DOCSLIB.ORG

Supplementary Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Information PHF5A Epigenetically Inhibits Apoptosis to Promote Breast Cancer Progression Yi-Zi Zheng,1,2 Meng-Zhu Xue,4 Hong-Jie Shen,3 Xiao-Guang Li,1 Ding Ma,1,2 Yue Gong,1,2 Yi-Rong Liu,1,2 Feng Qiao,1 Hong-Yan Xie,1,2 Bi Lian,1,2 Hai-Yun Zhao,1,2 Ling Yao,1 Wen-Jia Zuo,1,2 Da-Qiang Li,1 Peng Wang,4 Xin Hu,1,2 and Zhi-Ming Shao,1,2 Note: 6 Supplementary figures and 8 Supplementary tables. Fig. S1. RNA-seq based RBP Library construction and CRISPR screen reveals RBP hits related to tumor growth and metastasis. Fig. S2. PHF5A is frequently up-regulated in breast cancer, associated with poor clinical outcome, and essential for cancer cell proliferation and migration. Fig. S3. PHF5A associates with the U2 snRNP complex and regulates complex stability. Fig. S4. PHF5A globally regulates splicing. Fig. S5. The PHD-like domain in PHF5A is required for its association with Histone H3. Fig. S6 PHF5A regulates FASTK splicing to antagonize apoptotic signaling in breast cancer cells. Table S1. Clinicopathologic Variables in 40 Cases of TNBC Patients. Table S2. Primers Used in RT-PCR and qPCR Analyses. Table S3. Gene List of a Census of 1,542 Manually Curated RBPs and 159 Library Contained RBPs. Table S4. sgRNA Sequence of Genes in RBP library. Table S5. RIGER Ranking of Screen Hits. Table S6. Correlation between Clinicopathologic Variables and Expression of PHF5A in 373 Cases of Breast Cancer. Table S7. Univariate and Multivariate Analysis of DFS. Table S8. Univariate and Multivariate Analysis of DFS in TNBC Subgroup. Fig. S1. RNA-seq based RBP Library construction and CRISPR screen reveals RBP hits related to tumor growth and metastasis (A) GFP-luciferase labeled DCIS and CA1a cells were transplanted subcutaneously (n = 9) or injected via the tail veins (n = 6) into NOD/SCID mice. The resulting subcutaneous tumors and lung metastases were monitored by bioluminescence imaging on day 28. Images of representative mice are shown. (B) Representative H&E staining of subcutaneous tumors (scale bar, 20 µm) or lung metastases (scale bar, 40 µm). (C) Xenograft tumor induced by DCIS and CA1a cells are shown (n = 9). (D) Western blot analyses of ER, PR and HER2 protein expression in MCF10 sublines. (E) Hierarchical clustering of DCIS and CA1a with 1,901 TCGA breast tumor samples analyzed using a breast cancer intrinsic gene list. The color bars under the dendrogram indicate (i) where DCIS (orange) and CA1a (green) specimens are clustered and (ii) the PAM50 subtype of each sample (basal-like, red; HER2-enriched, pink; luminal A, dark blue; luminal B, light blue; and normal-like, grey). (F) Diagrams of 26 RBP expression patterns. For each diagram, the vertical axis represents expression level, and the four inflection points on the horizontal axis sequentially represent MCF10A, MCF10AT, DCIS and CA1a cells. The numbers on the top left corner represent the pattern number, and the numbers on the bottom left corner represent the number of genes classified into that pattern. (G) Western blot analyses of Cas9 expression in DCIS and CA1a cells. Cells were transduced with the lentiCas9-Blast virus either at a low MOI (MOI < 0.3) or at a high MOI (MOI > 1). (H) The growth of xenograft tumors and lung metastases was monitored by bioluminescence imaging on day 28, and pictures of representative mice are shown. (I) Pictures of the subcutaneous tumors removed after 4 weeks (n = 3). (J) Representative H&E staining of subcutaneous tumors or lung metastases from NOD/SCID mice using DCIS or CA1a cell lines transduced with the RBP library. Scale bar, 100 µm. (K) Weight of subcutaneous tumors (left) after dissection. Number of lung metastases (right) visible after dissection. Individual data points are represented. (n = 3, ***p < 0.001 ; Student’s t-test). (L) Cumulative probability distribution of sgRNAs in each experimental group. Distributions for each sample type are averaged across individual mice and infection replications. Fig. S2. PHF5A is frequently up-regulated in breast cancer, associated with poor clinical outcome, and essential for cancer cell proliferation and migration (A) Cumulative DFS curves of patients with high or low levels of PHF5A protein expression. Data are shown for luminal-like and HER2-positive breast cancers. (B) Representative images of PHF5A IHC staining in normal breast tissue. Scale bar, 100 µm (left) and 50 µm (right). (C) Kaplan–Meier analysis of luminal-A, luminal-B and HER2-positive breast cancers using the Kaplan–Meier-plotter database. (D) Significant correlation between PHF5A expression and basal type of breast cancer in both METABRIC (n = 1,986) and TCGA (n = 766) data sets; *** p < 0.001; Student t-test. (E) Western blot analyses of CRISPR-mediated knockdown of PHF5A in DCIS, MCF10A, MCF7, T-47D cells. Control sgRNA and mock were included as negative controls. (F) Cell proliferation assay of DCIS, MCF10A, MCF7 and T-47D cells. (G) Picture of wound healing assay described in Fig. 2K and Supplementary Fig. S2H. (H) Wound healing assay of DCIS cells. (I) Transwell migration assay of DCIS cells. (J) Xenograft tumor growth induced by DCIS cells was measured, and images of the removed tumors are shown (n = 8). In J, the data are represented as the means ± SEMs, whereas in F, H and I, individual data points are presented (n = 3). Student’s t-test; ***p < 0.001, **p < 0.01, *p < 0.05. Fig. S3. PHF5A associates with the U2 snRNP complex and regulates complex stability (A) qPCR analysis of PHF5A, SF3B1, SF3B2, SF3B3 and U2AF1 mRNA levels in HMECs and MCF10 sublines. (B) qPCR analyses of SF3B1, SF3B2, SF3B3, U2AF1 and PHF5A mRNA level in control and PHF5A-knockdown cells. For A and B, individual data points are represented (n = 3, **p < 0.01; Student’s t-test). Fig. S4. PHF5A globally regulates splicing (A) PSI profiles of the MXE, A3SS or A5SS events identified in control and PHF5A knockdown cells. The colored dots represent significantly up-regulated (red) or down-regulated (blue) AS events in PHF5A knockdown cells compared to control cells. Fig. S5. The PHD-like domain in PHF5A is required for its association with Histone H3 (A) Schematic diagram showing the SF3b subunits, including specific subunit domains. (B) Heatmap of ChIP-Seq signals of PHF5A, H3K4me3, H3K36me3 and SF3B3 in CA1a cells with exogenous PHF5A expression, ranked by PHF5A ChIP-seq signals. All ChIP-seq signals are displayed from -3 kb to +3 kb surrounding the region from the TSS to the TES. Fig. S6 PHF5A regulates FASTK splicing to antagonize apoptotic signaling in breast cancer cells (A) Venn diagram showing overlap of PHF5A-regulated genes in RNA-Seq and PHF5A-occupied genes in ChIP-Seq. (B) Bar graphs showing the relative fold change of ChIP-qPCR results in CA1a cells. (C) Western blot analysis showing the expression of SF3B1, SF3B2 and SF3B3 proteins in the CA1a cells described in Fig. 6A. (D) Schematic diagrams of two FASTK transcripts (FASTK-L and FASTK-S). The detailed mRNA and encoded protein sequences are shown to indicate the specific site in which the protein is truncated. The letters in red in the FASTK-S sequence indicate the differences from the FASTK-L sequence. (E) The alternative splice products, intron 5-containing FASTK-S (upper) and full-length transcript FASTK-L (lower), are shown by Sanger sequencing of the RT-PCR products. The primers used for sequencing are indicated by arrows. Table S1. Clinicopathologic Variables in 40 Cases of TNBC Patients Variables Number of patients Total 40 Age ≤50 years 16 ＞50years 24 Menopausal status Premenopause 15 Postmenopause 25 Tumor size ≤2cm 19 ＞2, 5≤cm 20 ＞5cm 1 Lymph node status Negative 25 Positive 15 Grade 1 or 2 3 3 32 Unknown 5 Histological type Invasive ductal carcinoma 37 Metaplastic carcinoma 2 Others 1 ER status Negative 40 Positive 0 PR status Negative 40 Positive 0 HER-2/neu status Negative 40 Positive 0 Abbreviations: ER, estrogen receptor; HER-2, human epidermal growth factor receptor 2; PR, progesterone receptor Table S2. Primers Used in RT-PCR and qPCR Analyses Gene Forward Primer 5’-3’ Reverse Primer 5’-3’ LETMD1 CTTTGGCAAAGCTGGGGATT CCGCTCCATGGTTCATTCAG PLSCR1 CAGGAAACGAAACCAGGAGC TCCGGGTGAGAAGCATTCAT POLDIP3 TGCCTTCATAAACCCACCCA CATGTGGTGGAGAAAGCCG RPL24 AGTCAAATTCCAGAGGGCCA TAGCGTTTTCCACCAACTCG ZCCHC10 TGCTTGGAATTTGGACATTGG ACTGCTACTGGAACTGGTTAC RT-PCR FASTK CATCTTGATGTCACTGTGCCA CAGCAGGGAGAGGTAGCG MAEA ACTACCGACTACACCAGCTG GCAGGGTCAGCGTGTTAAAA CTGATCCAGCAGTTCCGGTA TCGCCAGAAATCTTGCAGAC BUD3 AACACGAACTTAGCTTGGCC GATGGGTTCAGACTTACACCA AGGAGTCTTTGTGTCCCTGTA TCAAGGGTTCTGCATCTCGT FBXO32 ACTGGACTTCTCAACTGCCA GGATGTGTAGAGGGTCTGGAG FASTK CAGCAGGGAGAGGTAGCG CATCCTGGCTGCGTACCA GAACTACCTGCCCCTGGAAC TGGCACAGTGACATCAAGAT SF3B1 AGCGGAAGTTCTTGGGAGCG AGAGCTGCCTTCTTGCCTTG qPCR SF3B2 CCGATCCAGGGTAATCGCGA AAAACCGGCCGATTCAGCAC SF3B3 GACCGTGGCTTGCTCAATGG CCAGGGATCAGCGTGGTCTT U2AF1 ACGTCAAGTTTCGCCGTGAG TCCCATCTCATACTGACGGCA FASTK CCTTCCACGCCTTTGAAACA AGCCCTGCCTACTCTTCATG MAEA GGTTCTGTGTTGCCTTCCTG CAACCTGGCCATACTGCATC LETMD1 CCAGTGGCATAAGAACTCGC AGACTAAGTGCGGAAGGAGG ChIP-qPCR PLSCR1 TTCGAATGGTTCTGGGGTGA CTGGAAGTGGAGCAGGTACA POLDIP3 CAATCTCCTGCCCAACACAC AGTGGTAGAGTGACTTGCCC ZCCHC10 CTGAAGGTTTACGTCGGCTG ACAACTGTCGCGTTTGGTTT RPL24 CCATGCCCAGCCTCATTTTA TCTTTGCGATGTTGCCCAAT Table S3.
Recommended publications
  • University of California, San Diego

    University of California, San Diego

    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids

    Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids

    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
  • Translational Control in Cancer Etiology

    Translational Control in Cancer Etiology

    Downloaded from http://cshperspectives.cshlp.org/ on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Translational Control in Cancer Etiology Davide Ruggero Helen Diller Cancer Center, School of Medicine, University of California, San Francisco, California 94158 Correspondence: [email protected] The link between perturbations in translational control and cancer etiology is becoming a primary focus in cancer research. It has now been established that genetic alterations in several components of the translational apparatus underlie spontaneous cancers as well as an entire class of inherited syndromes known as “ribosomopathies” associated with in- creased cancer susceptibility. These discoveries have illuminated the importance of dereg- ulations in translational control to very specific cellular processes that contribute to cancer etiology. In addition, a growing body of evidence supports the view that deregulation of translational control is a common mechanism by which diverse oncogenic pathways promote cellular transformation and tumor development. Indeed, activation of these key oncogenic pathways induces rapid and dramatic translational reprogramming both by in- creasing overall protein synthesis and by modulating specific mRNA networks. These trans- lational changes promote cellular transformation, impacting almost every phase of tumor development. This paradigm represents a new frontier in the multihit model of cancer for- mation and offers significant promise for innovative cancer therapies. Current research,
  • Effects of Chromosome Specific Introgression in Upland Cotton on Fiber and Agronomic Traits

    Effects of Chromosome Specific Introgression in Upland Cotton on Fiber and Agronomic Traits

    Genetics: Published Articles Ahead of Print, published on December 30, 2005 as 10.1534/genetics.105.053371 1 Effects of Chromosome Specific Introgression in Upland Cotton on Fiber and Agronomic Traits * 1 * † * Sukumar Saha, Johnie N. Jenkins, Jixiang Wu, Jack C. McCarty, * ‡ § †† Osman A. Gutiérrez, Richard G. Percy, Roy G. Cantrell, and David M. Stelly *United States Department of Agriculture-Agriculture Research Service, Crop Science Research † Laboratory, Mississippi State, Mississippi 39762, Department of Plant and Soil Sciences, ‡ Mississippi State University, Mississippi State, Mississippi 39762, United States Department of Agriculture-Agriculture Research Service, Maricopa Agricultural Center, Maricopa, Arizona § †† 85239, Cotton Incorporated, Raleigh, North Carolina 27513, and Department of Soil and Crop Sciences, Texas A&M University, College Station, Texas 77843 Disclaimer: Mention of trademark or proprietary product does not constitute a guarantee or warranty of the product by the United States Department of Agriculture and does not imply its approval to the exclusion of other products that may also be suitable. 2 Running head: Evaluation of fiber and agronomic traits using chromosome substitution lines Key words: Chromosome substitution, Cotton, QTL, Germplasm, Mapping 1 Corresponding author: United States Department of Agriculture-Agriculture Research Service, Crop Science Research Laboratory, 810 Highway 12 East, Mississippi State, Mississippi 39762- 5367. E-mail: [email protected] 3 ABSTRACT Interspecific chromosome substitution is among the most powerful means of introgression and steps toward quantitative trait locus (QTL) identification. By reducing the genetic “noise” from other chromosomes, it greatly empowers the detection of genetic effects by specific chromosomes on quantitative traits. Here, we report on such results for 14 cotton lines (CS-B) with specific chromosomes or chromosome arms from G.
  • Structural Characterization of the Human Eukaryotic Initiation Factor 3 Protein Complex by Mass Spectrometry*□S

    Structural Characterization of the Human Eukaryotic Initiation Factor 3 Protein Complex by Mass Spectrometry*□S

    Supplemental Material can be found at: http://www.mcponline.org/cgi/content/full/M600399-MCP200 /DC1 Research Structural Characterization of the Human Eukaryotic Initiation Factor 3 Protein Complex by Mass Spectrometry*□S Eugen Damoc‡, Christopher S. Fraser§, Min Zhou¶, Hortense Videler¶, Greg L. Mayeurʈ, John W. B. Hersheyʈ, Jennifer A. Doudna§, Carol V. Robinson¶**, and Julie A. Leary‡ ‡‡ Protein synthesis in mammalian cells requires initiation The initiation phase of eukaryotic protein synthesis involves factor eIF3, an ϳ800-kDa protein complex that plays a formation of an 80 S ribosomal complex containing the initi- Downloaded from central role in binding of initiator methionyl-tRNA and ator methionyl-tRNAi bound to the initiation codon in the mRNA to the 40 S ribosomal subunit to form the 48 S mRNA. This is a multistep process promoted by proteins initiation complex. The eIF3 complex also prevents pre- called eukaryotic initiation factors (eIFs).1 Currently at least 12 mature association of the 40 and 60 S ribosomal subunits eIFs, composed of at least 29 distinct subunits, have been and interacts with other initiation factors involved in start identified (1). Mammalian eIF3, the largest initiation factor, is a codon selection. The molecular mechanisms by which multisubunit complex with an apparent molecular mass of www.mcponline.org eIF3 exerts these functions are poorly understood. Since ϳ800 kDa. This protein complex plays an essential role in its initial characterization in the 1970s, the exact size, translation by binding directly to the 40 S ribosomal subunit composition, and post-translational modifications of and promoting formation of the 43 S preinitiation complex ⅐ ⅐ mammalian eIF3 have not been rigorously determined.
  • Supplementary Table 1. Primer Sequences Used in RT-PCR Analysis

    Supplementary Table 1. Primer Sequences Used in RT-PCR Analysis

    Supplementary Table 1. Primer sequences used in RT-PCR analysis L32 Forward TGAAGCAGGCATCTGAGGG Reverse CGAAGGTGGAAGAG TGGGAG LIFR Forward CTCTCAGGCCAGAGTTGAGC Reverse GCTGTTCAGTCAGCCCTCTC CCR2 Forward TGTCTTCCCTGAATTGAGCC Reverse AAACGCATTAGTGGACAGGG IL12R Forward CGCAATACGTCGTGCGCTGC Reverse CACTCTGACTCCCACGCGCC CSF1R Forward GCTGGTGCGGATTCGAGGGG Reverse TTCGGCGTTAGTGGCCGAGC TGFbR1 Forward ACGCGCTGACATCTATGCAA Reverse CGTCGAGCAATTTCCCAGAA TGFbR2 Forward GCGCATCGCCAGCACGATCC Reverse TGGGCTTCCATTTCCACATCCGA CXCR1 Forward TCCTCCTGCCGCTGCTCACT Reverse CATGCGCAGTGTGAGCCCGT CXCR2 Forward CCTCGTGCCGCTGCTCATCA Reverse GGTGCGCAGTGTGAACCCGT CXCR3 Forward GGTCGCACTGCTCTGCGTGT Reverse GGGGCAGCAGGAAACCAGCC CXCR4 Forward GAGGCGTTTGGTGCTCCGGT Reverse TCGGTTCCATGGCAACACTCGC VEGFR1 (Flt1) Forward CGCGTGAAGAGTGGGTCCT Reverse CACATGCACGGAGGTGTTG VEGFR2 (Flk1) Forward AGCCCAGACTGTGTCCCGCA Reverse GGTGTCCGCGGAATCGGGTC VEGFR3 (Flt4) Forward GCCCGAGGACGAGGGTGACT Reverse CCTGGCTGCGCCTATCCTGC human Flt1 Forward GCACGTCAGCGAAGGCAAGC Reverse CCAGCTCAGCGTGGTCGTAGG Supplementary Table 2. List of putative miR-200 target genes amplified in human cancers amplified in cancers (Tumorscape)a Gene Symbol Title various cancers NSCLC PCT Errfi1 ERBB receptor feedback inhibitor 1 - yes 0.94 D11Bwg0517e DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed - yes 0.91 Pvrl4 poliovirus receptor-related 4 yes - 0.91 Mecp2 methyl CpG binding protein 2 yes yes 0.9 Jun Jun oncogene yes - 0.88 Prdm16 PR domain containing 16 - yes 0.88 Flt1 FMS-like tyrosine kinase 1 yes
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Dramatic Nucleolar Dispersion in the Salivary Gland of Schwenkfeldina Sp

    Dramatic Nucleolar Dispersion in the Salivary Gland of Schwenkfeldina Sp

    www.nature.com/scientificreports OPEN Dramatic nucleolar dispersion in the salivary gland of Schwenkfeldina sp. (Diptera: Sciaridae) José Mariano Amabis & Eduardo Gorab * Micronucleoli are among the structures composing the peculiar scenario of the nucleolus in salivary gland nuclei of dipterans representative of Sciaridae. Micronucleolar bodies contain ribosomal DNA and RNA, are transcriptionally active and may appear free in the nucleoplasm or associated with specifc chromosome regions in salivary gland nuclei. This report deals with an extreme case of nucleolar fragmentation/dispersion detected in the salivary gland of Schwenkfeldina sp. Such a phenomenon in this species was found to be restricted to cell types undergoing polyteny and seems to be diferentially controlled according to the cell type. Furthermore, transcriptional activity was detected in virtually all the micronucleolar bodies generated in the salivary gland. The relative proportion of the rDNA in polytene and diploid tissues showed that rDNA under-replication did not occur in polytene nuclei suggesting that the nucleolar and concomitant rDNA dispersion in Schwenkfeldina sp. may refect a previously hypothesised process in order to counterbalance the rDNA loss due to the under-replication. The chromosomal distribution of epigenetic markers for the heterochromatin agreed with early cytological observations in this species suggesting that heterochromatin is spread throughout the chromosome length of Schwenkfeldina sp. A comparison made with results from another sciarid species argues for a role played by the heterochromatin in the establishment of the rDNA topology in polytene nuclei of Sciaridae. Transcriptional activity of ribosomal RNA (rRNA) genes in specifc chromosome regions is the primary event for the local assembly of the nucleolus, the starting site of ribosome biogenesis.
  • RNA-Binding Proteins in Human Oogenesis: Balancing Differentiation and Self-Renewal in the Female Fetal Germline

    RNA-Binding Proteins in Human Oogenesis: Balancing Differentiation and Self-Renewal in the Female Fetal Germline

    Stem Cell Research 21 (2017) 193–201 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr RNA-binding proteins in human oogenesis: Balancing differentiation and self-renewal in the female fetal germline Roseanne Rosario a, Andrew J. Childs b, Richard A. Anderson a,⁎ a MRC Centre for Reproductive Health, Queen's Medical Research Institute, University of Edinburgh, 47 Little France Crescent, Edinburgh EH16 4TJ, UK b Department of Comparative Biomedical Sciences, The Royal Veterinary College, London NW1 0TU, UK article info abstract Article history: Primordial germ cells undergo three significant processes on their path to becoming primary oocytes: the initia- Received 7 October 2016 tion of meiosis, the formation and breakdown of germ cell nests, and the assembly of single oocytes into primor- Received in revised form 29 March 2017 dial follicles. However at the onset of meiosis, the germ cell becomes transcriptionally silenced. Consequently Accepted 13 April 2017 translational control of pre-stored mRNAs plays a central role in coordinating gene expression throughout the re- Available online 18 April 2017 mainder of oogenesis; RNA binding proteins are key to this regulation. In this review we examine the role of ex- Keywords: emplars of such proteins, namely LIN28, DAZL, BOLL and FMRP, and highlight how their roles during germ cell Germ cell differentiation development are critical to oogenesis and the establishment of the primordial follicle pool. RNA binding proteins © 2017 The Authors.
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
  • Manuscript for Proximity Interactome Analysis of Lassa

    Manuscript for Proximity Interactome Analysis of Lassa

    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.16.452739; this version posted July 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Main Manuscript for 2 Proximity interactome analysis of Lassa polymerase reveals 3 eRF3a/GSPT1 as a druggable target for host directed antivirals. 4 Jingru Fang1,2, Colette Pietzsch3,4, George Tsaprailis5, Gogce Crynen5, Kelvin Frank Cho6, Alice 5 Y. Ting7,8, Alexander Bukreyev3,4,9, Erica Ollmann Saphire2* and Juan Carlos de la Torre1* 6 1 Department of Immunology and Microbiology, Scripps Research, La Jolla CA 92037 7 2La Jolla Institute for Immunology, La Jolla CA 92037 8 3Department of Pathology, University of Texas Medical Branch, Galveston, TX 77550 9 4Galveston National Laboratory, University of Texas Medical Branch, Galveston, TX 77550 10 5Proteomics Core, Scripps Research, Jupiter, FL 33458 11 6Cancer Biology Program, Stanford University, Stanford, CA 94305 12 7Department of Genetics, Department of Biology and Department of Chemistry, Stanford 13 University, Stanford, CA 94305 14 8Chan Zuckerberg Biohub, San Francisco, CA 94158 15 9Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, 16 TX 77550 17 *Erica Ollmann Saphire; Juan Carlos de la Torre. 18 Email: [email protected] and [email protected] 19 Author Contributions: J.F., E.O.S., and J.C.T designed research; J.F. performed all non-BSL4 20 experiments and analyzed data; C.P.
  • Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6

    Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6

    Research Collection Doctoral Thesis Crystal structure of the eukaryotic 60S ribosomal subunit in complex with initiation factor 6 Author(s): Voigts-Hoffmann, Felix Publication Date: 2012 Permanent Link: https://doi.org/10.3929/ethz-a-007303759 Rights / License: In Copyright - Non-Commercial Use Permitted This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library ETH Zurich Dissertation No. 20189 Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6 A dissertation submitted to ETH ZÜRICH for the degree of Doctor of Sciences (Dr. sc. ETH Zurich) presented by Felix Voigts-Hoffmann MSc Molecular Biotechnology, Universität Heidelberg born April 11, 1981 citizen of Göttingen, Germany accepted on recommendation of Prof. Dr. Nenad Ban (Examiner) Prof. Dr. Raimund Dutzler (Co-examiner) Prof. Dr. Rudolf Glockshuber (Co-examiner) 2012 blank page ii Summary Ribosomes are large complexes of several ribosomal RNAs and dozens of proteins, which catalyze the synthesis of proteins according to the sequence encoded in messenger RNA. Over the last decade, prokaryotic ribosome structures have provided the basis for a mechanistic understanding of protein synthesis. While the core functional centers are conserved in all kingdoms, eukaryotic ribosomes are much larger than archaeal or bacterial ribosomes. Eukaryotic ribosomal rRNA and proteins contain extensions or insertions to the prokaryotic core, and many eukaryotic proteins do not have prokaryotic counterparts. Furthermore, translation regulation and ribosome biogenesis is much more complex in eukaryotes, and defects in components of the translation machinery are associated with human diseases and cancer.