Expression, ERK Phosphorylation and WNT Signaling in EPHB6 Receptor
Total Page：16
File Type：pdf, Size：1020Kb
CANCER GENOMICS & PROTEOMICS 11 : 239-250 (2014) Modulation of Liver-Intestine Cadherin (Cadherin 17) Expression, ERK Phosphorylation and WNT Signaling in EPHB6 Receptor-expressing MDA-MB-231 Cells LOKESH BHUSHAN 1, NADIA TAVITIAN 1, DILIP DEY 1, ZOHRA TUMUR 2, CYRUS PARSA 3 and RAJ P. KANDPAL 1 Departments of 1Basic Medical Sciences, 2Dental Medicine and 3Pathology Western University of Health Science, Pomona, CA, U.S.A. Abstract. Aberrant expression of erythropoietin-producing inverse relationship between the levels of phospho-ERK and hepatocellular carcinoma cell (EPH) receptors has been the abundance of cadherin 17, β- catenin and phospho- reported in a variety of human cancer types. In addition to GSK3 β in EPHB6-expressing MDA-MB-231 cells. From modulating cell proliferation and migration, EPH receptors these data we conclude that EPHB6-mediated alterations are also involved in tumor progression. The transcriptional arise due to changes in abundance and localization of activation and silencing of EPH receptors are also cadherin 17 and activation of WNT signaling pathway. associated with tumorigenesis. However, the mechanisms Transcriptional silencing of EPHB6 in native MDA-MB-231 underlying the involvement of EPH receptors in cells and consequent effects on cadherin 17 and WNT tumorigenesis have not been completely deciphered. We have pathway may, thus, be responsible for the invasive behavior investigated and described the role of EPHB6, a kinase- of these cells. deficient receptor, in modulating the abundance of cadherin 17 and activation of other intracellular signaling proteins. Erythropoietin-producing hepatocellular carcinoma cell We previously showed that EPHB6 alters the tumor receptor B6 (EPHB6) is a member of the largest family of phenotype of breast carcinoma cells. However, the receptor tyrosine kinases (1, 2). EPHB6 and EPHA10 are the mechanisms underlying these phenotypic changes had not only kinase-deficient members of this family. These kinase- previously been investigated. Herein we demonstrated the deficient receptors are likely to transduce signals by downstream effects of EPHB6 expression on the abundance associating with other kinase-sufficient receptors (3).The of cadherin 17, mitogen-activated protein kinase (MEK2), modulation of cell attachment and cell migration by EPH extracellular signal-regulated kinase (ERK), phospho-ERK, receptors has been correlated to invasiveness of tumor cells β- catenin, phospho- glycogen synthase kinase 3 beta (4-6). The decrease in the expression of EPHB6 receptor has (GSK3 β) (ser21/9), cell morphology and actin cytoskeleton. been linked to aggressiveness and invasiveness in melanoma These comparisons were made between EPHB6-deficient (7), neuroblastoma (8) and non-small cell lung carcinoma MDA-MB-231 cells transfected with an empty pcDNA3 (9). The invasiveness of MDA-MB-231 cells has been vector and cells stably transfected with an expression attributed, in part, to loss of EPHB6 (10), and ectopic construct of EPHB6. The results indicate elevated levels of expression of EPHB6 has been shown to suppress in vitro MEK2 and phospho-ERK. While there was no change in the invasiveness of MDA-MB-231 cells (11). However, the amount of ERK, the abundance of cadherin 17, β- catenin mechanism by which EPHB6 receptor suppresses the and phospho-GSK3 β was significantly reduced in EPHB6- invasive phenotype of MDA-MB-231 cells remains unclear. transfected cells. These studies clearly demonstrate an In addition to transducing signals from the cell surface to the nucleus, EPH receptors also contribute to cell adhesion. Similarly, a superfamily of cell surface molecules, which contribute to cell adhesion and signal transduction, is Correspondence to: Raj Kandpal, Department of Basic Medical comprised of cadherins. Cadherins are transmembrane Sciences, Western University of Health Sciences, Pomona, CA 91766, U.S.A. Tel: +1 9097063520, e-mail: [email protected] receptors that mediate calcium-dependent homophilic or heterophilic adhesion between cells. Members of the Key Words: EPHB6 , cadherin 17, CDH17 , ERK, WNT, β- catenin, cadherin superfamily include classical cadherins, GSK3 β, breast carcinoma. desmosomal cadherins, protocadherins and products of 1109 -6535 /2014 239 CANCER GENOMICS & PROTEOMICS 11 : 239-250 (2014) tumor-suppressor genes such as c-rearranged during catenin and phosphorylated glycogen synthase kinase 3 beta transfection ( RET ) gene and FAT (12). Classical cadherins (GSK3 β). We discussed these molecular changes in the enable adhesion between cells, maintain cell polarity and context of morphological and cytoskeletal rearrangements in preserve tissue integrity (13). Cadherins are linked with the native and EPHB6-expressing MDA-MB-231 cells. Our actin cytoskeleton via α, β, and γ isoforms of cytoplasmic studies suggest that EPHB6 down-regulates the levels of catenins (14-16), and facilitate a variety of molecular cadherin 17, and possibly also alters its cellular localization. changes during cell development and morphogenesis (17, 18). Aberrant expression of cadherins has been associated Materials and Methods with a variety of tumors (19, 20), and oncogenic properties of some cadherins have been confirmed (21, 22). Altered Cell culture. MCF10A, MCF7, BT20, MDA-MB-435, and MDA- expression of cadherin 17, in particular, has been implicated MB-468 cells were grown as described previously (10, 11). Native in several types of cancers (21, 23), and it has also been MDA-MB-231 cells transfected with pcDNA3 vector and EPHB6- considered a useful marker for gastrointestinal carcinomas transfected MDA-MB-231 cells (11) were cultured at 37˚C/7% CO 2 in Dulbecco’s modified eagle’s medium (DMEM) supplemented (24). The association of cadherin 17 expression with caudal- with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml type homeobox protein 2 (CDX2) transcription factor in PenStrep, and 10% fetal bovine serum (all Life Technologies, Grand ovarian cancer (23), and epidermal growth factor receptor Island, NY, USA). and nuclear factor kappa-light-chain-enhancer of activated B cells (NF- κB) signaling proteins in gastric cancer (21, 25) Total RNA isolation and reverse transcription polymerase chain suggests important roles of cadherin 17 in signal reaction (RT PCR). Cells were grown until 85-95% confluence in 25- transduction. Although EPH receptors and cadherins have mm cell culture flasks. RNA was isolated from various cell lines using TRI reagent (Molecular Research Center, Cincinnati, OH, been investigated extensively, detailed investigations of USA) according to the manufacturer’s protocol. The amount of RNA interactions between these two families of cell surface was determined by NanoDrop (Thermo Scientific, Waltham, MA, molecules have not been performed. Some recent USA), and its purity checked by determining the ratio of absorbance investigations, however, demonstrate modulation of signal at 260 nm and 280 nm. The RNA preparation was treated with transduction by cadherin and EPH receptor (26, 27). RNase-free DNase and 1.5 μg RNA was reverse transcribed with The altered regulation of various EPH receptors has been oligo dT using the Superscript III First-Strand RNA synthesis kit observed in a variety of cancer types (28). However, the (Life Technologies) according to the manufacturer’s protocol. The abundance of cadherin 17 ( CDH17 ) transcript was quantified by PCR downstream intracellular effector molecules have not been using 5’ACAATCGACCCACGTTTCTC3’ and characterized completely. Some EPH receptor signaling 5’ATATTGTGCACCGGGATCAT3’ oligonucleotides (Integrated events include EPHB4 dependent modulation of estrogen DNA Technologies, Inc., Coralville, IA, USA) as forward and receptor-alpha in breast cancer (29), activation of reverse primers, respectively. The reaction mixture (20 μl) containing mammalian target of rapamycin complex 1 and extracellular- 10 ng cDNA, 6.0 pmol each of forward and reverse primers, 4.0 regulated kinase pathways by EPHA2 (30), interaction of nmol dATP, dCTP, dGTP and dTTP, 0.4 units Taq DNA polymerase EPHB1 receptor with tumor-suppressor phosphatase and and 1X reaction buffer was amplified for 35 cycles of denaturation at 95˚C for 1 min, annealing at 65˚C for 1 min and extension at 72˚C tensin homolog (31), and EPHB3-mediated suppression of for 1 min. The amplified product was separated by electrophoresis metastasis via protein phosphatase 2(PP2A)/RAC/AKT on a 1% agarose gel and visualized by staining with ethidium signaling pathway in non-small cell lung carcinoma (32). bromide. PCR amplifications were also carried out with primers Morphological changes mediated by EPH have been corresponding to housekeeping gene β-actin transcript to normalize characterized by co-localization of EPHA2 and integrin α3 the amounts of cDNA templates used from various cell lines. at cell edges and protrusions in a glioblastoma cell line (33). The modulation of cell proliferation, migration and apoptosis Western blotting. MDA-MB-231 cells, stably transfected with an EPHB6 construct (MDA-MB-231-EPHB6) or an empty pcDNA3 has been attributed to specific activation of EPH receptors vector (MDA-MB-231-pCDNA), were grown in DMEM to 85-90% by their cognate ephrin ligands (34-39). Given the diversity confluence. The culture medium was aspirated and the dish washed of intracellular proteins affected by EPH receptors, it is not with 3 ml of ice-cold phosphate buffered saline (PBS). Cells were surprising that EPHB4 has been designated as both a tumor lysed by