Mycol. Res. 104 (11): 1295–1303 (November 2000). Printed in the United Kingdom. 1295

Phylogeny of the Peronosporomycetes (Oomycota) based on partial sequences of the large ribosomal subunit (LSU rDNA)

Ann B. PETERSEN and Søren ROSENDAHL Department of Mycology, Botanical Institute, University of Copenhagen, Øster Farimagsgade 2D, DK-1353 Copenhagen K, Denmark. E-mail: soerenr!bot.ku.dk

Received 16 June 1999; accepted 22 March 2000.

The phylogeny of the nuclear large ribosomal subunit (LSU) rDNA from Peronosporomycetes (Oomycota) was studied. Five orders Rhipidiales, Leptomitales, Saprolegniales, Pythiales and Peronosporales were included in the study in order to reveal phylogenetic relationships within the group. Based on maximum parsimony, neighbour-joining and maximum-likelihood the Peronosporomycetes seem to have evolved as two major lineages. One lineage includes members of the Rhipidiales, Leptomitales and Saprolegniales and the other includes the members of Pythiales and Peronosporales. However, the inclusion of Rhipidiales in Saprolegniomycetidae was not well supported. Leptomitales were placed basal to the Saprolegniales in the LSU rDNA based tree. In the Saprolegniaceae sensu lato the primary zoospore seems to have been lost several times in the evolution of this family. Species of Aphanomyces were placed on the most basal branch in this family. The obligate parasite, Albugo, was placed on the most basal branch within the Peronosporomycetidae. Phytophthora showed a closer relationship to Peronospora and Peronophythora than to Pythium suggesting that this genus should be removed from Pythiales to Peronosporales.

the Rhipidiomycetidae with members of the Rhipidiales, and INTRODUCTION reorganized Saprolegniomycetidae and Peronosporomycetidae. The Peronosporomycetes (Oomycota) are known to be related to The phylogenetic relationships between the groups in the chromophyte algae and other heterokont protists. This Peronosporomycetes have long been a matter of controversy relationship between Peronosporomycetes and heterokont (Bessey 1942, Barr 1983, Beakes 1987, Dick et al. 1984, Dick protists is based on the ultrastructure of the zoospore, e.g. a 1988, 1990). Bessey (1942), Barr (1983) and Beakes (1987) straminipilous ornamentation of the anterior flagella and proposed a monophyletic origin of the Peronosporomycetes. similarities in the flagellar rootlet structure (Barr 1981, 1992, Barr (1983) suggested that the obligate parasites on terrestrial Beakes 1987). DNA studies support this relationship and plants evolved from Saprolegniales through primitive Pythium suggest that Peronosporomycetes is monophyletic (Gunderson et and Phytophthora. According to this theory Peronosporomycetes al. 1987, Fo$ rster et al. 1990). developed from saprobes in aquatic habitats. Terrestrial The traditional taxonomy of Peronosporomycetes distin- facultative soil-borne parasites on plant roots developed from guishes four orders: Lagenidiales, Leptomitales, Peronosporales, these and later obligate parasites of the aerial parts of the and Saprolegniales (Sparrow 1960, Dick 1973). The taxonomy plants evolved. The zoospore stages and the dependency on of the Peronosporomycetes has been reorganized several times water were gradually reduced during this evolution. Barr (Dick, Wong & Clark 1984, Dick et al. 1989, Dick 1990, 1995). (1983) also suggested that Leptomitales evolved as a separate Dick et al. (1984) recognised three additional orders: lineage from Saprolegniales. This idea was based on the Rhipidiales, previously Rhipidiaceae, placed in Leptomitales, presence of chitin in some of the species in Leptomitales. Pythiales including organisms formerly placed in Lagenidiales Beakes (1987) supported the theory of a monophyletic and finally Sclerosporales including species of Sclerosporaceae origin of Peronosporomycetes, and proposed two different formerly placed in Peronosporales. In this revision Perono- evolutionary models for the class. In one of these Saprolegniales sporomycetes was subdivided in two subclasses: Sapro- was considered the main ancestral group due to the similarity legniomycetidae with Saprolegniales as a single order, and between Saprolegnia and the alga Vaucheria. Leptomitales, Peronosporomycetidae with the orders Leptomitales, Rhipidiales, Peronosporales and Lagenidiales evolved sequentially or Sclerosporales, Pythiales and Peronosporales. Leptomitales and independently from Saprolegniales. He further suggested Sclerosporales were later transferred to Saprolegniomycetidae that characteristics of wall synthesis during zoosporogenesis based on DNA studies (Dick et al. 1989, Klassen et al. 1988). should be regarded as a key character. Dick et al. (1989) and Dick (1995) proposed a third subclass, A polyphyletic origin of the Peronosporomycetes has also Phylogeny of the Peronosporomycetes 1296 been proposed. Sparrow (1976) suggested two independent Taylor (1988). The extracted DNA was checked on 1% evolutionary lineages, a saprolegnian and a peronosporacean agarose gels, and used for PCR-amplifications of LSU rDNA, lineage. Dick et al. (1984) and Dick (1988, 1990) adopted this except for P. farinosa, P. parasitica and A. candida where resting idea, and suggested different evolutionary hypotheses of spores were crushed with a pestle and used directly for PCR- Peronosporomycetes. Later, however, Dick (1995) stated that it amplifications. is not yet possible to designate primitive or advanced The primers LSU-0025-F and LSU-1170-R (Table 2) were phylogenetic criteria for Peronosporomycetes. used to amplify the first approximately 1200 bp of the LSU In order to propose new phylogenetic theories, it is rDNA. PCR conditions were: Initial denaturation for 1 min at necessary to include additional characters. Additional 96 mC, followed by 30 cycles of denaturation 1 min at 95 mC, characters for phylogenetic studies can be obtained from annealing 1 min at 52 m, extension 2 min at 72 m and a final nucleic acid sequences. Such characters have been used in extension of 7 min at 72 m. taxonomy and phylogeny of the economically important plant pathogens Pythium and Phytophthora (Lee & Taylor 1992, Briard et al. 1995, Crawford et al. 1996), and for species DNA sequencing of the Saprolegniaceae (Daugherty et al. 1998). Ribosomal DNA Amplifications were checked on 2% Nusieve gels, and PCR- (rDNA) sequences have been used extensively to reconstruct products were purified from the amplification mixture with phylogenetic relationships among fungi and algae, where the milipore Ultrafree-MC filters (Milipore Corporation, Bedford, evolutionary interpretation of morphological features is MA) and used in cycle-sequencing reactions (ABI Dye ambiguous (Taylor 1993, Bhattacharya & Medlin 1995, Hibbit Terminator Cycle Sequencing Ready Reactions Kit) together et al. 1997), and lately Dick et al. (1999) used 18S rDNA to with specific primers (Table 2). Both strands of the LSU rDNA suggest a phylogeny for the Peronosporomycetes. were sequenced on an automatic sequencer (ABI Prism TM So far the LSU (28S) rDNA has not been used to develop 377 DNA Sequencer), and chromatograms of these sequences phylogenetic hypotheses for the major lineages of the were checked using Sequencer 3.1 (Gene Codes Corporations Peronosporomycetes. The objective of the present study was to Inc., Ann Arbor). construct a phylogeny of members of the Peronosporomycetes based on partial sequences of LSU rDNA. The molecular phylogeny was compared with morphological and physio- Sequence alignment and phylogenetic analysis logical characters in this group. We sequenced 1200 base pairs (bp) of the large subunit ribosomal DNA (LSU rDNA) gene Twenty-four new sequences from this study were aligned from 24 members of the Peronosporomycetes representing the with two published LSU rDNA sequences obtained from three major subclasses listed above and several families GenBank, using the computer program ESEE (vers. 3.1 1997, within these. Cabot, E). The database on the structure of large ribosomal subunit RNA was used for the alignment (De Rijk, van der Peer & De Wachter 1997). The two published sequences were MATERIALS AND METHODS a sequence of Phytophthora megasperma accession no. X75631 Fungal material and Hyphochytrium catenoides accession no. X80345. For alignment of variable regions of the LSU rDNA the program The taxa\isolates used in the study and the sources of these Sequence Navigator (Applied Biosystems, version 1.0) was are given in Table 1. Peronospora farinosa and P. parasitica used. The sequences varied substantially and could not be were obtained as sporangia from infested spinach (Spinacea unambiguously aligned. The alignment is available from the oleracea) and infested white cauliflower (Brassica oleracea authors (soerenr!bot.ku.dk). Analyses were performed that var. botrytis) respectively obtained from Dæhnfeldt A\S included all organisms but with an exclusion of 180 characters (Denmark). Albugo candida was obtained as sporangia from (position 436–507, 580–625, 889–950) with an ambiguous infested Shepherds purse (Capsella bursa-pastoris). Saprolegnia alignment. Phylogenetic analyses were performed with the ferax (Sf5.6) and Achlya americana (am2) were isolated from software PAUP* 4.0b2. All maximum parsimony searches a lake (Bagsværd sø, Denmark), Saprolegnia litoralis (Sl1) were performed using Fitch parsimony (unordered, multistate was isolated from forest soil (Grib skov, Denmark). Dictyuchus characters) with gaps treated as missing data using the heuristic sp. no. 4.2 and Dictyuchus sp. no. 5.6 were isolated from twigs search option, TBR (tree bisection reconnection) branch from fresh water (Smørmosen, Denmark) and wet soil swapping and random addition sequence with 300 replicates. (Hareskoven, Denmark) respectively. To assess the robustness of the clades, bootstrap percentages were calculated. Bootstrap values (BV) were calculated for 200 replicates with simple entry of the data. Consistency index DNA extraction and PCR conditions (CI) and retention index (RI) were calculated for all parsimony The cultures were grown as 100 ml batches in liquid media trees (Kluge & Farris, 1969; Farris, 1989). In addition to the (Fuller & Jaworski 1987). The batches were inoculated from parsimony analysis alternative topologies were searched by agar cultures and incubated at 20 mC for 1 week. The resultant maximum-likelihood and neighbour-joining methods using mycelia were washed in dilute salt solution (DS) (Dill & Fuller PAUP* 4.0b2. 1971), blotted on filter paper and freeze dried. Total genomic Maximum-likelihood trees were constructed using the DNA was then extracted by the methods of Lee, Milgroom & heuristic search algorithm. The transition\transversion ratio A. B. Petersen and S. Rosendahl 1297

Table 1. List of species of the Peronosporomycetes sequenced in this study. Taxonomic placement of the species included (Dick 1995) and their source.

GenBank\EMBL Major group Species Isolate and source accession no.

Peronosporomycetes Peronosporomycetidae Peronosporales Peronosporaceae Peronospora farinosa Spinaceae oleracea AF235955 P. parasitica Brassica oleracea var. botrytis AF235957 Albuginaceae Albugo candida Capsella bursa-pastoris AF235938 Pythiales Pythiaceae Pythium aphanidermatum 170, Hockenhull, J.a AF235956 Lagenidium chthamalophilum 65-028b AF235946 L. giganteum Novo Nordisk A\Sc – Phytophthora infestans Pi-3, Novo Nordisk A\Sc – Peronophythora litchii CBS 100.81 AF235949 Rhipidiomycetidae Rhipidiales Rhipidiaceae Sapromyces elongatus CBS 213.82 AF235950 Saprolegniomycetidae Saprolegniales Saprolegniaceae Saprolegnia ferax Sf5.6, Petersen, A. Bd AF235953 S. litoralis SI1, Petersen, A. B.d AF235952 Achlya americana am2, Petersen, A. B.d AF235943 Isoachlya toruloides Tayseir, M. A.e AF235947 Aphanomyces euteiches ATCC 201684 AF235939 A. astaci (uv), So$ derha$ ll, K.f AF235940 A. piscicida njm 9211, Hatai, K.g AF235941 Dictyuchus sp. no. 5.6, Petersen, A. B.d AF235945 Dictyuchus sp. no. 4.2, Petersen, A. B.d AF235944 Leptolegnia sp. no. 3.1, Sørensen, D.d AF235954 Leptolegnia sp. no. 1.6, Sørensen, D.d AF235948 Thraustotheca clavata CBS 557.67 AF235951 Brevilegnia bispora CBS 568.67 AF235942 Leptomitales Leptomitaceae Apodachlya minima CR-55b AF235937 A. brachynema 61-020b AF235936

a The Royal Veterinary and Agricultural University, Copenhagen. b University of California, Berkeley Microgarden. c Novo Nordisk A\S, Bagsværd. d Department of Mycology, Botanical Institute, University of Copenhagen. e Botanical Department, Faculty of Science, Suez Canal University. f Department of Comparative Physiology, University of Uppsala. g Division of Fish Diseases, Nippon Veterinary and Animal Science University, Tokyo.

Table 2. Primers used for PCR and sequencing of LSU rDNA from organisms of Peronosporomycetes.

Name Sequence Reference

LSU-0025-F ACCCGCTGAACTTAAGCATAT van der Auwera et al. (1994) LSU-0344-F CGATAGCGAACAAGTACCGTG This study LSU-0670-F GACTGAGGTGCCTACAAC This study LSU-0826-F CTTGAAACACGGACCAAGGAG This study LSU-1170-R GCTATCCTGAGGGAAATTTCGG van der Auvera et al. (1994) LSU-0826-R CTCCTTGGTCCGTGTTTCAAG This study LSU-0670-R GTTGTAGGCACCTCAGTC van der Auwera et al. (1994) LSU-0344-R CACGGTACTTGTTCGCTATCG This study was estimated by maximum-likelihood. Standard settings for Peronosporomycetes based on its sistergroup relationship to this maximum-likelihood were used, and the Hasegawa-Kishino- group (van der Auwera et al. 1995). Yano (HKY) two parameter model for unequal base frequencies was chosen. Branch support was determined by bootstrap RESULTS analysis (Felsenstein 1985) calculated using 100 replicates. The settings for the bootstrap analysis were as above, except that The 24 sequences obtained were aligned with the published the transition\transversion ratio estimated above was used. sequences of the large ribosomal subunit of P. megasperma and Hyphochytrium catenoides was chosen as outgroup to the H. catenoides, and the length of the sequences obtained, Phylogeny of the Peronosporomycetes 1298

Fig. 1. Phylogenetic relationships within Peronosporomycetes (Oomycota) inferred from a maximum parsimony analysis of 981 nucleotides of nuclear LSU rDNA. A strict consensus tree of two equally most parsimonious trees requiring 984 steps with consistency index l 0n559 and retension index l 0n712 is shown. Bootstrap percentages higher than 50% from 200 replicates are shown above each branch. The differences in the two equally parsimonious trees obtained were whether Peronophythora litchii clustered with Phytophthora infestans or P. megasperma. Arrows (6) indicate where the primary zoospore is suggested to be lost in Saprolegniales. surrounded by the primers LSU-0025-F and LSU-1170-R, assigned above the branches. The tree divided the 25 varied from 1030 to 1121 bp. The taxa belonging to the taxa\isolates of Peronosporomycetes included in this study into Saprolegniales had an approx. 60 bp large deletion in helix 2 two major lineages. One lineage consisted of species of corresponding to bp 432–492 in P. megasperma (van der Leptomitales, Saprolegniales and Sapromyces, and the other Auwera, Chapelle & De Wachter 1994) or the excluded lineage contained the species of the Pythiales and Peronosporales. positions 436–507 in the alignment. These lineages were supported by bootstrap values of 74% A maximum parsimony tree based on 981 bp of the partial and 95% respectively (Fig. 1). sequences of the LSU rDNA of the Peronosporomycetes is In the former lineage, Sapromyces representing Rhipidiales shown in Fig. 1. Of the 981 included sites 361 were variable, was the most basal organism. The two species of Apodachlya and 245 sites of these were parsimony-informative. The tree representing Leptomitales were on the next branch to diverge was a strict consensus tree of two equally parsimonious trees (100% BV). Saprolegniales seemed to be the most advanced requiring 984 steps. The CI and the RI for the two trees were group in this lineage with high bootstrap support (92%). 0n559 and 0n712 respectively. Bootstrap percentages were Three major clusters were seen in Saprolegniales. Species of A. B. Petersen and S. Rosendahl 1299

Fig. 2. Phylogenetic relationships within Peronosporomycetes (Oomycota) inferred from a maximum likelihood analysis of 981 nucleotides of nuclear LSU rDNA using the model of Hasegawa–Kishino–Yano. The tree is an optimum maximum likelihood tree obtained by a heuristic search. The –Ln likelihood is 6366.15977 and the estimated transition\transversion ratio is 1.651202. (kappa l 3.249597). Bootstrap percentages higher than 50% from 100 replicates are shown above each branch.

Aphanomyces formed a cluster on the most basal branch with supported clade (100% BV), with the species of Peronospora on high bootstrap support (97%), resulting in a cluster containing the most basal line. The positions of Pythium and Lagenidium the remaining species of Saprolegniales with very low bootstrap in the LSU rDNA based tree were less clear. Pythium was support (55%). This cluster consisted of two major clusters. resolved as basal to Lagenidium (75% BV) while Lagenidium One of these contained species of Saprolegnia and Leptolegnia was resolved as a sister to the clade including Phytophthora but (93% BV), and the other major cluster were composed of with bootstrap support lower than 50%. Minor differences species of Achlya, Thraustotheca and Isoachlya in one internal were seen between the two most parsimonious trees. In the cluster (95% BV) and Brevilegnia and Dictyuchus in another two trees Peronophythora litchii clustered with either Phytoph- internal cluster (100% BV). thora infestans or P. megasperma. Albugo diverged on the most basal branch within the The overall topology of the trees obtained by maximum species representing the Peronosporomycetidae. The species of likelihood (Fig. 2) was similar to the tree based on maximum Peronospora, Phytophthora and Peronophythora formed a strongly parsimony seen in Fig. 1 except for the position of Lagenidium. Phylogeny of the Peronosporomycetes 1300

The optimum maximum likelihood tree had a -Ln likelihood of oosporogenesis resulting in non-periplasmic oospores, while 6366.15977 and the estimated transition\transversion ratio of the members of the Peronosporomycetidae have a centripetal this tree was 1.651202 (kappa l 3.249597) (Fig. 2). The oosporogenesis resulting in oospores with a persistent inclusion of Sapromyces as representing the Rhipidiales in the periplasm. Saprolegniomycetidae was supported by only 67% bootstrap in Sapromyces has morphological features that place it between the maximum likelihood tree. Aphanomyces was also suggested the Saprolegniomycetidae and the Peronosporomycetidae. Gotelli as basal in the Saprolegniales in the maximum likelihood tree. & Hanson (1987) noted that the ultrastructure of Sapromyces The resulting clade including the remaining species of zoospores suggests that Rhipidiales are more closely related to Saprolegniales obtained a bootstrap support of 79%. Isoachlya Saprolegniales than to Pythiales. Beakes (1987) noted that the clustered with Achlya and Thraustotheca, but this position was secondary cysts of Sapromyces are coated with an outer layer not well-supported (56%). In Peronosporomycetidae, Albugo was of fibrillar material and lack the electron-dense coat similar to placed on the most basal branch with high bootstrap support the secondary cysts of the Pythiales. The oospore morphology (96%) as in the maximum parsimony based trees. The species is similar to that found in Peronosporomycetidae, e.g. the of Lagenidium were placed as basal to a clade including presence of periplasm (Dick 1969, 1996). On the basis of the Pythium, Phytophthora and Peronospora but supported by low present study a placement for members of Rhipidiales can not bootstrap values (57%). In this clade Pythium was evolving on be suggested. Additional and independent molecular markers a separate line with low bootstrap supports (53%), showing will be needed to place this group of organisms with certainty. sistergroup relationships to a cluster including Peronospora, The phylogenetic trees resulting from sequences of the LSU Phytophthora and Peronophythora. This cluster was well- rDNA strongly suggest that Leptomitales should be included in supported (100%). the Saprolegniomycetidae as suggested by Dick et al. (1989). The topology of the neighbour-joining tree was identical Leptomitales and Saprolegniales are placed as sistergroups in all with the trees inferred from maximum likelihood method LSU rDNA based trees with very high bootstrap support (data not shown). (100%). Morphological characters also support this placement. In both orders the presence of a pyriform zoospore with a pair of flagella anchored near the spore apex (the primary DISCUSSION zoospore) has been described (Sparrow 1960, Dick 1973, The phylogenetic trees based on partial sequences of the LSU Jacobs 1982). Saprolegniales and Leptomitales share traits in rDNA presented here confirm the two major lineages in the the oospore morphology as both produce oospores without a Peronosporomycetes representing the Saprolegniomycetidae and periplasm (Dick 1969, 1995), and similarities are seen in the the Peronosporomycetidae as suggested by Dick et al. (1984). zoospore morphology (Randolph & Powell 1992). A proximal One lineage includes Sapromyces representing Rhipidiales, relationship between the Leptomitales and the Saprolegniales Apodachlya representing Leptomitales, and the species repre- was also suggested by Klassen et al. (1988) based on a senting Saprolegniales (Saprolegniomycetidae). The other lineage restriction analysis of ribosomal DNA, and lately by a includes species representing Pythiales and Peronosporales maximum parsimony analysis based on sequences of the SSU (Peronosporomycetidae). In a restriction analysis of rDNA rDNA (Dick et al. 1999). (Klassen et al. 1988), and in the taxonomic revisions by Dick The species of Saprolegniales included in the present study et al. (1989) and Dick (1995), Peronosporomycetes consisted of form a monophyletic clade. The genus Aphanomyces is three subclasses: Saprolegniomycetidae, Peronosporomycetidae and suggested to be the first lineage to diverge in the maximum Rhipidiomycetidae. However, the inclusion of Sapromyces, the parsimony trees, the neighbour-joining tree and in the single representative for the Rhipidiales in this study, in maximum likelihood trees. In many ways Aphanomyces is Saprolegniomycetidae is only moderately supported in the different from other genera of Saprolegniales. The K#-bodies maximum parsimony analysis (74% BV) and in the maximum- examined in the genus Aphanomyces are of different morpho- likelihood analysis (67% BV). types than the K#-bodies seen in other species of the Several characters support the existence of two major Saprolegniales (Powell & Blackwell 1995). The genus lineages in the LSU rDNA based phylogenetic trees. The Aphanomyces also has a different oospore organisation. In members of the Leptomitales and the Saprolegniales are able to Aphanomyces the ooplasm is non-fluid and shows no Brownian synthesise sterols de novo while the members of the Pythiales movement of the granules as it is seen in the other genera of are not (Domnas, Srebo & Hicks 1977, Nes 1987, Weete Saprolegniales (Dick 1971, Howard 1971, Traquair & McKeen 1989). K#-bodies (kinetosome-associated vesicles) present in 1980, Dick 1995). Antibodies produced against oospores the zoospore of some members of the Peronosporomycetes of A. euteiches showed almost no cross-reactions with might also be a key character. K#-bodies have so far been other genera of Saprolegniales and Pythiales, suggesting that found in Sapromyces, Apodachlya and members of the Sapro- Aphanomyces has a different wall chemistry compared to other legniales, but not in the Peronosporomycetidae (Holloway & groups of Peronosporomycetes (Petersen, Olson & Rosendahl Heath 1977, Hoch & Mitchell 1972, Olson et al. 1984, Powell, 1996). Lehnen & Bortnick 1985, Beakes 1987, Gotelli & Hanson Aphanomyces was suggested to be included in a newly 1987, Randolph & Powell 1992, Powell & Blackwell 1995). erected family of Saprolegniales, the Leptolegniaceae, together The oosporogenesis and oospore organisation is also an with species of Leptolegnia and Plectospira, by Dick et al. (1999) important key character. According to Dick (1969, 1995) based on morphological and molecular data. In the phylo- Saprolegniales and probably Leptomitales have a centrifugal genetic trees based on LSU rDNA presented here an unnamed A. B. Petersen and S. Rosendahl 1301 isolate of Leptolegnia clustered with Saprolegnia and not with independent losses of the primary zoospore during the Aphanomyces in the maximum parsimony trees, in the evolution of the Saprolegniales (Fig. 1). The primary zoospore maximum-likelihood tree and in the neighbour-joining tree. is first lost at the branch with Aphanomyces, then at the branch Our data are thus not supporting the erection of the family with Achlya and Thraustotheca, and the third time it is lost at Leptolegniaceae. However, we did not include the type species the branch with Brevilegnia and Dictyuchus. In our trees Leptolegnia caudata. It would be interesting to include LSU Saprolegnia is not the most basal organism of Saprolegniales, rDNA sequences of this species in future studies to evaluate but Aphanomyces is suggested to contain the most basal the proposed family Leptolegniaceae. Morphologically based organisms in this family. studies of these organisms indicate that they should be Dick et al. (1999) suggests that the primary zoospore is an grouped together (Powell & Blackwell 1998, Dick et al. 1999). apomorphic state. According to Dick (1990) the primary It has been postulated several times that Saprolegnia is the zoospore is known only with certainty in Saprolegnia sensu lato most basal organism in the Saprolegniaceae (Humphrey 1893, (including Isoachlya). It is thus most likely that the primary Atkinson 1909, Ho$ hnk 1933, Barr 1983), mainly because of its zoospore has been lost several times during evolution. The mechanism of asexual reproduction. In Saprolegnia two alternative, that this zoospore with restricted motility has morphologically different zoospores are formed. The first evolved twice, is doubtful. formed zoospore, the primary zoospore, is pyriform and has The topology of the part of the LSU rDNA based two flagella anchored in the spore apex. The secondary phylogenetic trees including members of the Peronosporo- zoospore is reniform with the flagella inserted laterally in a mycetidae is non-congruent with most phylogenetic theories of grove. This zoospore is generally a much better swimmer and the Peronosporomycetes. In most theories primitive Pythium it is in some species able to perform repeated emergence and\or Phytophthora are seen as ancestors to the obligate (Die! guez-Uribeondo, Cereneus & So$ derha$ ll 1994). The parasites in Peronosporales (Bessey 1942, Shaw 1981, Barr different mechanisms of spore release seen in the Sapro- 1983). This is partly based on the view that parasitism legniaceae have been viewed as a transition series with represents the apomorpic state in contrast to saprotrophy. In Saprolegnia exhibiting the ancestral mechanism (Humphrey the phylogenetic trees presented here Albugo is seen as basal 1893, Atkinson 1909, Ho$ hnk 1933). In this series the primary in the Peronosporomycetidae. Albugo is a biotrophic parasite on zoospore stage is reduced. Achlya releases pyriform spores hosts of relatively early origin like Amaranthaceae and from its sporangia showing some similarities with the primary Convolvulaceae (Dick 1988). This might support a basal zoospore of Saprolegnia, but they encyst at the apex of the placement of this genus compared to species of Pythium, zoosporangia, and have in some species been shown only to which contains parasites on monocots. In the true Fungi possess rudimentary flagella with stunted axonemes (Money studies on molecular phylogeny suggest that obligate parasites et al. 1987). In Thraustotheca the primary spores encyst in the such as Taphrinales and Uredinales are basal in Ascomycota and sporangium before they are released by rupture of the Basidiomycota respectively (Swan & Taylor 1993, Nishida & sporangial walls. Later secondary zoospores are released from Sugiyama 1994). A basal placement might also be the case for the cysts. In Dictyuchus the spores encyst in the sporangia. some of the obligate parasites of the Peronosporomycetes. Protoplasts are released through individual papilla that project Phytophthora and Pythium have traditionally been placed through the sporangial wall. These are reorganized into together in Peronosporaceae in Peronosporales (Waterhouse secondary zoospores on the surface of the sporangia. The 1973) or lately in Pythiales in Peronosporomycetidae based on only remnant of the primary zoospore in this genus is the cyst similarities in morphology and in details of the sexual walls in the sporangia (Coker & Matthews 1937). In reproduction (Waterhouse 1973, Dick 1995). In the phylo- Aphanomyces protoplasts are cleaved out in hypha-like genetic tree based on partial sequences of LSU rDNA the sporangia. These protoplasts move to the orifice of sporangia species of Phytophthora included in this study cluster with and encyst. Later the cysts germinate with a secondary Peronospora rather than with Pythium, suggesting that zoospore. It has been shown that the primary spores, the Phytophthora should be removed from Pythiales to Perono- protoplasts, of the plant pathogenic species Aphanomyces sporales. This alternative placement is strongly supported by euteiches do not possess flagella (Hoch & Mitchell 1972). bootstrap percentages (100%). Daugherty et al. (1998) confirmed this theory by using Several differences between Pythium and Phytophthora internal transcribed spacer sequences (ITS) of four genera of support such a movement. Species of Phytophthora produce Saprolegniaceae. In their phylogenetic analysis Saprolegnia well formed sporangia on distinct sporangiophores, compared merged as the most basal organism, sister to Achlya, to the hypha-like or spherical sporangia of Pythium, and the Thraustotheca and Dictyuchus, with Achlya and Thraustotheca as zoosporogenesis of the two genera follows two different most closely related, while Dictyuchus appeared to have patterns. In Pythium the protoplasm of the sporangia is evolved independently of these. emitted into a vesicle, where the differentiation of the The topology of the LSU rDNA based phylogenetic trees zoospores takes place, and the zoospores are released by of the Saprolegniaceae sensu lato is consistent with the topology rupture of the vesicle, while in Phytophthora the zoospores are of the phylogenetic tree based on sequences of ITS published fully differentiated in the sporangia within a boundary by Daugherty et al. (1998). In both studies a suppression of the plasmamembrane as seen in the Peronosporales. Several species flagella of the primary spores is seen during evolution of the of Phytophthora, e.g. the type species Phytophthora infestans, are family. But our trees include more species, and a new pattern dispersed aerially and show parallels to the species of emerges. The LSU based phylogenetic trees suggest several Peronosporales in the production of caducous sporangia and use Phylogeny of the Peronosporomycetes 1302 of direct germination via a germ-tube. Ecological differences on the manuscript, and for correcting the English text. This research was between Pythium and Phytophthora are well known. The supported by a grant from The Faculty of Science, University of Copenhagen, species of Pythium are saprobes in soil and water, and they are to A. B. Petersen. weak to moderate parasites (Waterhouse 1973). Species of Phytophthora are poor competitive saprotrophs but aggressive REFERENCES pathogens mainly on dicots, like the species found in Peronosporales (Waterhouse 1973). A key character used to Atkinson, G. F. (1909) Some problems in the evolution of the lower fungi. place Phytophthora together with Pythium in Pythiales is the Annales Mycologici 7: 441–472. Barr, D. J. S. (1981) The phylogenetic and taxonomic implications of flagellar nature of the exospore wall layer of the oospore (Dick 1969, rootlet morphology among zoosporic fungi. BioSystems 14: 359–70. Waterhouse 1973). In Peronosporales the mature oospore Barr, D. J. S. (1983) The zoosporic groupings of plant pathogens. Entity or contains a well-defined exposure wall layer derived from a non-entity? In Zoosporic Plant Pathogens. A modern perspective (S. T. persistent periplasm. In Pythium and Phytophthora a thin layer Buczacki, ed.): 43–83. Academic Press, London. of periplasm is present outside the membrane of the oospore, Barr, D. J. S. (1992) Evolution and kingdoms of organisms from the perspective Mycologia and this thin layer later disappears in some species. The LSU of a mycologist. 84: 1–11. Beakes, G. W. (1987) Oomycete phylogeny: ultrastructural perspectives. In rDNA based phylogenetic trees do not cluster Albugo and Evolutionary Biology of the Fungi (A. D. M. Rayner, C. M. Brasier & D. Peronospora together, but Albugo is placed on the most basal Moore, eds): 405–421. Cambridge University Press, Cambridge, UK. branch in the Peronosporomycetidae. In both genera a Bessey, E. A. (1942) Some problems in fungus phylogeny. Mycologia 34: conspicuous exospore wall layer is present. The LSU rDNA 355–379. based trees thus suggest that the exospore is not the key Bhattacharya, D. & Medlin, L. (1995) The phylogeny of plastids based on comparisons of small-subunit ribosomal RNA coding regions. Journal of character for uniting these organisms. Instead the exospore Phycology 31: 489–498. wall layer might represent a plesiomorph, shared with the Briard, M., Dutertre, M., Rouxel, F. & Brygoo, Y. (1995) Ribosomal RNA Rhipidiales, and reduced or lost at some of the internal sequence divergence within the Pythiaceae. Mycological Research 99: branches in the Peronosporomycetidae. 1119–1127. Lagenidium is a genus that has been placed differently by Coker, W. C. & Matthews, V. D. (1937) Saprolegniales. North American Flora Lagenidiaceae 2(1): 15–76. several authors. Sparrow (1960) placed it in in Crawford, A. R., Bassam, B. J., Dreth, A., Maclean, D. J. & Irwin, J. A. G. Lagenidiales together with the families Olpidiopsidaceae and (1996) Evolutionary relationships among Phytophthora species deduced Sirolpidiaceae based on their endobiotic, simple thalli with from rDNA sequence analysis. Mycological Research 100: 437–443. sexuality involving fusion of contents of two thalloid bodies. Daugherty, J., Evans, T. M., Skillom, T., Watson, L. E. & Money, N. P. (1998) Dick et al. (1984) transferred Lagenidiaceae to Pythiales, Evolution of spore release mechanisms in the Saprolegniaceae (Oomycetes): recognising the affinity between Pythium and Lagenidium. evidence from a phylogenetic analysis of internal transcribed spacer sequences. Fungal Genetics and Biology 24: 354–363. Lagenidium sensu stricto was later transferred to Pythiaceae (Dick de Rijk, P., van de Peer, Y. & de Wachter, R. (1997) Database on the structure 1995). In both genera zoosporogenesis by external cleavage of large ribosomal subunit RNA. Nucleic Acids Research 25: 117–122. in a vesicle is seen, and they share several traits in their Dick, M. W. (1969) Morphology and taxonomy of the Oomycetes, with special sexual reproduction. The trees based on maximum parsimony reference to Saprolegniaceae, Leptomitaceae and Pythiaceae. I. Sexual suggest that Pythium is basal to Lagenidium, but with bootstrap reproduction. New Phytologist 68: 751–775. Dick, M. W. (1971) Oospore structure in Aphanomyces. Mycologia 63: values below 50% (Fig. 1). The maximum likelihood tree (Fig. 686–688. 2) and the neighbour-joining tree suggest that Lagenidium Dick, M. W. (1973) Saprolegniales.InThe Fungi. An advanced treatise (G. C. evolved on a line basal to Pythium, but this is not well Ainsworth, F. K. Sparrow & A. S. Sussman, eds) 4A: 109–114. Academic supported by bootstrap values. Both trees suggest that the Press, New York. included species of Lagenidium should be placed in a separate Dick, M. W. (1988) Coevolution in the heterokont fungi (with emphasis on Coevolution of Plants and Lagenidiales the downy mildews and their angiosperm host). In order . Unfortunately the present data can not Animals (K. A. Pirozynski & D. L. Hawksworth, eds): 31–62. Academic resolve the phylogenetic placement of Lagenidium and Pythium. Press, London. Inclusion of sequences of a wide range of species of Dick, M. W. (1990) Phylum Oomycota.InHandbook of Protoctista (L. Margulis, Myzocytium, Myzocytiopsis and additional species of J. O. Corliss, M. Melkonian & D. Chapman, eds): 661–685. Jones & Bartlet, Lagenidium and Pythium might help to suggest a placement Boston. Peronosporomycetes of the genus Lagenidium. Dick, M. W. (1995) Sexual reproduction in the (chromistan fungi). Canadian Journal of Botany 73 (suppl. 1): S712–S724. Dick, M. W., Croft, B. J., Magarey, R. C., de Cock, A. W. A. M. & Clark, G. ACKNOWLEDGMENTS (1989) A new genus of the Verrucalvaceae (Oomycetes). Botanical Journal of the Linnean Society 99: 97–113. J. W. Taylor is acknowledged for his advice on sequencing and alignments of Dick, M. W., Vick, M. C., Gibbings, J. G., Hedderson, T. A. & Lopez Lastra, the LSU rDNA sequences. We wish to thank the following people for C. C. (1999) 18S rDNA for species of Leptolegnia and other Perono- supplying us with cultures: J. W. Taylor for the isolates of Lagenidium sporomycetes: justification for the subclass taxa Saprolegniomycetidae and chthamalophilum, Apodachlya minima and Apodachlya branchynema from U. C., Peronosporomycetidae and division of the Saprolegniaceae sensu lato into the Berkeley Microgarden, M. A. Tayseir for the culture of Isoachlya toruloides,K. Leptolegniaceae and Saprolegniaceae. Mycological Research 103: 1119–1125. Hatai for the culture of Aphanomyces piscicida,K.So$ derhall for the culture of Dick, M. W., Wong, P. T. W. & Clark, G. (1984) The identity of the oomycete Aphanomyces astaci, J. Hockenhull of the culture of Pythium aphanidermatum, causing ‘Kikuyu Yellows’, with a reclassification of the downy mildews. D. Sørensen for the cultures of Leptolegnia sp., B. D. Jensen for plants infected Botanical Journal Linnean Society 89: 171–197. with Peronospora farinosa and Peronosora parasitica, and Novo Nordisk A\S for Die! guez-Uribeondo, J., Cereneus, L. & So$ derha$ ll, K. (1994) Repeated zoospore the isolates of Lagenidium giganteum and Phytophthora infestans. We thank C. emergence in Saprolegnia parasitica. Mycological Research 98: 810–815. Hansen for technical help, and N. Daugbjerg for his advice on alignments and Dill, B. C. & Fuller, M. S. (1971) Amino acid immobilization of fungal motile maximum-likelihood analyses. M. W. Dick is acknowledged for his comments cells. Archiv fuW r Mikrobiologie 78: 92–98. A. B. Petersen and S. Rosendahl 1303

Domnas, A. J., Srebo, J. P. & Hicks, B. F. (1977) Sterol requirement for Nishida, H. & Sugiyama, J. (1994) Archiascomycetes: detection of a major new zoospore formation in the mosquito parasitizing fungus Lagenidium lineage within the Ascomycota. Mycoscience 35: 361–366. giganteum. Mycologia 69: 875–886. Nes, W. D. (1987). Biosynthesis and requirement for sterols in the growth and Farris, J. S. (1989) The retention of index and the rescaled consistency index. reproduction of Oomycetes.InEcology and Metabolism of Plant Lipids (G. Cladistics 5: 417–419. Fuller & W. D. Nes, eds): 305–328. [ACS Symposium Series No. 325.] Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the American Chemical Society, Washington, DC. bootstrap. Evolution 39: 666–670. Olson, L. W., Cerenius, L., Lange, L. & So$ derha$ ll, K. (1984) The primary and Fo$ rster, H., Coffey, M. D., Elwood, H. & Sogin, M. L. (1990) Sequence secondary spore cysts of Aphanomyces (Oomycetes, Saprolegniales). Nordic analysis of the small subunit ribosomal RNAs of three zoosporic fungi and Journal of Botany 4: 681–696. implications for fungal evolution. Mycologia 82: 306–312. Petersen, A. B., Olson, L. W. & Rosendahl, S. (1996) Use of polyclonal Fuller, M. S. & Jaworski, A. (1987) Zoosporic Fungi in Teaching and Research. antibodies to detect oospores of Aphanomyces. Mycological Research 100: Southeastern Publishing, Athens, GA. 495–499. Gotelli, D. & Hanson, L. C. (1987) An ultrastructural investigation of the Powell, M. J., Lehnen jr., L. P. & Bortnick, R. N. (1985) Microbody-like zoospore of Sapromyces androgynus (Oomycetes, Leptomitales). Mycologia 79: organelles as taxonomic markers among Oomycetes. BioSystems 18: 745–752. 321–334. Gunderson, J. L., Elwood, H., Ingold, A., Kindle, K. & Sogin, M. L. (1987) Powell, M. J. & Blackwell, W. H. (1995) Searching for homologous Phylogenetic relationships between chlorophytes, chrysophytes, and ultrastructural characters in zoosporic fungi. Canadian Journal of Botany 73 oomycetes. Proceedings of the National Academy of Sciences, USA 84: (suppl. 1): S693–S700. 5823–5827. Powell, M. J. & Blackwell, W. H. (1998) Phenetic analysis of the Saprolegniaceae Hibbit, D. S., Pine, E. M., Langer, E., Langer, G. & Donoghue, M. (1997) (Oomycetes). Mycotaxon 68: 505–516. Evolution of gilled mushrooms and puffballs inferred from ribosomal DNA Randolph, L. R. & Powell, M. (1992) Ultrastructure of zoospores of the sequences. Proceedings of the National Academy of Sciences, USA 94: oomycete Apodachlya pyrifera. Mycologia 84: 768–780. 12002–12006. Shaw, G. C. (1981) Taxonomy and evolution. In The Downy Mildews Hoch, H. C. & Mitchell, J. E. (1972) The ultrastructure of zoospores of (Spencer, D. M., ed.): 17–29. Academic Press, London. Aphanomyces euteiches and their encystment and subsequent germination. Sparrow, F. K. (1960) Aquatic Phycomycetes. 2nd edn. University of Michigan Protoplasma 75: 113–138. Press, Ann Arbor. Holloway, S. A. & Heath, I. B. (1977) An ultrastructural analysis of the changes Sparrow, F. K. (1976) The present status of classification in biflagellated fungi. in organelle arrangement and structure between the various sporetypes of In Recent Advances in Aquatic Mycology (E. B. G. Jones, ed.): 193–213. Elek Saprolegnia. Canadian Journal of Botany 55: 1328–1339. Science, London. Ho$ hnk, W. (1933) Polyplanetism and zoo$ spore germination in Saprolegniaceae Swan, E. C. & Taylor, J. W. (1993) Higher taxa of basidiomycetes: an 18S and Pythium. American Journal of Botany 20: 45–62. gene perspective. Mycologia 85: 923–936. Howard, F. L. (1971) Oospore types in Saprolegniaceae. Mycologia 63: Taylor, J. W. (1993) A contemporary view of the holomorph. Nucleic acid 679–686. sequences and computer databases and changing fungal classification. In Humphrey, J. E. (1893) The Saprolegniaceae of the United States, with special The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal notes on other species. Transactions of the American Philosophical Society, n.s. systematics (D. R. Reynolds & J. W. Taylor, eds): 3–15. CAB International, 17: 63–148. Wallingford. Jacobs, R. P. W. M. (1982) The genus Apodachlya. Antonie van Leeuwenhoek Traquair, J. A. & McKeen, W. E. (1980) Electron microscopy of developing 48: 389–399. Aphanomyces oogonia and oospores. Mycologia 72: 378–393. Klassen, G. R., McNabb, S. A., Whitmore, E., Gray, M. & Dick, M. W. (1988) van der Auwera, G., Chapelle & De Wachter, R. (1994) Structure of the large Restriction sites in ribosomal DNA as characters for the evolutionary study ribosomal subunit of Phytophthora megasperma, and phylogeny of the of zoosporic fungi. Abstracts, 16th International Congress of Genetics. Oomycetes. FEMS Letters 338: 133–136. Kluge, A. G. & Farris, J. S. (1969) quantitative phyletics and the evolution of van der Auwera, G., De Baere, R., van de Peer, Y., De Rijk, P., van den Broeck, anurans. Systematic Zoology 18: 1–32. I. & De Wachter, R. (1995) The phylogeny of the Hyphochytriomycota as Lee, S. B., Milgroom, M. G. & Taylor, J. T. (1988) A rapid, high yield mini- deduced from ribosomal RNA sequences of Hyphochytrium catenoides. prep method for isolation of total genomic DNA from fungi. Fungal Genetics Molecular Biology and Evolution 12: 671–678. and Biology 35: 23–24. Waterhouse, G. M. (1973) Peronosporales.InThe Fungi. An advanced treatise Lee, S. B. & Taylor, J. W. (1992) Phylogeny of five fungus-like protistian (G. C. Ainsworth, F. K. Sparrow & A. S. Sussman, eds) 4B: 165–183. Phytophthora species, inferred from the internal transcribed spacers of Academic Press, New York. ribosomal DNA. Molecular Biology and Evolution 9: 636–653. Weete, J. D. (1989) Structure and function of sterols in fungi. Advances in Lipid Money, N. P., Beakes, G. W., Webster, J. & Wakely, G. (1987) Rudimentary Research 23: 115–162. flagella in sporangiospores of Achlya. Transactions of the British Mycological Society 89: 108–114. Corresponding Editor: M. W. Dick