DOCSLIB.ORG

Thesis Reference

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thesis Reference Thesis A kinome-wide RNAi screen to identify genes controlling membrane lipid homeostasis in human cells GEHIN, Charlotte Abstract The control of lipid homeostasis is a fundamental process that allows cells to maintain the unique lipid composition of their membrane compartments and to deal with the energetic fluxes from metabolism. If most of enzymes involved in lipid metabolism are characterized, the question of the genetic control of lipid homeostasis is still outstanding. In order to find genes that control the homeostasis of membrane lipids, I combined a large-scale RNAi screen targeting the human knome with the techniques of targeted lipidomic analysis by mass spectrometry to monitor lipid changes in HeLa cells. Data analysis of the screen allowed the characterization of candidate genes involved in the control of membrane lipid homeostasis. In parallel, in the context of the NCCR Chemical Biology, I developed a robotically-assisted siRNA transfection assay and screened a library of chemicals potentially able to transfect siRNA in Human cells at least as efficiently than commercially available compounds. Reference GEHIN, Charlotte. A kinome-wide RNAi screen to identify genes controlling membrane lipid homeostasis in human cells. Thèse de doctorat : Univ. Genève, 2014, no. Sc. 4670 URN : urn:nbn:ch:unige-380353 DOI : 10.13097/archive-ouverte/unige:38035 Available at: http://archive-ouverte.unige.ch/unige:38035 Disclaimer: layout of this document may differ from the published version. 1 / 1 UNIVERSITÉ DE GENÈVE FACULTÉ DES SCIENCES Section de chimie et biochimie Département de biochimie Professeur H. Riezman A Kinome-Wide RNAi Screen to Identify Genes Controlling Membrane Lipid Homeostasis in Human cells THÈSE présentée à la Faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biochimie par Charlotte GEHIN de Hennebont (France) Thèse No4670 GENÈVE Atelier Repromail 2014 Table of contents TABLE OF CONTENTS SUMMARIES .................................................................................................................................. 2 1. English summary of the thesis ................................................................................................. 2 2. Résumé de la thèse en français ................................................................................................ 4 INTRODUCTION ............................................................................................................................ 6 1. Biology of membrane lipids .................................................................................................... 6 1.1. Lipids are essential components of life .................................................................................. 6 1.2. Membrane lipid composition in mammalian cells ................................................................. 8 1.2.1. Glycerophospholipids (GPLs) ...................................................................................... 11 1.2.2. Sphingolipids (SLs) ...................................................................................................... 17 1.2.3. Sterols ........................................................................................................................... 20 1.3. Insights into the canvas of membrane lipid metabolism ...................................................... 22 2. Control of membrane lipid homeostasis ................................................................................ 26 2.1. Importance of membrane lipid homeostasis ........................................................................ 26 2.2. Overview of mechanisms that control membrane lipid homeostasis .................................. 28 2.2.1 Energy sensors and regulatory mechanisms ................................................................. 28 2.2.2 Control of lipid trafficking by the lipid-transfer proteins (LTPs) ................................ 33 2.2.3 Control of sphingolipid homeostasis: review .............................................................. 37 3. Aim of the studies .................................................................................................................. 38 MATERIAL AND METHODS ..................................................................................................... 39 1. Experimental procedures ....................................................................................................... 39 2. Statistical analysis of the Kinome-wide RNAi screen .......................................................... 42 RESULTS ....................................................................................................................................... 44 1. Investigating the genetic control of membrane lipid homeostasis with RNA interference ... 44 1.1. Choice of siRNA as a tool for genetic perturbation screen in human cells. ........................ 44 1.2. Mass spectrometry targeted-lipidomics to quantify membrane lipid changes. ................... 45 i Table of contents 1.3. A pilot siRNA screen on lipid-related proteins identifies gene-specific lipid changes ....... 46 1.3.1. Choice of target genes for the pilot screen ................................................................... 47 1.3.2. Efficacy of siRNA-induced gene knockdown .............................................................. 47 1.3.3. siRNA gene knockdown is sufficient to detect significant lipid changes .................... 50 1.3.1. Cell-population context and gene knockdown effect: example of CERT .................... 56 1.4. Lessonss from the pilot screen experiment. ......................................................................... 59 2. Kinome-wide RNAi based screen in HeLa MZ cells ............................................................ 62 2.1. Experimental conditions ...................................................................................................... 62 2.2. Membrane lipid composition of HeLa MZ .......................................................................... 62 2.3. Data processing .................................................................................................................... 72 2.4. Quality controls .................................................................................................................... 77 2.1.1 Effects of transfection reagent and non-targeting siRNA controls .............................. 79 2.1.2 PLK1 siRNA induces an apoptotic lipid profile .......................................................... 79 2.1.1 CERT siRNA induces SL, PI and sterol changes ......................................................... 80 2.5. Kinome-wide RNAi screen results ...................................................................................... 86 2.2.4 Observation of lipid behavior. ...................................................................................... 86 2.2.5 The puzzle of hit identification .................................................................................... 87 a) Hit identification using threshold determination .......................................................... 88 b) Principal Component analysis (PCA)........................................................................... 91 c) Genes with patterns of lipid changes: correlation- vs HIS-based selection ................. 97 2.2.6 Validation of candidate genes based on literature ...................................................... 109 2.2.7 Hypothesis-driven analysis of lipid profiles ............................................................... 112 2.2.8 Ongoing research ........................................................................................................ 115 3. Screening of Dynamic Amphiphiles as siRNA Delivery System in Mammalian Cells ..... 116 3.1. Summary of the research ................................................................................................... 116 3.2. Articles ............................................................................................................................... 117 DISCUSSION .............................................................................................................................. 118 1. Analysis of candidate genes from the siRNA kinome-wide screen .................................... 118 2. How to interpret observed modifications of lipid profiles? ................................................ 122 3. Lessons from the screening “experience” and perspectives ................................................ 126 ii Table of contents APPENDIX .................................................................................................................................. 127 1. siRNAs ................................................................................................................................ 127 2. Oligonucleotide sequences of primers ................................................................................ 127 3. Discarded conditions ........................................................................................................... 127 4. Multiple reaction monitoring assay ..................................................................................... 127 5. Data ..................................................................................................................................... 127 ABBREVIATIONS .....................................................................................................................
Load more

Recommended publications
  • ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AP08962PU-N ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: ELISA, IHC, WB Recommended Dilution: ELISA: 1/32000. Immunohistochemistry on Paraffin Sections: 3.75 µg/ml. Western Blot: 1 - 3 µg/ml. Reactivity: Canine, Human Host: Goat Clonality: Polyclonal Immunogen: Synthetic peptide from C-terminus of human ALS2CR2 Specificity: This antibody reacts to STE20-Related Kinase Adaptor Beta (STRADB/ALS2CR2) at aa 406-418. It is expected to recognise both human isoforms: ILPIP-alpha (NP_061041.2) and ILPIP-beta (AAF71042.1). Formulation: Tris saline buffer, pH 7.3, 0.5% BSA, 0.02% sodium azide State: Aff - Purified State: Liquid purified Ig Concentration: lot specific Purification: Immunoaffinity Chromatography Conjugation: Unconjugated Storage: Store the antibody undiluted at 2-8°C for one month or (in aliquots) at -20°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Database Link: Entrez Gene 55437 Human Q9C0K7 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N Background: Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2, is connected to transferase/kinase activity and ATP binding, it has recently been shown to interact with XIAP, a member of the IAP (Inhibitor of Apoptosis) protein family.
    [Show full text]
  • A Sensitized RNA Interference Screen Identifies a Novel Role for the PI3K P110γ
    Author Manuscript Published OnlineFirst on June 7, 2011; DOI: 10.1158/1541-7786.MCR-10-0200 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 A sensitized RNA interference screen identifies a novel role for the PI3K p110γ isoform in medulloblastoma cell proliferation and chemoresistance Ana S. Guerreiro 1, Sarah Fattet 2,3, Dorota W. Kulesza 1, Abdullah Atamer 1, Alexandra N. Elsing 1, Tarek Shalaby 1, Shaun P. Jackson 4, Simone M. Schoenwaelder 4, Michael A. Grotzer 1, Olivier Delattre 2, and Alexandre Arcaro 1,5 1 Department of Oncology, University Children’s Hospital, Zurich, Switzerland 2 Laboratoire de Pathologie Moléculaire des Cancers, Institut Curie, Paris, France 3 Unité d'Hématologie et Oncologie Pédiatrique, Centre Hospitalier Universitaire Vaudois Lausanne (CHUV), Lausanne, Switzerland 4 Australian Centre for Blood Diseases, Monash University, 6th Floor Burnet Building Alfred Medical Research and Education Precinct, Prahran, Victoria, Australia 5 Division of Pediatric Hematology/Oncology, Department of Clinical Research, University of Bern, Switzerland Requests for reprints: Alexandre Arcaro, University of Bern, Department of Clinical Research, Tiefenaustrasse 120c, 3004 Bern, Switzerland. Tel. +41 31 308 80 29; FAX +41 31 308 80 28; Email [email protected] Grant Support: This work was supported by grants from the Werner und Hedy Berger-Janser – Stiftung zur Erforschung der Krebskrankheiten, the Forschungskredit der Universität Zürich, the Fondation FORCE, the Stiftung zur Krebsbekämpfung and the European Community FP7 (ASSET, project number: 259348) to AA. Running title: Role of p110γ in medulloblastoma Keywords: medulloblastoma; phosphoinositide 3-kinase; Akt; apoptosis; chemoresistance Downloaded from mcr.aacrjournals.org on October 5, 2021.
    [Show full text]
  • WO 2Ull/13162O Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date Χ 1 / A 1 27 October 2011 (27.10.2011) WO 2Ull/13162o Al (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, C12N 9/02 (2006.01) A61K 38/44 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, A61K 38/17 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/EP20 11/056142 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, 18 April 201 1 (18.04.201 1) SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Langi English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, 10160368.6 19 April 2010 (19.04.2010) EP ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicants (for all designated States except US): MEDI- EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, FT, LT, LU, ZINISCHE UNIVERSITAT INNSBRUCK [AT/AT]; LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Christoph-Probst-Platz, Innrain 52, A-6020 Innsbruck SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, (AT).
    [Show full text]
  • Phytophthora Sojae Effector Avr1d Functions As an E2 Competitor and Inhibits Ubiquitination Activity of Gmpub13 to Facilitate Infection
    Phytophthora sojae effector Avr1d functions as an E2 competitor and inhibits ubiquitination activity of GmPUB13 to facilitate infection Yachun Lina,b,c,1, Qinli Hud,e,1, Jia Zhoud,e, Weixiao Yina,f, Deqiang Yaog, Yuanyuan Shaoa, Yao Zhaoa,b,c, Baodian Guoa,b,c, Yeqiang Xiaa,b,c, Qian Chenh,i, Yan Wanga,b,c, Wenwu Yea,b,c, Qi Xiei, Brett M. Tylerj, Weiman Xingk,2, and Yuanchao Wanga,b,c,2 aDepartment of Plant Pathology, Nanjing Agricultural University, 210095 Nanjing, China; bThe Key Laboratory of Integrated Management of Crop Diseases and Pests (Ministry of Education), Nanjing Agricultural University, 210095 Nanjing, China; cThe Key Laboratory of Plant Immunity, Nanjing Agricultural University, 210095 Nanjing, China; dShanghai Center for Plant Stress Biology and Center of Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai 200032, China; eUniversity of Chinese Academy of Sciences, Beijing 100049, China; fDepartment of Plant Pathology, College of Plant Science and Technology and the Key Lab of Crop Disease Monitoring and Safety Control in Hubei Province, Huazhong Agricultural University, 430070 Wuhan, China; giHuman Institute, ShanghaiTech University, Shanghai 201210, China; hMinistry of Agriculture Key Lab of Pest Monitoring and Green Management, Department of Plant Pathology, College of Plant Protection, China Agricultural University, 100193 Beijing, China; iState Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, The Innovative Academy of Seed Design, Chinese Academy of Sciences,
    [Show full text]
  • Potential Genotoxicity from Integration Sites in CLAD Dogs Treated Successfully with Gammaretroviral Vector-Mediated Gene Therapy
    Gene Therapy (2008) 15, 1067–1071 & 2008 Nature Publishing Group All rights reserved 0969-7128/08 $30.00 www.nature.com/gt SHORT COMMUNICATION Potential genotoxicity from integration sites in CLAD dogs treated successfully with gammaretroviral vector-mediated gene therapy M Hai1,3, RL Adler1,3, TR Bauer Jr1,3, LM Tuschong1, Y-C Gu1,XWu2 and DD Hickstein1 1Experimental Transplantation and Immunology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA and 2Laboratory of Molecular Technology, Scientific Applications International Corporation-Frederick, National Cancer Institute-Frederick, Frederick, Maryland, USA Integration site analysis was performed on six dogs with in hematopoietic stem cells. Integrations clustered around canine leukocyte adhesion deficiency (CLAD) that survived common insertion sites more frequently than random. greater than 1 year after infusion of autologous CD34+ bone Despite potential genotoxicity from RIS, to date there has marrow cells transduced with a gammaretroviral vector been no progression to oligoclonal hematopoiesis and no expressing canine CD18. A total of 387 retroviral insertion evidence that vector integration sites influenced cell survival sites (RIS) were identified in the peripheral blood leukocytes or proliferation. Continued follow-up in disease-specific from the six dogs at 1 year postinfusion. A total of 129 RIS animal models such as CLAD will be required to provide an were identified in CD3+ T-lymphocytes and 102 RIS in accurate estimate
    [Show full text]
  • Inaugural-Dissertation Zur Erlangung Der Doktorwürde Der Naturwissenschaftlich-Mathematischen Gesamtfakultät Der Ruprecht-Kar
    Inaugural-Dissertation zur Erlangung der Doktorwürde der Naturwissenschaftlich-Mathematischen Gesamtfakultät der Ruprecht-Karls-Universität Heidelberg vorgelegt von Diplom-Biochemiker Stefan Knoth Tag der mündlichen Prüfung: 25.07.2006 Titel der Arbeit: Regulation der Genexpression bei der Erythroiden Differenzierung Gutachter: Prof. Dr. Stefan Wölfl, Universität Heidelberg Prof. Dr. Katharina Pachmann, Universität Jena Prof. Dr. Jürgen Reichling Prof. Dr. Ulrich Hilgenfeldt Zusammenfassung Viele Erkrankungen des blutbildenden Systems, insbesondere Leukämien, haben ihre Ursache in einer Störung der Differenzierungvorgänge, die ausgehend von undifferenzierten Stammzellen des Knochenmarks zu allen Arten von hochspezialisierten Blutzellen führen. Bei der Chronischen Myeloischen Leukämie (CML) im Stadium der Blastenkrise kommt es zu einer unkontrollierten Vermehrung unreifer Blasten. Alle Chronischen Myeloischen Leukämien exprimieren dass Fusionsprotein BCR-ABL welches aus der Translokation t(9;22)(q34;q11) resultiert. BCR-ABL ist eine konstitutiv aktive Proteinkinase und stimuliert die Zellen zu unkontrolliertem Wachstum. Es ist bekannt, dass sich bei transformierten Zellen mit verschiedenen Substanzen wie AraC oder Butyrat die Proliferation unterdrücken und eine weitere Differenzierung induzieren lässt. Daher werden diese Substanzen oder ihre Derivate als Therapeutika eingesetzt bzw. als solche erprobt. Bei CML-Zellen geht man davon aus, dass durch die genannten Chemikalien die Differenzierung in Richtung der erythroiden Reihe stimuliert wird, da verstärkt Hämoglobine synthetisiert werden. Wegen ihrer einfachen Handhabung in Kultur wurden diese Zellsysteme in der Vergangenheit häufig als Modelle zur Untersuchung der erythroiden Differenzierung verwendet. Die therapeutikastimulierte erythroide Differenzierung von CML-Zellen ist also in zweierlei Hinsicht interessant, einerseits aus medizinischer Sicht zur Bewertung der Vorgänge im behandelten Patienten und andererseits hinsichtlich der Eignung dieser Systeme als Modelle zur Erforschung der Erythropoese.
    [Show full text]
  • The Dual Role of Micrornas in Colorectal Cancer Progression
    International Journal of Molecular Sciences Review The Dual Role of MicroRNAs in Colorectal Cancer Progression Lei Ding 1,2,†, Zhenwei Lan 1,2,†, Xianhui Xiong 1,2, Hongshun Ao 1,2, Yingting Feng 1,2, Huan Gu 1,2, Min Yu 1,2 and Qinghua Cui 1,2,* 1 Lab of Biochemistry & Molecular Biology, School of Life Sciences, Yunnan University, Kunming 650091, China; [email protected] (L.D.); [email protected] (Z.L.); [email protected] (X.X.); [email protected] (H.A.); [email protected] (Y.F.); [email protected] (H.G.); [email protected] (M.Y.) 2 Key Lab of Molecular Cancer Biology, Yunnan Education Department, Kunming 650091, China * Correspondence: [email protected]; Tel.: +86-871-65031412 † These authors contributed equally to this work. Received: 29 August 2018; Accepted: 13 September 2018; Published: 17 September 2018 Abstract: Colorectal cancer (CRC) is responsible for one of the major cancer incidence and mortality worldwide. It is well known that MicroRNAs (miRNAs) play vital roles in maintaining the cell development and other physiological processes, as well as, the aberrant expression of numerous miRNAs involved in CRC progression. MiRNAs are a class of small, endogenous, non-coding, single-stranded RNAs that bind to the 3’-untranslated region (30-UTR) complementary sequences of their target mRNA, resulting in mRNA degradation or inhibition of its translation as a post-transcriptional regulators. Moreover, miRNAs also can target the long non-coding RNA (lncRNA) to regulate the expression of its target genes involved in proliferation and metastasis of CRC. The functions of these dysregulated miRNAs appear to be context specific, with evidence of having a dual role in both oncogenes and tumor suppression depending on the cellular environment in which they are expressed.
    [Show full text]
  • Newly Identified Gon4l/Udu-Interacting Proteins
    www.nature.com/scientificreports OPEN Newly identifed Gon4l/ Udu‑interacting proteins implicate novel functions Su‑Mei Tsai1, Kuo‑Chang Chu1 & Yun‑Jin Jiang1,2,3,4,5* Mutations of the Gon4l/udu gene in diferent organisms give rise to diverse phenotypes. Although the efects of Gon4l/Udu in transcriptional regulation have been demonstrated, they cannot solely explain the observed characteristics among species. To further understand the function of Gon4l/Udu, we used yeast two‑hybrid (Y2H) screening to identify interacting proteins in zebrafsh and mouse systems, confrmed the interactions by co‑immunoprecipitation assay, and found four novel Gon4l‑interacting proteins: BRCA1 associated protein‑1 (Bap1), DNA methyltransferase 1 (Dnmt1), Tho complex 1 (Thoc1, also known as Tho1 or HPR1), and Cryptochrome circadian regulator 3a (Cry3a). Furthermore, all known Gon4l/Udu‑interacting proteins—as found in this study, in previous reports, and in online resources—were investigated by Phenotype Enrichment Analysis. The most enriched phenotypes identifed include increased embryonic tissue cell apoptosis, embryonic lethality, increased T cell derived lymphoma incidence, decreased cell proliferation, chromosome instability, and abnormal dopamine level, characteristics that largely resemble those observed in reported Gon4l/udu mutant animals. Similar to the expression pattern of udu, those of bap1, dnmt1, thoc1, and cry3a are also found in the brain region and other tissues. Thus, these fndings indicate novel mechanisms of Gon4l/ Udu in regulating CpG methylation, histone expression/modifcation, DNA repair/genomic stability, and RNA binding/processing/export. Gon4l is a nuclear protein conserved among species. Animal models from invertebrates to vertebrates have shown that the protein Gon4-like (Gon4l) is essential for regulating cell proliferation and diferentiation.
    [Show full text]
  • Genome-Wide Association and Gene Enrichment Analyses of Meat Sensory Traits in a Crossbred Brahman-Angus
    Proceedings of the World Congress on Genetics Applied to Livestock Production, 11. 124 Genome-wide association and gene enrichment analyses of meat tenderness in an Angus-Brahman cattle population J.D. Leal-Gutíerrez1, M.A. Elzo1, D. Johnson1 & R.G. Mateescu1 1 University of Florida, Department of Animal Sciences, 2250 Shealy Dr, 32608 Gainesville, Florida, United States. [email protected] Summary The objective of this study was to identify genomic regions associated with meat tenderness related traits using a whole-genome scan approach followed by a gene enrichment analysis. Warner-Bratzler shear force (WBSF) was measured on 673 steaks, and tenderness and connective tissue were assessed by a sensory panel on 496 steaks. Animals belong to the multibreed Angus-Brahman herd from University of Florida and range from 100% Angus to 100% Brahman. All animals were genotyped with the Bovine GGP F250 array. Gene enrichment was identified in two pathways; the first pathway is involved in negative regulation of transcription from RNA polymerase II, and the second pathway groups several cellular component of the endoplasmic reticulum membrane. Keywords: tenderness, gene enrichment, regulation of transcription, cell growth, cell proliferation Introduction Identification of quantitative trait loci (QTL) for any complex trait, including meat tenderness, is the first most important step in the process of understanding the genetic architecture underlying the phenotype. Given a large enough population and a dense coverage of the genome, a genome-wide association study (GWAS) is usually successful in uncovering major genes and QTLs with large and medium effect on these type of traits. Several GWA studies on Bos indicus (Magalhães et al., 2016; Tizioto et al., 2013) or crossbred beef cattle breeds (Bolormaa et al., 2011b; Hulsman Hanna et al., 2014; Lu et al., 2013) were successful at identifying QTL for meat tenderness; and most of them include the traditional candidate genes µ-calpain and calpastatin.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name STE20-related kinase adaptor alpha Gene Symbol STRADA Organism Human Gene Summary The protein encoded by this gene contains a STE20-like kinase domain but lacks several residues that are critical for catalytic activity so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11 also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39 also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios megalencephaly and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. Gene Aliases FLJ90524, LYK5, NY-BR-96, PMSE, STRAD, Stlk RefSeq Accession No. NC_000017.10, NT_010783.15, NG_015817.1 UniGene ID Hs.514402 Ensembl Gene ID ENSG00000125695 Entrez Gene ID 92335 Assay Information Unique Assay ID qHsaCID0016267 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000336174, ENST00000375840, ENST00000447001, ENST00000392950, ENST00000245865 Amplicon Context Sequence CGCTGCCCATGGCTTATCATGCTGAGGTTGCTGCGCAAACCAGACAGGTAGACC TTCCCATCCACAGAGATCAGGATGTGGCTGGCTTTGACACTCCTGTGTACATATC CCATGTGGTGGATGTAGTCGAGGGCCTTCAGCACCC Amplicon Length (bp) 115 Chromosome Location 17:61784683-61787899 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 Page 1/5 PrimePCR™Assay Validation Report R2 0.9994 cDNA Cq 22.26 cDNA Tm (Celsius) 84 gDNA Cq 41.26 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Hereditary Spastic Paraplegia: from Genes, Cells and Networks to Novel Pathways for Drug Discovery
    brain sciences Review Hereditary Spastic Paraplegia: From Genes, Cells and Networks to Novel Pathways for Drug Discovery Alan Mackay-Sim Griffith Institute for Drug Discovery, Griffith University, Brisbane, QLD 4111, Australia; a.mackay-sim@griffith.edu.au Abstract: Hereditary spastic paraplegia (HSP) is a diverse group of Mendelian genetic disorders affect- ing the upper motor neurons, specifically degeneration of their distal axons in the corticospinal tract. Currently, there are 80 genes or genomic loci (genomic regions for which the causative gene has not been identified) associated with HSP diagnosis. HSP is therefore genetically very heterogeneous. Finding treatments for the HSPs is a daunting task: a rare disease made rarer by so many causative genes and many potential mutations in those genes in individual patients. Personalized medicine through genetic correction may be possible, but impractical as a generalized treatment strategy. The ideal treatments would be small molecules that are effective for people with different causative mutations. This requires identification of disease-associated cell dysfunctions shared across geno- types despite the large number of HSP genes that suggest a wide diversity of molecular and cellular mechanisms. This review highlights the shared dysfunctional phenotypes in patient-derived cells from patients with different causative mutations and uses bioinformatic analyses of the HSP genes to identify novel cell functions as potential targets for future drug treatments for multiple genotypes. Keywords: neurodegeneration; motor neuron disease; spastic paraplegia; endoplasmic reticulum; Citation: Mackay-Sim, A. Hereditary protein-protein interaction network Spastic Paraplegia: From Genes, Cells and Networks to Novel Pathways for Drug Discovery. Brain Sci. 2021, 11, 403.
    [Show full text]
  • Association of Cnvs with Methylation Variation
    www.nature.com/npjgenmed ARTICLE OPEN Association of CNVs with methylation variation Xinghua Shi1,8, Saranya Radhakrishnan2, Jia Wen1, Jin Yun Chen2, Junjie Chen1,8, Brianna Ashlyn Lam1, Ryan E. Mills 3, ✉ ✉ Barbara E. Stranger4, Charles Lee5,6,7 and Sunita R. Setlur 2 Germline copy number variants (CNVs) and single-nucleotide polymorphisms (SNPs) form the basis of inter-individual genetic variation. Although the phenotypic effects of SNPs have been extensively investigated, the effects of CNVs is relatively less understood. To better characterize mechanisms by which CNVs affect cellular phenotype, we tested their association with variable CpG methylation in a genome-wide manner. Using paired CNV and methylation data from the 1000 genomes and HapMap projects, we identified genome-wide associations by methylation quantitative trait locus (mQTL) analysis. We found individual CNVs being associated with methylation of multiple CpGs and vice versa. CNV-associated methylation changes were correlated with gene expression. CNV-mQTLs were enriched for regulatory regions, transcription factor-binding sites (TFBSs), and were involved in long- range physical interactions with associated CpGs. Some CNV-mQTLs were associated with methylation of imprinted genes. Several CNV-mQTLs and/or associated genes were among those previously reported by genome-wide association studies (GWASs). We demonstrate that germline CNVs in the genome are associated with CpG methylation. Our findings suggest that structural variation together with methylation may affect cellular phenotype. npj Genomic Medicine (2020) 5:41 ; https://doi.org/10.1038/s41525-020-00145-w 1234567890():,; INTRODUCTION influence transcript regulation is DNA methylation, which involves The extent of genetic variation that exists in the human addition of a methyl group to cytosine residues within a CpG population is continually being characterized in efforts to identify dinucleotide.
    [Show full text]