Regeneration of Populus Nigra Transgenic Plants Expressing a Kunitz
Total Page：16
File Type：pdf, Size：1020Kb
Molecular Breeding 4: 137–145, 1998. 137 c 1998 Kluwer Academic Publishers. Printed in Belgium. Regeneration of Populus nigra transgenic plants expressing a Kunitz proteinase inhibitor (KTi3)gene ࣿ Massimo Confalonieri1; , Gianni Allegro1, Alma Balestrazzi2, Corrado Fogher3 & Massimo Delledonne3 1Poplar Research Institute, via di Frassineto 35, 15033 Casale Monferrato (AL), Italy ( ࣿ author for correspondence; fax 39 142 55580); 2Department of Genetics and Microbiology ‘A. Buzzati-Traverso’, via Abbiategrasso 207, 27100 Pavia, Italy; 3Institute of Plant Genetics, Universita` Cattolica del S. Cuore, via Emilia Parmense 84, 29100 Piacenza, Italy Received 28 November 1996; accepted in revised form 15 December 1997 Key words: Agrobacterium tumefaciens, insect pest resistance, Kunitz trypsin proteinase inhibitor, Populus nigra L., transgenic plants Abstract Transgenic poplar (Populus nigra, cv. Jean Pourtet) plants were recovered as a result of Agrobacterium tumefaciens- mediated transformation performed with EHA105 pBI-KUN strain. Plasmid pBI-KUN contains a 650 bp insert derived from the soybean (Glycine max L.) KTi3, gene, coding for a Kunitz trypsin proteinase inhibitor. A total of 58 independent transgenic lines were obtained from 200 co-cultivated leaf explants. Southern blot hybridiza- tion analysis demonstrated the presence of KTi3 gene in the poplar genome. Northern blot analysis of different kanamycin-resistant plantlets confirmed the accumulation of KTi3 mRNA and revealed different levels of expression. The trypsin inhibitory activity was determined in poplar transgenic tissues by means of specific assay. Moreover, the trypsin-like digestive proteinases of the polyphagous moth Lymantria dispar (Lepidoptera, Lymantriidae) and Clostera anastomosis (Lepidoptera, Notodontidae) were detected and inhibited in vitro by Kunitz proteinase inhib- itor from selected transgenic plants. Two insect bioassays were performed on P. nigra transgenic plant lines, using larvae of the above mentioned insects. In both cases larval mortality and growth as well as pupal weight were not significantly affected when the insects were fed on transgenic leaves and control leaves, respectively. Abbreviations: BAP, 6-benzyl-aminopurine; IBA, indole-3-butyric acid; KTi, Kunitz trypsin inhibitor; LB, Luria Bertani; MS, Murashige & Skoog 1962; NAA, -napthaleneacetic acid; SDS, sodium dodecyl sulfate; SSC, sodium chloride/sodium citrate; Tris, tris(hydroxymethyl)amino methane; WPM, woody plant medium. Introduction the time required, by the tree, in order to reach sexu- al maturity and become suitable for classical breed- The genetic improvement of woody plants (forest, ing programmes [10]. Due to its small genome and ornamental, plantation and fruit trees) has been lim- ease of vegetative propagation, poplar (Populus spe- ited by several factors, such as the size of the trees, the cies and hybrids) represents a useful model system for long life cycle and the lack of information concerning the investigation of the genetics and molecular bio- their basic genetics [28]. Genetic engineering provides logy of woody species [35]. The economic import- the opportunity to transfer new specific traits of interest ance of poplar is now increasing, because of its fast (for example, those for insect pest resistance) into valu- growth and short rotation times; moreover, in the many able genotypes. Moreover, with the methods of genet- countries of the temperate regions of the world, pop- ic transfer, the period of time necessary to establish lar trees represent the primary source of wood [15]. and analyse transgenic lines is generally shorter than Poplars are seriously damaged by Lepidopteran pests 138 which cause heavy defoliations resulting in remarkably Materials and methods slower growth rates [23]. A severe damage to poplars is being caused by Hyphantria cunea Drury (Lepid- Plant materials and culture media optera, Arctiidae), which was accidentally introduced into Europe by woody or other commercial material Aseptic shoot cultures of Populus nigra (cv. Jean Pour- [1], due to the lack of natural enemies. Other recurrent tet) were maintained in vitro on woody plant medium poplar pests are represented by Clostera anastomos- (WPM) [26] with or without IBA (0.5 mg/l), supple- is L. (Lepidoptera, Notodontidae) and Lymantria dis- mented with 2% (w/v) sucrose (Merck), 0.3% (w/v) par L. (Lepidoptera, Lymantriidae). In Italy, economic charcoal (Sigma) and 0.7% (w/v) agar-agar (Merck). losses caused by defoliators are estimated to be 0.5% of Plantlets were propagated on the same basic medium, the total woody production value [14]. Therefore, the containing 0.5 mg/l IBA, through subculture of stem protection of poplars against Lepidoptera is urgently segments. Shoot regeneration was achieved by placing needed. leaf explants on modified WPM (with MS microsalts), Several chemically synthesized insecticides are containing 0.4% (w/v) agar-agar and 0.2% (w/v) gel- currently used to control insect damage in agricul- rite (Schweizerhall), supplemented with 0.5 mg/l BAP ture but they are estimated to have an enormous cost and 0.05 mg/l NAA. All cultures were maintained in a worldwide and a strong environmental impact. The growth chamber at 22–25 C, with a 16:8 h light/dark genetic engineering of insect tolerance into crop plants cycle. has become of significant interest to agricultural bio- technology. Ectopic expression of genes coding for Bacterial strains and plasmids proteinase inhibitors, which are part of the natural defence system developed by plants against insect The Agrobacterium tumefaciens strain EHA105 [17], attack, represent an effective approach. Successful a non-oncogenic derivative of strain A281, which har- protection against insect pests has been observed in bours the hypervirulent helper Ti plasmid pTiBo542 different transgenic plants which contain genes cod- was used for transformation. The pBI-KUN vec- ing for proteinase inhibitors [13, 16, 19, 25]. These tor plasmid (11 kb, Figure 1A) contains a 650 bp proteins act by forming stoichiometric protein-protein fragment that was obtained by PCR amplification complexes with various digestive enzymes, resulting of the soybean KTi3 gene [18] using two specific in the competitive inhibition of their catalytic func- primers carrying a BamHI site (K1: GGATCCATGAA- tions [24]. Four classes (cysteine, serine, metallo- and GAGCACCATCTTCTTTCTCTTTC) and a PvuII aspartyl-proteinase inhibitors) have been identified; site (K2: GTACCGGAAAGAGCGTCACTCACT- serine proteinase inhibitors are active against trypsin GTCGAC). The amplified fragment was cloned into and/or chymotrypsin-like enzymes [33]. Studies con- pGEM-T (Promega), sequenced and then introduced cerning the effects of proteinase inhibitors, localized in into the binary vector pBI121 (Clontech), routinely plant tissues or artificially introduced into diets, have used for plant transformation, under the control of the shown that the native proteinase inhibitors can inter- cauliflower mosaic virus (CaMV) 35S promoter and fere with the growth and development of insects, by the polyadenylation region from the nopaline synthase inhibiting their digestive enzymes [4, 8]. The soybean gene (nos-ter) [2]. The PvuII site was lost during the Kunitz factor is the most powerful trypsin inhibitor so cloning procedure. The resulting binary plasmid, pBI- far characterized in plants, and trypsin-like digestive KUN, was subsequently transferred to A. tumefaciens enzymes have been identified in all Lepidoptera species by electroporating at 2500 V an EHA105 suspension examined [7, 20, 21, 22, 31, 38]. Recent progress in culture grown overnight and washed with 10% glycer- Agrobacterium tumefaciens-mediated gene transfer of ol. Bacterial cultures were grown overnight in LB [34] black poplar [11, 12] makes it possible to produce new containing 150 mg/l kanamycin (Sigma) and 150 mg/l clones by introducing genes of agronomic interest. We rifampicin (Lepetit) and resuspended in liquid WPM used A. tumefaciens-mediated transformation of leaf to a final density of 0.35–0.6 (A550). explants to transform P. nigra L. with a Kunitz trypsin proteinase inhibitor gene. Transformation and plant regeneration Transformation and regeneration conditions were those described by Confalonieri et al. [12]. Leaf explants 139 selective regeneration medium for the first 40–45 days. Control explants were cultured using the same con- ditions described for the co-cultivated leaf explants. The regenerating calli were excised from the primary explants, cultured on the same medium for 30 days, and then transferred to selective regeneration medi- um containing a reduced amount of BAP (0.05 mg/l). Shoots (sized 1–2 cm) were elongated on WPM in the absence of growth regulators and kanamycin. Sub- sequently, they were subcultured twice on WPM con- taining 100 mg/l kanamycin to test rooting. Only those plantlets which rooted under these conditions were considered kanamycin-resistant and transferred to the greenhouse. Cultures were kept at 22–25 C, with a 16:8 h light/dark cycle. Transformation frequency was defined as percentage of inoculated leaf explants that produced kanamycin-resistant plantlets. Southern blot hybridization analysis of plant genomic DNA Total DNA was extracted from leaves of untrans- formed and putatively transgenic plants regenerated from independent transformation events, according to Rogers and Bendich [32], by freezing and grinding the tissues in liquid N2. For each sample, 10 ऌgof genomic DNA were digested with EcoRI