Metabolic Characterization of Folate Precursor Paba Uncovers Its Folate Independent Activity on Root Growth of Arabidopsis Thaliana

Inaugural-Dissertation zur Erlangung der Doktorwürde der Albert-Ludwigs-Universität Freiburg im Breisgau

Metabolic characterization of folate precursor pABA uncovers its folate independent activity on root growth of Arabidopsis thaliana .

Philip Kochersperger

Institut für Biologie II (Botanik) September 2011 Dekan: Prof. Dr. Gunther Neuhaus Promotionsvorsitzender: Prof. Dr. Samuel Rossel Betreuer der Arbeit: Prof. Dr. Klaus Palme und Dr. Franck Ditengou Kogutachter: Prof. Dr. Thomas Laux Drittprüfer: Prof. Dr. Ralf Reski

Tag der Verkündigung des Prüfungsergebnisses: 04.05.2012

2 I Table of contents

I Table of contents ...... 3 II Figure index ...... 6 III Table index ...... 6 IV Abbreviations ...... 7 V Zusammenfassung auf Deutsch ...... 11 1 Introduction ...... 12 1.1 Abstract ...... 12 1.2 Folates are essential cofactors for almost all living organisms ...... 12 1.3 Folates synthesis in plants ...... 13 1.4 Folates synthesis in plant tissues ...... 14 1.5 Folate biofortification in tomato and rice ...... 14 1.6 pABA metabolism ...... 15 1.7 pABA and other important benzoic acid derivatives ...... 17 1.8 The plant hormone auxin ...... 17 1.9 Definition of auxins based on their molecular structure and bioassays ...... 18 1.10 Definition of auxins based on receptor binding ...... 20 1.11 Auxin transport ...... 21 1.11 The root of Arabidopsis thaliana ...... 22 1.12 Organization of the root apical meristem ...... 23 1.13 Cell files of the Arabidopsis root ...... 24 1.14 Gravity perception and response in the Arabidopsis root tip ...... 25 1.15 Aims of the study ...... 26 2 Results ...... 27 2.1 pABA activity on root growth ...... 27 2.2 EMS mutants resistant to pABA activity ...... 28 2.3 pABA activity compared to auxin activity ...... 30 2.4 Molecular properties of pABA compared to auxins ...... 32 2.5 ADCS is the key enzyme for pABA synthesis in Arabidopsis thaliana ...... 33 2.6 Overexpression of ADCS affects plant development ...... 36 2.7 Sensitivity of ugt75b to pABA ...... 38 2.8 Expression pattern of ADCS, DHPS and UGT75B in roots ...... 39

2.9 IAA activity in lex::UGT75B background ...... 43 3 Discussion ...... 44 3.1 pABA activity depends on the auxin pathway ...... 44 3.2 Anti-auxinic activity of pABA ...... 44 3.3 Auxinic activity of pABA ...... 45 3.4 pABA molecular structure and auxinic properties ...... 46 3.5 The importance of ADCS for pABA synthesis ...... 46 3.6 Overexpression of ADCS results in alteration in plant growth...... 47 3.7 Importance of UGT75B for pABA activity ...... 48 3.8 Role of UGT75B for root growth ...... 48 3.9 Expression domains of genes involved in pABA metabolism ...... 49 3.10 A possible model for pABA activity ...... 51 3.11 Achievements ...... 51 4 Material and Methods ...... 53 4.1 Materials ...... 53 4.1.1 Plant lines ...... 53 4.1.2 Accession numbers ...... 53 4.1.3 Bacterial lines ...... 54 4.1.4 Plasmids ...... 54 4.1.5 Oligonucleotides ...... 55 4.1.6 Molecular biology material...... 56 4.1.7 Chemicals ...... 56 4.1.8 Other materials ...... 58 4.1.9 Devices ...... 58 4.1.10 Programs...... 59 4.1.11 Plant media ...... 59 4.1.12 Bacterial media ...... 60 4.1.13 Buffers and solutions ...... 61 4.2 Methods...... 63 4.2.1 Arabidopsis thaliana seed sterilization ...... 63 4.2.2 Plant growth conditions ...... 63 4.2.3 Extraction of plant DNA ...... 63 4.2.4 Transformation of Arabidopsis thaliana ...... 64 4.2.5 Selection of transformed plants ...... 64 4

4.2.6 Analysis of putative transformed lines ...... 64 4.2.7 RNA extraction from plants ...... 65 4.2.8 GUS staining of Arabidopsis thaliana ...... 65 4.2.9 Root length measurements ...... 65 4.2.10 Measurement of root hair length ...... 65 4.2.11 Count of lateral and adventitious roots ...... 65 4.2.12 Genotyping of the T-DNA insertion lines ...... 65 4.2.13 EMS mutagenesis of Arabidopsis thaliana seeds ...... 66 4.2.14 Identification of pABA resistant EMS mutants ...... 66 4.2.15 Microscopy ...... 66 4.2.16 Preparation of electro-competent E. coli cells ...... 66 4.2.17 Preparation of competent A. tumefaciens cells ...... 67 4.2.18 Transformation of chemically competent E. coli ...... 67 4.2.19 Transformation of competent A. tumefaciens cells ...... 67 4.2.20 Minipreparation of plasmid DNA ...... 68 4.3 Cloning procedures ...... 68 4.3.1 General procedures ...... 68 4.3.2 BP Cloning ...... 68 4.3.3 LR Cloning ...... 68 4.3.4 TOPO Cloning ...... 68 4.3.4 Conventional cloning ...... 69 4.3.5 Cloning of the ADCS promoter ...... 69 4.3.6 Modification of pMDC32 ...... 69 4.3.7 Cloning of the pADCS::CTS::ECFP reporter ...... 70 4.3.8 Cloning procedure of the complete ADCS gene...... 70 4.3.9 Cloning of an EST inducible RNAi expression vector ...... 70 4.3.10 Cloning of the ADCS-RNAi construct ...... 71 4.3.11 Cloning of the 35S::ADCS construct ...... 71 4.3.12 Cloning of pDHPS::GUS ...... 71 4.3.13 Cloning of pUGT75B::NLS3xYFP ...... 71 4.3.14 Cloning of lex::UGT75B ...... 71 5 References ...... 73 6 Acknowledgement ...... 81

II Figure index

Figure 1 Folate synthesis pathway of Arabidopsis thaliana ...... 13 Figure 2 pABA synthesis pathway of E. coli ...... 15 Figure 3 Molecular structure of (a) IAA, (b) pAPAA and (c) pABA...... 18 Figure 4 Auxinic charge separation, exemplified by the molecules BA and TCBA. . 19 Figure 5 Root tip organization of Arabidopsis thaliana ...... 23 Figure 6 Importance of the epidermis for auxin mediated growth...... 25 Figure 7 Activity of pABA on root growth of Arabidopsis thaliana ...... 27 Figure 8 rap mutants displayed pABA / 2,4-D resistant root growth...... 29 Figure 9 Gene model of AUX1 from ATG to TAG (3300 nt)...... 30 Figure 10 Cotreatment of seedlings with pABA and auxin...... 31 Figure 11 Charge separation of auxins compared to pABA...... 33 Figure 12 Importance of ADCS for plant growth...... 34 Figure 13 Rescue of adcs2 mutants by pABA supplementation...... 35 Figure 14 Importance of ADCS for root growth...... 36 Figure 15 Overexpression of ADCS affects plant development...... 37 Figure 16 UGT75B controls pABA activity on root growth...... 39 Figure 17 Functional analysis of ADCS expression ...... 40 Figure 18 Comparison of ADCS and DHPS promoter activity...... 41 Figure 19 Promoter activity of ADCS, UGT75B and DHPS in the root tip...... 42 Figure 20 IAA activity in lex::UGT75B background...... 43

III Table index

Table 1 Name, description and origin of plasmids used in this study...... 54 Table 2 Names, sequences and applications of used oligonucleotides...... 56 Table 3 Stock and working concentrations of used antibiotics...... 61

IV Abbreviations

2,4-D 2,4-dichlorophenoxyacetic acid :: Fused to °C Degree Celsius µF Microfarad µg Microgram µm Micro meter µM Micro molar ADCL Aminodeoxychorismate lyase ADCS Aminodeoxychorismate synthase AM Arabidopsis Medium ARF Auxin response factor AR adventitious roots ATG Start codon AFB Auxin signaling F-Box ABCB ATP Binding Cassette subgroup B ABP1 Auxin binding protein 1 A. tumefaciens Agrobacterium tumefaciens bp Base pairs cDNA complementary DNA CTS chloroplast targeting signal d Day ddH2O Double distilled water dNTPs Desoxyribonukleotidtriphosphate DEPC Diethylpyrocarbonat DHF Dihydrofolate DHPS Dihydropteroate synthase DHFS Dihydrofolate synthase DHFR Dihydrofolate reductase 7

DNA Deoxyribonucleic acid E.coli Escherichia coli ECFP Enhanced cyan fluorescent protein EDTA Ethylendiaminotetraacetat EGTA Ethylenglycolbis(2-aminoethyl)tetraacetat EMS Ethyl methanesulfonate ER endoplasmic reticulum EST estradiol EtOH Ethanol g gram X g X times standard gravity gADCS genomic sequence of ADCS GCHI GTP Cyclohydrolase I GFP Green fluorescent protein Gent Gentamicin Glc Glucose

GUS b-Glucuronidase h Hours Hyg B Hygromycin B

H2O water e.g. exempli gratia (for example) IAA Indol-3-acetic acid Kan Kanamycin kb Kilobase KDEL Lys-Asp-Glu-Leu kV Kilovolt L Liter LR Lateral roots M Molar M1 1st generation after EMS treatment 8

M2 2nd generation after EMS treatment MeOH Methanol MES 4-Morpholineethanesulfonic acid sodium salt mABA meta aminobenzoic acid mRNA messenger Ribonucleic acid mg Milligram min Minute ml Milliliter mM Millimolar MS salt Murashige & Skoog Medium Basal Salt Mixture ng Nanogram NTD Neural tube defects NAA 1-naphthaleneacetic acid NLS nuclear localization sequence NPA Naphthylphthalamic Acid OD Optical density oABA ortho-aminobenzoic acid PCIB p-chlorophenoxyisobutyricacid pADCS Promoter of ADCS pABA para-aminobenzoic acid pAPAA para-aminophenylacetic acid pADCS Promotor of ADCS PCR Polymerase chain reaction pH -log[H+] PIN PIN FORMED PLT Plethora Q Glutamine QC Quiescent center rap resistant against pABA Rif Rifampicin 9

RAM root apical meristem RNA Ribonucleic acid RNAi RNA interference rpm Revolutions per minute RT PCR Reverse transcriptase PCR s Second SCF SKIP1 cullin F-Box protein TFIBA 4,4,4-Trifluoro-3-(indole-3) butyric acid TAG Stop codon TCBA 2,3,6 Trichlorobenzoic acid T–DNA Transfer –DNA TAE-buffer Tris/Acetic acid/EDTA-buffer TE-buffer Tris/EDTA-buffer THF Tetrahydrofolate TIBA Triiodobenzoic acid TIR1 Transport inhibitor response 1 U Unit UTR Untranslated region V Volt WT Wild type Col Columbia-0 Ler Landsberg YFP yellow fluorescent protein x times

V Zusammenfassung auf Deutsch Die hier präsentierte Doktorarbeit charakterisiert eine bisher unbekannte Aktivität von p-Aminobenzoesäure (pABA), einer Vorstufe der Folsäure, und begründet damit eine neue Denkweise über den klassische Folsäuresyntheseweg. Die Zugabe von pABA zu Keimlingen von Arabidopsis thaliana bedingt eine Verminderung des Wurzelwachstums, eine Zunahme von Lateral- und Adventivwurzeln, eine Induzierung des Wurzelhaarwachstums und ein hypergravitropische Wurzelwachstum. Da diese Phänotypen ähnlich zu der Behandlung mit dem Pflanzenhormon Auxin sind, wurde die Interaktion von pABA und Auxin im Zuge des Wurzelwachstums untersucht. Interessanterweise besitzt pABA selbst eine Auxin ähnliche Aktivität, da die pABA Resistenz bestimmter Auxin- mutanten und weitere physiologische Experimente dies implizieren. Zudem gehört pABA der Molekülgruppe der Benzoesäurederivaten an, die aufgrund ihrer chemischen Grundstruktur bereits zahlreiche bekannte Auxine beinhaltet. Diese Doktorarbeit zeigt, dass das Wurzelwachstum sowohl durch appliziertes als auch durch pflanzlich produziertes pABA beeinflusst wird, was eng verbunden mit dem Auxin Reaktionsweg und unabhängig von Folsäure stattfindet. Appliziertes pABA inhibiert die Aktivität des natürlichen Auxins Indol-3-essigsäure auf die Wurzel. Die native Aktivität von pABA wirkt daher sehr wahrscheinlich auch auf das Pflanzenhormon Auxin, das in seiner Aktivität beeinflusst wird. Diese Resultate wurden durch die genetische Charakterisierung des Metabolismus von pABA generiert, welche die pABA-Synthese, pABA-Veresterung und pABA- Fusion zu Folsäure umfasste. Im Zuge dessen konnte auch die lang erwartete Wichtigkeit des Folsäuresynthesewegs für das generelle Wurzelwachstum gezeigt und zudem die Rolle der pABA-Veresterung, welche bislang als nicht essentieller pABA-Speicher angesehen wurde, neu definiert werden. Die pABA-Veresterung ist die wichtigste Kontrollinstanz, die die Aktivität von pABA in der Wurzel reguliert. Interessanterweise scheint die Wurzelepidermis das Schlüsselgewebe für die Aktivität von pABA zu sein, welche das Hauptwurzelwachstum, den Wurzelgravitropismus sowie das Wurzelhaarwachstum von Arabidopsis thaliana beeinflusst.

1 Introduction

1.1 Abstract Folates are essential cofactors acting as carrier of one carbon units during enzymatic reactions. The importance of folates is very well established for animal and human development, but remains uncharacterized in plants, the main source of folates. This study demonstrates, that the folate precursor pABA, besides its canonical role in folate biosynthesis, acts as a regulator of root development in Arabidopsis thaliana . When exogenously applied, pABA promotes root hair growth, lateral and adventitious root development while it inhibits main root growth. In addition, pABA treated plants display a hypergravitropic root response. Importantly, tetrahydrofolate, the final product of folate biosynthesis has none of these activities. Endogenous pABA levels are under strict control of UGT75B , which encodes a pABA glycosyltransferase. Overexpressing this gene results in dramatic root growth defects, which can be rescued by exogenous pABA. Conversely, down regulating UGT75B renders plants hypersensitive to pABA. Taken together, this study introduces pABA as a novel regulator of plant growth and also demonstrates for the first time the requirement for de novo synthesis of folates in roots. Finally, this data preclude for a relationship between pABA activity and auxin homeostasis in plants.

1.2 Folates are essential cofactors for almost all living organisms Tetrahydrofolate (THF) and its C1 substituted derivatives (summarized as folates) are important coenzymes for the transfer of C1 units (C1 metabolism) in almost all living organisms 1. Such reactions are crucial for synthesis of purines, certain amino acids and other important compounds 1. Importantly animals and therefore humans cannot synthesize folates de novo and depend on a dietary uptake from plants, fungi or bacteria. The most prominent folate deficiency in humans manifests as neural tube defects during embryo development, but also several other diseases are noteworthy like megaloblastic anemia, cardiovascular diseases, and some cancers 2-5. Increasing folate intake during pregnancy decreases the chance for neural tube defects markedly 6. The recommended dietary intake of folates for adults is 400µg/d 3 and 600µg/d 3 for pregnant women, which is mainly achieved through plant food.

In developed countries folate deficiency diseases have been mainly overcome by fortification of grains with folic acid 7. However this strategy might be more difficult to apply for less developed countries, due to infrastructural and financial concerns. Therefore folate research in plants focused in the past on elucidation and modulation of genes controlling folate biosynthesis to genetically increase the folate content of important food plants, to fortify folate already in the plant (biofortification) 8. Those approaches were successful by engineering folate biosynthesis and resulted in tomato, rice and lettuce cultivars with increased folate content 9-11 .

1.3 Folates synthesis in plants The folate synthesis pathway in plants has been almost completely uncovered and involves three different cellular compartments1 (Figure 1). The pterin moiety is synthesized via four enzymatic steps in the cytoplasm from GTP starting with the GTP-Cyclohydrolase I (GCHI) 12 .

Figure 1 Folate synthesis pathway of Arabidopsis thaliana . pABA and THF are indicated in bold letters. Unknown functions are shown as dotted arrows.

The pABA moiety is synthesized from chorismate by aminodeoxychorismate synthase (ADCS) and aminodeoxychorismate lyase (ADCL) in pastids 13,14 . Both precursors are imported into mitochondria and fused by dihydropteroate synthase (DHPS) to dihydropteroate 15 , which is then glutamylated to dihydrofolate (DHF). This step is catalyzed by the dihydrofolate synthase (DHFS) and is the only enzymatic 13 step of folate biosynthesis characterized at genetic level: knockout mutants of DHFS display an embryo lethal phenotype, with a growth arrest at the globular stage 16 . The last step of folate biosynthesis comprises the reduction of DHF to THF, which is catalyzed by dihydrofolate reductase (DHFR), an enzyme encoded in Arabidopsis by three genes. The existence of these three homolog genes is exceptional, since all other enzymatic steps before THF-biosynthesis are predicted to be encoded by single genes, hindering further genetic characterization of the pathway 1. After synthesis of THF up to approximately six glutamate residues can be added 1. Polyglutamation of THF enhances its metabolic usage, while monoglutamyl forms of THF are good substrates for folate transporters 17 . Recently the importance of folate polyglutamation has been demonstrated for root growth. A mutant, defective in this step, showed impaired root growth, disturbance of post embryonic quiescent center (QC) organization and a general decrease of certain amino acids and nucleotides content 18 .

1.4 Folates synthesis in plant tissues Since folates are crucial coenzymes for biosynthesis of certain nucleotides, a high folate content might be expected for actively dividing tissues. Green leaves were reported to have the highest folate content in plants, and folates are also reported as important cofactors during the photorespiration 19 . Since it was unclear for other dividing tissues, whether folates were produced or imported, studies to determine the expression of certain folate synthesis enzymes were conducted. It was shown that folate content of tissues is correlates with expression level of DHPS , postulating that folates are synthesized in all meristematic tissues including roots 20 . However genetic characterization to confirm the importance of expression of folate synthesis genes in those tissues is still to come. Interestingly, while QC cells, display a very low division rate, they seem to be an active spot of folate biosynthesis since several folate biosynthetic genes are found expressed there 21 . This result suggests folate biosynthesis to occur in distinct cells within a tissue.

1.5 Folate biofortification in tomato and rice The first attempt to raise folate content of plants aimed to increase folate biosynthesis by overexpressing the mammalian GCHI gene in tomato fruits 22 . In mammals, this enzymatic function is used for production of tetrahydrobiopterin.

Mamalian GCHI was chosen in order to avoid possible feedback regulation of plant GCHI by folate. GCHI overexpressing plants displayed at best 4 times folate increase in tomato fruits 22 . Subsequently it was elaborated that only overexpression of the enzymes ADCS and GCHI together resulted in a 19 times increase of folate content in tomato fruits 9. Importantly it was noted that folate production ceased in developing tomato fruits whenever ADCS transcripts were present in low amount suggesting the importance of the of ADCS and GCHI genes as checkpoints for the regulation of the folate pathway. Up to now the plant tissue with the highest folate content was engineered by Storozehnko and collaborators 10 , for which the simultaneous GCHI/ADCS overexpression produced rice grains with a total folate content of 1723µg/100g. This would represent enough folate for human nutrition solely from this source 10 . It was noted that overexpressing ADCS alone led to increased pABA content but with negligible increase in folate content in developing tomato fruits as well as in rice grains 9,10 . Such single overexpression of ADCS did not result in any visible phenotypic alteration 9,10 .

1.6 pABA metabolism Both characterized pABA synthesis genes in plants (ADCS and ADCL) were identified based on BLAST searches of sequence databases with the corresponding protein sequences of Escherichia coli (E. coli) 13,14 . Bacteria possess three genes encoding three enzymatic functions, needed for pABA synthesis from Chorismate: PabA, PabB and PabC (Figure 2).

Figure 2 pABA synthesis pathway of E. coli . In plants the PabA-PabB enzymatic functions are fused to ADCS and PabC is catalyzed by ADCL. Picture from Basset et al 13 .

PabA encodes a glutamine amidotransferase, while PabB catalyzes the conversion of chorismate to aminodeoxychorismate (ADC). In E.coli these enzymes work together in a complex and use glutamine to form ADC 23 (Figure 2). PabC, an aminodeoxychorismate lyase catalyzes the conversion of ADC to pABA and pyruvate (Figure 2). In plants the mechanism for conversion of chorismate to pABA is similar, however the bacterial PabA and PabB enzymatic functions are performed by the one protein encoded by the ADCS gene (AT2G28880)24 . The PabC function is encoded by the ADCL gene (AT5G57850)14 . Their function for pABA synthesis has been validated by complementing bacterial pab null mutants 12,13 . Both plant enzymes might be encoded by single genes and are therefore believed to result in a lethal embryo phenotype when knocked out. This was, at least for ADCS, strengthened by the fact that ADCS was identified as a candidate gene in a screen for embryo lethal genes in Arabidopsis 25 . However this was not further validated by a genetic complementation. Both enzymes, ADCS and ADCL possess a chloroplast targeting signal and are located in plastids 12,13 . This plastid localization was expected because chorismate, the precursor of pABA is produced through the shikimate pathway in plastids. It is important to note that pABA can be recognized already as a special molecule in the folate biosynthesis pathway, since it is the only compound, which is reversibly glycosylated 26 . The importance of pABA glycosylation is not clear, since disruption of UGT75B (AT1G05560), the main pABA glycosyltransferase, does not result in a phenotypic alteration 27 . However, such plants still contain pABA-Glucose, but at low concentration, suggesting the existcence of a second gene encoding another functional pABA-Glucose synthase. It was also noted that besides the main conjugation to glucose, there are also other conjugated forms of pABA, especially in Arabidopsis 26 . The level of pABA-Glucose varies between plant species and plant tissues, but in general it can be stated that 80% of pABA is conjugated, while 20% is free in native conditions 26 . It was shown, that applied pABA doses are readily taken up by plant pericarp and leaf tissues and are conjugated by a quick, saturable mechanism 26 . Since a clear clue for pABA-Glucose function is missing, it has been suggested as a storage form of pABA, which might be used upon high needs of folate by a yet unidentified esterase 26 .

Before the biochemical identification of UGT75B as the main enzyme for pABA esterification, UGT75B has been shown to be present in the cell plate during cytokinesis, interacting with the callose synthase complex 28 . If and how these results are connected to the pABA-glucose forming activity of UGT75B remains open. Furthermore, pABA has been identified as a substrate for the enzyme GH3.12, which catalyzes the conjugation of pABA and glutamate 29 . This finding is particularly interesting, since pABA-glutamate has been reported in plants, but is believed to result only as a breakdown product of THF 30 . However it is unknown, if the enzymatic activity of GH3.12 is relevant for pABA metabolism in vivo.

1.7 pABA and other important benzoic acid derivatives pABA is a member of the benzoic acid family, which is implicated in various processes in plants. All benzoic acid derivatives have the same origin in plants, the shikimate pathway 31 . The shikimate pathway represents a primary metabolism pathway, which uses the compounds phosphoenolpyruvate and Erythrose-4- phosphate to build up via six enzymatic reactions chorismate 31 . Chorismate is the connection point of primary and secondary metabolism, since it is used for the production of the amino acids phenylalanine, tyrosine and tryptophan, but also for the production of pABA and p-hydroxybenzoate 31 . Through these chorismate metabolites a vast array of secondary compounds is synthesized, highlighted through the plant hormones auxin and salicylic acid, flavonoids, a range of plant volatiles and folates 31 . The synthesis of auxin involves ortho amino benzoic acid (oABA), an isomer of pABA, which is built after the first synthesis step towards auxin. Interestingly, applying oABA to Arabidopsis seedlings induces auxin biosynthesis as well as auxin related phenotypes 32 , while supplementing tryptophan does not 33 . The importance of these results for auxin biosynthesis in plants in general has not yet been investigated, however it is known that auxin is synthesized in plants via tryptophan depended and independent pathways 34 .

1.8 The plant hormone auxin The initial auxin experiment was done by Charles Darwin, who postulated a mobile signal which induces the bending of plant coleoptiles towards a light source 35 . 50 years later a name 36 and the molecular identity of this mobile signal were found: auxin (indol-3-acetic acid)37 . At that time the Cholodny Went theory was formulated,

17 which states in its original form that : „Growth curvatures are due to an unequal distribution of auxin between the two sides of the curving organ. In the tropisms induced by light and gravity the unequal auxin distribution is brought about by a transverse polarization of the cells, which results in lateral transport of the auxin” 37 . The elucidation of molecular players regulating auxin synthesis 38 , auxin transport 39-41 and auxin signaling 42 finally confirmed the Cholodny Went theory. Today auxin is believed to play a role in every developmental process in plants, representing therefore one of the most important hormones in the plant world.

1.9 Definition of auxins based on their molecular structure and bioassays Despite the fact that indole-3-acetic acid (IAA) is the most important natural auxin 43 (Figure 3a) , the term „auxin“ covers also a lot of other molecules. A useful physiological definition for an auxin is „a molecule that prompts plant responses qualitatively similar to those elicit ed by IAA“ 44 , which is true for quite a number of compounds. In the past, hundreds of benzoic acid derivatives, besides other classes of molecule, were tested for auxin activity in classical auxin bioassays 45 . One classical auxin bioassay uses Avena coleoptiles, where putative auxins were tested mainly for their potential to induce an elongation of coleoptiles sections. pABA itself, as well as its isomers oABA and meta-aminobenzoic acid (mABA), were also tested and displayed no activity on the elongation of Avena coleoptiles 46,47 . The structurally closest compound to pABA which displayed auxin activity in the Avena coleoptile bioassay is para-aminophenylacetic acid (pAPAA) 47 which, compared to pABA, contains an additional CH 2-group between the carboxyl group and the benzene ring (Figure 3b, c).

a b c

Figure 3 Molecular structure of (a) IAA, (b) pAPAA and (c) pABA.

However the auxinic activity of pAPAA is 20 times lower than IAA and therefore very weak 47 . A common motif for a lot known artificial and natural auxins is the presence of a benzene ring, often as an indole ring, in the structure of the molecule. This ring structure represents the lipophilic basic structure of every auxinic molecule, crucial for the ability to diffuse across membranes. The character of all auxinic compounds and their auxinic strength has been attributed to the presence and position of side groups at the benzene/indole ring. Almost all auxins possess a carboxylic group which represents a strong negative charge 45 . In addition, it was suggested that active auxins possess at a 0,5 –0,55nm distance from the carboxylic group, a weakly positive charged area 48,49 . Disrupting this positive charged area by changing the side groups results in loss of auxin activity 50 . This theory is very well exemplified comparing benzoic acid, a substance which does not have any auxinic activity and 2,3,6 Trichlorobenzoic acid (TCBA), a derivative of benzoic acid with high auxin activity 49 (Figure 4). The chloride atoms in the 2, 3 and 6 position at the benzene ring withdraw electrons from the benzene ring and generate thereby a positively charged area at the 4 position (Figure 4b). This position lays 0,55nm apart from the carboxylic group, generating the auxinic charge separation 49 .

Figure 4 Auxinic charge separation, exemplified by the molecules BA and TCBA. Molecular structure of (a) benzoic acid and (b) TCBA. The weak positive charge is indicated by a „+“ , which is 0,55nm distant from the carboxylic group.

Today physiological experiments are mainly conducted using the auxins IAA, 1- naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D), since they represent the best characterized auxins. However there are differences observable when Arabidopsis seedlings are treated with these auxins in terms of lateral root development 34 and gene expression 51 , which might be explained by different 19 transport and/or metabolization. IAA is the main natural auxin and is therefore a target for inactivation processes as well as auxin transport processes in the cell. NAA can also be metabolized, but is only a substrate for auxin efflux carriers, but not for influx carriers 52 . Finally 2,4-D can be transported by auxin influx carriers, but not by auxin efflux carriers and is therefore accumulating in cells 52 .

1.10 Definition of auxins based on receptor binding With the molecular identification of the auxin receptor in Arabidopsis, a second approach for the classification of auxins arose: the ability to bind TIR1, the auxin receptor 53,54 . tir1 (transport inhibitor response1 ) was found by screening for mutants resistant to the auxin transport inhibitor Naphthylphthalamic Acid (NPA)55 . Auxin transport inhibitors trap auxin inside the cell by inhibiting auxin efflux. The tir1 mutant can therefore be considered as resistant to auxin and it was subsequently shown that TIR1 is a component of the SCF-complex, which marks transcriptional repressors (AUX/IAAs) with ubiquitin for proteolytic degradation. Once AUX/IAA repressors are degraded, the auxin transcription factors (ARF) can modulate auxin mediated transcription. The breakthrough in the understanding of auxin signaling came, when it was shown that auxin itself binds to TIR1 and activates the SCF complex for the ubiquitination of AUX/IAA proteins 53,54 . Together with the natural auxin IAA, the binding of NAA and 2,4-D to TIR1 was tested. It was shown that all 3 auxins could bind to TIR1, although 2,4-D bound with a lower efficiency than IAA 53,54 . The weaker affinity of 2,4-D to TIR1 might be counterbalanced since 2,4-D is not a substrate for auxin efflux processes and is accumulating in cells in higher levels compared to IAA 52 . Hence, 2,4-D has the strongest auxin activity, but conversely binds to TIR1 with the lowest affinity. TIR1 was the first discovered member of the auxin receptor family, which comprises until now 6 members (TIR1 AFB1-5). Initially it was believed that this TIR1 family comprised 4 members (TIR1 AFB1-3), which collectively regulate the response to IAA and 2,4-D56 . The quadruple mutant tir1afb1-3 is highly resistant to IAA and 2,4D and displays severe growth phenotypes from the embryo stage on 56 . However a surprising finding was the identification of AFB5. The afb5 mutant was selected based on its resistance to the artificial auxin picloram, while displaying normal sensitivity to IAA and 2,4D 57 . This work suggested for the first time that there

20 might exist certain specificity between auxins already at the receptor level; however the demonstration that natural auxins can bind AFB5 is still to be made. The TIR1AFB1-5 pathway is believed to govern the transcriptional responses following auxin perception. However there are many other physiological auxin responses which are too fast and which presumably do not require gene expression. For those quick responses, the ABP1 protein was proposed as an auxin receptor. ABP1 was first discovered in corn coleoptiles because of its strong binding capacity to auxin 58 . ABP1 has a KDEL motif important for endoplasmic reticulum (ER) retention and is found mainly localized to the ER, but it is also present in the cell wall, closely associated to the cell membrane 59 . Assigning a clear role to ABP1 in relation to auxin response was always challenging, since abp1 knockout mutants in Arabidopsis are embryo lethal 60 . However, the knockout mutant of ABP1 already suggested the importance of ABP1 for cell elongation 60 . Recently ABP1 function was connected to auxin transport, since it was shown that auxin regulation of PIN internalization involves the ABP1-mediated signaling pathway 61 . This work provided the support for ABP1 as auxin receptor for non-transcriptional dependent auxin signaling activities.

1.11 Auxin transport From the beginning of auxin research, the transport of auxin has been an important component of its biology. It was shown that auxin moves within a plant tissue by a velocity which is faster than simple diffusion, but slower than a phloem based transport 62 . Later it was elaborated that auxin is transported between cells by a combination of membrane diffusion and carrier-mediated mechanisms 52 . The ability of auxin to diffuse across membranes is based on its nature as a weak acid. In the apoplast, the pH is slightly acidic (pH 5 to 5,5). In this environment the carboxyl group of the IAA molecule is protonated and IAA can, free of charge, diffuse across the cell membrane. In contrast the cytosolic pH (around pH 7,2) leads to deprotonation of IAA and to the loss of ability to diffuse across membranes 63 . Because of this weak acid characteristic of IAA, the direction of auxin transport within a tissue can be governed by the cellular localization of the auxin efflux proteins. The first discovered molecular component of the auxin efflux machinery was the PIN1 protein 64 . pin1 mutants develop naked, pin-shaped inflorescences, a phenotype which can be phenocopied by NPA 65 . Subsequently it was shown that PIN1 localizes

21 polarly in tissues pointing in the direction of auxin flux 64 . The direct involvement of PIN proteins in auxin transport has been shown through their expression and auxin transport studies in heterologous systems like yeast 66 . PIN1 was the first discovered member of the PIN gene family, comprised out of 8 members (PIN1-8). Every PIN protein is conducting a specific function during plant development, however it was noted that PIN proteins can to some extent be functionally redundant 67 . A broader summary of the function of specific PIN proteins will be described later (section 1.13 and 1.14). A second group of efflux carriers are the ABCB transporters (ATP Binding Cassette subgroup B). There are 21 members of this gene family in Arabidopsis, ABCB1, 4 and 9 participate in auxin transport. ABCB proteins do not show specific polar localization (like PIN proteins) and are therefore believed to simply regulate auxin levels in individual cells. For example ABCB4, present in root hair cells, regulates auxin level during root hair growth 68 . However when ABCB and PIN proteins are coexpressed in plant tissues, they colocalize and function synergistically in polar auxin transport 69 . Besides the molecular components for cellular auxin efflux, plants also possess auxin influx carriers. The influx carrier AUX1 was found during a screen for mutants resistant to the artificial auxin 2,4-D, because aux1 mutants cannot import 2,4-D efficiently 40 . Furthermore grow aux1 mutant roots agravitropic, highlighting the importance of AUX1 for root gravitropic response 40 . Auxin resistance of aux1 mutants is specific for auxins such as IAA and 2,4-D, because the aux1 root phenotype can be rescued through the application of NAA 40 . These experiments elegantly confirmed the auxin transport data for IAA, NAA and 2,4-D from protoplasts, which stated that IAA is a substrate for auxin influx as well as efflux carriers, NAA enters the cell only by diffusion but is a substrate for efflux, while 2,4-D is only a substrate for influx carriers 52 .

1.11 The root of Arabidopsis thaliana The Arabidopsis root is an excellent model system to study developmental processes since it provides, related to its small size, an easily accessible system for quantitative measurements as well as for microscopical analysis. The root of Arabidopsis can be classified in four distinct tissues 70 . The basal end of the root is the root cap, a specialized tissue for gravity perception and protection of

22 the root apical meristem (RAM). The root cap is followed by the cell division zone, where the cells which later build the whole root originate. Root elongation takes place in the so called “elongation zone ”, in which elongating cells represent the driving force for root growth. After the completed cell elongation, the root cells acquire their final shape and function in the cell differentiation zone. The beginning differentiation zone can be visibly classified by emerging root hairs, specialized root epidermal cells, facilitating nutrient uptake.

1.12 Organization of the root apical meristem The organization of the root apical meristem in Arabidopsis thaliana is relatively simple and is made out of a few distinct cells and cell files (Figure 5).

Figure 5 Root tip organization of Arabidopsis thaliana . Picture from Petricka et al. 71

Setup and functionality of the RAM is regulated by the quiescent center (QC), a set of four specialized cells in the root meristem center, (Figure 5 white cells). QC cells are undifferentiated and are surrounded by stem cells, progenitors of the future specialized root tissues. The QC maintains a stem cell state in adjacent cells 72 . Auxin is an important player to maintain QC identity. It was shown that the QC is the focalizing point for auxin transport 73 , but IAA is also directly synthesized in the QC 38 . Altogether, both transport and local synthesis lead to a higher IAA concentration in

23 the QC when compared to the surrounding tissues 74,75 . PLETHORA transcription factors represent important players, required for stem cell specification and maintenance in the RAM, whose transcription is stimulated by auxin and is dependent on ARF transcription factors 76 . Double mutants of PLETHORA genes (plt1plt2 ) display an abnormal QC and occasionally arrested roots, a phenotype which is further increased in the triple mutant ( plt1plt2plt3 ), which is rootless 77 . Ectopic expression of PLT genes produces roots from the shoot apex, which suggested PLETHORA genes as master regulators of root meristem identity 77 .

1.13 Cell files of the Arabidopsis root Stem cells surrounding the QC can be distinguished according to the cell file they initiate. The inner tissue of the root, the stele, originates from several stem cells apically to the QC. The progeny of these founder cells later maturate into phloem and xylem. The stele is marked by high expression of the auxin efflux carrier PIN1 64 and is framed by pericycle cells from which lateral roots originate; specifically in those pericycle cells in contact with the xylem pole 78 . It was recently shown, that the signaling cascade resulting in lateral root development is initiated in the underlying protoxylem cells, in which the earliest observable event is a PIN1 relocalization 79 . The pericycle is followed by the endodermis, which contains the casparian strip, a cell wall located diffusion barrier. In stele, pericycle and endodermis PIN1 protein is present and localized basally, directing the auxin flux towards the QC 39 . PIN2 is the predominant PIN protein in the two outer cell files, the cortex and epidermis, is PIN2. PIN2 is localized basally in the cortex and apically in the epidermis, maintaining an auxin flux towards the QC in the cortex and auxin flux away from the QC in the epidermis 39 (described in section 1.14). The control of root elongation, as well as the elongation of other tissues, is believed to be dependent on the epidermis. It has been physiologically very well described, that the epidermis differs to underneath tissues in terms of auxin activity 80 ,37 . Bisected hypocotyls, cut longitudinally, curve outwards in water, but curve inwards after auxin application (Figure 6). This result indicates that auxin has a higher activity on the epidermis compared to the inner tissues. Consistently, removing the epidermis in such samples, impairs the auxin control of the bending 80 (Figure 6). Interestingly, direct quantification of auxin in the epidermis revealed very low levels of auxin compared to other tissues of the Arabidopsis root 75 , pointing towards high sensitivity

24 of the epidermis to auxin. The molecular basis for this higher auxin sensitivity of the epidermis is unknown 81 .

Figure 6 Importance of the epidermis for auxin mediated growth. Longitudinal fragments of maize coleoptiles exposed to water (-IAA) or IAA (+IAA), with (+OEW) or without (-OEW) epidermis. The outer surface of the coleoptiles points to the left. Picture from Kutschera et al. 80

1.14 Gravity perception and response in the Arabidopsis root tip Since the very first auxin experiments, auxin transport has been implicated to tropic growth processes. Since roots grow in dark environment the direction of root growth is governed by factors like water content, nutrient availability and gravity vector. Since it is not trivial to setup experiments with different water and nutrient availabilities in the medium and to interpret root response by a quantitative readout, the research has been focused mainly on root response to gravity. Gravity can be considered as a constant force, whose direction is changeable by simply turning the plants. Root growth adjustment according to a new gravity vector involves several specialized root tissues. Gravity perception occurs within the columella, which contains amyloplasts. These are plastids containing starch grains called statoliths which sediment according to the gravity vector and may trigger through their physical 25 force the cellular response 82 . The columella consists out of 4 layers of columella cells, which originate from the columella stem cells underneath the QC. The two first layers of the columella are from great importance for the gravity perception, since their laser ablation turns the root gravity-insensitive 83 . The signaling cascade following sedimentation of statoliths is not known, however it is hypothesized that calcium levels, pH and membrane potentials are modulated 82 . The earliest known affected molecular process after sedimentation of starch grains is a change of PIN3 localization in columella cells according to the gravity vector, thus redirecting the auxin flow 41 . This redirection is believed to result in different auxin levels on either side of the root, which induces differential growth of the meristem and thereby its reorientation according the gravity vector 42 Auxin is then believed to be transported apically in the epidermis by PIN2, into the elongation zone 39 . PIN2 in the root epidermis represents therefore the long expected auxin transport function important for a bending tissue. This mechanism can be seen as a model mechanism for every tropic growth in plants and was confirmed to be active in hypocotyls, where PIN2 activity is provided by PIN3 84 .

1.15 Aims of the study The aim of this Ph. D. work is to characterize the role of folate precursor pABA on plant development. For this purpose, the importance of pABA synthesis was validated in plants using classical mutant analysis approaches. Furthermore, as folates are needed in potentially every cell throughout the plant, this study also aimed to elucidate whether tissue specific pABA synthesis and thereby folate synthesis could regulate plant development.

2 Results

2.1 pABA activity on root growth This work originated from a screening for novel chemical compounds regulating root growth that were based on the structure of benzoic acid (BA). Many derivatives of BA act on the auxin pathway, e.g. the auxin transport inhibitor TIBA 85 , which induces agravitropic root growth in Arabidopsis thaliana . This assay was used as well to evaluate the activity of several chemical compounds, which revealed pABA as growth modulator (Figure 7b).

Figure 7 Activity of pABA on root growth of Arabidopsis thaliana . (a) Dose-response relationship between pABA concentration and main root length. (b) Seedlings growing on control medium, and medium supplemented with pABA, THF and

TIBA. (c) The inhibition of root growth by 100µM Sulfanilamide (Sulf) is reversed by THF and pABA. (d) pABA enhanced main root-gravitropic response after 3h rotation to 135°. (e) Emerged LR and AR abundance is increased in seedlings 6 dag on pABA supplemented medium. (f) pABA (200µM) treatment led to increased root hair length (f). Scale bars represent (b) 0,5cm and (f) 500µm. Used concentrations are 100µM pABA, 100µM THF and 10µM TIBA, if not stated otherwise.

Based on root length inhibition, 100µM pABA appeared as the optimal and reasonable concentration of pABA sufficient to elicit root growth phenotypes (Figure 7a). At this concentration, root length is not only inhibited but also displayed a straight growth behavior in contrary to untreated seedlings, which displayed a wavy root growth pattern (Figure 7 b). THF, the final product of pABA’s metabolic pathway, did not phenocopy the activity of pABA (Figure 7b). Importantly, both compounds (THF and pABA) were taken up and metabolized by the root with the same efficiency, since both compounds could rescue roots growth arrest induced by the folate synthesis inhibitor sulfanilamide (Sulf) (Figure 7c). Sulfanilamide blocks the enzymatic fusion of pABA and Pterin to form dihydropteroate 86 , hence stopping folate production. The slight root length increase observed for THF-supplemented seedlings might reflect the advantage of saving the energy to synthesize folates (Figure 7c). pABA treated seedlings exhibited a straight root growth, which went together with a faster response to gravity, indicated by the root tip reorientation according to the gravity vector (Figure 7d). Furthermore led pABA to an increased number of emerged lateral (LR) and adventitious roots (AR) (Figure 7e). At 200µM, pABA increased root hair length (Figure 7f) Once again, these phenotypes could not be phenocopied by THF supplementation (Figure 7d, e). pABA and the auxin transport inhibitor TIBA showed opposite activities on root growth (Figure 7). PABA induced straight roots growth while TIBA treated roots grew agravitropic (Figure 7b). To characterize the mode of action of pABA, an EMS screening for pABA resistant mutants was conducted.

2.2 EMS mutants resistant to pABA activity Screening for pABA resistant EMS mutants was based on root growth of Arabidopsis thaliana seedlings. Since pABA induces hypergravitropic, straight root growth, plants 28 showing agravitropic, waving or slanting root growth on pABA supplemented agar plates were selected. Six pABA resistant mutants were identified, which were named rap mutants for resistant against pABA . rap2 and rap 7 mutants showed a weak resistance, while rap5 , rap8 and rap10 displayed a complete resistance to pABA induced straight root growth (Figure 8). rap1 was highly resistant to pABA, showing WT-like waving root growth in presence of pABA (Figure 7). All mutants displayed the mendelian 1:3 ratio for segregation, which implies that the phenotype is caused by a mutation in a single gene (data not shown). Importantly, rap1 mutants could be only maintained heterozygous, since homozygous rap1 mutants displayed a general severe growth reduction and are characterized by sterile flowers (data not shown).

Figure 8 rap mutants displayed pABA / 2,4-D resistant root growth. Root phenotype of certain rap mutants is shown on AM, pABA and 2,4-D supplemented media. Note that rap1 is heterozygous and that all mutants display a certain pABA / 2,4-D resistant root growth behavior. rap5 , rap6 and rap10 displayed strong-agravitropic root growth and no other visible phenotype (Figure 7, 1 st row), reminding for mutants of the auxin influx carrier gene aux1 40 . In addition, aux1 mutants are also resistant to pABA induced straigth root growth (data not shown). As a first attempt to identify the gene disrupted in rap5 ,

29 rap6 and rap10, an allelism test cross was performed. rap5 , rap6 and rap10 were crossed with aux1 to check the status of AUX1 in these plants. Surprisingly all three mutants are disrupted in AUX1 , indicated by the aux1 phenotype of the F1 generation (data not shown). Moreover, sequencing the AUX1 gene in the respective mutant background revealed the independence of the mutants, since rap5 , rap6 and rap10 are characterized by three different mutations in aux1 , not reported so far (Figure 9).

Figure 9 Gene model of AUX1 from ATG to TAG (3300 nt). rap5 is characterized by a G to A mutation at nt 2043, which is at the border of the 6 th intron. rap6 shows a C to T mutation at nt 2339, resulting in an amino acid change of P to S. rap10 displays a G to A mutation at nt 400, resulting in an amino acid change of E to K. Arrows indicate the respective localization of the mutations.

The weakly pABA resistant mutants rap2 and rap7 were crossed with the agravitropic mutants pin2 39 and arg1 87 and were found not allelic with pin2 or arg1 (data not shown). Since the aux1 mutant was initially discovered through the resistance to the artificial auxin 2,4-D88 , all rap mutants were checked for the resistance to 2,4-D. Strikingly all rap mutants are resistant to 2,4-D, indicated by continued root growth in presence of 200nM 2,4-D (Figure 8 3rd row). The mutants rap 2 and rap7 showed a weaker resistance to 2,4-D, since they displayed only a clear resistance to 100nM 2,4-D (Figure 8 4th row). Interestingly the level of resistance to 2,4-D correlated to the level of resistance to pABA (Figure 8 2nd and 3 rd row). Taken together, the EMS screening revealed auxin mutants, which were in turn also resistant to pABA. Therefore the analysis of pABA activity was focused to its putative relationship with auxin signaling.

2.3 pABA activity compared to auxin activity So far, most known auxins are artificial molecules, meaning that they are not present in plants. The feature of being an auxin was first assigned in respect of the activity in 30 biotests like the Avena coleoptile test, based on the modulation of coleoptile elongation by putative auxins. Nowadays, a well-accepted model to study auxin activity is the Arabidopsis thaliana root. To tackle the relationship pABA/auxin, the activity of pABA was compared to those of auxins (IAA, NAA and 2,4-D). It is well known that auxins induce phenotypes like short root length, increased lateral root number, increased adventitious rooting, and root hair induction in Arabidopsis thaliana 34,89,90 , phenotypes similar to those observed when plant are treated with pABA (Figure 7). However from tested auxins, only 2,4-D, but not IAA and NAA, suppressed root waving similarly to pABA (Figure 10b, c). On the other hand, the hypergravitropic root growth is specific to pABA and has never been reported for an auxinic compound. To clarify if pABA and auxin not only induce similar phenotypes but also act in similar pathways, pABA and auxins were applied together and their activity on the root length was measured (Figure 10).

Figure 10 Cotreatment of seedlings with pABA and auxin. Cotreatment of auxin and pABA (100µM) led to a synergistic activity on the root length in case of 2,4-D (40nM) (c,d,i) and NAA (250nM) (e,f,i). Cosupplementation of IAA (250nM) and pABA diminishes the IAA activity (g,h,i). The scale bar represents 1cm.

Combining pABA and NAA for example, resulted in a synergistic activity on root length. The root is shorter than the sum of both single treatments (Figure 10f, i). 31 pABA and 2,4-D gave an intermediate phenotype where young seedlings (6d) showed a synergistic response (Figure 10d), but older seedlings (12d) displayed a partial suppression of 2,4-D activity by pABA (data not shown). Finally combining IAA and pABA led to a complete suppression of IAA activity (Figure 10h). This suppression of IAA activity by pABA is pABA dose dependent and required a ratio IAA/pABA of 1 to 10 (data not shown / section 2.9).

2.4 Molecular properties of pABA compared to auxins It has been suggested that active auxins possess a charge separation within the molecular structure, separating a strongly negative part (mostly a carboxylic group) from a weakly charged positive part by a certain distance around 0,5nm 48,91 . This concept was shown for IAA by Farrimond et al 48 (Figure 11a). TCBA, a benzoic acid derivative, was recognized as a strong auxin 91 . Its auxin activity was reported to be caused by 3 chloro groups bound to the benzene ring, which remove electrons from the benzene ring and generate thereby a net positive charge at position 4 in the benzene ring 91 . This positive charge lays 0,55nm away from the carboxylic group and generates thereby the auxinic charge separation 91 . The benzoic acid molecule, which has no additional chemical groups at the benzene ring, has no comparable positive charge and therefore no auxin activity 46 . The only part of the pABA molecule which is approximately 0,5nm away from the carboxyl group is the carbon atom in position 4 of the benzene ring (Figure 11c). pABA has been also investigated for its charge separation within the molecule and an electron gain has been attributed to the carbon atoms 2,3,5 and 6, while an electron loss marks the carbon atoms 1 and 4 of the benzene ring 92 (Figure 11c) Based on published bond length and bond angles of the pABA molecule 93 , I determined the distance between the carboxylic group and the position 4 of the benzene ring in pABA and found 0,49nm (Figure 11c).

Figure 11 Charge separation of auxins compared to pABA. Auxins possess a charge separation at a distance of 0,5nm between a strong negative group (carboxylic group) and a weaker positive charged area (“+”) , exemplified by (a) IAA 48 and (b) TCBA91 . (c) pABA has a region of electron loss at position 4 of the benzene ring 92 . This position is approximately 0,5nm apart from the carboxylic group.

2.5 ADCS is the key enzyme for pABA synthesis in Arabidopsis thaliana The single ADCS gene (AT2G28880) was identified based on BLAST searches of sequence databases with the protein sequences of E. coli PabA and PabB 13 . Moreover ADCS was identified as a putative candidate in a screen for embryo defective mutants ( emb1997 ), displaying a growth arrest at the globular stage 25 . For this study two further T-DNA insertions lines were isolated for ADCS (adcs-1 and adcs-2) . adcs-1 (SALK_034215) had a T-DNA inserted 48bp upstream of the transcriptional starting point (Figure 2a). Surprisingly homozygous adcs1 mutants showed no growth alterations (data not shown), which was already stated in my diploma thesis 94 . adcs-2 (SALK_095283) had a T-DNA insertion in the 12th exon of AT2G28880 (Figure 12a). Only heterozygous adcs-2 plants could be identified, which produced to 25% embryos arrested at the globular stage (Figure 12b-e). This observation is in agreement with the phenotype of emb1997 25 and the predicted onset of folate synthesis in embryos 16 . adcs-2 mutants could be complemented by ADCS WT allele, which reduced the ratio of arrested embryos from approximately 25% to 6,25%, the expected ratio for a complemented heterozygous mutant (Figure 12f,g). The complemented line 11 displayed an embryo defective ratio of 1,56%, indicative of a double insertion of the complementing construct (Figure 12g).

Figure 12 Importance of ADCS for plant growth. (a) Gene model of ADCS (At2g28880) representing 6,5kb of DNA, including promoter, UTRs, introns, exons and T-DNA insertions. (b) The PCR shows absence (“ADCS”) and presence (“adcs”) of the adcs2 T-DNA. (c) Heterozygous adcs2 lines produce defective embyos, at a (d) 1:3 ratio. (e) Defective embryos in adcs2 are arrested at the globular stage. The (a) WT ADCS sequence was introduced into adcs2 background, which was (f) confirmed by PCR. “adcs2 ” indicates the presence of the T -DNA, “pADCS::gADCS ” the presence of the complementing ADCS sequence in the lines 10, 11 and 17. (g) Reintroducing the ADCS sequence complements the adcs2 mutant phenotype, shown by a drop of defective seeds from 25% to 6,25% for the lines 10 and 17. Line 11 probably contains a double insertion of the pADCS::gADCS sequence, indicated by a drop of defective embryos from 25% to 1,56%. The scale bar represents 500µm (c) and 100µm (e).

Arrested embryos could furthermore complete their development on pABA supplemented medium and could even develop roots (Figure 13a-c). The shoot, not in contact with pABA medium, did not develop further (Figure 13d). These results strongly suggest ADCS (AT2G28880) as unique pABA synthesis gene. The observation that roots of adcs-2 could grow further on pABA supplemented medium suggest that pABA was indeed absorbed by the roots and metabolized. This result suggests the existence of an active folate pathway in roots.

Figure 13 Rescue of adcs2 mutants by pABA supplementation. (a) Siliques of adcs2 were opened and put on pABA supplemented medium. (b) 3 weeks later embryo development finished and germination started. (c) Growth differences became apparent one week after germination (left putative WT, right putative adcs knockout). (d) The 3 weeks old shoot part (magnification of panel c), which is not in contact with the pABA supplemented medium does not develop. The scale bar represents 100µm in a, b and d and 1cm in c.

In order to test this hypothesis an estradiol inducible RNAi line targeting a 209 bp fragment of ADCS was generated, coding for an ADCS specific linker region 95 . For this purpose an inducible Gateway® RNAi vector was constructed based on the pMDC7 vector 96 . Down regulation of ADCS expression in the root led to arrested root growth, highlighting the importance for de novo pABA synthesis for root growth (Figure 14a, b).

Figure 14 Importance of ADCS for root growth. (a) EST induction of the ADCS-RNAi line results in a significant down regulation of ADCS expression in roots. (b) The induction of the ADCS-RNAi led to arrested root growth 9dag. (c) The arrested roots can be rescued either through pABA or folate application. Scale bar corresponds to 1cm.

The root growth arrest could be rescued by either pABA or folate application (Figure 14c). Taken together these results demonstrate for the first time ADCS-dependent de novo synthesis of pABA in the root as a crucial step required for folate synthesis and thereby for root growth. However, this experiment could not show the existence of an endogenous specific pABA activity, since reduced pABA pools might be reconstituted from folate salvage 97 . Since pABA synthesis by ADCS is a very important mechanism for root growth, it was tried to increase the pABA content by overexpressing ADCS.

2.6 Overexpression of ADCS affects plant development ADCS has been already overexpressed under a fruit specific promoter in tomato and resulted in an increase of pABA content in tomato fruits 9. Therefore a similar approach was followed, but the cDNA of ADCS was expressed under the constitutive 35S promoter in Arabidopsis thaliana . 36

In total 19 individual overexpression lines were analyzed. Among them, two lines (OE1 and OE2) showed root growth reduction, which went together with a general growth reduction at the mature state (Figure 15a-c).

Figure 15 Overexpression of ADCS affects plant development. (a) Root growth phenotype, (b) root length reduction and (c) overall growth inhibition was observed in ADCS overexpression lines OE1 and OE2. (d) Expression level of the ADCS is increased in the overexpression lines OE1 and OE2. (e) Free pABA content of the ADCS overexpressing lines OE1 and OE2 is reduced. (f) Expression level of UGT75B is increased in OE1 and OE2. The scale bar represents 1 cm.

OE1 and OE2 displayed an increased ADCS expression level (Figure 15d), which correlated to the phenotypic strength (Figure 15a-c). However quantification of free pABA 13 revealed surprisingly a reduction of free pABA content in OE1 and at lesser extent in OE2 (Figure 15e).

It has been shown that pABA exists mostly in conjugated forms, mostly as pABA- glucose, which is synthesized by the pABA-glycosyltranferase UGT75B 27 . Interestingly UGT75B is upregulated in the OE1 and OE2 background, which might be a cause for the less free pABA content in OE1 and OE2. To address this theory, pABA sensitivity of ugt75b mutant plants 27 was investigated.

2.7 Sensitivity of ugt75b to pABA The glycosyltransferase UGT75B (AT1G05560) is the main enzyme for pABA- glucose biosynthesis in Arabidopsis thaliana 27 . This enzyme is active throughout the plant including leaves, flowers, siliques, and root 27 . ugt75b mutants showed higher sensitivity to pABA than wild type. At low concentration of pABA (10µM), 60% percent of ugt75B mutant seedlings showed emerged AR versus only 20% for WT Ler plants (Figure 16a). Similarly, root growth of ugt75b appeared more sensitive to pABA (Figure 16b). To gain further insight into the pABA regulation by UGT75B, we produced stable estradiol inducible overexpressor lines. Estradiol induction of UGT75B led to root growth alterations (Figure 16 c, d). Weak EST induction of UGT75B retarded root growth and roots displayed a right-hand slanting (Figure 16e). This phenotype was suppressed by exogenous pABA at high concentration application (200µM). As expected, after rescue, these plants appeared also slightly resistant to pABA and their roots grew more than wild type, suggesting a probable high pABA glycosylation rate through enhanced expression of UGT75B (Figure 16 e,g). Since glycosylation of pABA may have resulted in a suboptimal folate biosynthesis, it was checked whether THF could suppress phenotypes described above. THF supplementation could not suppress the root phenotype after UGT75B induction, indicating that this phenotype is not due to folate deficiency (Figure 16e-g). To gain a deeper understanding of this native pABA activity in roots, we analyzed the expression pattern of several genes involved in pABA metabolism.

Figure 16 UGT75B controls pABA activity on root growth. ugt75b mutants displayed a greater pABA sensitivity than WT concerning (a) AR development and (b) root growth. (c) Strong induction (20µM EST) of UGT75B expression resulted in (d) severe root growth phenotypes. (e) Low induction (0,1µM EST) resulted in (f) slanting and (g) reduced root growth, which could be suppressed by pABA, but not THF, application.

2.8 Expression pattern of ADCS, DHPS and UGT75B in roots To visualize the expression pattern of the first pABA synthesis enzyme ADCS, the gene coding for b-Glucoronidase (GUS) enzyme was fused with the ADCS promoter including the 5’ untranslated region , consisting of 2250bp upstream from the start codon (pADCS::GUS). The used ADCS promoter is identical to the promoter used to complement adcs2 knockout mutant.

The pADCS::GUS construct was active throughout the plant, displaying a rather concentrated expression within the columella, QC, vasculature, stomata, trichomes or pollen grains (data not shown). This pattern was comparable to the pattern observed for the previous pADCS::GUS lines generated during my diploma 94 , even though the ADCS promoter used in my diploma was slightly shorter (1998bp) and contained a sequence error (data not shown), which was improved in this work.

Figure 17 Functional analysis of ADCS expression (a) Used constructs to visualize ADCS promoter activity. (b-d) pADCS::GUS is active in shoots and is expressed in root vasculature from hypocotyl until root tip. (d, e) Note the strong expression in the QC. (f) The pADCS-intron::GUS construct is not active in the root tip. (g) WT control showing root autofluorescence. (h, i) The pADCS::CTS::ECFP signal is present in the root vasculature (star (*) h, i) and the columella (arrows in h, i). Scale bars are 500µm in b-d and 50µm in e-i.

In the seedling root, ADCS expression is visible in main root vasculature, starting from the root-shoot junction up to the elongation zone (Figure 17 c, d). ADCS promoter was very active in the QC (Figure 17e) and in the columella (Figure 17e). ADCS was also expressed in lateral root cap and in young epidermal cells close to the root tip (Figure 17e). Similar expression pattern is visible when the chloroplast

40 targeting signal (CTS) of ADCS 13 is fused to ECFP under the control of by ADCS promoter (Figure 17h, i). In good agreement with a previous attempt to visualize ADCS subcellular localization in protoplast 13 , the pADCS::CTS::ECFP signal also localized to chloroplasts of mature leaves (data not shown), or in plastid-like structures in phloem and in root columella cells (Figure 17h, i). However, expression in the QC and columella seems to be weaker compared to root vasculature and 3 out of 13 lines showed a signal in columella (Figure 17h), while the rest of the lines showed a staining in the root vasculature (data not shown). Since QC and columella cells display a substantial autofluorescence visible in WT seedling (Figure 17g), I examined lines which contained double T-DNA insertions of pADCS::CTS::ECFP. As expected, an increase in overall signal intensity, also in the columella was observed (Figure 17i). Since a knock down of ADCS led to the aforementioned root growth arrest, which could be reverted by folate application (Figure 13c), it remained open whether tissue specific pABA synthesis could really match the pattern of folate synthesis in plant. To clarify this issue, the expression pattern of DHPS , a gene coding for the enzyme catalyzing the fusion of pABA and pterin for folate synthesis 15 , was visualized (Figure 18b).

Figure 18 Comparison of ADCS and DHPS promoter activity. (a) ADCS promoter activity compared to (b) DHPS promoter activity. Scale bars represent 1mm for the overview picture and 50µm for the inlets, which show the root tips.

A 1998bp promoter fragment upstream to the start codon of DHPS was fused with the b-Glucuronidase gene and stably transformed into Arabidopsis thaliana . DHPS promoter activity matched the ADCS promoter activity in the whole plant, except in the root tip (Figure 18). There, DHPS expression is much weaker compared to ADCS and only present in the columella (Figure 18b), while ADCS is expressed in the QC (Figure 18a). Since pABA esterification plays a key role in regulating pABA activity, the expression pattern of AT1G05560, coding for UGT75B (pABA-glycosyltransferase), was investigated. A promoter fragment of 2087bp upstream of the ATG was fused to a NLS3xYFP fragment and transformed into Arabidopsis thaliana . As already suggested by Quinlivan et al. 26 , UGT75B is indeed expressed ubiquitously in plants, similarly to ADCS and DHPS (data not shown). An important exception is the expression of UGT75B in root epidermis (Figure 19c), where ADCS and DHPS are absent (Figure 19b,d).

Figure 19 Promoter activity of ADCS, UGT75B and DHPS in the root tip. (a) Expression of pABA metabolism genes, namely (b) pADCS::GUS, (c) pUGT75B::NLS3xYFP and (d) pDHPS::GUS in the root tip of Arabidopsis thaliana . The

42 respective enzymes are highlighted by stars: ADCS (*), UGT75B (**) and DHPS (***). Scale bars represent 50µm.

2.9 IAA activity in lex::UGT75B background Applied pABA suppressed the activity of applied IAA on root growth, like already indicated in section 2.3. This pABA activity requires at least 10 times higher pABA amounts than IAA (Figure 20a).

Figure 20 IAA activity in lex::UGT75B background. (a) Applied pABA suppressed IAA (1µM) activity on root growth. (b) The root hair elongation of 8dag induced lex::UGT75B seedlings is IAA hypersensitive. (c) Quantification of root hair length. The scale bar represents 500µm.

The activity of IAA was also determined in the lex::UGT75B background. Contrary to the IAA suppression by applied pABA, bear induced lex::UGT75B seedlings a higher sensitivity towards IAA, indicated by markedly induced root hair growth in IAA treated UGT75B overexpressing seedlings (Figure 20b, c).

3 Discussion

3.1 pABA activity depends on the auxin pathway pABA was discovered during a screen for benzoic acid related novel compounds modulating root growth of Arabidopsis thaliana . Since various benzoic acid derivatives are active auxins 45 , pABA activity might be related to auxin signaling pathways as well. Screening for pABA resistant EMS mutants revealed mutants, which are resistant to pABA-induced straight root growth ( rap mutants). Strikingly all mutants matching this criterion are also resistant to the artificial auxin 2,4-D and can be therefore considered as auxin mutants. The functions disrupted in previous 2,4-D resistant mutants covered auxin influx (aux1 and axr4 ) and auxin signaling ( axr1, axr3 and axr6 ), which were at the time the first identified molecular components of auxin transport 40 and the auxin induced ubiquitination pathway 98 . In this study, rap5 , 6 and 10 were isolated, which are disrupted in the AUX1 gene. The isolation of three independent aux1 alleles confirmed the quality of the EMS population of seeds used and suggested furthermore that aux1 might be very important for pABA activity on root growth. Since the EMS screen revealed also other 2,4-D resistant mutants different from aux1 , pABA activity appears tightly linked to auxin signaling pathways. This hypothesis is strengthened when looking at experiments for which pABA and auxins (IAA, NAA and 2,4-D) were combined. If pABA and auxin would act on different pathways their activity on root growth would be additive. In contrast, pABA combined with NAA or 2,4-D resulted in a synergistic reduction of root growth, while pABA masked completely the activity of IAA. This suggests that pABA and auxins act in the same pathway.

3.2 Anti-auxinic activity of pABA Compounds which counteract the activity of IAA have been commonly described as anti-auxins. Anti auxins were initially discovered based on their ability to suppress IAA activity in the classical auxin biotests like Avena coleoptile elongation. However, this anti auxinic activity is not well understood, since the molecular mechanism of anti auxinic activity has not been clarified yet 99 . 44

Anti-auxins such as p-chlorophenoxyisobutyricacid (PCIB) 100 and 4,4,4-Trifluoro-3- (indole-3) butyric acid (TFIBA) 99 , were both identified as substances, which reduce the growth of avena coleoptiles 101,102 . Since these molecules have IAA-like structures, but possess activities opposite to IAA, they were assigned as anti-auxins. However, the activity on root growth of certain plant species revealed differences between both anti-auxins, in terms of gravitropic response99 , main root length 99,103 and root hair development 104 . The mode of action of these two anti-auxins is not known for any of the processes mentioned above; only PCIB has been shown to act independently of auxin transport 65,103 . pABA displays as well some anti-auxin like features. The strongest anti-auxin effect is the suppression of IAA activity. Furthermore at low concentration (10µM), pABA led to an increased root length; a common anti-auxin feature. Recently this activity has been shown for PCIB as well as for TFIBA in flax and for TFIBA in Arabidopsis thaliana 99 . Interestingly TFIBA leads to an enhanced gravity response of flax roots, while PCIB inhibits the gravity response 99 . This example illustrates the current challenge for the understanding of anti-auxins, which cannot be solved at the moment on the basis of the available data. However, the comparison of PCIB and TFIBA made clear, that molecules sharing the anti-auxin activity might show different or even opposite activity on plant growth. This might be also true for pABA, which has some anti-auxin activity, but induces at higher concentration opposite phenotypes compared to the well accepted anti-auxin PCIB.

3.3 Auxinic activity of pABA In contrast to the anti-auxin concept, phenotypes induced by pABA when applied at high concentration (100µM) are rather similar to the activity of certain auxins. pABA treatment reduced root length similarly to common auxins such as IAA, NAA and 2,4- D. Likewise increased root-hair growth, lateral and adventitious root number induced by pABA are well described traits for auxin activity. Together, facts described above, rap mutants, combination-treatments pABA/auxins (NAA and 2,4D)(section 3.1) suggest that pABA possess an auxin like activity. Indeed, pABA induces PIN1 accumulation (data not shown) and an ectopic expression of the auxin marker DR5GUS 105 (Ditengou et al. unpublished).

3.4 pABA molecular structure and auxinic properties Auxin and anti-auxin activity of certain compounds is based on their molecular structure. Auxins are defined mainly by a set of physiological actions, but the structure-effect relationship of such compounds is still matter of debate 106 . However it is known that auxins possess a planar aromatic ring and a carboxylic group containing a side chain 107 . The activity of auxins depends strongly on side groups binding the ring structure. Through such substitutions, it is suggested, that a positive charged area at specific distance from the carboxylic group is generated 48,49 . pABA is matching the auxin guidelines for the planar ring structure and the carboxylic group. Even the weak positive charged area is present in 0,5nm distance from the carboxylic group, matching the auxinic guideline suggested by Farrimond et al. 48 . Compared to strong auxins like TCBA, where electrophilic chlorine atoms generate a much stronger positive charge at the benzene ring, the strength of the positive area in the pABA can be considered as rather weak. In good agreement with this is the rather mild auxinic property, pABA has to be used at concentrations 5000 times higher than 2,4-D, to induce an equivalent reduction of root length. To get a clue if pABA has an auxin related role for plant development and how the auxin pathway is perturbed by pABA, the activity of endogenous pABA in roots was clarified.

3.5 The importance of ADCS for pABA synthesis pABA is a folate precursor therefore crucial for the folate driven synthesis of certain amino acids, nucleotides and many other important compounds 1. Genetic analysis of folate biosynthesis was hindered by the lethality of folate biosynthesis mutants, since those genes are expected to be single genes 1. The current challenge in the folate field is lack of genetic confirmation for folate pathway genes, so it is unclear whether the known enzymes are the only, or even the major, significant ones in plants 1. ADCS, the first enzyme involved in the synthesis of pABA , is predicted to be encoded by a single gene (AT2G28880) 13 . The gene was identified based on its homology to the corresponding bacterial enzymes (PabA and PabB) and the ADCS activity was demonstrated by complementing the bacterial null mutant of PabA and PabB 13 . However, it was not known up to know whether ADCS activity encoded by AT2G28880 is relevant for plant growth.

The analysis of ADCS has been initiated by the characterization of two T-DNA mutants. adcs1 has a T-DNA insertion close to the TSS, which did not impair plant growth 94 . adcs2 is characterized by a T-DNA inserted in exon 12 and was therefore believed to be strongly affected. As expected adcs2 mutants displayed defective seeds, which contained embryos arrested at the globular stage. In good agreement, homozygous lines of this mutant could not be identified and only heterozygous adcs2 were propagated. Importantly, the embryo lethal phenotype in adcs2 was rescued by reintroducing the WT allele of ADCS . This result was independently confirmed, since adcs2 knockout embryos could complete their development on pABA supplemented medium. Moreover, another adcs2 allele was found in a screen for mutations conferring embryo lethality 25 , therefore displaying a phenotype identical to adcs2 . adcs2 and emb1997 contain a T-DNA inserted in the same exon 12 of At2G28880. The only mutant for folate synthesis characterized so far is a knockout mutant of DHFS, whose development as well is arrested at the embryo globular stage 16 . In agreement with these two studies, the analysis of the adcs2 mutant demonstrates the crucial role of the ADCS encoded by AT2G28880 for pABA synthesis in plants for embryo development. In order to show the importance of ADCS activity also for root growth, a RNAi knockdown of ADCS was established. RNAi induction led to a down regulation of ADCS expression and to severe root growth defects. Root growth defects were overcome by the supplementation of pABA or THF. Taken together these results confirm the requirement for pABA synthesis through ADCS for embryo and root development.

3.6 Overexpression of ADCS results in alteration in plant growth. To understand further the role of pABA in plant development, an attempt to increase pABA content in plant was conducted by overexpressing the ADCS gene. Out of 19 individual overexpression lines, only 2 lines showed a reduced root length at the seedling stage. Severity of phenotype correlated well with ADCS expression level resulting in an overall growth reduction also at adult stage. Taken together, ADCS overexpression in general caused no visible phenotypic alteration, but could in severe cases affect the whole plant growth. The relatively low impact of ADCS overexpression may be explained, firstly by the fact that pABA synthesis is a two-

47 step mechanism; the second step being catalyzed by the ADCL gene, which might represent a bottleneck for pABA synthesis. Secondly, pABA content and activity could be regulated by other mechanisms than biosynthesis of pABA. Regarding the activity ADCL , no evidence in literature exists confirming the importance of this gene for pABA synthesis in plants. However, there were two studies showing that the majority of pABA present in plant is conjugated to glucose 26,27 , indicating a possible control mechanism for pABA content and activity. Indeed, ADCS overexpressing lines contained not only low amount of free pABA, but also an elevated expression of the pABA-glycosyltransferase UGT75B , which could be interpreted as counterweight of pABA overproduction in these mutants. Taken together these data shed light at plant glycosyltransferase UGT75B as a putative regulator of endogenous pABA activity.

3.7 Importance of UGT75B for pABA activity UGT75B is the fourth enzyme besides ADCS, ADCL and DHPS, which has been shown to be involved in pABA metabolism. However, so far it was unclear whether the formation of pABA glucose was of any importance for plant development. To clarify this point, the activity of pABA was investigated in the ugt75b background. This mutant has a reduced velocity for pABA-glucose production and therefore contains lower levels of pABA-glucose 27 . ugt75b mutants appeared hypersensitive to pABA, developing shorter root and adventitious roots on pABA supplemented medium, suggesting that this mutant accumulated higher amounts of non-conjugated pABA in its tissues. This result suggests UGT75B as an important regulator of free pABA content in roots that, if not controlled, might perturb root development. Moreover, it opens the possibility that pABA might act independently from its canonical role as folate precursor in plant.

3.8 Role of UGT75B for root growth To gain further insight into pABA metabolism, UGT75B was overexpressed to lower the content of free pABA in the root. As expected resulted overexpression of UGT75B in pABA resistant plants, which is the complementary finding to the high pABA sensitivity of ugt75b mutant. Conditionally overexpression of UGT75B decreased root growth and induced root slanting. Importantly these defects could be suppressed by application of pABA, but

48 not folate, confirming firstly the intimate relationship between UGT75B function and the activity of free pABA in plant and secondly the importance of endogenous pABA for the control of root growth. Root slanting after UGT75B induction is opposite to straight root growth observed after pABA application. This implicates that endogenous pABA may act as a regulator of native root growth. However a decrease in root length is also observed when plants are grown on pABA. The fact that seedlings overexpressing UGT75B develop longer roots on pABA supplemented medium than WT could also reflect a resistance to pABA, as exogenous pABA is probably immediately conjugated to glucose by UGT75B. To furthermore characterize the activity of endogenous pABA, the expression domains were visualized for ADCS , DHPS and UGT75B .

3.9 Expression domains of genes involved in pABA metabolism Because nothing was known about the spatiotemporal expression of pABA biosynthesis in plants, the tissue expression domain of ADCS was determined, using the promoter fragment of AT2G28880 that complemented adcs2 knockout mutant fused to GUS reporter. ADCS is expressed in vasculature, QC and columella cells of Arabidopsis roots probably reflecting sites of pABA synthesis and as a consequence folate synthesis. adcs1 mutant, characterized by a T-DNA insertion 48bp upstream of the TSS, did not show any growth alteration 94 . Important cis elements were therefore presumed to lie further downstream along the 5’UTR region, which contains already the first intron. Indeed, the first intron in the UTR is from great importance for root tip expression of ADCS . Lack of the first intron resulted in a loss of root tip expression, together with a general drop of GUS activity (data not shown). In turn, prolonging the ADCS promoter by the CTS reveals no further changes in expression compared to the promoter alone. However this construct was necessary to indicate the subcellular localization of ADCS in the root, which might be plastidial, as indicated by overlap of CFP signal with chloroplast autofluoresence in leaves. The latter is consistent with published subcellular localization of ADCS 13 . This conclusion is strengthened by the expression domain of DHPS , whose promoter activity shows a similar pattern. However DHPS is not active in the QC, while ADCS is active. Since the folate biosynthesis genes GCHI and ADCL are expressed in the

49 the QC 21 , this suggest that other genes of the folate pathway might be also expressed there. DHPS may also have important cis regulatory elements similarly to ADCS further downstream in the gene sequence. Accordingly the DHPS sequence also contains two introns. The first one is located 195bp downstream of the start codon, while the second one is located in the end of the gene. Based on its close localization to the TSS, important cis regulatory elements for QC expression might be located on the first intron. This possibility is furthermore strengthened because DHPS (AT4G30000) shares the promoter with the gene AT4G30010 leaving only a 549bp gab between both start codons. The gene AT4G30010 was included in the DHPS promoter fragment, which is therefore represented by 1998bp upstream of the ATG. The possibility, that important cis elements lie even further upstream of the DHPS start codon seems unlikely, but is of course also possible. A complementation of a DHPS knockout mutant with the DHPS gene, driven by different lengths of DHPS promoters might clarify these issues. However the similarity between DHPS and ADCS promoter activity suggests that pABA synthesis and folate synthesis in plants occurs in the same tissues. The other gene involved in pABA metabolism is AT1G05560, which codes for the pABA-glycosyltransferase UGT75B. Interestingly UGT75B is expressed in root epidermis, where ADCS and DHPS expression are not detectable. Reconsidering phenotypes induced by pABA such as the reduction of main root growth and the induction of root hair growth, both strongly depending on the epidermis, suggesting that this tissue might be very sensitive to pABA. In turn the relatively high amount of pABA (100-200µM) needed to induce such phenotypes might reflect the balancing activity of UGT75B in the root epidermis. Conversely, when UGT75B activity is repressed in ugt75b mutant, plants become very sensitive to pABA, even at low concentrations (10µM). However, pABA seems not to be produced in the epidermis but just like IAA, pABA as a weak acid might be susceptible to diffuse across membranes. Although a pABA transporter has not yet been found, however such activity is postulated to relocate for example pABA-glucose in and out the vacuole 27 . Folates can serve themselves as a source for pABA, since it was demonstrated, that folates are actively broken down in plants, resulting in pterin and pABA-glutamate, which in turn, can be cleaved to pABA and glutamate 97 . Every living cell needs folate for synthesis of crucial compounds. Therefore the epidermis presumably contains

50 folate, which are either transported to the epidermal layer or recycled in this cell file and might be also a target for folate remediation. Considering the activity of pABA on root growth, folates remediation appears really important and it might be worth to be addressed its role in the future.

3.10 A possible model for pABA activity In section 3.1, pABA has been suggested as a compound with weak auxinic activity, based on induced phenotypes and resistant mutants. At the same time, pABA has an anti-auxinic activity, indicated by the suppression of IAA activity through pABA. While the auxinic activity is only apparent at pABA concentrations around 100µM, the anti auxinic activity of pABA can be traced down until 1µM pABA, which suppresses the activity of 200nM IAA (data not shown). Since in plants the amount of free pABA is naturally low, based on the activity of UGT75B, the anti-auxinic effect of pABA might overlay the auxinic effect in planta simply by the matters of concentrations. Therefore the reduced root length of induced UGT75B seedlings might reflect the diminished anti-auxinic activity of pABA or vice versa the relieved IAA activity. In accordance with this hypothesis are induced UGT75B seedlings are highly sensitive to IAA. pABA might therefore serve as an intrinsic regulator of IAA, which is involved in the regulation of root growth. Since pABA is the precursor of folates, a high pABA content goes together with high synthesis rate of folates, which are generally needed for growth. Since IAA represses root growth, pABA might act in turn as a repressor of IAA activity, therefore relieving the inhibition on root growth.

3.11 Achievements This study shows for the first time that (i) folate biosynthesis occurs throughout the plant and (ii) the importance of tissue specific synthesis of folates for root growth. Furthermore it provides evidences, that folate precursor pABA has its own activity besides its canonical role in folate synthesis and it acts, not only when supplemented in growth media but also as endogenous natural compound. The key enzyme controlling pABA activity in the root is the glycosyltransferase UGT75B, which catalyzes the formation of pABA-glucose and thereby inactivates pABA. This function is not only important in respect of pABA application, but even fulfills a regulatory role for pABA activity during root growth. Finally, this may explain why only pABA, among

51 all other intermediary compounds of folate biosynthesis, exists as a glycosylated form.

4 Material and Methods

4.1 Materials

4.1.1 Plant lines Arabidopsis thaliana - Wild type Columbia-0 (WT Col) - Wild type Landsberg (WT Ler) - Line SALK_034215 (adcs1)108 - Line SALK_095283 ( adcs2 )108 - GT6017 (ugt75b) 27 - pADCS::GUS - pADCS-intron::GUS - pADCS::CTS::ECFP - pADCS::gADCS - 35S::ADCS - RNAiADCS - lex::UGT75B - pDHPS::GUS - pUGT75B::NLS3xYFP - rap1, 2, 5, 6, 7, 10

4.1.2 Accession numbers The mutant lines adcs1 , adcs2 and ugt75b were obtained from NASC. adcs1 = SALK_034215 (NASC ID: N534215) adcs2 = SALK_095283 (NASC ID: N595283) ugt75b = GT6017 (NASC ID: N25709)

The genes, which were investigated in this study, are: AT2G28880 ( ADCS ) AT1G05560 ( UGT75B ) AT4G30000 ( DHPS ) AT2G38120 ( AUX1 )

4.1.3 Bacterial lines

E. coli TOP10: F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZ ΔM15 Δlac Χ74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG λ- (from Invitrogen) DB3.1: F- gyrA462 endA1 glnV44 Δ(sr1 -recA) mcrB mrr hsdS20(rB-, mB-) ara14 galK2 lacY1 proA2 rpsL20(Smr) xyl5 Δleu mtl1

Agrobacterium tumefaciens (A. tumefaciens ) GV3101::pMP90 from 109

4.1.4 Plasmids Plasmid Description Source pDONR201 Gateway® entry vector Invitrogen pDONR207 Gateway® entry vector Invitrogen pENTR Gateway® entry vector Invitrogen pMDC7 Gateway® ready, EST inducible expression vector 96 pMDC32 Gateway® ready, constitutive expression vector 96 pMDC162 Gateway® ready expression vector, carrying the 96 GUS sequence pB7CWG2 Gateway® ready expression vector, carrying the 110 ECFP sequence. pJawohl8 Gateway® ready constitutive RNAi expression from B. Ülker vector pOpOff1 Gateway® ready DEX inducible RNAi expression 111 vector MU006 Vector carrying the NLS3xYFP sequence from T. Laux pMDC7RNAi Gateway® ready EST inducible RNAi vector This study pMDC32-35S Simple expression vector This study Table 1 Name, description and origin of plasmids used in this study.

4.1.5 Oligonucleotides Ordered oligonucleotides were dissolved in water to 100µM and stored at -20°C.

Name Sequence Used for ADCS_16_fw cgttttgttcaacatcttctgagttatcatatcc Cloning of the ADCS gene ADCS_191_rev ggtaaactcttcttaacaaccgacaaatct Cloning of the ADCS gene ADCS_2053_fw gaacgtcttgcgcataaag Sequencing the ADCS gene ADCS_2317_rev gccaggctcacagacacgac Sequencing the ADCS gene ADCS_2484_fw ggttcaatgactggtgcc Sequencing of the ADCS gene ADCS_560-fw gcatgccccggaaccagt Sequencing the ADCS gene ADCS_ECFP1_fw agaagcttggttttgtgaggactatggtgagcaagggcgaggagc Cloning of the ADCS-ECFP construct ADCS_ECFP1_rev ctcctcgcccttgctcaccatagtcctcacaaaaccaagc Cloning of the ADCS-ECFP construct attB1_ECFP_fw ggggacaagtttgtacaaaaaagcagg ctatggtgagcaagggcgaggagc Cloning of the ADCS-ECFP construct attB2_BamHI_ECFP_rev ggggaccactttgtacaagaaagctgggtggatcc ttacttgtacagctcgtccatgc Cloning of the ADCS-ECFP construct AUX1_1090_fw atcagggattattctttgcatcttaacc Sequencing the AUX1 gene AUX1_1474_rev agaaacgatacagcagcacc Sequencing the AUX1 gene AUX1_1936_fw ttactgggctttcggagacgcatt Sequencing the AUX1 gene AUX1_2106_rev cacgaacaagaacacgttgc Sequencing the AUX1 gene AUX1_2520_rev tgccctccaatttcacaacc Sequencing the AUX1 gene AUX1_279_fw gtgttattgacattaccgtactcgttt Sequencing the AUX1 gene AUX1_380_rev ttcgacgtagagaacagagatg Sequencing the AUX1 gene AUX1_3UTR_rev ctagtatcggaagatattgttcatggt Sequencing the AUX1 gene AUX1_5UTR_fw agcccgaagcatcttatagtatttt Sequencing the AUX1 gene b_ATP_F gatcatgacatctctcgagg Control gene for RT PCR analysis b_ATP_R tggtaaggagcaaggagatc Control gene for RT PCR analysis cADCS_2436_rev gaaagcagctcttacacattccac Sequencing the ADCS gene cADCS_334_fw ctgtcgttattcggaatgatgagt Sequencing the ADCS gene CTS_SbfI_fw gtttcattagtttac cctgcagg agtaaaactacgag Cloning of the ADCS gene CTS_SbfI_rev cgtagttttact cctgcagg gtaaactaatgaaac Cloning of the ADCS gene ECFP_AatII_rev gacgtccttgtacagctcgtcca Cloning of the ADCS-ECFP construct fw_ADCS_RT tagaaaatcgaagtcattggc RT PCR for ADCS expression + sequenceing gADCS_3UTR BamHI_rev ccc ggatcc aaaaactatcttttattaaagagacttc Cloning of the ADCS gene Hyg_991_fw ctcgccgatagtggaaacc Sequencing expression clones LBa1 tggttcacgtagtgggccatcg Genotype adcs2 plants LBb1 gcgtggaccgcttgctgcaact Genotype adcs2 plants nos terminator rev agaccggcaacaggattcaa Sequencing expression clones OL_seq_fw tgttcctctcattttcttct Sequencing the ADCS gene pABAGlc_-2076_fw cacc gctcgggacaaaaacacatt Cloning of the UGT75B promoter pABAGlc_417_rev caaagccggttggatccagagaagag Cloning of the UGT75B promoter pABAGlc_rev ggagagtctcaaaaaggtgattc Cloning of the UGT75B gene pABAGlc_TOPO_fw cacc aaggagagacacagattcttgtattg Cloning of the UGT75B gene pADCS_-1007_attB1_fw ggggacaagtttgtacaaaaaagcagg ctcaattgataaaagaacaagtg Cloning of the ADCS gene pADCS_1574_rev aaacgaagccaagtgagaagaga Sequencing the ADCS gene pADCS_-270_fw cttcccaccaaatcttggcct Sequencing the ADCS gene pADCS_273_rev gctggagaggttttggatggtc Sequencing the ADCS gene pADCS_306_fw aagtcaaatgccaattcaccag Sequencing the ADCS gene pADCS_no intron_R ggggaccactttgtacaagaaagctgggt aactcgtttagaaacgaagccaagt Cloning of the ADCS promoter without the 1 st pADCS2_R ggggaccactttgtacaagaaagctgggt aactcctgtaccaaaagggagag Cloning of the ADCS promoter pADCS3fw ggggacaagtttgtacaaaaaagcagg ctatcttggcctctctgtttctg Cloning of the ADCS promoter pADCSmuta_fw catattactatcaatatatatatatatatatatatatataaacaac Cloning of the ADCS promoter pADCSmuta_rev atatatatatatattgatagtaatatgaagtc Cloning of the ADCS promoter pHPPKDHPS_1576_rev ttttttatcttcggaaagtctcatt Sequencing the DHPS promoter pHPPKDHPS_401_fw gtaattcgaaagaaaggttttcct Sequencing the DHPS promoter pHPPKDHPS_fw ggggacaagtttgtacaaaaaagcagg cttgacaggtaaaagagtttggact Cloning of the DHPS promoter fragment pHPPKDHPS_rev ggggaccactttgtacaagaaagctgggt cttgggaaatagaaagtagagagag Cloning of the DHPS promoter fragment pMDC_LB_rev aaagtctgccgccttacaac Sequencing expression clones pMDC_RB_fw tggacgaacggataaacc Sequencing expression clones pMDC7_XVE_rev aggactcggtggatatgg Sequencing expression clones pMDC7XVE_fw atctgcagggagaggagtttgtgtg Sequencing expression clones ppABAGlc+2_BamHI_rev ggatcc attttttttctacttgtcttagc Cloning of the UGT75B promoter rev_ADCS_RT agaagaaacatgcatctggag RT PCR for ADCS expression + sequenceing RNAi vs ADCS_fw ggggacaagtttgtacaaaaaagcagg cttgcctgatgctactcaattgctgaa Cloning of the ADCS RNAi fragment RNAi vs ADCS_rev ggggaccactttgtacaagaaagctgggt aactttatgcgcaagacgttcatgc Cloning of the ADCS RNAi fragment SALK_095283_LP aacaatagctcctcctgctc Genotype adcs2 plants SALK_095283_RP gctccagatgcatgtttcttc Genotype adcs2 plants SEQLA tcgcgttaacgctagcatggatctc Sequencing pDONR entry clones SEQLB gtaacatcagagattttgagacac Sequencing pDONR entry clones TOPO_AatII_ECFP_fw cacc gacgtcatggtgagcaagg Cloning of the ADCS-ECFP construct TOPO_HindIII_ppABAGlc-2067_fw cacc aagcttgctcgggacaaaaacacatt Cloning of the UGT75B promoter

Table 2 Names, sequences and applications of used oligonucleotides. Red letters indicate artificial sequences, like restriction sites or recombination sites, used for the cloning procedure.

4.1.6 Molecular biology material Restriction enzymes + buffers Fermentas RevertAid™ Reverse Transcriptase Fermentas dNTP Mix 10mM each Fermentas RiboLock™ RNase Inhibitor Fermentas DEPC-treated Water, molecular biology grade Fermentas Oligo(dT)18 Primer Fermentas 10X PCR Buffer S with 15mM MgCl2 Genaxxon biosience Taq-Polymerase 250 units 5U/µl Genaxxon biosience dNTP Mix 2mM each Fermentas GeneRuler™ 100bp DNA Ladder Fermentas GeneRuler™ 1kb DNA Ladder Fermentas pENTR™⁄D -TOPO® Cloning Kit invitrogen Gateway® BP Clonase® II enzyme mix invitrogen Gateway® LR Clonase® II enzyme mix invitrogen KOD Hot Start DNA Polymerase Novagen F-530 Phusion Polymerase Finnzymes DNeasy® Plant Mini Kit (50) QIAGEN PureLink™ Quick Plasmid Miniprep Kit invitrogen Illustra TM GFX PCR DNA and Gel Band Purification Kit GE Healtcare Klenow fragment Fermentas T4 DNA Ligase Fermentas

4.1.7 Chemicals 2-propanol ROTH Acetone ROTH Agar –Agar, Kobe I ROTH Agarose Electrophoresis grade invitrogen Ampicillin Natriumsalz ROTH BactoTM peptone DIFCO

Bromphenolblau Indikator pH 3 – 6 ROTH Calciumchloriddihydrat MERCK Calciumhypochloride SIGMA Chloralhydrate Fluka Chloroform ROTH Dimethylsulfoxid ROTH EDTA Dinatriumsalz Dihydrat ROTH Essigsäure Rotipuran 100% ROTH Ethanol ROTH Ethidiumbromidlösung 1% ROTH Gentamicin Sulphate DUCHEFA BIOCHEMIE Glycerol ROTH Hygromycin B DUCHEFA BIOCHEMIE Indol-3-acetic acid SIGMA K2HPO4 MERCK Kanamycin ROTH KH2PO4 MERCK LB –Medium (Luria/Miller) ROTH MES sodium salt SIGMA Methanol ROTH MURASHIGE & SKOOG MEDIUM Basal salt mixture DUCHEFA BIOCHEMIE NaOH MERCK Natriumchlorid ROTH 4–Aminobenzoic acid Fluka Potassium acetate MERCK Potassium ferricyanide SIGMA Potassium ferrocyanide ROTH Potassium hydroxide Fisher Chemicals Rifampicin DUCHEFA BIOCHEMIE Salzsäure 37% ROTH Select yeast extract LIFE TECHNOLOGIES Silvet L-77 LEHLE SEEDS Sodium dodecyl sulfate Fluka Sucrose J.T.Baker

Tris Ultra Qualität SIGMA Triton X100 SIGMA TRIzol invitrogen X-Gluc ROTH Xylencyanol FF SERVA

4.1.8 Other materials 100 Deckgläser 24 x 50mm ROTH 50 Objektträger ROTH Cellstar Greiner Bio ONE Combistäbchen BAYER Electroporation cuvettes cell projects Falcon tubes GREINER Floradur Topfsubstrat (soil) FLORAGARD Haftsichtfolie ROTH Latex Untersuchungshandschuhe ROTH Nitril Einmalhandschuhe ROTH Omnifix 5ml BRAUN Parafilm M ROTH PCR tubes Applied biosystems Petridishes GREINER Pipette tips ROTH Pipettes (0,5µl – 5ml) GILSON Roti®-Tape-Markierbänder ROTH Rotilabo Spritzenfilter steril ROTH Rotilabo®-Aluminiumfolie ROTH Sekuroka®-Sterilindikatorbänder ROTH Sterillium ROTH Vermiculit Müller Landesprodukte Zahnstocher Hygostar ROTH

4.1.9 Devices Axiovert 200M MAT ZEISS Balance SARTORIUS

Biofuge Pico Heraeus CanoScan 9950F Canon Consort Electrophoresis Power Supply SIGMA Dampfsterilisator Varioclav G:Box Syngene Gene Pulser X cell BIORAD Inkubationsschüttelmaschine INFORS HT MR2003 Heidolph Präzisionsbrutschrank Modell INB 500 MEMMERT Stemi SV11 Apo stereomicroscope ZEISS Thermal cycler eppendorf Thermocycler T3 Biometra Thermomixer compact eppendorf Ultraschallgerät Sonorex Bandelin Ultrospec 3100 pro BIOCHROM Unimax 1010 Heidolph Vortex Genie 2 Scientific Industries

4.1.10 Programs Adobe Photoshop CS5 ImageJ 1.43u Microsoft Office Word/Excel/PowerPoint 2010 ApE A plasmid editor v1.12 Vector NTI (Invitrogen) DNASTAR programs

4.1.11 Plant media Seedlings were grown in sterile square petri dishes containing AM medium: MS salt 2.2973 g (0,5x) Sucrose 10 g (1%) MES 1.086 g (5mM) Water 1L pH 5.8 - 6 (adjusted with HCl) Agar 13 g (1.3%)

MS salt, Sucrose and MES were dissolved in ddH2O and pH was adjusted by 10-12 drops of 37% HCl solution. Agar was added and the medium was autoclaved for 20min at 120°C. If necessary, certain compounds were added as sterile filtered solution after autoclaving. For propagation, 5-10d old seedlings were transferred from agar plates to soil.

Soil: 10 L soil 2.5 L Vermiculite 5 Combistäbchen (Insecticide + fertilizer) 2 L H2O Soil was autoclaved for 20 min at 120°C and insecticide was added afterwards.

4.1.12 Bacterial media

LB medium for E. coli : 10g bacto-tryptone 5g bacto-yeast extract 10g NaCl pH 7

YEP medium for A. tumefaciens : 10 g yeast extract 10 g peptone 5 g NaCl pH 7,5

LB as well as YEP medium was dissolved in 1L ddH2O and 1,5% agar (15g) was added, before autoclaving (20min at 120°C). For liquid medium, agar was left out.

Antibiotics were used as sterile filtered solution at the indicated concentration: Antibiotic Stock concentration Used concentration (Solvent)

Ampicillin 50mg/ml (H 2O) 100µg/ml

Kanamycin 25mg/ml (H 2O) 50µg/ml

Gentamicin 25mg/ml (H 2O) 25µg/ml Rifampicin 100mg/ml (EtOH) 75µg/ml Chloramphenicol 20mg/ml (EtOH) 25µg/ml

Spectinomycin 100mg/ml(H 2O) 100µg/ml Table 3 Stock and working concentrations of used antibiotics.

SOC medium for E. coli : 2% bacto-tryptone 0.5% bacto-yeast extract 10mM NaCl 2.5mM KCl 10mM MgCl2 10mM MgSO4 20mM glucose

The pH was adjusted to 7 using 1M KOH and the SOC medium was filtered sterile.

4.1.13 Buffers and solutions

TE buffer: 10 mM Tris-HCl (pH8) 1mM EDTA

50X TAE: 2M Tris 50 mM EDTA Acetic acid to adjust pH to 7,6

10X loading buffer for gel electrophoresis of DNA: 50% Glycerin 50 mM EDTA 0.25% Bromophenol Blue 0.25% Xylene Cyanol

DNA extraction buffer (for plant DNA): 0.2M Tris-HCl (pH 7,5) 0.25M NaCl 0.025M EDTA 0.5% SDS

GUS staining solution: 50 mM KPO4 buffer pH 7 5 mM Potassium Ferrocyanide 5 mM Potassium Ferricyanide 1 mg/ml X –Gluc 0,1% Triton X100

TfbI: 0.294g KOAc 0.989g MnCl2 *4H20 0.745g Kcl 0.147g CaCl *2H2O 15 ml glycerol ddH2O was added to 100ml and the pH was adjusted to pH 5,8 using 1M HCl. Finally the TfbI buffer was sterile filtered.

TfbII: 0.209g MOPS 1.1g CaCl2 * 2H2O 0.075g KCl 15mL glycerol

62 ddH2O was added to 100ml and the pH was adjusted to pH 7 using 1M KOH. Finally the TfbII buffer was sterile filtered.

PBST: 3,2mM Na2HPO4 0,5mM KH2PO4 1,3 mM KCl 135 mM NaCl 0,1% Tween 20 pH 7

4.2 Methods

4.2.1 Arabidopsis thaliana seed sterilization Arabidopsis thaliana seeds were surface sterilized in a solution of 4% w/v calcium hypochloride and 0.1% Triton X100 in 80% ethanol for 10min. After two washes in 80% ethanol and one rinse in 100% ethanol, seeds were left to dry under the sterile bench.

4.2.2 Plant growth conditions Sterile seeds were sown on AM medium. The plates were transferred, after vernalization in the dark for 2 days at 4ºC, to climate chambers where seeds were grown under long-day (16 h light/8 h dark; 6.3 W/m2 energy flow) conditions at 22ºC. If necessary, 5-10d old plants were transferred to soil and were grown under the same conditions.

4.2.3 Extraction of plant DNA High quality DNA was extracted from 6 day-old seedlings with the “DNeasy® Plant Mini Kit ” according to the manufacturer’s instructions. For routine needs the following protocol was used: A young leaf (~0,5cm2) was cut and grinded directly in a microcentrifuge tube with a small plastic pestle and 400 µl DNA extraction buffer was added. After vortexing, the sample was centrifuged for 5 min at 13000 rpm, 300 µl of the supernatant were transferred, to a new microcentrifuge tube. 300µl isopropanol were added and the

63 mixture was, after vortexing, incubated for 2 min at room temperature. The DNA was pelleted by centrifugation for 5 min at 13000 rpm. The supernatant was discarded completely and the sample was dried for 10min at room temperature. Finally the DNA was dissolved in 30 µl H2O.

4.2.4 Transformation of Arabidopsis thaliana A. tumefaciens clones carrying the correct expression vector were grown overnight in 20ml YEP medium, containing the appropriate antibiotics, under continuous shaking at 28°C. Afterwards this culture was transferred into 150 ml of fresh YEP medium containing the same antibiotics. This bacterial culture was grown overnight until an

OD 600 of 1.6 was achieved. Bacteria were pelleted by centrifuging for 20 min at 5500 x g and were resuspended in 5% sucrose to an OD 600 of 0,8. Finally 0,025% of Silvet L-77 was added. Stems of plants, grown at a density of 4 plants per pot (9 cm diameter), were cut approximately two weeks before transformation. Plants, which produced new flowers, were dipped for 1 min into the Agrobacteria solution. Transformed plants were sealed with a plastic bag and incubated for 24 h in the dark. Plants were watered for two additional weeks to allow seed development and were then dried.

4.2.5 Selection of transformed plants The F1 generation after plant transformation was harvested and surface sterilized. Seeds were distributed on AM plates containing 15µg/ml Hyg B. After vernalization (2d at 4°C), the seeds were put for 6h in light, to promote germination. Afterwards they were grown for 3d in darkness at 22°C. Resistant plants showed a clearly elongated hypocotyl compared to not transformed plants. The plates were transferred back to normal light conditions, where only the transformed plants were efficiently expanding the cotyledons and showed a visible root growth. These antibiotic resistant plants were then transferred to soil.

4.2.6 Analysis of putative transformed lines The F2 generation of selected Hyg B resistant plants was analyzed again for the resistance to Hyg B and the ratio of Hyg B resistant to not resistant seedlings was counted. Single insertion lines were chosen as reference lines, but, if helpful, the analysis was also extended to double insertion lines. Putative marker lines were

64 identified furthermore by the observation of the expected signal. Overexpression lines were proofed by analysis of the expression level of the depicted gene.

4.2.7 RNA extraction from plants RNA was extracted according to the TRIzol® method (Invitrogen) from roots of 10d old seedlings. Good RNA quality was confirmed through agarose-electrophoresis and a spectrophotometric measurement.

4.2.8 GUS staining of Arabidopsis thaliana Seedlings were fixed for 10 min in cold 90% acetone solution. Subsequently they were moved into GUS staining solution and were incubated for 30 min at 37°C in dark conditions. After the staining the seedlings were rinsed in phosphate buffer and were mounted on slides in a chloralhydrate/H2O/glycerol (2:1:1) solution.

4.2.9 Root length measurements At minimum 5d old seedlings, growing on AM-medium, were scanned together with a scale bar. The root length, from root-shoot junction to root tip, was measured with the ImageJ program.

4.2.10 Measurement of root hair length Pictures of root hairs of 5d old seedlings, growing on AM-medium, were taken with binocular and the root hair length was measured with the ImageJ program.

4.2.11 Count of lateral and adventitious roots The emerged AR and LR of 6d old seedlings were counted using a binocular.

4.2.12 Genotyping of the T-DNA insertion lines Genotyping of T-DNA insertion lines generated in the SALK institute was done using oligonucleotides suggested on the website http://signal.salk.edu/ for the respective mutant line. Briefly, two oligonucleotides flank the insertion point of the T-DNA. Only in absence of the T-DNA the PCR generates the predicted product of approximately 1kb. If a homozygous T-DNA insertion mutant is analyzed, no amplification can be observed.

The T-DNA presence is then further confirmed through a second PCR, which is based on one flanking oligonucleotide and one T-DNA localized oligonucleotide.

4.2.13 EMS mutagenesis of Arabidopsis thaliana seeds This work was already conducted in my diploma, however seeds were used also for this work. In brief, 400mg of WT seeds were incubated for 4 days on a wet nylon mesh in the cold room (vernalization). Afterwards, seeds were moved to the growth chamber for 24h and were subsequently incubated in a 0.3% EMS solution for 8h on a gently shaking platform. After mutagenesis, the seeds were extensively washed with water and 5000 seeds were put on soil at a density of 9 plants per pot. The M2 seeds were harvested for each pot separately.

4.2.14 Identification of pABA resistant EMS mutants The rap mutants were already identified in my diploma through a bulked mutant screen for pABA resistant mutants. Since the rap1 mutant is lethal, a second screen was initiated for this work, aiming to identify a heterozygous line of rap1 . The corresponding pool was identified by screening pool by pool for the highly pABA resistant rap1 phenotype. One pool was identified to contain putatively rap1 and 54 WT like seedlings of this pool were propagated. One propagated line showed to 25% the rap1 phenotype and was assigned as rap1 .

4.2.15 Microscopy Light microscopy was conducted using with a Zeiss Axiovert 200M MOT (Carl Zeiss MicroImaging, Germany) for high magnification pictures. Low magnification pictures were taken with a Zeiss Stemi SV11 Apo stereomicroscope (Carl Zeiss MicroImaging, Germany).

4.2.16 Preparation of electro-competent E. coli cells The E. coli strain was streaked out on LB medium and incubated o/n at 37°C. One single colony was inoculated into 2,5ml LB medium and was incubated o/n at 37°C on at 190rpm. This small culture was subsequently transferred into 300ml of LB medium, which was incubated at 37°C at 190rpm until an OD 600 of approximately 0,5 was achieved. The bacterial culture was cooled down for 15min on ice. Bacteria were pelleted by centrifuging for 5min at 4°C with 3500rpm. Supernatant was discarded

66 and bacteria were resuspended as well as incubated in 90ml ice-cold TfbI buffer for 15min. Centrifugation was repeated and bacteria were finally dissolved in 5ml ice- cold TfbII buffer. Competent bacteria were divided into 100µl aliquots, frozen in dry ice and stored at -80°C.

4.2.17 Preparation of competent A. tumefaciens cells A single colony of A. tumefaciens was inoculated in 10 ml YEP medium, supplemented with Rif and Gent, and was grown o/n at 28°C. Bacteria were transferred to a 100ml YEP (+Rif, Gent) and grown to an OD 600 of 0.5 –0.8. Growth was stopped by cooling 15 min on ice. Bacteria were centrifuged afterwards for 5 min at 4000 x g at 4°C. The supernatant was discarded; the bacteria were resuspended with 20 ml of 0.15M CaCl2. Centrifugation was repeated, supernatant discarded and the pelleted agrobacteria were resuspended in 2 ml of 20 mM CaCl2. Competent agrobacteria were divided into 200 µl aliquots, snap frozen in liquid nitrogen and stored at -80°C.

4.2.18 Transformation of chemically competent E. coli Competent E. coli were thawed 30min on ice. 10-50ng of DNA was added and the sample was incubated, after a gentle mix, 1min on ice. After this, the sample was incubated at 42°C for 1min and 1ml SOC-medium was added. The sample was shaken for 1h at 37°C and was finally transferred to solid LB medium, which contained appropriate antibiotics.

4.2.19 Transformation of competent A. tumefaciens cells Competent agrobacteria were thawed on ice and 1 µg of vector DNA was added. The sample was mixed very gently and transferred for 1 min on ice. Subsequently the sample was transferred to 37°C for 5 min. After heat shock bacteria were diluted in 1ml YEP medium and incubated 3h at 28°C. Bacteria were afterwards pelleted by centrifugation and resuspended in 100 µl YEP. Finally bacteria were plated on YEP agar plates, supplemented with the appropriate antibiotics, and were grown for 2d at 28°C.

4.2.20 Minipreparation of plasmid DNA Minipreparation of plasmid DNA from bacteria was done with the “PureLink™ Quick Plasmi d Miniprep Kit” according to the manufactures suggestions.

4.3 Cloning procedures

4.3.1 General procedures Standard molecular biology methods, were conducted according to Ausubel et al. and Sambrook et al. 112,113 . PCRs were done using either the KOD polymerase (from Novagen) or the Phusion polymerase (from Finnzymes) according to suggestions of the manufacturers. The specific sequences of interest in all established entry clones were confirmed by sequencing for their entire correctness. All generated expression vectors were transformed to Arabidopsis thaliana Col0 plants.

4.3.2 BP Cloning BP cloning was done using the Gateway® BP Clonase® II enzyme mix from Invitrogen according to suggestions of the manufacturer. BP Cloning uses specific recombination sites (attB1 and attB2) at both ends of the PCR product. Those PCR products were recombined by the BP Clonase into the pDONR207 vector (from Invitrogen), which contains the attP1 and attP2 sites, generating entry clones.

4.3.3 LR Cloning LR Cloning was done using the Gateway® LR Clonase® II enzyme mix from Invitrogen according to suggestions of the manufacturer. LR Cloning uses the entry clones, which contain the sequence of interest, flanked by the attL1 and attL2 sites, and transfers those sequences to destination vectors (marked by attR sites), generating expression vectors.

4.3.4 TOPO Cloning TOPO Cloning was done using the pENTR™⁄D -TOPO® Cloning Kit from Invitrogen according to suggestions of the manufacturer. TOPO Cloning is based on the activity of the TOPO-isomerase, which recognizes PCR products due to a specific CACC motif at the 5’ end. Such PCR products are incorporated into the cut pENTR vector,

68 which is characterized by a complementary overhang, at which the respective PCR products are linked in by the TOPO-isomerase.

4.3.4 Conventional cloning Ligations, DNA blunting and restriction digests were done with the corresponding enzymes from Fermentas according to the suggestions of the manufacturer.

4.3.5 Cloning of the ADCS promoter A 2175bp fragment of the ADCS promoter was amplified in two parts from genomic DNA. The oligonucleotides pADCS3_fw/ pADCS_muta_rev were used to amplify the first part, while the oligonucleotides pADCS_muta_fw/pADCS2_rev were used to amplify the second part. These two PCR products overlapped each other at a length of 27bp, which was used to fuse them. From this fusion the whole pADCS fragment was amplified using the primers pADCS3_fw and pADCS2_rev. The PCR fragment was cloned by BP cloning to pDONR207. The first intron of the ADCS promoter, which is located in the 5’UTR, 5bp upstream of the ATG, was removed. For this, the promoter without the intron was amplified from the WT ADCS promoter using the primers pADCS3fw and pADCS_nointron_rev. The 5bp fragment, which separates intron and ATG, was included in the intronless ADCS promoter. The amplified intronless ADCS promoter fragment was cloned by BP cloning into the pDONR207. The WT version as well as the intronless version of the ADCS promoter was then further cloned from pDONR207 to pMDC162 by LR cloning.

4.3.6 Modification of pMDC32 The pMDC32 vector contained the 35Spromoter, which might disturb expression studies of native genes. To use this vector also for other applications than overexpression, the 35S promoter was cut out by using the restriction sites AscI and SbfI. The so digested vector was blunted and ligated. The absence of the 35S promoter was checked by digestion and sequencing, which confirmed the novel vector pMDC32-35S.

4.3.7 Cloning of the pADCS::CTS::ECFP reporter Promoter of ADCS , CTS and ECFP reporter were amplified in three independent PCRs using the primers pADCS-1007attB1fw/pADCS_1574_rev, cADCS_OL_fw/ADCS_CFP_rev and ADCS_ECFP_fw/attB2_BamHI_ECFP_rev. These three fragments were overlapping each other and were fused. The fused product was directly cloned into the pDONR207 vectorby BP cloning. Since the promoter length is only 1007bp in this ECFP-construct, it was linked to the longer promoter version (section 4.3.1) using the native restriction site MfeI (970bp upstream of the ATG) and the PstI site (on the pDONR207 vector). This resulted in a 2436bp fragment of native ADCS sequence upstream of the ECFP sequence. This fragment was moved via the LR-reaction into the pMDC32-35S vector.

4.3.8 Cloning procedure of the complete ADCS gene To fuse ADCS promoter to ADCS genomic sequence a silent SbfI restriction site was generated in the CTS sequence. This was done by fusing the PCR product of the oligonucleotides pADCS-1007attB1fw/CTS_SbfI_rev to the PCR product of the oligonucleotides CTS_SbfI_fw/attB2_ECFP_BamHI_rev, both amplified from pADCS::CTS::ECFP (section 4.3.3). After generation of the pADCS::CTS::ECFP (containing the silent SbfI site) the construct was linked to the long ADCS promoter like it is described in section 4.3.3. This artificial, but silent, SbfI site in the CTS region was used to insert the genomic fragment of ADCS . The genomic fragment of ADCS was amplified from genomic DNA using the oligonucleotides CTS_SbfI_fw/gADCS_3UTR_BamHI_rev. The PCR product was digested by SbfI and BamHI and was ligated into pADCS::CTS::ECFP(SbfI) replacing partially the CTS and the ECFP sequence, which was flanked by an BamHI restriction site (see section 4.3.3). This generates a 6539bp fragment of the ADCS gene, which spans the region of 2175bp upstream of the ATG until the end of the 3’UTR region. This fragment of ADCS was transferred from pDONR207 to pMDC32-35S via the LR reaction.

4.3.9 Cloning of an EST inducible RNAi expression vector To generate an inducible RNAi expression vector the gateway® ready RNAi cassette from the constitutive RNAi expression vector pJawohl8 was transferred to pMDC7

70 using the restriction sites SpeI and XhoI. This generates an EST inducible RNAi expression vector, subsequently called pMDC7RNAi.

4.3.10 Cloning of the ADCS-RNAi construct The RNAi was amplified from genomic DNA using the oligonucleotides RNAi_vs_ADCS_fw/RNAi_vs_ADCS_rev and was cloned into the pDONR207 vector. In a second step the RNAi was transferred to the expression vector pMDC7RNAi.

4.3.11 Cloning of the 35S::ADCS construct This construct was already generated in my diploma; however it was used to generate new transformed ADCS overexpression lines. In brief, the cDNA of ADCS was amplified by PCR through the oligonucleotides cADCS_F and cADCS_R and was cloned into the pDONR207 vector and subsequently to pMDC32, which generates the 35S::ADCS construct.

4.3.12 Cloning of pDHPS::GUS A 1998bp fragment upstream of the ATG of the promoter of DHPS was amplified from genomic DNA using the oligonucleotides pHPPKDHPS_fw/pHPPKDHPS_rev. This fragment was cloned into the pDONR207and furthermore to the pMDC162 expression vector.

4.3.13 Cloning of pUGT75B::NLS3xYFP The promoter of UGT75B was amplified using the oligonucleotides TOPO_HindIII_ppABAGlc-2076_fw/ppABAGlc+2_BamHI_rev from genomic DNA. This fragment was cloned via TOPO® cloning to the pENTR vector. The fragment was linked, by using the restriction sites HindIII and BamHI, to a NLS3xYFP fragment residing on the vector MU006 (from T. Laux). From there the whole construct was moved via the restriction sites HindIII and SacI into pMDC32. These second ligation replaced the 35S promoter as well as the gateway® cassette in pMDC32, generating the pUGT75B::NLS3xYFP expression clone.

4.3.14 Cloning of lex::UGT75B The UGT75B genomic sequence, flanked by both UTRs, was amplified using the primers pABAGlc_TOPO_fw and pABAGlc_rev and was cloned by TOPO® cloning

71 into the pENTR vector. Subsequently it was cloned by the LR reaction (Invitrogen) into the pMDC7 vector, which revealed a construct, which allows EST inducible overexpression of UGT75B.

5 References

1 Hanson, A. D. & Gregory, J. F. Folate Biosynthesis, Turnover, and Transport in Plants. Annu Rev Plant Biol 62 , 105-125 (2011). 2 Ames, B. N. Micronutrient deficiencies. A major cause of DNA damage. Ann N Y Acad Sci 889 , 87-106 (1999). 3 Bailey, L. B. & Gregory, J. F. Folate metabolism and requirements. J Nutr 129 , 779- 782 (1999). 4 Lucock, M. Folic acid: nutritional biochemistry, molecular biology, and role in disease processes. Mol Genet Metab 71 , 121-138 (2000). 5 Stover, P. J. Physiology of folate and vitamin B12 in health and disease. Nutr Rev 62 , S3-12 (2004). 6 Study, M. V. Prevention of neural tube defects: results of the Medical Research Council Vitamin Study. . Lancet 338 , 131-137 (1991). 7 Bower, C. & Wald, N. J. Vitamin B12 deficiency and the fortification of food with folic acid. Eur J Clin Nutr 49 , 787-793 (1995). 8 Bekaert, S. et al. Folate biofortification in food plants. Trends Plant Sci 13 , 28-35 (2008). 9 Diaz de la Garza, R. I., Gregory, J. F. & Hanson, A. D. Folate biofortification of tomato fruit. Proc Natl Acad Sci USA 104 , 4218-4222 (2007). 10 Storozhenko, S. et al. Folate fortification of rice by metabolic engineering. Nat Biotechnol 25 , 1277-1279 (2007). 11 Nunes, A. C., Kalkmann, D. C. & Aragao, F. J. Folate biofortification of lettuce by expression of a codon optimized chicken GTP cyclohydrolase I gene. Transgenic Res 18 , 661-667 (2009). 12 Basset, G. et al. Folate synthesis in plants: The first step of the pterin branch is mediated by a unique bimodular GTP cyclohydrolase I. Proc Natl Acad Sci USA 99 , 12489-12494 (2002). 13 Basset, G. J. et al. Folate synthesis in plants: The p-aminobenzoate branch is initiated by a bifunctional PabA-PabB protein that is targeted to plastids. Proc Natl Acad Sci USA 101 , 1496-1501 (2004). 14 Basset, J. C. et al. Folate synthesis in plants: the last step of the p-aminobenzoate branch is catalyzed by a plastidial aminodeoxychorismate lyase. Plant J 40 , 453-461 (2004). 15 Rebeille, F., Macherel, D., Mouillon, J. M., Garin, J. & Douce, R. Folate biosynthesis in higher plants: purification and molecular cloning of a bifunctional 6-hydroxymethyl-

7,8-dihydropterin pyrophosphokinase/7,8-dihydropteroate synthase localized in mitochondria. EMBO J 16 , 947-957 (1997). 16 Ishikawa, T., Machida, C., Yoshioka, Y., Kitano, H. & Machida, Y. The GLOBULAR ARREST1 gene, which is involved in the biosynthesis of folates, is essential for embryogenesis in Arabidopsis thaliana. Plant J 33 , 235 –244 (2003). 17 Suh, J. R., Herbig, A. K. & Stover, P. J. New perspectives on folate catabolism. Annu Rev Nutr 21 , 255-282 (2001). 18 Srivastava, A. C. et al. The Folylpolyglutamate Synthetase Plastidial Isoform Is Required for Postembryonic Root Development in Arabidopsis. Plant Physiol 155 , 1237-1251 (2011). 19 Sahr, T., Ravanel, S. & Rebeille, F. Tetrahydrofolate biosynthesis and distribution in higher plants. Biochem Soc Trans 33 , 758-762 (2005). 20 Jabrin, S., Ravanel, S., Gambonnet, B., Douce, R. & Rébeillé, F. One-Carbon Metabolism in Plants. Regulation of Tetrahydrofolate Synthesis during Germination and Seedling Development. Plant Physiol 131 , 1431-1439 (2003). 21 Nawy, T. et al. Transcriptional Profile of the Arabidopsis Root Quiescent Center. Plant Cell 17 , 1908-1925 (2005). 22 Díaz de la Garza, R. et al. Folate biofortification in tomatoes by engineering the pteridine branch of folate synthesis. Proc Natl Acad Sci USA 101 , 13720-13725 (2004). 23 Roux, B. & Walsh, C. T. p-aminobenzoate synthesis in Escherichia coli: kinetic and mechanistic characterization of the amidotransferase PabA. Biochemistry 31 , 6904- 6910 (1992). 24 Camara, D., Richefeu-Contesto, C., Gambonnet, B., Dumas, R. & Rébeillé, F. The synthesis of pABA: Coupling between the glutamine amidotransferase and aminodeoxychorismate synthase domains of the bifunctional aminodeoxychorismate synthase from Arabidopsis thaliana. Arch Biochem Biophys 505 , 83-90 (2011). 25 Meinke, D. W. et al. A Sequence-Based Map of Arabidopsis Genes with Mutant Phenotypes. Plant Physiol 131 , 409-418 (2003). 26 Quinlivan, E. P. et al. The Folate Precursor p-Aminobenzoate Is Reversibly Converted to Its Glucose Ester in the Plant Cytosol. J Biol Chem 278 , 20731-20737 (2003). 27 Eudes, A. et al. Metabolism of the Folate Precursor p-Aminobenzoate in Plants: Glucose Ester Formation and Vacuolar Storage. J Biol Chem 283 , 15451-15459 (2008).

28 Hong, Z. L., Zhang, Z. M., Olson, J. M. & Verma, D. P. S. A novel UDP-glucose transferase is part of the callose synthase complex and interacts with phragmoplastin at the forming cell plate. Plant Cell 13 , 769-779 (2001). 29 Okrent, R. A., Brooks, M. D. & Wildermuth, M. C. Arabidopsis GH3.12 (PBS3) Conjugates Amino Acids to 4-Substituted Benzoates and Is Inhibited by Salicylate. J Biol Chem 284 , 9742-9754 (2009). 30 Gregory, J. F. Chemical and nutritional aspects of folate research: analytical procedures, methods of folate synthesis, stability, and bioavailability of dietary folates. Adv Food Nutr Res 33 , 1-101 (1989). 31 Dewick, P. M. The biosynthesis of shikimate metabolites. Nat Prod Rep 15, 17-58 (1998). 32 Hoang, L., Song, K. S., Rhee, I. K., Kim, J. H. & Lee, S. Mechanism by which Bacillus-Derived 2-Aminobenzoic acid inhibits the growth of Arabidopsis thaliana Roots. Journal of Plant Biology 50 , 514-516 (2007). 33 Staswick, P. E. The tryptophan conjugates of jasmonic and indole-3-acetic acids are endogenous auxin inhibitors. Plant Physiol 150 , 1310-1321 (2009). 34 Woodward, A. W. & Bartel, B. Auxin: Regulation, Action, and Interaction. Ann Bot 95 , 707-735 (2005). 35 Darwin, C. & Darwin, F. The power of movements in plants. London, England: Murray (1880). 36 Kögl, F. & Haagen-Smit, A. J. Über die Chemie des Wuchsstoffs. . Proc Kon Akad Wetensch Amsterdam 34, 1411 (1931 ). 37 Went, F. W. & Thimann, K. V. Phytohormones. New York The Macmillan Company (1937). 38 Stepanova, A. N. et al. TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development. Cell 133 , 177-191 (2008). 39 Müller, A. et al. AtPin2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 17 , 6903 –6911 (1998). 40 Bennett, M. J. et al. Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273 , 948-950 (1996). 41 Friml, J., Wisniewska, J., Benkova, E., Mendgen, K. & Palme, K. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415 , 806-809 (2002). 42 Ottenschlager, I. et al. Gravity-regulated differential auxin transport from columella to lateral root cap cells. Proc Natl Acad Sci USA 100 , 2987-2991 (2003). 43 Simon, S. & Petrášek, J. Why plants need more than one type of auxin. Plant Sci 180 , 454-460 (2011).

44 De Rybel, B., Audenaert, D., Beeckman, T. & Kepinski, S. Opportunities and challenges in plant chemical biology. ACS Chem Biol 4, 987 –998 (2009). 45 Katekar, G. F. Auxins-On the nature of the receptor site and molecular requirements for auxin activity. Phytochemistry 18 , 223-233 (1979). 46 Muir, R. M. & Hansch, C. The Relationship of Structure and Plant-Growth Activity of Substituted Benzoic and Phenoxyacetic Acids. Plant Physiol 26 , 369 –374 (1951). 47 Muir, R. M. & Hansch, C. On the Mechanism of Action of Growth Regulators. Plant Physiol 28 , 218-232 (1953). 48 Farrimond, J. A., Elliott, M. C. & Clack, D. W. Charge separation as a component of the structural requirements for hormone activity. Nature 274 , 401-402 (1978). 49 Thimann, K. V. Hormone action in the whole life of plants. University of Massachusetts Press (1977). 50 Toothill, J., Wain, R. L. & Wightman, F. Studies on plant growth-regulating substances. Ann Appl Biol 44 , 547 –560 (1956). 51 Pufky, J., Qiu, Y., Rao, M. V., Hurban, P. & Jones, A. M. The auxin-induced transcriptome for etiolated Arabidopsis seedlings using a structure/function approach. Funct Integr Genomics 3, 135-143 (2003). 52 Delbarre, A., Muller, P., Imhoff, V. & Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta 198 , 532- 541 (1996). 53 Dharmasiri, N., Dharmasiri, S. & Estelle, M. The F-box protein TIR1 is an auxin receptor. Nature 435 , 441-445 (2005). 54 Kepinski, S. & Leyser, O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435 , 446-451 (2005). 55 Ruegger, M. et al. Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects. Plant Cell 9, 745-757 (1997). 56 Estelle, M. et al. Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell 9, 109-119 (2005). 57 Walsh, T. A. et al. Mutations in an Auxin Receptor Homolog AFB5 and in SGT1b Confer Resistance to Synthetic Picolinate Auxins and Not to 2,4- Dichlorophenoxyacetic Acid or Indole-3-Acetic Acid in Arabidopsis. Plant Physiol 142 , 542-552 (2006). 58 Hertel, R., Russo, V. E. A. & Thomson, K. S. In-Vitro Auxin Binding to Particulate Cell Fractions from Corn Coleoptiles. Planta 107 , 325-& (1972).

59 Jones, A. M. & Herman, E. M. Kdel-Containing Auxin-Binding Protein Is Secreted to the Plasma-Membrane and Cell-Wall. Plant Physiol 101 , 595-606 (1993). 60 Jones, A. M., Chen, J. G., Ullah, H., Young, J. C. & Sussman, M. R. ABP1 is required for organized cell elongation and division in Arabidopsis embryogenesis. Genes Dev 15 , 902-911 (2001). 61 Paciorek, T. et al. Auxin inhibits endocytosis and promotes its own efflux from cells. Nature 435 , 1251-1256 (2005). 62 Bennett, M. J., Marchant, A., May, S. T. & Swarup, R. Going the distance with auxin: unravelling the molecular basis of auxin transport. Philos Trans R Soc Lond B Biol Sci 353 , 1511-1515 (1998). 63 Taiz, L. & Zeiger, E. Plant Physiology, Fifth Edition. Sinauer Associates (2010). 64 Gälweiler, L. et al. Regulation of Polar Auxin Transport by AtPIN1 in Arabidopsis Vascular Tissue. Science 282 , 2226-2230 (1998). 65 Okada, K., Ueda, J., Komaki, M. K., Bell, C. J. & Shimura, Y. Requirement of the Auxin Polar Transport System in Early Stages of Arabidopsis Floral Bud Formation. Plant Cell 3, 677-684 (1991). 66 Yang, H. & Murphy, A. S. Functional expression and characterization of Arabidopsis ABCB, AUX 1 and PIN auxin transporters in Schizosaccharomyces pombe. Plant J 59 , 179-191 (2009). 67 Blilou, I. et al. The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433 , 39-44 (2005). 68 Cho, M., Lee, S. H. & Cho, H. T. P-glycoprotein4 displays auxin efflux transporter-like action in Arabidopsis root hair cells and tobacco cells. Plant Cell 19 , 3930-3943 (2007). 69 Titapiwatanakun, B. et al. ABCB19/PGP19 stabilises PIN1 in membrane microdomains in Arabidopsis. Plant J 57 , 27-44 (2009). 70 Petricka, J. J. & Benfey, P. N. Root layers: complex regulation of developmental patterning. Curr Opin Genet Dev 18 , 354-361 (2008). 71 Petricka, J. J., Van Norman, J. M. & Benfey, P. N. Symmetry breaking in plants: molecular mechanisms regulating asymmetric cell divisions in Arabidopsis. Cold Spring Harb Perspect Biol 1 (2009). 72 Bennett, T. & Scheres, B. Root development-two meristems for the price of one? Curr Top Dev Biol 91 , 67-102 (2010). 73 Grieneisen, V. A., Xu, J., Maree, A. F., Hogeweg, P. & Scheres, B. Auxin transport is sufficient to generate a maximum and gradient guiding root growth. Nature 449 , 1008-1013 (2007).

74 Sabatini, S. et al. An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 99 , 463-472 (1999). 75 Petersson, S. V. et al. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell 21 , 1659-1668 (2009). 76 Aida, M. et al. The PLETHORA Genes Mediate Patterning of the Arabidopsis Root Stem Cell Niche. Cell 119 , 109-120 (2004). 77 Galinha, C. et al. PLETHORA proteins as dose-dependent master regulators of Arabidopsis root development. Nature 449 , 1053-1057 (2007). 78 De Smet, I., Vanneste, S., Inze, D. & Beeckman, T. Lateral root initiation or the birth of a new meristem. Plant Mol Biol 60 , 871-887 (2006). 79 Ditengou, F. A. et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc Natl Acad Sci USA 105 , 18818-18823 (2008). 80 Kutschera, U., Bergfeld, R. & Schopfer, P. Cooperation of Epidermis and Inner Tissues in Auxin-Mediated Growth of Maize Coleoptiles. Planta 170 , 168-180 (1987). 81 Kutschera, U. & Niklas, K. J. The epidermal-growth-control theory of stem elongation: an old and a new perspective. J Plant Physiol 164 , 1395-1409 (2007). 82 Morita, M. T. Directional Gravity Sensing in Gravitropism. Annu Rev Plant Biol 61 , 705-720 (2010). 83 Blancaflor, E. B., Fasano, J. M. & Gilroy, S. Laser ablation of root cap cells: implications for models of graviperception. Adv Space Res 24 , 731-738 (1999). 84 Rakusova, H. et al. Polarization of PIN3-dependent auxin transport for hypocotyl gravitropic response in Arabidopsis thaliana. Plant J (2011). 85 Rubery, P. H. Auxin Transport. In Plant Hormones and Their Role in Plant Growth and Development. Dordrecht, The Netherlands: Martinus Nijhoff , 341 –362 (1987). 86 Cossins, E. A. Folate biochemistry and the metabolism of one-carbon units. DD Davies, ed, The Biochemistry of Plants 11 (1987). 87 Boonsirichai, K., Sedbrook, J. C., Chen, R., Gilroy, S. & Masson, P. H. ALTERED RESPONSE TO GRAVITY Is a Peripheral Membrane Protein That Modulates Gravity-Induced Cytoplasmic Alkalinization and Lateral Auxin Transport in Plant Statocytes. Plant Cell 15 , 2612-2625 (2003). 88 Pickett, F. B., Wilson, A. K. & Estelle, M. The aux1 Mutation of Arabidopsis Confers Both Auxin and Ethylene Resistance. Plant Physiol 94 , 1462-1466 (1990). 89 Ludwig-Müller, J., Vertocnik, A. & Town, C. D. Analysis of indole-3-butyric acid- induced adventitious root formation on Arabidopsis stem segments. J Exp Bot 56 , 2095-2105 (2005).

90 Pitts, R. J., Cernac, A. & Estelle, M. Auxin and ethylene promote root hair elongation in Arabidopsis. Plant J 16 , 553-560 (1998). 91 Thimann, K. V. Hormone action in the whole life of plants. Amherst, Mass.: University of Massachussetts Press (1977). 92 Miller, D. M. Dipole moments and non-covalent bonding in gas phase molecules via rotationally resolved electronic spectroscopy: Beyond the rigid rotor. University of Pittsburgh (2010). 93 Banerjee, A. K., Agrawal, P. & Gupta, R. C. NMR-Study of Solid P-Amino Benzoic- Acid - Structure and Group Rotation. J Prakt Chem 315 , 251-257 (1973). 94 Kochersperger, P. Characterization of the Activity of para-Aminobenzoic acid (pABA) during Plant Development. Albert Ludwigs University Freiburg (2008). 95 Hilson, P. et al. Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. Genome Res 14 , 2176-2189 (2004). 96 Curtis, M. D. & Grossniklaus, U. A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133 , 462-469 (2003). 97 Orsomando, G. et al. Evidence for folate-salvage reactions in plants. Plant J 46 , 426- 435 (2006). 98 Leyser, H. M. et al. Arabidopsis auxin-resistance gene AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364 , 161-164 (1993). 99 Zhao, Y. & Hasenstein, K. H. Physiological interactions of antiauxins with auxin in roots. J Plant Physiol 167 , 879-884 (2010). 100 Burstrom, H. Studies on Growth and Metabolism of Roots .4. Positive and Negative Auxin Effects on Cell Elongation. Physiol Plant 3, 277-292 (1950). 101 Fransson, P. & Ingestad, T. The Effect of an Antiauxin on the Indoleacetic Acid Content in Avena Coleoptiles. Physiol Plantarum 8, 336-342 (1955). 102 Katayama, M., Kato, K., Kimoto, H. & Fujii, S. (S)-(+)-4,4,4-Trifluoro-3-(Indole-3- )Butyric Acid, a Novel Fluorinated Plant-Growth Regulator. Experientia 51 , 721-724 (1995). 103 Oono, Y. et al. p-chlorophenoxyisobutyric acid impairs auxin response in Arabidopsis root. Plant Physiol 133 , 1135-1147 (2003). 104 Hasenstein, K. H. & Zhao, Y. C. Primary Root Growth Regulation: The Role of Auxin and Ethylene Antagonists. J Plant Growth Regul 28 , 309-320 (2009). 105 Ulmasov, T., Liu, Z. B., Hagen, G. & Guilfoyle, T. J. Composite structure of auxin response elements. Plant Cell 7, 1611-1623 (1995).

106 Ferro, N. et al. Coulomb and overlap self-similarities: a comparative selectivity analysis of structure-function relationships for auxin-like molecules. J Chem Inf Model 46 , 1751-1762 (2006). 107 Calderon-Villalobos, L. I., Tan, X., Zheng, N. & Estelle, M. Auxin perception-- structural insights. Cold Spring Harb Perspect Biol 2 (2010). 108 Alonso, J. M. et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301 , 653-657 (2003). 109 Koncz, C. & Schell, J. The Promoter of Tl-DNA Gene 5 Controls the Tissue-Specific Expression of Chimeric Genes Carried by a Novel Type of Agrobacterium Binary Vector. Mol Gen Genet 204 , 383-396 (1986). 110 Karimi, M., Inze, D. & Depicker, A. GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7, 193-195 (2002). 111 Helliwell, C., Wielopolska, A., Townley, H., Moore, I. & Waterhouse, P. A high- throughput inducible RNAi vector for plants. Plant Biotechnol J 3, 583-590 (2005). 112 Ausubel, F. M. et al. Current Protocols in Molecular Biology. Grenn Publishing Associates and Wiley InterScience, New York (1996). 113 Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

6 Acknowledgement The two most important persons, which I owe my complete scientific education are Dr. Franck Ditengou and Prof. Dr. Klaus Palme. Due to their example, enthusiasm, patience and thrust in me and this project I learned not only to work scientifically but more importantly was introduced to the spirit of science. A big thank I wish to acknowledge also to every single member of AG Palme, because I started to work already as a student and was accepted and welcome from the very beginning. It was a special pleasure to spend the days together with Katja Rapp, Dulcenia Gomes, Irina Kneuper, Hugues Nziengui, Thomas Blein, Tarasz Pasternak, Christina Dal Bosco, Claude Becker and Francesco Pinosa. I will now and ever remember and miss this time. Thanks to Prof. Massimo Maffei and Prof. Fabrice Rebeille, our external collaborators in the pABA project. During this doctorate work I had the chance to supervise many talented students. The results of Hania Lasok, Nicolai Brekenfeld, Birgit Eisenmann, Nadine Prill and Arne Böddingmeier are an important part of this thesis. Last but not least I would like to thank all people of the biology department, which provide with their continuous efforts the foundation for this scientific work.

Thank you and goodbye...

Philip Kochersperger