Geographic Patterns of Cattle, Sheep and Goat Diversity

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Towards a strategy for the conservation of Sheep and goat genetic the genetic diversity of European cattle resources in marginal rural EU project ResGen CT98-118 areas sirs.epfl.ch/projets/econogene/ Utrecht Giessen Piacenza Madrid Tjele J.A. Lenstra G. Erhardt P. Ajmone- S. Dunner L.E. Holm I.J. Nijman O. Jann Marsan J. Cañón Oslo Malle C. Weimann R. Negrini Zaragoza I. Olsaker G. Mommens E. Prinzenberg E. Milanesi P. Zaragoza Jokioinen Berne Hannover Viterbo C. Rodellar J. Kantanen G. Dolf B. Harlizius A. Valentini I. Martín- Reykjavik M.C. Savarese Burriel Roslin Kiel E. Eythorsdottir E. Kalm C. Marchitelli Barcelona J.L. Williams Uppsala C. Looft Milano A. Sanchez P. Wiener B. Danell Munich M. Zanotti J. Piedrafita D. Burton Vilnas I. Medugorac G. Ceriotti Porto Dublin I. Miceikiene Grenoble Campo- A. Beja- D. Bradley Jelgava D.E. MacHugh P. Taberlet basso Pereira Z. Grislis R.A. Freeman G. Luikart F. Pilla N. Ferrand Jouy-en- C. Maudet A. Bruzzone Tartu H. Viinalass Josas D. Iamartino K. Moazami- Goudarzi D. Laloë

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Reconstruct history of the genetic landscape migration, introgression, breed formation > partitioning of diversity, relationships of breeds, geographic effects Compare cattle, sheep and goat Indicate priorities for conservation

1 Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Microsatellites - cattle, core data set : 77 breeds, 25-50 animals/breed, 30 markers - cattle, previous data : 104 breeds, 25-50 animals/breeds, 15-26 markers - sheep : 56 sheep, 50 animals/breed, 31 markers (Giessen) - goat : 46 breeds, 50 animals/breeds, 30 markers (Berne, Madrid)

AFLP ( Utrecht, Piacenza ) SNPs in candidate genes mtDNA variation in sheep and goat

Y-chromosomal SNPs (SNPs in 7.5 kb Utrecht, Hubrecht Laboratory )

2 Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

AFLP ( Utrecht, Piacenza ) SNPs in candidate genes mtDNA variation in sheep and goat

Y-chromosomal SNPs (7.5 kb, 800 animals, Utrecht, Hubrecht Laboratory )

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Y-chromosomal SNPs (7.5 kb, 800 animals, Utrecht, Hubrecht Laboratory )

3 Model-based clustering Structure, J. Pritchard (2000)

Originally designed for detection of stratification in genetic association studies Finding subdivision by optimization of Hardy-Weinberg and linkage equilibria via Monte-Carlo procedure Bayesian assignment of individuals to k clusters Application to human genotypes (Rosenberg et al. , 2002, Science 298, 2381-2385 ) praised by the Lancet as ‘ the most relevant biomedical publication in 2002 ’ and already in textbooks

Model-based clustering of cattle

Swedish Swiss HF Bretonne BP Betizu B Germ. Simmental Swiss Brown Sayaguesa Podolica Red Polled British HF Charolais Pirenaica Simmental Germ. Br. Württemberg Alistano Romagnola Bohemian Red Jutland 1950 Ayrshire Blonde d'Aquitaine Hinterwaelder Germ. Br. Bavaria Rubia Gallega Chianina Polish Red Dutch Belted Highland Limousin German Yellow Germ. Br. Orig Asturiana Valles N'Dama Red Danish German BP-W Hereford Bazadais Evolene Bruna Pirineds Asturiana Montana Somba Angeln Friesian-Holland Dexter Gasconne Eringer Menorquina Tudanca Lagunaire MRY Belgian Blue Aberdeen Angus Aubrac Piemontese Mallorquina Tora de Lidia Borgou Red HF dual Germ. Shorthorn Jersey Salers Grigio Alpina Retinta Casta Navarra Zebu Peul k Red HF dairy Maine-Anjou Guernsey Montbéliard Rendena Morucha Hungarian Grey Groningen WH Normande Betizu A Pezzata Rossa Ital. Cabannina Avilena Istrian 2 Europe Africa 3 North-West

SRP

SHI ABA

AYR JUT

DA DEX R ANG HFR H W HER FRH G Y BPW DUB R M RH2, RHD BWB GUE J ER GSH NOR POR GSI GYE BOR BPN MA BRW BRB N HIW MBE GBO HGY CHA SIM SWB LIM ERI RENGRA B EVO RGA AZ SA AS L V IST AS B AUB A MTU DA PIMCAB LI D BET ROM P G CNA IR AS SAY CHI M BP OR AVI I

RET POD MEN MAL TDL

4 Model-based clustering of cattle

North-West Central Mediterranean SRP

SHI ABA

AYR JUT

DA DEX R ANG HFR H W HER FRH G Y BPW DUB R > 3 main groups of breeds M RH2, RHD BWB GUE JER N GSH - North-West OR BOR POR GSI GYE BPN MA BRW BRB N HIW MBE GBO - Central HGY CHA SIM SWB LIM ERI RENGRA B EVO RGA AZ SA AS L - Mediterranean V IST AS B AUB A MTU DA PIMCAB LI D BET ROM P G CNA IR AS SAY CHI M BP OR AVI I

RET POD MEN MAL TDL

Model-based clustering of cattle

Germanic Central Mediterranean SRP 4 SHI ABA

AYR British JUT DA DEX R 3 5 ANG HFR H W HER FRH G Y BPW Baltic Lowland NW French Alpine Alpine Iberian DUBPodolianR M RH2, RHD Red Pied Intermediates Brown West Brown BWB GUE J Alpine ER GSH NOR POR GSI GYE BOR Intermediates BPN MA BRW BRB N HIW MB GBO E Y 8 clusters of breeds CH S HG A IM SWB LIM ERI RENGRA B EVO RGA AZ SA AS L V PRI IST AS B AUB A MTU DA PIMCAB LI D BET ROM 2 intermediate zones C P GA NA IR S SAY CHI M BP OR AVI I

RET POD New classification of breeds MEN MAL TDL

5 Model-based clustering of cattle

Germanic Central Mediterranean SRP 4 SHI ABA

AYR British JUT DA DEX R 3 5 ANG HFR H W HER FRH G Y BPW Baltic Lowland NW French Alpine Alpine Iberian DUBPodolianR M RH2, RHD Red Pied Intermediates Brown West Brown BWB GUE J Alpine ER GSH NOR POR GSI GYE BOR Intermediates BPN MA BRW BRB N HIW MBE GBO HGY CHA SIM SWB LIM ERI RENGRA B EVO RGA AZ SA AS L V PRI IST AS B AUB A MTU DA PIMCAB LI D BET ROM Genetic distances? P GA CNA IR S SAY CHI M BP OR AVI I

RET POD MEN MAL TDL

Visualization of distance analysis

Trees (hierarchical clustering) confounded by reticulation (e.g., relationships of breeds from different clusters)

Coordinate plots > geospatial gradients display part of the information confounded by inbred breeds Networks for more complex situations

6 Distance analysis example of reticulation

A C

D B Same distance

Distance analysis networks for reticulated data set NeighborNet: networks via Neighbor-Joining

A C

B D

7 Distance analysis of cattle breeds Neighbor networks

North-West Danish Red Again 3 major groups

F r i e s i G Groningen a e n r - m White-headed H D o a u l n t A l c a n B h M n g d l e a B l e u c e s k r B l e t r - d R - i P e R t e e i i d h e d s R in h d R H J d e n a e o H u W e d - a n l Y i S s o t R Sayaguesa H s l e a w t l a t o e s s s m is l n h n s i e t t e s t n e s l d i o a H e h o in D in l g o M l u o e s D a l t B a l ei ai l P a Betizu n ry n a n Toro di Lidia a e i G l B r i a e a h Maine-Anjou lg u i v c a ia t u n n s b A r i b u o h ra lu A c zu ar e R M n ti av o Be N M sta Ca Normande Charolais Retinta Chianina Jersey Podolic African a Dexter Istrian Romagnola zebu Guernsey se te l Aberdeen e ire on ue shir o r B Ayr -N em l Au Angus e i Te Hinterwälder o b Salers Pi P n rac n de L de to im d Gasconne Mediterranean re ana o ’A B r G P u q er i s u Hereford r re it S a i i g n n ai a n a n Bazadaize i i e n n a i e n n c d w A a w n Scottish n o l o r a p e r P Montbéliard E i R B n b n Highland B e a v a w z s n S G o E C o z s a l i r i r a m e e in w m B t r n a S r m m a g e n r e R e a a d r G n n o l m s t a r a Y e s n l e i a G l g l i I o r t a w

O l i

n Central a

Distance analysis of cattle breeds Neighbor networks

North-West Danish Red Again 3 major groups

F Lowland r Baltic-Highland i e s i G Groningen a e n Red Pied r - White-headed m D Network reproduces clusters H o a u l n t A l c a n B h M n g d l e a B l e u c e s k r B l e t r - d NW breeds more developed R - i P e R t e e i i d h e d s R in h d R H d e J n a e o H u W e d - a n l Y i S s o t R Sayaguesa H s l e a w t l a t o e s s s m is l n h n s i e t t e s n s Visualization only incomplete t e l d i o a H e h o in D in l g o M l u o e s D a l t B a l ei ai l P a Betizu n ry n a n Toro di Lidia a e i G l B r i a e a h Maine-Anjou lg u i v c a ia t u n n s b A r i b u o h ra lu A c zu ar e R M n ti av Iberian NW intermediates o Be N M sta Ca Normande Charolais Retinta Chianina Jersey Podolic African a Dexter Istrian Romagnola zebu Guernsey se te l Aberdeen e ire on ue shir o r B Podolian Ayr -N em l Au Angus e i Te Hinterwälder o b Salers Pi P n rac n de L de to im d Gasconne Mediterranean re ana o ’A British B r G P u q er i s u Hereford r re it S a i i g n n ai a n a n Bazadaize i i e n n a i e n n c d w A a w n Scottish n o l o r a p e r P Montbéliard E i R B n b n B e French-Pyrenean Highland a v a w z s n S G o E C o z s a l i r i r a m e e in w m B t r n a S r m m a g e n r e R e a a d r Central Intermediates G n n o l m s t a r a Y e s n l e i a G l g l i I o r t Central Brown a w Central-West O l i

n Central a

8 Distance analysis of cattle breeds Neighbor networks of clusters

Central Brown Central-West African zebu French-Pyrenean Podolian

British NW Iberian intermediates African taurine Lowland Pied Reduction of data Baltic-Highland Red African – Iberian relationship dairy NW clusters most distal What about the Y-chromosomes?

Cattle Y-chromosomes results also from Götherström et al. , 2005 haplotype Y1 Danish Red

F haplotype Y2 Lowland r Baltic-Highland i e s G i Groningen a e n Red Pied r White-headed - m H D o a u l n t A l c Y2 original haplotype a n B h M n g

d l e a B l e u c e s k r B l e t r - d R - i P e R t e e h i i d d s e R i J Y1 in (1) NW Europe n h d R H u d a e n e o H t W e n d - a l Y l i a Alistana S s o a R t w H t s l n e o e s s m n is l d s h s i e t t e o s t n e s (2) Northern Spain l i a H e h l M o in D in g o l u o a e s D a l a t B l Sayaguesa e a l P n in ir a a n y i e Toro di Lidia l B r G i a (3) European el u t a v h Maine-Anjou gi i c a an s A n b ru i bl A h u a ue u o c iz arr R M n et v Iberian o B Na aurochs bones! NW intermediates ta Charolais M as Normande C Retinta Chianina Jersey Podolica African Dexter Istrian Romagnola zebu Guernsey se l Aberdeen re te hire oi rue Podolian Ayrs -N on Bl

Te Hinterwälder o A Angus ie em n ubr Salers P i de de ac on P L et na im d’ Gasconne British r a P A r G o q B r i u u Hereford e r r s i S i e i ta a g n n in i a e Bazadaize a n n a n i ic e w n A a d Scottish n o n lp n r e w a P E i B n n Highland o b e French-Pyrenean R r v a w Montbéliard n a z o S G E B o z a C r l r a i e e s m in s m B t r n i r a m g m a w e n r e R a a e d r Central Intermediates S G n o n l m s a r t Y a e s n e l i a G l g l i I o r t Central Brown a w Central-West O l i

a at least 2 independent aurochs introgression events

9 Genetic history of European cattle

1. Neolithic migration routes

IC - Mediterranean coast L NFC BST Nordic SFR - Africa > Iberia Baltic-Highland Red FJA British - Danube > France, NW Ayrshire-like EFC Lowland Pied North-West Intermediate AYR - Russia > Scandinavia French-Pyrenean WFJ Central West WFC NVR HFR Central Intermediate DOL Central Brown Iberian TMKORP SRP 2. Differentiation by Podolian ESN WRP BOH SRW SH AB R Other colour of first letter I A ES VAN (ASV ): introgression DJE AY SBW LBL DAR adaptation, breeding R JUT RIN LBR DBP DEX LIR LBW DAR B ANG LW HFR Y1 LLG H PBW - divergence of old H W ER FRH G BPW GSH BP DUB Y RH2W BPE R RRHDH2 British breeds M RHD HAR B WFR V GUE WB BE VGT J ER S NOR IM OR GLA GYE BOR P BP N LMP - divergence of dairy MA BRG N HIW M G BE HF BO PIG C R P HGY NW clusters ( Lowland Pied , HA SIM S WBTGV US LIM ERI RERENGRA BA EVO RGA Z SAL ASV Baltic-Highland Red , NW intermed.) Y1 AU PRI IST ASM BDA B PI ALI TUD MCAB ROM MA P G S ARQR CNA IR AS BU with Y1 haplotype SAY CHI M B OR AVI PI MMA BUS AL BUS E RE R T POD IL MER SYK ME ALL and wild introgression? MAL N TDL

MOD

Genetic history of European cattle

1. Neolithic migration routes

IC - Mediterranean coast L NFC BST Nordic SFR - Africa to Iberia Baltic-Highland Red FJA British Ayrshire-like EFC - Danube > central, >NW Lowland Pied North-West Intermediate AYR French-Pyrenean WFJ - Russia > Scandinavia Central West WFC NVR HFR Central Intermediate DOL Central Brown Iberian TMKORP SRP Podolian ESN 2. Differentiation by W RP BOH SRW SH AB R Other colour of first letter I A ES VAN (ASV ): introgression DJE AY SBW LBL DAR adaptation, breeding, R JUT RIN LBR DBP DEX LIR LBW DAR B wild introgression ANG LW HF LLG R Y1H PBW H W ER FRH G BPW GSH BP DUB Y RH2W BPE R RRHDH2 3. Historic North-South M RHD HAR B WFR V GUE WB BE VGT J ER S NOR G IM OR LA GYE BOR P contrasts maintained BP N LMP MA BRG N HIW MBE H GBO PIG - Langue d’oc - d’oïl C FR P HGY HA SIM S WBTGV US LIM ERI RENGRA BA EVO RGA Z SAL - Hoch - Niederdeutsch ASV Y1 AU PRI IST ASM BDA B PI CA ALI TUD M B ROM MA P G S - Catholic - Protestant ARQR CNA IR AS BU SAY CHI M B OR AVI PI MMA BUS ALE BUS Landscape effect? RE ILR T POD MER SYK ME ALL MAL N TDL

MOD

10 Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Reconstruct history of the genetic landscape migration, introgression, breed formation > partitioning of diversity, relationships of breeds, geographic effects Compare cattle, goat and sheep Indicate priorities for conservation

Goat microsatellites, Neighbor-Net graph V Orobica

S l I d t Valais Black w a

I l i

t i s s Neck a a Thuringian Austrian

t s l n Central/Alpine a i P

a n forest Tauernschecken B e n a

a i

o It c n al o i d P a c Most differentiation in n a o k l C i d S sh F a g m e w o re i f o l s a a Central, Western Europe s n s l w ’ c c t A n h A l ia p d G i co A ta e n l a r e lo p m u in m an r e e Italian A ed l lp l i o Girgentana ne AustrianPinzgauer

Swiss Grisons Striped Swiss St. Gallen booted Hungarian Native French Rove Turkish Hair French Turkish Angora Pyrenean Turkish Gurcu Portuguese Brava Turikish Abaza

Cypriotic Machaeras Spanish Florida a m Spanish Payoya ra Greek goat A ar lb ad a na R an u at e o ia Saudi- Saudi- Middle-Eastern G r A m n h Ve agu l ani M Arabian Arabian s l a A b a ni h a d A an an ti s M r l l i a i a n b b a C Najrani Beeshi p an h S a a a an n a S p s n ic i t a A ia D rpa ni s g a n n u S a lia r i a t a lb k th p o n n tn i a H at i S ta C Gr a e a n a i a I s g 'E n i s n h an li r ll an i c li o A e C n a M d M a re It an p F li Greek u or ta z e I h Skopelos a k Western-Mediterranean e

Albanian Liqenasi Central-Mediterranean

11 Goat microsatellites, Neighbor-Net graph V Orobica

S l I d t Valais Black w a

I l i

t i s s Neck a a Thuringian Austrian

t s l n Central/Alpine a i P

a n forest Tauernschecken B e n a

a i

o It c n al o i d P a c Structure : n a o k l C i d S sh F a g m e w o re i f o l 5 reproducible clusters s a a n s l s w ’ c c t A n h A l ia p d G i co A ta e n l a r e lo p m u in m an r e e Italian A ed l Regions in graphs lp l i o Girgentana ne AustrianPinzgauer correspond to clusters Swiss Grisons Striped Clear correlation with Swiss St. Gallen booted Hungarian Native geography French Rove Turkish Hair French Turkish Angora Pyrenean Turkish Gurcu Portuguese Brava Turikish Abaza

Cypriotic Machaeras Spanish Florida a m Spanish Payoya ra Greek goat A ar lb ad a na R an u at e o ia Saudi- Saudi- Middle-Eastern G r A m n h Ve agu l ani M Arabian Arabian s l a A b a ni h a d A an an ti s M r l l i a i a n b b a C Najrani Beeshi p an h S a a a an n a S p s n ic i t a A ia D rpa ni s g a n u S a lia r i a t a lb n k th p o n n tn i a H a i S ta C Gr a e a n a ti a I s g 'E n i s n h an li r ll an i c li o A e C n a M d M a re It an p F li Greek u or ta z e I h Skopelos a k Western-Mediterranean e

Albanian Liqenasi Central-Mediterranean

Goat, genetic clusters

• Allelic richness : Middle-Eastern, Central-Mediterranean > Western-Mediterranean > Northern/Alpine • Loss of alleles during migration into Europe?

6.4 TWZ BUK BDE 5.5 6.3

VBN PCG SGB 4.4 4.9 5.5 6.1 4.6 5.8 CAM 6.4 ALP 6.0 PIZ TAS 7.5 5.8 GRS 6.2 NAT CAR FrALP 6.4 5.4 4.7 BIO 5.8 VAL ORO 5.5 ROV HAS PYR 6.5 MAT 7.3 7.3 5.6 ABA COR 6.9 LIQ 7.4 7.3 CAP 8.3 BRA 6.8 SAR GMO 7.5 6.3 DUK 7.3 7.5 SKO GDR 7.0 7.4 GUR VER MUZ 6.3 8.1 GRG FLR ANG 7.7 6.8 7.6 HAI 5.3 ARG PYY 6.2 6.9 GIR MLG MAK 6.8 BRA Brava ALP Swiss Alpine VAL Valdostana GIR Girgentana ABA Abaza COR Corsican BDE German Alpine ORO Orobica GRG Greek Goat ANG Angora FLR Florida BIO Bionda dell’Adamello TAS Tauernschecken GMO Grigia Molisana BAL Baladi GDR Cab. del Guadarrana BUK Polish fawn-coloured TWZ Thuringian Forest Goat HAS Hasi BES Beesho MLG Malaguena CAM Camosciata delle Alpini VBN Valais Black Neck LIQ Liquenasi GUR Gurcu PYR Pyrenaen FrALP French Alpine NAT Hungarian Native MAT Mati HAI Hair PYY Payoya GRS Grisons Striped ARG Argentata dell’Etna MUZ Muzhake MAK Machaeras ROV Rove PCG Peacock Goat CAP Capore SKO Skopelos NAG Najrani SAR Sarda PIR Pinzgauer CAR Carpathian BES NAG VER Verata SGB St Gallen Booted DUK Dukati 7.3 6.9

12 Goat Y-chromosomes

V Orobica

S l I d t Valais Black w a o Haplotype Y1A I l i

t i s s Neck a a Thuringian Austrian

t s l n Central/Alpine a i P

a n forest Tauernschecken B e n Haplotype Y1B a

a i

o It c n al o i d P a c Haplotype Y2 n a o k l C i d S sh F a g m e w o re i f o l s a a n s l s w ’ c c t A n h A l ia p d G i co A ta e n l a r e lo p Eastern origin of m u in m an r e e Italian A ed l lp l i o Girgentana Y1A and Y2 ne AustrianPinzgauer Founder effects in Europe Swiss Grisons Striped Swiss St. Gallen booted Hungarian Native Middle-Eastern French Rove Turkish Hair French Turkish Angora Pyrenean Turkish Gurcu Portuguese Brava Turikish Abaza

Cypriotic Machaeras Spanish Florida a m Spanish Payoya ra Greek goat A ar lb ad a na R an u at e o ia Saudi- Saudi- G r A m n h Ve agu l ani M Arabian Arabian s l a A b a ni h a d A an an ti s M r l l i a i a n b b a C Najrani Beeshi p an h S a a a an n a S p s n ic i t a A ia D rpa ni s g a n u S a lia r i a t a lb n k th p o n n tn i a H a i S ta C Gr a e a n a ti a I s g 'E n i s n h an li r ll an i c li o A e C n a M d M a re It an p F li Greek u or ta z e I h Skopelos a k Western-Mediterranean e

Albanian Liqenasi Middle-Mediterranean

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

Reconstruct history of the genetic landscape migration, introgression, breed formation > partitioning of diversity, relationships of breeds, geographic effects Compare cattle, goat and sheep Indicate priorities for conservation

13 Sheep microsatellites, Neighbor-Net graph

Central, NW Europe German White Mountain Most differentiation again G H e P u rm It o n in Central, Western Europe a a li g n li s a R a h r h n i B ö H a rit n B e n GermanBrown Mountain is e a C h r t S g h ik w a a ta Sc le m ot da a tis le s h c e a a Ita Bl n lia a a k c r n k- o d f d e a h l c o a le e d d k r La d ko ng h a u ui o S k h B R o i t e g ri n a n n r ar a a a a l i i i i K a m n K n n k Po e k y no a a a K i l re e r i s b b e k is b O m l l r o Po h l G e l l K G re k y v u A K k A s is a A e a h m G re k Le ar Po ien G ee lic n K m ie r ek ag nia er c G re h D a ajdi British Exmoor an G is om an N ian rk R rabi eri Tu udi-A an H i W Sa -Arabi Naem elsh M audi bian ounta S i-Ara in Saud French Thone et Martod Egyptian Ossimi Polish Zelazna Turkish Morkaraman Turkish Akkaraman German Merino

a Spanish Rubia li Cypriote Fat-tailed g T del Molar u ur P o ki e n sh Spanish Colmenareña ri R K d e o a le na a m ra Middle-East ti M a ñ R an ya n n o e o ia ka e a n nç r m n i ri u H T G n e ino ga g H a P u si n a r a e G n o n ka a lv M e r S r u ia l ga ia li y B e n n is ri a s n M h G e g h an It n ia h a s G k a T R a r s r i r r r u M a Merinos r a i n e e K ia r o c T g n a e e e n c k n hur p a a k k f a u a pa C S a g n A a T n n u e a S ll s a t H S e d h r n f e i a s u c o a n k in a u g k e a c n m ia a ia ti a a e s South-Eastern Europe ugue a t ia t M l n Polish Merino L h A or n s o P a i n i n ia Greek Skopelos ta a l I p ta S I

Sheep microsatellites, Neighbor-Net graph

Central, Western Europe German White Mountain Structure : G H e P u r I o n m ta 3 reproducible clusters a li g n li s a R a h r h n i B ö H a rit n B e n GermanBrown Mountain is e a C h r t S g h ik North, West of Balkan no w a a ta Sc le m ot da a tis le s h c e correlation with genetic a a Ita Bl n lia a a k c r n k- o d f d e a h distances or geography l c o a le e d d k r La d ko ng h a u ui o S k h B R o i t e g ri n a n n r ar a a a a l i i i i K a m n K n n k Po e k y no a a a K i l re e r i s b b e k is b O m l l r o Po h l G e l l K G re k y v u A K k A s is a A e a h m G re k Le ar Po ien G ee lic n K m ie r ek ag nia er c G re h D a ajdi British Exmoor an G is om an N ian rk R rabi eri Tu udi-A an H i W Sa -Arabi Naem elsh M audi bian ounta S i-Ara in Saud French Thone et Martod Egyptian Ossimi Polish Zelazna Turkish Morkaraman Turkish Akkaraman German Merino

14 Sheep genetic clusters 2 clusters in the East, dispersal in the North and West Allelic richness : again decrease SE > NW

5.9 SBF 5.5 POM 6.5 6.4 KAM WMT SDL 6.0 GGH 5.0 MPO 5.7 6.9 WRZ 5.4 ZEL 5.2 RHO EXH 5.4 GOR 7.0 MLS 6.1 CIK RME KKL WBS 5.4 5.7 RAC 6.7 6.2 6.7 6.4 6.0 RTS TSI UME 7.1 7.5 6.0 6.2 TUR THM 5.2 BER LAN SHK 6.8 RUD 7.0 RBM CLM LAT 6.1 6.7 5.6 ALT 7.1 CHU 7.3 KAL 5.7 6.1 BAR 6.9 GDP PIL LES ORI 7.1 6.9 KRY 6.2 6.9 6.3 6.7 7.2 6.6 7.2 6.9 AKK MOR MCG DAG MRS KEF 6.8 KAR 5.4 6.9 7.0 SKO KYM SGR SFA CHU Churra Braganzana CIK Cikta SGR Segureña ORI Orino 6.6 6.8 GDP Gentile di Puglia CLM Colmenareña THM Thone et Martod PIL Pilioritiko 5.8 ANO KAM Kanieniec EXH Exmoor Horn WMT Welsh Mountain RAC Racka CFT MLS German Merino GGH German Grey Heath WRZ Polish Heath RTS Romanian Merino MPO Poish Merino GMS German Brown/White Mountain ANO Anogeiano RUD Ruda CFT Cypriote Fat-Tailed MRS Spanish Merino LAN Delle Langhe BAR Bardhoka SFA Sfakia DAG Daglic POK Pomorska LAT Laticauda GOR Polish Mountain SHK Shokodrane HER Heri RME Transylvanian Merino MCG Manchega KAL Kalarritiko SKO Skopelos KKL Karakul UME Hungarina Merino RBM Rubia del Molar KAR Karagouniko TSI Tsigaia KRY Karayaka ZEL Zelazna RHO Rhön KEF Kefalleneas Turcana MOR Morkaraman OSS TUR HER NAE NAJ ALT Altamurana SBF Scottish Black Face KYM Kymi AKK Akkamaran NAE Naemi 7.0 BER Bergamasca SDL Swaledale LES Lesvos AWA Awassi NAJ Najdi 6.9 7.3 7.1

Sheep Y-chromosomes G variant Central, Western Europe German White Mountain A variant G H e P u rm It o n a a li g n li s a R a h r h n i B ö H a European origin of A? ri n B e n GermanBrown Mountain ti e a C sh r t S g h ik w a a ta Sc le m ot da a tis le s Dispersal of A over Europe h c e a a Ita Bl n lia ac a k r n k- o by long-distance upgrading d f d e a h l c o a le e d d k r La d ko ng h a u ui o S k h B R o i t e g ri n a n n r ar a a a a l i i i i K a m n K n n k Po e k y no a a a K i l re e r i s b b e k is b O m l l r o Po h l G e l l K G re k y v u i A A e K s k sh am A G e k e ra P ie r e L ic Ka om ni G re k gl ian e ec G ee Da an jdi ran r sh m Na British Exmoor ia G rki Ro abian ri n Tu di-Ar n He Sau rabia aemi Welsh udi-A an N Moun Sa Arabi tain audi- French Thone et Martod S Egyptian Ossimi Polish Zelazna Turkish Morkaraman Turkish Akkaraman German Merino

a Spanish Rubia li Cypriote Fat-tailed g T del Molar u ur P o ki e n sh Spanish Colmenareña ri R K d e o a le na a m ra Middle-East ti M a ñ R an ya n n o e o ia ka e a n nç r m n i ri u H T G n e ino ga g H a P u si n a r a e G n o n ka a lv M e r S r u ia l ga ia li y B e n n is ri a s n M h G e g h an It n ia h a s G k a T R a r s r i r r r u M a Merinos r a i n e e K ia r o c T g n a e e e n c k n hur p a a k k f a u a pa C S a g n A a T n n u e a S ll s a t H S e d h r n f e i a s u c u o a n k in a g k e a c n m ia a ia ti a a e s South-Eastern Europe ugue a M t ia t l n Polish Merino L h A or n s o P a i n i n ia Greek Skopelos ta a l I p ta S I

15 Comparison of cattle, sheep and goat

Expected effects of migration and breeding - correlation geography and genetic distance - decrease of allelic richness SE > NW - phenotypes of NW breeds more developed

Goat - prototype species

Sheep - more panmictic in NW Europe by upgrading with rams from other regions

Cattle - less effect on allelic richness within continent - outstanding position of NW dairy breeds explained by introgression of aurochs bulls

Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

16 Criteria for conservation

1. Genetic distances mainly determined by genetic Contributions of cattle breeds drift of allele frequencies to diversity of safe set of non-endangered breeds

FST distances, A u a tiz n via Weitzman algorithm e ui 40% B rq 4% lo > priority of inbred breeds al M 30% 3% 2. Low kinships 20% 2% Marker-Estimated Kinships (J. Windig, K. Engelsma, H. Eding, Lelystad) 10% 1% > priority of Eastern breeds 0% 0% 3. Molecular diversity 0.4 0.5 0.6 0.7 0.8 number of alleles Heterozygosity (exp) To be tested with realistic datasets. Correlation with kinship?

4. Diverse phenotypes

Criteria for conservation

1. Genetic distances by random drift 2. Low kinship, 3. Molecular diversity GCAACAAACTACTCTCGGCTTTTAGGAAAGACTCTTGTGCACAGACAGT ..G...... T...... G...... G...... T...... T...... G...... A...... C...... T...... > priority to Middle-Eastern breeds 4. Diverse phenotypes

> priority to Northern/Western/Central breeds

17 Dilemma for conservation

> priority to Northern/Western/Central breeds

Two obvious criteria lead to different choices

Recommendations for conservation

1. Forget genetic distances on the basis of genetic drift 2. Conserve molecular diversity primitive breeds, hybrid species origin GCAACAAACTACTCTCGGCTTTTAGGAAAGACTCTTGTGCACAGACAGT ..G...... T...... G...... G...... T...... T...... G...... A...... C...... T...... 3. Specify valuable phenotypes to be conserved

4. Breed management select on desired phenotype but also protect the heterozygosity : consider outcrossing Genetic purity : > considerable sentimental appeal > direct threat of animal health > yet difficult to define on the DNA level

18 Geographical patterns of cattle, sheep and goat diversity Clines, clusters, introgression, and a conservation dilemma

History of the genetic landscape migration, introgression, breed formation > partitioning of diversity, relationships of breeds, geographic effects Differences between cattle, sheep and goat Conservation : dilemma, considerations