Monitoring the Distribution of Indigenous and Non-Indigenous
Total Page：16
File Type：pdf, Size：1020Kb
Monitoring the Distribution of Indigenous and Non-indigenous Ascidians & Macroinvertebrates in Harbours Around Newfoundland Callahan, A.G.1, Deibel, D.1, McKenzie, C.H.2 & Sargent P.1 1Ocean Sciences Centre, Memorial University, St. John's, Newfoundland Labrador, Canada A1C 5S7 2Northwest Atlantic Fisheries Centre, Department of Fisheries and Oceans Canada, St. John's, Newfoundland Labrador, Canada Introduction Gene Sequencing Invasive, non-indigenous ascidians have been a significant biofouling problem for the 1. Ascidians 2. DNA aquaculture industry in Nova Scotia and Prince Edward Island since the mid-1990s. Given 3. Polymerase 4. TA Cloning collected by Extraction Chain Reaction the high level of vessel traffic between Newfoundland and the Maritime Provinces, it may be SCUBA divers. (Folmer primers) a matter of when rather than if one or more of these species invades Newfoundland harbours. As part of the first assessment of non-indigenous invertebrates in Newfoundland harbours, field work has been conducted in the fall of 2006 and summer of 2007 in four ports (Port-aux-Basques, Corner Brook, Botwood and Argentia). All four ports are visited regularly by a variety of ships sailing from locations in the southern Gulf of St. Lawrence. This project was done to assess the abundance and biodiversity of macroinvertebrates on H. pyriformis H. pyriformis H.H. pyriformis pyriformis wharf pilings, including indigenous and non-indigenous ascidians. Quadrat samples, visual (total DNA from 4 animals (amplified CoxI gene (clones of CoxI gene surveys and photographic records were taken at each harbour and, when encountered, + molecular size marker) from 4 animals + from 2 animals) ascidians were fixed for genetic analysis. molecular size marker) We are also exploring the use of sequence analysis of the cytochrome oxidase I gene (COI) of mtDNA to confirm taxonomic identity and to develop species-specific primers for early detection of larvae and juveniles of indigenous and non-indigenous ascidians. Sequencing Results Ascidan Species Collected Halocynthia pyriformis A, B, E C, F PortAuxBasquesPort-Aux-Basques GGTGCCCAGATATGGCTTTTCCTCGGCTAAATAATATGAGTTTTTGGCT T TTACCTCCAG 300 Botryllus schlosseri LogyBayLogy Bay GGTGCCCAGATATGGCTTTTCCTCGGCTAAATAATATGAGTTTTTGGCT C TTACCTCCAG 300 ************************************************* ********** PortAuxBasques CTTTGTTTATGTTATTGTTGTCTTCAGTTATTGAGAGTGGGGTAAGGACAGGTTGGACAG 360 LogyBayPort-Aux-Basques CTTTGTTTATGTTATTGTTGTCTTCAGTTATTGAGAGTGGGGTAAGGACAGGTTGGACAG 360 Logy Bay ************************************************************ A, B, C PortAuxBasquesPort-Aux-Basques TTTATCCCCCATTGTCTGGAAATTTAGC T CATTCTAGGCCTGCATTGGACTGTGCTATTT 420 LogyBayLogy Bay TTTATCCCCCATTGTCTGGAAATTTAGC A CATTCTAGGCCTGCATTGGACTGTGCTATTT 420 Halocynthia pyriformis Didemnum albidum **************************** ******************************* G, I, J, K, M H. pyriformis were sequenced from two geographic locations on opposite sides of NL. A, D, E We obtained the sequence of a 709 bp region of the Cox I genome and these sequences can now be found in GenBank. B The sequences of H. pyriformis from the 2 locations differed by only a single base pair Botryllus schlosseri substitution at 2 loci (290 bp & 389 bp, yellow boxes). Botwood C These were neutral substitutions as both base pair sequences coded for the same Corner Brook Boltenia echinata amino acid. Ascidian collection sites Asterisks (*) indicate base pairs that are identical among the two sequences shown. Quadrat collection sites D, E Molgula citrina Blast Search Results Port-Aux-Basques G D B, D, E L N A K C E Argentia J H I Ascidia callosa M F Aplidium glabrum Fig. 1: The four harbours we are surveying (red squares) are Port-aux-Basques, Corner Blast results from H. pyriformis sequences indicate that H. pyriformis has an 85% match Brook, Botwood & Argentia, where quadrat samples and visual & photographic surveys to H. roretzi and an 81% match to H. papillosa. were taken. The quadrat samples were scraped by hand from inside a 0.25 x 0.25 m frame, and all organisms retained on 1000 µm mesh identified and counted. Green squares mark locations at which ascidians were collected in addition to our routine harbour surveys. Ascidian Phylogenetic Tree Botryllus schlosseri is the only non-indigenous species found to date in Newfoundland. 55 coxI (Amaroucium stellatum) We inserted our H. pyriformis CoxI 99 coxI (Aplidium nordmanni) sequence into the phylogenetic tree of Stach coxI (Clavelina lepadiformis) 55 Quadrat Abundance Data 96 coxI (Clavelina picta) and Turbeville (2002) (See figure to the left). coxI (Ascidiella aspersa) The Cox I sequences were aligned using the 71 coxI (Perophora viridis) 82 39 coxI (Polycarpa pomaria) CLUSTAL W alignment mode in AlignX. The 81 coxI (Styela clava) alignment was imported into MEGA version Absent coxI (Botryllus schlosseri) 46 2.1 and the phylogenetic tree constructed. 95 coxI (Halocynthia papillosa) 88 coxI (Halocynthia roretzi) 62 The tree illustrates the high degree of 58 CoxI (Halocynthia pyriformis) affinity with H. roretzi and H. papillosa, and coxI (Molgula occidentalis) coxI (Polyclinum aurantium) also a relatively high degree of overlap with coxI (Branchiostoma floridae) the CoxI sequences of S. clava and coxI (Ciona intestinalis) B. schlosseri. 100 coxI (Didemnum candidum) 80 coxI (Oikopleura dioica) -2 0.1 Absent Animals x m Animals Future Directions As a result of the discovery of B. schlosseri, we are conducting a more intensive survey of several small harbours in Placentia Bay during 2007 to determine the spatial distribution of this potentially invasive species. CoxI sequences will be determined for all species from Figure 1, as well as for Styela clava, Ciona intestinalis, Botrylloides violaceous and Didemnum sp. Species-specific primers will be developed to aid in identification of juvenile and larval ascidians. Fig. 2: Mean (±SD) animal abundance from the quadrat scrape samples. Acknowledgements Depending upon the number of wharves available in each harbour, 'n' varied between 3 & 9 sites per harbour. We would like to thank J. Hall and Dr. M. Rise from the Ocean Sciences Centre, MUN for their help with the molecular methods for this research. In addition, we thank T. Baines, R. Mussels were present and most abundant everywhere except in Argentia (Nov-Dec 2006). Boland, S. Kenny, B. O’Donnell & C. Vickers for their help in the field. SD was ≥ to the mean values, indicating a great deal of patchiness among sites within each harbour. Ascidians were relatively abundant (10-80 m-2), except at Botwood, which contained only mussels..