biota cover 7 2006 9/9/2007 13:32 Page 1

C M Y CM MY CY CMY K

Revija za biologijo in ekologijo / Journal of biology and ecology Vol. 7, 1-2, 2006 Vol. 7, 1-2, 2006 1-2, 7, Vol. Photo: Milan Vogrin ^rna {torklja Ciconia nigra Proceedings of the 4th International Conference on the Black Stork Ciconia nigra Black Stork Ciconia nigra Davod-Püspökpuszta, Hungary, 15-18 April 2004

ISSN 1580-4208

designed by: darinka knapiË printed by: marginalija Drustvo za proucevanje ptic in varstvo narave Drustvo varuhov okolja Radoziv Society of Bird Research and Nature Protection Environmental Society Radoziv

Composite biota cover 7 2006 9/9/2007 13:32 Page 2

C M Y CM MY CY CMY K

Front cover: Black Stork Ciconia nigra, Photo: Zsolt Kalotas

BIOTA - Revija za biologijo in ekologijo BIOTA - Journal of biology and ecology

Revija Prof. Dr. Juha Merilä - Department of Ecology and Systematics, University of Helsinki, DPPVN - Druπtva za prouËevanje ptic in varstva Finland narave Dr. Claude Miaud - University of Savoie, Ptujska c. 91, SI- 2327 RaËe, Slovenija France Dr. David Mifsud - Naturhistorisches Museum in Druπtva varuhov okolja Radoæiv Basel, Basel, Switzerland Ul. Ivanjke Uranjek 1, SI-3310 Æalec, Prof. Dr. Timothy A. Mousseau - Department Slovenija of Biological Sciences, University of South Carolina, USA Journal of Dr. Zbynek RoËek - Academy of Sciences and DPPVN - Society of bird research and nature protection Charles University, Prague, Czech Republic and Environmental Society Radoæiv Dr. Luca Salvati - Rome, Italy Andrej Sovinc - Landscape park SeËoveljske Glavni in odgovorni urednik - Editor in chief soline Milan Vogrin, Andrej ©orgo - DPPVN, Slovenia Zg. Hajdina 83c, SI-2288 Hajdina, Slovenia Dr. Piotr Tryjanowski - Adam Mickiewicz E-mail: [email protected] University, Poland Dr. Reuven Yosef - International Birding & PomoËnik urednika - Assistant editor Research Centre in Eilat, Israel dr. Andreja MikliË Dr. Marco Zuffi - University of Pisa, Italy University of Ljubljana Dr. Igor Æiberna - University of Maribor, Biotechnical Faculty Pedagogical Faculty Maribor, Slovenia Groblje 3, SI/1230 Dom`ale E-mail: [email protected] Lektorji - Lectors za angleπËino - for English language: TehniËni urednik - Technical editor Dr. Victor Kennedy Darinka KnapiË za slovenπËino - for Slovene language: Tanja Vovk Petrovski Uredniπki odbor - Editorial Advisory Board Prof. Dr. Ronn G. Altig - Mississippi State Izhaja - Issued University, USA dve πtevilki letno - two numbers per year Prof. Dr. Luigi Boitani - University of Roma “La Sapienza”, Italy Exchange of publications Matjaæ BedjaniË - DPPVN, Slovenia All periodicals sent in exchange for Biota should MSc. Zoran Belec - Zavod za gozdove be addressed to: /DPPVN, Slovenia DPPVN, Ptujska c. 91, SI-2327 RaËe, Slovenia Dr. Helmut Faber - Graz, Austria Dr. Ioan Ghira - Babes-Bolyai University, Tisk - Printed by Romania Marginalija, d.o.o., Sempeter, Slovenia

Revija Biota je indeksirana v BIOSIS, COBIB, CSA (Cambridge Scientific Abstracts), Elsevier Geo Abstracts and ROL (Recent Ornithological Literature) Journal Biota is covered by the BIOSIS, COBIB, CSA (Cambridge Scientific Abstracts), Elsevier Geo Abstracts and ROL (Recent Ornithological Literature) Revijo sofinancirajo: MOP - Ministrstvo za okolje, prostor in energijo, DEF - Danube Environmental Forum

Composite Biota Vol. 7, No. 1-2, 2006

Revija za bio lo gi jo in eko lo gi jo Journal of bio logy and ecology

Društvo za pro uče va nje ptic in vars tvo nara ve Society of Bird Research and Nature Protection

Društvo varuhov okolja Radoživ Environmental Society Radoživ

Biota 7/1-2, 2006 3

Vsebina/Contents

Forward Enikő Anna TAMAS, Bela KALOCSA & Maris STRAZDS ...... 5

Članki/Articles

Luis Santiago CANO ALONSO An approach to wintering of Black Stork Ciconia nigra in the Iberian Peninsula ...... 7

Luis Santiago CANO ALONSO, Cláudia FRANCO, Carlos PACHECO, Susana REIS, Gonçalo ROSA & Manuel FERNÁNDEZ-GARCÍA The breeding population of Black Stork Ciconia nigra in the Iberian Peninsula ...... 15

Gunthard DORNBUSCH The Black Stork Ciconia nigra in Germany ...... 25

Margarida FERNANDES, Carla BORGES, Fernanda SIMÕES, José Manuel CABALLERO, Carlos PACHECO & Cláudia FRANCO Molecular sexing of the Black Stork Ciconia nigra: sex ratios in the Portuguese population ...... 31

Ihor HORBAN & Hrihoriy BUMAR Conservation biology of Black Stork Ciconia nigra in Ukrainian Polissya ...... 37

Béla KALOCSA & Enikő Anna TAMÁS Analysis of the nesting data of Black Storks Ciconia nigra in the Gemenc region of the Danube-Drava National Park (1992-2003) ...... 47

Béla KALOCSA & Enikő Anna TAMÁS An evaluation of colour ringing recoveries of Black Storks Ciconia nigra related to Hungary ...... 51

Ming MA, Shunde WEI, Feng XU & Shoujing YIN Black Stork Ciconia nigra in Xinjiang, China ...... 59

Satish PANDE, Amit PAWASHE, Prashant DESHPANDE, Niranjan SANT, Raju KASAMBE & Anil MAHABAL Recent records, review of wintering distribution, habitat choice and associations of Black Stork Ciconia nigra in India and Sri Lanka ...... 65

Nikolai PETKOV, Petar IANKOV & Dimitar GEORGIEV Recent status and changes in the breeding population of the Black Stork Ciconia nigra in Bulgaria ...... 77 4 Biota 7/1-2, 2006

Nuno SANTOS, P. SERRA, Margarida FERNANDES, Carlos PACHECO, Cláudia FRANCO & G.ROSA Hematology and blood parasites of juvenile Black Storks Ciconia nigra in Portugal...... 83

Fernanda SIMÕES, Carla BORGES, José Manuel CABALLERO, Cláudia FRANCO, José MATOS & Margarida FERNANDES D-loop deletion in the mitochondrial DNA of the Black Stork Ciconia nigra ...... 89

M. STRAZDS, J. ĶUZE, S. REINE Evaluation of Black Stork Ciconia nigra nest inspections in Latvia in 2003–2005 ...... 93

Enikő Anna TAMÁS & Béla KALOCSA The diet of young's and feeding places of Black Storks Ciconia nigra in Gemenc ...... 103

Marko TUCAKOV, Béla KALOCSA, Tibor MIKUSKA, Anna Eniko TAMAS , Antun ŽULJEVIĆ, Boris ERG & Tamás DEME The Black Stork Ciconia nigra between the Sió channel and the Drava river in the central Danube floodplain: transboundary monitoring and protection plan ...... 109

Piotr ZIELIŃSKI The role of forest reserves in the protection of the Black Stork Ciconia nigra in central Poland ...... 119 Biota 7/1-2, 2006 5

Foreword

Black Stork Ciconia nigra is a unique species in many ways. Its breeding range encompasses at least 50 countries in three continents - Europe, Asia, and Africa. The total population size is estimated at 20–25 thousand breeding pairs. The largest proportion, both in terms of population size (7,800–12,000) and number of range countries (35), is present in Europe. The entire range extends to well over 100 countries. In Europe as a whole it is classified as Rare (less than 10,000 pairs) and listed as SPEC2, stressing Europe’s global responsibility for the welfare of this beautiful bird. Compared to the White Stork Ciconia ciconia, its life is hidden, because it prefers living in remote places far from people. It is a long distance migrant in most parts of its breed- ing range, and covers from a few hundred to more than 7,000 km on migration from its northern breeding grounds to wintering grounds in Sub-Saharan Africa, the Middle East, India, and sometimes the southern parts of Europe. The migration pattern of birds from the Southern African population is not very well known. The first International Conference on the Black Stork was organized in 1993 in Latvia, reflecting the need for international co-operation in order to achieve effective protection of the species. An international working group was established. The second International Conference was held in Spain in 1996, and the third in Belgium in 2001. By then it was clear that the lower Hungarian Danube valley is of extraordinary importance for the European population of the species. This was the main reason we organized the 4th International Conference on the Black Stork on 15-18 April 2004 in Hungary, Dávod-Püspökpuszta. At the conference, 95 participants from 20 countries shared their knowledge of the status of the Black Stork and the protection of the species and its habitats. During the three day programme, 26 presentations were given, 21 posters were exhibited, and four films were shown. Different sections covered the range, ecology, genetics, habitats, movements, migration and wintering of the species, as well as aspects of habitat protection. Despite formal assurances of the safety of the species by governments and international bodies, many presentations at the conference showed that the habitat of a major part of the spe- cies’ northern breeding population - mature forests - is threatened by intensification of forestry, legal gaps in protection, unsuitable management practices and other kinds of disturbance, particularly in the largest populations of Central and North Eastern Europe. Facilities for human welfare also cause many other problems for migrating birds - such as electrocution on high voltage power lines and collisions with wires. Other major threats include the decrease in availability and quality of feeding grounds, especially the various streams and waterbodies of all kind in the entire range of the species. It is not only the Black Stork that would benefit from a favourable conservation status of these areas. Its vast range is both the strength and the weakness of this magnificent bird. Black Stork is not considered globally threatened; however, it is considered locally endangered or threatened in most of its breeding range. A major problem lies in the fact that none of the single range countries, neither the most stork rich (like Poland, Belarus or Latvia), nor the 6 Biota 7/1-2, 2006 most resource rich (like Germany, France or Russia) is responsible for the entire popula- tion. However, studies presented at the conference confirm that there is no such thing as a national population. Birds from Latvia are found nesting in Poland and Germany; birds from Russia are shot while trying to cross mountain ranges during migration in Pakistan, and birds from Germany roost before migration in Luxembourg or France. Organizing such a conference in Hungary was a move in the right direction. As with previ- ous meetings, the new location within an important part of the species’ range increased local and regional participation and will certainly increase the level and quality of work devoted to Black Stork conservation and study in the region. This conference, like previous meetings, benefited from extensive participation of Black Stork researchers from distant parts of the species’ range - from Portugal and Estonia to India and the South African Republic. Compared with the presentations held in Latvia in 1993, we saw that there is huge progress in our knowledge of this species. However, there is much yet to learn. For such a far ranging bird, even within any single country, almost no sites can be desig- nated as more important than others - perhaps the Central Danube floodplain is one of the very few global examples to the contrary - but even these very rich areas support only a fraction of the entire population. But - using a comparison - we do not want to save a single tree, even if it is the best one - we want to save the entire remaining forest. Our greatest challenge is to level out resources used for species research in both the West and the East, the North and the South, and to level out research intensity between studies being done in species breeding range and those on migration and wintering grounds. By levelling out we do not mean less there, more here. We mean maximizing both study intensity and funds to the highest possible level, despite political and other man-made obstacles. This is the only way to achieve significant improvement in the conservation of the species. It is not going to be easy, but the easy things have already been done. The event was organized jointly by MME/BirdLife Hungary, BITE Baja Youth Nature Protection Society and the Duna-Dráva National Park. Finally, we would like to thank Gemenc Co. Ltd. for providing support with the organiza- tion of the conference, and acknowledge the time and energy of the people who worked hard to ensure a successful meeting.

10. February 2007

Enikő Anna Tamás, Béla Kalocsa & Maris Strazds CANO ALONSO Biota 7/1-2, 2006 7

An approach to wintering of Black Stork Ciconia nigra in the Iberian Peninsula

Luis Santiago CANO ALONSO

Departamento de Zoología y Antropología Física (Vertebrados), Facultad de Biología, Universidad Complutense, Ciudad Universitaria, 28040 Madrid. Spain E-mail: [email protected]

Abstract The Iberian Peninsula is one of the few places where Black Stork Ciconia nigra winter in Europe. The Black Stork wintering period in the Iberian Peninsula lasts from mid-November, when the post-fledging migration has finished, until mid-January, when the Black Stork begins the breeding season in some sites of the Peninsula. The number of concentration places and the number of individuals have increased since the nineties. The origin of these individuals is varied. There are individuals from Iberia (Portugal and Spain), but there are also individuals from others countries of Europe.

Key words: Ciconia nigra, wintering, Iberia

Received 15 January 2007; accepted 9 May 2007 8 Biota 7/1-2, 2006 CANO ALONSO

INTRODUCTION METHOD The Iberian Peninsula is situated at the For this survey, I have been gathering western extreme of Europe; it is a biogeo- available information about Black Storks graphical link between Europe and Africa, in Iberia from November to January during and it is the limit of Black Stork distribution the last decade. The sources of this infor- in the western Palearctic. Moreover, the mation have been: my own data, regional Iberian Peninsula is a part of the western ornithologist yearbooks, personal com- Palearctic Black Stork migratory route. ments of Iberian ornithologist colleagues, This territory is one of the few places where and information gathered in internet Black Stork winter in Europe. Although forums. In addition, I have consulted the the Black Stork wintering period has been unique and still unpublished investiga- studied in Africa, Israel and recently in the tion of this theme in the Iberian Peninsula eastern Paleartic (Bobek et al. 2001, 2004, (Sansegundo 1992). Van den Bossche 1996, 2001), its wintering in the Iberian Peninsula is still relatively RESULTS AND DISCUSSION unknown. Although the presence of Black In the early nineties, the greatest number Stork in the Iberian Peninsula in winter of localities in Spain with a Black Stork has long been known (Cramp & Simmons presence was 15 (November 1991), and 1977, Hancock et al. 1992, Sansegundo the largest Black Stork group watched was 1992), there is only scattered information formed by 27 individuals in December about this species in Iberia during this 1991 (Sansegundo 1992). season. This situation is different in the early 21st The Black Stork wintering period in the century. In 2004, the number of localities Iberian Peninsula lasts from mid-November, with a presence of Black Storks during the when the post-fledging migration has fin- winter has risen above 25 ,and the largest ished, until mid-January, when some of the Black Stork group watched in recent years Black Storks begin to occupy breeding ter- was formed by 46 individuals (Parkes et al. ritories in different sites of the Peninsula. 2001).

Figure 1. Types of Black Stork wintering places in Iberia and the Balearic Islands according to the number of individuals observed. CANO ALONSO Biota 7/1-2, 2006 9

Main wintering places maximum number of birds in a group in Black Stork observations can be grouped this rice field was 46 individuals (Parkes et in two types in the Iberian Peninsula dur- al. 2001). 101 birds were counted around ing the winter season (see Figure 1). There the Guadalquivir river (marshes, rice fields, are some observations of lone individuals and river) in three days during the Second (sometimes a couple) in the territory, on International Waterbirds census in 2002 the northern coast, Mediterranean coast, (Equipo de seguimiento de procesos natu- southern coast, and interior of the penin- rales-EBD-CSIC 2002). The exact number of sula. In this group two kinds of places must individuals is unknown, but the number be distinguished: of birds has increased since 1991. The ori- There are wintering observations of lone gin of these birds is partly known: there Black Storks in breeding territories every are birds from Portugal and Spain, but year. There has not yet been any control there are also birds from the Germany, of ringed individuals, but it is possible that Czech Republic, Luxembourg, France, and these Black Storks are resident individuals. Belgium. There are other controls of ringed Moreover, there are lone Black Stork win- birds, but unfortunately the origin of these tering observations outside the Iberian birds is still unknown, because the ring breeding area, only one single year in codes are unknown at this moment. each place. In many cases, these places A new Black Stork detected in the nineties are anomalous sites (around cities, rubbish in the wintering place was detected in dumps, the northern coast). The origin of the nineteen nineties in the Guadalhorce these individuals is unknown, but I sug- Valley (Andalusia), about two hundred gest the possibility that these individuals kilometres away from the Marshes of could be extra-Iberian birds which don’t the Guadalquivir river to the southeast complete the migratory route across the (Environmental agents of the Territorial Strait of Gibraltar. Section from High and Middle Guadalhorce On the other hand, there are observations Valley-Junta de Andalucía & SEOBirdLife/ of concentrations of individuals between Málaga local group). The habitat of this five and more than fifty birds in certain place is a collected river whose riverside places in the southern half of the Iberian has been transformed by agricultural activ- Peninsula. ities. There are ring controls of Iberian and central European birds (Portugal and Wintering places Luxembourg), which showed fidelity to The most important winter places in Iberia this place in 2003 and 2004. The maxi- are the Marshes of the Guadalquivir River, mum number of individuals during the in Andalusia (Southern Spain), and particu- 2003/2004 wintering period was 17 birds, larly the rice fields around the river. In the and at least 16 birds in the preceding peri- early nineties, the number of individuals od (SEO/Birdlife-Málaga; Environmental varied between 16 and 32 (an average agents of the Territorial Section from High of 24 individuals) on the right river bank and Middle Guadalhorce Valley-Junta de (Manez & Garrido 1996). In the last decade Andalucía). This number seems to remain more information has been published constant throughout the following years about other Marshes of the Guadalquivir (2004/2006). and the surrounding rice fields. Parkes et Other important places are located in al. (2001) report 57 birds in the 1998-1999 Badajoz province, in the Southwest of winter period, 58 birds in 1999-2000 and Spain. In the middle of the nineties, there 54 birds in 2000-2001 in a rice field near were four wintering places. The Orellana the left bank of Guadalquivir River. The reservoir was the most important site in 10 Biota 7/1-2, 2006 CANO ALONSO

Figure 2. Group of Black Storks in rice field (Seville, Spain). Photo: Alejandro Torés.

Badajoz, where up to 25 birds were found habitat in Iberia is the rice fields. Over 50% (Traverso & Galan 1996). At the moment, of observations take place in this habitat. the number of birds in Orellana reservoir Ponds and collected rivers are other impor- is approximately the same, but there are at tant habitats. The trofic availability is high least 14 wintering places in this province. in all cases and the water depth remains The Black Stork wintering habitat is highly low all winter. The Red Swamp Crayfish varied in this province, including reser- Procambarus clarkia is very important voirs, rice fields, streams, ponds, even rub- because it is the fundamental diet in many bish dumps. The bird density is low except places during the winter. The abundance on the Guadiana River. Around 50 indi- of this invertebrate is high in the rice fields viduals can be in this province during the and certain rivers, and it is a very easy prey winter. The origin of these birds is Iberia, for Black Storks. but there are controls of Czech birds in There is a high fidelity for the wintering this season (the same Czech individual was places of the Iberian birds and non-Iberian observed on November 1999 and 2003; birds. For example, there are controls of Traverso, personal comment). In addition, a Portuguese bird born in 1996, in the there are other places in Iberia where Black Marshes of the Guadalquivir River from Storks are seen every year, where one or 1998 to 2003. two Black Storks can be observed, and the The movement of individuals during the density of the storks is low. winter appears reduced because there Many of the individuals in the Iberian are controls of the same ringed birds in Peninsula in winter are adults (about 80%) the same places during this season (data (Parkes et al. 2001), which suggests that from Angulo; Lopez Huertas; Parkes; Reyes; some local pairs remain over winter in the Romero; Tamayo Torés; Traverso). This area, taking some benefits from this migra- observation appears to be corroborated tory strategy (Parejo et al. 1996). by satellite tracking of Black Storks in Iberia during the winter period (Pojer & Torés, Ecology personal comments). The most important Black Stork wintering The distribution of birds in wintering places CANO ALONSO Biota 7/1-2, 2006 11

Figure 3. Juvenile of Black Stork wintering in a rubbish dump (Burgos, Spain). Winter 2002/2003. Photo: J. Eduardo Mateos.

is very important for the discovery of eco- internet). The number of reservoirs, ponds logical aspects of the Black Storks in this and collected rivers has also increased in season. There is some evidence that sug- Portugal and Spain in the past decade. gests that the ideal free distribution model Another reason could be the increase of (Fretwell & Lucas 1970) may explain the the Iberian and central-European Black distribution of Black Storks in the Iberian Stork population: More birds in general Peninsula during the winter season. in this area mean more birds wintering in Preliminary data of monitoring works Spain. (Parkes et al. 2001, Equipo de seguimiento It is seems that the observed migrato- de procesos naturales-EBD-CSIC, on the ry strategy in Black Stork in the Iberian internet, Traverso, personal comment), Peninsula in winter reassembles processes suggest that the number of birds in places previously reported in White Stork (Tortosa increases only to a certain limit, and then et al. 2002). Unfortunately, a very impor- another wintering place is established by tant problem remains: several wintering other birds. Black Stork locations do not have any pro- The increase in the number of Black Storks tection in Iberia. in the Iberian Peninsula in winter seems clear throughout the last decade. There Acknowledgements are several reasons that can help to explain The support of Alejandro Torés, Dr. José Luis this phenomenon. First, habitat suitability Tellería, Fina Alonso and Alicia Hernansanz has been increased. For example, in Spain has been essential for the development of the surface of rice fields has been increased this work. Additionally, I am very grateful to from an average of 74,760 hectares in the Javier Prieta; Cristina Parkes; Daniel López period 1985-1989 to an average of 113,400 Huertas; Antonio Tamayo; José Antonio hectares in the period 1997-2001 (from Ángulo Farfán; Roberto Carbonell Alanís; 32,900 hectares in 1996 to 40,000 hect- Isidoro Carbonell Alanís; César Sansegundo; ares in 2000 in Andalusia MAPA, on the Francisco Chiclana; David González Ortega; 12 Biota 7/1-2, 2006 CANO ALONSO

J. Eduardo Mateos; Ricard Gutiérrez; Miguel the Association “Amigos de la Janda” for Ángel Núñez; Dave Langlois; Marc Perís; their contribution and participation in this Víctor Manuel Pizarro; José María Traverso project. Really, they are co-authors of this Martínez; Rafael Romero; Eduardo Soto- paper. The help of Axel Mahlau, Juaco Largo; Salvador Pacheco; Juan José Ramos Grijota and the company GesNatura s.l. Encalado; Javier Briz; Carlos Usieto; José have been very important for the develop- Manuel Garcia Hernandez, Environmental ment of this communication. agents of the Territorial Section from High Also, I should like to extend my grateful and Middle Guadalhorce Valley-Junta thanks to Frantisek Pojer; Carlos Pacheco, de Andalucía; SEOBirdLife/Málaga local Wim Van den Bossche and Gerard Jadoul group; SEOBirdLife/Sevilla local group and for their help.

References BOBEK, M., POJER, F., PESKE, L. & SIMEK, J. 2003: Wintering of Black Storks (Ciconia nigra) from the Czech Republic in different parts of Africa. Third International Black Stork Conference, Fourneau Saint-Michel (Belgique / Belgium), March 28-31 2001. Aves 40: 176-178. BOBEK, M., PESKE, L., RABAS, P., POJER, F. & SIMEK, J. 2004: New Odyssey: A satellite tracking of the migration of Black Storks Ciconia nigra From Siberia- Preliminary results. Dávod Püspökpuszta (Hungary), April 2004. CRAMP, S. & SIMMONDS, K.E.L. eds 1977: Handbook of the Birds of Europe, the Middle East and North Africa. The Birds of the Western Palearctic. Volume I. Ostrich to Ducks, in Oxford University Press. EQUIPO DE SEGUIMIENTO DE PROCESOS NATURALES-EBD-CSIC 2002: Censo internacional de aves invernantes de las marismas del Guadalquivir, on the internet: http://rbd.ebd. csic.es/cinternacional/dircinternacional.htm. FRETWELL, S. & LUCAS, H.L. 1970: On territorial behavior and other factors influencing habitat distribution in birds. I. Theoretical development. Acta Biotheoretica 19: 16–36. HANCOCK, J.A., KUSHLAN, J.A. & KAHL, M. P. 1992: Storks, Ibises, and Spoonbills of the World, in Academic Press, ISBN 0-12-322730-5, ed.: KEITH Stuart, URBAN Emil K. & FRY C. Hilary. New York. MÁÑEZ, M. & GARRIDO, H. 1996: The Black Stork in the Marismas of Guadalquivir River (Andalusia), Spain. Second Black Stork Conference. ADENEX, Trujillo (Spain), March 1996. MAPA 2004: Encuesta sobre superficies y rendimientos de cultivos (ESYRCE), on the Internet: www.mapa.es. PAREJO, D., LÓPEZ, A. & CORBACHO, C. 1996: Wintering of the Black Stork in Extremadura, Spain: Analysis. Second Black Stork Conference. ADENEX, Trujillo (Spain), March 1996. PARKES, C., TORES RUIZ, A. & TORES SANCHEZ, A. 2001: Población invernante de Cigüeña Negra (Ciconia nigra) en los arrozales junto al río Guadalquivir, in the internet http://alados. org SANSEGUNDO, C. 1992: Áreas de concentración e invernada de la Cigüeña Negra en España. En TORTOSA, F.S., CABALLERO, J.M. & REYES-LÓPEZ, J. 2002: Effect of Rubbish Dumps on Breeding Success in the White Stork in Southern Spain. Waterbirds 25: 39–43. TRAVERSO, J.M. & GALÁN, C. 1996: Wintering of the Black Stork in NE. Badajoz province (Extremadura), Spain. Second Black Stork Conference. ADENEX, Trujillo (Spain), March 1996. CANO ALONSO Biota 7/1-2, 2006 13

VAN DEN BOSSCHE, W. 1996: Wintering of the Black Stork in Israel. Second Black Stork Conference. ADENEX, Trujillo (Spain), March 1996. VAN DEN BOSSCHE, W. 2003: Black Storks (Ciconia nigra) wintering in Northern Israel. Third International Black Stork Conference, Fourneau Saint-Michel (Belgique / Belgium), March 28-31 2001. Aves 40: 127-139.

Yearbooks consulted: ANUARIO ORNITOLÓGICO DE ASTURIAS, in the internet: http://valdellera.biz/anuario.htm ANUARIO ORNITOLÓGICO DE LA PROVINCIA DE BURGOS, on the internet: http://avesdeburgos. com/anuario.htm. BERMEJO, A.; DE la PUENTE, J. & J. SEOANE (eds.) (2001): Anuario Ornitológico de Madrid 2000, ISBN 84-93000-3-5, ed.: SEO-Monticola. Madrid. BERMEJO, A.; DE la PUENTE, J. & J. SEOANE (eds.). (2002): Anuario Ornitológico de Madrid 2001. ISBN 84-93000-6X, ed.: SEO-Monticola. Madrid. DE la PUENTE, J.; BERMEJO, A. & J. SEOANE. (1997): Anuario Ornitológico de Madrid 1996. ISBN 84-605-6583-I, ed.: SEO-Monticola. Madrid. DE la PUENTE, J.; BERMEJO, A. & J. SEOANE. (1998): Anuario Ornitológico de Madrid 1997. ISBN 84-930000-0-0, ed.: SEO-Monticola. Madrid. DE la PUENTE, J.; BERMEJO, A. & J. SEOANE. (1999): Anuario Ornitológico de Madrid 1998, ISBN 84-930000-1-9, ed.: SEO-Monticola. Madrid. DE la PUENTE, J.; BERMEJO, A. & J. SEOANE (eds.). (2000): Anuario Ornitológico de Madrid 1999 ISBN 84-930000-2-9, ed.: SEO-Monticola. Madrid. GOROSTI (2000): Anu. Ornit. de Navarra. Vol. 5: 87-123. 1998, on the internet: http://www.retena. es/personales/allamas/anuario. GOROSTI (2001): Anu. Ornit. de Navarra. Vol. 6: 71-111. 1999, on the internet: http://www.retena. es/personales/allamas/anuario. 14 Biota 7/1-2, 2006 CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & FERNÁNDEZ-GARCÍA Biota 7/1-2, 2006 15

The breeding population of Black Stork Ciconia nigra in the Iberian Peninsula

Luis Santiago CANO ALONSO1, Cláudia FRANCO2, Carlos PACHECO2, Susana REIS3, Gonçalo ROSA4 & Manuel FERNÁNDEZ-GARCÍA5

1 Departamento de Zoología y Antropología Física (Vertebrados), Facultad de Biología, Universidad Complutense, Ciudad Universitaria, 28040 Madrid. Spain E-mail: [email protected] 2 Instituto da Conservação da Natureza, Rua de Santa Marta 55, 1169-294 Lisboa, Portugal 3 Rua Quiloa, no3, 2800-230 Cova da Piedade, Portugal 4 Rua da Juventude, lote 19, 2o dir, Pinhal dos Frades 2840 Seixal, Portugal 5 GesNatura s.l., Avenida de Brasil 4. E-28020 Madrid, Spain

Abstract The Iberian Peninsula is situated in the western extreme of Europe, and it is the limit of the Black Stork distribution of the western Palaearctic. The Black Stork in Iberia occupies the south western quadrant of the Peninsula in both Portugal and Spain, and is geographically separate from the population in Central and Eastern Europe. In the early nineties the popu- lation was estimated at 230-270 pairs (European Birds Population: estimates and trends). We compiled recent data collected between 1995 and 2002 in a national (Portugal: 1995- 1997) and regional (Spain: 1996-2002) census and surveyed the population of 405-483 pairs (83 confirmed and 13 possible pairs in Portugal and 322 confirmed and 65 possible pairs in Spain). However, the census effort was unequal between all areas and we suspect that the value might be slightly underestimated. The Iberian population represents between 4% and 7% of the European and about half of European Union breeding population. The increase in the estimates since the early nineties is certainly a result of better coverage and census efforts, but there is some evidence of a small increase in the population. There is apparent stability in the number of pairs in the core area and an expansion in the edge of the distribution. Most nests are placed on rocks (69%) in both riverine and mountain cliffs and the remaining (31%) are in trees, mainly Cork Oak and pines. Finally, we present cur- rent threats, limiting factors and conservation measures in both Portugal and Spain.

Keywords: Ciconia nigra, breeding, Iberian peninsula

Received 29 January 2007; accepted 9 May 2007 CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & 16 Biota 7/1-2, 2006 FERNÁNDEZ-GARCÍA

INTRODUCTION 1987 (Gonzalez 1987), but similarly it was The Iberian Peninsula is located at the incomplete. southwestern extreme of Europe, and it In the nineties, the first national census was is at the western limit of the Black Stork’s done in Portugal (Rosa et al. 2001). In this Ciconia nigra distribution in the western same period, the political situation changed Palaearctic. The Black Stork occupies the in Spain; each Spanish Autonomous southwestern quadrant of the Iberian Community was granted environmen- Peninsula in both Portugal and Spain. This tal responsibility for its territory and each population is geographically separate from region organised its own Black Stork cen- a much larger one in Central and Eastern sus. An outcome of this situation is that Europe (Cramp 1977). Until the end of the nowadays there is detailed information last century, information about the Iberian about the population and distribution of population was scarce and was always Black Stork in Spain, but this information analysed separately in each country. In the is scattered and has never been analysed eighties, the only information available for as a unit. Portugal was published in a National Atlas Although many studies were regional- of breeding birds (Rufino 1989), although ly important for the establishment and there was no directed effort for Black Stork implementation of conservation measures, and the estimate was rather incomplete. In it is necessary to have a global and biologi- Spain, a national census was carried out in cally more meaningful perspective of the

Figure 1. Administrative divisions in the Iberian Peninsula where the Black Stork breeding population occurs: provinces (brown) and Autonomous Communities (black) in Spain and dis- tricts (grey) in Portugal.

Castilla y León ;BNPSB #SBHBOÎB 4FHPWJB 4BMBNBODB SPAIN (VBSEB «WJMB Madrid $PJNCSB .BES J E $BTUFMP
#SBODP 5PMFEP $ÈDFSFT 4BOUBSÏN Castilla-La Mancha 1PSUBMFHSF Extremadura $JVEBE
3FBM ²WPSB #BEBKP[

$ØSEPCB +BÏO #FKB )VFMWB 4FWJMMB Andalucia

PORTUGAL CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & FERNÁNDEZ-GARCÍA Biota 7/1-2, 2006 17

Table 1. Breeding pairs of Black Stork in Portugal and Autonomous Communities of Spain.

Autonomous Country Pairs Period Method Source Communities PORTUGAL - 83-96 1995-97 National census Rosa et al., 2001 1997, 2001, Forest rangers CMA-Junta de Andalucía 52-66 2002 monitoring Andalucía/Red Book Castilla-La Provincial cen- CA y MA-JCCLM/ 24-34 1999, 2001 Mancha sus Red Book Provincial CMA-Junta de census; Forest SPAIN Castilla y León 61-80 2000 Castilla y León/Red rangers moni- Book toring DGMA-Junta Forest rangers Extremadura 173-195 2002 Extremadura/Red monitoring Book Regional cen- CMA Madrid/Red Madrid 12 2001 sus Book TOTAL IBERIA 405-483

Iberian population. Therefore, we decided breeding population in Spain (see acknowl- to compile the information available from edgements). both countries instead of presenting it as The information collected was the follow- separate national census. This might con- ing: tribute to a better understanding of the Confirmed pairs - pairs with known nests population limitations and trends and for and confirmed reproduction (all of Spain) the definition of conservation measures, and secure pairs, even if the nest was mainly in border areas between different unknown (14 pairs in Portugal). This rep- administrative regions. resents the minimum number of breeding pairs. METHODS Estimated pairs - this is the number of We compiled the most recent information confirmed breeding pairs plus the number about the breeding population of Black of possible breeding pairs (pairs which the Stork in Portugal and Spain. The data from evidence suggest exist, although they are Portugal was obtained during the national not secure). census that took place between 1995 and Distribution of breeding pairs for the 1997 (Rosa et al. 2001). Data from Spain Iberian Peninsula in an UTM grid of 10 per comes from provincial and regional census 10 kilometres. carried out between 1997 and 2002 and Breeding habitat. We defined the breeding compiled for the Atlas of the Breeding Birds habitat in the Iberian Peninsula according of Spain (Cano & Hernández 2003) and for to the dominant forest type and topogra- the Red Data Book of Birds of Spain (Cano phy. We identified three main types of nest & Hernández 2002). The contribution of supports: trees, river cliffs and hill cliffs. the regional or provincial Environmental Data shown relates only to active nests. Services was essential to obtain an impor- Threats and limiting factors were identified tant part of the information about the from monitoring programs in both coun- CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & 18 Biota 7/1-2, 2006 FERNÁNDEZ-GARCÍA

Figure 2. Distribution of confirmed pairs of Black Stork (dots in 10x10km square UTM grid) and range (darker), with administrative limits as background (see fig. 1).

tries and the Red Data Book of Portuguese ing pairs when compared with a previous Vertebrates (Almeida et. al. 2005 and the one published in the early nineties (Tucker regional conservation plans (Castilla et al. 1994). This increase results from bet- La Mancha and Castilla y Leon) and the ter coverage and census effort, but there Red Data Book of Spainish Birds (Cano & is also evidence of a small increase in both Hernández 2002) we consulted. The mag- population size and range in both coun- nitude of threats and limiting factors was tries. classified in four qualitative categories: The Black Stork breeds in eight districts of Low, Medium, High and Unknown. Portugal and thirteen provinces of Spain, Finally, we reviewed the conservation strat- corresponding to five autonomous com- egy for the Iberian Peninsula concerning munities, one more autonomous com- the Natura 2000 Sites (Council Directive munity when compared with data from 92/43/EEC of 21 May 1992). the first census (Fernández et al. 2001) (Figure 1). The distribution of the breeding RESULTS AND DISCUSSION pairs in Portugal and Spanish Autonomous Breeding population and distribu- Communities is shown in Table 1 and Figure tion 2. One Spanish Autonomous Community, The population estimate for the Iberian Extremadura, contains the core of the Peninsula is 405 to 483 pairs. This estimate Iberian population, in the centre of the shows an increase in the number of breed- distribution area, with 173-195 breeding CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & FERNÁNDEZ-GARCÍA Biota 7/1-2, 2006 19 pairs. The number of breeding pairs per Douro basins. Cliffs are relatively common province in Spain and district in Portugal is in the main river valleys and their subsidiar- shown in Figure 3. According to our data, ies and they are inhabited by an important there is apparent stability in the number part of the population, mostly in border of pairs in this region throughout the last areas between Portugal and Spain. decade, while an increase and an expan- - Hills and mountains are used as breeding sion of range was observed in some areas areas, especially if cliffs are available. This in the edge of the distribution (Figure 4). habitat type is well represented in the cen- Analysing the distribution of Black Stork tre of Portugal and western Spain. according to the main drainage basins - Mature pine forests are an important shows that the Tagus basin, in the centre breeding habitat, mainly in the moun- of the Iberian Peninsula, is by far the most tains and valleys of the centre of the Black important in Iberia, containing nearly 200 Stork’s range. pairs. Guadiana basin has approximately - Evergreen oak agro-system and Mediter- 100 pairs, Douro has over 60 pairs, and ranean wood and scrubland are the typical Guadalquivir has nearly 30 pairs. breeding habitat in the southwest and northwest of the species range. Breeding habitat There are basically three types of nest sup- The Black Stork inhabits four main macro ports: trees, river cliffs and hill/mountain habitat types in the Iberian Peninsula: cliffs. The most important nest support is - Steep river valleys, mainly in Tagus and cliffs, which contain 55.3% of the active

Figure 3. Number of breeding pairs per province (Spain) and districts (Portugal). Darker colours represent higher abundance.

Figure 3: Number of breeding pairs per province (Spain) and districts (Portugal). Darker colours represent higher abundance. CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & 20 Biota 7/1-2, 2006 FERNÁNDEZ-GARCÍA

Figure 4. Trends in Black Stork breeding population. Top: number of pairs (rectangles- stability; small arrows – slight increase; large arrows – large increase; darker colours represent higher abundance). Bottom: areas of range expansion (indicated by the arrows). CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & FERNÁNDEZ-GARCÍA Biota 7/1-2, 2006 21

Table 2. Threats and inferred magnitude for the Black Stork population in the Iberian Peninsula.

Threats and limiting factors Magnitude

Habitat Loss and change 1. Dams High (big dams) 2. Forest Fires Medium 3. Replacement of mature wood with fast growing tree plantations Unknown Pollution 4. Water Pollution Unknown Human Disturbance 5. Recreational Activities High 6. Agriculture and forestry Medium 7. Use and construction of roads High 8. Shepherding Unknown Non natural Mortality 9. Collision with and electrocution by power lines Unknown 10. Accidental destruction of nests Low

Nests 11. Robbing of eggs and chicks Low nests; of which 44.2% are in river valleys Area for birds; PT ZPE0037) and Natura and 11.1% are in hill or mountain areas. 2000 site. The remaining nests (44.7%) are located in trees, mainly Quercus sp. and Pinus sp. Conservation instruments Council Directive 92/43/EEC of 21 May Threats and limiting factors 1992 proposes an Environmental net- We have identified 11 main threats to the work in the European countries for the Black Stork in Iberia (Table 2). Human dis- conservation of European biodiversity. In turbance, mostly the result of recreational theory, the areas of this network will be activities such as angling, navigation, and protected. This network has been called hiking, is the most relevant and wide- “Natura 2000 Sites”. Around 60% of breed- spread threat. The construction and use of ing sites are in these protected areas, new dirt tracks and roads close to nest sites which contribute to reinforcing conserva- is also an important disturbance factor. tion measures. Nevertheless, about 40% of Habitat loss and change caused by the the population is still not covered by any construction of big dams has a significant kind of special protection measures. Only impact by irreversible habitat loss. One two Autonomous Communities in Spain, example is the Alqueva dam, recently con- Castilla La Mancha and Castilla and León, structed in Portugal, which submerged the have developed an action plan. Madrid, nest sites of 10% of the breeding pairs in Extremadura and Andalucia (about 60% the country. A significant loss of breeding of the Iberian population) have not yet and feeding habitat is also expected with elaborated any action plan for the Black the construction of the planned Sabor Stork. Portugal has elaborated a technical dam, located in a SPA (Special Protection proposal for a national action plan. CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & 22 Biota 7/1-2, 2006 FERNÁNDEZ-GARCÍA

It is relevant to note that an important and the interior of the centre and south part of the population breeds in river val- of Portugal. An outcome of this project is leys along the border between the two the attainment of a broader view of the countries. Management of these areas species’ biology and requirements, which requires the development and application will allow the development of common of similar rules and conservation measures strategies for the conservation of the Black in both countries, which rely on coordi- Stork in Iberia. nation and joined efforts between the administrations of the two countries. The Acknowledgements first step in the conservation of impor- We are very grateful to: Roberto Carbonell tant border areas was taken with the cre- Alanís, Iñigo Fajardo (Huelva), José Antonio ation of protected areas in both countries Torres Esquivias (Córdoba), María Jesús along the Douro river (Arribas do Douro Martos (Sevilla), Salvador Pacheco (Jaen), and Arribes del Duero Natural Parks). A José Manuel Hernández García (Ciudad similar process is now taking place along Real), Ignacio Molina (Consejería de the Tagus river with the already existing Medio Ambiente de la Junta de Castilla y Tejo Internacional Natural Park and the León), Emilio Ramos (Salamanca), Alberto Tajo Internacional Natural Park, currently Madroño (SEO/BirdLife), Luis Veríssimo, under development. One issue that is now Delegación Provincial de Sevilla, Córdoba y being addressed by both countries from Huelva de la Consejería de Medio Ambiente, this cooperation perspective is the regula- Junta de Andalucia, Consejería de Medio tion of navigation along the international Ambiente de la Junta de Castilla y León, sections of the Douro rivers and Tagus Dirección General de Medio Ambiente, rivers. Another example of cooperation Junta de Extremadura, and Consejería was a INTERREG project, which included de Medio Ambiente de la Comunidad de several studies of Black Stork between the Madrid. autonomous region Extremadura (Spain)

References ALMEIDA, J., CATRY, P., ENCARNACÃO, V., FRANCO, C., GRANADEIRO, J.P., LOPES, R., MOREIRA, F., OLIVERA, P., ONOFRE, N., PACHECO, C., PINTO, M., PITTA GROZ, M.J., RAMOS, J. & SILVA, L. 2005. Ciconia nigra. In: Cabral M.J., Almeida, J., Almeida, P. R., Dellinger, T., Ferrand de Almeida, N., Oliveira, M.E., Palmeirim, J.M., Queiroz, A.I., Rogado, L. & Santos-Reis, M. Eds.: Livro Vermelho dos Vertebrados de Portugal. Instituto da Conservação da Natureza. Lisboa: 179-180. CANO ALONSO, L. S. & HERNÁNDEZ GARCÍA, J.M. 2003: Cigüeña Negra, Ciconia nigra. In: Martí, R. & Del Moral, J.C. eds. Atlas de las Aves reproductoras de España. Dirección General de Conservación de la Naturaleza-Sociedad Española de Ornitología. Madrid: 120- 121. CANO ALONSO, L. S. & HERNÁNDEZ GARCÍA, J. M. 2002: Cigüeña Negra (Ciconia nigra). In: Madroño, A., C. González, Y J. C. & Atienza eds.. Libro Rojo de las Aves de España. SEO/BirdLife. Unpublished Inform for Dirección General de Conservación de la Naturaleza /Ministerio de Medio Ambiente. Madrid. CRAMP, S. 1977: Handbook of the birds of Europe, the Middle East and North Africa. The birds of Western Palearctic. Vol. 1. Ostrich to ducks. Oxford: Oxford University Press. FERNÁNDEZ, M., CANO, L.S. & PRADA, L. 2001: The Black Stork in the Region of Madrid (Central Spain): Status, Trends and Population changes, in press, Third International Black Stork Conference. Fourneau Saint-Michel. Belgium. CANO ALONSO, FRANCO, PACHECO, REIS, ROSA & FERNÁNDEZ-GARCÍA Biota 7/1-2, 2006 23

GONZÁLEZ, J.L. 1987: Inventario de la población española de Cigüeña Negra. Unpublished inform, ICONA. Madrid. ROSA, G., PACHECO, C., MONTEIRO, A., CARVALHO, A. & ARAÚJO, A. 2001: Situaçao da Cegonha- preta Ciconia nigra em Portugal: Receseamento da populaçao nidificante (1995- 1997), in press, Airo 11: 15-22. RUFINO, R. coord. 1989: Altas das aves que nidificam em Portugal continental. CEMPA/SNPRCN, Lisboa. TUCKER, G.M., HEATH, M.F., TOMIALOJC, L. & GRIMMETT, R.F.A. 1994: Birds in Europe: Their Conservation Status, in BirdLife conservation series 3. BirdLife International. Cambridge. U.K. 24 Biota 7/1-2, 2006 DORNBUSCH Biota 7/1-2, 2006 25

The Black Stork Ciconia nigra in Germany

Gunthard DORNBUSCH

Staatliche Vogelschutzwarte Steckby, Zerbster St. 7. D-39264 Steckby, Germany E-mail: [email protected]

Abstract The Black Stork Ciconia nigra is distributed in three distinct populations in Eurasia, the Iberian Peninsula, and Southern Africa. The world population numbers 12,000 breeding pairs. Europe is the distribution centre of the breeding population. These 6,500 European breeding pairs are mainly settled in the area between Latvia, Germany, and Hungary. Germany represents only a small fraction of the distribution area. There were only 10 to 20 breeding pairs in the north between 1950 and 1960. From 1971 to 1990, the number increased to more than 170 pairs. Since 1986 we have recognized an important increase from east to west. In Germany a total of 430 occupied territories with 330 breeding pairs were known in 2001. The centre of settlement is found in the mixed forest region from Brandenburg, Sachsen-Anhalt, and Niedersachsen. Also, a large population of Black Stork exists in Nordrhein-Westfalen, Hessen, and Bayern. Since 1990 there has been a strong recolonization of the western and southwestern parts of Germany.

Keywords: Black Stork, distribution, population, trend

Received 9 February 2007; accepted 27 June 2007 26 Biota 7/1-2, 2006 DORNBUSCH

The situation and protection of the Black 1950 - 1960 10 - 20 BP, Stork in Germany must be seen in context 1961 - 1970 population increase up with the species distribution in the whole to 35 BP, area (Dornbusch 2000). In divided parts of 1971 - 1990 population growth to the wide breeding area, there are three dif- more than 170 BP, ferentiated populations in Eurasia, Iberian around 1995 ca. 300 BP, Peninsula, and Southern Africa (Del Hoyo 2001 430 occupied territories et al. 1992). including 330 occupied nests or BP, Table 2 Large groups of Black Stork, for instance, (Dornbusch 1993, Dornbusch 2003). live in Belarus, with 950 – 1,300 breed- This development is shown in figure 2. ing pairs (BP), in Latvia with 750 - 900 Today there is a verified documented view BP, and in Lithuania with 400 - 600 BP. In on the status of the breeding population Central Europe there are strongholds of resulting from a German specialist group settlements in Poland with 950 – 1,200 meeting entitled “Bestand, Erfassung und BP, in Slovakia with 400 - 600 BP, in the Schutz des Schwarzstorchs in Deutschland” Czech Republic with 300 - 400 BP, and in which took place from April 18 – 19, 2002 in Germany with 300 - 400 BP (Czuchnowski the Bird Protection Observatory at Steckby. & Profus 2004 et pers. comm., Dornbusch This gives an insight into the status of Black & Dornbusch 1998, Pojer 2004, Rybanic & Stork in Germany with an accuracy never Karaska 2004, Strazds 1996, 1998). before achieved. In Asia, in recent years there seems to have The most important stronghold of sta- been a population decrease, but there ble settlements in Germany is the mixed are no known counts, and therefore the woodland zone of Brandenburg, Sachsen- maximal dates of the population estimate Anhalt and Niedersachsen with at least are founded on a longer average time 100 BP, nearly 30% of the German popula- in the past. One estimate of the world tion group. In comparison with the strong population is nearly 12,000 breeding pairs recolonization on the western and south- (Table 1; Balogh & Tamás 2004, Dornbusch western border of the breeding area in 2000, 2001, Dornbusch & Dornbusch 1998, the years after 1990, there are also good Heath et al. 2000, Pojer 2004, Strazds 1996, numbers in Nordrhein-Westfalen with 30 1998, 2001). BP, in Hessen with 50 BP, and in Bayern Over time and a wide geographical with 70 BP. Some dates concerning repro- range there have been marked popula- duction, landscape binding, and nest site tion changes of the species. Since the distribution, in accordance with the SPA mid 19th century, the Black Stork has dis- in Sachsen-Anhalt, are shown in Figures appeared from many regions in Central 3 and 4. In Sachsen-Anhalt nearly 50% of Europe, but vigorous growth of new settle- nest sites are protected in SPA, some in ments began in the middle of the 20th nature reserves, and others with nest pro- century. For example, the development of tection zones of 100 - 300 m around them. a population group of the Black Stork in Black Stork requires global protection. An Sachsen-Anhalt (Germany) between 1876 international network of protected and and 2003 is offered here (Figure 1). In sustainable managed sites for breeding, Germany, population dynamics took the migration resting, and wintering is of top following course: priority for the conservation of this fasci- nating species. DORNBUSCH Biota 7/1-2, 2006 27

Table 1. Status of the Black Stork Ciconia nigra in the world, estimate 1998 – 2003.

Region Breeding pairs (BP) Population estimate (BP) W / N / C Europe 2,470 – 3,130 S / SE Europe 670 – 810 E Europe 2,860 – 3,860 = European range of Eurasian population 6,000 – 7,800 ca. 7,000 Transcaucasus ca. 80 W Turkestan ca. 190 W Siberia ca. 1,100 C / E Siberia ca. 160 Far East ca. 240 Anterior Asia ca. 1,250 China, Mongolia, Korea ca. 1,180 = Asian range of Eurasian population 3,000 – 4,200 ca. 4,000 Iberian Peninsula 400 – 500 ca. 500 Southern Africa 400 – 600 ca. 500 World population range 9,800 – 13,100 ca. 12,000

Table 2. Status of the Black Stork Ciconia nigra in Germany 2001.

Breeding Territorial pairs Region References pairs (BP) (TP) incl. BP Schleswig-Holstein 8 9 Janssen & Kock 2001 Mecklenburg- 13 15 C. Rohde pers. comm. Vorpommern Niedersachsen 42 47 Staatl. Vogelschutzwarte in NLÖ 2002 Sachsen-Anhalt 23 33 Dornbusch, G. 2001 add. Brandenburg 35 43 T. Ryslavy pers. comm. Nordrhein-Westfalen 32 45 M. Jöbges pers. comm. Saarland 0 0 M. Hormann pers. comm. Rheinland-Pfalz 13 15 K. Isselbächer pers. comm. Hessen 52 82 M. Hormann pers. comm. Thüringen 22 ca. 35 S. Klaus pers. comm. Rau, Ulbricht & Zöphel Ms. 2002 et pers. Sachsen 29 35 comm. Baden-Württemberg 0 0 D. Schmidt in litt. Bayern ca. 70 ca. 80 R. Pfeifer in litt. Germany ca. 339 BP ca. 439 TP i.e. ca. 430 territorial pairs (TP) [= occupied territories] incl. ca. 330 breeding pairs (BP) [= occupied nests] [State: 2004 - 02 - 20] 28 Biota 7/1-2, 2006 DORNBUSCH

Figure 1. Population dynamics of the Black Stork Ciconia nigra in Sachsen 1876 – 2003.

Figure 2. Population dynamics of the Black Stork Ciconia nigra in Germany 1950 – 2001. DORNBUSCH Biota 7/1-2, 2006 29

Figure 3. Population dynamics and reproduction of the Black Stork Ciconia nigra in Sachsen 1981 – 2003.

Figure 4. Population dynamics of the Black Stork Ciconia nigra in the lowlands and Harz moun- tains in Sachsen 1981 – 2003, with the reproduction rate. 30 Biota 7/1-2, 2006 DORNBUSCH

REFERENCES BALOGH, E. & TAMAS, E. A. ed. 2004: 4. International Conference on the Black Stork (Ciconia nigra), Abstract vol., Dávod-Püspökpuszta/Hungary 2004. Baja, 1 - 123. CZUCHNOWSKI, R. & P. PROFUS 2004: The Black Stork Ciconia nigra in Poland: present status, ecology and protection. In: Balogh, E. et al., Abstr. vol. 4. IBSC in Hungary, 66. COULTER, M. C. & SIS et IWRB 1993: Action Plan Storks, Ibises and Spoonbills. Draft, Sept. 1993. In: CMS (Bonn Convention), AEWA Draft 1, 33 - 47 et 2, 85 - 86, Sep. CMS Secret. Bonn. DORNBUSCH, G. 2000: Der Schwarzstorch: Status, Gefährdungen und Schutzziele. Schriftenr. Landschaftspflege Naturschutz, Bonn, 60, 53 - 62. DORNBUSCH, G. 2001: Verbreitung, Gefährdung und Schutz des Schwarzstorchs. 2. Jubiläumsbd. Weißstorch, Tagungsbd. 8. u. 9. Sachsen-Anhaltischer Storchentag 1999 u. 2000, Loburg, 73 - 77. DORNBUSCH, G. 2003: Zur Bestandsentwicklung des Schwarzstorchs in Deutschland. Ms. (Vortrag 2. Überregionale Weiß- und Schwarzstorch-Tagung 28. - 30.03.2003 in Petershagen-Windheim, Kr. Minden-Lübbecke.) DORNBUSCH; G. 2006: Zur Bestandsentwicklung des Schwarzstorchs Ciconia nigra in Deutschland. Charadrius 41, 1/2, 79 - 83. DORNBUSCH, G. & DORNBUSCH, M. 1998: Populations and Status of the Black Stork Ciconia nigra in the World. Ms. DORNBUSCH, M. 1993: Zur Situation des Schwarzstorchs in Mitteleuropa. Tagungsbd. Int. Weißstorch- u. Schwarzstorch-Tagung März 1992 in Minden, Schriftenr. Umwelt u. Naturschutz Kr. Minden-Lübbecke 2, 47 - 48. FERRERO, J. J. ed. 1996: 2. International Conference on the Black Stork, Abstracts, Trujillo/Spain 1996. Mérida, 1 - 130. HEATH, M., BORGGREVE, C. & N. PEET 2000: Black Stork Ciconia nigra. In: European bird popula- tions, Estimates and trends, Cambridge, 19. DEL HOYO, J., ELLIOTT, A. & J. SARGATAL 1992: Handbook of the Birds of the World. Vol. 1. Barcelona. JADOUL, G., LIBOIS, R., BOSCHE, W. VAN DEN & STRAZDS, M. 2001: 3. International Black Stork Conference, Program et Abstracts, Fourneau Saint-Michel/Belgium 2001. C. R. I. E. et SOLON, Fourneau Saint-Michel, 1 - 124. JANSSEN, G. & J. KOCK 2001: Schwarzstorch. In: Min. Umwelt, Natur u. Forsten Schleswig- Holstein, Jagd u. Artenschutz, Jber. 2001, 44 - 46. POJER, F. 2004: NATURA 2000 in the Czech Republic. A proposal of SPAs for the Black Stork (Ciconia nigra). Poster paper 4. IBSC in Hungary. RYBANIC, R. & D. KARASKA 2004: Populations of Black Stork in Slovakia, its distribution, breeding habitats, ringing, recoveries and protection. In: Balogh, E. et al., Abstr. vol. 4. IBSC in Hungary, 74. STRAZDS, M. 1996: Status of the Black Stork in the World. In: Ferrero, J. J. et al., 2. Int. Conf. on the Black Stork, Abstracts, Trujillo/Spain 1996, Mérida, 10 – 11, et in litt. STRAZDS, M. 1998: The status of the world Black Stork population and ringing recoveries, are all nests equal? Torgos 28, 223 - 232. STRAZDS, M. 2001: Conservation status of the Black Stork in the world. In: Jadoul, G. et al., Abstr. 3. IBSC in Belgium, 9. STRAZDS, M. ed. 1993: 1. International Black Stork Conservation and Ecology Symposium, Abstracts, Jurmala/Latvia 1993. Jurmala, 1 - 108. FERNANDES, BORGES, SIMÕES, CABALLERO, PACHECO & FRANCO Biota 7/1-2, 2006 31

Molecular sexing of the Black Stork Ciconia nigra: sex ratios in the Portuguese population

Margarida FERNANDES1, Carla BORGES2, Fernanda SIMÕES2, José Manuel CABALLERO3, Carlos PACHECO1 & Cláudia FRANCO1;

1Instituto da Conservação da Natureza, Rua de Santa Marta, 55, 1169-294 Lisboa, Portugal, E-mail: [email protected] 2INETI-Dept Biotechnology, Estrada do Paço do Lumiar, 22, Lisboa, Portugal 3Junta de Extremadura, Avenida de Portugal s/n, Mérida, Spain

Abstract We sexed 125 chicks of black stork ringed between 2003 and 2005 in Portugal. We used a combination of molecular methods which effectively determine sex in this species. Analysis was done mainly using feather samples, applying a non invasive approach to a threatened population. Sex ratios and female proportion within broods were calculated. An excess of females was observed during the years studied, and globally, the deviation from parity was statistically significant. This result needs to be confirmed and related to changes in habitat quality. The sex ratio of black stork populations should be monitored in the long term as they may be an important source of information for monitoring ecological stress. This is the first assessment of sex in a wild population in Portugal.

Key words: Black Stork, Ciconia nigra, sex ratio, Portugal

Received 6 February 2007; accepted 4 April 2007 FERNANDES, BORGES, SIMÕES, CABALLERO, 32 Biota 7/1-2, 2006 PACHECO & FRANCO

INTRODUCTION ened in Portugal and Spain, with a recent Unlike many other bird species, it is not attribution of the IUCN Red List category possible to reliably determine the sex of Vulnerable (Cano Alonso & Hernandez of Black Storks Ciconia nigra by external Garcia 2004, Almeida et al 2005). Part of the morphological observation. Cramp (1977) Iberian population, around 100 pairs (Rosa described the sexes in this species as “alike”, et al 2001), breeds in Portugal, choosing although other authors have pointed out undisturbed areas of rocky habitat or for- discrete differences such as adult males est (Franco & Pacheco, pers. comm.). Since being on average larger (Del Hoyo et al. the 1990s an annual monitoring of nests 1992). Molecular determination of sex in has been performed in Portugal, including birds is now a common procedure with ringing of chicks. In 2003, other studies a wide range of applications from sexing were started, involving satellite tracking chicks and forensics to bird aviary man- of some individuals (Franco 2006) and a agement. It allows sexing from a small genetic study of the population which sample of tissue using a non invasive pro- indicates low genetic variability (data not cedure for the wild animals. However, the presented, Fernandes et al in prep). same techniques do not apply for all spe- Knowledge of the sex of an individual is cies. Molecular sexing has been described important in population studies because for Ciconia boyciana (Itoh et al 1997) and many life history characters including sur- other storks (Tomasulo et al 2002) but to vival, fecundity, and dispersal may differ date there has been no published data on between sexes. Sex ratio is also of interest molecular methods of determination of to evolutionary biologists as the target sex in black stork. Sexing of animals yields itself of natural selection (Lessells et al important information for ecological and 1996). population studies, individual life history, We describe an effective combination of and long term monitoring of ringed birds. methods for sexing black stork and pres- It also allows the calculation of sex ratios in ent results obtained for individuals ringed a population which is subjected to environ- in Portugal from 2003 to 2005. Sex ratios mental variation or change and adaptation of the population in Portugal were calcu- of the species. Sex ratio adjustments have lated. recently been described for some species depending on habitat quality (Stauss et al MATERIALS & METHODS 2005) and maternal condition (Gilbert et Bird sampling al 2005). Material was collected in Portugal in 2003- Among black storks breeding in Europe, 2005 (Table 1). During nest control, all different populations exist; one of the chicks from each brood were sampled smallest, 405-483 pairs (Cano Alonso et al, corresponding to a total number of 137 in press), breeds in the Iberian Peninsula. samples. In certain cases the same nests The Iberian population is geographically were controlled during two consecu- isolated (Cramp 1977, Birdlife International tive years. Around 6-10 growing feathers 2004) and partly resident (Bernis 1974, were plucked from the chicks, which were Parkes & Torés Sanchez 2003), although between 33 and 52 days of age (n = 123). most birds migrate to winter in Africa Feathers were stored in paper envelopes in (Cramp 1977). It is thought that black storks a dry and dark place. Moreover, to guaran- show breeding site fidelity, so this popu- tee a high DNA content in one sample per lation might be isolated in reproductive brood, approximately 200µl of blood was terms. Mainly because of its small popula- collected from one of the chicks in each tion size, the species is considered threat- brood (n = 34) and later stored at -20ºC. FERNANDES, BORGES, SIMÕES, CABALLERO, PACHECO & FRANCO Biota 7/1-2, 2006 33

Figure 1. Molecular sexing of Black Stork. Digestion was performed overnight at Results of Asp700I digestion of PCR products 55ºC. The lysis buffer volume was adjusted amplified with P2/ P8. Samples with two to the size and number of the feathers bands (378bp and 280bp) are females (1, 2, 3, (350-600µl). We also used a higher quan- 4 and 8) and with one band (378bp) are males tity of cold (-70ºC) ethanol (350-500µl). For (5, 6 and 7). M = 100bp marker (Fermentas). feather samples 30µl of DTT was previously added, freshly prepared, following the rec- ommendation of Sorenson (pers.comm; Sefc et al. 2003). DNA was finally recovered in 50-80µl of elution buffer and stored at 4ºC for immediate use. We amplified all samples with primers P2 (5´-TCTGCATCGCTAAATCCTTT-3´) and P8 (5´-CTCCCAAGGATGAGRAAYTG-3´) described by Griffiths et al. (1998) and previously used for bird species. Template DNA (1.5-5µl) from blood and (1,5-10µl) from feathers was carried out in a 23µl reaction volume containing 0.9mM dNTPs, 1.6 pmol of each primer, 2.5ul of PCR buffer Two control samples from black storks of (NH4)2(SO)4, 2.7 mM MgCl2, 0,1mg/ml BSA known sex were used, to verify results of and 1U of Taq polymerase (MBI Fermentas). molecular sexing. One tissue sample was When amplification failed, ImmoMix ready obtained from a dead animal whose sex mixture for PCR (Bioline) was used and up was determined by internal morphological to 10µl of DNA was added. Amplification observation and the other was composed was performed in an iCycler BioRad ther- of feathers from a zoo animal. mocycler. PCR reactions consisted of a Sex ratio touchdown profile with a first step of 4 We used the total of broods in which all min denaturation at 94ºC, 5 cycles of 30s chicks were sexed to calculate the sex denaturation at 94 ºC, 30s annealing at ratio within each brood. Sex ratio was also 55ºC and 30 s extension at 72ºC, followed calculated for each year and for the global by 35 cycles of 30s denaturation at 94 ºC, sample using the total number of males 20s annealing at 50ºC and 20 s extension and females. We used chi-square statistics at 72ºC and a final extension step at 72ºC to test for independence between years for 5 min. and significant deviations from 1:1 ratio. After PCR amplification we added an We performed an ANOVA to test for inde- enzyme digestion step (Sacchi et al 2004). pendence of sex ratio in each brood over The products of PCR were submitted to the years using Program R - 2.1.1 (RDCT restriction enzyme digestion with Asp700 2005). or HaeIII (Roche). The reaction mix was Molecular analysis performed in a total volume of 15µl and DNA was extracted from blood using contained 0.5 units of enzyme, 12 µl of the Puregene blood kit (Gentra) or from PCR product and 1.5 µl of 10x enzyme buf- feathers using the Nucleospin tissue DNA fer. The digest was incubated at 37ºC for 3 extraction kit (Macherey-Nagel) with some hours. modifications as follows: we used a higher To detect whether contamination of sam- concentration of proteinase K per sam- ples with exogenous DNA or PCR products ple (20-25µl for a solution of 20mg/ml). had occurred, tubes without samples were FERNANDES, BORGES, SIMÕES, CABALLERO, 34 Biota 7/1-2, 2006 PACHECO & FRANCO

Table 1. Sampling of Black Stork Ciconia nigra in Portugal and number of chicks of each sex determined by molecular analysis. Female proportions within broods indicated as an average, standard deviation indicated between brackets. Sex ratio expressed in terms of percentage of females.

Number of Number of ani- No. of No. of Average proportion of Year Sex ratio nests visited mals sampled Males females females within broods 2003 19 49 17 29 0.54 0.36 0.63 2004 21 53 21 30 0.58 (0.28)0.59 2005 12 35 11 17 0.65 (0.33) 0.61 included in the DNA extraction and PCR information and may be relevant for fur- amplification procedure as negative con- ther studies. Four of these animals were trols. DNA extractions, pre-PCR and post- satellite tracked, so knowledge of their PCR pipetting were carried out in different sex can be further related with dispersion rooms and aerosol-resistant filter pipette distances, territory movements, migration tips were used to avoid contamination. timings and other aspects of their biology. The PCR products and the products of Concerning brood sex proportion, we cal- digestion were separated by 2% agarose culated the average proportion of females gel electrophoresis in 0.5x TBE at 70 V, and in each year (see table 1) and noticed an stained with ethidium bromide. apparent excess of female production. As an example, we can refer to four broods Results and discussion sampled in 2003 (three with 3 chicks and In Black Stork, female samples present one with 4 chicks) which were exclusively three bands of 378 bp, 280 bp and 107 bp, composed of female chicks. An ANOVA test although the third one may be present as was performed with year as a factor but no a very weak signal in the gel, visible only by differences were found (F value =0.3439, direct observation under UV transillumina- P >0.05). tion. Male samples present a single band of We did calculations of sex ratio per year 378 bp (Figure 1). and an excess of females was demon- A total of 125 birds were successfully sexed. strated for all the years (Table 1). We first From the individuals ringed and sampled tested if there were differences for the in Portugal, 12 failed to be amplified and number of females and males among years 2 sexed, most probably because of the low and chi-square was not significant (χ = amounts of DNA present in the sample. 0.181; P > 0.05). Then we pooled the data The use of feather samples with this meth- from three years and tested for deviation od proved to be easy and reliable, making from a 1:1 sex ratio. Chi-square was then 2 it applicable to other monitoring programs significant (χ = 5,83; P < 0.01) showing an in storks and other bird species. overproduction of females. These results Table 1 summarizes results of sex determi- are preliminary and need to be related nation for each year in Portugal. Among with other factors. Sex ratio may be deter- the Portuguese animals ringed and sexed mined by mothers and can be related to between 2003 and 2005, a significant num- habitat quality (Stauss et al 2005, Sasvari & ber is expected to be later controlled in Nishiumi 2005). Black storks in the Iberian the wild (17% of the black storks ringed Peninsula can be subjected to strong envi- in the last 30 years in Portugal were later ronmental variations caused by droughts recaptured; data from Portuguese Ringing or wet springs and differences in food Centre). Knowledge of their gender is basic availability. FERNANDES, BORGES, SIMÕES, CABALLERO, PACHECO & FRANCO Biota 7/1-2, 2006 35

Another preliminary study on a different for future comparisons. A wider sample black stork region in Spain, sexing 38 indi- over the years will be necessary to confirm viduals, found an overall sex ratio tend- significant variations. Records of environ- ing to 1:1 (Fernandez-Garcia & Lanzarot in mental variations such as temperature and press). Known sex ratios of other bird spe- rainfall will also be useful to relate to these cies have shown non significant deviations results. The sex ratio of the black stork from an expected 1:1 ratio (e.g. Rudnick population should be monitored in the pers.comm., Laaksonen et al 2004, Lessells long term as it may be an important source et al 1996). However, by comparison, our of information for monitoring ecological sex ratios for the black stork of 0.59 to stress. We believe this molecular approach 0.63 are higher than others. For instance, is an effective way of routinely sexing chicks Montagu’s harrier and Eurasian kestrel pre- using a non invasive approach. Molecular sented lower sex ratios than black stork, sexing is a reliable method of obtaining varying from 0.510 to 0.614 and 0.47 to data on sex ratios of wild populations and 0.59 respectively (Leroux & Bretagnolle that information can be related to other 1996; Laaksonen et al 2004). On the other ecological factors. hand, a significant bias in the 1:1 sex ratio was found in wood stork, in Brasil and the ACKNOWLEDGEMENTS United States, one favoring females and This study was financially supported by hypothetically related to low quality sites, Junta de Extremadura (Spain). We would and another with a higher proportion of like to thank the BTVS from ICN and the males in sites with a low level of predation Riga Zoo for tissue samples. We also thank (Seccomandi et al 2003). all the collaborators involved in field work These results are indicative of a sex ratio and sample collection, in particular, Victor deviation towards females and form a basis Pizarro and Juan Carlos Aronja.

References ALMEIDA, J., CATRY, P., ENCARNACAO, V., FRANCO, C., GRANADEIRO, J.P., LOPES, R., MOREIRA, F., OLIVERA, P., ONOFRE, N., PACHECO, C., PINTO, M., PITTA GROZ, M.J., RAMOS, J., SILVA, L. 2005. Ciconia nigra. In: Cabral M.J., Almeida, J., Almeida, P. R., Dellinger, T., Ferrand de Almeida, N., Oliveira, M.E., Palmeirim, J.M., Queiroz, A.I., Rogado, L. & Santos-Reis, M. Eds.: Livro Vermelho dos Vertebrados de Portugal. Instituto da Conservação da Natureza. Lisboa: 179-180. BERNIS, F. 1974: Migracion de falconiformes y Ciconia spp por Gibraltar. Ardeola 19:152-224 BIRDLIFE INTERNATIONAL 2004: Birds in Europe: population estimates, trends and population status. BirdLife Conservation Series No. 12. CANO ALONSO, L.S., FRANCO, C., PACHECO, C., REIS, S., ROSA, G. & FERNANDEZ, M. 2006: The Breeding Population of Black Stork in Iberian Peninsula. Biota 7(1-2), Proceedings of the 4th International Black Stork Conference, 15 – 18 April 2004 Hungary. CANO ALONSO, L.S. & HERNANDEZ GARCIA, J.M. 2004: Cigüeña Negra (Ciconia nigra). In: LMadroño, A., González, C. & Atienza, J.C. eds.: Libro Rojo de las Aves de España. Ministerio de Medio Ambiente & SEO/BirdLife. Madrid. CRAMP, S. 1977: Handbook of the birds of Europe, the Middle East and North Africa. The birds of Western Palearctic. Vol. 1. Ostrich to ducks. Oxford: Oxford University Press. DEL HOYO, J., ELLIOTT, A. & SARGATAL, J., eds. 1992: Handbook of the Birds of the World. Vol.1. Lynx Edicions, Barcelona. FERNANDEZ-GARCIA, M. & LANZAROT, P. 2006: Sex ratio assessement in black stork nestlings of a Central Spain population. Biota 7 (1-2), Proceedings of the 4th International Black Stork Conference, 15 – 18 April 2004 Hungary. FERNANDES, BORGES, SIMÕES, CABALLERO, 36 Biota 7/1-2, 2006 PACHECO & FRANCO

FRANCO, C. 2006: Dispersão e Migração de cegonha-preta Ciconia nigra Alentejo, Centro e Extremadura. ICN report. GILBERT, L., RUTSTEIN, A.N., HAZON, N. & GRAVES, J.A. 2005: Sex-biased investment in yolk androgens depends on female quality and laying order in zebra finches (Taeniopygia guttata). Naturwissenschaften 92: 178-181. GRIFFITHS, R., DOUBLE, M.C., ORR, K. & DAWSON, R.J.G. 1998: A DNA test for most birds. Molecular Ecology 7:1071-1075. ITOH, Y., OGAWA, A., MURATA, K., HOSODA, T. & MIZUNO, S. 1997: Identification of the sex of oriental white stork Ciconia boyciana by the polymerase chain reaction based on its sex chromosome specific DNA sequences. Genes Genet. Syst. 72:51-56. LAAKSONEN, T., LYYTINEN, S. & KORPIMAKI, E. 2004: Sex-specific recruitment and brood sex ratios of Eurasian Kestrels in a seasonally and annually fluctuating northern environ- ment. Evolutionary Ecology 18:215-230. LEROUX, A. & BRETAGNOLLE, V. 1996: Sex ratio variations in broods of Montagu’s Harriers Circus pygargus. Journal of Avian Biology 27:63-69. LESSELLS, C.M., MATEMAN, A.C. & VISSER, J. 1996: Great tit hatchling sex ratios. Journal of Avian Biology 27:135-142. PARKES, C. & TORES SANCHEZ, A. 2003: Wintering population of black stork (Ciconia nigra) in the rice fields of Guadalquivir river, south Spain (1998/2001). Aves 40:184-188. RDCT 2005: R: A Language and Environment for Statistical Computing, Version 2.1.1. R Development Core Team. Available online at http://cran.r-project.org. ROSA, G., PACHECO, C., MONTEIRO, A., CARVALHO, A. & ARAUJO, A. 2001: Situação da cegonha- preta Ciconia nigra em Portugal: recenseamento da população nidificante (1995-97). Airo 11:15-22. SACCHI, P., SOGLIA, D., MAIONE, S., MENEGUZ, G., CAMPORA, M. & RASERO, R. 2004: A non-inva- sive test for sex identification in short-toed eagle (Circaetus gallicus). Mol Cell Probes 18:193-196. SASVARI, L. & NISHIUMI, I. 2005: Environmental conditions affect offspring sex ratio variation and adult survival in Tawny Owls. Condor 107:321-326. SECCOMANDI, A., TOMASULO-SECCOMANDI, A., DEL LAMA, S. & BRYAN, Jr L. 2003: Biases in the sex ratio in north and south America nesting colonies of wood stork. The 27th Annual Waterbird Society Meeting. Cuiaba, Mato Grosso. SEFC, K., PAYNE, R.B. & SORENSON, M.D. 2003: Microsatellite Amplification from Museum feather samples: effects of fragment size and template concentration on genotyping errors. The Auk 120:982-989. STAUSS, M, SEGELBACHER, G, TOMIUK, J. & BACHMANN, L. 2005: Sex ratio of Parus major and P. caeruleus broods depends on parental condition and habitat quality. Oikos 109:367- 373. TOMASULO, A.M., DEL LAMA, S.N., ROCHA, C.D. 2002: Molecular Method of Sexing Waterbirds without DNA Extraction. Waterbirds 5: 245-248. HORBAN & BUMAR Biota 7/1-2, 2006 37

Conservation biology of Black Stork Ciconia nigra in Ukrainian Polissya

Ihor HORBAN & Hrihoriy BUMAR

Ivan Franko National University of Lviv, Hrushevsky St. 4, Lviv 79005, Ukraine E-mail: [email protected]

Abstract During the last 20 years, investigations on biotopic distribution and changes in the num- ber of black storks on two reserves in Ukrainian Polissya (on the border with Belorussia) were performed. The oldest nests have been used by Black Storks Ciconia nigra in Shatsck National Park for 12-14 years, but now the duration of use of old nests is considerably decreased. The local population of Black Stork is 4-10 pairs. The major threat to their nests is forestry near the breeding territories. Under current conditions, this factor plays a prin- cipal role in affecting the population number of Black Storks in all Ukraine, especially in non-protected territories. Complex climatic conditions is another factor affecting breeding nest decline. In Poliskyi natural reserve, 14 nests of Black Stork were observed during 2001- 2003; 6-8 of them were occupied by storks (43-57%). The largest number of offspring was in 2000 (23 birds), in 2001 – 13, and in 2002 – 12. As a rule, there were 3 birds per nest, and in only one case there were 4. Over 50% of nests found are built on platforms for beekeep- ing. Martes martes in Shatsck National Park, Lynx lynx and Strix nebulosa in Poliskyi natural reserve are natural enemies of Black Stork young in the nests. Strix nebulosa can occupy nests used by Black Storks. In Poliskyi natural reserve, the nests of Black Storks are built on lateral branches of old pines, often in the lower part of the crown. In Shatsck National Park, the nests are distributed uniformly in pines, oaks, alders, and birches. Such a diversity of nest distribution is a result of the influence of agricultural activity, especially cutting of old trees.

Key words: Black Stork, Ciconia nigra, Ukrainian Polyssia, protection

Received 9 February 2007; accepted 31 May 2007 38 Biota 7/1-2, 2006 HORBAN & BUMAR

INTRODUCTION Regional Park “Pripyat’-Stochid.” In the lat- Polissya has always been the most favour- ter two areas, however, about 40% of stork able region for breeding of Black Storks nests found were built in alders Alnus glu- Ciconia nigra in Ukraine; here the breeding tinosa in wet forests consisting exclusively population of Black Storks reaches its high- of alders. est reported density in Ukraine (Dunajwski As for cases of nest predation recorded by 1936, Fesenko 1996, Zhezherin 1988, Zhyla us, in Shatsk National Park and Regional 1992). Recently, a number of nature reserves Landscape Park “Pripyat’-Stochid”, there were founded in Polissya. These reserves were two attacks on Black Stork nestlings by have become particularly important to the Pine Marten Martes martes and in Polissya conservation of this species, one that has Natural Reserve, one attack by Lynx Lynx been listed in The Red Book of Ukraine lynx. In Little Polissya (Zhovkva district, Lviv since 1980. Of special importance to sus- region) and in the valley of Western Buh taining the breeding population of the (Voldymyr-Volynsk and Luboml’ districts, Black Stork in Ukraine are Polissya Natural Volyn’ region), we recorded two take-overs Reserve, Rivne Natural Reserve, Shatsk of Black Stork nests by Lesser Spotted National Park, and the Regional Landscape Eagle Aquila pomarina and one takeover Park “Pripyat’-Stochid.” Ukrainian scientific by Buzzard Buteo buteo. literature contains numerous publications devoted to the study of Black Stork distri- MATERIAL AND METHODS bution, as well as a number of discussions For the past 20 years, studies on breeding focused on estimation of abundance of biology, habitat distribution, and chang- the species (Holovach et al., 1990, Horban es in abundance of the Black Stork have 1990, 1992). However, only a few studies been carried out in two protected areas dedicated to the biology and behaviour in Ukrainian Polissya. These two territories of the Black Stork exist (Grishchenko et are located near the state border with the al 1992, Smohorzevsky 1979, Stadnytsky Republic of Belarus. One of the two ter- 1992). This article serves to supplement ritories is a part of Shatsk National Park. several insufficiencies in the material avail- The total area of the latter reached over able on the subject. 32,830 ha in 2000 and 48,997 ha in 2001. In Poliskyi Natural Reserve, stork nests are Approximately 50% of Shatsk National Park built mostly on side branches of old pines is covered with mixed coniferous-decid- (50%), often in the lower part of treetops. uous forests dominated by Scotch Pine In Shatsk National Park, stork nests (n = Pinus silvestris. The other territory studied is 12) were found in pines (25%), oaks (17%), located in Zhitomir region and is a part of alders (42%), and birches (17%). Large-scale Polissya Natural Reserve. More than 80% of forestry conducted in Shatsk National Park Poliskyi Natural Reserve is covered with for- and its buffer areas may have increased the ests. The total area of the reserve reached recorded variety among the tree species 20,104 ha in 2000 and above 30,000 ha on which storks build their nests. Among in 2001. Both territories are rich in wet 14 nests found by us in Poliskyi Natural meadows and peat bogs. Poliskyi Natural Reserve, 11 (79%) were located in old pine Reserve is also rich in raised (oligotrophic) forests with less than 10% in birches. The bogs. Some additional studies were car- other three nests were also found in old ried out on the territory of the Regional pine forests with birch Betula pendula and Landscape Park “Prypiat-Stochid,” a 44,958 oak Quercus robur as subdominant tree ha area covering the flood land between species. Similar forests are also found in the rivers Prypiat and Stochid. The park is Shatsk National Park and the Landscape rich in Black Stork foraging areas. The park HORBAN & BUMAR Biota 7/1-2, 2006 39

Table 1. Distribution of Black Stork observations across different foraging habitats in Polissya (percent).

Water Quarries Water basins basins Lakes and Drainage Fields and Year Rivers and in populated near n ponds canals pastures sand-pits areas motor ways 1997 29 39 21 2 3 2 3 133 1998 33 36 16 2 5 4 5 108 1999 33 36 18 2 5 2 3 129 2000 25 33 18 3 10 5 6 147 2001 30 38 12 3 6 3 8 140 2002 26 38 18 2 5 2 8 146 2003 30 34 17 3 5 3 7 148 Total 29 36 17 2 6 3 6 951 territory, however, is not very favourable breeding ponds, storks are found in broods for breeding of this species (Horban and or large groups of 11–20 birds. Especially Flade 2000). In Poliskyi Natural Reserve, large groups of Black Storks, consisting of on the other hand, there are many trees more than 30–40 birds, are observed in late adequate for nest building yet few food August and September on fish-breeding resources, especially after draining melio- ponds near Pishcha (Shatsk district, Volyn’ ration performed in the buffer zone of region), Perebrody (Dubrovytsk district, the reserve. In addition to the monitor- Rivne region), and Dibrivsk (Zarichnansk ing studies carried out in protected areas, district, Rivne region) villages. More than we performed a long-term study in Little 60% of Black Stork occurrences near banks Polissya (Lviv region, Rava-Rus-Radechiv- of lakes and ponds correspond to the sec- Brody geobotanical region). Bird censuses ond half of summer and early autumn, were performed using transect and terri- while about 80% of occurrences of the tory-mapping methods (Bibby, Burgess & species along the banks of small rivers hap- Hill 1992, Hagemaijer & Blair 1997). pened during the breeding period. In Poliskyi Reserve, storks build their nests RESULTS immediately beside their foraging habi- Frequencies with which foraging storks tats, in the range of 0.1–2.0 km (Table 2). In were observed in different habitats are Shatsk National Park, the distance between shown in Table 1. Although there was a the nest and foraging areas remains within large number of cases when storks were 0.6–2.3 km. In the Regional Landscape observed feeding on banks of lakes and Park “Prypiat-Stochid,” where river flood ponds (29%), more typical foraging habi- basins are especially wide, the distance is tats of this species during its breeding 0.4–1.2 km. Draining melioration signifi- period are banks of small rivers (36%), and cantly affected the food resources of the now also banks of drainage canals (17%) Black Stork, which until 1970, in Polissya, with a relatively slow flow of water. These had been feeding mainly on fish and tri- canals are, to some extent, similar to small tons Triturus vulgaris and Triturus cristatus, rivers and are often constructed in their the species characteristic to small forest place. On banks of lakes, rivers, or drainage water basins. To supplement the sparse canals, storks feed individually or in pairs, data on characteristics of Black Stork while on banks or shallow waters of fish- nests in Ukraine (Tcherkass 1992) and 40 Biota 7/1-2, 2006 HORBAN & BUMAR

Table 2. Characteristics of Black Stork nests in Polissya Natural Reserve.

Nest Tree Height of the Nest location Nest size (m) Distance to Distance no. Species nest location (m) the nearest to the canal (km) nearest river (km) 1 Pine 9 Man-made platf. 1.1 × 1.2 2.0 – 2 Pine 11 Side branches 1.2 × 1.3 – 1.5 3 Pine 12 Side branches 1.3 × 1.6 1.5 – 4 Pine 10 Bort' top* 1.3 × 1.2 1.0 – 5 Pine 10 Bort' top 1.2 × 1.2 1.5 0.7 6 Pine 10 Side branches 1.2 × 1.2 2.0 1.5 7 Pine 12 Side branches 1.0 × 1.1 0.1 – 8 Pine 13 Side branches 1.0 × 1.0 0.5 – 9 Pine 15 Side branches 1.2 × 1.4 – 0.7 10 Pine 10 Side branches 1.1 × 1.2 – 0.2 11 Oak 10 Side branches 1.4 × 1.5 – 0.1 12 Pine 9 Bort' top 1.2 × 1.4 – 0.2 13 Pine 12 Bort' top 1.2 × 1.4 0.4 – 14 Pine 14 Bort' top 1.2 × 1.3 2.0 – Bort is a beehive installed on trees for indigenous to Polissya region beekeeping. other aspects of breeding of this species 3). Out of 14 monitored nests, 9 were locat- (Afanasiev 1992, Ivanovsky 1990, Shkaran ed in the protected territory of Poliskyi 1992), the information we collected is dis- Natural Reserve. Almost all nests were played in Table 2. located in an old mixed pine-birch forest, During the past ten years, the breeding not far from transition (mesotrophic) peat population of the Black Stork in Shatsk bogs. Nest 11 was located in an oak-birch- National Park has varied from 4 to 10 pairs. alder forest. Forests in which the nests Here 7 cases of nest replacement were studied were located were not sparse, with recorded. The main cause of nest aban- canopy fullness of about 0.5–0.8. All nests donment was forestry conducted close to were located in parts of forests where nesting trees. Such cases were especially there were many large old trees. Such common during 1980–1990. In present- trees often grow near forest-dividing vistas day Ukrainian Polissya, however, intense made for prevention of fires, or unused for- forestry continues to be the leading cause est roads. In Shatsk National Park, certain of reduction of time spans during which nests are found near old drainage canals, Black Storks occupy their nesting territo- partially covered with thickets, landscape ries. Harsh climate conditions also nega- forms similar to those of forest vistas. It is tively affect the number of nests available possible that the conditions under which for breeding: stork nests are ruined either storks make their flights to the nest influ- because of excess amounts of snow (as in ence their choice of nesting trees. the winters of 1997 and 2003) or because In Poliskyi Natural Reserve, 13 out of 14 of strong winds (1998). nests were found in pines, and only one During 2000–2003, in the northern part was found in an oak. Other tree species in of the Ovruch and Olevsk districts, in the Reserve (birch, alder, and aspen) were the territory of Poliskyi Natural Reserve not suitable for nesting of Black Storks. and adjoined areas (Syrnyk, Bigunsk, and Most of the nests, even those built on Tchorinsk forests), we organised monitor- bort tops, were located near southern and ing of Black Stork breeding success (Table south-eastern sides of the tree trunk. In HORBAN & BUMAR Biota 7/1-2, 2006 41

Table 3. Nest occupation and nesting success of the Black Stork in Polissya Natural Reserve.

Nest no. Number of nestlings Year 2000 Year 2001 Year 2002 Year 2003 1 3 3 Unoccupied Unoccupied 2 2 3 Unoccupied Unoccupied 3 3 (all died) Unoccupied Unoccupied Unoccupied 4400Unoccupied 53322 62022 73220 82222 9 3 Unoccupied 2 0 10 Unoccupied Unoccupied 2 2 112223 12 4 Unoccupied Unoccupied Unoccupied 13 Unoccupied Unoccupied Unoccupied Unoccupied 14 Unoccupied 2 2 Unoccupied Nests occupied 11 9 9 7 Nestlings total 31 17 16 11

Poliskyi Natural Reserve, 43% of all found forest cuts regularly visited by people (in stork nests were built on top of borts. Bort Poliskyi Natural Reserve, nests 1 and 8 is a beehive for keeping a semi-cultivated were placed this way). Today, forest cuts form of honeybee, a way of beekeeping are often conducted not only in autumn indigenous to Polissya. Borts are installed and winter, but also in early spring, at a by beekeepers on large old trees. Bort time when storks are starting to occupy top dimensions are 1.7 × 1.2 m, while the their nesting territories. This intensifies the dimensions of bort trunks are 1.0 × 1.0 m. human disturbance factor. In addition, dur- In cases when beekeepers took down a ing forest cuts, large old trees are cut down bort from under a Black Stork nest, storks preferentially, which decreases the number rebuilt it on leftover boards or side branch- of potential nesting places. es (nests 1 and 6). Although, in the region While studying nesting success during the studied, there are more than 300 borts past two years (2002–2003), we found a installed, most borts are placed at large decrease in the number of occupied nests distances from foraging habitats favoured as well as a decrease in the total num- by Black Storks. In addition, regular visits ber of fledglings. With the recent (2002) by beekeepers are likely to disturb birds, expansion of Great Grey Owl Strix nebulosa thus reducing the number of nests actually breeding range, many stork nests in Poliskyi placed on top of borts. Natural Reserve were occupied by owls, In all parts of Polissya studied by us, Black and, as a result, a part of the breeding Black Stork nests were located near drainage Stork population remained without nests. canals (in Polissya Natural Reserve, 65% of In 2003, these same nests remained unoc- all found nests), small rivers, springs, or peat cupied, even thought the total number of pits rich in fish, especially Loach Misgurnus owls noticeably decreased. Additionally, fossilis. Stork nests are built far from motor the summer of 2003 was marked with a ways and no closer than 2 km from popu- severe drought that influenced the nest- lated areas, including both protected and ing success of Black Storks. In 2003, only 7 unprotected areas. However, certain nests breeding pairs remained in Poliskyi Natural were found close to haymaking fields and Reserve, and 2 of them were without nest- 42 Biota 7/1-2, 2006 HORBAN & BUMAR lings (Table 3). Year to year, there were only may have led to false conclusions on the 7–11 nests (50–79%) occupied by storks. current trends in Black Stork abundance. The mean number of nestlings per nest To objectively evaluate the real tenden- successively decreased from 2.5 in 2000 to cies in the numbers of breeding pairs of 1.9 in 2001 to 1.8 in 2002 to 1.6 in 2003. A Black Storks in Ukraine, we need a long- similar trend was observed in other areas term (at least three years) joint study of studied, however, with a smaller sample changes in forestry, as well as monitoring size. As a rule, there were 2–3 fledglings of occupied, new, and unoccupied Black per nest; however, in the year most favour- Stork nests, together with a characterisa- able to the Black Stork, there were two tion of annual roaming of breeding birds. It cases with 4 young birds successfully leav- should be remembered that the numbers ing their nests (Table 3). of the breeding Black Stork population can fluctuate significantly because of climate DISCUSSION variations and food availability, as has been For the past two decades, the instability of shown with our studies in Poliskyi Natural Black Stork numbers has been the subject Reserve (Table 3 and Results section). If of controversy in Ukrainian ornithological such a project of constant monitoring of literature. Two opposite schools of thought all known nests in Polissya as well as of exist: one stating that the numbers of a coordinated examination of old forests Black Storks are declining (Iaremchenko & were undertaken for a period of at least Sheihas, 1989, Marisova et al. 1990), and three years, the real trends in Black Stork another arguing for a gradual increase abundance in the country could be estab- of numbers caused by adaptation of the lished. Failing this, all previous discussions species to changes in the natural environ- can be considered inconclusive. ment and the close presence of people Studies have shown that Black Storks use (Grishchenko 1992, Grishchenko et al. their nests for long periods of time. Today, 1992). With the recent intensification of the oldest nests found in studied areas exploitation of old forests in Ukraine, it have been used by storks for 12–14 years. is difficult to objectively determine the Our conversations with foresters and other real direction of change in Black Stork workers involved in forestry lead us to think abundance. However, taking Little Polissya that, today, the time spans of nest use are of Lviv region or even Western Polissya significantly shorter. If, in 1960–1970, a of Volyn’ region as an example, we see a certain nest had been used for up to 23–24 decline in the number of occupied nests years, in the 1980s the oldest known nests and nesting territories during the past 5–6 would have been 11–15 years of age. In years. Observations of increase in the num- the first half of the 1990s, the possibility of ber of breeding pairs may have been a side long-term nest use significantly decreased. effect of frequent relocation of nesting In territories not belonging to the state territories by storks because of the intense Fund of Natural Reserves (FNR), all known forestry conducted in old parts of forests. nests are no more than 5–7 years old, and, Frequent violations of laws regulating con- considering the current intensification of servation of nature can also lead to reloca- forest cuts in old parts of oak and pine tions of nesting territories and, accord- forests, we can predict that part of the ingly, to an increase in the number of local Black Stork population will be left Black Stork occurrences in larger territories. without trees suitable for nesting. It is dif- The increase in the number of Black Stork ficult to say if and how Black Storks are able occurrences, coupled with the short period to adapt to this, and, while White Storks during which censuses were carried out, Ciconia ciconia have adapted to nesting HORBAN & BUMAR Biota 7/1-2, 2006 43 on buildings of various types, similar cases drastic fluctuations of climate conditions are not known for Black Storks. For a long during the amphibian breeding season. time, in the scientific literature, draining However, in the forests of Polissya (exclud- melioration has been suspected as the ing protected areas), most such water main cause of possible decline in Black basins have dried up and disappeared. In Stork population. Today, it is intense for- Poliskyi Reserve, Black Storks often feed estry that has grabbed the spotlight of in man-made pits created during sand similar discussions. The subject of intense mining or road building. Changes in forest forestry has already been discussed in hydrologic regime, as well as the intensifi- Ukrainian literature (Horban 1992, Fesenko cation of anthropogenic stress (especially 1996, Smohorzevsky 1979). However, in during berry and mushroom collection), the past, draining melioration was some- have led to an increase in the frequency of times regarded as having positive effects forest fires, which, in their turn, affect the on the numbers of the species in Polissya. Black Stork population. Cases of forest fires We think that a certain positive effect of have been registered even in protected melioration is entirely possible in the case areas (Poliskyi Reserve, Shatsk National of Belarussian Polissya, where, thanks to Park). Moreover, the drainage canals, the network of draining canals, the num- which were about to become a typical ber of water basins and suitable foraging foraging habitat of Black Storks, are, in habitats has increased (Samusenko and recent years, being taken over by Common Samusenko 1991). The positive effect of Reed Phragmites australis and willows Salix melioration, however, may be possible fragilis, Salix triandra. This is another seri- only in specific forest landscapes and is ous factor contributing to the decay of this not permanent. Considering the more rup- species’ food resources. Studies performed tured landscape of Ukrainian Polissya, the in the Regional Landscape Park “Pripyat’- influence of draining melioration on the Stochid” have indicated an expansion of population of the Black Stork is strong- the breeding range of Great White Egret ly negative (Strautman 1963, Tatarynov Egretta alba in the Pripyat’ valley, a species 1973, Voinstvensky et al. 1981, Zhezherin that competes with the Black Stork for 1961). In Belarus, the replacement of small food in their common foraging habitats natural rivers with a dense network of along the banks of small rivers and shallow straight draining canals increased the water basins. total area of foraging habitats and made In Poliskyi Natural Reserve, almost 50% of food more accessible to storks. However, found nests were built on top of beehives in Ukrainian Polissya and in forests on installed in tree tops, called borts. Nests the border between Ukraine and Belarus, built on these platforms are well protected draining canals were a suitable foraging against winds and snowfalls, factors that habitat to storks in only the first 10–20 are of significant danger to massive nests. years of their existence. Afterwards, the On the other hand, the frequency of storks canals began drying up, and the avail- nesting on these platforms may indicate a ability of food to Black Storks during the certain competition between storks and reproductive period noticeably decreased. beekeepers for old trees. Still, it is entirely The decrease in the number of fish in possible that, even without the human water basins of Polissya was especially sig- interference factor, storks favour borts as a nificant. Additionally, during the past 5–7 platform for building their nests. years, we observed a decrease in the num- In the diet of the Black Stork in Polissya, ber of amphibians in Black Stork foraging along the banks of small rivers the habitats, a decrease which is connected to dominant species were Northern Pike 44 Biota 7/1-2, 2006 HORBAN & BUMAR

Esox lucius, and Gudgeon Gobio gobio Among adults as well as children, it is well (Smohorzhevsky 1979). Among amphib- known that this species is listed in The Red ians, the species most commonly eaten Book of Ukraine. However, many forestry by storks was Common Frog Rana tempo- workers, especially in protected areas, think raria. In the past, in forest water basins the that because of the conservation status of most numerous food eaten by storks were the Black Stork, it is impossible to carry Crucian Carp Carassius carassius and Loach out unabridged cuts in old parts of forests. Misgurnus fossilis, species that can survive In such cases, some managers or forestry in the mud of even very shallow forest workers conceal information on the exis- basins while they are drying up. However, tence of stork nests with the purpose of in Polissya, for the past two decades these further conducting forestry in these ter- species of fish have been decreasing in ritories. Although such cases are rare, the number, and, in many regions, have started absence of adequate enforcement of laws disappearing. The decline in food resources for the conservation of nature leads to a can be considered one of the main causes decrease in the number of nesting habitats of instability of the Black Stork population suitable to Black Storks. Considering the in unprotected areas of Polissya. increasing exploitation of forest resources, We noted a significant decay in foraging especially in old parts of forests, a special habitats of Black Stork, especially in unpro- program to protect nesting territories of tected territories that have undergone Black Storks is necessary. Without the col- draining melioration. On one hand, the laboration of public organisations for the melioration lowered the level of ground conservation of nature with state institu- waters in forests where storks could feed tions, attempts at conservation of nesting even in small wet glades or peat pits in the territories of Black Storks will be of little woods. Presently, not as many storks feed effect. this way as before; the birds are forced to fly larger distances from their nests Acknowledgements while foraging. In Little Polissya, observa- Parts of our field studies were performed tions showed that storks’ foraging flights under support of the state program entitled were 0.6–1.7 km long during 1976–1984; The Influence of Ecological Environment this distance increased to 1.2–2.5 km after on Status and Conservation of Biodiversity 1980–1984. Today, 1.2–2.5 km long forag- of Shatsk National Natural Park (state reg- ing flights are typical, while their maximum istration №0106U001323). The authors are lengths reach 3.5–4.3 km. Long foraging thankful to their colleagues, R. M. Horban, flights negatively affect the growth rate V. I. Mateichyk, and I. M. Stadnystsky for of Black Stork nestlings and increase their their help in the collection of field materi- chances of being eaten by predators. als in Western and Little Polissya, and to In Polissya, local people hold Black Storks Eugene Shcherba for translating this article in a very high regard; they consider these into English. birds puzzling and aesthetically pleasing. HORBAN & BUMAR Biota 7/1-2, 2006 45

REFERENCES AFANASIEV, V. T. 1992: Black Stork in Sumske Polissya and in the south of Branshchina. Black Stork in Ukraine. Tchernivtsi: 17. In Ukrainian. BIBBY, C. J., BURGESS, N. D., & HILL. D. A. 1992: Bird Census Techniques. Academic Press, London. DUNAJEWSKI, A. 1936: Materials on distribution of Black Stork Ciconia nigra in Poland. Acta Ornithologica Musei Zoologici Polonici. Vol. 2: 1–21. In Polish. FESENKO, H. V. 1996: Analysis of results of Black Stork censuses in Ukraine. Works of the Ukrainian Ornithological Society. Kyiv: 208–215. In Russian. GRISHCHENKO, V. M.1992: Black Stork in Ukraine: Myths and Reality. Black Stork in Ukraine. Tchernivtsi: 26–29. In Ukrainian. GRISHCHENKO, V. M., O. F. HOLOVACH, V. V. SEREBRIAKOV, I. V. SKILSKY & SAVCHUK, O. V. 1992: Summaries of running of “The Year of Black Stork” in Ukraine. Black Stork in Ukraine. Tchernivtsi: 1–16. In Ukrainian. HOLOVACH, O. F., GRISHCHENKO, V. N. & SEREBRIAKOV, V. V. 1990: Contemporary abundance, distribution, and migrations of Black Stork in Ukraine. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 191–203. In Russian. HORBAN, I. M. 1990: Abundance of Black Stork in Western Ukraine. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 204–205. In Russian. HORBAN, I. M. 1992: Studies and attempts of abundance estimation of Black Stork in Ukraine. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 186–194. In Russian. HORBAN, I. & FLADE, M. 2000: The importance of the Upper Pripyat (Ukraine) for the protection of birds. The Ecology and Conservation of Floodplains and Lowland Mires in the Polesya Region. Minsk: 103-110. HAGEMAIJER, W. J. M. & BLAIR, M. J. 1997: The EBCC Atlas of European Breeding Birds: Their Distribution and Abundance. Poyser, London. 902 pp. IAREMCHENKO, O. A. & SHEIHAS, I. N. 1989: On the present condition of rare species of birds in Polissya Reserve. Theses of Presentations at the All-Union Conference on Problems of Cadastre and Census of the Animal World. Part 3. Ufa: 254–256. In Russian. IVANOVSKY, V. V. 1990: Status of Black Stork population in Vitebsk region in 1983–1989. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 206–211. In Russian. MARISOVA, I. V., MAKARCHENKO, M. M. & SERDUK, V. A. 1990: Black Stork in Tchernigovshchina. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 221–223. In Russian. The Red Book of Ukraine. The Animal World 1994: Black Stork Ciconia nigra. M. P. Bazhan Ukrainian Encyclopaedia, Kyiv: 311. In Ukrainian. SAMUSENKO, E. G. & SAMUSENKO, I. E. 1991: The influence of melioration on abundance of storks. Theses of Presentations at 10th All-Union Ornithological Conference. Part 1. Navuka i Technika, Minsk: 142. In Russian. SHKARAN, V. I. 1992: Distribution and certain ecological characteristics of Black Stork in north- ern and north-eastern Volyn’ region. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 204–206. In Russian. SMOHORZHEVSKY, L. O. 1979: Fauna of Ukraine. Birds. Vol. 5, No. 1. Naukova Dumka, Kyiv: 95–100. In Ukrainian. STADNYTSKY, I. M. 1992: Data on Black Stork behaviour. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 200–202. In Russian. STRAUTMAN., F. J. 1963: The Birds of Western Regions of USSR. Vol.1. Lviv University Press, Lviv. 203 pp. In Russian. 46 Biota 7/1-2, 2006 HORBAN & BUMAR

TATARYNOV, K. A. 1973: Vertebrate Fauna of Western Ukraine. Lviv University Press, Lviv: 27–40. In Ukrainian. TCHERKASS, N. D. 1992: Nesting of Black Storks on top of beehives. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 202–203. In Russian. VOINSTVENSKY, M. A., V. I. KRYZHANOVSKY & LEGEIDA, N. S. 1981: Changes in fauna of Ukrainian Polissya after land drainage. Vestnik Zoologii Year 1981 (5): 3–9. In Russian. ZHEZHERIN, V. I. 1961: On distribution of Black Stork in Volyn’ region. The Collection of Works of Zoological Museum of AN URSR. 30: 82–84. In Ukrainian. ZHEZHERIN, V. I. 1988: The Black Stork. Rare and Disappearing Plants and Animals of Ukraine. Naukova Dumka, Kyiv: 167–168. In Russian. ZHYLA, S. N. 1992: Distribution of Black Stork in Ukraine. Storks: Distribution, Ecology, and Conservation. Navuka i Technika, Minsk: 194–197. In Russian. KALOCSA & TAMÁS Biota 7/1-2, 2006 47

An analysis of nesting data of Black Storks Ciconia nigra in the Gemenc region of the Danube-Drava National Park (1992-2003)

Béla KALOCSA1 & Enikő Anna TAMÁS2

1Nagy István u 15, H-6500 Baja,.Hungary, E-mail: [email protected] 2Apáczai Csere J. u. 8, H-6500 Baja, Hungary, E-mail: [email protected]

Abstract Between 1992 and 2003 we registered 189 Black Stork nests in the Gemenc area. We co- operate with the regional Nature Protection Authority, and give them our data so that they can carry out legal protective measures. For the surroundings of the registered nests, we analyzed the available data. From our studies we concluded that the forest type chosen for nesting proved to be the most significant factor, and forestry proved to be the biggest threat to nesting. Breeding success and other factors influencing the Black Stork popula- tion have also been investigated for 12 years.

Keywords: nesting site choice, nest supporting tree, forest structure

Received 8 February 2007, accepted 7 July 2007 48 Biota 7/1-2, 2006 KALOCSA & TAMÁS

INTRODUCTION Figure 2. Nest supporting tree species in The Black Stork Ciconia nigra is a regular Gemenc (154 nests). but rare breeder in Hungary. It occupies mostly floodplain habitats in the coun- try, but occurs also in the forested hills (Kalocsa & Tamas 1996). The main threat to the species in Hungary is the decrease of suitable habitats in terms of both quality and quantity, which holds true both for nesting grounds and foraging areas (Kalocsa & Tamas 1996). Our aim is to point out the spe- cial habitat need of the species and the threats to this type of habitat. Nest mapping STUDY AREA Each winter, after the deciduous trees have Our study area covers the northern shed their foliage, we systematically look part of the Central Danube Floodplain, for newly built nests in the area, and we the Gemenc Area of the Danube-Drava inspect already known ones. We record the National Park in Hungary. It is a 180 km2 nests on a map, measure the GPS co-ordi- area along the right bank of the river nates, and take photos. Danube, km 1503 to 1470, most of it being a recent inundation zone; it is regularly Most important characteristics of suit- flooded. Most of the recent inundation able habitats & trees area is covered by deciduous softwood In the nest register we keep records of and hardwood forests, approximately 80% the nest supporting tree species, the sur- of which are plantations. rounding forest type, and neighbouring tree species. METHODS Nesting data were collected each year from Breeding results 1992 to 2003. We survey nest occupation and breeding success in occupied nests by observation and counting the number of young, if pos- sible. We calculate breeding success as a Figure 1. Forest types chosen for nesting by ratio of known number of young per suc- Black Storks Ciconia nigra in Gemenc (154 cessful breeding. In case of nest failure, we nests). try to find the reasons.

RESULTS AND DISCUSSION

Nest mapping The number of registered nests up to April 2004 is 189, and the number of existing nests in 2004 is 75 (the others have fallen down or the trees where they were situated have been cut down). The number of known breed- ing pairs in 2003 was 38, an average KALOCSA & TAMÁS Biota 7/1-2, 2006 49

Figure 3. Number of young per successful and in 17 cases between 100 and 200 breeding (1992-2003). metres from it. Out of these 51 nests, 36 were abandoned

4,50 during or because of forestry

4,05 (direct disturbance, or because 4,00 the coverage was decreased).

3,50 3,31 3,22 3,21 Of these 36, in 28 cases logging 3,13

2,85 2,72 2,73 3,00 was carried out within less than

2,58 2,50 2,36 100m, and in eight cases the 2,50 2,25 distance was between 100 and 2,00 200m. 1,50 Of all the affected nests, only

1,00 five were re-occupied, three of them two years after the log- 0,50 ging took place, one after four 0,00 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 years, and one after five years. The other nests were never number during the period investigated. used by Black Storks again. Thus the average breeding density is 21.1 bp/100km2, which is rather high, the high- Legal background est breeding density of Black Storks known Floodplain forests (like any other forests (cf. Janssen et. al. 2004). The Black Storks in Hungary) are registered in the land use in our area use the nests for 2.5 years on register as a forest. If an area is registered average, a very short period (cf. Janssen et. as a forest, there is a legal obligation to al. 2004), which means that there is a high cultivate it, but if an area is a nature pro- rate of disturbance that forces them to tection area, then its primary function as change often (Kalocsa & Tamás 1996). defined by another law is nature protec- tion. This is a contradiction. Most important characteristics of suit- If a strictly protected bird species (like able habitats and trees Black Stork) nests in a protected area, it is Analysis of nest mapping results in terms possible to designate a 100 m radius gen- of forest types inhabited by Black Storks eral circular protection zone – according to shows a preference for old, natural forests legal agreement – since the designation of compared to plantations and monocul- the Danube-Drava National Park in 1996, tures (Figure 1). and a 400 m radius circular protection zone Nest supporting trees are characterised in the breeding season, but the protection by large horizontal branches and forks zone is not excluded from forestry plan- suitable for supporting the huge nests. ning – if the bird moves, the forest can be This shows that the most suitable trees managed. are Oaks Quercus robur and White Poplars Populus alba. Other tree species are also Breeding results used, but not in high numbers (Figure 2). We have summarized the breeding success in Gemenc during the study period (1992- Threat to nesting places: forestry 2003). The least successful year was 2001, During our studies, 51 nests were affected with an average number of young of 2.25, by forestry activity in Gemenc; in 34 cases and the most successful was 2000, with an the forestry operations took place within average of 4.05 young per nest (Figure 3). less than 100 metres from the nest tree, The clutch sizes of Black Storks varied 50 Biota 7/1-2, 2006 KALOCSA & TAMÁS

Figure 4. Clutch sizes for successful breeding during hatching and the following days (1992-2003) n = 189 (the number of success- when young storks are too weak to stand, ful breedings during 12 years, where the then the failure is very high, as the hatch- number of young is known). lings are forced to sit in the rainwater trapped in the nests. This kind of loss was 100 characteristic of the year 2003.

90 86 Food availability influenced by 80 hydrological circumstances is 70 another very important factor. 60 The positive impact of plenty of

47 50 available food could be observed

40 in 2000, when large numbers of 33 30 trapped fish were accessible in shal-

20 low water in the floodplain, and in

12 11 10 2000 weather conditions were also

0 positive (almost no precipitation 12345during the breeding season). Predation was also observed in sev- between one to five fledged young in eral cases. In our study area, we found sev- our study area from 1992 to 2003. Most of eral signs of predation by a raptor, proba- the young were raised in broods of three. bly Goshawk (as the remains of Black Stork In favourable conditions, e.g. 2000, when young were shredded). In two cases, the food availability and weather conditions young disappeared from the nest and we were above average, the number of five- found White-tailed Eagle feathers under young broods was very high (11). A sum- the tree. This suggests that White-tailed mary of clutch sizes can be seen for the 11 Eagle could have taken the young, but we years in Figure 4. have no other proof of this. Other kinds of Factors influencing breeding success predation, such as by mammals, have not Weather has a high impact on breeding been observed in our study area. success. If there is cold and rainy weather

REFERENCES KALOCSA, B. & TAMÁS, E.A. 1996: Nesting of Black Storks in the Gemenc floodplain forest, 2nd International Conference ont he Black Stork, Trujillo, Spain, (in press) JANSSEN G, HORMANN M. & ROHDE, C 2004: Der Schwarzstorch. Die Neue Brehm-Bücherei Bd. 468. Westarp Wissenschaften, Hohenwarsleben. KALOCSA & TAMÁS Biota 7/1-2, 2006 51

An evaluation of colour ringing recoveries of Black Storks Ciconia nigra in Hungary

Béla KALOCSA 1 & Enikő Anna TAMÁS 2

1MME BirdLife Hungary, H-6500 Baja, Nagy István u. 15., Hungary E-mail: [email protected] 2MME BirdLife Hungary, H-6500 Baja, Apáczai Csere J. u. 8., Hungary, E-mail: et@blackstork. hu

Abstract The colour ringing of Black Storks has been carried out in Hungary since 1994. By 2004 we had ringed 497 Black Storks (including 13 in northern Croatia), except for three of them, in their nests, as pulli. Of the ringed birds, 48 individuals have been sighted alive at least once; by April 2004,14 were found dead. We analysed the data according to the place and time of occurence. Post-breeding, first and second year, and older individuals have been recovered during spring and autumn migration, as well as in the breeding season. Apart from those ringed in Hungary, we observed ten individuals ringed in the Czech Republic, six Black Storks of Slovakian ori- gin, one from Belgium, one from Serbia, one from Poland and two whose ringing place is unknown. Of the individuals ringed in Hungary, some were sighted abroad as well: 24 in Israel, one in Serbia, three in Croatia, and one in Germany.

Keywords: Black stork, colour ring, recovery, Hungary

Received 8 February 2007; accepted 7 July 2007 52 Biota 7/1-2, 2006 KALOCSA & TAMÁS

INTRODUCTION the country can be evenly represented, we We have been involved in the International try to evenly distribute rings within each Black Stork Colour ringing Programme region and throughout the country (Table since 1994. In the first year (1994), we 1). Once chosen, we ring every year in the colour ringed Black Storks only in Gemenc same nest, but if the nesting site changes, Landscape Protection Area (GLPA). From we try to ring each year in the same area. the second year on, southern Hungarian This is not always possible. Black Stork populations were also includ- From the beginning, we intended to main- ed. tain or slightly increase the number of Since 1998, colour ringing has been car- ringed young from year to year, to a rea- ried out within the framework of the sonable extent. During the nest inspec- Black Stork Protection Programme of the tions carried out before ringing, we choose Raptor Specialist Group of the Hungarian the bigger broods in order to be effective Ornithological and Nature Protection (more ringed birds per tree). It is also Society (MME BirdLife Hungary), which important to choose nests that are relative- was initiated that year (Kalocsa & Tamás ly easily accessible (close to roads/settle- 2002). From 2001, we managed to colour ments, and in trees that are not too tall , for ring young storks in almost every part of safer climbing). the Hungarian breeding range. We should mention that from 2001 to 2003, the num- Method of ringing ber 5 (as the first character of the colour When the young reach six to eight weeks ring’s code) was also used in the northern of age (having 5-10 cm long black prima- part of Croatia (Kopacki Rit), which borders ries, and white heads), ringing is ideal. our main study area, the Danube-Drava This means that they are big enough to National Park. be ringed safely, but too small to try to fly away. We use rock-climbing equipment to MATERIALS AND METHODS go up to the nest. The safest method is that one person climbs to the nest, while the Choosing broods for ringing ringer and a helper stay below. The young So that each breeding area of the species in are transported down one-by-one in a cot-

Table 1. Black Stork Ciconia nigra colour ringing in Hungary (and Croatia = HR) 1994-2003.

Béda- Somogy Gemenc Kiskunság Tolna, Zemplén Komárom- Börzsöny Kopacki total Karapan- Fejér Esztergom Rit (HR) csa 1994 - - 13 ------13 1995 5 19 9 ------33 1996 5 19 29 ------53 1997 4 13 32 3 - - - - - 52 1998 - 8 25 ------33 1999 6 10 51 ------67 2000 5 15 26 ------46 2001 2 19 19 - 5 19 4 - 3 71 2002 8 18 17 2 2 16 8 5 76 2003 6 - 15 2 - 15 - 7 5 53 total 41 121 236 7 7 50 4 15 13 497 Rin- Deme T., Horváth Kalocsa Boros E., Kalocsa Frank T., Krug T. Kazi R. T. gers Nagy T., Z., B. Halmos B., Serfőző Mikuska names Kalocsa Pintér G. Staudin- J., Béres B. A. ger I. I. KALOCSA & TAMÁS Biota 7/1-2, 2006 53

Table 2. Black Stork concentrations in Gemenc.

no. of ringed Black year Dates place maximum flock size Storks 14 23/08 – 07/09 Báli lake 51 1999 (10 local young) 9 15/07 – 29/07 Báli lake 72 2000 (1 local young) 2002 24/06 – 16/07 Báli lake 40 3 20/05 – 22/05 Gyékényes lake 53 2 22/05 – 26/05 Báli lake 54 4 2003 18/08 – 28/09 Nyéki dead branch 40 2 02/09 – 05/09 Cserta dead branch 35 1 ton bag, ringed, measured and put back 14 dead, one counted twice). into the nest. In comparison, of 584 Black Storks ringed in the Czech Republic there were 101 Methods of identification recoveries, or 17.3% (Pojer 2003). The lat- Occasional identifications can occur any ter higher rate can partly be explained time, as any birdwatcher with binoculars by the activity of ring readers along the or a telescope can be lucky enough to find migration route: in Hungary (particularly and identify a ringed Black Stork some- in the Gemenc floodplains) we have been where, but this results in uncertain and watching colour-ringed Black Storks for sometimes imprecise recovery data. eight years, and identified ten Czech birds Systematic monitoring is carried out par- which migrated through Hungary, while ticularly in known congregation sites. We Black Storks starting from Hungary would started to look for ringed Black Stork indi- most probably meet the first birdwatchers viduals in 1996, concentrating on the GLPA to identify them in Israel. (now part of the Danube Drava National Recoveries can be grouped by date, place, Park). and circumstances of observation, as fol- The first and most important task is to find lows. congregation sites (these are often feeding places, temporary shallow lakes in flood- Observation in the breeding season plains), where one has to look carefully Black Stork concentrations in Gemenc are for ringed individuals in groups. We try to frequent (Table 2). When feeding plac- identify as many as possible. es are in suitable condition, summering Systematic monitoring also includes con- and locally breeding individuals can be trol of known nesting pairs every year, observed in the feeding groups. Among when during the breeding season, we look these, more Black Storks ringed abroad at both birds, both legs, on the nest (from have been identified (Table 3), most of a hide). them originating in the Czech Republic (10), Slovakia (6), one from Belgium, one RESULTS AND DISCUSSION from Poland, one from Serbia and two of We have colour-ringed altogether 497 unknown origin. Black Storks during the ten years of the One Black Stork ringed in Hungary was programme. Of these 497 colour-ringed found nesting 40 km to the north of the Black storks, 61 have had at least one place of ringing (at the time seen nesting recovery (12.3%) until April 2004 (48 alive, this bird was in its seventh calendar year, 54 Biota 7/1-2, 2006 KALOCSA & TAMÁS

Table 3. Recoveries: Black Storks ringed abroad, identified in Hungary.

Czech Serbia & Slovakia Belgium Poland ? Republic Montenegro 1994 1995 1 1996 1997 1 3 1998 1999 3 1 2000 1 1 1 2001 2002 1 2 2003 6 1 2004

Table 4. Black Storks ringed and identified near their natal place.

Ring no. ringed Identified 50V 1995, Gemenc 2000, Gemenc 530 1996, Gemenc 1999, Kolut, Serbia 541 1996, Béda-Karapancsa 2003, 2004, Kopacevo, Croatia 542 1996, Gemenc 1996, Israel, 1997, Gemenc 55A 1997, Gemenc 1997, Gemenc 563 1998, Gemenc 2004, Kopacevo, Croatia 56C 1997, Béda-Karapancsa 1999, 2000, 2002, 2003 seen nesting, Gemenc 56V 1999, Vaskút 1999, Gemenc 57N 1999, Béda-Karapancsa 1999, Gemenc 580 1999, Gemenc 2000, Gemenc 581 1999, Gemenc 1999, Gemenc 582 1999, Gemenc 1999, Gemenc 583 1999, Gemenc 1999, 2000, 2001, 2002, Gemenc 584 1999, Gemenc 2000, Gemenc 587 1999, Gemenc 1999, Gemenc 58H 1999, Gemenc 2000, Gemenc 58M 1999, Gemenc 1999, Gemenc 58V 1999, Gemenc 1999, Gemenc, 2000, Israel 593 1999, Gemenc 1999, Gemenc 594 1999, Gemenc 1999, 2000, Gemenc 59L 1999, Gemenc 1999, Gemenc 5CC 2000, Gemenc 2000, Gemenc 5002 2001, Gemenc 2002, Gemenc 5009 2001, Gemenc 2003, Gemenc 501R 2002, Gemenc 2003, Gemenc, 2003, Rétszilas 502A 2001, Somogy 2003, Gemenc 5054 2002, Kopacevo, Croatia 2002, Kopacevo, Croatia KALOCSA & TAMÁS Biota 7/1-2, 2006 55 but was previously already identified at The colour-ringed Black Stork of unknown feeding places at the age of third, fourth origin was wearing a colour ring which was and sixth calendar year as well). Some not used in the Black Stork colour-ringing more ringed Black Storks were sighted in scheme, and we have not been able to Hungary as adults (Table 4). Altogether 15 trace its ringer. ringed Black Storks returned after one to seven years near their place of ringing in Observation during migration our country. One adult (eighth calendar 26 Black Storks colour ringed in Hungary year) Black Stork was identified in Croatia were, by April 2004, identified in Israel on in 2003, another adult (fourth calendar migration (Table 5). We have no data from year) Black Stork was identified in Serbia. the other, western migration route, which These places in the neighbouring coun- is used by a number of birds from Czech tries are so close to the places of origin Republic, Slovakia, and Poland (Pojer of these birds (a few tens of kilometers), 2003). however, that they can be considered as returned during breeding season to the Found dead natal place (Table 4). 14 Black Storks colour ringed in Hungary The latter three recoveries are interest- have been found dead (13 near nests, one ing for different reasons. The only Belgian in Israel) (Table 5). The young which died Black Stork (Kalocsa & Tamás 2002, 2003) near (or in) the nest were possibly affected was second calendar year, feeding in a by rough weather, thrown from the nest summering flock during breeding season. by strong winds during storms. The indi- This means it returned to Europe before vidual which was found dead in Israel was reaching sexual maturity, but we don’t trapped in a fish net (set up horizontally know if it used the western or the eastern above a pond, to prevent birds from steal- migration route, although theoretically it ing fish), from where it couldn’t escape. belongs to the western population. In Hungary, a Slovakian, a Czech and a The Serbian recovery was of a first calendar Polish colour ringed Black stork were found year bird, moving approximately 40 km dead, two of them victims of uninsulated northwards to feed in a flock before start- electric poles, while the third (the Polish ing its first migration. one) died from unknown causes.

Table 5. Recoveries: Black Storks ringed in Hungary, identified abroad.

Serbia & Israel Germany Croatia Montenegro 1994 1 1995 5 1996 11 1997 5 1998 1999 1 2000 1 2001 1 1 2002 2 1 2003 2 2004 1 56 Biota 7/1-2, 2006 KALOCSA & TAMÁS

Acknowledgements Mikuska, Molnár Zoltán, Mórocz Attila, Thanks to the following people who helped Nagy Kornél Péter, Nagy Tibor, Németh in different ways: Bajai Győző, Bartók Zoltán, Ákos, Omacht Zoltán, Osztrogonácz Miklós, Benei Béla, Blaskovits Zoltán, Boros Emil, Palkó Sándor, Pigniczki Csaba, Pintér Willem van den Bossche, Buzetzky Győző, András, Frantisek Pojer, Schmidt Tamás, Csonka Péter, Deme Tamás, Boris Erg, Siklósi Máté, Staudinger István, Szabados Felső Barnabás, Frank Tamás, Gyenis Milán, Sándor, Szabó Judit, Szarvas Pongrác, Halmos Gergő, Hetyei Róbert, Horváth Szőke Péter, Tajti László, Tőgye János, Marko Zoltán, Husti Gábor, Dr. Kalotás Zsolt, Tucakov, Várnagy Dávid, Várnagy Ferenc, Kammermann Péter, Kazi Róbert, Kempl Velekei Balázs, Prof. Dr. Zsuffa István, Antun Zsolt, Kováts László, Krug Tibor, Lovászi Zuljevic, and Zsumbera Zsolt. Péter, Mazula András, József Mikuska, Tibor

REFERENCES KALOCSA, B. & TAMÁS, E.A. 2002: The international Black Stork (Ciconia nigra) colour ringing programme and its Hungarian results (1994-2000). Aquila 107-108: 249-257. In Hungarian, with English abstract. KALOCSA, B. & TAMÁS, E.A. 2003: Black Stork (Ciconia nigra) Colour Ringing and Recoveries in Hungary, 1994-2000. Aves 40: 109-117. POJER, F. 2003: Black Stork (Ciconia nigra) Colour Ringing in the Czech Republic - Statistics and Results: a preliminary Report. Aves 40: 106-108. MA, WEI, XU & YIN Biota 7/1-2, 2006 57

Black Stork Ciconia nigra in Xinjiang, China

Ming MA, Shunde WEI, Feng XU & Shoujing YIN

Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, No. 818 Beijing Road, Urumqi 830011, Xinjiang, P. R. China, E-mail: [email protected]

Abstract On the basis of old books and some modern papers on the Black Stork Ciconia nigra and White Stork Ciconia ciconia asiatica, and including on-the-spot investigation and visits in Xinjiang from 1985 to 2004, we know there has been a great change in the distribution of the storks. One hundred years ago the White Stork was a common species in Yarkant and Kashgar, southern Xinjiang, but during the 1980s it was believed to be extinct not only in Xinjiang, but throughout China. The main reasons were thought to be that human population increased sharply in the oasis from 1950 to 2000, wetlands were cultivated and habitat destroyed, species competition between the Black Stork and White Stork, and illegal activities which affect the wildlife in the area, including hunting, fishing with explo- sives, poisoning, trapping, collecting eggs, and destroying the nests (e.g. by cutting down trees). In southern Xinjiang, it is estimated there were about 1,000 individuals in the Black Stork population from April to August in recent years. The biggest flock of Black Storks was found in Paman Reservoir on 19th May 1990, of about 110 individuals. 13 nests were found in an area of about 100 km2. The clutch size of the storks was from 4 to 5 eggs, occasionally 3 to 6 eggs (average = 4.57 ± 0.79, n = 7). The rate of fertilized eggs was 87.5% (n = 32). The diet indicated that the main food of the Storks in the breeding season was scaled fish.

Key words: Black Stork, Ciconia nigra, breeding ecology, population status, Xinjiang China

Received 6 February; accepted 27 March 2007 58 Biota 7/1-2, 2006 MA, WEI, XU & YIN

INTRODUCTION diverse and numerous in Xinjiang, includ- Xinjiang is one of the most arid regions ing shallow fresh or salt water pools and and the farthest area from the sea in the lakes, and along slowly flowing rivers near world, covering an area of 1.6 million km2. farmland or deserts, primarily in coniferous There are two vast basins with deserts: forest and poplar forest, but also in treeless Taklamakan, in the Tarim basin, is the sec- plateaus. In South Xinjiang, the breeding ond largest desert on earth, and the Turfan range includes Aksu, Wensu, Awat, Xayar, depression sinks to 150 m below sea level, Kuqu, Yuli, Qarkilik, Niya, Keriya, Kargilik which is the second lowest point with (Ye Cheng), Markit, Akto, Kashi, Toksun less than 50 mm average annual rainfall. and Bayinbuluke around the Tarim Basin, However, there are some famous moun- and from the Tianshan Mountains to the tains, such as the Tian-shan Mountains, Kunlun Mountains below an elevation of (3,500-7,400 m above sea level), the Kunlun 3,500m in almost every river valley. There Mountains, (5,000-8,611 m), the Altay were a few overwintering Storks in Akto Mountains, (2,000-4,300 m), and some and Wensu (Wei et al 1990). great rivers such as the Tarim River (2,179 km long) in southern Xinjiang, the Ili River MATERIAL AND METHODS (1,500 km) from Xinjiang to Kazakhstan, In the southern region of Xinjiang, the and the Ulungur River. All the rivers run research group visited the fields during the with no outlets to the sea, except the Irtysh breeding season from March to July, and River. Some areas are not as dry as people sometimes obtained information regard- think, for there are many bodies of water ing the nests from local herdsmen. If nests and wetlands near deserts in basins or were occupied, they were measured as plateaus, and some important waterfowl, soon as possible, including the size of tree, such as swans, spoonbills, cranes, pelicans nest, eggs or chicks, the exact position of and storks in the area. the nest was located on a map, and the At the end of the 19th century, Dr. Svan nest was regularly watched from a distance Hedin (from Sweden), N.M. Przevalski, P. throughout the day from 5:00 to 20:00 dur- K. Kozlov and V. I. Roborovski (Russians) ing the breeding season. Binoculars and explored Xinjiang and passed through the telescopes were used for observing behav- Tarim Basin many times, and many new iour ecology, and for observing the feed- species were discovered in central Asia. For ing place of the storks and counting them a long period of time, however, few people in the feeding area. In the following days, studied Black Stork in China (Zhang 1983, we surveyed the entire study area (10 x 10 Tan 1986, Teng 1986, Cheng 1987, Wei et al km2) to search for as many groups of storks 1990, Ma et al 1991). with nests as possible. When researchers From 1985 to 2004, our investigations of approached the nests, the nestlings often distribution, quantity, reproduction, feed- vomited food from their crops, so the food ing-habits, population ecology, and win- materials could be collected on the ground tering areas of Black Stork were carried out and analyzed. in the Tarim Basin. RESULTS Habitat and distribution Population Size and Fluctuation The Black Stork Ciconia nigra is a migratory During the study period we had some species that breeds in northern China and opportunities to investigate many wet- winters in southern China or neighbouring lands around the Tarim Basin and the Tarim countries such as India and Pakistan (Bobek River; in 20 areas and about 25 times (Table 2003). The habitats of this species are 1) over 170 storks were counted in the MA, WEI, XU & YIN Biota 7/1-2, 2006 59

Figure 1. Daily changes in the number of feedings for Black Stork recorded in Paman Reservoir in June-July, 1990.

80

70

60

50

40

30

20

10

0 1 2 3 4 5 6 7 8 9 101112131415161718192021222324 (hours)

survey. In southern Xinjiang, we estimated 2). The nests were all built in large trees that there were 500 to 1,000 Black Storks (Populus diversifolia) in Xayar, but only 4-5 from April to August in recent years. were occupied during that year. From 19th to 23rd May, 1990, about 110 The nests are made of large piles of poplar storks were found feeding in the shallow branches and bark, often built on the pre- waters at the northern end of the Paman vious year’s nest, especially if it was a suc- Reservoir near Xayar, 83° 08’E, 41° 00’N, cessful site. Two nests may be located only with an elevation of 960 metres; the area of 200 meters apart. Sometimes other birds water was more than 2,800 ha, surrounded such as Spanish Sparrow Passer hispani- by poplar Populus diversifolia, Tamarix spp., olensis place their nests inside the stork’s Typha spp., reeds Phragmites communis nests, and are not driven off. etc.. We saw the biggest population of The typical clutch size of the stork was 4 to storks in China between the end of May 5 eggs, occasionally 3 to 6 eggs (average = and the beginning of July many times 4.57 ± 0.79, n = 7). Eggs averaged 84.7 (82- between 1989 and 1992. On 7th Sept. 88) g in weight, and 48.7 (46.7-50.0) x 69.2 2004, we saw another group of about 30 (66.3-71.0) mm in size (n = 14). storks in Bayinbuluke. It was a migration The eggs are white in colour. Incubation is group, we think. performed by both sexes, and the incuba- tion period is between 31 and 34 days. Reproduction After hatching, both adults care for the The Tarim Basin is one of the main breeding young attentively. The rate of growth is regions of Black Stork in China. Every year, slow, reaching weights of 2.5 to 2.7 kg in the storks come to their breeding area and 30 to 50 days; the fledging period is from lay eggs in March and April. A total of 13 60 to 70 days. Most hatchlings returned nests was found in Paman Reservoir (ca. to their nests for the night until 100 days 100 km2) during the 1990 survey (Table of age. The rate of eggs fertilized is 87.5% 60 Biota 7/1-2, 2006 MA, WEI, XU & YIN

(n=32); rate of eggs hatched is 65.6% and the Ili River in Tianshan and Issyk-Kul. She rate of success is 50% (Table 3). stayed at Ebinur Lake for about two weeks. After several days of rest, Petr and Roman Food flew to the area of Karakum and Kyzylkum, The main food taken in the breeding narrowly surviving war, famine, aridity and areas is usually small fish, and accidentally sandstorms. Between October 2nd and shrimps, toads, insects and snakes. When 14th, Katerina left Issyk-Kul and returned people approach the nests, the young to the Tarim River in Xinjiang China. In often spit up food from their crops, so we November, the bad news came to us that were able to collect samples of food to Petr was missing at Kabul, Afghanistan, analyze stork feeding. In 15 samples, we and Roman also disappeared on his way found that the Crucian Carp Carassius aura- to Pakistan. Katerina wandered for more tus is a favoured food (See table 4 and 5). than two months at Bachu and Shache In summer, the storks usually mass and (Yarkant), at the edge of the Taklimakan look for food in the shallow water of the Desert. During this time, she tried several northeast part of the Paman Reservoir. times to go over the Kunlun Mountains Every day there are two peak feeding times and the Karakorum Mountains but failed. from 05:00 (sunrise) to 08:30 am, and 15:00 On December 12th, the temperature in to 19:00 pm (sunset) (Figure 1). southern Xinjiang had already fallen to 0°C. Katerina tried one last time to reach Migration Pamor. She flew along the Yarkant River In 2002-2003, a plan to track the migration via Taxkorgan and Kunjirap Pass (Bobek of Black Stork with satellites was devel- 2003). Finally, she arrived at Nanga Parbat. oped by the Czech Academy of Science On her way, there are several mountains, and Czech Radio. In Xinjiang our research Muztagata (7,546 m), Kongur (7,719 m), group supplemented the effort with and Qoglr (K2) (8,611 m). ground inspections. On December 17th we caught the signals At the beginning of July 2002, researchers of Katerina from Kashmir using the Argos searched for targets in the area of the Jenisj System. After a 400 km migration, Katerina River and the Irtys River between Siberia had successfully arrived at her wintering and Altai. About 20 days later, we finally ground. In this migration study, Katerina caught three adult birds and put wireless stayed in Xinjiang for about three months, emitters (weighing 100 g) on them, which which tells us that Xinjiang is one of the enabled us to track the migration routes of most important pass-ways for Black Stork the birds with the help of satellites. From migration. the results of DNA tests, we learned that two of the birds were male and the other DISCUSSION one female. We called them Petr, Roman, The research data compares breeding suc- and Katerina. cess in Xinjiang and Shanxi Provinces, two In mid August, Katerina began her trip. On geographical areas of China, to determine th August 19 , she arrived at Eblnur Lake whether there are any differences in habi- th in Xinjiang, China. On September 4-7 , tat and population (Table 3). However, the Petr and Roman began their migration. population size at Xayar is much larger, They flew to Kazakhstan from Russia, fly- because storks seldom aggregate during ing 100-200 km each day. On September the dry season and its associated decrease th 10 , Roman flew 565 km, breaking the in water level, as do the birds in South Black Stork record (488 km/day). At the Africa (Tarboton 1982). In China, all spe- same time, Katerina was in the area of cies of storks are endangered; from our MA, WEI, XU & YIN Biota 7/1-2, 2006 61

Table 1. Survey of Black Stork in Southern Xinjiang.

Dates Water Area County Number 29 March 1985 Aksu River Wensu 17 16 April 1985 Karayurguen Aksu 8 8 April 1986 Peacock River Yuli 8 6 April 1987 Baiyang River Turpan 1 20 June 1987 Kizil River Wuqia 2 9 July 1988 Yurungkax River Hotan 2 10 Jan. 1989 Gez River Akto 4 29 April 1989 Qarqan River Qiemo 6 6 May 1989 Niya River Minfeng 1 13 May 1989 Karakea River Moyu 2 20 May 1989 Yapu Lake Pishan 4 27 May 1989 Kalama Lake Markit 1 29 May 1989 Xiaohaizi Bachu 10 + 8 June 1989 Paman Reservoir Xayar 90+ (13 nests) 19 May 1990 Paman Reservoir Xayar 110 2 July 1992 Paman Reservoir Xayar 25 May – June 1992 Swan Lake Hejing 4 12 June 1992 Xiker Lake Jiashi 2 1 May 1992 Toksu River Xinhe 11 2 May 1992 Tula Lake Kuqa 15 May 1995 Paman Reservoir Xayar 48 6 March 1997 Qarqan River Qiemo (1 nest) June 1998 Paman Reservoir Xayar 43 June 1998 Dalongchi Lake Kuche (Kuqa) 13 26 June 2004 Kekeyar (Kunlun) Yecheng 5 (1 nest with 3 young) 7 Sept. 2004 Bayinbuluke Hejing 29+

Table 2. Breeding data of Black Stork in Paman Reservoir (1990).

No. of nest No.1 No.5 No.8 No.10 No.12 No.13 No.W Total % X Clutch size 4 6 4 5 4 5 4 32 100 4.57 Fertiliz 4 6 3 4 3 4 4 28 87.5 4.00 ed Hatched 4 6 0 0 3 4 4 21 65.5 3.00 Leave nest 4 6 0 0 2 4 0 16 50.0 2.29

Table 3. Comparison of breeding ecology for Black Stork in Xinjiang and Shanxi Provinces.

Items Xinjiang (Ma et al 1991) Shanxi (Liu et al 1990) Clutch—size 4—6 eggs (n=7) 2—4 eggs (n=5) (n=7, X=4.57) (n=5, X=4.0) Rate of fertilized 87.5% (n=32) 55% (n=4) Rate of hatched 65.6% 55% Rate of success 50.0% 45% Breeding data of Nicl 1.4—1.5 1.1 Nest sites in trees in cliffs Main food scaled fish non-scaled fish Population size at most 50—110 2—7 62 Biota 7/1-2, 2006 MA, WEI, XU & YIN

Table 4. Feeding nestlings of different ages with fish in Paman Reservoir (1990).

Age (days) 20 30 39 59 65 Items Number of nestlings 3 1 1 2 1 Food weight /once vomit (g) 30 80 30 298 100 149 235 105 Number of fish 13 5 4 28 10 36 68 57 The longest fish (mm) 100 105 95 185 150 110 100 97 The heaviest fish (g) 14 23 17 48 50 20 14 6 No.of Species of fish 1 1 1 6 2 5 4

Table 5. The food composition of Black Stork in Paman Reservoir (mm, g).

No. of Nest Total Total No.13 No.12 No. 1 (a) No. 1 (b) Numbers Weight Max. Max. Number(n) Length Weight Weight(w) (mm) (g) Species nwnwnwnw∑n%∑w%

Carassius auratus 28 62 10 62 34 146 62 214 134 71 484 62 105 14 Hemiculter 12 26 7 25 2 6 21 11 57 7 100 5 leucisculus Leuciscus 2 95 2 1 95 12 185 48 leuciscus Hedinichthys 11 14 2 36 13 7 50 6 155 20 yarkomtensis Megalobrama 140 1102 150618040 amblycephala Ctenogobius 1 3 1 1 3 55 3 giurinus Gammarus spp. 63 232210581 301 (shrimp) Other fish 6 40 6 3 40 5 Total 57 105 28 298 36 149 68 235 189 100 787 100

study, we propose that the reasons for atica, and also including on-the-spot inves- the decrease in numbers are low hatch- tigations and visits in Xinjiang from 1985 ing rates, predation of eggs and chicks by to 2004, we know of great changes in the crows, collecting and eating the eggs and distribution of storks. One hundred years chicks by local people, destruction of the ago the White Stork was a common species environment by humans, and insufficient in Yarkant and Kashgar, and in southern food for the storks. Xinjiang (Scully 1876; Ludlow & Kinnear On the basis of ancient books and some 1933-34, Przewalski 1948), but around the modern papers on the Black Stork Ciconia 1980s it was believed to be extinct in nigra and White Stork Ciconia ciconia asi- China. MA, WEI, XU & YIN Biota 7/1-2, 2006 63

The main reasons are probably the fact that Stork is not regarded as a bird of eastern the human population increased sharp- China, there were descriptions of white ly in the oasis between 1950 and 2000; storks with red bills in ancient Chinese wetlands were cultivated causing habitat literature. That means the former distribu- destruction; species competition between tion of Ciconia ciconia might have been the Black Stork and White Stork; and illegal more widespread. activities which affect wildlife in the area, including hunting, fishing with explosives, Recommendations poisoning, trapping, collecting eggs, and 1. For ecological balance, control the destroying nests (e.g. cutting down trees). human population in the breeding zone. Because the populations of White Stork 2. Also control the population of domestic were closer to human settlements, it was animals, recover natural vegetation, and easier for White Storks to lose their habitat reduce pressure on the environment. and nesting areas than Black Storks; there 3. Improve living condition of local people, were many more dangers affecting them. and reduce hunting pressure. This is the For instance, many lakes and rivers in the biggest oil field in Tarim, but local herds- plains have dried up because of irrigation, men are very poor. Pauperization is the which has had a direct adverse effect on main reason for hunting birds and gather- the availability of stopover and breeding ing eggs and chicks from nests. sites for storks. In particular, Lop Nur, the 4. Forbid local people from fishing during largest lake in Xinjiang before 1958 -1970, times of food shortage in spring. has diminished and dried up; it is a salt- 5. Strengthen management in the breeding desert now. The Tarim River, Qarqan River, and feeding areas, i.e. establish a reserve. Hotan River and Yarkant River have all 6. Education is very important in China. shortened in length and no longer reach Local inhabitants should be made aware their lakes of laws and regulations respecting wildlife In fact, there are only a handful of records protection and management. (not all confirmed) of Ciconia ciconia from Xinjiang and Tibet. None of these reports Acknowledgements are recent. This species should not be This study project was supported by the confused with the Oriental Stork (Ciconia Chinese Academy of Sciences (CAS) and boyciana), which is still found breeding the National Natural Science Foundation in northeastern China and wintering in of China (NSFC, No. 39970132 and central and southeastern China. In fact, No.30470262) from 1989 to 2002. We are China is home to almost the entire win- grateful to the following people who par- tering population of this species. (Note: ticipated in field work: Cai Dai, M. Baturhan, Ciconia boyciana was formerly regarded Kun Dai, Jinghe Gu and Zexin Jia. We are as a subspecies of Ciconia ciconia. This also grateful for the satellite data and ref- has caused some confusion in Chinese erences sent by Dr. Miroslav Bobek, Dr. ornithological literature). It interesting to Malcolm C. Coulter and Dr. M. Strazds. note that although the European White 64 Biota 7/1-2, 2006 MA, WEI, XU & YIN

REFERENCES BOBEK, M. 2002-2003: Reports on Black Stork in http://www.rozhlas.cz/ . CHENG, T. 1987: A Synopsis of the Avifauna of China. Science Press, Beijing, 37-38. LIU, HUANJIN, Hualong Su and S. Shen. 1990: A Preliminary Study on the Food Habit of ciconia nigra. Chinese Journal of Zoology 30: 21-23. LIU, HUANJIN and Hualong Su. 1990: Study on Ecology and Biology of Black Stork in Shanxi Province. Science Press, Beijing, 1-120: MA MING, M. BARTURHAN & KUN DAI. 1991. A preliminary observation on reproductive ecology of Black Stork in the Tarim River. Studies on the Animals in Xinjiang, 70-76. STRAZDS, M. 1990: Black Stork in Lativa-numbers distribution and ecology. Baltie Birds 5: 174- 179. TAN, Y. 1986: The Protected and Rare Animals in China. Birds:2.Ciconiiformes. Chinese Wildlife, 5-8. TARBOTON, W. 1982: Breeding status of the Black Stork in the Transvaal. Ostrich 53(3), 151-156. TENG, KEYU. 1986: Observation on the ecology habit of Black Stork. Shanxi Forest Science and Technology 3: 21-23. WEI, S. & MA M. 1990: Distribution and reproduction of Black Stork in Tarim Basin. Journal of 1st Aug. Agricul. College 13: 55-58. ZHANG, X. 1983: The Breeding Ecology of the Black Stork. Chinese Wildlife 5:18-19. PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 65

Recent records, review of wintering distribution, habitat choice and asso- ciations of Black Stork Ciconia nigra in India and Sri Lanka

Satish PANDE, Amit PAWASHE, Prashant DESHPANDE, Niranjan SANT, Raju KASAMBE & Anil MAHABAL

ELA Foundation, C-9, Bhosale Park, Sahakarnagar-2, Pune 411009, India E-mail: [email protected], [email protected]

Abstract Black Stork Ciconia nigra is an uncommon, wary, winter and passage migrant to India. The wintering population of Black Storks has reduced alarmingly. For Black storks that visit South Asia, India appears to be a major wintering ground. Until 1983, the wintering distri- bution of these storks is reported to be mainly from Northern India up to Solapur district, in the Deccan 180 N latitude. Our observations indicate range extension and show that most wintering Black Storks in India are adults and only a few are juveniles. The earliest sightings are in December and the latest are in mid-April. Our recent surveys and reported observations on the habitat choice of Black Storks in India show that they are found on natural lakes, artificial irrigation reservoirs, on river banks in agricultural or forest country, water bodies in forests, scrub, arid and semi-desert areas as well as on the sea coast.

Key words: Black Stork, Ciconia nigra, observations, wintering distribution, habitat choice, India

Received 6 February 2007; accepted 4 April 2007 PANDE, PAWASHE, DESHPANDE, SANT, 66 Biota 7/1-2, 2006 KASAMBE & MAHABAL

INTRODUCTION Northern India in 1986 and again in 1989 Black Stork Ciconia nigra is an uncom- at Pong Dam, Himachal Pradesh (Pandey mon, wary winter and passage migrant to 1989a, b); at various places in Rajasthan India. The geographic distribution of this (Sharma 1981, Vyas 1992, Sharma & Raza species is mostly in Poland, Baltic coun- 1994, Andheria 2000, Changani 2002); in tries, Western Europe, east through Russia Gujarat (Himmatsinghji 1985, Bhaskaran and North China. The species also inhabits 1995); and in Madhya Pradesh (Newton et Germany, France, Scandinavia, Burgundy al 1986, Misra 1994, Saxena 1998, Shafiq and Iberia. Black Storks are monotypic and 2002). There are few records in the north- two discrete populations are recognized: eastern part of India, particularly in Assam one population breeds in Central Asia and (Barman and Talukdar 1995), Guwahati, winters in Southwestern and Southern Asia Meghalaya (Choudhary 2003), Arunachal and the other breeds in Eastern Russia and Pradesh (Datta et al 1998) and West Bengal winters in Eastern China and Korea. Both (Sivakumar & Vibhu Prakash 2004). Black populations are widely scattered in win- Storks have been recorded in various parts ter along streams and forest ponds, etc., of Maharashtra (Mahabal & Lamba 1987, and are very inadequately covered by the Sawji 1990, Prasad 1997, Kurhade 2003, Asian Waterfowl Census (AWC) 1994. The Kasambe-in press) as well as in Andhra wintering distribution of these storks in Pradesh (Manakadan 1987, Anand Mohan the Indian subcontinent is reported mainly 2000) and particularly in Eastern Godavari to Northern India, from Punjab, Gangetic district during December-January 1987, plains to Eastern Assam, south through 1989, 1992, and 1995 (Rao et al 2000). There Rajasthan, Kutch, Northern Gujarat and is a single sighting of this stork at Nagarhole up to 18º N latitude, i.e. Solapur district in in Karnataka (Andheria 1999). There are Maharashtra in the Deccan (Ali and Ripley also records in the southernmost part of 1968, Elphick 1995) After reviewing the India, particularly Tamil Nadu (Perennou literature, we observed that although there and Santharam 1990, Relton 1998) and in are no systematic studies on the distri- Kerala (Narayan Kurup 1989, Praveen and bution pattern and movements of Black Menon 1994, Prasad 1997, Jayson 2000). Storks in India, there are several scattered There is a report of Black Storks in the observations throughout the country. Deccan (Pande et al 2003). The record of This paper deals with the review of pub- Black Stork from Thrissur at 100.20’ north lished records and recent unpublished latitude seems to be the southernmost records of wintering Black Storks in various for India. Ali and Ripley (1968) have stated states of India, along with observations on that these storks have not been previously their habitat choice and associations. This recorded in South India, although a couple also includes our own observations carried were seen decades ago in Sri Lanka (Henry out on the wintering population of these 1971). storks in Pune and Kolhapur districts in Table 1 indicates that, in general, sightings the states of Maharashtra from December of these storks are often solitary, in couples 1998 until April 2004. and a few in small, scattered parties of from three to ten birds. Once, a flock of 25 RESULTS Black Storks was recorded at Ranthambore Previous records of wintering distribu- in Rajasthan in January 2000 (Andheria tion (1965 onwards) 2000). A review of the literature (Table 1, Figure India is a major wintering ground for Black 1) shows that Black Storks were recorded Storks in South Asia. 47 %, 31% and 81% in various states of India, particularly in of all migrant Black Storks to the region PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 67

Figure 1. Published records of Ciconia nigra in India. No. of Black Storks on the Y axis and year of record on the X axis.

250

200

150

100

50

0 1966-75 1976-85 1986-90 1991-95 1996-00 2001-04 have been recorded in India in 1994, 1995, Jammu and Kashmir, Punjab, Haryana, and 1996 respectively. Furthermore, from Bihar and Orissa. published records, including AWC records, the number of storks was calculated for the New records of wintering distribution first 10 years and the remaining were illus- Table 2 and Figure 3 show a compilation of trated in 5 year increments in Figure 1. This our observations, as well as collected infor- indicates that the number of storks was at mation on Black Storks from personal com- a maximum during 1986-1990 but then munication from bird watchers and mem- they decreased marginally during 1991- bers of the ELA Foundation, all supported 1995 and 1996-2000. Figure 3 also shows by photographs, from various districts of wintering distribution of Black Storks in Gujarat, Madhya Pradesh, Maharashtra many states of India; however, there are and Karnataka, during December 1997 to no authentic records from the states of February 2004. Here, once again the storks

Figure 2. Recent unpublished observations of Ciconia nigra. No. of Black Storks on Y axis and Year of record on X axis.

80 70 60 50 40 30 20 10 0 1997 1998 1999 2000 2001 2002 2003 2004 PANDE, PAWASHE, DESHPANDE, SANT, 68 Biota 7/1-2, 2006 KASAMBE & MAHABAL were observed solitarily, in couples and a Madhya Pradesh, East Godavari in Andhra very few in small loose parties of three to Pradesh, Veer Dam near Pune, and water 13 birds. Two flocks of 19 and 31 birds were reservoirs near Amravati in Maharashtra noted at two different water reservoirs at seem to be some of the favoured sites for Amravati in November 2001 (Kasambe). wintering Black Storks in peninsular India. The number of storks observed from 1997 Further, it has been mentioned that dur- until 2004 is plotted year wise in Figure ing the AWC 1987-91, the most important 2. This indicates that their numbers were sites in India were identified at Kaziranaga highest in 2001, followed by 2003 and National Park, Assam and the Ramganga 2002, and during the remaining years they Barrage in Corbett National Park, Uttar were seen in smaller numbers. It can be Pradesh. seen from Tables 1 and 2 that most of the wintering Black Storks in India are Habitat choice adults, with red beaks and scarlet feet, and Black Storks are water birds and are found very few are juveniles with black beaks. wading in marshes at the edges of water The adult to juvenile ratio of Black Storks bodies or in shallow waters. New records from published and unpublished records and older reported observations on the (Tables 1 and 2) is estimated to be 24.6: habitat choice of Black Storks in India show 1 (n = 282). However, the age of ten Black that they are found mostly in water res- Storks was not mentioned in the records. ervoirs in scrub areas followed by river Furthermore, it can be seen that the earli- banks, forest ponds and water reservoirs est sightings are in October, most occur in in agricultural cropland and a single record November, and the latest in March. In our on the sea coast. These storks are reported observations at Pune, Nashik, Amravati dis- from just below the mean sea level to 500 tricts (Maharashtra) and Dharwad district m altitude. Our observations at Dharwad, (Karnataka), the habitats chosen by Black Karnataka have revealed that some of the Storks seem to be stopover sites for one habitats are used by storks both for feed- week to a maximum of four weeks. Hence, ing and roosting, particularly near water these places do not appear to be their final bodies with large surrounding trees or wintering grounds and the birds appear reed beds, where the storks find safe roosts here in passage. at night, while other areas like islands in Further, Table 2 and Figure 3 show that rivers and reservoirs are used exclusively Black Storks regularly wintered at Veer for roosting at noon and night (Pande, S., Dam, Naygaon, and Saswad areas near personal observation). On several occa- Pune city from December 1998 to January sions, the authors have noted storks soar- 2003. They did not visit in the winters ing on rising thermals in the late after- of 2003 and 2004, probably because the noon. In India, Black Storks are seen to water bodies of their choice had dried feed on aquatic animals, particularly frogs, because of a severe prevailing drought. fish, crustaceans, water insects and occa- Storks were also regular visitors in the vicin- sionally young or disabled birds, rodents, ity of Amravati town from December 2000 etc. (Ali and Ripley 1968). However, on until February 2004, whereas, at Dharwad, two occasions, when water bodies were Karnataka, they were seen in alternate smaller than usual because of drought, years. At all these places, although winter- the authors have clearly seen storks feed- ing Black Storks are seen regularly, they ing exclusively on fish. We observed from come in very small numbers. published and unpublished records (Table From Figure 3 it can be seen that Pong Dam 1 and 2) that Black Storks prefer water bod- in Himachal Pradesh, Kanha National Park in ies in scrub areas (WS = 58.2%), followed PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 69

Figure 3. Map showing previous published and recent unpublished Indian records of Black Stork.

by water bodies in forests (WF=19.5%), Geese Anser indicus, European White Storks rivers (R=13.7%), water bodies in agricul- Ciconia ciconia, a few medium and small tural areas (WA=8.2%), and the sea coast sized waders (Sandpipers, Shanks, Stints, (SC=0.4%) (n=292). Godwits), Ospreys Pandion haliaetus and Western Marsh Harriers Circus aeruginosus Associations with other animals (Table 1 and 2). With winter migrant birds In India, wintering Black Storks have With local birds been seen associating with other winter They also associate with resident and migrants including Demoiselle Cranes local migrants such as Painted Stork Grus virgo, Common Cranes Grus grus, Mycteria leucocephala, Asian Open-bill Comb Ducks Sarkidiornis melanotus, Ruddy Stork Anastomus oscitans, White-necked Shelducks Tadorna ferruginea, Barheaded Stork Ciconia episcopus, Black-necked Stork PANDE, PAWASHE, DESHPANDE, SANT, 70 Biota 7/1-2, 2006 KASAMBE & MAHABAL

Table 1. Previous published records of Black Stork Ciconia nigra during winter in India

Date No. Age Locality Lat/Long. Hb. Act.. Assoc. Ob.P Reference Khamgao, Pune, Mahabal & Lamba J 1966 1 A 18.30N74.10E WA F 1D MS (1987) Sariska, J 1978 1 A 27.05N79.17E WF 1D Sharma (1981) Rajasthan 22N 1982 1 Kanha NP, MP 23N WF F 2.5M Newton et. al.(1986) Newton, et. 22J 1983 2 Kanha NP, MP 23N WF F 2.5M al.(1986) Himmatsinghji 25N 1983 2 A,J Kutch, Gujrath 24.08N70.16E WS F 1D (1985) 7N 1985 6 A Rollapadu, AP 15.52N78.18E R F 2M Manakadan (1987) 23F1986 6 A Pong Dam, HP 31.18-32.07N R F 1.5M Pandey (1989) Bharatpuzha, BK, Narayan Kurup 7J 1987 1 A RF 1D Kerla Waders (1989) Periyar WLS, Narayan 24F1987 1 A 10N76E R F WNS 1D Kerla Kurup(1989) J 1987 2 A E.Godavari, AP 16N R F 1D Rao et.al.(2000) Kota, SE 1988-92 4 A 25.19N75.52E WS F 4Y Vyas(1992) Rajasthan 30J 1988 1 J Pondicherry, TN 12N WS F 2M Perennou (1990) 21F 1989 1 A Pong Dam, HP 31.18-32.07N R F 1D Pandey(1989) D 1989 4 A E.Godawari, AP 16N R F 1D Rao et.al.(2000) 1990 5 A Buldhana, MS 20.32N76.14E WS F 1D Sawji(1990) Sri Venk. Anand Mohan 1991-94 1 A 13.38N79.11E WF F WLS,AP (2000) D 1992 3 A E.Godawari, AP 16N WA F 1D Rao et.al.(2000) Praveen & Menon O1993-94 6 Walayar, Kerala 10.50N76.51E WA F 4M (1994) WS, Sharma & Raza J 1994 1 A Rajasthan WA F WNS, 1D (1994) PS, OBS J 1994 4 A Trichur, TN 10.59N79.02E WA F WS 1D Relton (1998) RT, SB, 6M 1994 10 A Bhopal, MP 22.57N77.43E WF F WI, GC, 1D Misra (1994) WNS Deepor Beel, Barman & Talukdar 16D 1994 2 A 26.03N90.36E WF F GAS 1D Assam (1995) Sasan Gir, 23D 1994 11 A 21N71E WS F 1D Baskaran (1995) Gujarat Kumbhalgarh 1994-2000 1 A WF F Changani (2002) WLS,Raj. J 1995 6 A E.Godawari, AP 16N R F 1D Rao et.al.(2000) Pakhui WL, 1996 1 26.53N92.07E R F 1D Datta et.al.(1998) Ar.Pr. Amravatina-gar, WNS, 6F 1997 2 A WA F 1D Prasad (1997) Kerala PS F 1997 5 A Pune, MS 18N WA F WS 1D Prasad(1997) J 1998 1 A Morena, MP 25.15N76.22E R F 1D Saxena(1998) 14J ‘99 1 A Nagarhole, K 11.45N76.05E WF F LAS 1D Andheria(1999) Buxa Tiger Sivakumar et al 2000-01 1 A 26N89E WF F 1D Reserve, WB (2004) Guwahati, 24J ‘99 1 A 25.58N91.45E WF F Ducks 1D Choudhary (2003) Meghalaya PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 71

Ranthambor, WNS, J 2000 25 A 25.N76E WF F 1D Andheria (2000) Rajasthan PS WNS, PS, 4J 2000 1 J Thrissur, Kerala 10.20N75.55E SC F 1D Jayson (2000) OBS, WS J 2001 1 A Kanha NP, MP 22.07N80.30E WF F 1D Shafiq (2002) PS, Kasambe 25F 2001 3 A Amravati, MS 20.56N WF F 1D Ducks (2003), in Press WS, Ahmadnagar, 16J 2003 11 A 19.05N WS F WNS, 2W Kurhade (2003) MS PS, SB Ceylon 1961 2 A WF F Henry (1971) (SriLanka)

Ephippiorhynchus asiaticus, Lesser Adjutant Threats Stork Leptoptilos javanicus, Greater Adjutant The authors have witnessed two incidences Stork Leptoptilos dubius, Eurasian Spoonbill of attempted hunting of adult Black Storks Platelea leucorodia, Brahminy Kite Haliastur in our region. One stork was rescued near indus, River Tern Sterna aurantia, Great Akola (Maharashtra), and was treated but Cormorant Phalacrocorax carbo, Greater died (Joshi, Deepak, personal communica- Flamingo Phoenicopterus ruber, Lesser tion). On the other occasion, a Black Stork Whistling Duck Dendrocygna javanica and was found in a field near Nashik, unable White Ibis Threskiornis melanocephalus to fly. An injury to one leg was noted. In general we noticed that association with The stork was treated for two weeks and White-necked Stork, Painted Stork, White released successfully (Ranade, S, personal Stork, Bar-headed Goose and Demoiselle communication). We also came across two Crane seems to be commonest among incidences of attempted hunting of White wintering Black Storks in India. Ali and Storks Ciconia ciconia. A review of the lit- Ripley (1968) have also reported repeated erature shows five incidences of hunting, association with White-necked Stork. when five White Storks Ciconia ciconia died. The other rescued, injured stork went With mammals to a zoo. Black Storks were seen with mammals such Increasing human interference and as Spotted Deer Axis axis (Family: Cervidae), encroachment on wetlands, excessive fish- Gaur Bos gaurus (Family: Bovidae) at Pench ing activities, hunting, droughts, water pol- National Park, Madhya Pradesh in February lution, and molestation are the prime risks 2002 (Pande, S., unpublish data) and faced by Black Storks on their wintering January 2003 (Sant, N.R. unpublished), and grounds in India, as elsewhere. Reduced domestic cattle in several places. It is quite habitat safety and scarce food availability likely that the Black Storks are observed will have a negative effect on the wintering near mammals because of flushing of population of Black Storks in our region. the potential prey such as grasshoppers The effect of severe prevailing drought was and other insects. They are seen to avoid recently demonstrated (2003-2004), when man. We did not observe any inter-specific no Black Stork was seen on water bodies aggression between Black Storks and other near Pune, since they had totally dried up. species of local and migratory birds or mammals. However, dogs accompanying Conservation grazing domestic cattle often disturbed The conservation status of Black Stork is the Black Storks, which were then forced to noted in Appendix II of CITES (Convention leave the place. on International Trade in Endangered PANDE, PAWASHE, DESHPANDE, SANT, 72 Biota 7/1-2, 2006 KASAMBE & MAHABAL

Table 2. Recent unpublished records of wintering Black Stork Ciconia nigra in India.

Date No. Age Locality Lat/Long. Hb. Act.. Assoc. Ob.P Reference Sant N.R. F 1997 5 A Dharwad, Karnataka 15.27N75.05E WS FR LAS, CD 30D Sant N.R. 10D1997 2 J Veer, Pune, MS 17-18N R F BD, Wad 35D Pande S.A. Du, Wad, DJ 1998/99 2 J Veer, Pune, MS 17-18N R F 30D Pande S.A. GF DJ 1999/00 2 J Veer, Pune, MS 17-18N R F BHG 40D Pande S.A. F 1999 2 A Dharwad, Karnataka 15N75E WS FR LAS, CD 1W Sant N.R. DJ 1999/00 2 A Naygaon,Pune,MS 17-18N WS R DC,Du 20D Pande S.A. BHG, PS, 24D 2000 1 A Amrawati, MS 20.56N WS F 1D Kasambe R WNS J 2001 1 A Nasik, MS 20N73E R Hurt 10D Ranade S J 2001 2 A Veer, Pune, MS 17-18N R F DC,Du 1D Pande S.A. F 2001 3 A Dharwad, Karnataka 15N75E WS FR LAS,CD 1W Sant N.R. 11N 2001 13 A Amravati, MS 20.56N WS F PS,BHG 1D Kasambe R 25N 2001 31 A Amravati, MS 20.56N WS F PS, GC 1D Kasambe R 25N 2001 17,2 A,J Amravati, MS 20.56N WS F BHG,SB 1D Kasambe R PS,OBS, 25D 2001 5 A Amravati, MS 20.56N WS F 1D Kasambe R GC J 2002 4 A Naygaon,Pune, MS 17-18N WS F RT,O 1D Pande S.A. Garade, Saswad, Pune, SB, Wad, Pawashe J 2002 6 A 17-18N WS F 2W MS BNS A.P. WNS, Pawashe JF 2002 2 A Ketkavale, Pune, MS 17-18N WS F 2W Ducks A.P. F 2002 2 A Pench NP, MP WF F Gaur, SD 1D Pande S.A. 24N 2002 1 A Amravati, MS 20.56N WS F BHG 1D Kasambe R 24N 2002 7 A Amravati, MS 20.56N WS F PS 1D Kasambe R J 2003 4 A Naygaon,Pune, MS 17-18N WS R DC, PS, WI 1D Pande S.A. Pawashe J 2003 6 A Garade, Pune, MS 17-18N WS F SB, MH 2W A.P. J 2003 1 A Veer, Pune, MS 17-18N R F BD 1D Pande S.A. Kolhatkar J 2003 1 A Velavadar, Gujarat 21.36N72.06E WS F DC, CC 1D C. M 2003 2 A Kolhapur, MS 17N WA Fly 1D Pande S.A. J 2003 3 A Kanha NP, MP 23N WF F LWT, SD 1D Sant N.R. 23N 2003 14 A Amravati, MS 20.56N WS F WNS, CC 1D Kasambe R 7D 2003 1 A Amravati, MS 20.56N WS F PS,B D 1D Kasambe R J 2004 1 A Pune, MS 18N R Fly 1D Ranade S PS, BHG, 11J 2004 3 A Amravati, MS 20.56N WS F 1D Kasambe R GC 22F 2004 1 A Amravati, MS 20.56N WS F PS,DC 1D Kasambe R F2004 5 A Dharwad, Karnataka 15N75E WS F,R WNS 1D Sant, N.R.

Key to abbreviations used in tables 1 and 2: Date: This is the date on which the observations were recorded: O-October, N-November, D- December, J-January, F-February, M-March. Age: A-Adult, J-Juvenile. Locality: This specifies the locality where the birds were sighted; Ar.Pr.-Arunachal Pradesh, AP-Andhra Pradesh, Guj-Gujarat, HP-Himachal Pradesh, K-Karnataka, MP-Madhya Pradesh, MS-Maharashtra State, Raj.-Rajasthan, TN-Tamil Nadu, UP-Uttar Pradesh, WB-West Bengal, WLS- PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 73

Wildlife Sanctuary, NP-National Park. Hb- Habitat - habitats where the Black Storks were observed: WA-Water body in agricultural area, WS-Water body in scrub area, WF-Water body in forest, R-River bank, SC-Sea coast. Act. - Activity: F-feeding, Fly-Flying, R-Roosting, Hurt-Injured. Assoc. - Associations: BD-Brahminy Duck, BHG-Bar-headed Goose, BK-Brahminy Kite, BNS-Black- necked Stork, CC-Common Crane, CD-Comb Duck, DC-Demoiselle Crane, GAS-Greater Adjutant Stork, GC-Greater Cormorant, GF-Greater Flamingo, LAS-Lesser Adjutant Stork, LWT-Lesser Whistling Teal/Duck, MH-Marsh Harrier, OBS-Open-bill Stork, O-Osprey, PS-Painted Stork, , RT- River Tern, SD-Spotted Deer, SB-Eurasian Spoonbill, WI-White Ibis, WNS-White-necked Stork, WS-White Stork. Ob.P. - observation period - The duration during which observations were made in D-Day, W- Week. Reference -the relevant reference is mentioned. Observer -The names of observers are given.

Species of Wild Fauna and Flora) 2000 and 22.6% of Black Storks recorded in pub- Schedule IV of the Wildlife (Protection) Act lished and unpublished records (Tables 1 1972, of India. The South Asian non-breed- and 2) (n = 292) were seen in 14 protected ing population of Black Storks at 1% level areas. We are making active efforts on is 100 and an estimate of the total popula- behalf of the ELA Foundation to educate tion is < 10,000 (Islam and Rahmani 2004). local villagers and school children through Whenever Black Storks or any other birds slide shows and reports in newspapers to are found in distress, members of the ELA create awareness and prevent poaching. Foundation actively intervene and aid Active participation of forest department the needy birds. We, on behalf of ELA and local NGOs is taken when the need Foundation, our NGO, took active success- arises, but much still needs to be done ful conservation measures in the form of on the wintering and foraging grounds in confiscating and burning net traps and our region to safeguard the future of the arresting poachers, with the help of the declining Black Stork population. Forest Department, when net traps were discovered on the wintering grounds of Acknowledgements Black Storks and White Storks (2002 and The study was partly supported by the ELA 2003). Continued vigilance in the area Foundation. We thank Pramod Deshpande occupied by the storks was maintained in for making the map included in this MS. the winter to prevent future disturbances. PANDE, PAWASHE, DESHPANDE, SANT, 74 Biota 7/1-2, 2006 KASAMBE & MAHABAL

REFERENCES Asian Waterfowl Census1987-91: Distribution and status of Asian Waterfowl. AWB, Publication No. 86, IWRB, Publication No. 24. ALI SALIM, S & DILLON, R. 1968: Handbook of the Birds of India and Pakistan. Vol. 1 Oxford University Press, Bombay. ANAND MOHAN, B. 2000: Birds in and around Sri Venkateshwara Wildlife Sanctuary, Andhra Pradesh. Zoo’s Print Journal 15: 339-343. ANDHERIA, A. P. 1999: Birds of Nagarhole (Rajiv Gandhi ) National Park, Karnataka. Newsletter for Birdwatchers 39: 58-60. ANDHERIA, A. P. 2000: Birds of Ranthambore National Park, Rajasthan. Newsletter for Birdwatchers 40: 51-53. BARMAN, R. & TALUKDAR, B.K. 1995: New record of Black Stork Ciconia nigra in Deepar Beel, Assam. Newsletter for Birdwatchers 35: 15. BASKARAN, S. T. 1995: An Audio Guide to the birds of South India and notes on Night Herons and Black Storks. Newsletter for Birdwatchers 35: 50. CHANGANI, A. K. 2002: Avifauna of Kumbhalgarh Wildlife Sanctuary in the Aravalli Hills of Rajasthan. Zoo’s Print Journal 17: 764-768. CHOUDHARY, A. 2003: The birds of Nongkhyllem. Newsletter for Birdwatchers 43: 52-53. DATTA, A., SINGH, P., ATHREYA, R.M. & KARTHIKEYAN, S. 1998: Birds of Pakhui Wildlife Sanctuary in Western Arunachal Pradesh, Northeast India. Newsletter for Birdwatchers 38: 91- 96. ELPHICK, J. 1995: The Atlas of Bird Migration. Random House, New York. HENRY, G. M. 1971: A Guide to the Birds of Ceylon. Oxford University Press, Bombay. HIMMATSINHJI 1985: The Black Stork in Kutch: old record confirmed. J. Bombay Nat Hist. Soc. 82: 403. ISLAM, M. Z. AND RAHMANI, A. R. 2004: Important Bird Areas in India: Priority sites for conserva- tion. Indian Bird Conservation Network: Bombay Natural History Society and BirdLife International, UK. JAYSON, E.A.. 2000: Occurrence of Black Stork Ciconia nigra (Linnaeus) in Kole Wetland of Thrissur, Kerala. Newsletter for Birdwatchers 40: 39-40. KASAMBE , R. In press. A note on Black Storks. Zoo’s Print Journal. KURHADE, S. 2003: Sighting of Black Stork and White Stork in Ahmadnagar, Maharashtra. Newsletter for Birdwatchers 43: 41. MAHABAL, A. & LAMBA, B.S. 1987: On the birds of Poona and vicinity. Rec. Zool. Surv. India, Occ. Paper No. 94: 1-115. MANAKADAN, R. 1987: The Black Stork Ciconia nigra (Linnaeus) in Kurnool District (Andhra Pradesh). J. Bombay nat. Hist Soc. 84: 675-676. MISRA, M. K. 1994: Stork Watching at Ratapani. Newsletter for Birdwatchers 35: 118. NARAYAN, K. D. 1989: Sight records of Ibis and Storks in Kerala. J. Bombay nat. Hist. Soc. 86: 239. NEWTON, P. N., STANLEY, B. & GRAY, J. N. 1986: The birds of Kanha Tiger Reserve, Madhya Pradesh, India. J. Bombay nat. Hist. Soc. 83: 477-498. PANDE, S., TAMBE, S, FRANCIS, C. & SANT, N. 2003: Birds of Western Ghats, Kokan and Malabar (Including birds of Goa). Oxford University Press and Bombay Natural History Society. PANDEY, S. 1989a: Black Stork. Newsletter for Birdwatchers 29: 9. PANDEY, S.1989b: The Pong dam Lake bird sanctuary, Himachal Pradesh. Newsletter for Birdwatchers 29: 3-4. PERENNOU, C & SANTHARAM, V. 1990: Status of some birds in southeastern India. J Bombay.Nat. Hist.Soc 87: 306-307. PRASAD, A. 1997: Black Storks in Kerala. Newsletter for Birdwatchers 37: 65. PANDE, PAWASHE, DESHPANDE, SANT, KASAMBE & MAHABAL Biota 7/1-2, 2006 75

PRAVEEN, J. & MENON, A. 1994: Walayar-An Avian Picture. Newsletter for Birdwatchers 34: 79- 82. RAO, V. V., NAGULU, V. & SRINIVASULU, C. 2000: Additional site records of Black Stork Ciconia nigra (Linn.) in Andhhra Pradesh. J.Bombay nat. Hist. Soc 97: 143. RELTON, A. 1998: Threatened birds of Karaivetti Bird Sanctuary, Tiruchirapalli, Tamil Nadu. Newsletter for Birdwatchers 38: 21-22. SAWJI, P.G. 1990: Black Storks in Maharashtra. Newsletter for Birdwatchers, 30: 11. SAXENA, R. 1998: A checklist of birds of Morena District (M.P.) Newsletter for Birdwatchers 38: 28-30. SHAFIQ, T. 2002: A visit to Kanha National Park, Madhya Pradesh, India. Newsletter for Birdwatchers 42: 22-24. SHARMA, A.K. 1981: Birds of Sariska Tiger Reserve. Newsletter for Birdwatchers 21:7-10. SHARMA, S. K. & RAZA, T. 1994: Birds of Southern Rajasthan. Newsletter for Birdwatchers 34 109-113. SIVAKUMAR, S. & VIBHU, P. 2004: Fauna of Protected Areas-6: Waterbirds of Buxa Tiger Reserve, West Bengal. Zoo’s Print Journal 19: 1451-1452. SRIDHAR, S. 1989: White and Black-necked Storks in the 1989 census (with extract of Table of Asian Waterfowl Census 1989). Newsletter for Birdwatchers 29: 10. VYAS, R.1992: Checklist of the birds of Kota district in south-east Rajasthan. Newsletter for Birdwatchers 32: 8-10. 76 Biota 7/1-2, 2006 PETKOV, IANKOV & GEORGIEV Biota 7/1-2, 2006 77

Recent status and changes in the breeding population of the Black Stork Ciconia nigra in Bulgaria

Nikolai PETKOV, Petar IANKOV & Dimitar GEORGIEV

Bulgarian Society for the Protection of Birds, E-mail: [email protected]

Abstract There are several publications discussing the breeding population of the Black Stork Ciconia nigra in Bulgaria. In general, they give a contradictory picture of the total number of breeding pairs. There is uncertainty about the number of nesting pairs and the percent- age of non-breeding Black Storks that stage in the country during the summer. This paper attempts to solve the contradiction and provide reliable data on real breeding numbers, distribution, and population trends of Black Stork in Bulgaria, focusing on the period 1990 – 2003. The data is based on results of the Bulgarian Society for the Protection of Birds project for the national Breeding Bird Atlas. For the first time, results are presented from a systematic survey of all 1420 10x10 km UTM squares of the territory of Bulgaria. Changes and trends in the breeding population of the species are discussed based on previous publications on the Black Stork in Bulgaria.

Key words: Black Stork, Ciconia nigra, Bulgaria, population status

Received 20 February 2007; accepted 15 April 2007 78 Biota 7/1-2, 2006 PETKOV, IANKOV & GEORGIEV

INTRODUCTION precise population figure because there The distribution and numbers of the breed- are many non-breeding pairs and wander- ing population of the Black Stork Ciconia ing adults. A thorough review of the status nigra in Bulgaria have been the subjects of the Black Stork was made by Petrov et al. of several publications. For the first half (1991). From 1964 until 1990, 297 breeding of the 20th century, Patev (1950) describes sites were registered, mapped on a 10x10 the Black Stork as an almost extinct species km UTM grid. The population by the end in Bulgaria. In an overview of the status of the 1980s was estimated at 200-220 of the species, covering the period 1889 pairs with a positive trend of increase in – 1963, Boev & Paspaleva-Antonova (1964) the breeding pairs’ density. Similar data report 74 breeding localities in the whole was presented by Petrov et al. (1993). country. At the beginning of the 1980s, the Information on the numbers and trend of Black Stork was included in the Bulgarian the species for the period around 1993 is Red Data Book as an Endangered Species published in Tucker & Heath (1994): 150- with about 50 known pairs (Michev 1985). 170 pairs with a small increase as a trend. The same author noted that the numbers For the period 1990-1997, the Bulgarian and distribution of the species were poorly population was estimated to be 150-180 known. More information on the species breeding pairs, with an increasing trend appeared in early 1990 (Simeonov et al. (BirdLife International/EBCC, 2000). It is 1990), but the same number of 50 pairs is obvious that in spite of the general agree- reported. It is, however, mentioned that ment that the population is increasing, the species is distributed throughout the there are some contradictions in the popu- whole country, but it is difficult to give a lation figures.

Figure 1. Breeding distribution of the Black Stork in Bulgaria in the period 1889 – 1963 (Boev & Paspaleva-Antonova 1964). PETKOV, IANKOV & GEORGIEV Biota 7/1-2, 2006 79

Figure 2. Breeding distribution of the Black Stork in Bulgaria in the period 1964 – 1990 (Petrov et al 1991). Size of dots show confirmed breeding (the largest), possible breeding and probable breeding.

MATERIAL AND METHODS which on one hand omits the possibility This paper is based on a careful assess- of counting as breeding pairs individuals ment of all existing data on the Black summering in the country, but at the same Stork in the literature, as well as on the time leaves out a considerable number most recent data from the Breeding Bird of observations and records that might Atlas of Bulgaria (BSPB/BirdLife Bulgaria, well be actual breeding pairs. Thus the in press). The standard methodology of figure presented in this paper should be mapping breeding birds on the UTM grid regarded as the minimum number of pairs was applied. For the first time, a systematic breeding in the country. survey of all 1240 10x10 km UTM squares covering the entire territory of Bulgaria RESULTS AND DISCUSSION was implemented. Data was collected for Breeding distribution the period 1990-2000, and some supple- Out of 1240 10x10 km UTM squares of mentary records were gathered during the Bulgaria, the Black Stork is recorded dur- following years (up to 2003). However, for ing the breeding season in 363 squares the purpose of this paper and the evalu- (29.3%). A comparison of distribution ation of the national population, we have maps of the species published over the considered mostly data collected after years shows a definite increase in the area 1996. The data is stored in the National Bird of breeding distribution. There are sev- Databank of BSPB/BirdLife Bulgaria. We eral regions (Figure 1-3) where the species have evaluated the number of breeding has been recorded during three periods pairs based solely on confirmed breeding, (around 1960, around 1990, and around 80 Biota 7/1-2, 2006 PETKOV, IANKOV & GEORGIEV

Figure 3. Breeding distribution of the Black Stork in Bulgaria in the period 1990 – 2000 (National Bird Databank with the BSPB/BirdLife Bulgaria). Size of dots show confirmed breeding (the larg- est), possible breeding and probable breeding.

2000). These regions are, roughly, the the year 2000, the increase in the area of Eastern Rhodope Mountains, the Strandja distribution continued. There were two Mountains, the Eastern Balkan Range and prominent changes . the Ludogorie Plateau, the middle part of The first was the appearance of com- the Bulgarian sector of the Danube river pact breeding of the species in the Sakar (around the town of Svishtov), the Sofia Mountains, thus connecting the most Plain, and the Western part of the Sredna densely populated areas of Strandja and Gora Mountains. In the 1990s the breeding Eastern Rhodope. The second significant distribution of the species was much more change was the occurrence of breeding random and significantly widened across pairs in South-West Bulgaria. the country with two prominent concen- It is possible that part of the observed trations in South-East (Starndja) and South increase in Black Stork distribution is due Central (Eastern Rhodope and the northern to more intense ornithological surveys in slopes of the Western Rhodope) Bulgaria. Bulgaria, especially after 1988, resulting in At the same time, new breeding locations better knowledge of the species. However, were recorded. Most of the newly found a significant part of the observed positive breeding localities were located in new trend can be attributed to actual occupa- areas, especially in the Danube Plain and tion of new territories by the species. The the northern slopes of the Balkan Range. appearance of the species in new areas of During this period the Black Stork was the country confirms the actual increase in recorded throughout the country, with the breeding numbers. exception of South-West Bulgaria. Around PETKOV, IANKOV & GEORGIEV Biota 7/1-2, 2006 81

Breeding population numbers some reconsideration of its listing as a It is typical of the Black Stork that solitary rare species. If strictly applying the IUCN adult birds wander throughout the breed- criteria on a national scale, the species ing season, as has been previously report- should be moved to one of the lower ed (Boev & Paspaleva-Antonova 1964). This categories such as Low Risk. Nevertheless, could contribute to overestimation of the the species depends on a combination breeding pairs. This is the main reason, in of habitat patches for its annual breed- our opinion, for the differences in the esti- ing cycle – proper nesting sites and a mates of the Bulgarian Black Stork popula- vicinity of wetlands suitable for foraging. tion. In some cases the publications refer As a predominantly fish eating bird, it to registered nests that still do not tell the needs clean, shallow wetlands, well pop- actual number of pairs (Nankinov 1997). ulated with fishponds, marshes, rivers, The publication of Petrov et al. (1991) of and streams that can provide the neces- 200 –220 pairs should be considered the sary resources for the breeding period. most accurate estimate for the Bulgarian Much of the breeding population nests in breeding population in the 1990s. The fig- various protected areas, especially in the ures given in Tucker & Heath (1994) and nature parks Strandja and Russenski Lom, BirdLife International/EBCC (2000) are a and some of the protected areas in the slight underestimate of the national popu- Eastern Rhodopes. There is currently no lation, although they correctly indicate the prescription for buffer zones around Black positive trend in the numbers. We consid- Stork nests and they are not automatically er that the national population currently formed when a nest is found. The authori- stands between 300 and 320 pairs. In our ties in charge of nature conservation issues population estimate, we consider only are the Ministry of Environment and Water cases of confirmed breeding. It is very pos- and its regional inspectorates and the sible that some of the pairs that we discard Ministry of Agriculture and Forestry with in our estimate may actually be breeding. its Forestry Department, which is in charge Thus this figure presents the realistic mini- of nature park management. The National mum Bulgarian breeding population. This Forestry Strategy, currently under develop- suggests an increase of some 50% for the ment, is a key to the future conservation of period 1990 – 2002. Considering the large forest nesting pairs. declines in many other countries in Europe, this is an outstanding figure. It is mostly Conclusions due to the increase in rock breeding birds Data from the Breeding Bird Atlas clearly where the population is densest. In most suggests a considerable increase in the of the 10x10 km squares, there are only breeding population of some 50%. The single breeding pairs. The highest number estimate is based on a critical review tak- of breeding pairs per 100 sq. km was found ing into account only confirmed breeding in the Eastern Rhodope Mountains (12 - 14 mainly in the last five to six years, so the pairs – in 4 squares along the Arda River figure should be considered as a mini- Valley). mum figure. Strictly applying the criteria, the species should be categorized as Low Conservation status Risk/Near Threatened Species. It is growing The Black Stork is a strictly protected spe- in numbers and many nests are located in cies in Bulgaria under conservation leg- various kinds of protected areas. However, islation and it has been listed in the Red very few of these areas have management Data Book since 1985. However, the recent plans currently being implemented. There increase in breeding population calls for is almost no data on the breeding biology 82 Biota 7/1-2, 2006 PETKOV, IANKOV & GEORGIEV parameters of the species, especially for different light on the state opinion of the forest nesting birds. secure character of the cliff/rock nesting Although there is no immediate risk for pairs. It is obvious that there are a number rock/cliff nesting pairs, there are a number of real and potential threats that can eas- of potential threats that can quickly affect ily sweep out a large part of the breeding the population. The most important are population. large-scale infrastructure projects such as Another significant potential threat may dam constructions – like the planned Arda have a devastating effect on the species river dam cascade, which will flood a num- during the migration period. This comes ber of nest sites and destroy important from an explosion of plans for Wind Power feeding sites. The recent increase in con- Turbines that are being built at an alarming struction of small and medium size hydro- rate, and all are to be built on the migration power stations affects natural river courses route Via Pontica along which the larger and destroys important foraging micro- part of the European Black Stork popula- habitats, and plans for more such stations tion migrates. This poses a real threat, con- in the future threaten even further destruc- sidering that conservation precautions and tion. Other threats include open mining considerations have so far not been taken in rocky habitats, disturbances caused by into account during the EIA process. The cliff climbing and paragliding, and unsus- lack of a national strategy and the permis- tainable forestry activities, whose effect is sions given on a case-by-case basis pose a largely unknown. This sheds an altogether real conservation problem for the future.

REFERENCES BIRDLIFE INTERNATIONAL/EBCC. 2000. European bird populations: estimates and trends. Cambridge, UK: BirdLife International, BirdLife Conservation Series No. 10, 160 pp. BOEV N. & M. PASPALEVA-ANTONOVA. 1964: Contribution to the study on the Black Stork (Ciconia nigra L.) in Bulgaria. – Bull. Inst. Zool. and Museum BAS, 16, 5-16. In Bulgarian, with German Summary. BSPB/ BirdLife Bulgaria, in press. Breeding Bird Atlas of Bulgaria. Bulgarian Society for the Protection of Birds/BirdLife Bulgaria, Sofia. MICHEV, T. 1985: Black Stork Ciconia nigra. In: Red Data Book of Bulgaria, V. 2, Animals, Sofia, BAS, p. 55. In Bulgarian. NANKINOV, D. 1997: National Bird Databank with BSPB/BirdLife Bulgaria. 2004. Bulgarian Society for the Protection of Birds/BirdLife Bulgaria, Sofia. PATEV, P. 1950: Birds of Bulgaria. Sofia, BAS. In Bulgarian, with English Summary. PETROV, T., P. IANKOV, T. MICHEV, B. MILCHEV, L. & PROFIROV. 1991: Distribution, numbers and conservation measures for the Black Stork, Ciconia nigra (L.) in Bulgaria. – Bull. Mus. South Bulgaria 17: 25-32. In Bulgarian, with English Summary. PETROV, T., P. JANKOV, T. MICHEV, B. MILCHEV, L.&PROFIRO, V. 1993: Distribution, numbers and measures for the protection of the Black Stork in Bulgaria. In: 1st International Black Stork Conservation and Ecology Symposium, 19-23 April 1993, Jurmala, Latvia, Abstracts: 67. SIMEONOV, S., MICHEV, T. & NANKINOV, D. 1990: Fauna of Bulgaria. V. 20. Aves. Part I, Sofia, BAS Publ. M. Drinov. In Bulgarian, with English Summary. TUCKER, G. M. & HEATH,. M. F. 1994: Birds in Europe: their conservation status. BirdLife International, BirdLife Conservation Series No. 3, Cambridge. SANTOS, SERRA, FERNANDES, PACHECO, FRANCO & ROSA Biota 7/1-2, 2006 83

Hematology and blood parasites of juvenile Black Storks Ciconia nigra in Portugal

Nuno SANTOS1, P. SERRA, Margarida FERNANDES1, Carlos PACHECO, Cláudia FRANCO2 & G.ROSA

1Instituto Conservação da Natureza, Rua Santa Marta, 55, 1150-294 Lisboa, Portugal E-mail: [email protected], 2Instituto da Conservação da Natureza, Rua de Santa Marta, 55 - 3º 1150-294 Lisboa, Portugal. E-mail: [email protected]; [email protected]

Abstract Blood analyses can be used to evaluate wildlife health and serve as indicators of nutritional or disease status, habitat quality, and other environmental stressors. We determined hema- tologic values in fledgling Black Storks Ciconia nigra in Portugal during the 2003 breeding season. Sixteen samples were obtained from chicks in nests. Blood samples (c. 1 ml) were obtained by venipuncture of physically restrained juveniles aged 28-42 days, placed in 2 ml containers with calcium EDTA, and kept refrigerated until processing. Hematologic parameters determined were hematocrit, hemoglobin, differential white cell count, white blood cell, red blood cell and thrombocyte counts. Hemoglobin concentration was deter- mined either by the alkaline hematin method or by means of an automatic analyser. Mean hematologic values determined were: hemoglobin 9.5 ± 1.3 g/dl (n = 12), white blood cell count 20.8 ± 10.1 x 106/ml (n = 16), red blood cell count 1.3 ± 0.4 x 109/ml (n=16), throm- bocyt count 0.17 ± 0.09 x 109/ml (n = 16), and hematocrit 29.3 ± 5 % (n = 9). These values are quite different from the published ones for some individuals of the Spanish popula- tion (Puerta et al, 1989). One of our individuals presented an elevated value of WBC (54.3 x 103/ml) which could indicate an infectious condition. The juvenile was closely observed and apparently fledged with no further problems. This study, although drawn from a small sample, is important as complementary information to field monitoring and also as there are still few reference values for this endangered species.

Key words: hematology, blood parasites, veterinary, juvenile, Portugal

Received 7 February 2007; accepted 27 August 2007 SANTOS, SERRA, FERNANDES, PACHECO, FRANCO 84 Biota 7/1-2, 2006 & ROSA

INTRODUCTION screening and ecological studies of wild The Black Stork Ciconia nigra is a long populations, especially in assessing body distance migrant which winters in south- condition, nutritional status and sub-clini- ern Africa, although small numbers remain cal effects of pollutants (Bowerman et al. the whole year in the Iberian Peninsula 2000, Shmueli et al. 2000, Quillfeldt et al. (Tucker & Heath 1994). Management of 2004, Villegas et al. 2004). endangered wildlife populations should To our knowledge, only two papers have be based on demographic, physiologic, been published dealing with reference val- genetic, habitat and health data, like hema- ues for hematologic analysis in Black Stork tological values and parasite prevalence (Puerta et al 1989, Lanzarot et al. 2005). (Cooper 1989, Pérez et al 2003, Uhart et al Puerta et al. (1989) studied only a small 2003). Hematological values provide some number of nestlings, while Lanzarot et al. insight into the health status of the animal (2005) sampled a small number of nests at the moment when it was sampled, and from a limited part of this species’s distri- can reflect habitat quality, nutrition, and bution, and didn’t count thrombocytes. other environmental stressors. Because As part of a long-term monitoring program of the easiness in obtaining them, they of the Portuguese breeding population of are generally some of the most important Black Stork, carried out by the Instituto de data available for wildlife health monitor- Conservação da Natureza, blood samples ing (Ferrer 1990, Gee et al 1981, Hellgren were obtained from 26 fledgling Black et al 1993, Howlett et al 2002, Hunter, Storks, from the same number of nests, 1989, Pérez et al, 2003, Lanzarot el al 2005). in the 2003 and 2004 breeding seasons. However, their usefulness depends on the Blood smears from 16 fledglings from the existence of reference values to compare 1998 breeding season were also included with (Gee et al 1981, Lanzarot el al 2001, in the analysis. Kasprzak et al 2006, Kurhalyuk et al 2006). The objectives of this study were to obtain Hemoprotozoa are traditionally consid- reference values for some hematological ered to be only slightly pathogenic to wild and biochemical parameters in fledgling birds (Bennett et al. 1988, Atkinson & van Black Storks, and to carry out a survey of Riper III 1991), but this can be because of hemoprotozoa in fledgling Black Storks the difficulty in finding the cause of death or sub-lethal effects in wild birds (Grenfell MATERIAL AND METHODS & Gulland 1995). Mortality appears to be Black Stork blood samples were obtained restricted to juveniles, debilitated individu- from the whole breeding range of this spe- als, and populations without previous con- cies in Portugal, including southern, cen- tact with the parasite (Fallis & Desser 1977, tral, and northern sub-populations. They Olsen & Gaunt 1985, Jenkins et al 1989, were collected in the 1998 (n = 21), 2003 (n Peirce 1989, Hunter et al 1997). Despite = 16), and 2004 (n = 11) breeding seasons. this, their importance in the dynamics of Blood samples (c. 1 ml) were obtained natural bird populations cannot be dis- by venipuncture of physically restrained, missed, as there is some evidence they can apparently healthy juveniles aged 28-42 depress breeding rates in males, fecun- days. They were collected from the medial dity in females, and diminish host fitness metatarsal vein using 2 ml syringes and 25 (Atkinson & van Riper III 1991, Stuht et gauge needles. From each brood only one al. 1999, Dunbar et al 2003, Merino et al juvenile was sampled. Because of the high 2000). number of nests monitored, the hour of Blood chemistry is an important tool in sample collection could not be standard- clinical diagnosis, but also in sanitary ized, and varied between 9:30 and 19:30. SANTOS, SERRA, FERNANDES, PACHECO, FRANCO & ROSA Biota 7/1-2, 2006 85

Part of each sample was placed in 2 ml chemistry analysis were performed in a calcium EDTA tubes and kept refrigerat- commercial laboratory. ed until processing, always within 12-40 hours. The rest of the sample was placed RESULTS AND DISCUSSION in plain tubes in order to obtain serum for The values obtained in this study (Table blood chemistry, after centrifugation at 1 to 3) are generally different from those 5.000g for 10 minutes. One or two smears reported by Puerta et al (1989) in this same were made from the remaining blood and species in Spain. Namely, we found higher immediately air-dried. Samples from the counts of thrombocytes, which could be 1998 breeding season were used only to explained by the indirect counting method obtain blood smears. utilized by Puerta et al (1989) in their study, The hematologic parameters determined together with the use of heparin as antico- were hematocrit, hemoglobin concentra- agulant, as noted by that author and also tion, differential white cell count, white by Montesinos et al (1997). blood cell, red blood cell and thrombocyte On the contrary, we found lower values for counts. From these we calculated red cell most of the parameters analysed, includ- indices, namely mean cell volume, mean ing hematocrit, hemoglobin concentra- cell hemoglobin and mean cell hemoglo- tion, and red and white blood cell counts. bin concentration. The blood chemistry Puerta et al (1989) studied seven Black parameters determined were glucose Stork chicks aged 59-68 days, considerably (GLU), urea (BUN), uric acid (URIC), creatine older than those sampled in this study. kinase (CK), aspartate aminotransferase Hematocrit, hemoglobin concentration, (AST), alanine aminotransferase (ALT), total and red blood cell count are known to proteins (TP), albumin (ALB), alfa 1, alfa 2, increase with age in fledglings of birds beta and gamma globulins (GLOB). in general, including this species and the For hematocrit, blood was placed in closely related White Stork Ciconia ciconia microhematocrit tubes and centrifuged at (Puerta et al 1989, Montesinos et al 1997, 3000 g for 10 minutes. White blood cell, Lanzarot et al. 2005), which could explain red blood cell, and thrombocyte counts these differences. were carried out manually in improved Although our mean white blood cell count Neubauer hemocytometers, following the was much lower than that reported by methodology of Doxey and Nathan (1989), Puerta et al. (1989), we found one indi- except that Natt and Herrick’s solution vidual with a value of 54.33x106/ml, similar and 1:100 dilution were used. Hemoglobin to those reported by that author. Values concentration was determined either by like that could suggest the animal is suffer- the alkaline hematin method (n = 12) or ing from an infectious disease. That brood by means of an automatic analyser (n = 9) was closely monitored and found to fledge as described in Doxey and Nathan (1989). without any further problem. Values obtained by each method were not Blood chemistry values from this study statistically different (U = 6, P > 0,05, Mann- are also different from those reported by Whitney U-test). Puerta et al (1989), including higher URIC Blood smears were fixed in methanol, and lower PT. BUN, AST and ALT are all with- stained with Giemsa solution, and used in one standard deviation from the mean to look for blood parasites and for differ- reported by those authors. Nevertheless, ential 100-white blood cell counts. Blood values reported in this study are based parasites were screened by scanning each on extremely small sample sizes, so they smear for 30 minutes, constantly chang- should be regarded cautiously. ing fields, at 1000x magnification. Blood The hematologic values we report in SANTOS, SERRA, FERNANDES, PACHECO, FRANCO 86 Biota 7/1-2, 2006 & ROSA ALB/ GLOB GLOB MCHC (g/dl) beta GLOB gamma (%) Basophils alfa 2 GLOB MCH (pg) GLOB (%) MCV (fl) Eosinophils Hemoglobin (g/dl) (%) Monocytes /ml) 9 Thrombocytes (10 in concentration, and red cell indices. cell and red in concentration, (%) /ml) 9 Lymphocytes RBC (10 /ml) 6 WBC (10 (%) Heterophils GLU BUN URIC CK ALT AST PT ALB alfa 1 Hematocrit Hematocrit (%) Hematocrit, blood cell counts, hemoglob counts, blood cell Hematocrit, count. blood cell white Differential cautiously. Blood chemistry these values should be regarded values of Black Stork. Because of small sample sizes, MeanSDRange 31.2n1726262621171916 17.0-40.4 5.0 8.0-54.33 17.03 0.73-2.24 9.41 0.01-0.465 1.43 0.41 6.0-14.94 0.129 164.3-411.0 0.09 45.4-132.9 9.94 20.9-39.9 1.84 246.7 80.9 77.6 27.0 31.6 3.7 MeanSDRangen 254.7 245-270 3333213333333 13.4 7-11 9.3 11.9-19.9 798-2321 2.1 15.3 10-15 1399 4.1 12.5 810.7 2.8-3.1 160 3.5 1.4-1.5 0.1-0.2 2.9 0.5-0.8 0.1-0.2 1.5 0.4-0.6 0.2 0.94-1.15 0.1 0.1 0.6 0.1 0.1 0.2 0.5 0.1 1.05 0.1 0.11 MeanSDRangen4242424242 45.4 15-80 15.9 44.4 7-79 20.2 3.5 0-17 3.3 0-16 5.6 4.5 0-9 1.0 2.5 Table 1. Table 2. Table 3. Table SANTOS, SERRA, FERNANDES, PACHECO, FRANCO & ROSA Biota 7/1-2, 2006 87 this paper generally agree with those of are URIC, CK, ALB and alfa GLOB, for which Lanzarot et al. (2005), being all within one we found higher values, and beta GLOB, standard deviation from the mean report- with lower ones. ed by those authors, except the differential All 40 blood smears from the same number white blood cell count of monocytes and of chicks when screened for hemoprotozoa basophils, for which we found higher val- were negative. A larger sample, including ues. Although our sample is still very small, older chicks and breeding adults, would not allowing us to draw conclusions, most be necessary to test the hypothesis that blood chemistry values are also within this species, in the Iberian Peninsula, is free one standard deviation from the mean from these parasites. reported by the same authors. Exceptions

REFERENCES ATKINSON, C. T. & VAN RIPER III, C. 1991: Pathogenicity and epizootiology of avian haematozoa: Plasmodium, Leucocytozoon and Haemoproteus. In: Loye, J. E. & Zukm, M., eds. Bird- parasite interactions. Oxford University Press, Oxford. BENNETT, G. F., CAINES, J. R. & BISHOP, M. A. 1988: Influence of blood parasites on body mass of passeriform birds. Journal of Wildlife Diseases, 24: 339-343. BOWERMAN, W., STICKLE, J., SIKARSKIE, J. & GIESY, J. 2000: Hematology and serum chemistries of nestling bald eagles Haliaeetus leucocephalus in the lower peninsula of MI, USA. Chemosphere 41: 1575-1579. COOPER, J. E. 1989: Disease and threatened birds. International Council for Bird Preservation Technical Publication no. 10, Cambridge. DOXEY, D. L. & NATHAN, M. B. 1993: Manual of laboratory techniques, new edition. BSAVA, Gloucestershire. DUNBAR, M. R., TORNQUIST, S. & GIORDANO, M. R. 2003: Blood parasites in sage-grouse from Nevada and Oregon. Journal of Wildlife Diseases 39:203-208. FALLIS, A. M., DESSER, S. S. 1977: On species of Leucocytozoon, Haemoproteus and Hepatocystis. In: Kreier, J.P. ed. Parasitic Protozoa, vol. III, Academic Press, New York. FERRER, M. 1990: Hematological studies in birds. The Condor 92:1085-1086. GEE, G. F., CARPENTER, J. W. & HENSLER, G. L. 1981: Species differences in haematological values of captive cranes, geese, raptors and quail. Journal of Wildlife Management 45: 463- 483. GRENFELL, B. & GULLAND, F. 1995: Ecological impact of parasitism on wildlife host populations. Parasitology 111 (supplement): 3-14. HELLGREN, E. C., ROGERS, L. L. & SEAL, U. S. 1993: Serum chemistry and haematology of black bears: physiological indices of habitat quality or seasonal patterns? Journal of Mammalogy 74: 304-315. HOWLETT, J. C., BAILEY, T. A., SAMOUR, J. H., NALDO, J. L. & D`ALOIA, M.-A. 2002: Age-related hematologic changes in captive-reared houbara, white-bellied and rufous-crested bustards. Journal of Wildlife Diseases 38: 804-816. HUNTER, D. B. 1989: Detection of pathogens: monitoring and screening programs. In: J. E. Cooper ed. Disease and threatened birds. International Council for Bird Preservation Technical Publication no. 10, Cambridge. HUNTER, D. B., ROHNER, C. & CURRIE, D. C. 1997: Mortality in fledgling Great Horned Owls from Black Fly hematophaga and leucocytozoonosis. Journal of Wildlife Diseases 33: 486- 491. SANTOS, SERRA, FERNANDES, PACHECO, FRANCO 88 Biota 7/1-2, 2006 & ROSA

JENKINS, C. D., TEMPLE, S. A., VAN RIPER, C. & HANSEN, W. R. 1989: Disease-related aspects of conserving the endangered Hawaiian Crow. In: Cooper, J.P. ed. Disease and threat- ened birds. ICBP Technical Publication no. 10, Cambridge. KASPRZAK, M., PONIŃSKA, A., JERZAK, L. & KULCZYKOWSKA, E. 2006: Day-night variations in hematological parameters in wild juvenile White Storks Ciconia Ciconia. In: Tryjanowski, P., Sparks, T.H. & Jerzak, L. eds. The White Stork in Poland: studies in biol- ogy, ecology and conservation. Bogucki Wydawnictwo Naukowe, Poznań. KURHALYUK, N., KAMINSKI, P., KASPRZAK, M. & JERZAK, L. 2006: Antioxidant enzymes activity and lipid peroxidation processes in the blood of White Stork Ciconia ciconia chicks from Western Poland. In: Tryjanowski, P., Sparks, T.H. & Jerzak, L. eds. The White Stork in Poland: studies in biology, ecology and conservation. Bogucki Wydawnictwo Naukowe, Poznań. LANZAROT, M. P., BARAHONA, M. V., ANDRÉS, M. I. S., FERNANDEZ-GARCIA, M. & RODRÍGUEZ, C. 2005: Hematologic, protein electrophoresis, biochemistry and cholinesterase values of free-living black stork nestlings (Ciconia nigra). Journal of Wildlife Diseases 41: 379-386. MERINO, S., MORENO, J., SANZ, J. J., ARRIERO, E. 2000: Are avian blood parasites pathogenic in the wild? A medication experiment in blue tits (Parus caeruleus). Abstracts, 4th Meeting of the European Wildlife Diseases Association, Zaragoza. MONTESINOS, A., SAINZ, A., PABLOS, M. V., MAZZUCCHELLI, F. & TESOURO, M. A. 1997: Hematological and plasma biochemical reference intervals in young white storks. Journal of Wildlife Diseases 33: 405-412. OLSEN, G. H. & GAUNT, S. D. 1985: Effect of hemoprotozoal infections on rehabilitation of wild raptors. J. Am. Vet. Med. Ass., 187: 1204-1205. PEIRCE, M. A. 1989: The significance of avian haematozoa in conservation strategies. In: Cooper, J.E. ed. Disease and threatened birds. ICBP Technical Publication no. 10, Cambridge. PÉREZ, J. M., GONZÁLEZ, F. G., GRANADOS, J. E., PÉREZ, M. C., FANDOS, P., SORIGUER, R. C. & SERRANO, E. 2003: Hematological and biochemical reference intervals for Spanish ibex. Journal of Wildlife Diseases 39: 209-215. PUERTA, M. L., PULIDO, R. M., HUECAS, V.& ABELENDA, M. 1989: Hematology and blood chem- istry of chicks of white and black storks (Ciconia ciconia and Ciconia nigra). Comp. Biochem. and Physiol. A, 94: 201-204. QUILLFELDT, P., MASELLO, J. & MOSTL, E. 2004: Blood chemistry in relation to nutrition and ecto- parasite load in Wilson’s storm-petrels Oceanites oceanicus. Polar Biol. 27: 168-176. SHMUELI, M., IZHAKI, I., ZINDER, O. & ARAD, Z.2000: The physiological state of captive and migrating great white pelicans (Pelecanus onocrotalus) revealed by their blood chemistry. Comp. Biochem. Physiol. A 125: 25-32. STUHT, J. N., BOWERMAN, W. W. & BEST, D. A. 1999: Leucocytozoonosis in nestling bald eagles in Michigan and Minnesota. Journal of Wildlife Diseases, 35: 608-612. TUCKER, G. M. & HEATH, M. F. 1994: Birds in Europe: their conservation status. BirdLife Conservation Series 3. BirdLife International, Cambridge. UHART, M. M., QUINTANA, F., KARESH, W. B. & BRASELTON, W. E. 2003: Hematology, plasma bio- chemistry and serosurvey for selected infectious agents in southern giant petrels from Patagonia, Argentina. Journal of Wildlife Diseases 39: 359-365. VILLEGAS, A., SANCHEZ, J., COSTILLO, E. & CORBACHO, C. 2004: Blood chemistry and haematocrit of the black vulture (Aegypius monachus). Comp. Biochem. Physiol. A132: 489-497. SIMÕES, BORGES, CABALLERO, FRANCO, MATOS & FERNANDES Biota 7/1-2, 2006 89

D-loop deletion in the mitochondrial DNA of the Black Stork Ciconia nigra

Fernanda SIMÕES1, Carla BORGES1, José Manuel CABALLERO2, Cláudia FRANCO3, José MATOS1 & Margarida FERNANDES3

1INETI-Dept Biotechnology, Estrada do Paço do Lumiar, 22, Lisboa, Portugal 2Junta de Extremadura, Avenida de Portugal s/n, Mérida, Spain 3Instituto da Conservação da Natureza, Rua de Santa Marta, 55, 1169-294 Lisboa, Portugal, E-mail: [email protected]

Abstract The black stork Ciconia nigra is a migrant species which is poorly known and has a his- tory of strong decline in the last century, with local extinctions and recolonizations in Central Europe. Few genetic studies have been reported for this species, and only a few conservative regions of DNA sequences are known. Using black stork samples from several European locations, we have been able to characterise a short variable region of Ciconia nigra mitochondrial D-loop. A 22 bp deletion was found, in comparison to available mito- chondrial sequences from other stork species - Ciconia ciconia and Ciconia boyciana. This molecular data provides additional information on the unresolved phylogenetic relation- ships among storks of the genus Ciconia. This work is the first report on D-loop sequences from the black stork.

Key words: Black Stork, Ciconia nigra, mitochondrial DNA

Received 15 February 2007; accepted 4 April 2007 SIMÕES, BORGES, CABALLERO, FRANCO, MATOS & 90 Biota 7/1-2, 2006 FERNANDES

INTRODUCTION AGATACCATGGCCAGCTACC). Primers were The black stork Ciconia nigra nests through- designated according to the nucleotide out Eurasia from Iberia to eastern Siberia position number in the C. boyciana D-loop and China, and also in southern Africa (Del sequence. Hoyo et al 1992, Wetlands International PCR amplification was carried out in a 2002). The isolation of the Iberian black 25 µL reaction volume containing 1 mM stork population may stem from an accen- dNTPs, 20 pmoles of each primer, 2.5 mM tuated decline in numbers in Western and MgCl2, 0.3 µg of BSA, and 1 U of Taq poly- Central Europe during the 19th century, merase (Fermentas). The cycling param- which seem to have led to local extinctions, eters were 3 min at 94ºC, followed by 36 and greater discontinuity in the European cycles of 95ºC for 1 min, 52ºC for 1 min and population (Del Hoyo et al 1992). 72ºC for 1 min and a final extension step Cytochrome b and ribosomal regions of at 72ºC for 3 min. Amplification products black stork mitochondrial (mt) DNA have were separated by electrophoresis on a been previously studied (Slikas 1997, 1-2% agarose gel. As PCR products were Hedges & Sibley 1994, Van Tuinen et al absent when using primers 201F/532R, 2000, 2001) but did not show strong dif- we used primers 102F/532R which ampli- ferentiation among members of the genus fied a multiplicity of fragments. Individual Ciconia. bands were picked from the gel and spe- Aiming to highlight the intraspecific rela- cifically PCR reamplified and cloned using tionship between European black stork a TA cloning vector (InsT/A cloning kit, individuals, and based on previously avail- Fermentas). Transformation of Escherichia able mitochondrial DNA sequences from coli DH5α was followed by recombinant Ciconidae, this work focuses on the charac- plasmid purification. Recombinant plas- terisation of intraspecific polymorphisms mids were then sequenced using a 310 in the variable d-loop region from black ABI Prism Genetic Analyser. The similarity stork. No sequences from the mitochon- between obtained sequencing data and drial control region were known for the Ciconidae mitochondrial sequences was stork species Ciconia nigra. confirmed using the nucleotide BLAST pro- gram (www.ncbi.nih.gov). Sequences from METHODS 13 black stork individuals and C. ciconia Blood or feathers were obtained from and C. boyciana were aligned with use of 30 black stork individuals from different the Multialign program (Corpet 1988). geographic European areas such as Iberia (Portugal and Spain), Latvia, Poland, and RESULTS AND DISCUSSION Belgium. DNA was extracted either from By homology with the other Ciconia blood using the Puregene blood kit (Gentra) sequences, a PCR product of 425 bp was or from feathers using the Nucleospin tis- expected, but primers 102F/532R ampli- sue DNA extraction kit (Macherey-Nagel) fied several fragments ranging from 380 with minor modifications. to 450 bp. This multi-band phenomenon We designed three primers by align- has been observed in many vertebrate ment with homologous sequenc- species, particularly birds, and is thought es from white stork - Ciconia ciconia to result from the presence of nuclear cop- (AB026818) and oriental stork - Ciconia ies of mtDNA. (Sorenson & Fleischer 1996). boyciana (AB026193): two forward prim- Sequencing of sub-cloned PCR products ers (102F-GCATTAACTTGCTTGTCC and revealed one 405 bp amplified product 201F- ATGATGCGTGGATAAATACTG) corresponding to the C. nigra D-loop mito- and one reverse primer (532F- chondrial target. Another fragment around SIMÕES, BORGES, CABALLERO, FRANCO, MATOS & FERNANDES Biota 7/1-2, 2006 91

Figure 1. DNA sequence comparison between a partial D-loop region from Ciconia ciconia (Ciconia) and Ciconia boyciana (Boyciana) and the determined sequences from Ciconia nigra (Nigra). Dots represent identical bases. Dashes represent deletions. In Nigra sequence base substitutions are represented by Y=C/T , W=A/T; R=A/G, S =C/G, K=G/T. Arrows represent primer positions, numbers above the arrows correspond to the base numbers from which primers were designed based on the Ciconia boyciana sequence (AB026193).

425 bp was found to be a forward-for- The 5 identified haplotypes were derived ward primer flanked product. From all 13 from 13 individuals from different loca- sequenced individuals, 5 haplotypes were tions from the European black stork popu- found (submitted to GenBank, Acession lation: 3 individuals from Portugal, 3 from Numbers: AY685122-AY685126). Sequence Spain, 4 from Poland, 2 from Belgium and comparison is shown in Figure 1. There is one individual from Latvia. Despite the low high nucleotide identity with the C. ciconia sample size, the relatively high number of and C. boyciana mitochondrial sequences polymorphic sites supports the concept of (mainly from the 5’ forward direction) fol- a variable nature of the studied fragment, lowed by a major 22 bp deletion. This dele- as previously hypothesised for the homol- tion explains why the pair of primers 201F/ ogous sequences (Yamamoto et al 2000). 532R did not amplify black stork samples, Multiple sequence alignment revealed since the 201F primer was designed in the eight deletions for black stork sequences: corresponding region of the C. ciconia and six 1 bp point deletions, one 22 bp dele- C. boyciana sequences. tion and one 2 bp deletion, as well as a 3 SIMÕES, BORGES, CABALLERO, FRANCO, MATOS & 92 Biota 7/1-2, 2006 FERNANDES bp insertion (Figure 1). These variations amplification and direct sequencing of PCR show a clear differentiation between the products for multiple individual analysis of black stork and the two other Ciconias. black stork D-loop sequences. The variable Accordingly, Slikas (1997) placed the black mitochondrial region from Ciconia nigra stork apart from the white stork and orien- revealed in this study can nevertheless be tal stork. In that study the black stork was a valuable molecular marker for answering positioned closer to other African mem- questions such as the unresolved phylo- bers of genus Ciconia on a consensus phy- genetic relationships among members of logenetic tree based on cyt-b sequences. Ciconidae family. The present work also shows that Ciconia ciconia and Ciconia boyciana are more simi- lar to each other than Black Stork, their Acknowledgments European congener. This study was financially supported by Based on the sequence presented here, Junta de Extremadura (Spain). European it is now possible to design primers for samples were provided by Riga Zoo (Latvia), specific amplification of this short vari- Miejski Ogrod Zoo (Poland) and Roland able region of mitochondrial D-loop from Libois and Johan Michaux (Belgium). We C. nigra, bypassing the bias caused by also thank Carlos Pacheco and all the peo- the homologous primers used. This will ple who collected Iberian samples in the enable faster mitochondrial specific PCR field.

REFERENCES CORPET, F. 1988: Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16: 10881-10890. DEL HOYO, J., ELLIOTT, A. & SARGATAL, J eds. 1992: Handbook of the Birds of the World. Vol.1. Lynx Edicions, Barcelona. HEDGES, S.B. & SIBLEY, C.G. 1994 Molecules vs morphology in avian evolution: ‘pelecaniform’ birds. Proc. Natl. Acad. Sci. USA 91: 9861-9865. SLIKAS, B. 1997: Phylogeny of the avian family Ciconiidae (storks) based on cytochrome b sequences and DNA-DNA hybridization distances Journ. Mol. Phylogenet. Evol. 8: 275-300. SORENSON, M.D. & FLEISCHER, R.C. 1996: Multiple independent transpositions of mitochondrial DNA control region sequences to the nucleus. Proc. Nat. Acad. Sci USA 93: 15239- 15243. VAN TUINEN, M., SIBLEY, C.G. & HEDGES, S.B. 2000: The early history of modern birds inferred from nuclear and mitochondrial ribosomal genes. Mol. Biol. Evol 17: 451-457. VAN TUINEN, M., BUTWILL, D.B., KIRSCH, J.A. & HEDGES, S.B. 2001: Convergence and divergence in the evolution of aquatic birds. Proc. R. Soc. Lond., B, Biol. Sci. 268: 1345-1350. WETLANDS INTERNATIONAL 2002: Waterbird Population Estimates. Third Edition. Wetlands International Global Series No. 12, Wageningen, The Netherlands. YAMAMOTO, Y, MURATA, K.M., MATSUDA, H., HOSODA, T., TAMURA, K. & FURUYAMA, J. 2000: Determination of the complete nucleotide sequence and haplotypes in the D-loop region of the mitochondrial genome in the Oriental white stork, Ciconia boyciana. Genes Genet. Syst.75: 25-32. STRAZDS, ĶUZE, REINE Biota 7/1-2, 2006 93

Evaluation of Black Stork Ciconia nigra nest inspections in Latvia in 2003–2005

M. STRAZDS1, J. ĶUZE2, S. REINE3

1Latvian Ornithological society, P.o. Box 1010, Riga, LV–1047, Latvia, E-mail: [email protected] 2Ķemeri National Park, “Meža māja”, Jūrmala, LV-2012, Latvia, E-mail: [email protected] 3Dienvidkurzemes mežsaimniecība, “Bojas”, Kazdangas pag., Liepājas raj. LV–3457, Latvia, E-mail: [email protected]

Abstract Data about Black Stork Ciconia nigra distribution and numbers in various older and more recent publications are often based on “external data” (questionnaires etc.), but the cred- ibility of the data used is only rarely discussed. In 2003 a field inventory was started in the southwestern part of Latvia to test such data. After special training sessions, local forestry managers inspected nests located within the territory they were supervising. The project was continued in 2004 in the same area. In 2005, the project was extended to two more Forestry regions. Accuracy of estimates for occupied Black Stork nests varied between regions and years from 9 to 61%. Major errors were caused by the following factors: inspection of the wrong nests, incorrect identification of species, wrong evaluation of nest status (inhabited vs. not inhabited) or wrong data about breeding success (number of juveniles fledged). The causes of errors and possibilities of use for such data are discussed.

Key Words: Black Stork, monitoring, questionnaires, data quality

Received 30 January 2007; accepted 10 May 2007 94 Biota 7/1-2, 2006 STRAZDS, ĶUZE, REINE

INTRODUCTION trained participants and consequently Well organized monitoring of endangered raise the risk of mistakes at the level of species like Black Stork Ciconia nigra is of individual interpretation. the highest importance, as it collects up- To test the utility of such scheme, in 2003 to-date information that helps to promote an experimental monitoring project was special conservation measures for species started in the southwestern part of Latvia. of concern. Information for Black Stork The territory included one forestry region monitoring purposes is usually gathered and the people involved were local for- in the sample plots that are selected in a est district managers. The data submitted particular density to represent the overall were audited during the breeding season situation of the monitored population. In (mainly July). The purpose of the audit was practice, this means a few large or many to test the accuracy of information pro- small plots, but the most important pre- vided by well trained forestry professionals condition is to obtain representative data and to establish whether or not such data that allows statistically correct interpreta- could be used for monitoring the breeding tion of the collected data. success of Black Stork. Breeding success of each pair depends on food availability or capacity of the territory MATERIAL AND METHODS in each season, the number of eggs laid In the first year of work a field inven- and hatching success as well as predation tory was carried out in Dienvidkurzeme rate — the major factor that affects the Forestry region of State Share Company survival of chicks. The desired monitoring Latvijas valsts meži. This region is located scheme therefore would include inspect- within the southwestern part of Latvia and ing the number of eggs laid (in Latvia nests comprises 137 known nests of Black Stork. should be visited during a one month In spring, before the breeding season of period from middle April on), inspecting storks began (on the 15th of April), a spe- hatched eggs (during the first half of June) cial training seminar was organized for dis- and inspecting numbers of nearly fledged trict managers. All of the potential partici- juveniles (the second half of July). pants were shown how to distinguish nests Until 2003, monitoring of Black Stork in of Black Stork from those of raptors, along Latvia was implemented on only a lim- with a short field training session (visiting ited scale. A number of nests were visited three different nests and nest sites). They only once a year at the end of the breed- received a description of each nest, includ- ing season. That resulted in a rather large ing its precise location. After inspecting all amount of information that was not useful nests on the list, each district manager had for monitoring needs — mostly dealing to report back about their current condi- with so called “early” or “late” nests. In the tion (collapsed, existing, still in use) before first case, juveniles can already be out of the middle of the breeding season. the nest; the problem with late nests is that The last information about results of field they can still be destroyed and breeding inventories was received on the 18th of results therefore can be interpreted only June. Auditing of results was started on as “unknown”. the 21st of June and continued until the A potential solution to this problem would 24th of July. By this time, 51 nests had be a large scale monitoring scheme that been visited and most of the nests (20 covers most of the known total (national) from 25) that were declared to be inhab- population by visiting every nest several ited were inspected. Nīcas forestry district times per season. This would necessarily was the only one where auditing was not mean involving large numbers of well carried out, mostly because of lack of time STRAZDS, ĶUZE, REINE Biota 7/1-2, 2006 95

Table 1. Audit of Black Stork nest inventories in Latvia, 2003–2005.

Year inspection Audit inspection nd rd –2 Nests checked Nests checked Nests checked 3 Training seminar Training st (Black stork nests) (Black stork 1 2003, DK 15.04. 3.5-2.6. 123 21.06.–24.07. 51 (48) 21.06.–21.08. 41 2004, DK 20.05. 20.04.–20.06. 63 2.07.–28.07. 34 (31) 9.07.–9.08. 23 2005, DK None 4.04.–29.06. 78 24.05.–17.07. 25 (24) 2.07.–20.08. 20 2005, RV 5.05. 5.05.–9.06. 62 5.05.–30.07. 25 (20) 20.08.–12.09. 5 2005, DL 3.05. 20.04.–29.06. 51 3.05.–19.07. 26 (20) 1.07.–29.08. 25 and the fact that the local district man- previously been received, that is, the most ager declared all three visited nests to be recent available information about nest inhabited. When the process of auditing conditions was different from the results was completed, another seminar was orga- of first inventories contributed by district nized on the 23rd of September to analyze managers. As a result, we cannot eliminate the main reasons for misinterpretation by the possibility that in the majority of unau- the inspectors. dited cases, the given information would In 2004 this project was continued in be correct and, consequently, the percent- Dienvidkurzeme Forestry Region (DK) only age of correct evaluations higher. (Table 1). In 2005 it was extended to two Some of the recognized mistakes can be more Forestry Regions — Rietumvidzeme classified as “objective”, such as the evalu- (RV) and Dienvidlatgale (DL), situated in ated numbers of juveniles in some nests the north and southeastern parts of the that are located high up in a tree and are country respectively. Extension of the difficult to inspect — it was expected that project involved participation of new, less this would be the most common mistake. trained people and allowed comparison Correct information in such situations can of monitoring results submitted by district be gained only by reaching the nest, which managers with three years experience and means extra time spent at every nest and those without it. the need for special training and equip- ment. Because of these, as well as safety, RESULTS reasons, tree climbing was not encour- First, it should be noted that, in most aged. cases, the number of visited objects per During the following seasons, problems forestry district is too small, and therefore discovered during the first year of work objective evaluations of district manager were considered and district managers skills was problematic or, in some cases, were trained accordingly. Although the even impossible. In most districts, only inventory carried out in DK in the second several nests were audited and if some of year showed an increase in data quality them appeared to be evaluated incorrect- (Table 3), there was rather steep reduction ly, relative error was rather high (Table 2). in data quality during the third season, rea- Because of previous knowledge of the site, sons for which are discussed later. auditing was at first hand targeted towards Since the data set for each Forestry Region nests where contradictory information had taken separately is too small, the evalua- 96 Biota 7/1-2, 2006 STRAZDS, ĶUZE, REINE

Table 2. Results of the Audit of Black Stork nest inventories in southwestern Latvia, 2003. 1

Forestry Mistakes recognized: district Number of objects (together with DM) (together Number of audited objectsNumber of audited (number of compared nests) (number of compared (number of nests not found) (number of nests not found) Evaluation of DM conclusions % of DM conclusions Evaluation Number of objectsDM by visited Proper nest not found (1); other nest — of 1. Alsungas 7 7 (4) 3 (2) 34% (3) Common Buzzard declared as nest of Black stork (1) 2. Rendas 14 14 (5) 4 100% (4) 3. Akmensraga 8 8 (2) 3 (1) 100% (3) Number of juveniles not identified properly 4. Apriķu 15 15 (3) 3 67% (3) (1) Still existing nest not found (1), nesting suc- 5. Raņķu 8 8 (4) 3 34% (3) cess evaluated not correct (1) Conditions of nest not evaluated properly 6. Ventas 11 11 (6) 2 50% (2) (or wrong nest visited; 1) Proper nest not inspected, or claimed 9 (“6”; 50–100% 7. Dūrupes 9 4 (3) as not found (2), after repeated control 4) (4) together with auditor evaluation correct Number of juveniles evaluated improperly 8. Remtes 3 3 2 (2) 50%+ (2) (1; conceded in the report) In one case DM in spring did not evaluate properly if nest is inhabited or not; have 9. Grobiņas 9 9 (4) 3 100% (3) not recorded notes at the site; results of the second control correct Proper nest not found (or wrong nest speci- 10. fied without comments; 2); not evaluated 17 14 (3) 7 43% (7) Krīvukalna properly if nest is inhabited or not (1), adults considered to be juveniles (1) Garbled information on two nests (1), not evaluated properly if nest is inhabited or 11. Pampāļu 13 12 (8) 3 0% (3) not (1), species not recognized properly (at the same time proper nest not found) Proper nest not found (indicated presence of collapsed nests; 2), not evaluated prop- erly if nest is inhabited or not (2); in both 12. Zvārdes 16 7 (1) 14 (1)2 0–40% (5) cases results of the second control (after consultations with auditor) correct, number of juveniles not evaluated properly (1) 13. Nīcas 6 6 (3) 0 123 Total: 136 51 (8) 49% (41) (47) STRAZDS, ĶUZE, REINE Biota 7/1-2, 2006 97

1 Number of nests, not found by district managers, indicated in brackets. That can point either to vanished nests or the fact that district manager has not searched in the proper place. In fur- ther analysis only found nests have been taken into account. 2 In the Zvārde district almost all known nests have been visited, including those not inspected by district managers as well as 5 of 6 nests inspected by district managers.

tion of main errors (Table 4) both between the inspector to identify the inhabitant’s years and between Forestry Regions is species and breeding status (fresh mosses tentative and may serve as an indication of are indicators of Black Stork’s presence, tendencies only. fresh “decoration” branches are a sign of diurnal raptors, etc.). The problem of DISCUSSION proper evaluation of nest status emerged Misinterpretation of observation results despite the initial training seminar and can result from different obstacles. Wrong most probably is a matter of experience. evaluation of nest status is the most com- Inspection from the ground may, however, plex and common problem recognized cause wrong results of the audit as well during auditing of results. Recognizing — in one case a nest without obvious nest inhabitants was a problem in cases inhabitants was estimated by us to be when new (previously unknown) nests an unoccupied (freshly built?) nest of the were found. For example, for several rea- Black Stork. In the following year when it sons storks may have moved from an old was occupied it turned to be the nest of a nest site, and inspectors have found anoth- Common Buzzard. er nest in the vicinity. Such nests often are A common mistake that resulted in the declared to be those of Black Stork without wrong evaluation of number of juveniles proper checking, especially if adult birds was visiting the nest in the wrong season. have been observed in the vicinity of the During early visits in June, precise evalua- nest. tion of the number of juveniles is impos- At first glance the precision level of data sible because they are too small and invis- provided by district managers may seem ible from the ground. Even if the nest was to be not too bad, but one should realize reached by climbing, information gathered that first year visits always included a large at this time cannot be used for monitoring proportion of nests which had not been needs – juvenile Black Storks still have to visited for a long time and so were either spend roughly one month in the nest and collapsed or abandoned. Correct evalu- therefore breeding results can be inter- ation in this case was “nest is collapsed” preted only as “unknown”. Late visits (in — a statement which is really difficult to August) from the monitoring point of view evaluate as wrong if the nest tree is known are as pointless as early ones since by that precisely. When it comes to evaluation time many juvenile birds have already left of nesting success in occupied nests, the the nests. results were much poorer, even for the In several cases, the date of visits was even Dienvidkurzeme Forestry Region during not recorded (or not indicated on return the third year of work (Table 4). forms), which excludes the possibility of In difficult cases, nests should always be deselecting such mistakes later while ana- checked by approaching closely (climbing) lyzing the results. During the first year of or inspected from neighboring trees. In work, even in the second visit, when all of most cases, the content of the nest allows the district managers had been specially 98 Biota 7/1-2, 2006 STRAZDS, ĶUZE, REINE

Table 3. Results of the Audit of Black Stork nest inventories in Latvia, 2003–2005. Year Correct Correct Other species Nests checked Incorrect species (Black stork nests) (Black stork Wrong inhabitance Wrong Not checked by DM Not checked by (% of nests checked) Nests checked by DM Nests checked by Wrong nesting success Wrong Considered Black Stork Black Stork Considered 2003, DK 51 (48) 0 14 37 3 4 5 25 (68%) 2004, DK 33 (30) 2 7 24 1 3 4 16 (67%) 2005, DK 25 (24) 0 4 21 1 1 9 10 (48%) 2005, RV 25 (20) 4 3 18 1 0 4 13 (72%) 2005, DL 26 (20) 3 0 23 3 2 10 8 (35%) 2005 Total 76 (64) 7 7 62 5 3 23 31 (50%) reminded to fill in field notes, for 20 out such inventories and underlined the need of 25 occupied nests that were visited, the for better training in the object they are district managers didn’t record the date. monitoring. During discussions in the sec- Even worse, in two cases the checking was ond seminar, it appeared that some of done too early, while 14 nests were visited the district managers did not know how too late. This resulted in almost 80% of to distinguish between adult birds and nests being visited in an improper sea- fledglings. Such situations may result in son. This problem was particularly bad in interpreting an occupied but unproductive 2005, when all the forest district managers nest with one or two adults as a productive involved were busy with elimination of the nest with juveniles. In several cases, district aftereffects of a hurricane that hit Latvia managers with limited or no field experi- during the 8th–9th of January. ence reported juvenile birds seen in a nest Lack of correctly completed field notes that was actually occupied but not produc- was the main reason for another group of tive. In the first case, the reporter was inter- mistakes. In some cases, observations were viewed and finally it appeared that “two not recorded correctly, and as a result, juveniles” were actually adult birds that the wrong conclusions were made. For had been seen on the nest. Some district example, it appeared later that observa- managers paid no attention to the color of tion of “bird that was flying in the direction the birds’ legs and bills, which should have of nest” was interpreted as an “occupied been noted at the first step. In other cases nest” even though the nest was not visited. in 2005, some of the juveniles were consid- If additional information is not available ered to be adults “feeding juveniles”. (such as a description of exact observa- Another set of mistakes emerged because tion), such mistakes are difficult to check. the nests were not inspected by district The only possible solution in such situ- managers who had participated in train- ations is a proper visit to the nest and ing, but by assistants or, in some cases, recording of all signs of inhabitance in even local foresters who were not espe- either field notes or on a special form. cially educated to participate in the proj- In a few cases, district managers showed ect. This does not mean that information a lack of knowledge that is essential to from other observers cannot be used for STRAZDS, ĶUZE, REINE Biota 7/1-2, 2006 99

Table 4. Causes of errors made by district managers while inventorying Black Stork nests in Latvia, 2003–2005.

Causes of errors (n) 1 Year Stork Black Stork nests Black Stork Evaluation correct Evaluation (% of DM thoughts) vice versa vice Of DM which checked by Too late control late Too data mismatch Evaluation made from the ground made from Evaluation Adults considered to be juveniles or be juveniles to considered Adults Other species considered to be Black Other to species considered Inhabited nests of Black Stork (as thought by DM) (as thought by Inhabited nests of Black Stork Wrong/missing data in return forms or forms data in return Wrong/missing 2003, DK 48 34 14 (19) 8 (42%) 2 3 3 2 1 2004, DK 30 23 18 (15+3)2 11 (61%) 1 1 2 3 1 2005, DK 24 20 13 (13) 3 (23%) 0 1 4 5 0 2005, RV 20 17 5 (5) 1 (20%) 0 0 0 4 0 2005, DL 20 20 13 (14)3 1 (9%) 3 2 2 5 3 2005 Total 64 57 31 (32) 5 (16%) 3 3 6 14 3

1 could be results of visits which in fact have never taken place; wrong data in forms can be also result of errors while putting data from original forms into computer (done by a third person). 2 one nest of Common Buzzard considered to be Black Stork, two abandoned nests considered inhabited at the same time one inhabited nest considered abandoned and two successful nests not checked by district managers resulting in equal total based on four wrong and two missing figures. 3 two occupied nests considered abandoned. monitoring or data gathering purposes. of newly found nests between forest man- When reporting on breeding results of agers with experience and field training a particular nest, the information source and those who have received only theo- should be always known. The need for retical training is rather large. Proper evalu- more field training is essential (Table 5), ation of training experience can be made since a change in the persons involved only after a large number of newly found over the course of several years resulted nests are tested, since all three nests were in the same errors being made even with- pointed out by the same forest manager; in the Dienvidkurzeme Forestry Region, individual knowledge may also be a result where the nest inventory has now been of previous experience rather than from carried out for the third time. the field training provided. Still, it should Although the amount of analysed material be stressed that many studies using data is too small to make any “global” conclu- provided by forestry managers or question- sions, the difference in proper evaluation naire censuses for population estimates 100 Biota 7/1-2, 2006 STRAZDS, ĶUZE, REINE

Table 5. Differences in correct identification of newly found nests.

Nests con- Black Stork Lesser- sidered to (% of cor- Common Goshawk Spotted be Black rect evalua- Buzzard Eagle Stork tion) Without field training 12 5 (41%) 2 4 1 With field experience 3 3 (100%) 0 0 0

(Grischchenko 1995, Keller & Profus 1991, is improved. Involvement of larger num- Samusenko 1993), and even for breeding bers of well trained inspectors and enlarg- success figures, do not use even theoreti- ing of territory covered by sample plots cally instructed personnel, or do not give can give actual information on a sufficient any evaluation of source data used, so proportion of a national population to be quite possibly the precision of such data used for monitoring needs. might be similar to that presented here, or With a view to reducing the number of even less good. Thus the population size improperly evaluated sightings and and demography data based on such stud- expanding the experience of the partici- ies, especially from countries with large pants, it is necessary to repeat field train- populations, should at the very least be ing seminars and to visit different nest treated with caution. sites before the monitoring season starts. In the end one more obstacle should To avoid misinterpreting breeding status, be mentioned. One possible reason for it is necessary to increase the number of improper evaluations could be a wish to visits during the breeding season to an make results “politically correct”, “improv- optimal 3 or 4. This was confirmed during ing” them with a view to showing that in the second and third year of the study the forest district, “everything runs accord- (2004 and 2005 respectively) when district ing to plan”. Such an attitude is absolutely managers were required to carry out at unacceptable as it abuses the main idea of least two, and in optimal cases, 3–4 field monitoring. visits. These repeated controls gave sig- nificant information in at least some cases, Main conclusions particularly when nests were unsuccessful Data gathered during such projects can — in two cases late predation of some be used for monitoring needs only if it is chicks was discovered, while in two cases statistically useful, which means that at early predation/disappearance of eggs was least 95% of all nest inventories must be discovered. correct. In this project, evaluation of nest- To avoid factual misinterpretation, all par- ing success of occupied Black Stork nests ticipants should complete field notes or, improved over the years from 16% to 62%, optimally, a field form at every nest visit. with a tendency to improve with field In case of the latter, it is important to make training and experience gained over sev- sure that any forms supplied for filling in eral years. Consequently, if research is not are understood correctly prior to filling in. implemented on such accuracy, the data In several cases, initial “errors” were caused is not applicable for monitoring purposes. by checking the wrong boxes on a form, Despite the large proportion of improperly while the original evaluation of the obser- evaluated situations, inventory projects vation was correct (2 cases in DK, 2nd year, such as this can be useful as a monitoring 1 case in DL 1st year). Apart from that, in tool if the quality of work and its accuracy order to expand our knowledge of the STRAZDS, ĶUZE, REINE Biota 7/1-2, 2006 101 status of present pairs (or single birds) it is G. Brēmanis, Andris Butāns, Andris Cirsis, also important to register every observa- Andris Cvirnis, Guntars Čukna, Raivis tion of Black Storks within the territory in Dālbergs, Arnis Eihmanis, Agris Elerts, Andis question. Ērglis, Raimonds Freimanis, Juris Ginovskis, Edgars Griķis, Pāvels Grišāns, Aigars Gāliņš, Acknowledgements Viktors Gulbis, A. Intenbergs, Gints Kaktiņš, For the idea of the project and for impor- Guntars Kampernovs, Normunds Lācītis, tant input in its implementation we are Aivars Litiņš, Aigars Loks, A. Namnieks, grateful to Jānis Buņķis; for assistance in Ivars Nīmanis, Ivars Ozols, Uldis Ozols, Vilis the organisation and management of the Pūtelis, U. Radziņš, Raimonds Ripelis, J. project we are grateful to the manager Rozītis, Jānis Ruks, Kārlis Rusmanis, Māris of the ecology and research unit, Laila Rušiņš, A. Rutkis, Ervīns Sermolis, Alvis Šica, and ecologists of the Rietumvidzeme Spārns, Ziedonis Šņore, Ainārs Tiļļa, Ivars and Dienvidlatgale Forestry Regions Laila Veldre, Jānis Vēliks, J. Vilde, A. Virsis, Aldonis Šestakovska and Sandra Līckrastiņa of the Utināns, Ģirts Zāģeris, and D. Zobova. We state Share Company “Latvijas Valsts meži”; are also very grateful to Gerard Jadoul, for carrying out the field inventories we Pierre Varlomont, and Thierry Mulders for are grateful to all the district managers and assistance in inspections of some nests in their assistants: Kārlis Altītis, Andris Ancāns, 2004 ,and Helmuts Hofmanis in 2005, par- Uldis Averats, Gunārs Avotiņš, Leons ticularly for climbing the trees. Barutis, Aldis Brantevics, A. Birkenbergs,

REFERENCES GRISHCHENKO, V. 1995: Dynamics of the Black Stork breeding range in Ukraine. In: Second International Conference on the Black Stork. March 1996, Trujillo, Estremadura, Spain. ADENEX, Merida: 32. KELLER, M. & PROFUS, P. 1991: Present situation, Reproduction and Food of the Black Stork in Poland. In: Les Cigognes d’ Europe. Colloque International, Metz: 228–236. SAMUSENKO, I. 1993: The Black Stork in the Belarus. In: Strazds, M. ed. 1st Black Stork Conservation and Ecology Symposium. Program, Abstracts, participants. April 1993, Kemeri, Latvia: 91. 102 Biota 7/1-2, 2006 TAMÁS & KALOCSA Biota 7/1-2, 2006 103

The diet of young and feeding places of adult’s Black Storks Ciconia nigra in Gemenc

Enikő Anna TAMÁS1 & Béla KALOCSA2

1MME BirdLife Hungary, Apáczai Csere J. u. 8, H-6500 Baja, Hungary E-mail: [email protected] 2MME BirdLife Hungary, Nagy István u 15, H-6500 Baja, Hungary E-mail: [email protected]

Abstract We have been carrying out investigations of the feeding of Black Storks Ciconia nigra in the Gemenc area since 1996. We have collected data about the species and quantity of prey found near nests and thrown up by young during ringing; furthermore, we regularly observe Black Storks at feeding places as well. Based on these eight years’ data, the food and feeding place preference of the Black Stork can be determined (for this habitat, or for this type of habitat). Main food of the Black Stork is fish, whereas the most important feed- ing grounds are temporary shallow floodplain waterbodies.

Keywords: Ciconia nigra, diet, foraging habitat use, temporary waterbodies, water regime

Received 8 February 2007; accepted 7 July 2007 104 Biota 7/1-2, 2006 TAMÁS & KALOCSA

INTRODUCTION area. They always visit dried-up, shallow The Black Stork Ciconia nigra is a regular water bodies which are rich in fish, favour- but rare breeder in Hungary. It occupies able conditions for Black Storks (Kalocsa & mostly floodplain habitats in the country, Tamás 2003). but occurs also in the forested hills. The main threat to the species in Hungary is STUDY AREA the decrease of suitable habitats in terms Our study area covers the northern of both quality and quantity, which holds part of the Central Danube Floodplain, true both for nesting grounds and forag- the Gemenc Area of the Danube-Drava ing areas. National Park in Hungary. It is a 180 km2 In order to be able to provide efficient area along the right bank of the river protection for the Black Stork terms of Danube, from km 1503 to 1470, most of foraging habitat, we must have informa- it being a recent inundation zone, i.e. it is tion about their prey preferences, feeding regularly flooded. habits and feeding possibilities. Black Storks are present in the area from METHODS March to October, during breeding sea- Investigation of the food of Black Storks son in relatively smaller numbers. Larger between 1996 and 2000 has been under- groups can be observed during migration, taken (Kalocsa & Tamas 2004) and we con- mostly in August and September. They tinued our collection of food data with gather mostly in shallow, fish-rich feeding similar methods as follows. places. Summering, non-breeding Black 1. Food of nestlings Stork flocks can also be regularly observed We regularly ring Black Stork nestlings in in the Gemenc area and the surrounding the framework of the International Black

Figure 1. Percentage of bird species grouped by feeding preferences observed at Nyéki dead branch, March-October 2003. TAMÁS & KALOCSA Biota 7/1-2, 2006 105

Figure 2. Monthly maximum of birds observed at Nyéki dead branch, March-October 2003.

Stork Colour Ringing Program. When a During the monitoring period, the water researcher climbs up to the nest in order to level was also recorded (by the Technical ring the young, some of the young throw Faculty of Eötvös József College, Baja). up food they've recently eaten. If the prey can then be identified, we record it and RESULTS place the food back in the nest (the young 1. Food of nestlings almost immediately eat it again). We have During a period of eight years, we col- to note that our main goal to visit the nest lected 58 samples from young Black Storks. is ringing, and we collected the food data From those, we identified 64% of prey (419 as a side effect of this. This means that if pieces of carcasses) consisting of fish, most there is food available we will record it, frequently Carassius auratus (99 pieces) but we don’t force young to throw up to and Esox lucius (73 pieces). 26% of prey was provide us with data. frogs, mostly Rana esculenta (100 pieces), 2. Monitoring of feeding places 8% tadpoles, mostly of Pelobates fuscus. From October 2002 to December 2003, 2% was other prey, including earthworms, in a complex monitoring programme car- dragonfly larvae, Triturus dobrogicus (one ried out in part of the Gemenc floodplain, piece) and Natrix natrix (two pieces) (Table 1). waterbirds were counted 55 times on Nyéki Dead Branch, an oxbow lake of the Danube 2. Monitoring of feeding places which serves as a feeding place for different Altogether 94 bird species were registered waterbird species depending on changes at the Nyéki Dead Branch during the moni- in water level. The number of individuals of toring period . Black Storks were continu- different species was recorded. Data on the ously present from March to October. Five occurrence of Black Storks from March to breeding pairs nested in the vicinity of the October 2003are presented in this article. oxbow lake. 106 Biota 7/1-2, 2006 TAMÁS & KALOCSA

Table 1. Food of nestlings (1996-2003; 58 samples, 419 identified prey).

SPECIES OF PREY Number per cent Rana esculenta 100 23,87 Bombina bombina 7 1,67 tadpoles 35 8,35 Triturus dobrogicus 1 0,24 Natrix natrix 2 0,48 Carassius auratus 99 23,63 Esox lucius 73 17,42 Abramis brama 24 5,73 Misgurnus fossilis 12 2,86 Perca fluviatilis 9 2,15 Lepomis gibbosus 4 0,95 Ichtalurus nebulosus 3 0,72 Abramis sapa 2 0,48 Neogobius fluviatilis 1 0,24 other fish 43 10,26 other prey 4 0,95 identified summa 419 100,00

In 2003, the water level of the Nyéki Dead tion, most potential feeding places had Branch changed in a continuous transition already dried up. For example, in May 2003, from lake status to very shallow, almost 72 individuals were feeding at another dry status (Figure 1). In the period studied, dead branch in Gemenc, Báli lake, but in water level decreased from 186 cm to 23 August this lake was completely dry and cm (measured above the zero point of empty, while on the Nyéki Dead Branch the installed temporary gauge). The dead ideal circumstances were present (Kalocsa- branch in different states is ideal for differ- Tamás 2003), as large schools of fish in ent groups of bird species with different the extremely shallow water were easily needs. The clear dependence on water accessible. level can be seen in Figure 1 and 2. While in March no feeding Black Storks were DISCUSSION present, in April and May, still with high The food of young Black Storks in our area water level (166 cm) there was only one, consists mainly of fish, if they are available, in June four, in July five. In the second half and occasionally frogs, as observed earlier of August, with a drastic decrease in the (Kalocsa & Tamás 2004). water level (75 to 30 cm), the number of Other kinds of prey are very rare. According feeding Black Storks increased significantly to a study carried out in the Czech Republic, (Figure 2). In August, 40 Black Storks were aquatic animals, mainly fish, prevailed in observed feeding there; in September the the Black Stork nestlings’ diet . Six species number of observed individuals was 24, of fish, undetermined species of frogs and and in October, three. By the start of migra- snakes, two mammal species, and eight TAMÁS & KALOCSA Biota 7/1-2, 2006 107 insect species were found (Hampl et.al., number of birds in a study area increas- 2005). es drastically during spring and autumn According to different published findings, migration, while in spring different duck Black Stork is clearly a fish-eating species. species and Coots dominate; in autumn It takes other kinds of prey, mainly amphib- the main role is played by fish eating bird ians, reptiles and small mammals, if fish are species: egrets, herons and Black Storks. not available. For comparison, we provide The importance of temporary water bodies a list of the 15 most frequently reported for the feeding of Black Storks cannot be prey of Black Stork (Janssen et al 2004): understated - at least for this habitat-type Lampetra planeri, Salmo trutta, Esox lucius, – both in breeding season and during Alburnus alburnus, Cyprinus carpio, Carassius migration. carassius, Gobio gobio, Leuciscus cephalus, Human activities have had a drastic impact Rutilus rutilus, Tinca tinca, Misgurnus fossilis, on temporary water bodies, making them Anguilla anguilla, Lota lota, Perca fluviatilis, permanent (e.g. reservoirs), or draining Cottus gobio.This list was prepared based them (e.g. in order to gain arable land). on 29 different European references, rang- Humanity intends to stabilize the water ing from 1866 to 2000. Of the 15 species regime of rivers (for navigation, flood safe- reported in the literature, five were found ty, etc.), so this special habitat-type is close in our study area. The dominant fish spe- to disappearing. cies in the diet of the Black Stork depends We think that the remaining few, still tem- mainly on habitat (small mountain creeks, porary water bodies must remain tempo- drained fishponds, and floodplains differ rary, and there is a great need to restore from each other). them and even to create temporary water From systematic monitoring of a single bodies - not only for Black Storks. feeding place, it can be well seen that the

References KALOCSA, B. & TAMÁS, E.A. 2003: Duna-Dráva Nemzeti Park Gemenci Tájegység - Vén-Duna élőhely-revitalizációs program II. ütem és monitoringja/Kétéltű- és madárfauna monitoring, manuscript, in Hungarian KALOCSA, B. & TAMÁS, E.A. 2004: Addendum to the diet of the Black Stork (Ciconia nigra) in the Gemenc Region of the Danube-Drava National Park, Hungary 1996-2000. les Actes de la IIIéme Conference Internationale sur la Cigogne noire, Forneau-Saint Michel, Belgique, „AVES” vol. 40/1-4 JANSSEN, G, HORMANN, M. & ROHDE, C 2004: Der Schwarzstorch. Die Neue Brehm-Bücherei Bd. 468. Westarp Wissenschaften, Hohenwarsleben. pp 169-184. HAMPL, R, BUREŠ, S, BALÁŽ, P, BOBEK, M. & POJER, F. 2005: Food Provisioning and Nestling Diet of the Black Stork in the Czech Republic. Waterbirds 28: 35–40. 108 Biota 7/1-2, 2006 TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, ERG & DEME Biota 7/1-2, 2006 109

The Black Stork Ciconia nigra between the Sió channel and the Drava river in the cen- tral Danube floodplain: transboundary monitoring and protection plan

Marko TUCAKOV1, Béla KALOCSA2, Tibor MIKUSKA3, Anna Eniko TAMAS4, Antun ŽULJEVIĆ5, Boris ERG6 & Tamás DEME7

1Marka Oreškovića 9, 25275 Bački Breg, Serbia; E-mail: [email protected] 2MME/BirdLife Hungary, Nagy István u. 15, H-6500 Baja, Hungary; E-mail: [email protected] 3Kopački rit Nature Park Management Office, Ul. Petefi Sandora 33, HR-31327 Bilje, Croatia; E-mail: [email protected] 4MME/BirdLife Hungary, Apáczai Csere János u. 8, H-6500 Baja, Hungary; E-mail: [email protected] 5Vere Gucunje 20, 25000 Sombor, Serbia; E-mail: [email protected] 6IUCN - The World Conservation Union, Programme Office for South-Eastern Europe Dr Ivana Ribara 91, 11070 Belgrade, Serbia; E-mail: [email protected] 7Al-Dunai Természetvédelmi Alapitvány, H-7700 Mohács-Erdőfű, Hungary; E-mail: [email protected]

Abstract The largest and incomparable inland floodplain of the Danube extends 130 kilometers along its banks in the area where the borders of Hungary, Serbia and Croatia meet. Most of the area is protected: Gemenc and Beda-Karapancsa as a part of the Hungarian Danube- Drava National Park, Gornje Podunavlje as a Special Nature Reserve in Serbia, and Kopački Rit as a Nature Park in Croatia. Forest stands and a variety of water bodies (river branches, oxbows, marshy depressions, and carp fishponds) dominate over the site - the most valu- able ones are preserved in a 52,500 ha large recent inundation area. However, the area is still under strong human pressure, being used for forestry, water management, hunting, agricultural and recreation purposes. The Black Stork, as a flagship species of the area, strongly bounds during its life cycle all habitats in this transboundary site. Its local distri- bution, numbers, breeding habits, movements, threatening factors, and its conservation needs have been studied by the authors in the International Black Stork Colour Ringing Program.

Key words: Ciconia nigra, Danube floodplain, transboundary site protection

Received 6 February 2007; accepted 20 April 2007 TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, 110 Biota 7/1-2, 2006 ERG & DEME

INTRODUCTION areas are covered with alluvial forests, but Extensive alluvial floodplains represent only very small fragments are intact, and one of the key habitat types for Black most of them are plantations. Storks Ciconia nigra in Central Europe In Croatia, the southwestern parts end- (Kalocsa & Tamás 1996, 2002, Schneider- ing at the Drava river are protected as the Jacoby 1999). One of the most important, Kopački rit Nature Park, while there are still and the most nearly natural, floodplain sections in the northern part that deserve complexes in Central Europe lies along the protection. Compared to the northern Danube, from the mouth of Sió channel Hungarian section, this part of the flood- near Szekszard in Hungary downstream to plain is dominated by marshes, extensive the mouth of the Drava and Dalj in Croatia reed beds and sedge grasses. Alluvial for- and Bogojevo in Serbia, covering 75,000 ha ests cover only 30% of the area, and they of alluvial wetlands (Diester 1994). are dominated by soft-wood Salix alba Black Stork is a regular breeder through- and Populus alba/nigra forest communi- out the entire area because of the optimal ties, while hardwood common oak Quercus local combination of well-wooded areas robur and red ash Fraxinus angustifolia for- and shallow wetlands on which the spe- ests have developed in very small fractions. cies is dependent (Hancock et al. 1998). Along the left Danube bank the exist- Concerning species ecology and habitat ing embankments closely follow the river, requirements, the Black Stork is good leaving a very narrow corridor of intact indicator species regarding the quality of floodplain. Most of the valuable wetland breeding and feeding habitats it occu- habitats are already cut off from the river pies (Kalocsa & Tamás 2002). At the same and native forest communities have been time, together with the White-tailed Eagle logged. However, there are still important Haliaeetus albicilla, it is an ideal charis- fragments of old forests, as well as numer- matic species of the whole transboundary ous river side-branches and marshes. area (Kryštufek 1999) and a good tool-spe- In Serbia, in the Gornje Podunavlje Special cies, whose conservation needs should be Nature Reserve, the alluvial habitats are used for integration of different protection situated within a compact area which is regimes. mostly cut off from the recent inundation The aim of this paper is to present the area, while just a small part in the south is results of the joint transboundary field flooded regularly. Natural and semi-natu- research program, including data on ral forest stands dominate the area, along breeding distribution, characteristics of with plantations of alochtonous three nest sites and breeding habitats, migration species, mainly hybrid fast-growing pop- patterns and threatening factors, and to lars. However, old and still active Danube propose a general Black Stork protection branches lined with aquatic vegetation, as plan for this region. well as alkaline meadows, are still exten- sive and preserved. STUDY AREA The biodiversity value of the area is widely Gemenc, Béda and Karapancsa, three small recognised since it harbors a wide variety regions in Hungary, are all part of the of animal and plant communities. Over Danube-Drava National Park. Most of it 40 plant communities can be found in is still an inundation area, with Gemenc, Kopački Rit alone (Mihaljević 1999). At which is up to 11 km wide, being the most least 51 fish species, 12 species of amphib- important section, while some territories in ians, 10 species of reptiles, 293 species of Béda and Karapancsa lie outside the flood birds, and 55 species of mammals are just protection dam areas. At least 70% of these an indication of the biodiversity value of TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, ERG & DEME Biota 7/1-2, 2006 111

Table 1. Results of mapping and breeding success of Black Stork Ciconia nigra pairs breeding in central Danube floodplain in 2003.

Danube Danube Beda – Parameter Gemenc right bank left bank Total Karapancsa (Croatia) (Serbia) Number of located exist- 70 28 32 31 186 ing nests Number of located breed- 38 11 8 15 72 ing pairs Number of successful pairs 15 8 2 10 35 Total number of chicks 47 18 5 23 93 Average number of chicks 3,13 2,2 2,5 2,3 2,62 per successful pair Overall breeding success 1,23 1,6 0,63 1,5 1,29 this whole Danube region (Deme 2003a, Group from 1998 to 2000. In 2001, regional 2003b, Puky 2003, Dombi 2003, Mikuska et transboundary cooperation started with al. 2002, Stojanović 2002, Panjković et al. Croatia and in 2002 also with Serbia and 2000, Mihaljević 1999). Among these, there Montenegro. In this paper we use data are number of wetland-related species that gathered between 1992 and 2004. are threatened on a global or European In Croatia, Black Stork surveys started in level and that are listed in appropriate 1998 after the cessation of hostile activi- national or international Red Lists (IUCN ties in the region and the establishment of 2004, Radović et al. 2003). Because of this, the Kopački rit Nature Park Management the major part of the remaining floodplain Office. Regular surveying of the breeding areas are designated as Ramsar sites under population started in 2000, while the first the terms of the Convention on Wetlands nestlings were colour ringed in 2001. In of International Importance, especially as this paper we use data gathered from 1998 Waterfowl Habitats and as Important Bird to 2004. Areas (IBA) under the terms of the EU Birds The first systematic survey in the Serbian Directive (Heath & Evans 2000). part started in 1996 and lasted until 1999. All parts of the region were visited, but METHODS the study was not combined with a sur- The Black Stork study started as an individ- vey of nesting sites of all breeding pairs. ual venture in separate countries, and was After 2002, when Serbia became a part of integrated by using the method of bird International Black Stork Colour Ringing marking prescribed by the International Program, research was intensified. A major Black Stork Colour Ringing Program part of the reserve was covered by a winter (Ferrero 1996). survey of Black Stork nests which were In Hungary, a Black Stork survey has been monitored in the breeding season. The first carried out since 1992, first under the aus- colour ringing was carried out in 2003. The pices of a Dutch-Hungarian framework on database formed between 1996 and 2003 water management. Hungary became a was used in this paper, as well as published part of the International Colour Ringing and unpublished data received from local Program in 1994. A three-year National birders. Field work in all three countries Black Stork Program was conducted by the included gathering data on local distribu- MME BirdLife Hungary Raptor Specialist tion, characteristics of nest sites, numbers, TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, 112 Biota 7/1-2, 2006 ERG & DEME breeding habits, migration patterns, and June and July. In that locality, where there threatening factors. are rich feeding niches, flocks overnight together. RESULTS Breeding distribution and abundance Feeding sites and food supply In the entire study area, 72 pairs bred dur- Black Storks explore a wide variety of feed- ing 2003 (Table 1) comprising over 10% of ing sites, from temporal lakes and marshes the whole Pannonian population, estimat- in the recent floodplain, small pools and ed to be 715 pairs (BirdLife International depressions within the alluvial forests, and 2004). The distribution of breeding pairs dead river branches and small channels, as was not equal throughout the area – the well as secondary wetlands. The value for highest number is recorded in the Gemenc feeding of these sites is changing through region (38 pairs), followed by the left bank time and space. In the early spring, birds of the Danube in Serbia (15 pairs) and often use drained fishponds, as well as Beda-Karapancsa region (11 pairs). The low- temporary wetlands outside the recent est number of breeding pairs was recorded floodplain. This time often overlaps with along the right bank of the Danube in flooding that makes the recent floodplain Croatia, with only eight pairs. unsuitable for foraging. When breeding starts, birds forage in the vicinity of the Characteristics of nest site and breeding nests, taking advantage of small depres- habitats sions within the forest stands and amphib- Nesting trees were similar throughout the ian–spawning season. After chick hatch- whole area (Table 2). The most impor- ing, increased energy requirements force tant nesting trees were Quercus robur and Black Storks to leave the forests and start Populus alba/nigra (87% of nests were built to explore wetlands in the vicinity. This in these tree species). 94% of all nests were time overlaps with the slow water level situated within natural or semi-natural decrease in the recent floodplain that cre- mixed stands of native tree species, while ates a set of small depressions filled with only 6% were found in planted stands of trapped aquatic animals, particularly fish. non-native tree species as Euro American Water level changes in these depressions poplars, Juglans nigra, Acer negundo, and on a daily basis, and birds switch from Robinia pseudoacacia. one foraging site to another accordingly. Nests were situated from 6 to 31 m above This phase of foraging lasts until the end the ground. Black Storks nest almost exclu- of autumn migration. During dry years, sively in old, natural forest stands that are when water level in the inundation zone near the end of their exploitation cycle. is low, fishponds and irrigation canals in Within the stand, they select old, large arable fields surrounding the area can play trees. For example, the circumference of a more important role for Black Stork feed- these trees in Croatia was from 66-588 cm ing, even in the breeding season. (258.1 cm on average; N = 31). In suitable feeding sites, Black Storks for- age together with other large water birds. Non-breeding individuals According to the observed feeding flocks, Congregations of non-breeding specimens Little Egret Egretta garzetta, Great White within the breeding period are regular in Egret E. alba Grey Heron Ardea cinerea, and the area. These specimens are not sexu- White Stork Ciconia ciconia most frequently ally mature, or non-breeding adults, form use the same niches. very characteristic flocks, strongly bonded to temporary lakes and ponds in May, TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, ERG & DEME Biota 7/1-2, 2006 113

Table 2. Host trees for nests of Black Stork Ciconia nigra in central Danube floodplain (N = 264).

Danube Danube Beda – Tree species Gemenc right bank left bank Total Karapancsa (Croatia) (Serbia) Quercus robur 96 (67%) 30 (71%) 16 (53%) 24 (55%) 166 (63%) Populus alba 29 (20%) 7 (17%) 10 (32%) 15 (34%) 63 (24%) Populus nigra 2 (1%) Subtotal a 127 37 26 39 229 (87 %) Fraxinus angustifolia 7 (5%) 2 (5%) 9 (3%) Ulmus laevis 1 (1%) 2 (1%) 3 (1%) Ulmus sp. 2 (6%) 2 (1%) Quercus cerris 2 (5%) 2 (1%) Salix alba 1 (1%) 1 (0%) Pyrus pyraster 1 (2%) 1 (0%) Subtotal b 9 4 2 3 18 (7%) Juglans nigra 5 (2%) 1 (3%) 6 (2%) Fraxinus pennsylvanica 4 (3%) 1 (2%) 5 (2%) Fraxinus sp. 2 (6%) 2 (1%) Populus euramericana 2 (1%) 2 (1%) Acer negundo 1 (1%) 1 (0%) Robinia pseudoacacia 1 (2%) 1 (0%) Subtotal c 7 5 3 2 17 (6%) TOTAL 143 46 31 44 264

Migration ed frequently, but here feeding was not Black Storks start to arrive from around the observed. Other birds sharing the same 10th of March until the beginning of May. stop-over sites include, together with the The earliest arrival was 28th February, 2002. same species seen in the feeding sites in There is no sharp shift between the end of breeding season, Spoonbill Platalea leu- the spring migration and the beginning of corodia. the breeding season, since local pairs were Thanks to some of the recoveries of colour observed on their nests since early April. ringed individuals, we know that the area The autumn migration starts at the end should be considered as one ecological of August, with the first arrival of migrat- unit with respect to the Black Storks. ing flocks very characteristic of the area. Three individuals originating from Béda- The first migrating flocks were observed Karapancsa were observed in Gemenc. around the end of August, while the peak 57N was ringed on 21st June 1999 and of autumn migration is in mid September. observed at a feeding place 50 km to This lasts until late October, with 28th the north on 7th September 1999. 505U, October (1982) the latest (Mikuska et al. ringed in 2003, came from the same place. 2002). This bird was observed in Gemenc in 2004, The estimated number of migrating Black in non-breeding feeding flocks. The third Storks in autumn migration is 600-1000 Black Stork, 56C, which was ringed as pul- individuals per day in the whole area. lus in 1997, was observed in Gemenc in dif- However, individual flocks on particular ferent feeding places in 1999, 2000, 2002 foraging sites are always smaller. The larg- and 2003. This bird has proven to breed est flock counted was 300 birds. Migrating in Gemenc, as it was identified on its nest flocks roosting on arable agricultural land rearing three young in 2003. 541 comes outside the protected area were record- from the same nest in Béda-Karapancsa, TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, 114 Biota 7/1-2, 2006 ERG & DEME

Homorúd – and was seen several times favorable conditions in smaller areas inside in Kopačevo, Croatia. 541 was ringed in our study area. In this case, all key habitat 1996 and observed during the breeding elements attained optimal level. A shallow season near Kopačevo in 2003 and 2004, depression suitable for feeding was situ- an indication that it is breeding there. ated immediately beside the forest stand, X00R, ringed in Gornje Podunavlje, Bački while mature forest was not disturbed at Monoštor on 7th July 2003 as pullus, was all. Since this stand is situated in a part of observed 60 km north in Gemenc in the the alluvial forests cut off from the influ- same year on 28th September. One Black ence of Danube floods by an embank- Stork, 530, which was ringed as pullus in ment, the water level in the depression was Gemenc in 1996, was observed in Kolut, temporarily high and suitable for feeding. Gornje Podunavlje in 1999, possibly breed- This occurs in irregular years of excep- ing there (40 km to the south). One indi- tionally high groundwater levels. At the vidual ringed in Gemenc was observed in end of the 1990s at least two such years Kopačevo: 563, ringed in Baja in 1998, is occurred. However, the depression suf- assumed to breed there following observa- fered immense changes, mainly caused tions in 2004 (80 km to the south). by a rapid decrease of the water level, and now is mainly dry. The second possible rea- DISCUSSION son for this concentration may lie in com- Ecology plex intraspecific relations (Lõhmus & Sellis Breeding density is higher than elsewhere 1996). The species might also be tending in Eastern Europe, where 1.3-1.8 pairs breed to breed in loose colonies if habitat condi- per 100 km2, while in exceptional cases tions permit (Homonnay 1943). density may reach 8.4 bp /100 km2 (Sackl A canopy of mature woodlands in the & Strazds 1997). It is possible that breeding area is not a precondition for breeding, as density is higher in alluvial forests in com- reported by Sackl & Strazds (1997). Even if parison to mountain ones: for example, in large numbers of pairs breed in old stands, Austria densities are 0.2-1.7 pairs/100 km2 these can be considered to be fragments of (Sackl & Strazds 1997). However, the size of once spacious native forests, now degrad- particular territories can not be established ed by intensive forestry management, and according to breeding density, since ter- interspaced by planted non-native trees. ritories overlap in suitable foraging areas. All the forest stands in the area can be clas- Size of particular territories in floodplain sified as semi-natural (Rebane et al. 1997). forests can be 100 – 500 ha (Puzović et al. The trend toward breeding in solitarily 1989), but also 50-150 km2 (Profus 1994). mature trees of common oak and white Keeping in mind that the size of breed- poplars surrounded by young planted ing territories depends predominantly on stands of poplar and willow is increasing. feeding conditions (Puzović et al. 1989), These mature trees have been left in the good status of feeding niches locally is the forest after logging surrounding trees for most evident reason for the existence of the purpose of natural rejuvenation or dense populations. wild boar Sus scrofa feeding (in the case of Although it is a solitary nester (Hancock et oaks). A very small number of nests have al. 1992; Sackl & Strazds 1997), the breed- been placed on planted alochtonous three ing concentration in Apatinski rit in 1996, species (Table 2), since suitable breeding probably present also in 1995, when 7 niches for Black Stork in crowns on these pairs bred in an old 153 ha stand of white trees and within the monotonous stands poplar and common oak (Puzović pers. they form are lacking. comm.), can indicate temporarily very According to the number of migrating TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, ERG & DEME Biota 7/1-2, 2006 115 birds recorded in the area in the peak of trees. Old trees of both species are pre- autumn migration, the area is one of the ferred nesting places for storks, and their most important stop-over places for this existence is a precondition for Black Stork species in Europe. survival (Kalocsa & Tamás 1996, Puzović et al, 1989). Threats and protection Bearing in mind that Black Stork is local- The most severe threat the area is cur- ly threatened, particularly by the loss of rently facing is loss of natural forests and breeding sites, human disturbance, and wetlands through inappropriate inten- loss of wetland feeding areas, it can be sive forestry practice and various water used as a tool-species whose habitat management activities (Puzović & Grubač requirements will serve for improvement 2000). The biggest impact on the flood- of its habitat management in our study plain was caused by the construction of area (Kalocsa & Tamás 1996, Stojanović embankments along the river bank in the 2001). Thus, in order to define more sus- nineteenth and twentieth centuries, which tainable forestry practice (Haffner 1999), isolated formerly wide floodplain areas we suggest the adoption of the following from the river. The formerly flooded land guidelines and their implementation into became suitable for poplar planting in legislation related to the protected areas, the following decades. Poplar plantations as well as to further both conservation and in the area are subject to highly intensive forestry management plans as necessary management: poplar clones are fast grow- Black Stork conservation measures: ing and undemanding regarding habitat 1. Establishment of 400m radius circular conditions in the floodplains, while trunks protection zones around every nest, where are currently highly profitable. Intensive all kinds of human presence will be exclud- poplar breeding, coupled with destruction ed within the breeding season. Outside of native softwood stands, wet meadows the breeding season, any forestry activities and the character of riverside habitats, should be prevented within a 200m radius started in the area in the 1950s. Recent around the nests. plans foresee even more aggressive plant- 2. A mosaic of old common oaks and white ing of poplars in the future (Marković & poplars should be left in every forest sec- Orlović 2002). There is a reasonable danger tion where rejuvenation is planned. that all current alluvial forests, including 3. Remaining old and preserved forest frag- those in the protected floodplains, will be ments dominated by common oak and extirpated after the attenuation of restric- white poplars should be mapped and pro- tive rules which prohibit these actions. tected as IUCN category I zones, in order to The remaining fragments of semi-natu- halt all interventions which could threaten ral stands where white poplars and com- them. mon oaks exist suffer from intensive man- 4. No more hybrid poplar plantations agement, too. Solitary white (and black should be planned in the area. Populus nigra) poplars are not desirable in 5. Previously planted hybrid poplar plan- plantations, and very old trees are regu- tations should be carefully restored into larly logged. Solitary common oaks have autochtonous forest communities. recently been left in rejuvenated stands in 6. All feeding areas should be protected order to ensure enough acorns for natu- from disturbance and intensive use. ral rejuvenation, but very old and dying 7. Restoration of formerly suitable feeding individuals have been cut on a regular sites should be enforced by revitalization basis to minimize the possible threat of projects, in order to improve water supply spreading disease to healthy neighbouring in former aquatic habitats and establish TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, 116 Biota 7/1-2, 2006 ERG & DEME the possibility of movement and spawning major part of their previous natural values for fish. during the last couple of decades. The 8. International attention, assistance, and reasons are numerous, but a predominant nature conservation funds must be con- cause for all is human activity: chronic centrated on the planning and implemen- unbalance of the water regime, decreases tation of these conservation measures, in the width of flooded zones, meliora- having in mind the international impor- tions, accelerated eutrophycation, and tance of the area. massive planting of hybrid poplars in shal- 9. Presently uncoordinated nature-man- low depressions, wet meadows and pas- agement systems should be integrated tures, all of which caused changes in the in the entire area, regardless of borders, optimal ratio between forest, wetlands and different management offices, and land- meadows. Formal approaches to protec- users. In order to achieve this, we sug- tion without undertaking proper measures gest two steps: I. Area richness deserves of active management are not enough to the highest level of national protection. ensure the survival of Black Storks and their Until now, only the Hungarian part lies habitats. Therefore, adoption and enforce- within a National Park; the Croatian and ment of the above management guide- Serbian parts do not, despite the lack of lines and proposals is of crucial importance lowland national parks in both countries for the conservation of Black Storks, as well (Puzović 1996, Radović et al. 2006). The as the whole Central Danube floodplain establishment of National Parks (accord- and its high biodiversity. ing to the IUCN criteria) should be a pri- ority of national conservation polices in Acknowledgements both Croatia and Serbia. Further conserva- Many thanks to József Mikuska, David tion efforts should lead to the establish- Reeder, Bartók Zoltán, Husti Gábor, Nagy ment of a transboundary Ramsar site. The Kornél Péter, Dominik Karakas, Branislav potential for a transboundary Drava-Mura- Mijić, Mario Romulić, Slobodan Puzović, Danube biosphere reserve has not been Elizabeta Stanić Vojnić-Hajduk, Bojan Tadić fully appreciated, and should be carefully and Adrian Tomik for their help during the reconsidered (Euronatur 1996). research. II. Natural wetlands in the area, many of them protected over decades, have lost a

REFERENCES BIRDLIFE INTERNATIONAL 2004: Birds in Europe: population estimates, trends and conserva- tion status. BirdLife International Conservation series No. 12, BirdLife International, Cambridge. DIESTER E. 1994: The function, evaluation, and relicts of near-natural floodplains. Limnologie Aktuell – Band 2: Biologie der Donau. Gustav Fischer Verlag, Stutgart-Jena-New York. DEME T. 2003a: Halfaunisztikai kutatások Béda-Karapancsán. In: Somogyvári O. ed.: Élet a Duna- ártéren - természetvédelemről sokszemközt című tudományos tanácskozás összefo- glaló kötete, Pécs. In Hungarian. DEME T. 2003b: Madártani kutatások Béda-Karapancsán. In: Somogyvári O. (ed.): Élet a Duna- ártéren - természetvédelemről sokszemközt című tudományos tanácskozás össze- foglaló kötete. Pécs. In Hungarian. DOMBI I. 2003: Denevérfaunisztikai kutatás az Alsó-Duna völgyben. In: Somogyvári O. ed.: Élet TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, ERG & DEME Biota 7/1-2, 2006 117

a Duna-ártéren - természetvédelemről sokszemközt című tudományos tanácskozás összefoglaló kötete. Pécs. In Hungarian. DPRP – Danube Pollution Reduction Programme (PCU UNDP/GEF) 1999: Evaluation of Wetlands and Floodplain Areas in the Danube River Basin. Final Report May 1999. WWF Danube-Carpathian Programme and WWF-Auen Institute, Vienna. EURONATUR 1998: European Life Line Drava – Mura: Proposal for Transfrontier Biosphere Reserve. Thematic map. EURONATUR, Conztanz. FERRERO, J. J. 1996: International ringing programme of Black Stork. Proceedings of II International Conference on the Black Stork, Trujillo, Spain. HANCOCK, J., KUSHLAN, J. & KAHN, P. 1992: Storks, Ibises and Spoonbills of the World. Academic Press, London. HEATH,. M.F. & EVANS, M. I. 2000: Important Bird Areas in Europe: Priority sites for conservation. Volume 2: Southern Europe. BirdLife International, Cambridge. HOMONNAY, N. 1943: Beitrage zur Kenntnis der Nistplatze und der Verbreitung des Schwarzen Storches (Ciconia nigra L.) in Ungarn. Frag. Faun. Hungarica 6: 9-19. In German. IUCN 2004: IUCN Red List of Threatened species. http://www.iucnredlist.org/. KALOCSA, B. & TAMÁS, E.A. 1996: Nesting of Black Storks in the Gemenc floodplain forest, Proceedings of II International Conference on the Black Stork, Trujillo, Spain. KALOCSA B. & TAMÁS E. A. 2002: A fekete gólya (Ciconia nigra) állományának felmérése a gemenci erdőben – fészkelési szokások és költési eredményesség (1992-2000). Aquila. 107-108: 215-223. In Hungarian with English Summary. KRYŠTUFEK, B. 1999: Osnove varstvene biologije. Tehniška založba Slovenije, Ljubljana. In Slovene. LÕHMUS, A. & SELLIS, U. 1996: A theoretical approach to the habitat selection studies on the Black Stork. Proceedings of II International Conference on the Black Stork, Trujillo, Spain. MARKOVIĆ, J. & ORLOVIĆ, S. 2002: Plantaže topola i zaštita vlažnih staništa i biodiverziteta: Praktično i ekonomski opravdano protiv romantičnog i deklarativnog. Šume 67: 19-26. In Serbian. MIKUSKA, J. MIKUSKA, T. & ROMULIĆ, M. 2002: Vodič kroz biološku raznolikost Kopačkog rita. Knjiga 1. Ptice. Matica Hrvatska, Osijek. In Croatian. MIHALJEVIĆ, M. 1999: Kopacki rit – review of research and bibliography. Zavod za znanstveni rad Osijek & Hrvatska akademija znanosti i umjetnosti, Zagreb-Osijek. MITSCH, W.J. & GROSSELNIK, J.G. 1993: Wetlands. Van Nostrand Reinhold, New York. PANJKOVIĆ, B., KRIZMANIĆ, I., PUZOVIĆ, S., STOJŠIĆ, V., KOVAČEVIĆ, B. & ŠTETIĆ, J. 2000: Significant biodiversity components at Apatinski and Monoštorski rit (YU). Proceedings of 33rd Conference of International Association for Danube Research. Limnological Reports 33: 171-178. PUKY, M. 2003: Gemenc herpetológiai jelentősége és a Délkelet-Dunántúl kétéltű-hüllő ponttérképezésének eredményei. In: Somogyvári O. ed.: Élet a Duna-ártéren - természetvédelemről sokszemközt című tudományos tanácskozás összefoglaló kötete, Pécs. In Hungarian. PROFUS, P. 1994: Black Stork Ciconia nigra. In: Tucker, G. & Heath, M., eds: Birds in Europe: Their conservation status. BirdLife Conservation Series No 3. Birdlife International, Cambridge: 98-99. PUZOVIĆ, S. 1996: Breeding bird species diversity in Serbia with special reference to national parks. Proceedings of International scientific conference “Forest ecosystems of the national parks”: 237-241. Ministry of environment of Republic of Serbia, Belgrade. PUZOVIĆ, S. & GRUBAČ, B. 2000: Federal Republic of Yugoslavia.. In: Heath, M.F. & Evans, M. I., eds.: Important Bird Areas in Europe: Priority sites for conservation. Volume 2: Southern Europe. BirdLife International, Cambridge: 725-745. TUCAKOV, KALOCSA, MIKUSKA, TAMAS, ŽULJEVIĆ, 118 Biota 7/1-2, 2006 ERG & DEME

PUZOVIĆ, S., SEKULIĆ, V. & PAVLOVIĆ, D. 1989: Black Stork (Ciconia nigra L.) at Obedska bara 1983-1987. Bulletin of Natural History Museum Belgrade B43/44: 161-174. In Serbian with English Summary. RADOVIĆ, D., KRALJ J., TUTIŠ, V. & ĆIKOVIĆ, D. 2003: Red Data Book of Birds of Croatia. Ministarstvo zaštite okoliša i prostornog uređenja, Zagreb. In Croatian with English Summary. RADOVIĆ, J., ČIVIĆ, K. & TOPIĆ, R. 2006: Biodiversity of Croatia. State Institute for Nature Protection, Ministry of Culture – Republic of Croatia, Zagreb. In Croatian with English Summary. REBANE, M., WALICZKY, Z, & TURNER, R. 1997: Boreal and temperate forests.. In: Tucker, G. & Evans, M., eds: Habitats for birds in Europe: a conservation strategy for the wider environment. BirdLife International, Cambridge: 203-238. SACKL, P. & STRAZDS, M. 1997: Ciconia nigra Black Stork.. In: Hagemeier, W. & Blair, M., eds: The EBCC Atlas of European Breeding Birds. T & A D Poyser, London: 56-57. SCHNEIDER – JACOBY, M. 1999: Breeding distribution and ecology of the Black Stork Ciconia nigra in the Sava alluvial wetlands, Croatia. Acrocephalus 20: 167-176. STOJANOVIĆ, V. 2002: Specijalni rezervat prirode “Gornje Podunavlje” – geografski prikaz, zaštita, korišćenje. Prirodno – matemetički fakultet, Institut za geografiju, turizam i hotelijerstvo, Novi Sad. In Serbian. ZIELIŃSKI Biota 7/1-2, 2006 119

The role of forest reserves in the pro- tection of the Black Stork Ciconia nigra in central Poland

Piotr ZIELIŃSKI

Department of Ecology and Vertebrate Zoology, University of Łódź, Banacha 12/16, 90-237 Łódź, Poland, E-mail: [email protected]

Abstract The black stork Ciconia nigra in central Poland (Łódź voivodship) increased from about 3 breeding pairs in the 1940s to 59 pairs in 2003. The density of the BS was 0.3 pairs per 100 km2 of the total study area in 2003, 1.6 pairs per 100 km2 of forested area and 3.3 pairs per 100 km2 of forests older than 60 years. Eleven pairs of black storks built their nests within the boundaries of the forest reserves, 34 pairs had nests outside the forest reserves, and six pairs had one nest inside and one nest outside the reserves. Thus, the black stork shows a strong tendency to build nests in the forest reserves. The greatest increase in the number of breeding pairs in central Poland was recorded in the 1970s. At that time, most of the forest reserves were already established, making growth in the number of pairs possible. Forest reserves protect old-growth stands, which provide breeding trees for the storks. In addition, forest reserves serve as refuges from human encroachment and are thus of cru- cial importance for long-term protection of the breeding sites of the black stork.

Key words: nature protection, forest reserves, central Poland, Black Stork, Ciconia nigra

Received 12 February; accepted 12 May 2007 120 Biota 7/1-2, 2006 ZIELIŃSKI

INTRODUCTION are dominated by Scots pine Pinus sylves- After a serious decline in the 19th century, tris, which covers 86% of the total area. the status of the black stork in Europe is The average age of the forests is 59 years improving in many areas, particularly in (Raport 2001). 71 forest reserves cover an western and central Europe (Profus 1994, area of 35 km2 (Walczak et al. 2001). Jansen & Kock 1996, Pfeifer 1997, Kołudzki et al. 2003). However, the species is declin- METHODS ing in some areas and the causes of this Field surveys were carried out in the years decline remain unclear (Rosenwald & 2001-2003. Additional data both from pub- Lõhmus 2003). In Poland, the black stork lished (Dunajewski 1936, Sosnowski 1955, occurs throughout the country with an esti- Bednorz 1974, Markowski 1981, Kabała mated 1100-1200 breeding pairs (Profus 1987, Hejduk & Markowski 2002, Kołudzki 2001). The common conservation practice et al. 2002) and unpublished sources (for- in many countries is that, after the nest of estry archives) were used to reconstruct the black stork is created, buffer zones are the fate of particular nests. established around the nest (post factum conservation activity). Another approach is to create forest reserves protecting old- RESULTS growth stands without considering the Altogether, 51 pairs with active nests actual presence of the black stork (pre were found. Another 8 pairs were prob- factum conservation activity). The aim of ably breeding in the Łódź voivodeship in this study is to examine the importance the years 2001-2003. In these cases, adult of forest reserves in the protection of the black storks were regularly observed in black stork. the same regions from May through July, but no active nests were found. Thus, the Figure 1. Location of the study area (shaded) estimated minimum number of black stork in Poland. pairs breeding in the Łódź voivodeship in the years 2000-2003 was 59. The density per 100 km2 of the total study area was 0.3 pairs; in the forest area it was 1.6 pairs per 100 km2 and in forest aged over 60 years it was 3.3 pairs per 100 km2. Eleven pairs of black storks built their nests within the boundaries of the forest reserves, 34 pairs had nests outside the forest reserves, and 6 pairs had one nest inside and one nest outside the reserves.

Nests were found in the following forest reserves (values in brackets indicate the year of creation of the reserve and area in ha): Lubiaszów (1958, 202.4), Wiączyń STUDY AREA (1958, 8.8), Jasień (1958, 14.5), Wolbórka (1959, 35.25), Molenda (1959, 143.0), Jodły The research was conducted in the Łódź Oleśnickie (1962, 9.7), Dębowiec (1965, voivodeship (Figure 1), central Poland. The 47.0), Nowa Wieś (1967, 116.58), Żądłowice area of the Łódź voivodeship is mainly (1968, 138.79), Jeleń (1976, 47.19), Ryś lowland and covers 18,219 km2, including (1977, 53.93), Wojsławice (1978, 97.29), 3712 km2 of forest (20.4%). The forests ZIELIŃSKI Biota 7/1-2, 2006 121

Figure 2. Number of forest reserves and the number of forest reserves in succeeding number of pairs of black storks in central decades (Figure 2). Poland in succeeding decades. Significantly more pairs established a breeding territory after the creation of forest reserves than before (12 vs 4, respectively; χ2 = 4.0, df = 1, P<0.05, Figure 3). In the years 1990-2003 the histories of 46 nests were recorded (only pairs record- ed for more than 5 years were included). Eleven pairs breeding in the for- est reserves renested within 500 m of their original nest site, while only four moved Kruszewiec (1979, 81.54), Kopanicha (1980, to other areas (Figure 4). In contrast, of 31 42.53), Dęby w Meszczach (1989, 39.15), pairs breeding outside the forest reserves, Jodły Łaskie (1991, 59.19), Czarna Rózga 22 pairs renested in new areas, while only (1996, 185.6). nine renested within 500 m of their origi- The mean area of the forest reserve with the nal nest site (Figure 5, χ2 = 8.1, df = 1, nests of black storks was 77.79 ha (range: P<0.01,). This result clearly demonstrates 8.8-202.4, n = 17), and the mean area of that black storks breeding in the forest the forest reserve without black stork nests reserves remain in the same territory for was 40.33 ha (range: 0.17-164.91, n = 54). many years, while pairs breeding outside Thus, forest reserves with black stork nests the forest reserves tend to move to new were significantly larger (t = 3.37, df = 69, nesting areas. P<0.01). All the reserves were created to protect old-growth stands and different DISCUSSION forest communities. Forest management is one of the most In the years 2000-2003, 51 nests were important factors contributing to black recorded in the total forest area, so the stork breeding density (Rosenvald & number of nests found in a total area of for- Lõhmus 2003). The preference in forest 2 est reserves (35 km ) would be expected management for even-aged stands makes to be 0.5 nests. This figure is much less than it difficult for the black stork to find a the 11 nests found in the forest reserves. tree appropriate to site a nest. However, If we consider only forests aged over 60 large trees may be found in old-growth 2 years (1804 km ), the expected number of stands. The present study shows that the 2 nests found in an area of 35 km would be increase in the number of forest reserves ca 1 nest, which is still much less than the facilitates an increase in black stork densi- 11 nests observed in the forest reserves. It ty. The strong positive correlation indicates may be concluded from these results that that the increase in the number of forest the black stork shows a strong tendency to reserves probably facilitated the increase build nests in the forest reserves. in the number of black stork pairs breed- There was a highly significant positive cor- ing in central Poland. The probable expla- relation (r = 0.98, P<0.001, df = 4) between nation for this result is that diminished the number of black stork pairs and the forestry operations facilitated settlement 122 Biota 7/1-2, 2006 ZIELIŃSKI

Figure 3. Percentage of the number of breed- of storks looking for new territories, result- ing sites established before/after the creation ing in the establishment of breeding pairs. of forest reserves. Thus, cessation of forest management (due to creation of the reserve) may increase the probability of the establishment of new territories by black storks. The positive effect of reserves can be attrib- uted to a number of factors, but the most important seems to be the protection of old-growth stands, which provide breed- ing trees for the black stork. Even small forest reserves effectively protect breeding sites of the black stork. Protection of feed- ing places for the black stork in the forest reserves is also important, but this holds Figure 4. Percentage of black stork pairs true only in large reserves. However, food breeding inside the forest reserves that abundance might also affect the breeding stayed within 500 m of their original nest success of the black stork and an artificial site (white) or moved out of the 500 m zone increase in food abundance by releasing (shaded). young trout into brooks might result in a higher reproduction rate (Janssen & Kock 1996). Black storks breed successfully in areas without, or with limited, forest manage- ment. In contrast, nest sites not protected by strict regulations were often destroyed during forestry operations. Of 18 nests documented in the years 1955-1985 in the Pilica Forest, central Poland (Kabała 1987), 4 were sited in reserves and 14 outside the reserves. Of these 14 nests, 9 were destroyed by clearcuts, while none of the Figure 5. Percentage of black stork pairs nests situated inside the reserves were breeding outside the forest reserves that destroyed (P<0.05, one-tailed Fisher exact renested within 500 m of their original nest test). Consequently, in central Poland most site (white) or renested further than 500 m pairs established territories after the cre- away (shaded). ation of the forest reserves. Since 1983 the nests of black storks have been strictly pro- tected by a disturbance-free zone, which further improved the status of this species in Poland. In contrast to the forest reserves, land- scape parks are not preferred by black storks and this form of nature protection is of little value to the black stork (Zieliński et al. 2002). The conclusion is that the establishment of a net of small and permanent forest ZIELIŃSKI Biota 7/1-2, 2006 123 reserves (30 – 100 ha each), protecting old- Acknowledgements growth stands in damp habitats, is one of I wish to thank Tomasz Janiszewski, the most important conservation actions Zbigniew Kołudzki and Jacek Tabor for for the black stork. Forest reserves protect their help with the field work. I am also suitable habitats providing breeding trees grateful to Romuald Olaczek (University of for the stork, serve as refuges from human Łódź) for helpful discussion about nature activities, and thus are of crucial impor- reserves in Poland. The staff of state forest tance for the long-term protection of the districts kindly provided data on the local- breeding sites of black storks. ity of some nests.

REFERENCES BEDNORZ, J. 1974: The black stork Ciconia nigra in Poland. Ochrona Przyrody 39: 201-243 (in Polish). DUNAJEWSKI, A. 1936: Materjały do występowania czarnego bociana (Ciconia nigra Linn.) w Polsce. Acta Ornithologica 2, 1: 1-26. HEJDUK, J. & MARKOWSKI, J. 2002: The occurence of the black stork Ciconia nigra (L.), black grouse Tetrao tetrix (L.) and hazel hen Bonasa bonasia (L.) in Łódź region (The results of an enquiry). Acta Universitatis Lodziensis, Folia Biologica et Oecologica 1: 217-225 (in Polish). JANSSEN, G. & KOCK, J. 1996: Besiedlung Schleswig-Holsteins durch den Schwarzstorch (Ciconia nigra) 1974-1995. Corax 16: 271-285. KABAŁA, C. 1987. Populacja bociana czarnego Ciconia nigra (L.) w środkowym dorzeczu Pilicy. Tomaszów Mazowiecki. 1-42. KOŁUDZKI, Z., WĘŻYK, M., KOCINIAK, M. & ZIELIŃSKI , P. 2003: Occurrence of the Black Stork Ciconia nigra in the former Piotrków Voivodship in the years 1994-2001. Chrońmy Przyrodę Ojczystą, 59: 5-18. In Polish. MARKOWSKI, J. 1981: Bocian czarny – Ciconia nigra – na terenie Wyżyny Łódzkiej. Acta Universitatis Lodziensis, Folia zoologica et anthropologica 1: 95-97. PFEIFER, R. 1997: Der Schwarzstorch Ciconia nigra in Bayern – Ausbreitungsgeschichte, Verbreitung und aktueller Status. Orn. Anz. 36: 93-104. PROFUS, P. 1994: Black Stork Ciconia nigra. In: Tucker, M., Heath, M., Tomiałojć, L. & Grimmett, R.F.A., eds. Birds in Europe - their conservation status. Bird Life Conservation Ser. no 3. BirdLife International, Cambridge: 98-99. PROFUS, P. 2001: Der Schwarzstorch (Ciconia nigra) in Polen – Verbreitung, Bestandsentwicklung, Brutbiologie und Schutzmaβnahmen. Tagungsband 134. Jahreversammlung der Do-G, p. 101. Schwyz. RAPORT. 2001: Raport o stanie środowiska w województwie łódzkim w 2000 roku. Biblioteka Monitoringu Środowiska, Łódź, 1-167. ROSENVALD, R., LÕHMUS, A. 2003: Nesting of the black stork (Ciconia nigra) and white-tailed eagle (Haliaeetus albicilla) in relation to forest management. Forest Ecology and Management 185: 217-223. SOSNOWSKI, J. 1955: Bocian czarny pod Tomaszowem Mazowieckim. Chrońmy Przyrodę Ojczystą 11, 5: 43-44. WALCZAK, M., RADZIEJOWSKI, J., SMOGORZEWSKA, M., SIENKIEWICZ, J. GACKA-GRZESIKIEWICZ, E.& PISARSKI Z. 2001: Obszary chronione w Polsce. Instytut Ochrony Środowiska, W-wa. ZIELIŃSKI, P., KOŁUDZKI, Z., TABOR, J. & WIECZOREK, M. 2002: The importance of landscape parks and nature reserves for breeding of the black stork Ciconia nigra in Central Poland. In: J. K. Kurowski, P. Witosławski eds.: Funkcjonowanie parków krajobrazowych w Polsce. Katedra Geobotaniki i Ekologii Roślin Uniwersytetu Łódzkiego, Łódź, pp. 158-162. In Polish. 124 Biota 7/1-2, 2006

INSTRUCTIONS mm high) after size reduction. TO CONTRIBUTORS References. In the list of references, the fol- lowing usage should be followed: Biota publishes papers from all fields of Journal: SURNAME, A.B. Year: Title. Full biology and ecology in their widest sense. Journal name, Volume: pagination. It is open for authors from all countries. The Book: SURNAME, A.B. & SURNAME, C. Year: language of papers is English or Slovene Title. Publisher, Place. (with English summary). Chapter: SURNAME, A., SURNAME & B. Types of papers SURNAME, C. Year: Chapter title. In: Editors. The journal publishes original scientific Book or Proceeding title. Publisher, Place: papers, short communications, review pagination. articles, book reviews, special issues con- In the text, citations should give the taining selected and edited papers dealing author’s name and the year of publication, with a specific theme or based on a confer- e.g. Surname (1998) or (Surname 1998) ence or workshop. or Surname & Surname (1998). Where The submission of a paper obliges the there are three or more authors, the first author(s) not to submit the same paper authors name plus “et al” must be given, elsewhere. Manuscripts are submitted to e.g. Surname et al. (1998, 1999). Where two reviewers for evaluation of their signifi- or more papers abbreviate to the same cance and soundness. Authors will gener- citation (i.e. two or more papers produced ally be notified of acceptance, rejection, or by the same authors in the same year), need for revision within three months. The use “a”, “b”, “c”, etc. in the order of their first referees remain anonymous. Decisions of appearance, e.g. (Surname 1998a, b). the editor are final. Reprints and proof The form of the manuscript Proof will be send to the main author only The paper should consist of title, author’s once and it should be returned to the name and address, abstract (not exceed Editor without delay. Corrections should 250 words), key words (no more than six) be limited to typographical errors. main text (i.e. introduction, material and The editors reserve the right to correct the methods, results, discussion) followed by proofs themselves, using the accepted ver- acknowledgements, references, tables and sion of the typescript, if the author’s cor- figures. Authors of scientific taxa should be rections are overdue and the journal would omitted. Manuscripts should be double- otherwise be delayed. Proofs should be spaced on one side of the paper, with wide checked very carefully. It is the correspon- margins all round. The text of a manuscript dence author’s responsibility to ensure that should be without special style settings proofs are correct in every respect. and footnotes. Headings should be on 30 reprints of each article will be send to separate line, and their hierarchy should the first-named author free of charge plus not exceed three. a copy of the issue in which your paper has Authors are urged to have the manuscript appeared. revised by “native speaker”, if necessary. Submit three copies of the manuscript, including tables, figures, and photocopies Tables and figures should be numbered of illustrations (if you send the manuscript consecutively according to the text. Each as e-mail attachment please send it as Rich should be on a separate sheet of paper. Text Format (rtf.)) to: Each caption to a figure or table should start with the number of the figure/table, BIOTA e.g. Figure 1., Table 2. Tables and figures Milan Vogrin, Zg. Hajdina 83c, should be numbered in order of appear- SI-2288 Hajdina, Slovenia ance in the text. Fax: 00386 (0)2 788 30 51 Illustrations must be submitted camera- E-mail: [email protected] ready for copying, usually as laser print- outs. All internal structures, letters, graphic symbols must be well readable (at least 2 Biota 7/1-2, 2006 125

NAVODILO AVTORJEM Literatura Vsi uporabljeni viri morajo biti citirani med Biota objavlja prispevke s področja bio- tekstom. Literaturo uredite po abecednem logije in ekologije v najširšem pomenu redu prvega avtorja in glede na letnico besede. Prispevki so lahko v angleškem ali izdaje: v slovenskem jeziku z daljšim angleškim Revija: PRIIMEK, A.B. Leto: Naslov. Polno povzetkom (enako naslovi tabel in grafov), ime revije, letnik: strani. ki ga pripravi avtor sam. Knjiga: PRIIMEK, A.B. & PRIIMEK, C. Leto: Naslov. Izdajatelj, kraj. Vrste prispevkov Poglavje: PRIIMEK, A., PRIIMEK, B. & PRIIMEK, V Bioti je mogoče objavljati izvirne znan- C. Leto: Naslov poglavja. V: Urednik(i). stvene članke, kratke notice, pregledne Naslov knjige ali zbornika. Izdajatelj, kraj: članke in predstavitve novih knjig. Biota strani. sprejema tudi prispevke z različnih kon- V tekstu citiramo na naslednji način: ferenc in posvetov. Z objavo se avtorji Priimek (1998) ali (Priimek 1998) ali Priimek obvežejo, da ne bodo nikjer objavili ena- & Priimek (1998). Če so več kot trije avtorji kega prispevka. Vsi prispevki bodo pred- pa: Priimek et al. (1998, 1999). V primeru, če loženi v recenzijo dvema recenzentoma. citiramo več del istega avtorja, objavljenih Recenzenti ostanejo anonimni. Avtorji v enem letu, posamezno delo označimo s bodo obveščeni o sprejemu, zavrnitvi ali črkami a, b, c, itd., npr. (Priimek 1998a, b). reviziji prispevka predvidoma v treh mese- cih. Odločitev urednika je dokončna. Korektura in separati Prvi odtis prispevka urednik pošlje glav- Oblika prispevka nemu avtorju v korekturo. Avtor je dolžan Prispevek mora vsebovati naslov, imena vrniti popravljeno besedilo v najkrajšem avtorjev in njihove naslove, izvleček (do možnem času. Širjenje obsega besedila ob 250 besed), ključne besede (do šest) ter korekturah ni dovoljeno. glavni tekst (uvod, material in metode, Glavni avtor prejme 30 separatov in izvod rezultati, diskusija) ki mu sledi zahvala, lite- revije, kjer je bil objavljen prispevek, brez- ratura, tabele in grafi. Prispevek predložite plačno. v dveh izvodih, z dvojnim medvrstnim raz- Original in dve kopiji prispevka vključno s makom in s širokimi robovi. Odstavki naj tabelami, slikami in grafi pošljite na naslov bodo med seboj ločeni s prazno vrstico. V (v kolikor prispevek pošiljate po elektron- kolikor je prispevek pisan v angleškem jezi- ski pošti, datoteko shranite kot “obogateno ku, avtorju priporočamo, da ga pregleda besedilo” - Rich Text Format (rtf.): “native speaker”. BIOTA Tabele in slike (grafi, fotografije, risbe) Milan Vogrin, Zg. Hajdina 83c, naj bodo oštevilčene po zaporedju, kot se SI-2288 Hajdina, Slovenia pojavljajo v besedilu. Vsaka tabela in graf Fax: 02 788 30 51 morata biti na svojem listu. Tabela ali graf E-mail: [email protected] se morata pričeti z zaporedno številko, npr. Slika 1, Tabela 2. Ilustracije naj bodo tiskane na laserski tiskalnik. Risbe so lahko narisane tudi s črnim tušem na paus papirju. Črke, številke in simboli morajo biti velike vsaj 2 mm. 126 Biota 7/1-2, 2006

TO ADVERTISE IN THIS JOURNAL SEND AN E-MAIL TO

[email protected] biota cover 7 2006 9/9/2007 13:32 Page 2

C M Y CM MY CY CMY K

Front cover: Black Stork Ciconia nigra, Photo: Zsolt Kalotas

BIOTA - Revija za biologijo in ekologijo BIOTA - Journal of biology and ecology

Revija Prof. Dr. Juha Merilä - Department of Ecology and Systematics, University of Helsinki, DPPVN - Druπtva za prouËevanje ptic in varstva Finland narave Dr. Claude Miaud - University of Savoie, Ptujska c. 91, SI- 2327 RaËe, Slovenija France Dr. David Mifsud - Naturhistorisches Museum in Druπtva varuhov okolja Radoæiv Basel, Basel, Switzerland Ul. Ivanjke Uranjek 1, SI-3310 Æalec, Prof. Dr. Timothy A. Mousseau - Department Slovenija of Biological Sciences, University of South Carolina, USA Journal of Dr. Zbynek RoËek - Academy of Sciences and DPPVN - Society of bird research and nature protection Charles University, Prague, Czech Republic and Environmental Society Radoæiv Dr. Luca Salvati - Rome, Italy Andrej Sovinc - Landscape park SeËoveljske Glavni in odgovorni urednik - Editor in chief soline Milan Vogrin, Andrej ©orgo - DPPVN, Slovenia Zg. Hajdina 83c, SI-2288 Hajdina, Slovenia Dr. Piotr Tryjanowski - Adam Mickiewicz E-mail: [email protected] University, Poland Dr. Reuven Yosef - International Birding & PomoËnik urednika - Assistant editor Research Centre in Eilat, Israel dr. Andreja MikliË Dr. Marco Zuffi - University of Pisa, Italy University of Ljubljana Dr. Igor Æiberna - University of Maribor, Biotechnical Faculty Pedagogical Faculty Maribor, Slovenia Groblje 3, SI/1230 Dom`ale E-mail: [email protected] Lektorji - Lectors za angleπËino - for English language: TehniËni urednik - Technical editor Dr. Victor Kennedy Darinka KnapiË za slovenπËino - for Slovene language: Tanja Vovk Petrovski Uredniπki odbor - Editorial Advisory Board Prof. Dr. Ronn G. Altig - Mississippi State Izhaja - Issued University, USA dve πtevilki letno - two numbers per year Prof. Dr. Luigi Boitani - University of Roma “La Sapienza”, Italy Exchange of publications Matjaæ BedjaniË - DPPVN, Slovenia All periodicals sent in exchange for Biota should MSc. Zoran Belec - Zavod za gozdove be addressed to: /DPPVN, Slovenia DPPVN, Ptujska c. 91, SI-2327 RaËe, Slovenia Dr. Helmut Faber - Graz, Austria Dr. Ioan Ghira - Babes-Bolyai University, Tisk - Printed by Romania Marginalija, d.o.o., Sempeter, Slovenia

Revija Biota je indeksirana v BIOSIS, COBIB, CSA (Cambridge Scientific Abstracts), Elsevier Geo Abstracts and ROL (Recent Ornithological Literature) Journal Biota is covered by the BIOSIS, COBIB, CSA (Cambridge Scientific Abstracts), Elsevier Geo Abstracts and ROL (Recent Ornithological Literature) Revijo sofinancirajo: MOP - Ministrstvo za okolje, prostor in energijo, DEF - Danube Environmental Forum

Composite biota cover 7 2006 9/9/2007 13:32 Page 1

C M Y CM MY CY CMY K

Revija za biologijo in ekologijo / Journal of biology and ecology Vol. 7, 1-2, 2006 Vol. 7, 1-2, 2006 1-2, 7, Vol. Photo: Milan Vogrin ^rna {torklja Ciconia nigra Proceedings of the 4th International Conference on the Black Stork Ciconia nigra Black Stork Ciconia nigra Davod-Püspökpuszta, Hungary, 15-18 April 2004

ISSN 1580-4208

designed by: darinka knapiË printed by: marginalija Drustvo za proucevanje ptic in varstvo narave Drustvo varuhov okolja Radoziv Society of Bird Research and Nature Protection Environmental Society Radoziv

Composite