Induction of Mutation of a Synthetic C-Ha-Ras Gene Containing Hypoxanthine1

Home , Hypoxanthine

(CANCER RESEARCH 52. 1836-1839. April. 1992] Induction of Mutation of a Synthetic c-Ha-ras Gene Containing Hypoxanthine1

Hiroyuki Kamiya, Hiroyuki Miura, Hisayo Kato, Susumu Nishimura, and Eiko Ohtsuka2

Faculty of Pharmaceutical Sciences, Hokkaido University, Nishi-6, Kita-12, Kita-ku, Sapporo 060, Japan [H. K., H. M., H. K., E. O.], and Biological Division, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104, Japan fS. N.]

ABSTRACT promoter in the 5'-flanking region showed transforming activ The second base of codon 61 of a synthetic c-l la-ra.vgene was replaced ity when introduced into NIH3T3 cells by transfection (23). These synthetic c-Ha-ras genes have several unique restriction with a hypoxanthine residue in a site-specific manner. Transfection of enzyme sites and, therefore, can easily be modified in a site- this gene into NIH3T3 cells by the calcium phosphate procedure resulted in increased focus formation. Total DNA was extracted from transformed specific manner by insertion of a modified base using a DNA cells, and the sequences of the inserted c-l la-ra.v DNA were analyzed by cassette mutagenesis technique. We recently reported that the the polymerase chain reaction-single-strand conformation polymorphism gene is useful for site-directed incorporation of a modified base method. Mutations with A (or hypoxanthine) to G transition were de into codon 12 (24). tected exclusively. These results suggest that the synthetic c-Ha-nu gene We report here high transforming activity of a synthetic c- can be used for investigations of mutageneses caused by DNA lesions. Hz-ras gene with hypoxanthine in the second position of codon 61 and mutations with A to G transition in this position. INTRODUCTION Activated ras genes have frequently been detected in tumors MATERIALS AND METHODS and tumor cells and are thought to be involved in tumor Materials. Restriction enzymes, T4 polynucleotide kinase, and T4 initiation and/or progression (1, 2). These activated ras genes DNA ligase were purchased from Takara. Tag DNA polymerase was have been found to have a point mutation at a specific site, obtained from Perkin Elmer Cetus. Oligonucleotides were synthesized either in codon 12, 13, or 61 or some other position that by the phosphoramidite method using an Applied Biosystems model induces substitution of an amino acid in the ras-encoded pro 380A DNA synthesizer. The reagents necessary for oligonucleotide tein, p21. The mutant p21s differ from normal p21 in having synthesis including deoxyinosine phosphoramidite were also purchased lower GTPase activities and altered guanine nucleotide-binding from Applied Biosystems. The Oligonucleotides synthesized were puri fied by reverse-phase and anion-exchange high-performance liquid activities (1, 2). In addition, the GTPases of the mutated p21s are not activated by GTPase-activating protein (3). Thus the chromatography as described previously (21). NuSieve GTG agarose was obtained from FMC BioProducts. mutant p21s remain as GTP complexes. The fact that the Construction of a Plasmid for a Normal Human c-Ha-ras Gene. A regions around the 12th, 13th, and 61st amino acids contact plasmid, pRSVras, which has EcoRV and Ac/I sites on the 5' and 3' with a phosphate group of a bound guanine nucleotide was sides, respectively, of codon 61 and encodes a normal p21 (codon 61 is substantiated by determination of the three-dimensional struc CAA for glutamine), was constructed by exchanging a DNA fragment ture of p21s complexed with GDP or GTP analogues (4-10). around codon 61 of pRSV-rr6l (23). The nucleotide sequence of this Point mutations are thought to be induced in many cases by modified c-Ha-ras gene was confirmed by the method of Maxam and modification of a base in DNA by a mutagen and subsequent Gilbert (25) and Sanger et al. (26) after the plasmid had been transfected misincorporation of an "incorrect" deoxynucleoside triphos- into, and amplified in, the EscherÃ¬chiacoliGWS 100 strain. phate at the site opposite to the modified base catalyzed by Construction of a Vector having a c-Ha-ras Gene containing a Hypo DNA polymerase. Hypoxanthine is produced by deamination xanthine Base. Phosphorylation and ligation of Oligonucleotides were of an adenine base either spontaneously or in the presence of carried out as described previously (21, 22). A DNA cassette (Fig. lÃ©) was purified by NuSieve GTG agarose gel electrophoresis followed by nitrous acid (11). The existence of a specific repair enzyme for hypoxanthine (hypoxanthine-DNA glycosylase) (12, 13) sug phenol and chloroform extractions. It was then phosphorylated with T4 polynucleotide kinase and joined to a vector derived from pRSVras gests the generation of hypoxanthine in DNA in vivo. The by digestions with EcoRV and Ac/I. The joined DNA was treated with preferential recognition of a hypoxanthine-thymine base pair Â£coRVand then T4 DNA ligase (Fig. 2). Control vectors with a CAA by hypoxanthine-DNA glycosylase (14) indicates that hypoxan codon (normal, Gln-61) or a CTA codon (activated, Leu-61) were thine originates from A in double-stranded DNA. The base- constructed by the same procedure. The vectors were purified by phenol pairing properties of hypoxanthine in oligodeoxyribonucleo- and chloroform extractions and ethanol precipitation and quantitated tides and oligoribonucleotides have been studied extensively with DNA DIPSTICK (InVitrogen). (15-20), and results have shown that hypoxanthine in oligo- DNA Transfection. DNA transfection was performed by the calcium nucleotides forms a stable base pair with an adenine or cytosine phosphate procedure as described previously (23, 27); 20 or 100 ng of residue in the opposite strand. Therefore, generation of hypo DNA and 30 ^g of genomic DNA isolated from NIH3T3 cells were used for each transfection assay. xanthine in vivo may lead to a point mutation. We previously synthesized genes for human c-Ha-ras proteins Sequence Analysis of ras Genes Present in Transformed NIH3T3 Cells. Genomic DNA was extracted from transformed cells by the (21, 22). Of these synthetic human c-Ha-ras genes, those with conventional method using proteinase K. A portion of the ras gene a point mutation in codon 12 or 61 and a long terminal repeat around codon 61 was amplified by the PCR1 (28) in a DNA thermal cycler (Perkin Elmer Cetus). The following conditions were used for Received 10/3/91 ; accepted 1/24/92. the PCR: 94Â°C,30 s; 55Â°C,1min; 72Â°C,2min, 45 cycles. The primers The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in used for the PCR were U7 (dGAGACCTGTCTGCTGGATATC) and accordance with 18 U.S.C. Section 1734 solely to indicate this fact. L9(dTTTAACGCGTTTGATCTGTTCACGGTATTGATGGATG- ' This work was supported, in part, by a Grant-in-Aid from the Ministry of Health and Welfare for a Comprehensive 10-Year Strategy for Cancer Control, TCTTC) (22). The amplified DNAs were purified by agarose gel elec trophoresis. The sequence of codon 61 was investigated by PCR-SSCP Japan. 2To whom requests for reprints should be addressed, at Faculty of Pharma ceutical Sciences, Hokkaido University, Nishi-6, Kita-12, Kita-ku, Sapporo 060, 3The abbreviations used are: PCR, polymerase chain reaction; SSCP, single- Japan. strand conformation polymorphism. 1836

(29) analysis using U7 and L9 as primers. In some cases, the ras genes C/e I amplified by the PCR were also analyzed by the method of Maxam and fcoRV DNAcassette Gilbert (25).

RESULTS Synthesis of Oligonucleotides Containing Hypoxanthine. Be cause a hypoxanthine residue is produced by deamination of an adenine base, the adenine residue located in the second position of codon 61 of the c-Ha-ras gene was replaced by hypoxanthine. For this purpose, we introduced a hypoxanthine base at the 17th position from the 5' side of oligomer U8, which corre sponds to codon 56 to codon 62 of the sense strand of synthetic c-Ha-ras genes (Fig. 1). The Oligonucleotides synthesized were highly purified by high-performance liquid chromatography, as described in the "Materials and Methods," to avoid effects of by-products. Construction of a Vector Having a c-1la-ru.v Gene containing a Hypoxanthine Base. Cassette mutagenesis was carried out by the method used previously to avoid insertion of cassettes as trimers. A similar procedure was previously used successfully for introducing an O6-methylguanine residue into codon 12 of a synthetic c-Ha-ras gene (24). Fig. \b shows DNA cassettes containing CIA (I, hypoxan thine), CAA (normal, Gln-61), and CTA (activated, Leu-61) codons with a Ac/I end and an internal EcoRV site. These DNA cassettes were synthesized as described previously (21, 22), phosphorylated, and ligated. Fig. 2. Construction of vectors for transfection. pRSVras was digested with The plasmid pRSVras, which has EcoRV and Bell sites on Ac/I and EcoRV and joined with a phosphorylated DNA cassette. The DNAs the 5' and 3' sides, respectively, of codon 61 and encodes a thus obtained were then treated with EcoRV and subsequently ligated. normal p21 (Gln-61), was digested with EcoRV and BcÃ±.When the E. coli HB101 strain was used as a host, pRSVras was not Table 1 Numbers affaci induced by c-Ha-ras genes cleaved by Hell because of methylation of an adenine base at the Ac/I site. Therefore, the dam~ GW5100 strain was used. Experiment no. Codon61CAA The cleaved pRSVras was joined with the DNA cassette, and (Gin) then DNA was digested with Â£o>RV(Fig. 2). After subsequent CIA 12242Â»NDC37 1848 ligation, the vector was purified by phenol and chloroform CTA (Leu)1Â°0 ND3"04 94"1 extractions and ethanol precipitation. " Twenty ng of DNA was used. Transformation of NIH3T3 Cells with the Synthetic c-Ha-ras '' One hundred ng of DNA was used. r ND, not determined. Gene Containing Hypoxanthine. The constructed vectors were transfected into NIH3T3 cells by the calcium phosphate pro cedure (23, 27). After culture for 3 weeks, foci were formed in The numbers of foci induced by the CIA-ras gene were approx cultures of NIH3T3 cells transfected with the CIA-ros gene. imately half those induced by the CTA (Leu-61 )-ras gene (Table 1). This high transforming activity may suggest inefficient repair of hypoxanthine residues in NIH3T3 cells. On the other hand, transfection of the normal CAA (Gln-61) ras gene re sulted in scarcely any foci, as expected (Table 1). d CTTGATACCGCAGGCCAAG Analysis of c-Ha-ras Genes Present in the Transformed d CTTGATACCGCAGGCCI A G NIH3T3 Cells. Duplex DNA corresponding to codons 49-104 d CTTGATACCGCAGGCCTAG of c-Ha-ras isolated from transformed cells was amplified by the PCR (28). The amplified 168-base pair fragments were isolated by agarose gel electrophoresis, and the sequence of codon 61 was determined by PCR-SSCP analysis, which is capable of detecting a single base alteration (29). Fig. 3 shows the electrophoretic patterns obtained by analyses of three (i SO i! IO K -Yil-Ã¯il-Ilt-AJ[-Gl7-Glu-Thr-Cn-ltg-l[u-Â»!Hlt-ltu-Alp-Thr-Â»ll-Glr- -GU-Glu-TÃr-Ser-Ali-Met-ArÂ«- clones, as examples. The amplified DNA derived from these ( III ) ( ill ) ( DI -) (- W ) clones showed exactly the same mobility as the standard DNA AGGII GII ATCGACGOTGAGACCTOTCTGCTOOATATCCTTGATACCOCAGGCO* GAAGAATACTCTOCGATGCGt TAGCTGCCACTCTGGACÃ•GACGACCUTAIGAACTATOGCGTCCGGTTCTTCTTATGAGACGCTACGCI'Ot I containing G in the second position of codon 61. The mobility ( us â€”¿)( â€”¿ii2 -)(â€”-ur â€”¿-Iof these amplified DNAs in the single-stranded form was quite /Â»iv *;i Fig. 1. DNA cassettes for site-specific modification of codon 61. a, Oligonucle different from those of the standard DNAs having A, C, or T otides containing codon 61. Bold characters, second nucleotide of codon 61. These in the second position of codon 61. This suggested that the Oligonucleotides were used for construction of normal (Gln-61, CAA), modified mutation induced by hypoxanthine located in the second posi (CIA, I represents hypoxanthine), and activated (Leu-61, CTA) ras genes. The tion of codon 61 of c-Ha-ras was exclusively an A (I) to G Oligonucleotides are US. b, constructed DNA cassettes. N corresponds to A, I, or T; shaded characters, a Bell end and an internal EcoRV site. transition. This sequence was confirmed by direct sequencing 1837

by the method of Maxam and Gilbert (25) of amplified DNAs from these clones (Fig. 4). Subsequently, 17 additional trans formed NIH3T3 foci induced by transfection of c-Ha-ras con Standards taining hypoxanthine were determined by PCR-SSCP analysis. Of the 20 clones analyzed, 19 were found to have G in the second position of codon 61, while one contained both G and ds A C T G 1 23 T in this position. DISCUSSION Hypoxanthine, produced by deamination of adenine, is struc turally analogous to guanine rather than parental adenine. It has the same hydrogen donor (endocyclic imino group) and acceptor (carbonyl oxygen) sites as guanine. Therefore, hypo xanthine may induce a mutation to G, because it appears to pair with C in the Watson-Crick manner like a G-C pair (Fig. 5, a and b). Furthermore, there are reports that complementary oligonucleotides containing a hypoxanthine-adenine pair as well as a hypoxanthine-cytosine pair form stable duplexes and - that pairs with G and T do not induce destabilization (15-20). These findings suggest that hypoxanthine may cause transition and transversion. We recently reported site-directed insertion of an C^-methylguanine base into codon 12 of a synthetic c-Ha-ras gene and its transforming activity in NIH3T3 cells (24). A similar strat egy using DNA cassette mutagenesis should be very useful for investigating DNA lesions in other positions. Because the sec ond base of codon 61 is A and is one of the hot spots of c-Ha- ras gene activation, using the DNA transfection assay, we examined the effect of its substitution with hypoxanthine by cassette mutagenesis. As shown in Table 1, raÃgenes containing hypoxanthine showed potent transforming activity. Thus, gen Fig. 3. Analysis of the synthetic c-Ha-ros genes present in transformed NIH3T3 eration of hypoxanthine from adenine by deamination may be cells by PCR-SSCP. Amplified DNAs were analyzed by 6% polyacrylamide gel electrophoresis. The gel did not contain glycerol, and electrophoresis was per one cause of mutations. formed at 4'C. All samples analyzed in experiment 2 in Table 1 (lanes 1-3) In our system, mutations to C are thought not to lead to showed the same electrophoretic pattern as the "G" standard. Lanes A, G, T, and focus formation because it was reported that a Pro-61 (CCA at C indicate standard samples containing CAA, CGA, CTA, and CCA, respectively, at codon 61; lane ds. marker corresponding to the double strand. codon 61) mutant did not have transforming activity (30). However, it is possible to detect mutations to G (Arg-61) or T (Leu-61) in our system. In the present study, mutations to G were detected almost exclusively, suggesting that DNA polymerase(s) in NIH3T3 cells incorporates dCTP but not dATP as a substrate in the position opposite to hypoxanthine. In an in vitro study in which the Klenow fragment was used, the DNA polymerase was found to insert C to pair with hypoxanthine (31). This finding suggests that DNA polymerases utilize dCTP

â€¢¿j--H-N 0-H-N codon 61 i*(N N-H -N x) â€¢¿Â«-. H /^N=/ LHN-H--O \

0-H-N 0--H-

N-H---N N=/ \

Fig. 4. Maxam-Gilbert sequence analysis of the amplified c-Ha-raj gene (the Fig. 5. Base pair characteristics of hypoxanthine. a, a normal Watson-Crick same sample as for lane 2 in Fig. 3). base pair (G-C); b, a hypoxanthine-C base pair; c, a hypoxanthine-A base pair (Watson-Crick type). The distance between the two bases is more than in a normal Watson-Crick base pair; d, a hypoxanthine-A base pair (Hoogsteen type). 1838

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 1992 American Association for Cancer Research. MUTATION INDUCED BY HYPOXANTHINE IN ras GENE preferentially in spite of the ability of hypoxanthine to form ras proteins. Science (Washington DC), 247: 939-945, 1990. 10. Pai, E. F., Krengel, U., Petsko, G. A., Goody, R. S., Kabsch, W., and base pairs with C and A. Wittinghofer, A. Refined crystal structure of the triphosphate conformation Hypoxanthine can pair with C in the normal Watson-Crick of H-ras p21 at 1.35 A resolution: implications for the mechanism of GTP manner (17) like a G-C pair (Fig. 5, a and b). Nuclear magnetic hydrolysis. EMBO J., 9: 2351-2359, 1990. 11. Shapiro, H, S., and Chargaff, E. Studies on the nucleotide arrangement in resonance studies showed that a hypoxanthine-A base pair was deoxyribonucleic acids. XI. Selective removal of cytosine as a tool for the a Watson-Crick type (17), although it was a Hoogsteen type in study of the nucleotide arrangement in deoxyribonucleic acid. Biochemistry, 5:3012-3018,1966. crystals (32) (Fig. 5, c and d). Although A can pair with 12. Karran, P., and Lindahl, T. Hypoxanthine in deoxyribonucleic acid: genera hypoxanthine in a Watson-Crick manner, the distance between tion by heat-induced hydrolysis of adenine residues and release in free form the deoxyribose moieties is different from that in normal (pur- by a deoxyribonucleic acid glycosylase from calf thymus. Biochemistry, 19: 6005-6011, 1980. ine-pyrimidine) base pairs and the hypoxanthine-C pair (Fig. 5, 13. Sanear, A., and Sanear, G. B. DNA repair enzymes. Annu. Rev. Biochem., a-c). Furthermore, the total conformation of a hypoxanthine- 57:29-67, 1988. 14. Dianov, G., and Lindahl, T. Preferential recognition of I-T base-pairs in the A pair is different from that of normal pairs, regardless of initiation of excision-repair by hypoxanthine-DNA glycosylase. Nucleic whether this pair is a Watson-Crick or Hoogsteen type. Possi Acids Res., 19: 3829-3833, 1991. bly, DNA polymerase(s) recognizes the distance and/or the 15. Martin, F. H., and Castro, M. M. Base pairing involving deoxyinosine: implications for probe design. Nucleic Acids Res., 13: 8927-8938, 1985. total conformation of the base pair and thereby incorporates 16. Kawase, V.. Iwai, S., Inoue, H., Miura, K., and Ohtsuka, E. Studies on dCMP but not dAMP. Alternatively, a proofreading mecha- nucleic acid interactions. I. Stabilities of mini-duplexes (dGiAiXAjGv dC2T4YT4C2) and self-complementary d(GGGAAXYTTCCC) containing nism(s) may remove an A residue opposite hypoxanthine be deoxyinosine and other mismatched bases. Nucleic Acids Res., 14: 7727- cause of the abnormal distance and/or conformational differ 7736, 1986. ence of the base pair, although DNA polymerase(s) incorporates 17. Uesugi, S., Oda, Y., Ikehara, M., Kawase, Y., and Ohtsuka, E. Identification of I:A mismatch base-pairing structure in DNA. J. Biol. Chem., 262: 6965- dCMP and dAMP with comparable efficiencies. Another pos 6968, 1987. sible explanation is that Arg-61 mutants are selected because 18. Kawase, Y., Iwai, S., and Ohtsuka, E. Synthesis and properties of hexanu- of their much greater transforming activity than that of Leu-61 cleotides containing deoxyinosine. Chem. Pharm. Bull. (Tokyo), 36: 118- 121, 1988. mutants. However, this explanation is not likely because these 19. Kawase, Y., Iwai, S., and Ohtsuka, E. Synthesis and thermal stability of two types of mutants are reported to have comparable trans dodecadeoxyribonucleotides containing deoxyinosine pairing with four major forming activities (23, 30). bases. Chem. Pharm. Bull. (Tokyo), 37: 599-601, 1989. 20. Kawase, Y., Koizumi, M., Iwai, S., and Ohtsuka, E. Synthesis of wobble One of the transformed clones contained a ras gene(s) mu pairing oligoribonucleotides. Chem. Pharm. Bull. (Tokyo), 37: 2313-2317, tated to T. This finding may indicate that dAMP was incorpo 1989. 21. Miura, K., Inoue, Y., Nakamori, H., Iwai, S., Ohtsuka, E., Ikehara, M., rated less than dCMP into the site opposite hypoxanthine. Noguchi, S., and Nishimura, S. Synthesis and expression of a synthetic gene Alternatively, an abasic site produced by hypoxanthine-DNA for the activated human c-Ha-ras protein. Jpn. J. Cancer Res., 77: 45-51, glycosylase(s) (12,13) may have caused a mutation to T, because 1986. 22. Miura, K., Kamiya, H., Tominaga, M., Inoue, Y., Ikehara, M., Noguchi, S., dAMP was incorporated opposite abasic sites (33, 34). Nishimura, S., and Ohtsuka, E. Overexpression of cellular and activated In this communication, we showed that a synthetic c-Ha-ras human c-Ha-ros proteins by mutating a synthetic gene. Chem. Pharm. Bull. gene is very useful for site-specific modification of codon 61 (Tokyo), 35: 4878-4882, 1987. 23. Kamiya, H., Miura, K., Ohtomo, N., Koda, T., Kakinuma, M., Nishimura, with a modified base. Studies of the focus-forming activities of S., and Ohtsuka.E. Transformation of NIH3T3 cells with synthetic c-Ha-ros ras genes containing other carcinogen-induced lesions at codon genes. Jpn. J. Cancer Res., 80: 200-203, 1989. 24. Kamiya, H., Miura, K., Ohtomo, N., Nishimura, S., and Ohtsuka, E. Trans 61 are in progress. forming activity of a synthetic c-Ha-ros gene containing an O*-methylguanine in codon 12. Jpn. J. Cancer Res., 82: 997-1002, 1991. 25. Maxam, A. M., and Gilbert, W. A new method for sequencing DNA. Proc. REFERENCES Nati. Acad. Sci. USA, 74: 560-564, 1977. 26. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain- 1. Barbacid, M. ras genes. Annu. Rev. Biochem., 56: 779-827, 1987. terminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977. 2. Nishimura, S.. and Sekiya, T. Human cancer and cellular oncogenes. 27. Perucho, M., Goldfarb, M. Shimizu, K., Lama, C, Fogh, J., and Wigler, M. Biochem. J., 243: 313-327, 1987. Human-tumor-derived cell lines contain common and different transforming 3. Gibbs, J. B., Schaber, M. D., Allard, W. J., Sigal, I. S., and Scolnick, E. M. genes. Cell, 27: 467-476, 1981. Purification of ras GTPase activating protein from bovine brain. Proc. Nati. 28. Saiki, R. K., Gelfand, D. H., Stoffel, S., Sharf, S. J., Higuchi, R., HÃ¶rn,G. Acad. Sci., USA, 85: 5026-5030, 1988. T., MullÃs,K. B., and Erlich, H. A. Primer-directed enzymatic amplification 4. DeVos, A. M., Tong, L., Milburn, M. V., Matias, P. M., Jancarik, J., of DNA with a thermostable DNA polymerase. Science (Washington DC), Noguchi, S., Nishimura, S., Miura, K., Ohtsuka, E., and Kim, S-H. Three- 2^9:487-491, 1988. dimensional structure of an oncogene protein: catalytic domain of human c- 29. Orita, M., Suzuki, Y., Sekiya.T., and Hayashi, K. Rapid and sensitive H-ras p21. Science (Washington DC), 239: 888-893, 1988. detection of point mutations and DNA polymorphisms using the polymerase 5. Tong, L., Milburn, M. V., deVos, A. M., and Kim, S-H. Structure of raj chain reaction. Genomics, 5: 874-879, 1989. protein. Science (Washington DC), 245: 244, 1989. 30. Der, C. J., Finkel, T., and Cooper, G. M. Biological and biochemical 6. Pai, E. F., Kabsch, W., Krengel, U., Holmes, K. C., John, J., and Wittingh- properties of human ras" genes mutated at codon 61. Cell, 44: 167-176, ofer, A. Structure of the guanine-nucleotide-binding domain of the Hz-ras 1986. oncogene product p21 in the triphosphate conformation. Nature (Lond.), 31. Ohtsuka, E., Matsuki, S., Ikehara, M., Takahashi, Y., and Matsubara, K. An 341: 209-214, 1989. alternative approach to deoxyoligonucleotides as hybridization probes by 7. BrÃ¼nger,A. T., Milburn, M. V., Tong, L., de Vos, A. M., Jancarik, J., insertion of deoxyinosine at ambiguous codon positions. J. Biol. Chem., 260: Yamaizumi, Z., Nishimura, S., Ohtsuka, E., and Kim, S-H. Crystal structure 2605-2608, 1985. of an active form of RAS protein, a complex of a GTP analog and theHRAS 32. Corfield, P. W. R., Hunter, W. N., Brown, T., Robinson, P., and Kennard, p21 catalytic domain. Proc. Nati. Acad. Sci. USA, 87: 4849-4853, 1990. O. Inosine-adenine base pairs in a B-DNA duplex. Nucleic Acids Res., /5: 8. Krengel, U., Schlichting, I., Scherer, A., Schumann, R., Freeh, M., John, J., 7935-7949, 1987. Kabsch, W., Pai, E. F., and Wittinghofer, A. Three-dimensional structures 33. Randall, S. K., Eritja, R.. Kaplan, B. E., Petruska, J., and Goodman, M. F. of H-ras mutants: molecular basis for their inability to function as signal Nucleotide insertion kinetics opposite abasic lesions in DNA. J. Biol. Chem., switch molecules. Cell, 62: 539-548, 1990. 262:6864-6870, 1987. 9. Milburn, M. V., Tong, L., de Vos, A. M., BrÃ¼nger,A., Yamaizumi, Z., 34. Takeshita, M., Chang, C-N , Johnson, F., Will, S., and Grollman, A. P. Nishimura, S., and Kim, S-H. Molecular switch for signal transduction: Oligodeoxynucleotides containing synthetic abasic sites. J. Biol. Chem., 262: structural differences between active and inactive forms of protooncogenic 10171-10179, 1987.

1839

Hiroyuki Kamiya, Hiroyuki Miura, Hisayo Kato, et al.

Cancer Res 1992;52:1836-1839.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/52/7/1836

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/52/7/1836. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.