Supplementary Information PHF5A Epigenetically Inhibits Apoptosis to Promote Breast Cancer Progression Yi-Zi Zheng,1,2 Meng-Zhu Xue,4 Hong-Jie Shen,3 Xiao-Guang Li,1 Ding Ma,1,2 Yue Gong,1,2 Yi-Rong Liu,1,2 Feng Qiao,1 Hong-Yan Xie,1,2 Bi Lian,1,2 Hai-Yun Zhao,1,2 Ling Yao,1 Wen-Jia Zuo,1,2 Da-Qiang Li,1 Peng Wang,4 Xin Hu,1,2 and Zhi-Ming Shao,1,2 Note: 6 Supplementary figures and 8 Supplementary tables. Fig. S1. RNA-seq based RBP Library construction and CRISPR screen reveals RBP hits related to tumor growth and metastasis. Fig. S2. PHF5A is frequently up-regulated in breast cancer, associated with poor clinical outcome, and essential for cancer cell proliferation and migration. Fig. S3. PHF5A associates with the U2 snRNP complex and regulates complex stability. Fig. S4. PHF5A globally regulates splicing. Fig. S5. The PHD-like domain in PHF5A is required for its association with Histone H3. Fig. S6 PHF5A regulates FASTK splicing to antagonize apoptotic signaling in breast cancer cells. Table S1. Clinicopathologic Variables in 40 Cases of TNBC Patients. Table S2. Primers Used in RT-PCR and qPCR Analyses. Table S3. Gene List of a Census of 1,542 Manually Curated RBPs and 159 Library Contained RBPs. Table S4. sgRNA Sequence of Genes in RBP library. Table S5. RIGER Ranking of Screen Hits. Table S6. Correlation between Clinicopathologic Variables and Expression of PHF5A in 373 Cases of Breast Cancer. Table S7. Univariate and Multivariate Analysis of DFS. Table S8. Univariate and Multivariate Analysis of DFS in TNBC Subgroup. Fig. S1. RNA-seq based RBP Library construction and CRISPR screen reveals RBP hits related to tumor growth and metastasis (A) GFP-luciferase labeled DCIS and CA1a cells were transplanted subcutaneously (n = 9) or injected via the tail veins (n = 6) into NOD/SCID mice. The resulting subcutaneous tumors and lung metastases were monitored by bioluminescence imaging on day 28. Images of representative mice are shown. (B) Representative H&E staining of subcutaneous tumors (scale bar, 20 µm) or lung metastases (scale bar, 40 µm). (C) Xenograft tumor induced by DCIS and CA1a cells are shown (n = 9). (D) Western blot analyses of ER, PR and HER2 protein expression in MCF10 sublines. (E) Hierarchical clustering of DCIS and CA1a with 1,901 TCGA breast tumor samples analyzed using a breast cancer intrinsic gene list. The color bars under the dendrogram indicate (i) where DCIS (orange) and CA1a (green) specimens are clustered and (ii) the PAM50 subtype of each sample (basal-like, red; HER2-enriched, pink; luminal A, dark blue; luminal B, light blue; and normal-like, grey). (F) Diagrams of 26 RBP expression patterns. For each diagram, the vertical axis represents expression level, and the four inflection points on the horizontal axis sequentially represent MCF10A, MCF10AT, DCIS and CA1a cells. The numbers on the top left corner represent the pattern number, and the numbers on the bottom left corner represent the number of genes classified into that pattern. (G) Western blot analyses of Cas9 expression in DCIS and CA1a cells. Cells were transduced with the lentiCas9-Blast virus either at a low MOI (MOI < 0.3) or at a high MOI (MOI > 1). (H) The growth of xenograft tumors and lung metastases was monitored by bioluminescence imaging on day 28, and pictures of representative mice are shown. (I) Pictures of the subcutaneous tumors removed after 4 weeks (n = 3). (J) Representative H&E staining of subcutaneous tumors or lung metastases from NOD/SCID mice using DCIS or CA1a cell lines transduced with the RBP library. Scale bar, 100 µm. (K) Weight of subcutaneous tumors (left) after dissection. Number of lung metastases (right) visible after dissection. Individual data points are represented. (n = 3, ***p < 0.001 ; Student’s t-test). (L) Cumulative probability distribution of sgRNAs in each experimental group. Distributions for each sample type are averaged across individual mice and infection replications. Fig. S2. PHF5A is frequently up-regulated in breast cancer, associated with poor clinical outcome, and essential for cancer cell proliferation and migration (A) Cumulative DFS curves of patients with high or low levels of PHF5A protein expression. Data are shown for luminal-like and HER2-positive breast cancers. (B) Representative images of PHF5A IHC staining in normal breast tissue. Scale bar, 100 µm (left) and 50 µm (right). (C) Kaplan–Meier analysis of luminal-A, luminal-B and HER2-positive breast cancers using the Kaplan–Meier-plotter database. (D) Significant correlation between PHF5A expression and basal type of breast cancer in both METABRIC (n = 1,986) and TCGA (n = 766) data sets; *** p < 0.001; Student t-test. (E) Western blot analyses of CRISPR-mediated knockdown of PHF5A in DCIS, MCF10A, MCF7, T-47D cells. Control sgRNA and mock were included as negative controls. (F) Cell proliferation assay of DCIS, MCF10A, MCF7 and T-47D cells. (G) Picture of wound healing assay described in Fig. 2K and Supplementary Fig. S2H. (H) Wound healing assay of DCIS cells. (I) Transwell migration assay of DCIS cells. (J) Xenograft tumor growth induced by DCIS cells was measured, and images of the removed tumors are shown (n = 8). In J, the data are represented as the means ± SEMs, whereas in F, H and I, individual data points are presented (n = 3). Student’s t-test; ***p < 0.001, **p < 0.01, *p < 0.05. Fig. S3. PHF5A associates with the U2 snRNP complex and regulates complex stability (A) qPCR analysis of PHF5A, SF3B1, SF3B2, SF3B3 and U2AF1 mRNA levels in HMECs and MCF10 sublines. (B) qPCR analyses of SF3B1, SF3B2, SF3B3, U2AF1 and PHF5A mRNA level in control and PHF5A-knockdown cells. For A and B, individual data points are represented (n = 3, **p < 0.01; Student’s t-test). Fig. S4. PHF5A globally regulates splicing (A) PSI profiles of the MXE, A3SS or A5SS events identified in control and PHF5A knockdown cells. The colored dots represent significantly up-regulated (red) or down-regulated (blue) AS events in PHF5A knockdown cells compared to control cells. Fig. S5. The PHD-like domain in PHF5A is required for its association with Histone H3 (A) Schematic diagram showing the SF3b subunits, including specific subunit domains. (B) Heatmap of ChIP-Seq signals of PHF5A, H3K4me3, H3K36me3 and SF3B3 in CA1a cells with exogenous PHF5A expression, ranked by PHF5A ChIP-seq signals. All ChIP-seq signals are displayed from -3 kb to +3 kb surrounding the region from the TSS to the TES. Fig. S6 PHF5A regulates FASTK splicing to antagonize apoptotic signaling in breast cancer cells (A) Venn diagram showing overlap of PHF5A-regulated genes in RNA-Seq and PHF5A-occupied genes in ChIP-Seq. (B) Bar graphs showing the relative fold change of ChIP-qPCR results in CA1a cells. (C) Western blot analysis showing the expression of SF3B1, SF3B2 and SF3B3 proteins in the CA1a cells described in Fig. 6A. (D) Schematic diagrams of two FASTK transcripts (FASTK-L and FASTK-S). The detailed mRNA and encoded protein sequences are shown to indicate the specific site in which the protein is truncated. The letters in red in the FASTK-S sequence indicate the differences from the FASTK-L sequence. (E) The alternative splice products, intron 5-containing FASTK-S (upper) and full-length transcript FASTK-L (lower), are shown by Sanger sequencing of the RT-PCR products. The primers used for sequencing are indicated by arrows. Table S1. Clinicopathologic Variables in 40 Cases of TNBC Patients Variables Number of patients Total 40 Age ≤50 years 16 ＞50years 24 Menopausal status Premenopause 15 Postmenopause 25 Tumor size ≤2cm 19 ＞2, 5≤cm 20 ＞5cm 1 Lymph node status Negative 25 Positive 15 Grade 1 or 2 3 3 32 Unknown 5 Histological type Invasive ductal carcinoma 37 Metaplastic carcinoma 2 Others 1 ER status Negative 40 Positive 0 PR status Negative 40 Positive 0 HER-2/neu status Negative 40 Positive 0 Abbreviations: ER, estrogen receptor; HER-2, human epidermal growth factor receptor 2; PR, progesterone receptor Table S2. Primers Used in RT-PCR and qPCR Analyses Gene Forward Primer 5’-3’ Reverse Primer 5’-3’ LETMD1 CTTTGGCAAAGCTGGGGATT CCGCTCCATGGTTCATTCAG PLSCR1 CAGGAAACGAAACCAGGAGC TCCGGGTGAGAAGCATTCAT POLDIP3 TGCCTTCATAAACCCACCCA CATGTGGTGGAGAAAGCCG RPL24 AGTCAAATTCCAGAGGGCCA TAGCGTTTTCCACCAACTCG ZCCHC10 TGCTTGGAATTTGGACATTGG ACTGCTACTGGAACTGGTTAC RT-PCR FASTK CATCTTGATGTCACTGTGCCA CAGCAGGGAGAGGTAGCG MAEA ACTACCGACTACACCAGCTG GCAGGGTCAGCGTGTTAAAA CTGATCCAGCAGTTCCGGTA TCGCCAGAAATCTTGCAGAC BUD3 AACACGAACTTAGCTTGGCC GATGGGTTCAGACTTACACCA AGGAGTCTTTGTGTCCCTGTA TCAAGGGTTCTGCATCTCGT FBXO32 ACTGGACTTCTCAACTGCCA GGATGTGTAGAGGGTCTGGAG FASTK CAGCAGGGAGAGGTAGCG CATCCTGGCTGCGTACCA GAACTACCTGCCCCTGGAAC TGGCACAGTGACATCAAGAT SF3B1 AGCGGAAGTTCTTGGGAGCG AGAGCTGCCTTCTTGCCTTG qPCR SF3B2 CCGATCCAGGGTAATCGCGA AAAACCGGCCGATTCAGCAC SF3B3 GACCGTGGCTTGCTCAATGG CCAGGGATCAGCGTGGTCTT U2AF1 ACGTCAAGTTTCGCCGTGAG TCCCATCTCATACTGACGGCA FASTK CCTTCCACGCCTTTGAAACA AGCCCTGCCTACTCTTCATG MAEA GGTTCTGTGTTGCCTTCCTG CAACCTGGCCATACTGCATC LETMD1 CCAGTGGCATAAGAACTCGC AGACTAAGTGCGGAAGGAGG ChIP-qPCR PLSCR1 TTCGAATGGTTCTGGGGTGA CTGGAAGTGGAGCAGGTACA POLDIP3 CAATCTCCTGCCCAACACAC AGTGGTAGAGTGACTTGCCC ZCCHC10 CTGAAGGTTTACGTCGGCTG ACAACTGTCGCGTTTGGTTT RPL24 CCATGCCCAGCCTCATTTTA TCTTTGCGATGTTGCCCAAT Table S3.