https://doi.org/10.1101/311845; this version posted April 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT MEF2 (myocyte enhancer factor 2) transcription factors are found in the brain and muscle of insects and vertebrates and are essential for the differentiation of multiple cell types. We show that in the fruitfly Drosophila, MEF2 is essential for normal development of wing veins, and for mushroom body formation in the brain. In embryos mutant for D-mef2, there was a striking reduction in the number of mushroom body neurons and their axon bundles were not detectable.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Forkhead Transcription Factors and Ageing
    Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing.
    [Show full text]
  • Posttranslational Modifications of Tubulin and Cilia
    Downloaded from http://cshperspectives.cshlp.org/ on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Posttranslational Modifications of Tubulin and Cilia Dorota Wloga,1 Ewa Joachimiak,1 Panagiota Louka,2 and Jacek Gaertig2 1Laboratory of Cytoskeleton and Cilia Biology, Department of Cell Biology, Nencki Institute of Experimental Biology, Polish Academy of Sciences, 02-093 Warsaw, Poland 2Department of Cellular Biology, University of Georgia, Athens, Georgia 30602 Correspondence: [email protected]; [email protected] Tubulin undergoes several highly conserved posttranslational modifications (PTMs) includ- ing acetylation, detyrosination, glutamylation, and glycylation. These PTMs accumulate on a subset of microtubules that are long-lived, including those in the basal bodies and axonemes. Tubulin PTMs are distributed nonuniformly. In the outer doublet microtubules of the axoneme, the B-tubules are highly enriched in the detyrosinated, polyglutamylated, and polyglycylated tubulin, whereas the A-tubules contain mostly unmodified tubulin. The non- uniform patterns of tubulin PTMs may functionalize microtubules in a position-dependent manner. Recent studies indicate that tubulin PTMs contribute to the assembly, disassembly, maintenance, and motility of cilia. In particular, tubulin glutamylation has emerged as a key PTM that affects ciliary motility through regulation of axonemal dynein arms and controls the stability and length of the axoneme. TYPES OF CONSERVED TUBULIN PTMs bules and along the length or even around the circumference of the same microtubule (Fig. 2). ubulin undergoes several conserved post- According to the “tubulin code” model (Verhey translational modifications (PTMs) (Janke T and Gaertig 2007), tubulin PTMs form patterns 2014; Song and Brady 2015; Yu et al. 2015). of marks on the microtubules that locally influ- The most studied tubulin PTMs and their re- ence various activities, such as the motility of sponsible enzymes are summarized in Figure 1.
    [Show full text]
  • Regulation of Mitochondrial Respiration by VDAC Is Enhanced by Membrane-Bound Inhibitors with Disordered Polyanionic C-Terminal Domains
    International Journal of Molecular Sciences Review Regulation of Mitochondrial Respiration by VDAC Is Enhanced by Membrane-Bound Inhibitors with Disordered Polyanionic C-Terminal Domains Tatiana K. Rostovtseva 1,*, Sergey M. Bezrukov 1 and David P. Hoogerheide 2 1 Program in Physical Biology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA; [email protected] 2 Center for Neutron Research, National Institute of Standards and Technology, Gaithersburg, MD 20899, USA; [email protected] * Correspondence: [email protected] Abstract: The voltage-dependent anion channel (VDAC) is the primary regulating pathway of water- soluble metabolites and ions across the mitochondrial outer membrane. When reconstituted into lipid membranes, VDAC responds to sufficiently large transmembrane potentials by transitioning to gated states in which ATP/ADP flux is reduced and calcium flux is increased. Two otherwise unrelated cytosolic proteins, tubulin, and α-synuclein (αSyn), dock with VDAC by a novel mechanism in which the transmembrane potential draws their disordered, polyanionic C-terminal domains into and through the VDAC channel, thus physically blocking the pore. For both tubulin and αSyn, Citation: Rostovtseva, T.K.; the blocked state is observed at much lower transmembrane potentials than VDAC gated states, Bezrukov, S.M.; Hoogerheide, D.P. such that in the presence of these cytosolic docking proteins, VDAC’s sensitivity to transmembrane Regulation of Mitochondrial potential is dramatically increased. Remarkably, the features of the VDAC gated states relevant for Respiration by VDAC Is Enhanced by bioenergetics—reduced metabolite flux and increased calcium flux—are preserved in the blocked Membrane-Bound Inhibitors with state induced by either docking protein.
    [Show full text]
  • Biophysical Investigation of the Dual Binding Surfaces of Human Transcription Factors FOXO4 and P53
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Biophysical investigation of the dual binding surfaces of human transcription factors FOXO4 and p53 Jinwoo Kim+, Dabin Ahn+, and Chin-Ju Park* Department of Chemistry, Gwangju Institute of Science and Technology, Gwangju, 61005, Korea *Correspondence to: [email protected]. + These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.425814; this version posted January 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Cellular senescence is protective against external oncogenic stress, but its accumulation causes aging- related diseases. Forkhead box O4 (FOXO4) and p53 are human transcription factors known to promote senescence by interacting in the promyelocytic leukemia bodies. Inhibiting their binding is a strategy for inducing apoptosis of senescent cells, but the binding surfaces that mediate the interaction of FOXO4 and p53 remain elusive. Here, we investigated two binding sites involved in the interaction between FOXO4 and p53 by using NMR spectroscopy. NMR chemical shift perturbation analysis showed that the binding between FOXO4’s forkhead domain (FHD) and p53’s transactivation domain (TAD), and between FOXO4’s C-terminal transactivation domain (CR3) and p53’s DNA binding domain (DBD), mediate the FOXO4-p53 interaction.
    [Show full text]
  • Up-Regulation of Foxo4 Mediated by Hepatitis B Virus X Protein Confers Resistance to Oxidative Stress-Induced Cell Death
    INTERNATIONAL JOURNAL OF MoleCular MEDICine 28: 255-260, 2011 Up-regulation of Foxo4 mediated by hepatitis B virus X protein confers resistance to oxidative stress-induced cell death Ratakorn SRISUTTEE1, SANG SEOK KOH3, EUN HEE PARK1, IL-RAE CHO1, HYE JIN MIN3, BYUNG HAK JHUN2, DAE-YEUL YU4, SUN PARK5, DO YUN PARK6, MI OCK LEE7, DIEGO H. CASTRILLON8, RANDAL N. Johnston9 and YOUNG-Hwa CHUNG1 1WCU Department of Cogno-Mechatronics Engineering and 2Department of Nanomedical Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan; 3Therapeutic Antibody Research Center and 4Disease Model Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon; 5Department of Microbiology, Ajou University School of Medicine, Suwon; 6Department of Pathology, College of Medicine, Pusan National University, Yangsan; 7College of Pharmacy, Seoul National University, Seoul, Republic of Korea; 8Department of Pathology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA; 9Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada Received January 27, 2011; Accepted March 17, 2011 DOI: 10.3892/ijmm.2011.699 Abstract. The hepatitis B virus X (HBX) protein, a regula- may be a useful target for suppression in the treatment of tory protein of the hepatitis B virus (HBV), has been shown HBV-associated hepatocellular carcinoma cells. to generate reactive oxygen species (ROS) in human liver cell lines; however, the mechanism by which cells protect them- Introduction selves under this oxidative stress is poorly understood. Here, we show that HBX induces the up-regulation of Forkhead box The human hepatitis B virus (HBV) induces acute and class O 4 (Foxo4) not only in Chang cells stably expressing chronic hepatitis and is closely associated with the incidence HBX (Chang-HBX) but also in primary hepatic tissues of human liver cancer (1,2).
    [Show full text]
  • Molecular Determinants of Tubulin's C‑Terminal Tail Conformational
    Letters pubs.acs.org/acschemicalbiology Molecular Determinants of Tubulin’sC‑Terminal Tail Conformational Ensemble † § † § † † † Kathryn P. Wall, , Maria Pagratis, , Geoffrey Armstrong, Jeremy L. Balsbaugh, Eric Verbeke, ‡ † Chad G. Pearson, and Loren E. Hough*, † University of Colorado, Boulder, Colorado, United States ‡ University of Colorado, Anschutz Medical Campus, Colorado, United States *S Supporting Information ABSTRACT: Tubulin is important for a wide variety of cellular processes including cell division, ciliogenesis, and intracellular trafficking. To perform these diverse functions, tubulin is regulated by post-translational modifications (PTM), primarily at the C-terminal tails of both the α- and β-tubulin heterodimer subunits. The tubulin C-terminal tails are disordered segments that are predicted to extend from the ordered tubulin body and may regulate both intrinsic properties of microtubules and the binding of microtubule associated proteins (MAP). It is not understood how either interactions with the ordered tubulin body or PTM affect tubulin’s C-terminal tails. To probe these questions, we developed a method to isotopically label tubulin for C-terminal tail structural studies by NMR. The conformational changes of the tubulin tails as a result of both proximity to the ordered tubulin body and modification by mono- and polyglycine PTM were determined. The C-terminal tails of the tubulin dimer are fully disordered and, in contrast with prior simulation predictions, exhibit a propensity for β-sheet conformations. The C-terminal tails display significant chemical shift differences as compared to isolated peptides of the same sequence, indicating that the tubulin C- terminal tails interact with the ordered tubulin body. Although mono- and polyglycylation affect the chemical shift of adjacent residues, the conformation of the C-terminal tail appears insensitive to the length of polyglycine chains.
    [Show full text]
  • Early Lineage Segregation of the Retinal Basal Glia in the Drosophila Eye Disc Chia‑Kang Tsao1,2, Yu Fen Huang1,2,3 & Y
    www.nature.com/scientificreports OPEN Early lineage segregation of the retinal basal glia in the Drosophila eye disc Chia‑Kang Tsao1,2, Yu Fen Huang1,2,3 & Y. Henry Sun1,2* The retinal basal glia (RBG) is a group of glia that migrates from the optic stalk into the third instar larval eye disc while the photoreceptor cells (PR) are diferentiating. The RBGs are grouped into three major classes based on molecular and morphological characteristics: surface glia (SG), wrapping glia (WG) and carpet glia (CG). The SGs migrate and divide. The WGs are postmitotic and wraps PR axons. The CGs have giant nucleus and extensive membrane extension that each covers half of the eye disc. In this study, we used lineage tracing methods to determine the lineage relationships among these glia subtypes and the temporal profle of the lineage decisions for RBG development. We found that the CG lineage segregated from the other RBG very early in the embryonic stage. It has been proposed that the SGs migrate under the CG membrane, which prevented SGs from contacting with the PR axons lying above the CG membrane. Upon passing the front of the CG membrane, which is slightly behind the morphogenetic furrow that marks the front of PR diferentiation, the migrating SG contact the nascent PR axon, which in turn release FGF to induce SGs’ diferentiation into WG. Interestingly, we found that SGs are equally distributed apical and basal to the CG membrane, so that the apical SGs are not prevented from contacting PR axons by CG membrane. Clonal analysis reveals that the apical and basal RBG are derived from distinct lineages determined before they enter the eye disc.
    [Show full text]