ORIGINAL RESEARCH

Stress Levels of Glucocorticoids Inhibit LH␤-Subunit Gene Expression in Gonadotrope Cells

Kellie M. Breen, Varykina G. Thackray, Tracy Hsu, Rachel A. Mak-McCully, Djurdjica Coss, and Pamela L. Mellon

Department of Reproductive Medicine and Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California 92093-0674

Increased glucocorticoid secretion is a common response to stress and has been implicated as a mediator of reproductive suppression upon the pituitary gland. We utilized complementary in vitro and in vivo approaches in the mouse to investigate the role of glucocorticoids as a stress- induced intermediate capable of gonadotrope suppression. Repeated daily restraint stress length- ened the ovulatory cycle of female mice and acutely reduced GnRH-induced LH secretion and synthesis of LH ␤-subunit (LH␤) mRNA, coincident with increased circulating glucocorticoids. Ad- ministration of a stress level of glucocorticoid, in the absence of stress, blunted LH secretion in ovariectomized female mice, demonstrating direct impairment of reproductive function by glu- cocorticoids. Supporting a pituitary action, glucocorticoid receptor (GR) is expressed in mouse gonadotropes and treatment with glucocorticoids reduces GnRH-induced LH␤ expression in im- mortalized mouse gonadotrope cells. Analyses revealed that glucocorticoid repression localizes to a region of the LH␤ proximal promoter, which contains early growth response factor 1 (Egr1) and steroidogenic factor 1 sites critical for GnRH induction. GR is recruited to this promoter region in the presence of GnRH, but not by dexamethasone alone, confirming the necessity of the GnRH response for GR repression. In lieu of GnRH, Egr1 induction is sufficient for glucocorticoid repres- sion of LH␤ expression, which occurs via GR acting in a DNA- and dimerization-independent manner. Collectively, these results expose the gonadotrope as an important neuroendocrine site impaired during stress, by revealing a molecular mechanism involving Egr1 as a critical integrator of complex formation on the LH␤ promoter during GnRH induction and GR repression. (Molecular Endocrinology 26: 1716–1731, 2012)

NURSA Molecule Pages†: Ligands: Corticosterone.

tress profoundly disrupts reproductive function. idence that the glucocorticoid receptor (GR) antagonist, SWhether the nature of the stressor is physical (e.g. RU486, attenuates the inhibitory effect of immobilization foot-shock, exercise), immunological (e.g. infection, ad- stress on LH secretion in male rats or psychosocial stress ministration of cytokines or endotoxins), or psychologi- on pituitary responsiveness to GnRH in ovariectomized cal (e.g. isolation, mental performance tasks), each has ewes implies a physiological role for glucocorticoids in been shown to decrease circulating levels of gonadotro- mediating the inhibitory effects of stress on LH secretion, pins in mammals (1–5). Associated with this reproductive although RU486 can also block the effects of progester- disturbance is an activation of the hypothalamic-pitu- one (6–8). itary-adrenal axis and an elevation in circulating gluco- Although there is little doubt that glucocorticoids sup- corticoids from the adrenal cortex, the final hormonal press gonadotropin secretion, the neuroendocrine mech- effectors of the hypothalamic-pituitary-adrenal axis. Ev- anism underlying this effect is not well understood. Inhi-

ISSN Print 0888-8809 ISSN Online 1944-9917 † Annotations provided by Nuclear Receptor Signaling Atlas (NURSA) Bioinformatics Resource. Printed in U.S.A. Molecule Pages can be accessed on the NURSA website at www.nursa.org. Copyright © 2012 by The Endocrine Society Abbreviations: ChIP, Chromatin immunoprecipitation; DBD, DNA-binding domain; Egr1, early doi: 10.1210/me.2011-1327 Received November 18, 2011. Accepted July 2, 2012. growth response factor 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green First Published Online July 31, 2012 fluorescent protein; GR, glucocorticoid receptor; GST, glutathione-S-transferase; ␣GSU, gly- coprotien hormone alpha-subunit; SF1, steroidogenic factor 1; TK, thymidine kinase.

1716 mend.endojournals.org Mol Endocrinol, October 2012, 26(10):1716–1731 Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1717 bition at the hypothalamic level is supported by evidence fers biological specificity (26). Synthesis of the ␤-subunit that glucocorticoids reduce the frequency of LH pulses in gene of each hormone is the rate-limiting step in the over- ovary-intact female sheep, ovariectomized female rats, all production of LH and FSH (26, 27). Because expres- and women during the follicular phase of the ovulatory sion of each ␤-subunit is tightly controlled by endocrine, cycle (9–11). Because LH pulse frequency is generally paracrine, and autocrine actions, including hypothalamic modulated by the GnRH neurosecretory system, these GnRH, the activin-inhibin-follistatin system, and steroid findings suggest an action of glucocorticoids to suppress hormones of gonadal origin (27, 28), it is possible that the frequency of GnRH pulses. A recent study in follicular GR regulation of transcriptional activity underlies the in- phase sheep provides the first definitive evidence that glu- hibitory effects of stress on the gonadotrope. cocorticoids inhibit GnRH pulses in pituitary portal Transcriptional effects of steroid hormones within the blood (12). GR is expressed within hypothalamic neurons gonadotrope have been shown for the gonadotropin implicated in GnRH regulation (13), and such neurons genes, including Cga, Fshb, and Lhb (29, 30). With regard provide a potential indirect target by which glucocortico- to Lhb, androgen repression of Lhb involves protein-pro- ids may inhibit GnRH secretion or GnRH synthesis (14); tein interactions between the androgen receptor and ste- however, a direct action within the GnRH neuron itself is roidogenic factor 1 (SF1) and is localized to a bipartite supported by evidence that glucocorticoids blunt GnRH SF1 element within the LH␤ proximal promoter, critical synthesis and release from immortalized GnRH neurons, for mediating GnRH responsiveness (31, 32). Progester- GT1–7 cells (15, 16). Thus, the mechanism whereby glu- one repression also involves indirect receptor binding but cocorticoids suppress GnRH and LH remains unclear and differs from androgen repression of LH␤ gene expression may involve direct actions upon the GnRH neuron itself, in that, rather than SF1 elements, progesterone repression indirect actions via another neuronal cell type, or actions involves two novel promoter regions located upstream of upon an extrahypothalamic site. the SF1 sites. Similar to progestins and androgens, gluco- With regard to a site outside of the central nervous corticoids have been shown to inhibit LH␤ gene expres- system, the most obvious possibility is that glucocortico- sion (29, 33), although the mechanism is unclear, raising ids act via GR located within gonadotrope cells of the the possibility that stress impairs fertility by way of dis- anterior pituitary gland. Evidence that glucocorticoids re- ruption of gene expression within the gonadotrope cell. duce the amplitude of the LH response to a GnRH chal- We initiated two lines of investigation in the mouse to lenge in rodents, pigs, cows, and women is consistent with tease apart the mechanisms whereby elevated glucocorti- this possibility (17–20). Further, suppression of respon- coids inhibit gonadotrope responsiveness during episodes siveness to GnRH in vitro has been observed in rodent, of stress. First, we tested the hypothesis that restraint porcine, and bovine pituitary cell cultures, indicating that stress, and/or an elevation in glucocorticoids mimicking glucocorticoids can act directly upon the gonadotrope cell the level induced by restraint stress, can disrupt reproduc- to inhibit responsiveness to GnRH (19–21). Consistent tive function and inhibit gonadotrope production of LH with an action upon the gonadotrope cell, GR has been in female mice. Second, we conducted a series of studies to identified in rat gonadotropes (22), and studies in rat and examine the molecular mechanisms underlying glucocor- pig primary cells suggest that glucocorticoids inhibit sig- ticoid regulation of the LH␤ promoter utilizing the im- naling mechanisms downstream of the GnRH receptor, ␤ including protein kinase C and cAMP (20, 23). It is not mortalized L T2 gonadotrope cell line. known, however, whether these nongenomic actions of glucocorticoids that inhibit intracellular signaling path- ways ultimately lead to a reduction in LH release. Alter- Materials and Methods natively, evidence suggests that glucocorticoids can act Animals genomically to suppress gonadotrope responsiveness by Female C57Bl/6 mice (6 wk of age) were purchased from The regulating transcription and translation of the GnRH re- Jackson Laboratory (Bar Harbor, ME), and housed in a UCSD ceptor gene (24, 25). vivarium animal facility under standard conditions. All animals Another potential mechanism whereby glucocortico- were housed under a 12-h light, 12-h dark cycle (lights on at ids could diminish GnRH responsiveness of the gonado- 0700 h) and provided with food and water ad libitum. Mice trope is via regulation of gonadotropin synthesis. At the were group housed (four females per cage) for 2 wk of acclima- tization. All experimentation was performed between 0900 and molecular level, LH and FSH are glycoprotein hormones 1300 h in a room within the vivarium. Care was taken to min- that exist as heterodimers, consisting of a common and imize pain and discomfort for the animals. Mouse colonies were abundantly expressed glycoprotein hormone alpha-sub- maintained in agreement with protocols approved by the Insti- unit (␣GSU) complexed with a unique ␤-subunit that con- tutional Animal Care and Use Committee at the University of 1718 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731

California, San Diego. All procedures were approved by the Plasmids University of California, San Diego IACUC. The Ϫ1800 rat LH␤-luc in pGL3 was kindly provided by Dr. Mark Lawson. The 5Ј-truncations of the Ϫ1800-bp LH␤-luc Determination of phase of estrous cycle reporter plasmid were created by inserting fragments between At 8 wk of age, vaginal lavage was performed daily (at KpnI and HindIII in pGL3 have been partially described by Thackray et al. (35): Ϫ400, Ϫ300, Ϫ200, Ϫ150, Ϫ87. The 5Ј- 0900 h) by flushing the vagina with distilled H2O. Collected smears were mounted on glass slides and examined microscop- and 3Ј-mutations of either Egr1 or SF1 binding sites in the Ϫ200 ␤ ically for cell type (34). The smears were classified into one of rat LH -luc have been reported previously (35). The reporter three phases of estrus: diestrus, proestrus, or estrus. Female mice plasmids with the multimerized consensus SF1 site (TGACCT- exhibiting two consecutive 4- to 6-d estrous cycles, including TGA) or consensus Egr1 site (CGCCCCCGC) were created by positive classification of diestrus, proestrus, and estrus, were ligating an oligonucleotide, containing four copies of the indi- used in animal experiments. Estrous cycle length was calculated cated site, between KpnI and NheI in pGL3, upstream of the as the length of time between two successive occurrences of 81-bp thymidine kinase (TK) promoter. The sequences of all estrus. The time spent in each cycle stage was calculated as the promoter fragments were confirmed by dideoxynucleotide sequencing. proportion of time classified in each cycle phase during the The mouse Ptx1 pcDNA3 expression vector has been previ- observation period, and values were analyzed by two-way re- ously described (36). The rat Egr1 and mouse SF1 cDNA were peated measures ANOVA, group (no stress vs. stress) ϫ time (d kindly provided by Dr. Jacques Drouin and Dr. Bon-chu Chung, 1–d 18 vs. d 19–d 36). All statistics were performed using JMP respectively. The cDNA were cloned into the pCMV expression 7.0 (SAS Institute, Cary, NC), and significance was established vector using the ClaI/XbaI restriction sites of both plasmids. The as P Ͻ 0.05. human Egr1 cDNA was provided by Dr. Hermann Pavenstadt and was cut using XhoI/EcoRI and inserted into pGEX-5X ex- Restraint stress protocol pression vector using the SmaI restriction site by blunt end clon- After vaginal lavage and estrus classification, mice were ei- ing. Dr. Douglass Forbes provided the green fluorescent protein ther returned to their group home cage (no stress) or placed (GFP) expression plasmid. The wild-type rat GR pSG5 plasmid individually into clear plastic restraint tubes (stress). The venti- was provided by Dr. Keith Yamamoto. Both GR mutants are in lated tubes (Harvard Apparatus, Holliston, MA) are designed to pSG5 and have been previously described; the GRdim4 mutant be small enough to restrain a mouse so that it is able to breathe contains four point mutations that prevent dimerization and but unable to move freely. The restraint devices were cleaned DNA binding of the receptor (29), and the GR DNA-binding between uses with soap, water, and ethanol (70%). Mice are domain (DBD) mutant contains a mutation in the DNA-binding continually observed by experienced personnel during the 180- domain (33). min restraint period. After the restraint period, stress mice are returned to individual home cages or killed by decapitation, and Cell culture and transient transfection trunk blood or pituitary tissue was collected from individual L␤T2 cells, cultured as previously described (29), were animals. Hormone values were analyzed by one-way ANOVA seeded into 12-well plates at 3 ϫ 105 cells per well and incubated followed by Tukey’s post hoc test or two-way ANOVA, group overnight at 37 C. Each well was transfected with 400 ng of the (no stress vs. stress) ϫ time (vehicle vs. GnRH). luciferase-reporter plasmid or control pGL3 vector and 100 ng of a ␤-galactosidase reporter gene regulated by the TK promoter Corticosterone response protocol (TK-␤gal) as a control for transfection efficiency using FuGENE Female mice (8 wk of age) were ovariectomized and allowed 6 transfection reagent (Roche Applied Science, Indianapolis, to recover for 2 wk before experimentation. To test the LH IN). In experiments utilizing Egr1, SF1, or Ptx1 to induce pro- response to a stress level of corticosterone, animals received a moter activity, cells were also transfected with 100 ng Egr1 bolus injection of corticosterone (200 ng/kg, sc) or vehicle. After (unless indicated otherwise) or empty pCMV vector, 100 ng SF1 90 min, animals were killed by decapitation, and trunk blood or empty pCMV vector, 50 ng Ptx1 or empty pcDNA3 vector. Eighteen hours after transfection, cells were transferred to se- was collected from individual animals. Hormone values were rum-free DMEM (supplemented with 0.1% BSA, 5 mg/liter analyzed by one-way ANOVA followed by Tukey’s post hoc transferrin, and 50 nM sodium selenite) containing either the test. natural glucocorticoid, corticosterone (100 nM, Sigma Aldrich, St. Louis, MO), synthetic glucocorticoid, dexamethasone (100 Hormone analysis nM, Sigma Aldrich), or vehicle (0.1% ethanol). When cells were Trunk blood was collected and serum separated by centrifu- treated with GnRH (10 nM; Sigma Aldrich), treatment with gation and stored frozen at Ϫ20 C before analysis at the Center GnRH or vehicle (0.1% BSA) began 6 h before harvest. Cells for Research in Reproduction Ligand Assay and Analysis Core were harvested and extracts were prepared for assay of lu- at the University of Virginia (Charlottesville, VA). Corticoste- ciferase and ␤-galactosidase activity as previously described rone concentrations were determined by RIA in single 25- to (33). 50-␮l aliquots of serum. Assay sensitivity averaged 20.0 ng/ml. CV-1 cells, a monkey kidney cell line that does not express LH concentrations were determined by two-site sandwich im- detectable endogenous GR (37), were seeded into 12-well plates munoassay in duplicate 50-␮l aliquots of serum. Assay sensitiv- at 1.5 ϫ 105 cells per well as previously described (38) and ity averaged 0.07 ng/ml. treated as indicated above with the following addition. Each Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1719 well was transfected with 50 ng of the GR expression vector damine antiguinea pig IgG secondary antibody (ab6905, 1:300 (wild type or mutant) or empty pGS5 vector. dilution; Abcam, Cambridge, MA) plus a goat fluorescein anti- Luciferase reporter experiments were performed in triplicate rabbit IgG secondary antibody (FI-1000; Vector Laboratories, and were repeated at least three times. To normalize for trans- Burlingame, CA; 1:300 dilution) for 60 min at room tempera- fection efficiency, all luciferase values were divided by ␤-galac- ture. After rinsing with PBS, sections were coverslipped with tosidase, and the triplicate values were averaged. To control for Vectashield HardSet mounting medium with 4Ј,6-diamidino-2- interexperimental variation, the control pGL3 reporter plasmid phenylindole (Vector Laboratories). Exclusion of each primary was transfected with TK-␤gal and any relevant expression vec- antibody was run as a negative control, and each antibody was tors, and the average pGL3/␤gal value was calculated. Average run separately to confirm that each immunostaining pattern was luc/␤gal values were divided by the corresponding pGL3/␤gal similar to published reports (40, 41). Specificity of the GR an- value. Individual values obtained from each independent exper- tibody was confirmed by immunoblot analysis of L␤T2 and iment were averaged and analyzed by Student’s t test or one-way CV-1 cell lysates, cell lines previously shown to contain and lack ANOVA followed by Tukey’s post hoc test. GR (29, 37), respectively, which detected a single band of the expected size. Quantitative real-time PCR Sections were viewed using an inverted fluorescence micro- Preparation of cDNA from mouse pituitary or L␤T2 cells scope (Nikon Eclipse TE 2000-U; Nikon, Tokyo, Japan), and was performed as previously described (39). Briefly, RNA was digital images were collected using a Sony CoolSNAP EZ cooled extracted with Trizol reagent (Invitrogen/GIBCO, Carlsbad, charge-coupled device camera (Roper Scientific, Trenton, NJ) CA) according to the manufacturer’s instructions, treated to and analyzed with Nikon Imaging System—Elements image remove contaminating DNA (DNA-free; Ambion, Austin, TX), analysis system (version 2.3; Nikon). and reverse transcribed using Superscript III First-Strand Syn- thesis System (Invitrogen). Quantitative real-time PCR was per- Western blot analysis formed in an iQ5 Real-Time PCR instrument (Bio-Rad Labora- Nuclear extracts were prepared as previously described (36) tories, Inc., Hercules, CA) and used iQ SYBR Green Supermix from L␤T2 cells treated with dexamethasone (100 nM,18h), (Bio-Rad Laboratories) with specific primers for glyceralde- GnRH (10 nM, 45 min), GnRH ϩ dexamethasone or vehicle hyde-3-phosphate dehydrogenase (GAPDH), LH␤, or Egr1 (0.1% BSA/0.1% ethanol). Nuclear extract (20 ␮g) was boiled cDNA. for 5 min in 5ϫ Western-loading buffer, fractionated on a 10% LH␤ forward: CTGTCAACGCAACTCTGG SDS-PAGE gel, and electroblotted for 90 min at 300 mA onto LH␤ reverse: ACAGGAGGCAAAGCAGC polyvinylidene difluoride (Millipore Corp., Billerica, MA) in 1ϫ Egr1 forward: ATTTTTCCTGAGCCCCAAAGC Tris-glycine-sodium dodecyl sulfate/20% methanol. Blots were Egr1 reverse: ATGGGAACCTGGAAACCACC blocked overnight at4Cin3%BSAandthen probed for1hat GAPDH forward: TGCACCACCAACTGCTTAG room temperature with rabbit antihuman Egr1 antibody (sc- GAPDH reverse: GGATGCAGGGATGATGGTTC 110, Santa Cruz Biotechnology) diluted 1:750 in blocking buf- The iQ5 real-time PCR program was as follows: 95 C for 15 fer. Blots were then incubated with a horseradish peroxidase- min, followed by 40 cycles at 95 C for 15 sec, 55 C for 30 sec, linked secondary antibody (Santa Cruz Biotechnology), and and 72 C for 30 sec. Within each experiment, the amount of bands were visualized using the SuperSignal West Pico chemi- LH␤ or Egr1 and GAPDH mRNA was calculated by comparing luminescent substrate (Pierce Biotechnology, Inc., Rockford, a threshold cycle obtained for each sample with the standard IL). Bio-Rad Pre-stained Protein Ladder Plus serves as a size curve generated from serial dilutions of a plasmid containing marker. GAPDH, ranging from 1 ng to 1 fg. All samples were assayed (in triplicate) within the same run, and the experiment was con- Chromatin immunoprecipitation (ChIP) ducted three times. Values were analyzed by one-way ANOVA ChIP assays were performed as previously described (29, 35). followed by Tukey’s post hoc test or two-way ANOVA, group Briefly, confluent L␤T2 cells in 10-cm plates were treated with ϫ (no stress vs. stress) time (vehicle vs. GnRH). dexamethasone (100 nM, 1 h), GnRH (10 nM, 1 h), GnRH ϩ dexamethasone (cotreatment 1 h), or vehicle (0.1% BSA/0.1% Dual immunofluorescence ethanol) and cross-linked with 1% formaldehyde. The nuclear Adult mouse pituitary paraffin tissue sections (Zyagen, San fraction was obtained, and chromatin was sonicated to an av- Diego, CA) were dewaxed in xylene, rehydrated through a series erage length of 300–500 bp using a Branson Sonifier 250 (Bran- of graded ethanol baths, and washed in H20. Sections were son Ultrasonics Corp., Danbury, CT). Protein-DNA complexes immersed in 10 mM sodium citrate buffer (pH 6.0), heated in a were incubated overnight with nonspecific rabbit IgG (sc-2027, standard microwave twice for 5 min, and allowed to stand for Santa Cruz Biotechnology) or rabbit antihuman GR (ab3579, 20 min at room temperature. After a brief wash in PBS, nonspe- Abcam) and precipitated with protein A/G beads. Immunopre- cific binding was blocked with 5% goat serum/0.3% Triton cipitated DNA and DNA from input chromatin were analyzed X-100 for 60 min at room temperature. Dual fluorescence la- by quantitative PCR using primers specific for a 220-bp se- beling was tested on the same section with a guinea pig antirat quence of the mouse LH␤ proximal promoter (Ϫ180 LH␤/ϩ40 LH␤ primary antibody (anti-r␤ LH-IC-2, NIDDK NHPP; 1:200 LH␤). Primers specific to the mouse FSH␤ promoter (Ϫ223 dilution in 5% goat serum/0.3% Triton X-100) plus a rabbit FSH␤/ϩ57 FSH␤) and FSH␤ coding region were used as posi- antimouse GR primary antibody (sc-1004, Santa Cruz Biotech- tive and negative controls, respectively. DNA from immunopre- nology, Inc., Santa Cruz, CA; 1:500 dilution) for 48 h at 4 C. cipitated samples was quantified relative to a standard curve LH␤- and GR-containing cells were revealed using a goat rho- representing percent of input chromatin. For ChIP assays com- 1720 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731 paring chromatin from hormone-treated L␤T2 cells, the fold A enrichment of antibody signal over IgG was calculated for each prestress daily restraint stress primer set, and data from each independent experiment were E normalized to the indicated negative control gene. ChIP and P input samples were quantified using a standard curve made D from ChIP input DNA. ChIP samples were normalized to their E appropriate input samples and are expressed as fold enhance- P D ment over nonspecific IgG. Ϫ180 LH␤-forward: CGAGTGTGAGGCCAATTCACTGG E ϩ40 LH␤-reverse: GGCCCTACCCATCTTACCTGGAGC P D Ϫ223 FSH␤-forward: GGTGTGCTGCCATATCAGAT-

TCGG histological classification Vaginal 1 9182736 ϩ57 FSH␤-reverse: GCATCAAGTGCTGCTACTCACC- Day of assessment TGTG B C FSH␤-coding forward: GCCGTTTCTGCATAAGC 8 5 FSH␤-coding reverse: CAATCTTACGGTCTCGTATACC * The iQ5 real-time PCR program was as follows: 95 C for 15 7 * 4 min, followed by 40 cycles at 95 C for 15 sec, 55 C for 30 sec, and 72 C for 30 sec. All samples were assayed within the same 6 3 run, and the experiment was conducted three times. Individual 5 2 values obtained from each independent experiment were aver- aged and analyzed by one-way ANOVA followed by Tukey’s Cycle length (days) 4 1

post hoc test. stage (days) in cycle Time 3 0 EPD EPD 1-18 19-36 1-18 19-36 1-18 19-36 Glutathione-S-transferase (GST) interaction assay No stress Stress Stress 35 S-labeled proteins were produced using the TnT Coupled FIG. 1. Daily stress disrupts estrous cyclicity in the mouse. A, Reticulolysate System (Promega Corp., Madison, WI). Bacteria Representative profiles depicting estrous cyclicity, as measured by transformed with the GST plasmids were grown to an OD of 0.6 vaginal cytology, during the prestress period (d 1–d 18) and and then induced with isopropyl-␤-d-thiogalactoside overnight subsequent daily restraint stress period (d 19–d 36) in three female at 30 C. The bacterial pellets were sonicated in 0.1% Triton mice subjected to 180 min of daily restraint stress. E, Estrus; P, X-100 and 5 mm EDTA in 1ϫ PBS and centrifuged, and the proestrus; D, diestrus. Shading indicates period of exposure to daily supernatant was bound to glutathione Sepharose 4B resin (Am- restraint stress. B, Average estrous cycle length in the no stress group and stress group (n ϭ 9/group) during the two periods of assessment, ersham Pharmacia Biotech, Piscataway, NJ). The beads were d 1–d 18 and d 19–d 36. C, Time spent in each stage of the cycle in washed four times in PBS and then in HEPES/Nonidet P-40/ stress mice during the prestress period, d 1–d 18, and stress period, d dithiothreitol (HND) buffer [10 mg/ml BSA, 20 mm HEPES (pH 19–d 36. *, Significant (P Ͻ 0.05) group (no stress vs. stress) ϫ time (d 7.8), 50 mm NaCl, 5 mm dithiothreitol, and 0.1% Nonidet 1–d 18 vs. d 19–d 36) interaction. P-40]. For the interaction assay, 35S-labeled in vitro-transcribed ϭ and -translated GR (20 ␮l), SF1 (5 ␮l), or GFP (5 ␮l) was added group (n 9/group), and estrous cyclicity was monitored to the beads with 400 ␮l HND buffer. The beads were incubated for an additional 18 d (d 19–d 36). Figure 1A illustrates for 1 h at 4 C and then washed twice with HND buffer and twice profiles of vaginal histological classification during the with 0.1% Nonidet P-40 in PBS. Thirty microliters of 2ϫ Laem- prestress and stress period of three female mice exposed to mli load buffer were added, and the samples were boiled and 180 min of daily restraint stress. In mice not subjected to then electrophoresed on a 10% sodium dodecyl sulfate-polyac- rylamide gel. One tenth of the 35S-labeled in vitro-transcribed stress, cycle length was not significantly different between and -translated product was loaded onto the gel as input. The gel the two periods of assessment (P Ͼ 0.05; d 1–d 18 vs. d was dried, and the proteins were visualized by autoradiography. 19–d 36, 5.33 Ϯ 0.31 vs. 4.81 Ϯ 0.45 d, Fig. 1B). In contrast, stressed mice exhibited a significant increase in average cycle length in the stress period compared with Results the prestress period (P Ͻ 0.05; d 1–d 18 vs. d 19–d36, 5.25 Ϯ 0.35 vs. 6.75 Ϯ 0.55 d). Specifically, exposure to Chronic restraint stress compromises estrous daily restraint stress significantly increased the time spent cyclicity in diestrus during the stress period, d 19–d 36, without To evaluate the mechanism whereby elevated gluco- altering the time spent in estrus or proestrus as compared corticoids impair reproduction, we developed a model to with the prestress period, d 1–d 18 (P Ͼ 0.05; Fig. 1C). assess whether daily restraint stress disrupts estrous cy- clicity. Vaginal cytology was examined daily by vaginal Acute restraint stress disrupts gonadotrope lavage in a cohort of female mice during an 18-d control function period (d 1–d 18). After this period of observation, mice Having found that repeated exposure to stress com- were randomly assigned to either the stress or no stress promises reproductive neuroendocrine activity as evi- Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1721 denced by a disruption in estrous cyclicity in female mice, A the next step was to focus on the role of the pituitary Blood Blood GnRH Blood gland and test whether gonadotrope responsiveness, as (n=7/grp) (n=7/grp) or Veh (n=7/grp/trt) assessed by GnRH-induced LH synthesis or secretion, is No stress diminished by acute restraint stress. Separate cohorts of Stress female mice, in which estrus cyclicity was confirmed and 017018030 diestrus females selected, were used to assess gonadotrope Time (min) responsiveness to GnRH in the absence or presence of B C # stress. In the first study, GnRH-induced LH secretion was 800 No stress 2.5 Stress * monitored in groups of control mice (no stress) or mice 2.0 600 * exposed to 180 min of restraint stress (Fig. 2A). Blood 1.5 * 400 was collected before stress, as well as 30 and 180 min 1.0 LH (ng/ml) LH after the initiation of the control or stress period for mea- 200 * 0.5 ϭ surement of corticosterone (n 7 per time point per Corticosterone (ng/ml) 0 0 030 180 h group). To assess LH release in response to GnRH, female Ve Veh Time (min) GnRH GnRH diestrus mice were administered GnRH (200 ng/kg, sc; No stress Stress n ϭ 7 per group per treatment) or saline vehicle and killed D 10 min after injection. Blood was collected and processed GnRH Pit or Veh (n=7/grp/trt) for measurement of LH at 180 min after the initiation of stress. This GnRH dose was selected because it has been No stress shown to produce a significant, yet submaximal, LH re- Stress sponse, that peaks 10 min after administration in a mouse 0180Time (min) model of diestrus in which female mice are ovariecto- E mized and estrogen primed (42, 43). Serum levels of cor- 25 Pituitary ticosterone remained low in no stress control animals # (Fig. 2B, open circles); corticosterone levels were signifi- 20 * cantly increased in stressed mice at 30 min (P Ͻ 0.05; 15 stress vs. no stress, 588.6 Ϯ 26.4 vs. 108.8 Ϯ 35.5 ng/ml) 10 * /GAPDH mRNA

and remained significantly elevated 180 min after initia- β 5 tion of restraint (Fig. 2B, gray circles). Stress did not sig- LH nificantly induce serum levels of progesterone at either 30 0 min or 180 min after the initiation of restraint (data not VehGnRH Veh GnRH No stress Stress shown). Mean LH in the no stress diestrus females receiv- FIG. 2. Acute stress disrupts pituitary responsiveness to GnRH. A, ing vehicle was not significantly different from values in Schematic depicting events during the 180-min observation period in the vehicle-treated stress animals, indicating that stress which animals were maintained in no stress conditions (white bar)or does not significantly impair responsiveness to endoge- subjected to restraint stress (gray bar) for measurement of circulating Ͼ corticosterone and GnRH-induced LH. Time of euthanasia and blood nous GnRH in this animal model (P 0.05; stress Veh vs. collection (Blood coll’n) are indicated: 0, 30, and 180 min. At 170 min, no stress Veh, Fig. 2C). In the no stress group, exogenous no stress and stressed animals (group) are divided into two treatments GnRH caused a robust increase in circulating LH levels as (n ϭ 7/group per treatment) receiving either GnRH (200 ng/kg, sc) or Ͻ Ϯ vehicle (Veh). B, Serum corticosterone (ng/ml) was measured in no compared with vehicle-treated animals (P 0.05; 1.83 stress (white circles) and stress animals (gray circles). *, Significant 0.23 vs. 0.56 Ϯ 0.11 ng/ml, Fig. 2C). GnRH also signifi- (P Ͻ 0.05) effect of stress. C, Serum LH (ng/ml) was measured in no stress cantly increased LH in stressed animals (P Ͻ 0.05, Fig. (white bars) and stressed (gray bars) animals that received vehicle or Ͻ 2C). However, the LH response to exogenous GnRH was GnRH, respectively, 10 min before euthanasia. *, Significant (P 0.05) effect of GnRH; #, difference between no stress and stress. D, Schematic significantly blunted in restraint-stressed animals com- depicting events during 180-min observation period in which animals are pared with the response in no stress controls (P Ͻ 0.05; maintained in no stress conditions (white bar) or subjected to restraint stress GnRH vs. no stress GnRH, 1.19 Ϯ 0.18 vs. 1.83 Ϯ stress (gray bar) for measurement of GnRH-induced LH␤ mRNA. No stress and stressed animals are divided into two groups (n ϭ 7/group) receiving 0.23 ng/ml; Fig. 2C), suggesting that stress diminishes the either GnRH (200 ng/kg, sc) or vehicle (Veh) at 0 min of observation. Time ability of the pituitary to respond to GnRH. Taken to- of euthanasia and blood collection (Blood coll’n) occurred at 180 min. E, gether, these experiments reveal an interplay between Quantitative RT-PCR analysis of LH␤ mRNA was performed on individual mouse pituitary glands, and the amount of LH␤ mRNA was compared GnRH and stress and implicate responsiveness of the pi- with the amount of GAPDH mRNA and expressed as relative transcript tuitary gonadotrope as a potential neuroendocrine site of level. *, Significant (P Ͻ 0.05) effect of GnRH; #, difference between no LH suppression. stress and stress. grp, Group; trt, treatment. 1722 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731

We further investigated the response of the gonado- A trope by analyzing GnRH-induced LH␤ mRNA tran- Cort Blood or Veh (n=6/trt) script level in mice exposed to restraint stress. Initially, diestrus female mice received saline vehicle or GnRH (200 ng/kg, sc; n ϭ 7 per group per treatment) and were sub- sequently sorted into no stress or stress treatment groups 090Time (min) (Fig. 2D). Animals were killed and the pituitary glands B 1000 C 4 were collected for mRNA analysis by quantitative RT- * ␤ 750 3 PCR. Stress did not alter basal LH transcript levels com- * pared with expression in no stress vehicle controls (P Ͻ 500 2 0.05; stress Veh vs. no stress Veh; Fig. 2E). In the absence 250 LH (ng/ml) 1 of stress, exogenous GnRH resulted in a 4-fold increase in 0 0 ␤ Corticosterone (ng/ml) LH mRNA compared with values in vehicle-treated an- Veh Cort Veh Cort imals (P Ͻ 0.05; Fig. 2E). In stressed mice, the LH␤ tran- script level in response to GnRH was significantly re- DEF duced by approximately 45% (P Ͻ 0.05; no stress GnRH * * vs. stress GnRH, 16.5 Ϯ 2.3 vs. 8.9 Ϯ 1.1; Fig. 2E). * Collectively, these observations raise the possibility that stress can interfere with ovarian cyclicity by disrupting FIG. 3. Glucocorticoids inhibit LH and GR are expressed in mouse the synthesis and secretion of LH at the level of the ante- gonadotrope cells. A, Schematic depicting experimental events in rior pituitary gonadotrope cell. which animals were administered corticosterone (200 ng/kg, sc; gray bar) or vehicle (white bar), 90 min before euthanasia and blood collection (Blood coll’n). B and C, Serum corticosterone (ng/ml, panel Glucocorticoids impair LH secretion in vivo B) or LH (ng/ml, panel C) measured in animals administered vehicle potentially via receptors expressed in mouse (white bars) or corticosterone (gray bars). *, Significant (P Ͻ 0.05) gonadotrope cells effect of treatment. D–F, Photomicrographs of representative mouse Our studies thus far demonstrate that circulating glu- pituitary sections subjected to two-color immunofluorescence staining using a fluorescein isothiocyanate-conjugated anti-GR (green cocorticoids are increased within 30 min and remain sig- fluorescent signal), followed by rhodamine-conjugated anti-LH␤ (red nificantly elevated for the 180-min stress paradigm (Fig. fluorescent signal). Red (panel D), green (panel E), and merge (panel F) 2). Because stress likely induces a host of inhibitory inter- immunofluorescence images were taken of the same microscopic field using appropriate filters. White stars, GR-positive/LH␤-positive cells. mediates, any of which could alter reproductive activity, Scale bar,20␮m. Cort, Corticosterone; trt, treatment; Veh, vehicle. we directly assessed the role of glucocorticoids by testing the hypothesis that a stress-like level of glucocorticoid in nadotrope, we used dual-label immunofluorescence of female mice reduces LH secretion. Pilot studies were con- adult mouse anterior pituitary sections for LH␤ and GR ducted to identify a dose of glucocorticoid that approxi- (rhodamine- and fluorescein isothiocyanate-conjugated mated a stress level (ϳ750 ng/ml) and an animal model secondary antibodies, respectively; Fig. 3, D–F). LH␤ im- that eliminated confounding effects of ovarian steroids. munostaining identified gonadotropes that accounted for a Blood was collected 90 min after a bolus administration small proportion of labeled anterior pituitary cells (Fig. 3D), of vehicle or corticosterone (200 ng/kg, sc; n ϭ 6 per whereas GR immunostaining occurred in an extensive pop- treatment) to ovariectomized female mice (Fig. 3A). Cor- ulation of pituitary cells (Fig. 3E). Of interest, numerous ticosterone remained low in mice treated with vehicle, yet LH␤-containing gonadotropes showed GR staining, con- values were markedly elevated after administration of firming the presence of GR in this anterior pituitary cell type corticosterone (P Ͻ 0.05; Fig. 3B). Treatment with corti- in the mouse (merge, white stars, Fig. 3F). costerone significantly reduced mean LH as compared with the value in mice treated with vehicle (P Ͻ 0.05; Cort Glucocorticoids regulate LH␤ gene expression in vs. Veh, 3.4 Ϯ 0.3 vs. 1.9 Ϯ 0.6 ng/ml, Fig. 3C), demon- gonadotrope cells strating sufficiency of glucocorticoids to disrupt repro- Having confirmed the presence of GR in adult mouse ductive neuroendocrine function and relevancy as an in- pituitary gland, we next tested the hypothesis that the hibitory factor induced during stress. stress-induced decrease in LH␤ mRNA expression could Evidence that GR is expressed in gonadotrope cells in be recapitulated in cultured gonadotrope cells. As ex- the rat (22) supports our hypothesis of a direct action of pected, immortalized pituitary gonadotrope cells, L␤T2, glucocorticoids via GR within mouse gonadotrope cells. responded to GnRH with a 2-fold increase in endogenous To confirm the presence of this receptor in mouse go- LH␤ mRNA as measured by quantitative RT-PCR (Fig. Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1723

4A). Treatment of L␤T2 cells with a physiological, stress appropriate model for investigating the role of glucocor- level of corticosterone decreased GnRH-induced LH␤ ticoid-induced suppression of LH␤ gene expression. mRNA expression (P Ͻ 0.05; GnRH vs. GnRH ϩ Cort, We began to dissect out the mechanism whereby glu- 2.1 Ϯ 0.3 vs. 1.6 Ϯ 0.1; Fig. 4A); however, corticosterone cocorticoids reduce LH␤-subunit induction in L␤T2 cells, alone did not reduce LH␤ expression. These findings in- by investigating the regulation of an LH␤-luciferase re- dicate that repression by glucocorticoids occurs in the pres- porter after incubation with either natural or synthetic ␤ ence of GnRH and confirm the L␤T2 gonadotrope cell is an glucocorticoids. For this purpose, L T2 cells were tran- siently transfected with Ϫ1800 bp of the rat LH␤ regula- tory region fused upstream of a luciferase reporter gene A (LH␤-luc) or pGL3 control plasmid and treated with cor- 3.0 # ticosterone (100 nM), dexamethasone (100 nM), or vehicle 2.5 * 2.0 (0.1% ethanol) for 24 h before harvest. Neither the nat- ural glucocorticoid, corticosterone, nor the synthetic glu- 1.5 *

/GAPDH mRNA cocorticoid, dexamethasone, significantly altered basal β 1.0 Ϫ ␤ Ͼ

LH expression of the 1800-bp LH promoter (P 0.05; 0 Veh Cort GnRH GnRH Veh vs. Cort or Dex; Fig. 4B). In contrast, both glucocor- +Cort B ticoids significantly blunted the robust increase in pro- 6 moter activity induced by GnRH (10 nM, final6hof 5 * # Ͻ

gal # glucocorticoid treatment; P 0.05; Fig. 4B). Specifically, β 4 ␤ 3 * * GnRH resulted in a 4.6-fold induction of LH -luc, which -Luc/

β 2 was reduced 35% by corticosterone, or 45% by dexa- LH Fold induction 1 methasone. Although both glucocorticoids are capable of 0 VehCort Dex GnRH GnRH GnRH transcriptional repression of GnRH induction of the LH␤ C +Cort +Dex promoter, we focused on the synthetic glucocorticoid, 5 GnRH dexamethasone, based on the intensity of its effect and 4 GnRH + Dex evidence for its potent interaction with the endogenous gal β 3 # steroid receptor, GR, expressed in L␤T2 cells (29) and # # #

-Luc/ 2 #

β identified in mouse gonadotrope cells (Fig. 3). LH Fold induction 1 Using a promoter truncation approach, we identified 0 ␤ -1800 -400 -300 -200 -150 -87 regions of the LH gene that are functionally involved in Truncation from transcription start site glucocorticoid regulation. L␤T2 cells were transiently FIG. 4. Glucocorticoid repression localizes to the LH␤ proximal transfected with a series of truncated LH␤ reporter plas- promoter. A, Quantitative RT-PCR analysis of LH␤ mRNA extracted mids, ranging in length from Ϫ1800 to Ϫ87 bp of the from L␤T2 cells cultured in the presence of GnRH (10 nM, 6 h), 5Ј-regulatory sequence. Figure 4C illustrates the effect of corticosterone (Cort; 100 nM, 24 h), GnRH ϩ corticosterone [Cort (100 nM, entire 24 h); GnRH (10 nM, final 6 h)], or vehicle (Veh; 0.1% BSA/ treatment with GnRH in the presence or absence of dexa- 0.1% ethanol). Results are expressed as LH␤ mRNA levels normalized methasone on progressive 5Ј-LH␤ promoter truncations. to GAPDH mRNA levels and are the mean of three separate As observed previously, GnRH induction of the LH␤ gene experiments performed in triplicate. Results shown are average Ϯ SEM relative to the vehicle treatment. *, Significant (P Ͻ 0.05) effect of declined incrementally as the promoter was progressively GnRH; #, significant repression by corticosterone. B, The Ϫ1800-bp rat truncated from Ϫ1800 to Ϫ87 (Fig. 4C and Ref. 44). ␤ ␤ LH -luc reporter gene was transfected into L T2 cells, and cells were Dexamethasone repressed LH␤ promoter activity by ap- subsequently treated with corticosterone (Cort; 100 nM, 24 h), dexamethasone (Dex; 100 nM, 24 h), or vehicle alone (Veh; 0.1% BSA/ proximately 40% when the region contained at least 0.1% ethanol) or either glucocorticoid (100 nM, entire 24 h) in Ϫ150 bp of the proximal promoter. Interestingly, further combination with GnRH (10 nM, final 6 h), and harvested for luciferase truncation of the region from Ϫ150 to Ϫ87, which re- as a measure of LH␤ promoter activity. Results are depicted as fold induction by hormone treatment relative to vehicle (dashed line)as moved the proximal GnRH responsive elements [such as indicated. *, Significant induction by GnRH vs. vehicle control; #, early growth response factor 1 (Egr1) and SF1], resulted significant repression by glucocorticoid treatment on GnRH-induced in a loss of GnRH induction and elimination of dexa- ␤ ␤ Ј LH expression. C, L T2 cells were transfected with a series of 5 - methasone repression, indicating that GnRH responsive- truncated LH␤-luc reporter plasmids and treated with GnRH (10 nM, ␤ final 6 h) or GnRH ϩ dexamethasone [Dex (100 nM, entire 24 h); GnRH ness of the LH gene is required for glucocorticoid repres- (10 nM, final 6 h)] to determine regions of the LH␤ promoter that are sion. Collectively, these data suggest that GR exerts its responsive to glucocorticoids. Results for each truncation are depicted inhibitory effects upon the LH␤ proximal promoter, as LH␤ fold induction relative to vehicle of that truncation (dashed line). #, Significant repression by glucocorticoid treatment on GnRH- likely via interactions with GnRH-responsive factors, induced LH␤ expression. such as Egr1 and SF1. 1724 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731

Proximal binding elements are important for expressed throughout pituitary development and plays a glucocorticoid repression critical role in activation of a number pituitary genes, The proximal 150 bp of the rat LH␤ promoter contain including Lhb (45). SF1 is specifically expressed in the multiple binding elements that are critically important for gonadotrope of the anterior pituitary gland, and its im- GnRH regulation of LH␤ transcription (Fig. 5A), includ- portance for reproduction is underscored by a lack of ing tandem elements for both Egr1 and SF1 that are ar- gonads in SF1-null mice (46). Although highly important ranged on either side of a homeobox element, previously for LH␤ transcription, SF1 and Ptx1 are not regarded as shown to bind pituitary homeobox factor 1 (Ptx1). Ptx1 is factors induced or regulated by GnRH (47). On the other hand, Egr1 is rapidly induced by GnRH and considered a critical regulator of LH␤ gene expression (47), because A Egr1 null mice lack LH␤ expression in the pituitary go- nadotropes (48). Therefore, we focused on the role of -150 -87 Egr1 in glucocorticoid repression of LH␤ gene expression SF1 Egr1 Ptx1 SF1 Egr1 rat LHβ and tested the hypothesis that glucocorticoids interfere with GnRH induction of LH␤ by blunting the GnRH- stimulated increase in Egr1 mRNA and protein. To inves- B n.s. C tigate hormone regulation of Egr1 mRNA, L␤T2 cells 30 * * were treated with hormone, and after 45 min, RNA was 20 harvested for Egr1 mRNA analysis by quantitative RT- Veh 10 Dex GnRH GnRH + Dex PCR. Egr1 mRNA was low in vehicle-treated control cells, and expression was unchanged by treatment with 0

Egr1/GAPDH mRNA dexamethasone alone (Fig. 5B). As expected, GnRH Veh Dex GnRH GnRH Ab: αEgr1 +Dex caused a dramatic 27.2-fold induction in Egr1 mRNA D (P Ͻ 0.05 vs. Veh). This increase in GnRH-induced Egr1 ChIP: GR/IgG 6.0 * transcript, however, was not significantly decreased by Ͼ ϩ 4.0 * dexamethasone (P 0.05; GnRH vs. GnRH Dex, 27.2Ϯ 4.6 vs. 23.1 Ϯ 4.5; Fig. 5B). Because we found that 2.0 treatment with glucocorticoids does not suppress levels of

Fold enhancement 0 GnRH-induced Egr1 transcript, we next tested the hy- Veh Dex GnRH GnRH +Dex pothesis that dexamethasone regulates translation or deg- ␤ FIG. 5. GnRH-responsive factor necessary for GR recruitment. A, radation of Egr1 in L T2 cells using Western blot analy- Schematic of the proximal 150 bp of the rat LH␤ 5Ј-regulatory region sis. Protein expression of Egr1 was undetectable in illustrating the known promoter elements involved in expression of the nuclear extracts of L␤T2 cells after treatment with vehicle LH␤ gene. Proteins binding each site are indicated. B, Quantitative RT- PCR analysis of Egr1 mRNA extracted from L␤T2 cells cultured in the or dexamethasone (Fig. 5C). After treatment with GnRH, presence of dexamethasone (Dex; 100 nM, 18 h), GnRH (10 nM,45 Egr1 protein was readily detected, yet protein expression min), GnRH ϩ dexamethasone [Dex (100 nM, entire 18 h); GnRH (10 did not significantly change after cotreatment with GnRH nM, final 45 min)], or vehicle (Veh; 0.1% BSA/0.1% ethanol). Results and dexamethasone, indicating that GR does not interfere are expressed as Egr1 mRNA levels normalized to GAPDH mRNA levels and are the mean of three separate experiments performed in with GnRH induction of Egr1 protein. triplicate. Results shown are average Ϯ SEM. *, Significant induction by We further examined how glucocorticoids might influ- GnRH vs. vehicle control. C, Western blotting analysis of nuclear ␤ ␤ ence GnRH-induced LH expression by performing ChIP extracts from L T2 cells treated with dexamethasone (Dex; 100 nM, ␤ ␤ 18 h), GnRH (10 nM, 2 h), GnRH ϩ dexamethasone [Dex (100 nM, assays on the endogenous mouse LH promoter in L T2 entire 18 h); GnRH (10 nM, final 2 h)], or vehicle (Veh; 0.1% BSA/0.1% cells. Cells were treated with dexamethasone or GnRH ethanol) was performed using an antibody for Egr1. A protein band alone or in combination for 60 min before cross-linking. was detected at the expected size of 82 kDa for Egr1. The experiment was repeated three times with similar results, and a representative gel Sonicated chromatin was immunoprecipitated using ei- is shown. D, ChIP was performed using cross-linked chromatin from ther anti-GR or nonspecific IgG. Cross-linking was re- L␤T2 cells treated with dexamethasone (Dex; 100 nM, 1 h), GnRH (10 versed and precipitates analyzed by quantitative PCR for ϩ nM, 1 h), GnRH dexamethasone [Dex (100 nM, 1 h); GnRH (10 nM, 220 bp of the LH␤ promoter (Ϫ180 to ϩ40). Dexameth- 1 h)], or vehicle (Veh; 0.1% BSA/0.1% ethanol) and antibodies directed against GR or nonspecific IgG as a negative control. ChIP and asone treatment alone did not increase GR binding to the input DNA were analyzed by quantitative PCR using primers proximal promoter over vehicle treatment (P Ͻ 0.05; Veh encompassing the proximal promoter of Lhb to determine the amount vs. Dex; Fig. 5D). However, we can only rule out a change of immunoprecipitated DNA. ChIP samples were normalized to the ␤ respective input samples and then expressed as fold enrichment in GR occupancy of the LH promoter at 60 min, and relative to the nonspecific IgG ChIP samples. that later (or earlier) changes in the response to glucocor- Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1725 ticoids are still possible. In contrast, GnRH treatment A 60 increased GR binding 3.8-fold compared with vehicle # 50 (P Ͻ 0.05; Veh vs. GnRH), indicating that recruitment of Empty Vec gal GR to the LH␤ promoter is not dependent on dexameth- β 40 * Egr1 30 asone binding, but rather is dependent on a GnRH-re- -Luc/

β * 20

sponsive factor. No difference in GR binding was ob- LH served when the cells were concomitantly stimulated with 10 0 dexamethasone and GnRH as compared with GnRH Veh Dex alone, suggesting that a change in GR conformation or B C recruitment due to ligand does not underlie the mecha- 25 0 nism of glucocorticoid repression of LH␤ transcription. GnRH * GnRH+Dex 20 25 * gal

β *# Glucocorticoids interfere with Egr1 actions at the 15 * # * # 50 -Luc/ 10 level of the promoter β # * 75 LH Having determined that GR recruitment is dependent Fold induction 5 on GnRH (i.e. a responsive factor such as Egr1), yet the 0 Relief of repression (%) 100 inhibitory effect of glucocorticoids is downstream of EV Egr1 EV Egr1 GnRH-induced Egr1 mRNA or protein, we investigated D the role of Egr1 at the level of the LH␤ promoter. We 3.0 GnRH

gal 2.5 * # GnRH+Dex began by testing the hypothesis that glucocorticoids re- β ␤ 2.0 duce activity of the LH promoter when induced by Egr1 * * * # n.s. -Luc/ 1.5 # * # itself, in the absence of GnRH. Egr1 is a potent activator β 1.0 of LH␤ transcription, and transfection of an Egr1 expres- Fold induction 0.5

␤ -200 LH sion plasmid in L T2 cells treated with vehicle caused a 0 robust 35-fold increase in LH␤ activity (P Ͻ 0.05; Veh: WT 5'SF1 5'Egr1 3'SF1 3'Egr1 Empty Vec vs. Egr1; Fig. 6A). Treatment with dexametha- Mutations sone significantly blunted the increase in LH␤ activity in- FIG. 6. Glucocorticoids interfere with Egr1 actions at the level of the duced by Egr1 compared with the response in cells treated proximal promoter. A, To test whether glucocorticoids can interfere ␤ Ͻ with Egr1-induced LH expression, Egr1 (black bars) or empty vector with vehicle (P 0.05; Egr1 (black bars): Dex vs. Veh; Fig. (Empty Vec, open bars) was transfected with the Ϫ1800-bp LH␤-luc 6A), indicating that glucocorticoids can interfere with acti- reporter plasmid into L␤T2 cells and subsequently treated with vation by Egr1 at the level of the LH␤ promoter in gonado- dexamethasone (Dex; 100 nM, 24 h) or vehicle (Veh; 0.1% BSA/0.1% trope cells and that GR suppression does not require factors ethanol). Data are shown relative to vehicle-treated in the absence of Egr1. *, Significant induction by Egr1 vs. vector control; #, significant involved in GnRH signaling upstream of Egr1. repression by glucocorticoid treatment on Egr1-induced LH␤ We next attempted to rescue the glucocorticoid repres- expression. B, To determine whether titrating in increasing levels of Ϫ ␤ sion of GnRH-induced LH␤ activity in L␤T2 cells. We Egr1 can rescue glucocorticoid repression of 1800-bp LH -luc activity, L␤T2 cells were transfected with empty vector (EV, 200 ng) or hypothesized that if Egr1 were the sole factor affected by increasing amounts of Egr1 [50 ng (plus 150 ng empty vector), 100 ng glucocorticoids, then titrating increasing amounts of Egr1 (plus 100 ng empty vector), 200 ng] and treated with GnRH (white into L␤T2 cells would restore full induction and prevent hatched bars, 10 nM, final 6 h) or GnRH ϩ dexamethasone [gray ␤ ␤ hatched bars, Dex (100 nM, entire 24 h); GnRH (10 nM, final 6 h)]. diminishment by glucocorticoids. LH -luc/ gal values Results are depicted as LH␤-fold induction relative to the vehicle- are represented as fold induction of GnRH or GnRH ϩ treated condition in the presence of the same amount of Egr1 (dashed Dex relative to the vehicle control condition containing line) as indicated. *, Significant induction by GnRH; #, significant repression by glucocorticoid treatment on GnRH-induced LH␤ the same amount of Egr1. In the absence of exogenous expression. C, The effect of increasing Egr1 on the ratio of LH␤-fold Egr1, dexamethasone significantly blunted GnRH-in- induction in cells treated with GnRH alone vs. GnRH with duced LH␤ activity (P Ͻ 0.05; empty vector: GnRH vs. dexamethasone was calculated and expressed as percent repression. *, GnRH ϩ Dex; Fig. 6B). In the presence of increasing Significant difference in the ratio as compared with EV determined by Student’s t test. D, L␤T2 cells were transfected with either the Ϫ200- amounts of overexpressed Egr1 (50–200 ng), the percent bp LH␤-luc reporter plasmid (WT) or reporter plasmids containing the repression significantly decreased (P Ͻ 0.05; empty vec- Ϫ200-bp LH␤ region with mutations in SF1 or Egr1 binding elements tor vs. 100 or 200 ng Egr1; Fig. 6C), indicating that re- as indicated and cultured in the presence of GnRH (white hatched bars) or GnRH ϩ Dex (gray hatched bars). Data are shown for each pression occurs, in part, via interfering with Egr1 function mutant promoter, relative to its own vehicle treatment. See Fig. 6B on the promoter. legend for more details. n.s., Not significant P ϭ 0.08; WT, wild type. We focused our attention on the action of glucocorti- coids at the level of the LH␤ promoter and analyzed the 1726 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731 necessity of known GnRH-responsive elements within the A ␤ proximal 150 bp of the LH gene for glucocorticoid re- 25 CV-1 cells Ј Ј Veh pression by creating cis mutations in the 5 -SF1, 3 -SF1, 20 Dex *

gal #

Ј Ј β 5 -Egr1, and 3 -Egr1 binding elements in the context of a 15 minimal Ϫ200 bp LH␤ promoter (WT). We used this * -Luc/ 10 # minimal LH␤ promoter because it is sufficient for respon- β * LH Fold induction 5 # ** siveness to GnRH and glucocorticoids. cis mutation of * * 0 either the 5Ј-or3Ј-SF1 or the 5Ј-Egr1 site preserved sig- Egr1 SF1 Ptx1 Egr1 Egr1 Egr1 nificant GnRH induction and was sufficient for glucocor- SF1 Ptx1 SF1 Ptx1 ticoid repression, suggesting that these elements are not B C required for either GnRH induction or GR repression 5 5 Ͻ Veh (P 0.05; *, significant induction by GnRH; #, signifi- 4 * 4 Dex cant repression of GnRH induction; Fig. 6D). In contrast, # 3 3 the 3Ј-Egr1 cis mutation was the only mutation to abro- * 2 2 * # gate glucocorticoid repression (Fig. 6D, 3Ј-Egr1 muta- * # gal foldinduction gal gal foldinduction gal SF1 multimer β β tion). Of interest to our study, this Egr1 binding site has Egr1 multimer 1 1 Luc/ Luc/ 0 0 been shown to be critical for GnRH induction as well Egr1 Egr1 SF1 SF1 (49), and cis mutation of this element eliminated signifi- SF1 Egr1 cant induction by GnRH in our hands, implying that Ptx1 Ptx1 GnRH responsiveness is necessary for repression by FIG. 7. Interruption of LH␤ transcriptional complex formation by glucocorticoids. A, To investigate glucocorticoid-mediated interference glucocorticoids. of Egr1, SF1, and/or Ptx1 induction of LH␤ promoter activity, CV-1 cells were transfected with a GR expression vector and the Ϫ1800-bp LH␤- Interaction and involvement of Lhb promoter luc reporter plasmid, along with Egr1, SF1, or Ptx1 alone or in proximal binding factors combination, as indicated, and treated with dexamethasone (gray bars, ␤ Dex; 100 nM, 24 h) or vehicle (white bars, Veh; 0.1% BSA/0.1% Egr1 conveys GnRH induction of the LH promoter ethanol). *, Significant induction of LH␤ promoter activity vs. vector by interaction with other regulators of gene expression in control (dashed line); #, significant repression by glucocorticoid the gonadotrope (47, 49–51). To assess the complex and treatment. B and C, Induction of the Egr1 multimer (B) or SF1 multimer (C) by the indicated Egr1 or SF1 alone, respectively, or in combination cooperative roles of Egr1, SF1, and Ptx1, we used heter- with Ptx1, was assessed after treatment with dexamethasone (gray ologous CV-1 cells. Unlike gonadotrope cells, CV-1 cells bars, Dex; 100 nM, 24 h) or vehicle (white bars, Veh; 0.1% BSA/0.1% lack GnRH receptors, an Egr1 response to GnRH, and are ethanol) and depicted as fold induction relative to induction of the devoid of endogenous SF1, Ptx1, and GR, which allowed control luciferase reporter driven by the TK promoter. *, Significant induction of multimer activity vs. vector control (dashed line); #, us to reconstitute these factors and determine the neces- significant repression by glucocorticoid treatment. sity and sufficiency of proteins involved in suppression by dexamethasone. In addition to GR, CV-1 cells were cotransfected with 1800-bp LH␤-luc reporter plasmid or cells were cotransfected with the Egr1 multimer or con- pGL3 control plasmid and Egr1, SF1, or Ptx1 alone, or in trol TKluc pGL3 plasmid, GR, and either Egr1 alone, or combination, and tested for activation of LH␤ transcrip- Egr1 in combination with SF1 and Ptx1, to test for suffi- tion in the presence of dexamethasone or vehicle. As ciency to activate transcription in the presence or absence shown in Fig. 7A (white bars), overexpression of Egr1, of dexamethasone. Egr1 was sufficient to induce tran- SF1, or Ptx1 alone induced small increases in LH␤ tran- scriptional activation of the Egr1 multimer, and this effect scription, with induction by Egr1 reaching significance. was blunted by glucocorticoids (P Ͻ 0.05; #, significant Dexamethasone significantly diminished induction by repression by Dex; Fig. 7B). Of interest, this site was Egr1 (P Ͻ 0.05; Egr1: Dex vs. Veh). Interestingly, dexa- sufficient to allow for enhanced activation by the combi- methasone also significantly repressed LH␤ induction nation of Egr1, SF1, and Ptx1, an affect that was also when Egr1 was cotransfected with SF1 alone or SF1 plus diminished by glucocorticoids. In contrast to the suffi- Ptx1 (P Ͻ 0.05; Egr1: Dex vs. Veh, Egr1/SF1: Dex vs. ciency of the Egr1 site, a consensus SF1-binding site mul- Veh; Fig. 7A). timer does not convey responsiveness to dexamethasone To address whether the Egr1-binding site is sufficient when induced by SF1 alone, but activation of the SF1 site for glucocorticoid repression of LH␤ transcription, re- by the combination of Egr1, SF1, and Ptx1 is disrupted by porter constructs containing four copies of the Egr1 con- dexamethasone. Taken together, these findings indicate sensus site ligated into pGL3 upstream of a minimal TK that the Egr1 site activated by Egr1 alone is sufficient for promoter were created (Egr1 multimer, Fig. 7B). CV-1 mediating repression. In contrast, the SF1 site activated Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1727 by SF1 alone is not sufficient although a complex with interactions with other transcription factors (52, 53). The SF1, Egr1, and Ptx1 on the SF1 site can be repressed. second GR mutant, GR DBD mut, prevents direct DNA binding by the mutant. Dexamethasone elicited suppres- Role of the GR at the level of the Lhb promoter sion in the presence of either transfected GR mutant, in- Because CV-1 cells lack GR, this cell model allowed us dicating that GR dimerization and DNA binding are not to determine the necessity of DNA binding or dimeriza- necessary for repression of GnRH-induced LH␤ pro- tion by GR for repression in gonadotrope cells. In the moter activity (P Ͻ 0.05; Dim mut or DBD mut: Veh vs. absence of transfected GR in CV-1 cells, dexamethasone Dex; Fig. 8A). does not inhibit LH␤ promoter activity (P Ͼ 0.05; no GR: After demonstrating that GR does not require DNA Veh vs. Dex; Fig. 8A), confirming that GR is necessary for binding to elicit repression upon the LH␤ promoter, we repression of LH␤ by glucocorticoids. To determine investigated the ability of GR to be tethered to DNA by a whether direct DNA binding by GR plays a critical role in GnRH-induced factor, by testing the hypothesis that GR the repression of LH␤ by glucocorticoids, we transfected is capable of binding Egr1. We asked whether in vitro- CV-1 cells with two different GR mutants that are inca- transcribed and -translated GR could bind bacterially ex- pable of binding DNA. The first mutant, GR Dim mut, pressed GST-Egr1 in pull-down experiments. Figure 8B contains four point mutations in the dimerization domain demonstrates precipitation of 35S-labeled GR with GST- of GR. These mutations prevent homodimerization of Egr1, as compared with GST alone, illustrating a physical GR, but do not prevent indirect DNA binding through interaction between GR and Egr1. As a positive control, we show that 35S-labeled SF1 binds GST-Egr1, a strong A interaction that has been previously reported (54). In con- 25 CV-1 cells trast, the interaction between 35S-labeled GFP with either 20 # # gal # GST construct was undetectable. Together with the ChIP β 15 results in Fig. 5D, these findings indicate that GR does not

-Luc/ 10 directly bind the LH␤ promoter; rather it physically in- β ␤ LH

Egr1/SF1/Ptx1 5 teracts with Egr1 and thus is recruited to the LH pro- Fold induction by 0 moter as a complex with Egr1, identifying Egr1 as a crit- No GR WT Dim DBD ical factor mediating GnRH induction and GR repression GR mut mut ␤ B of LH gene expression. 10% Input GST GST-Egr1

GR Discussion

Utilizing a restraint stress paradigm that robustly stimu- SF1 lates corticosterone to investigate stress-induced suppres- sion of gonadotrope function in female mice, we demon- strate that chronic exposure to stress impairs estrous GFP cyclicity and reduces GnRH-induced LH synthesis and secretion in diestrus female mice. Whether the increase in FIG. 8. GR does not require dimerization or DNA binding, but is glucocorticoids is induced by stress or exogenously ad- capable of physically interacting with Egr1. A, The necessity of ministered, both conditions lead to repression of gonado- dimerization or DNA binding by GR, or by GR itself, was assessed in CV-1 cells. The Ϫ1800-bp LH␤-luc reporter plasmid was maximally trope function, confirming the inhibitory role of gluco- induced with a combination of Egr1, SF1, and Ptx1 in CV-1 cells corticoids within the reproductive axis and cotransfected with empty vector (No GR), wild-type GR (WT GR), GR demonstrating the capacity for suppression during stress. dimerization mutant (Dim mut), or GR DBD mutant (DBD mut) and Although we acknowledge that stress likely increases a subsequently treated with dexamethasone (gray bars, Dex; 100 nM, 24 h) or vehicle (open bars, Veh; 0.1% BSA/0.1% ethanol). Data are variety of mediators, including other hormones of the presented relative to the Ϫ1800-bp LH␤-luc reporter cotransfected adrenal stress axis that have been shown to alter repro- with the empty vectors for Egr1, SF1, and Ptx1 for each GR expression ductive function during stress (2, 55, 56), we conclude, vector. #, Significant repression by glucocorticoid treatment. B, GST interaction assays were performed using bacterially expressed Egr1- based on our current investigation, that glucocorticoids GST fusion protein and 35S-labeled in vitro translated GR, SF1, or GFP are sufficient to disrupt reproductive neuroendocrine as a control. One tenth of the protein input (10% Input) and the GST function. tag-alone (GST, negative control) are shown (note that the SF1 complex with GST-Egr1 has spilled over into the intermediate empty Seminal work by Dr. Neena Schwartz and colleagues lane between the GST and the GST-Egr1 lanes). (57) clearly identified inhibitory effects of glucocorticoids 1728 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731 within the reproductive neuroendocrine axis and postu- strating that the pathway between GnRH binding its re- lated that glucocorticoids may alter hypothalamic and ceptor and induction of the immediate early gene, Egr1, is pituitary function. Indeed, in vivo analyses demonstrated intact. Furthermore, glucocorticoids blunt the ability of that glucocorticoids could prevent the postcastration rise overexpressed Egr1 to induce LH␤ activity, providing ev- in LH in rats but also blunt the response to GnRH in idence that GR inhibition does not require elements up- anterior pituitary fragments in culture (20, 57). Our pres- stream of Egr1 and focus our attention on a mechanism ent investigation expands upon these early studies by involving Egr1 at the promoter level. We show that titrat- demonstrating that glucocorticoids can act directly upon ing in increasing amounts of Egr1 partially overcomes the anterior pituitary gonadotrope cell to suppress GnRH glucocorticoid repression of Lh␤ in L␤T2 cells, solidify- induction of LH␤ gene expression. Intriguingly, we ob- ing a mediatory role of Egr1. serve a similar suppression in LH␤ gene expression after With regard to the mechanism of repression, similar to stress, but it remains to be determined whether this is a other steroid hormone receptors, GR mediates transcrip- direct effect of glucocorticoids within the pituitary gland. tional regulation of target genes via a host of direct and With regard to direct actions within the gonadotrope, we indirect mechanisms. For example, within the gonado- demonstrate a novel mechanism whereby GR is recruited trope cell, induction of either the murine FSH␤ or human to the 5Ј-region of the mouse LH␤ gene in live L␤T2 cells ␣GSU gene occurs via direct GR binding to DNA at con- and blunts GnRH induction of LH␤ by interfering served glucocorticoid response elements (29, 30). In con- with the genomic effects of Egr1 on the proximal LH␤ trast, using cell models either devoid of or expressing GR promoter. (CV-1 vs. L␤T2 cells, respectively), we find that neither an Glucocorticoid repression via GR maps to a highly intact DBD nor dimerization domain is necessary for GR active region of the LH␤ promoter, which contains ele- repression of the rat LH␤ gene, implicating a genomic ments critical for GnRH induction. Promoter analyses action that occurs via indirect GR binding. In addition, revealed that glucocorticoid-mediated repression is lost GR is recruited to the LH␤ promoter chromatin by GnRH upon 5Ј-truncation of the bipartite SF1 and Egr1 elements induction in the presence or absence of glucocorticoids. in the LH␤ proximal promoter. Truncation of this region, Coupled with our findings that GR physically interacts however, also eliminated GnRH induction of the pro- with Egr1 in GST-pulldown experiments, this provides moter (Fig. 4C, Ϫ87 LH␤-luc), suggesting that the ability evidence in support of our hypothesis that GR is tethered of glucocorticoids to repress is closely tied to the highly to the LH␤ promoter via a GnRH-induced factor, and in coordinated and complex mechanism of GnRH action on particular by Egr1. Lhb. Not surprisingly, the only cis mutation that relieved The requirement for a GnRH-induced factor may also suppression by glucocorticoids (Fig. 6D, the 3Ј-Egr site) contribute to the differential effect of glucocorticoids on also prevented significant induction of the LH␤ promoter transcription within the gonadotrope cell. On the one by GnRH, supporting the conclusion that glucocorticoid- hand, genes encoding FSH␤, ␣GSU, and GnRH receptor induced repression is dependent on the response to GnRH are each induced by glucocorticoids alone (30, 33, 59). and highlights the importance of Egr1 for repression by On the other hand, our data reveal that GR repression glucocorticoids. requires GnRH, likely due to the deficiency of GR recruit- Glucocorticoids have the potential to interfere with ment to the proximal promoter in the absence of GnRH. GnRH induction of LH␤ via interference of GnRH recep- On the GnRH receptor gene in gonadotrope cells, GnRH- tor signaling upstream and downstream of Egr1 induc- induced GR recruitment has been shown to be involved in tion. For example, studies performed using rat and pig glucocorticoid induction of transcription (59). In that pituitary cell cultures suggest that chronic exposure to case, however, the recruitment of GR to the GnRH recep- glucocorticoids can disrupt GnRH receptor-signaling tor promoter is dependent on rapid phosphorylation of mechanisms involved in gonadotropin release, including GR by GnRH-signaling pathways, which differs from our activation of protein kinase C and cAMP (20, 23). Fur- finding that GR repression of LH␤ transcription does not ther, GR has been shown to interact rapidly with c-Jun require GnRH signaling upstream of Egr1 activation. N-terminal kinase, a kinase implicated in mediating ef- Rather, we conclude that GR is recruited by a factor in- fects of GnRH in gonadotrope cells (58). In contrast to duced by GnRH and hypothesize that Egr1 itself mediates these actions of glucocorticoids on GnRH signaling, our the balance between GnRH induction and GR repression findings support an action of glucocorticoids down- of the LH␤ promoter. stream of Egr1 induction by GnRH via GR acting within In summary, the present study shows that restraint the LH␤ chromatin. Glucocorticoids do not alter GnRH- stress potently activates the adrenal stress axis in mice and induced Egr1 mRNA or protein in L␤T2 cells, demon- interferes with gonadotropin synthesis and secretion. We Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1729 expand upon this finding by demonstrating that admin- V.G.T. was partially supported by NIH Grants K01 DK080467, istration of a stress level of glucocorticoids inhibits LH and R01 HD067448. D.C. was partially supported by NIH secretion in female mice and detailing a mechanism Grants R01 HD057549, R21 HD058752, and R03 HD054595. The LH␤ antibody was provided by Dr. A. F. Parlow from the whereby glucocorticoids repress activity of the anterior National Hormone and Pituitary Program, Harbor-UCLA pituitary gland via regulation of LH␤ gene expression in Medical Center. DNA sequencing was performed by the DNA- gonadotrope cells. We identify GR in native gonadotrope sequencing shared resource, University of California, San Diego, cells in the mouse and demonstrate that the recruitment of Cancer Center, which is funded in part by National Cancer GR to the mouse LH␤ promoter via Egr1 interferes with Institute Cancer Support Grant P30 CA023100. Serum hor- mone assays were performed by The University of Virginia Li- the tripartite transcriptional complex necessary for medi- gand Assay Core Laboratory, which is supported through Na- ating responsiveness of this gonadotropin gene to GnRH. tional Institute of Child Health and Human Development Grant Utilizing dual in vivo and in vitro approaches, collec- U54 HD028934. tively, this work reveals new insights regarding the inter- Disclosure Summary: The authors have nothing to disclose. action between the adrenal stress and reproductive neu- roendocrine axes by identifying a mechanism whereby LH␤ expression is dampened after a stress elevation in References glucocorticoid. 1. Ferin M 1999 Clinical review 105: Stress and the reproductive cycle. J Clin Endocrinol Metab 84:1768–1774 2. Rivier C, Rivest S 1991 Effect of stress on the activity of the hypo- Acknowledgments thalamic-pituitary-gonadal axis: peripheral and central mecha- nisms. Biol Reprod 45:523–532 We thank Dr. Alexander (Sasha) Kauffman (University of Cal- 3. Tilbrook AJ, Turner AI, Clarke IJ 2002 Stress and reproduction: central mechanisms and sex differences in non-rodent species. Stress ifornia, San Diego, La Jolla, CA) and Dr. Catherine Rivier (Salk 5:83–100 Institute, La Jolla, CA) for insightful discussions regarding the in 4. Tilbrook AJ, Turner AI, Clarke IJ 2000 Effects of stress on repro- vivo experiments. We are grateful to Dr. Jacques Drouin (Uni- duction in non-rodent mammals: the role of glucocorticoids and sex versity of Montreal, Quebec, Canada) for generously providing differences. Rev Reprod 5:105–113 the mouse Ptx1 and rat Egr1 cDNAs; to Dr. Hermann Paven- 5. Dobson H, Smith RF 2000 What is stress, and how does it affect reproduction? Anim Reprod Sci 60–61:743–752 stadt (University of Munster, Munster, Germany) for providing 6. Briski KP, Vogel KL, McIntyre AR 1995 The antiglucocorticoid, the human Egr1 cDNA; and to Dr. Douglass Forbes (University RU486, attenuates stress-induced decreases in plasma-luteinizing of California, San Diego, La Jolla, CA) for providing the GFP hormone concentrations in male rats. Neuroendocrinology 61: expression plasmid. The mouse SF1 pCMV expression plasmid 638–645 was a kind gift of Dr. Bon-chu Chung (Academia Sinica, Taipei, 7. Dong Q, Salva A, Sottas CM, Niu E, Holmes M, Hardy MP 2004 ␤ Rapid glucocorticoid mediation of suppressed testosterone biosyn- Taiwan), and the rat LH -luciferase plasmid was kindly pro- thesis in male mice subjected to immobilization stress. J Androl vided by Dr. Mark Lawson (University of California, San Diego, 25:973–981 La Jolla, CA). We thank Dr. Keith Yamamoto (University of 8. Breen KM, Oakley AE, Pytiak AV, Tilbrook AJ, Wagenmaker ER, California, San Francisco, San Francisco, CA) for providing the Karsch FJ 2007 Does cortisol acting via the type II glucocorticoid rat GR plasmid and Dr. Al Parlow of the National Hormone and receptor mediate suppression of pulsatile luteinizing hormone se- ␤ cretion in response to psychosocial stress? Endocrinology 148: Peptide Program for providing the NIDDK-anti-r LH-IC-2 an- 1882–1890 tibody. We also thank Jason Meadows, Emily Witham, Chuq- 9. Saketos M, Sharma N, Santoro NF 1993 Suppression of the hypo- ing (Carol) Yao, Courtney Benson, and Dr. Suzanne Rosenberg thalamic-pituitary-ovarian axis in normal women by glucocortico- (University of California, San Diego, La Jolla, CA) for technical ids. Biol Reprod 49:1270–1276 10. Breen KM, Billings HJ, Wagenmaker ER, Wessinger EW, Karsch FJ assistance and helpful discussions throughout this work. 2005 Endocrine basis for disruptive effects of cortisol on preovula- tory events. Endocrinology 146:2107–2115 Address all correspondence and requests for reprints to: Pa- 11. Li XF, Edward J, Mitchell JC, Shao B, Bowes JE, Coen CW, Light- mela L. Mellon Ph.D., Department of Reproductive Medicine/ man SL, O’Byrne KT 2004 Differential effects of repeated restraint Neuroscience, University of California, San Diego, 9500 Gil- stress on pulsatile lutenizing hormone secretion in female Fischer, man Drive, La Jolla, California 92093-0674. E-mail: Lewis and Wistar rats. J Neuroendocrinol 16:620–627 [email protected]. 12. Oakley AE, Breen KM, Clarke IJ, Karsch FJ, Wagenmaker ER, This work was supported by National Institutes of Health Tilbrook AJ 2009 Cortisol reduces gonadotropin-releasing hor- (NIH) grants R01 HD020377, R01 HD072754, and R01 mone pulse frequency in follicular phase ewes: influence of ovarian DK044838 (to P.L.M.) and by the Eunice Kennedy Shriver Na- steroids. Endocrinology 150:341–349 13. Dufourny L, Skinner DC 2002 Progesterone receptor, estrogen re- tional Institute of Child Health and Human Development/NIH ceptor ␣, and the type II glucocorticoid receptor are coexpressed in through cooperative agreement (U54 HD012303) as part of the the same neurons of the ovine preoptic area and arcuate nucleus: a Specialized Cooperative Centers Program in Reproduction and triple immunolabeling study. Biol Reprod 67:1605–1612 Infertility Research (to P.L.M.). P.L.M. was also partially sup- 14. Gore AC, Attardi B, DeFranco DB 2006 Glucocorticoid repression ported by P30 CA023100, P30 DK063491, and P42 ES010337. of the reproductive axis: effects on GnRH and gonadotropin sub- K.M.B. was partially supported by NIH Grant K99 HD060947. unit mRNA levels. Mol Cell Endocrinol 256:40–48 1730 Breen et al. Glucocorticoid Repression of LH␤ Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731

15. Attardi B, Tsujii T, Friedman R, Zeng Z, Roberts JL, Dellovade T, ing hormone ␤-subunit gene expression. Endocrinology 150:2395– Pfaff DW, Chandran UR, Sullivan MW, DeFranco DB 1997 Glu- 2403 cocorticoid repression of gonadotropin-releasing hormone gene ex- 36. Rosenberg SB, Mellon PL 2002 An Otx-related homeodomain pro- pression and secretion in morphologically distinct subpopulations tein binds an LH␤ promoter element important for activation dur- of GT1–7 cells. Mol Cell Endocrinol 131:241–255 ing gonadotrope maturation. Mol Endocrinol 16:1280–1298 16. DeFranco DB, Attardi B, Chandran UR 1994 Glucocorticoid re- 37. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans- ceptor-mediated repression of GnRH gene expression in a hypotha- activation domains of the human glucocorticoid receptor. Cell 55: lamic GnRH-secreting neuronal cell line. Ann NY Acad Sci 746: 899–906 473–475 38. Corpuz PS, Lindaman LL, Mellon PL, Coss D 2010 FoxL2 is re- 17. Melis GB, Mais V, Gambacciani M, Paoletti AM, Antinori D, quired for activin induction of the mouse and human follicle-stim- Fioretti P 1987 Dexamethasone reduces the postcastration gonad- ulating hormone ␤-subunit genes. Mol Endocrinol 24:1037–1051 otropin rise in women. J Clin Endocrinol Metab 65:237–241 39. Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL 2007 p38 18. Pearce GP, Paterson AM, Hughes PE 1988 Effect of short-term mitogen-activated kinase is critical for synergistic induction of the elevations in plasma cortisol concentration on LH secretion in pre- FSH ␤ gene by gonadotropin-releasing hormone and activin pubertal gilts. J Reprod Fertil 83:413–418 through augmentation of c-Fos induction and Smad phosphoryla- 19. Li PS, Wagner WC 1983 In vivo and in vitro studies on the effect of tion. Mol Endocrinol 21:3071–3086 adrenocorticotropic hormone or cortisol on the pituitary response 40. Larder R, Clark DD, Miller NL, Mellon PL 2011 Hypothalamic to gonadotropin releasing hormone. Biol Reprod 29:25–37 dysregulation and infertility in mice lacking the homeodomain pro- 20. Suter DE, Schwartz NB, Ringstrom SJ 1988 Dual role of glucocor- tein Six6. J Neurosci 31:426–438 ticoids in regulation of pituitary content and secretion of gonado- 41. Miyamoto J, Matsumoto T, Shiina H, Inoue K, Takada I, Ito S, Itoh tropins. Am J Physiol 254:E595–E600 J, Minematsu T, Sato T, Yanase T, Nawata H, Osamura YR, Kato 21. Suter DE, Orosz G 1989 Effect of treatment with cortisol in vivo on S 2007 The pituitary function of androgen receptor constitutes a secretion of gonadotropins in vitro. Biol Reprod 41:1091–1096 glucocorticoid production circuit. Mol Cell Biol 27:4807–4814 22. Kononen J, Honkaniemi J, Gustafsson JA, Pelto-Huikko M 1993 42. Chappell PE, Schneider JS, Kim P, Xu M, Lydon JP, O’Malley BW, Glucocorticoid receptor colocalization with pituitary hormones in Levine JE 1999 Absence of gonadotropin surges and gonadotropin- the rat pituitary gland. Mol Cell Endocrinol 93:97–103 releasing hormone self-priming in ovariectomized (OVX), estrogen 23. Li PS 1994 Modulation by cortisol of luteinizing hormone secretion (E2)-treated, progesterone receptor knockout (PRKO) mice. Endo- from cultured porcine anterior pituitary cells: effects on secretion crinology 140:3653–3658 induced by phospholipase C, phorbol ester and cAMP. Naunyn 43. Bronson FH, Vom Saal FS 1979 Control of the preovulatory release Schmiedebergs Arch Pharmacol 349:107–112 of luteinizing hormone by steroids in the mouse. Endocrinology 24. Maya-Nu´n˜ ez G, Conn PM 2003 Transcriptional regulation of the 104:1247–1255 GnRH receptor gene by glucocorticoids. Mol Cell Endocrinol 200: 44. Coss D, Thackray VG, Deng CX, Mellon PL 2005 Activin regulates 89–98 luteinizing hormone ␤-subunit gene expression through Smad- 25. Adams TE, Sakurai H, Adams BM 1999 Effect of stress-like con- binding and homeobox elements. Mol Endocrinol 19:2610–2623 centrations of cortisol on estradiol-dependent expression of gonad- 45. Tremblay JJ, Lanctôt C, Drouin J 1998 The pan-pituitary activator otropin-releasing hormone receptor in orchidectomized sheep. Biol of transcription, Ptx1 (pituitary homeobox 1), acts in synergy with Reprod 60:164–168 SF-1 and Pit1 and is an upstream regulator of the Lim-homeodo- 26. Pierce JG, Parsons TF 1981 Glycoprotein hormones: structure and main gene Lim3/Lhx3. Mol Endocrinol 12:428–441 function. Annu Rev Biochem 50:465–495 46. Zhao L, Bakke M, Parker KL 2001 Pituitary-specific knockout of 27. Kaiser UB, Conn PM, Chin WW 1997 Studies of gonadotropin- releasing hormone (GnRH) action using GnRH receptor-express- steroidogenic factor 1. Mol Cell Endocrinol 185:27–32 ing pituitary cell lines. Endocr Rev 18:46–70 47. Tremblay JJ, Drouin J 1999 Egr-1 is a downstream effector of 28. Vale W, Rivier C, Brown M 1977 Regulatory peptides of the hy- GnRH and synergizes by direct interaction with Ptx1 and SF-1 to ␤ pothalamus. Annu Rev Physiol 39:473–527 enhance luteinizing hormone gene transcription. Mol Cell Biol 29. Thackray VG, McGillivray SM, Mellon PL 2006 Androgens, pro- 19:2567–2576 gestins and glucocorticoids induce follicle-stimulating hormone 48. Topilko P, Schneider-Maunoury S, Levi G, Trembleau A, Gourdji ␤-subunit gene expression at the level of the gonadotrope. Mol D, Driancourt MA, Rao CV, Charnay P 1998 Multiple pituitary Endocrinol 20:2062–2079 and ovarian defects in Krox-24 (NGFI-A, Egr-1)-targeted mice. 30. Sasson R, Luu SH, Thackray VG, Mellon PL 2008 Glucocorticoids Mol Endocrinol 12:107–122 induce human glycoprotein hormone ␣-subunit gene expression in 49. Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik MA 2000 the gonadotrope. Endocrinology 149:3643–3655 Divergent and composite gonadotropin-releasing hormone-respon- 31. Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, sive elements in the rat luteinizing hormone subunit genes. Mol Rissman E, Wilson EM, Shupnik MA 2001 Androgen suppression Endocrinol 14:472–485 of GnRH-stimulated rat LH␤ gene transcription occurs through 50. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y 1999 Activa- Sp1 sites in the distal GnRH-responsive promoter region. Mol En- tion of luteinizing hormone ␤ gene by gonadotropin-releasing hor- docrinol 15:1906–1917 mone requires the synergy of early growth response-1 and steroid- 32. Jorgensen JS, Nilson JH 2001 AR suppresses transcription of the ogenic factor-1. J Biol Chem 274:13870–13876 LH␤ subunit by interacting with steroidogenic factor-1. Mol Endo- 51. Kaiser UB, Halvorson LM, Chen MT 2000 Sp1, steroidogenic fac- crinol 15:1505–1516 tor 1 (SF-1), and early growth response protein 1 (egr-1) binding 33. McGillivray SM, Thackray VG, Coss D, Mellon PL 2007 Activin sites form a tripartite gonadotropin-releasing hormone response and glucocorticoids synergistically activate follicle-stimulating hor- element in the rat luteinizing hormone-␤ gene promoter: an integral mone ␤-subunit gene expression in the immortalized L␤T2 gonado- role for SF-1. Mol Endocrinol 14:1235–1245 trope cell line. Endocrinology 148:762–773 52. Rogers SL, Nabozny G, McFarland M, Pantages-Torok L, Archer J, 34. Becker KL 1995 Principles and practice of endocrinology and me- Kalkbrenner F, Zuvela-Jelaska L, Haynes N, Jiang H, Four muta- tabolism. 2nd ed. Philadelphia: Lippincott tions in the GR dimerization domain result in perinatal lethal mice. 35. Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y, Mellon PL In: Nuclear Receptors: Steroid Sisters, Keystone, CO 2004, p 194 2009 Progesterone inhibits basal and GnRH induction of luteiniz- (Abstract 316) Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1731

53. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, ductive functions: role of endogenous corticotropin-releasing fac- Cato AC 1994 A distinct modulating domain in glucocorticoid tor. Science 231:607–609 receptor monomers in the repression of activity of the transcription 57. D’Agostino J, Valadka RJ, Schwartz NB 1990 Differential effects of factor AP-1. EMBO J 13:4087–4095 in vitro glucocorticoids on luteinizing hormone and follicle-stimu- 54. Halvorson LM, Ito M, Jameson JL, Chin WW 1998 Steroidogenic lating hormone secretion: dependence on sex of pituitary donor. factor-1 and early growth response protein 1 act through two com- Endocrinology 127:891–899 58. Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, posite DNA binding sites to regulate luteinizing hormone ␤-subunit Tahara M, Hisamoto K, Kurachi H, Murata Y 2000 Activation of gene expression. J Biol Chem 273:14712–14720 the luteinizing hormone ␤ promoter by gonadotropin-releasing 55. Cates PS, Li XF, O’Byrne KT 2004 The influence of 17beta-oestra- hormone requires c-Jun NH2-terminal protein kinase. J Biol Chem diol on corticotrophin-releasing hormone induced suppression of 275:21639–21647 luteinising hormone pulses and the role of CRH in hypoglycaemic 59. Kotitschke A, Sadie-Van Gijsen H, Avenant C, Fernandes S, Hap- stress-induced suppression of pulsatile LH secretion in the female good JP 2009 Genomic and nongenomic cross talk between the rat. Stress 7:113–118 gonadotropin-releasing hormone receptor and glucocorticoid re- 56. Rivier C, Rivier J, Vale W 1986 Stress-induced inhibition of repro- ceptor signaling pathways. Mol Endocrinol 23:1726–1745