Journal of Cell Science uigebyncwudhealing wound motility embryonic actin-based during of modes different temporally coordinate 3-kinase phosphoinositide and ERK Article Research n erdcini n eimpoie htteoiia oki rpryattributed. properly is Attribution work Commons original the Creative that the provided of medium distribution terms any use, the in unrestricted reproduction under permits and distributed which article (http://creativecommons.org/licenses/by/3.0), Access License Open an is This concert in embryonic finger- work protrusions, cable, which actin lamellipodia, the sheet-like dynamic and form with filopodia also like Along cells 1992). edge leading Lewis, and epithelium fashion and ‘purse-string-like’ the a (Martin draw in together to forward at functions tissue cable connective which actin margin, contractile wound a embryos assembling the contrast, by By primarily 1997). wounds is heal Martin, movement called by This projections (reviewed membrane substratum. lamellipodia (leading-edge sheet-like wound actin-based wound by the exposed propelled surround the that over cells cells) of crawling distinct the and by 1997). proliferation Martin, the and cell (Nodder to re-epithelialisation response, of contribute inflammatory mechanisms could differences the include These which in embryos. of tissues, capacity healing in adult improved healing wound and between differences embryonic wound several adult are improve There to healing. applications process has therapeutic healing embryos the developing investigating in and for repair system scar wound important without an of become heal study perfectly wounds the Therefore, and embryonic have formation. wounds, rapidly Embryos adult wounds unlike repair 1997). and, and to integrity (Martin, capabilities skin and injury remarkable restore cell to diverse following together which homeostasis work in must process lineages complex tissue a is healing Wound Introduction words: Key is structures two these of function and of formation activation for discrete sequential vital The the targets. actomyosin is divides that downstream contractile which distinct signalling report and a (PI3K) homeostasis, we signals structures: 3-kinase upstream and Here, actin phosphoinositide intracellular integrity edge. two and distinct of leading tissue ERK functionally segregation the temporal of two the at recovery requires by protrusions achieved healing efficient actin wound of and embryonic example cable in perfect movement a Tissue provides survival. healing wound Embryonic Summary ( correspondence for *Author 2 1 Li Jingjing o:10.1242/jcs.133421 doi: 5005–5017 126, ß Science Cell of Journal 2013 August 2 Accepted otefraino ci rtuin htdiemgainadzpeig hs idnsrva e ehns o coordinating for mechanism new a healing. reveal wound findings embryonic These cable namely setting, zippering. actomyosin tissue drives and complex which migration leading a myosin-2, activity, drive in Cdc42 and motility that and Rho Rac actin-based protrusions enhances of of which actin modes signalling, activation PI3K of different the restored formation by for dominated the responsible is phase to is second and The constriction. activity, and formation PI3K suppresses ERK activated h eln onainCnr,McalSihBidn,Uiest fMnhse,Ofr od acetrM39T UK 9PT, M13 Manchester Road, Oxford Manchester, UK of 9PT, University M13 Building, Manchester Smith Road, Michael Oxford Centre, Manchester, Foundation of Healing University The Sciences, Life of Faculty 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. eeihlaiaini dl onsi hrceie primarily characterised is wounds adult in Re-epithelialisation R,P3,Wudhaig h GTPases, Rho healing, Wound PI3K, ERK, 1,2 ie Zhang Siwei , [email protected] 1,2 ieaSoto Ximena , ) Xenopus 1,2 aa Woolner Sarah , Xenopus a,Cc2adRopa rca u itntrlsi regulating in roles distinct but crucial play Rho and and 2009), injury Cdc42 al., that et Rac, (Clark shown Cdc42 been and vitro has Rho in of It activation and movements. an tissue triggers initiate machineries the cytoskeletal signals distinct drive of the that what of formation is re-activation the coordinate processes a morphogenetic considered similar be gastrulation. also during that prevalent mean can processes repair, morphogenetic tissue healing events embryonic especially wound morphogenetic repair, between tissue similarities and and Simske The 2000; 2001). Chisholm, and 2000; Hardin, Chin-Sang 1997; al., al., et adopted et shut also Masson Kiehart which are epithelium structures 2000; actin in al., the same by These et 2002). ‘zippering’, fuse Jacinto al., et 1993; to called Jacinto al., help process et filopodia (Young a is and Closure by lamellipodia together. is sheets completed epithelium epithelial cable, embryonic actomyosin then opposing an the the accumulate draws in first and which hole during cells edge large (Martin leading a example, closed, which development For in embryonic closure, that 2004). normal processes actin Parkhurst, the morphogenetic has during of some repair tissue occur Analysis with during 1998). similarities formed (Bement Gipson, are revealed epithelia and that cornea structures Danjo and cytoskeleton 1993; gut al., adult of et been wounds have to in cables restricted Wood observed actomyosin entirely 2002; because not al., is healing, structure wound et string embryonic (Davidson purse wound The 2002). the al., close et to cable the with nesnilqeto nbt mroi on lsr and closure wound embryonic both in question essential An mroi on eln notopae.I h is phase, first the In phases. two into healing wound embryonic .elegans C. 1 n niu Amaya Enrique and and nvivo in mro uigvnrlecoue(Williams- enclosure ventral during embryos tde aesgetdta h ml GTPases small the that suggested have studies 1,2, * Drosophila 5005 dorsal Journal of Cell Science Results tissue morphogenesis. different and orchestrating healing wound for both in mechanism the movements novel targets, of cytoskeleton a their segregation and revealing GTPases upstream temporal Rho intracellular a distinct functionally two determines these pathways promoting of phase, signalling coordination and second zippering. exquisite activity and migration The for Cdc42 edge the attenuation. wound the and at ERK formation predominates filopodia Rac upon elevating signalling restored specifically and ERK PI3K by phase, suppressed Restored this is in activity purse-string PI3K signalling actomyosin contraction. subsequent leading and and activity phase, assembly Rho first of 3-kinase the peak a initiates phosphoinositide to activity ERK and signalling. (ERK) (PI3K) extracellular kinase of activation signal-regulated sequential wound by controlled of are phases that distinct closure two discover and model, wound-healing o uefca ons(i.1) h oprsnbetween comparison The as 1B). (Fig. rate same wounds the mesenchymal a at the superficial proceeded to Once then deep for closure 1C). due the wound (Fig. of healed, delayed, cells repair layer mesenchymal the was with of closure coincided layer which the wound phase, wounding, deep ‘transition’ following 1B). minutes Fig. of 60 panel; bottom of and progression 1A, to 10 minutes (Fig. similar between 10 was wounds However, first wounds superficial of deep the the of of layer curve in that the closure deeper that wound with the observed the together closure, We which removed layer. we was in wounds, superficial cells superficial wounds, our mesenchymal to deep supporting and comparison panel; generated a top 50% 1A, as also (Fig. act area close To minutes wound the 90 1B). to of nearly Fig. 20% took slow remaining wound a wound the phase, the heal early the which to the in Following began, for 80%. phase to second up minutes close 10 using to phase minutes early layer only 30 the During cell took minutes. 30 a superficial it by lasted with which began cap, the phase, wounds early animal superficial of fast these the of region closure in Wound small forceps. wound superficial a 2002). a al., removing generated et (Davidson be we layer three cell cell First could to mesenchymal epithelial by deep, two superficial, wounds a a of and cells: consists layer excisional started ectoderm cap prospective of animal wound of the we layers types stage stage, this two blastula At healing, compared. which late cell in of wound of closure, movement regulation embryonic the tissue in understand characterising in system To 2009; 2011). vertebrate al., dynamics et al., powerful Clark et a 1982; Fuchigami development, be (Stanisstreet, external to research and wound-healing proved size have large embryos their to Owing distinct phases two temporal comprises closure wound Embryonic are they distinct how functionally regulate moreover, to and, space signals targets. and upstream downstream closure time the However, in wound about 2005). coordinated known ruffling, in al., actin is the et involved membrane of less regulators Woolner direct much drives these leading 1992; cytoskeleton, about much the Rac al., know we at et whereas and accumulation (Ridley actin 1995; 2002) edge and Hall, formation al., and 2002), lamellipodia al., (Nobes et et formation Wood Wood filopodia 1992; and Hall, promotes fibres and stress Cdc42 (Ridley of formation cables the contractile regulates Rho dynamics. actin 5006 ee euethe use we Here, ora fCl cec 2 (21) 126 Science Cell of Journal Xenopus mroa our as embryo nvivo in embryonic Xenopus ae,bfr ntaino h lwphase. deep the slow By of the healing of ‘transition’ rate. with initiation seemed delayed coincided before same layer a closure layer, both wound because mesenchymal deep the phase, in intact because slow phase at an the healing, closed in of indispensable support normal wounds the deep powering contrast, is and wound layer for deep of superficial intact an essential phases that appeared different it not phase, the early involvement the during In the healing. mechanisms suggested distinct healing wound of deep and superficial poigcl hes(aisne l,20;Wo ta. 2002). of al., of et zippering phases different Wood the 2002; during and dynamics al., actin examine et migration To (Davidson assist sheets lamellipodial cell protrusions purse- opposing whereas a 1992); filopodial in Lewis, edge and and and wound (Martin the F-actin manner contract comprises string to cable functions and actin myosin-2, lamellipodial/filopodial contractile and The cable protrusions. actin tissue contractile facilitate that a structures movement: two re-organise form to cells cytoskeleton edge actin leading their healing, wound embryonic During filopodial-based zippering by and characterised migration is phase late whereas the is contraction, healing actomyosin-driven wound by embryonic characterised of phase early The riyha,adi eurdfratncbefrain(Wang formation cable actin for required factor is transcription and the and head, signalling Grainy kinase ERK tyrosine in activates these receptor that of family work (RTK) Ret One a wounding. Stitcher, Previous post involves pathways pathways injury. signalling following upstream two are activated that pathways be Drosophila signalling to analyse might to closure known wound began of we phases controlled, temporal be the how healing investigate wound To in embryonic activated during sequentially phases are distinct the signalling PI3K as and ERK protrusions filopodial is phase in together. late zipper increase the edges contrast, wound an By during closure. by and wound force characterized cable of driving actin phase major early an the the of provide formation contraction the together, of actomyosin that Taken of closure. timing indicate formation wound This findings of the phase these 1G). early with (Fig. the well and from hour cable correlated actin 1 which edge staining minutes, than myosin-2 10 wound more at active for peak the a sustained at reaching was wounding, accumulated post minutes myosin-2 revealed 2 2005) Bement, active and light (Benink that (pMLC) regulatory string. myosin-2 the purse of of actomyosin chain Ser19 the two phosphorylated of of the component Immunostaining zippering other the be myosin-2, to 3,4). appeared Movies material and (supplementary together 1F) sheets opposing (Fig. we the during phase those wounding), than edge longer post early also leading were wound hour filopodia the These (1 1E,F). wound at (Fig. closure filopodia the of 1D; of Once numbers (Fig. period. greater phase were observed this late filopodia during wounding the few edge reached a leading of Only the early healing. at the minutes wound formed with embryonic coinciding of within 1,2), phase Movies edge superficial material at of supplementary emerged wound ring closure F-actin circumferential during the a dynamics that found actin We domain) wounds. imaged binding live (F-actin moesin and GFP-tagged encoding albino mRNA injected we closure, wound enx nlsdtelclsto n ciaino non-muscle of activation and localisation the analysed next We a hw htEKMP a eatvtdby activated be can ERK/MAPK that shown has eou laevis Xenopus mro with embryos Xenopus Journal of Cell Science hshrlto nmoi- ih hi ntasce ons ,wud l lsool p pteim cl as 500 bars: Scale epithelium. ep, blastocoel; bl, wound; w, wounds. transected in chain light myosin-2 on phosphorylation iooilporsos E iooi omto ttewudeg 0mntsatrwudn nGPijce mro ne hw rxmlwudfron o wound (number density proximal the shows of Quantification Inset (F) embryo. layer epithelium. GFP-injected superficial with ep, in the area; cable wound whereas wounding actin w, point, after thick edges. time shows minutes wound 100 this Inset opposing 60 embryo. by from GFP-moesin-injected edge extended close in filopodia wound healed indicate wounding indicat the has Arrows post line filopodia. at layer minutes dashed formation deep 10 Filopodia Red the edge (E) that cap. wound protrusions. Note animal the filopodial embryo. the at the cable on of actin layer cells Circumferential (mesenchymal) vegetal (D) deep healed. and and cells layer cap (epithelial) animal superficial the between between boundary represents line dashed Blue fpR ttelaigeg lsammrn n uliof nuclei and membrane plasma edge leading the at pERK accumulation an of revealed immunostaining 2A,B; particular, Fig. (Fig. in material and (supplementary hour S1C), activation a 1 ERK showed by of Immunostaining timescale decreased similar S1A,B). and 2A; Fig. minutes (Fig. 30 material analysis supplementary to up blot for remained western phosphorylation high The by S1A). Fig. wounding material supplementary after from detectable minutes was both activation 2 In ERK (pERK). wounds, deep Thr202/Tyr204 and on superficial assessed (LaBonne ERK we of responses closure, timeframe phosphorylation wound the wound the embryonic explore during To early activation 1999). In ERK the Slack, of and 2009). of Christen 1995; al., one al., et et also (Wu is repair pathway wound and Xenopus wound assembly larval for actin required is of and edge activation 2002) al., the et to (Cho embryos leads in which ERK Pvr, platelet- receptor, the its is through (PDGF/ VEGF), other factor The growth factor/vascular-endothelial 2011). growth McGinnis, derived and Kim 2009; al., et means * are significance. Data confirm wounds. to deep performed and was superficial ANOVA in Two-way speed experiment. closure each wound for of embryos Quantification phases. (B) temporal wounding. distinct post comprises pw, healing wound Embryonic 1. Fig. m )adlnt fflpdaa h on dei al n aepae (means phases late and early in edge wound the at filopodia of length and m) mro,atvto fteEKMP signalling ERK/MAPK the of activation embryos, A ielpesre fspriiladde on lsr nbatl tg embryos. stage blastula in closure wound deep and superficial of series Time-lapse (A) 6 ... *** s.e.m.; cievrino IK(10CA)(ablaae l,2001) al., et (Carballada CAAX) (p110 PI3K of version ( active PI3K encoding of mRNAs version of dominant-negative plasma Injection a PI3K, 2013). the al., of et product on (Pickering the membrane (PIP3), to binds 3,4,5-trisphosphate which (GPH), phosphatidylinositol GFP-tagged a Grp1 using of area domain wound PH the We in healing. activity wound PI3K embryonic assessed of also hour S1A,B), phase late 1 Fig. the material ceased, with supplementary overlapping activation 2A,B; ERK (Fig. when wounding wounds post levels was deep original signalling and PI3K to S1A). superficial restored Fig. both material in supplementary 2A; signalling with (Fig. ERK coincidentally of declined rise analysis, PI3K the blot of (Ser473) western level Akt using phosphorylated the (pAkt) of that detection found by we assessed signalling, Intriguingly, migration. cell in the cells. with edge spatially wound and in phase cable early actin the contractile with appeared temporally therefore ERK overlap of to Activation 2C). (Fig. cells edge wound enx xmndP3 inlig nte seta pathway essential another signalling, PI3K examined next We P , P .5 C & tiigo epwuda oratrwounding. after hour 1 at wound deep a of staining H&E (C) 0.05. , .0.()Tm oreo muoloecnesann o Ser19 for staining immunofluorescence of course Time (G) 0.001. eprlrglto fcl oiiy5007 motility cell of regulation Temporal 6 ..o he needn experiments, independent three of s.d. m A,50 (A), m D 8)adaconstitutively a and p85) m CG,10 (C,G), m iooi per filopodia f m (D,E). m sborder es a o yet not has e rno or few swith ts n 5 5 Journal of Cell Science on;b,batce;e,eihlu.(–)PP oaiaini none pteim() al hs on E n aepaewud() re,GF Green, (F). wound 50 phase bars: late Scale and wounding. (E) wound post phase pw, early epithelium; (D), epithelium ep, unwounded wound; in w, localisation mCherry-moesin; PIP3 (D–F) red, epithelium. ep, blastocoel; bl, wound; C muoloecnesann fpERK, of staining Immunofluorescence (C) means are Data 0 ftewudae n1 iue Fg A o panel; top 3A, (Fig. minutes 10 in area closing wound by embryos control, the the with Unexpectedly, of compared healing 80% 2001). of phase al., early the et by material with (Wakioka signalling (supplementary injected Raf S2A) ERK to Ras Fig. disrupted act from first transduced might signalling phases we To pathways healing. late hypothesis, activated wound injecting two embryonic this and are of phases the test two early signalling the that in PI3K the functionally suggested and with respectively, ERK overlapping that sequentially, finding Our inverse of phases closure spatial different wound regulate embryonic signalling as PI3K and well ERK as phase late temporal the signalling. in ERK a edge with leading activation indicating the remarkable at level 2F), a accumulation, high (Fig. GPH 2D,E). a was by to (Fig. measured restored edge there as was leading activity, closure, the PI3K the at wound However, accumulation GPH of during probe in that GPH phase decrease discovered the early of We efficiency S1D). the the Fig. confirm material to (supplementary controls as served healing. wound with embryonic wounds, during deep activated in sequentially are pAkt signalling and PI3K pERK and ERK 2. Fig. 5008 ora fCl cec 2 (21) 126 Science Cell of Journal spred1 6 spred1 ...fo he needn xeiet n ersn EKadpk inlitniisnraie to normalized intensities signal pAkt and pERK represent and experiments independent three from s.e.m. RA(ia ta. 05,tu inhibiting thus 2005), al., et (Sivak mRNA RAsoe eakbeaclrto in acceleration remarkable showed mRNA a tblna odn oto.()Qatfcto fpR n Atatvto uigebyncwudhealing. wound embryonic during activation pAkt and pERK of Quantification (B) control. loading as -tubulin b ctnn(lsammrn)adDP nces natasce mroi on 0mntsatrwudn.w, wounding. after minutes 10 wound embryonic transected a on (nucleus) DAPI and membrane) (plasma -catenin eosre osgiiatdfeec nteerypaeof phase early progressed, closure the material wound supplementary as 3E,G,H; in However, S2D). Fig. Fig. difference panel; top 3B, significant (Fig. S2B). healing no injecting Fig. by observed inhibited hyper- material we was to signalling (supplementary construct PI3K signalling When CAAX) the PI3K and (p110 activity; activate PI3K PI3K disrupt active to constitutively (LY294002) PI3K ( of inhibitor of PI3K phase last dominant-negative the at S2F–I). reversed Fig. was material effect (supplementary of the closure to phase and early Similar closure the accelerated signalling. wound also ERK treatment MEK1, PD of inhibit overexpression, inhibitor to chemical (PD), a used PD184352 we phenotype, this confirm qiaetrslswr bandfloigteteto healing of bottom treatment 3B, following (Fig. obtained S2D were zippering Fig. results material wound Equivalent supplementary of 3E,I,J; Fig. failure healing, panel; of complete phase late a the in with delay remarkable a revealed embryos of advantage S2C 5). Fig. the 3A material (Fig. Movie supplementary lost wound 3D,J; gaping-open Fig. they S2C, a panel; with bottom onward, finished Fig. and hour closure 1 wound material from supplementary However, 3D,G; Fig. m omdlt IKsgaln,w sdtretos the tools: three used we signalling, PI3K modulate To C,20 (C), m m (D–F). m A etr ltaayi hw h eunilatvto of activation sequential the shows analysis blot Western (A) D 8)cntutadachemical a and construct p85) a tblncontrols. -tubulin D D p85 p85 9 oi 6). Movie , -injected mRNA, spred1 P-Grp1; 9 .To ). Journal of Cell Science anWinyts a sdt etfrsgiiac ewe oto n te rus * groups. other and control between significance for test to used was test Mann–Whitney GJ uniiaino eaiewudcoue1 iue G,3 iue H,6 iue I n 2 iue J otwudn.Ma on closure wound means Mean as wounding. shown are post Results (J) control. minutes to 120 relative and closure (I) show minutes groups 60 other (H), 1; minutes to 30 normalized (G), was minutes embryos 10 control closure of wound percentage relative of Quantification (G–J) omlyrsrc IKsgaln nteerypae thus might phase, edge early signalling leading phase. the the this ERK of during in advancement cells that PI3K-mediated signalling the the speculated PI3K in limiting the hyper-activation restrict and between PI3K normally and similarity phase, inhibition unexpected unusual early reports ERK this an of explain previous wound noticed effects To during 2004). we contradicts signalling al., finding, wound ERK phase et for accelerate (Matsubayashi role early closure could positive ERK the a suggesting of in inhibition healing that result The early the in closure signalling phase wound PI3K suppresses of signalling end ERK very the at seen could 3J). which defect (Fig. gastrulation, the upon for mortality account high with have injected to S2E, Fig. embryos appeared material However supplementary 7). 3F,G; Fig. Movie panel; top 3C, By injecting (Fig. by S2H,I). activity CAAX Fig. PI3K elevated p110 material artificially (supplementary we the when closure conclude contrast, to of failed phase of but closure late S2F,G), wound inhibition of Fig. phase that material early (supplementary normal confirming a exhibited (LY), signalling PI3K LY294002 with embryos healing. wound of phases distinct regulate signalling PI3K with and ERK 3. Fig. spred1 (A), RA naclrtderypaewsobserved was phase early accelerated an mRNA, D p85 B and (B) 10caax p110 C.Ec mg hw ieps onig cl a:200 bar: Scale wounding. post time shows image Each (C). 10CAAX p110 mRNA AC ielpesre fwudhaigi oto n nebysinjected embryos in and control in healing wound of series Time-lapse (A–C) he ol lee IKatvt sepce Fg 4E,G,H,J; (Fig. expected as activity PI3K altered tools PI3K of the three level studies the with modulated in previous ERK we to signalling 2008), As PI3K al., signalling ERK- from et PI3K. regulation (Hayashi negative signalling of PI3K and inverse an ERK suggested existence of also of the activation regulation sequential (supplementary confirming negative wounding S3A–D), post dependent Fig. minutes 10 material at signalling the of used PI3K injection in to we Similar signalling inhibitor, PD. ERK PI3K spred1 signalling, and ERK of Ras of a regulator inhibitor as Spred1 chemical negative function that direct its possibility to the pAkt a addition out restored as rule only To acts 4A–D). controls itself (Fig. whereas hour restoration minutes, minutes 1 rapid 10 after 4 precocious, a after signalling in pAkt PI3K result of did in it decrease but wounding, immediate post the alter not uigwudrpi,s estott netgt hte a whether that investigate found Using to we system. analysis, out wound-closure described blot our set western in been we existed never so relationship ERK- similar has an repair, al., by wound phenomenon et mediated (Hayashi during this be activity to However, PI3K shown of (Foschi 2008). later regulation signalling was negative and factor dependent 1997) growth al., during et described previously eunilatvto fEKadP3 ahashsbeen has pathways PI3K and ERK of activation Sequential P , RA Dtetetas asdaqikrsoainof restoration quick a caused also treatment PD mRNA, .5 ** 0.05; eprlrglto fcl oiiy5009 motility cell of regulation Temporal P , D m .1 *** 0.01; .(–)Haigcre frslsi A–C. in results of curves Healing (D–F) m. 8,L n 10CA.Atog all Although CAAX. p110 and LY p85, P , .0;n,ntsignificant. not ns, 0.001; spred1 6 s.e.m.; vrxrsindid overexpression n 5 .Non-parametric 3. Journal of Cell Science pteim K epithelium, *** h al hs Fg 4K,K in (Fig. edge leading phase the early at control activity were whereas the PI3K during that experiments reduced showed signalling exhibited and Parallel probe embryos PI3K activation GPH one-directional. the and with ERK is performed ERK of healing between suggesting PI3K dynamics wound crosstalk S3E,F), the Fig. the modulated material that affect the supplementary 4E,F,H,I; not S3E,G), (Fig. did Fig. signalling material supplementary means are Values points. time different at groups experimental of levels in pAkt pAkt or and in pERK pERK pAkt are of and quantification pERK and of blot quantification a Western and signalling. (E–G) PI3K blot of wounding. Western restoration post (H–J) quicker embryos a in injected results control signalling and ERK of Disruption 4. Fig. 5010 tblnwstelaigcnrl o h uniiaingah,cnrlbr bak r EKo Atlvl ncnrleby tdfeettm poin time different at embryo control in levels pAkt or pERK are (black) bars control graphs, quantification the For control. loading the was -tubulin P , .0;n,ntsgiiat KM I3lclsto ncnrl(K,K control in localisation PIP3 (K–M) significant. not ns, 0.001; ora fCl cec 2 (21) 126 Science Cell of Journal 9 –N 9 hwtelaigegs ,wud re,GPGp;rd Cer-osn cl as 20 bars: Scale mCherry-moesin. red, GFP-Grp1; green, wound; w, edges. leading the show 9 ,ihbtn R inligby signalling ERK inhibiting ), p110-caax- 9 ,Srd (L,L Spred1 ), n oto-netdebysps onig o l etr ltquantifications, blot western all For wounding. post embryos control-injected and R inligi h aepaeprisarcvr fPI3K of recovery a permits phase late of the down signalling. shut in the signalling and signalling, ERK PI3K suppresses closure wound ol eosre nebysijce with injected embryos 4M,M (Fig. in 4N,N observed (Fig. be could rn Fg 4L,L (Fig. front overexpressing 9 ), D 8 (M,M p85 AD etr lt n uniiaino EKadpk in pAkt and pERK of quantification and blots Western (A–D) 6 9 s.e.m.; 9 whereas ), .Teeoe R ciaini h al hs of phase early the in activation ERK Therefore, ). 9 9 spred1 n 10CA (N,N CAAX p110 and ) .Smlratvto fP3 ttelaigedge leading the at PI3K of activation Similar ). n 5 .p,ps onig * wounding. post pw, 3. D p85 D e ohg IKatvt ttewound the at activity PI3K high to led m 8 togyatnae IKactivity PI3K attenuated strongly p85 m. n oto netdebysps wounding. post embryos injected control and 9 mro – hwunwounded show K–N embryo. ) P , .5 ** 0.05; P , 10CAAX p110 0.01; s e bars Red ts. spred1 Journal of Cell Science *** eghi wounds. in length ( nlsd l eut r hw smeans as shown are results All analysed. hse lt.()Qatfcto frltv MCfursec nest ttewudedge. wound the at intensity fluorescence pMLC relative of Quantification (F) plots. whisker fatncbeadflpdaa h on dei F-osnijce mro ncmiainwt control, with combination in embryos GFP-moesin-injected edge. in wound edge the at wound formation the filopodia and at accumulation filopodia actin and promotes PI3K cable and actin phosphorylation of myosin-2 regulates ERK 5. Fig. wound PI3K embryonic and of ERK phases by different the regulated closure. the of during any, were if signalling which, structures wondered we closure Therefore, actin-based gaping- PI3K-mediated phase. restricts a early ERK strongly avoid the wound also of to in it required function embryonic but is the wound, of it open whereas complicated: phase more role; is late positive signalling the a playing in signalling closure, PI3K mainly that acts suggested results normally edge closure leading wound the above at The extension filopodia and regulates contraction PI3K actomyosin modulates signalling ERK aeilFg 4,) utemr,acmiaino ihdose high (supplementary a phase of combination late of a delayed material Furthermore, S4C,D). a (supplementary Fig. with material closure ending wound S4A,B), on Fig. inhibition effect ERK PD, accelerated ERK and the or PI3K eliminated by it of Spred1 that inhibition discovered and with double signalling, moderate S4E,F) a was Fig. achieved which of material attenuated dose medium (supplementary artificially a combined LY was first we signalling PI3K, on dependent ERK when closure 0ebysfo he ace eemaue.()Qatfcto fflpdanme e 100 per number filopodia of Quantification (D) measured. were batches three from embryos 10 20 bar: Scale filopodia. indicate Arrowheads wounding. post minutes 10 4–) niaigta nteasneo ciae ERK, wound for activated force of driving the absence as the acts closure. activity in PI3K that precocious Fig. indicating material (supplementary phase S4G–J), early the down slowed further rohasidct MCa h on de cl a:50 bar: Scale edge. wound the at pMLC with indicate injected Arrowheads embryos and embryos uninjected 6 100 oass hte h ceeaini h pe fwound of speed the in acceleration the whether assess To D P , 8 rL splmnaymtra i.SEF n Spred1 and S4E,F) Fig. material (supplementary LY or p85 m .0;n,ntsignificant. not ns, 0.001; fwudeg)o tlat2 mro rmtrebthswr nlsd aaaepotda o n hse lt.()Qatfcto ffilopodial of Quantification (E) plots. whisker and box as plotted are Data analysed. were batches three from embryos 20 least at of edge) wound of m n ctrl 5 63, n D p85 5 85, n p110 6 5 ...adKuklWli n-a NV etwsue ocmaealgop ocnrl * control. to groups all compare to used was test ANOVA one-way Kruskal–Wallis and s.e.m. 122, spred1 n spred1 , p110caax 5 0 flpda na es 0ebysfo he ace eeaaye.Dt r lte sbxand box as plotted are Data analysed. were batches three from embryos 20 least at on (filopodia) 105 m .()Qatfcto frltv -ci loecneitniya h on edge. wound the at intensity fluorescence F-actin relative of Quantification (C) m. and D 8 or p85 D p85 m .()Imnfursetsann fpL ntasce onsi control in wounds transected on pMLC of staining Immunofluorescent (B) m. mro eefxd1 iue otwudn.w on ra p epithelium. ep, area; wound w, wounding. post minutes 10 fixed were Embryos . Fg 5E). (Fig. Fg B,weesihbtn R ciain yeither by activation, margin ERK wound the inhibiting at whereas embryos accumulation Control 5B), pMLC contraction. (Fig. actomyosin strong of revealed force driving the infcn nraei iooillnt,fo 2.5 from length, filopodial in with increase together PI3K, significant 5D), a hyper-activated (Fig. increased artificially dramatically of of we length number Disruption the filopodia When not 5A,D,E). 5E). but 5D), (Fig. (Fig. (Fig. filopodia edge number the leading reduced activity the PI3K filopodia at longer formed and more ERK were when significantly However, inhibited, closure. wound was wound the of signalling Control at phase filopodia early signalling. the of in PI3K number margin limited and a only ERK formed of embryos modulation upon altered F-actin a 5C). showed (Fig. the which embryos of PI3K-inhibited edge, in leading scale. 5A; quantification decrease the (Fig. time 50% at by (FI) same confirmed intensity accumulation the fluorescence was over finding F-actin 11) This after Movie impaired with minutes material 10 injected supplementary showed embryos edge contrast, wound By mRNA the 5A). at 10) (Fig. cable Movie wounding actin material an and (supplementary assembled 9) embryos Movie 8), mRNA-injected material Movie (supplementary embryos material (supplementary enx xmndtepopoyaino ysn2(pMLC), myosin-2 of phosphorylation the examined next We h omto fflpda rtuin a losignificantly also was protrusions filopodial of formation The embryos control that showed dynamics actin of Analysis n 5 0wudeg el rma es he ace febyswere embryos of batches three least at from cells edge wound 20 eprlrglto fcl oiiy5011 motility cell of regulation Temporal m nwounds. in m spred1 n ctrl 5 , 65, p110caax n D p85 5 and 44, spred1 n D p110 p85 5 A ofclimages Confocal (A) P -mRNA-injected RAinjections, mRNA 75, , .5 ** 0.05, n n p110-CAAX 5 m spred1 0clsfrom cells 20 mto5 5 P 51 , D 0.01, p85 m m - Journal of Cell Science splmnaymtra i.SB.Hwvr efudthat found we However, with S6B). injected embryos Fig. material (supplementary that inhibit on PCR Real-time to xnr3 2009). al., known et (Biddle concentration transcription a with embryos for at injected required We was closure. transcription wound whether embryonic it examined closure. first wound we could embryonic that in during Hence, targets signalling ERK transcriptional pERK (supplementary found by that regulated cells be suggesting analysed edge we S6A), wound we Fig. in immunostaining, material nuclei When the by with 2007). colocalised al., wounds edge et wound embryonic in factors (Fitsialos transcription nuclear cells modulate to able are PI3K components. cytoskeletal and downstream vitro upstream the ERK the next to link we events that of effectors edge, signalling downstream wound the effects the identify to at sought dynamics distinct cytoskeletal on the signalling established GTPases Having Rho small cytoskeleton through regulate organisation signalling PI3K and ERK of injection 5012 otwudn Fg C 0mntsps onig.Hwvr it 6A,B, However, Rac healing wounding). (Fig. immediately post to occurred minutes stage 10 Similar Rho wound 6C, of final wounding). (Fig. the wounding activation post post the as activation, minutes Moreover, Cdc42 in 120 and enhanced and peak wounding). minutes a 60 gradually injury reaching post post progressed, was and immediately minutes Rac 10 activation activated Both process. moderately 6A,B, (Fig. wound-healing were entire Cdc42 the during Rho 2005). and Rhotekin Bement, of Rac of and domain active (Benink binding domain Rho down the binding and active pulling 1998), for The for al., 2013). et used (Zhang al., was assay Cdc42 (supplementary 70–117) et Cdc42 (aa pull-down (Soto and PAK1 Rho S7) GST Rac, Fig. active material of GTPase levels the Rho detect our active to We We Cdc42. applicable and an assembly. Rho could Rac, actin signalling members developed family PI3K to Rho the and signalling directly ERK target PI3K whether investigated and candidates therefore ERK good therefore linking are and for repair, tissue 2009). during dynamics al., et (Clark reorganisation level be transcriptional to cytoskeletal fast the too of at seems which controlled speed healing, wound the embryonic during with level. seen transcriptional fits the embryonic finding at closure for This unlikely wound are required embryonic signalling regulate PI3K not to and ERK S6C,D), was Therefore, Fig. healing. transcription wound material (supplementary that closure indicating wound in defect injecting supplementary by signalling upon 5B,F; signalling (Fig. PI3K of edge disruption D contrast, By leading S5). Fig. the material to accumulation novdi iooilporso.Ls fEKlast an to leads ERK of is 5B,F; Loss (Fig. PI3K filopodia. protrusion. and of filopodial overproduction accumulation contraction; in actomyosin involved therefore pMLC and myosin-2 of level S3). Fig. material supplementary the change p85 esatdb nlsn h ciainsaeo a,Cc2and Cdc42 Rac, of state activation the analysing by started We actin of regulators key are GTPases small of family Rho The nsmay efudta R srqie o ciainof activation for required is ERK that found we summary, In w ee rncie ttemdlsuatasto,showed transition, midblastula the at transcribed genes two , a xeiet aesonta ohEKadP3 signalling PI3K and ERK both that shown have experiments RAijcino Ytetet rehneeto PI3K of enhancement or treatment, LY or injection mRNA aaii fetvl niie rncito nembryos in transcription inhibited effectively -amanitin ora fCl cec 2 (21) 126 Science Cell of Journal spred1 nvivo in RAo Dtetet lmntdpMLC eliminated treatment, PD or mRNA 10CAAX p110 a aaii i o hwasignificant a show not did -amanitin mroi on-eln ytm to system, wound-healing embryonic RAddntsignificantly not did mRNA Xenopus oyeaeII polymerase siamois a -amanitin and In epnil o h ciain hc skont regulate Meanwhile, to and 1996). known al., signalling is et is which (Kimura PI3K signalling activation, phosphorylation ERK and Rho myosin-2 dynamics. for ERK cytoskeletal responsible upstream actin post downstream between that levels 6F,I). links (Fig. found Rho Rho affect not active we did PI3K reduced whereas healing, Rho wounding, effectively examined wound we overexpression When during 6D,E,G,H). 6F), PI3K (Fig. (Fig. hyper- activation of wounding before inhibition activation post caused Cdc42 Rho whereas and and Cdc42, Rac attenuation) reduced Rac and and significantly Rac ERK signalling of both 6E) of thus activation (Fig. activation (and clear injury, Cdc42 overexpression post showed minutes 6D), embryos 10 (Fig. At control through healing. respectively. acted although PI3K wound Rac/Cdc42, and of and ERK phase whether Rho late asked with wounding). next overlapped the we activation and Therefore, Cdc42 signalling post and PI3K Rac restored closure, of wound minutes peak of 120 the ERK phase embryos whereas contraction with early correlated unwounded the and temporally in than phosphorylation Rho of level minutes activation 60 higher Intriguingly, although a decrease, 6C, to at (Fig. started and maintained minutes, 30 still at peak its reached hw iia atr ffs,te lw yais(Fuchigami dynamics slow, then fast, of pattern similar in a closure shows wound stage al., tail-bud et Intriguingly, Abreu-Blanco slower 2002; 2012). filopodial/ al., a et extensive and (Wood by contraction protrusions cable, lamellipodial primarily fast actomyosin characterized a the phase by including zippering mainly healing, are promoted wound phase of signals phases embryonic distinct during as of such setting, 7). target complex (Fig. modes segregation healing a whereby wound distinct in regulate motility mechanism actin to cell temporal edge. new order of facilitating in a leading incorporated and propose simultaneously the thus we at Cdc42, way, specificity formation this and when filopodia In closure, and Rac of its accumulation activates phase targets, signalling PI3K second place, specific the take at zippering During promoting cable and actomyosin migration edge. the activated, of myosin-2 wound contraction of the the is phosphorylation to leading the chain, signalling and light activity ERK Rho different downstream phase functionally injury, first the grouping In phases. following by distinct contraction temporally exquisitely edge this of achieved into signals leading upstream is be In pool of fine-tuning migration re-epithelialisation. same to the and that successful the show need and we ensure share study, thus contraction to that and edge coordinated processes components leading two cytoskeleton are healing, During behaviours. migration two wound cellular are corresponding of space embryonic their accuracy and and and efficiency time the signalling determine in that segregation mechanisms major and specificity Target closure increased wound Discussion the of phase explains early perturbed. the also is ERK in when which the seen by formation activity, and induced filopodia Rac probably of PI3K are levels higher embryos restored The ERK-inhibited 2005). in al., for et (Wood Cdc42 vital Woolner protrusions be 2002; filopodial to al., and known et lamellipodial are of which formation Cdc42, the and Rac activates PI3K ocnld,w dniidRo a n d4 sspecific as Cdc42 and Rac Rho, identified we conclude, To rvossuisin studies Previous Drosophila on lsr lorevealed also closure wound Xenopus spred1 spred1 also Journal of Cell Science ml h Tae a,Cc2adRo h temporally The Rho. and studied Cdc42 extensively Rac, the GTPases as Rho such small regulators, upstream specific have applicable processes. we be morphogenetic other could mechanisms to healing widely signalling is wound more it embryonic intracellular during processes, the revealed morphogenetic wound- between other that our these similarities likely between and the system regulation Given healing and 2002). and organization al., cytoskeletal et migration during (Jacinto seen filopodial/lamellipodial that closure resembles restrict closely cable zippering actin to contractile the that functions observation our during Moreover, described 1997). been also in has enclosure in machineries ventral phases actin different different the in of during form edge primarily Xenopus wound structures actin the two at simultaneously Drosophila assemble protrusions and difference major the a However, between differentiated. more are epithelia the mro lhuhcnann eaieyundifferentiated wound in mechanisms relatively stage comparable later uses to containing healing still early the cells, that although epidermal demonstrate findings Our embryo, means 2011). as wound shown al., post are results (I) et All activity (I). Rho Active activity reduces (D–F) Rho and affect input. not activation, as does (H) taken but with Cdc42 healing. wounding, was and injected post wound lysate * and (G) embryos during embryo before unwounded. Rac in signalling activity 5% increases uw, (H) and ERK healing. significantly Cdc42 control by wound Spred1 and (G) in during D–F. regulated Rac of embryos pull-downs is reduces Quantification control GST Rho (G–I) in (F) whereas input. pull-downs Rho signalling, as GST and PI3K taken (C) (E) by Rho Cdc42 regulated and (D), are (B) Rac Cdc42 Cdc42 (A), and Rac Rac Active GTPases (A–C) Rho Small 6. Fig. h omto fdfeetatnsrcue scnrle by controlled is structures actin different of formation The Drosophila mro.Itrsigy h itnttmoa separation temporal distinct the Interestingly, embryos. Wo ta. 02 be-lnoe l,21) the 2012), al., et Abreu-Blanco 2002; al., et (Wood Xenopus P on lsr sta,weesatncbeand cable actin whereas that, is closure wound , .5 ** 0.05, .elegans C. mroi on lsr edsrb here describe we closure wound embryonic Xenopus P , .1 s o significant. not ns, 0.01; mro Wlim-asne al., et (Williams-Masson embryos and Drosophila Drosophila mro,where embryos, Xenopus dorsal ehnsst copihti ak is,tesalRho possible suggested small as two other, the each are First, antagonise task. There directly during this could GTPases. these accomplish GTPases of Rho to profiles activation mechanisms small distinct wound in with observe upstream associated we that is structures healing actin of formation separate atr,jntoa rtis(isao ta. 07 n key and 2007) al., the et at (Fitsialos activity growth proteins its of junctional expression on the factors, driving focus including healing level, transcriptional wound during signalling in context. this ERK involved extracellular Ras, in activate is what PI3K might unclear and mechanism receptors still membrane similar plasma is al., and it a signals et though that even (Foschi healing, possible PI3K wound is and ERK It similar of to 1997). lead profiles can It activation stimulation temporally achieved. factor sequential growth is this that signalling how shown PI3K been and to has signalling ERK as of PI3K activation remain sequential Cdc42 Questions and and Rac injury. Rho, ERK of following profiles upstream activation distinct a the of determines where mechanism, separately separation second be the temporal for instead evidence signals. provide upstream but results segregated might Our spatially other, Abr GTPases or temporally Rho each by protein small regulated antagonise the RhoGAP/GEF directly Second, 2011). not the al., et through (Vaughan Cdc42 antagonises otsuiso h oeo ontemtreso ERK of targets downstream of role the on studies Most spred1 Xenopus eprlrglto fcl oiiy5013 motility cell of regulation Temporal and D oyewudhaig hr h directly Rho where healing, wound oocyte p85 uigwudhaig %eby yaewas lysate embryo 5% healing. wound during 6 s.e.m.; n 5 .w wounded; w, 3. ing. D p85 Journal of Cell Science a/d4 aebe eelda h PH-domain-containing the as revealed and been PI3K have between links Rac/Cdc42 Mechanistic healing. wound embryonic preventing and taut edge wound. wound gaping-open the a pulling phases we by two study, closure, throughout required wound our premature is of in cable possible Moreover, actomyosin the 2005). that avoid leading al., show halts et might that (Woolner it healing machinery edge contact-inhibition second, the reducing and of (Matsubayashi by it activation 2011); edge First, movement wound al., the initially. tissue et at rate organised mobilisation healing cell more delayed unnecessary a of even enable force price early driving could major the small the a in the as edges, adopted benefits with is wound two it why another contracting same explaining have phase, besides the might at edge, that cable migration wound actomyosin suggest and the We activity contracts protrusive time. vigorously in restricts It string also 2002). but purse al., the et to of similar (Jacinto and role healing, dual wound dual closure a during the suggests contraction wound migration actomyosin of and phase role protrusion perturbing early edge wound that accelerates enhances finding wound signalling unexpected embryonic the activation ERK in However, through observe contraction myosin-2. actomyosin we of promote that to is activation closure major ERK the contraction, of actomyosin myosin-2 drives role the Because that 1997). protein enhancing motor al., the thus et is (MLCK), (Klemke myosin-2 kinase of chain activation light also downstream myosin is another target, it phosphorylates mechanism, signalling (MLC) this ERK to chain that addition and possible 2011). In light Rho 2009). myosin al., al., of et activity the (Kakiashvili et the of enhances Guilluy tension phosphorylation turn and downstream 2009; in the factor GEF-H1 al., growth of ERK to both Activation et that under leading (Kakiashvili RhoGEF, shown a stimulations Rho, been 2008), (Fujishiro GEF-H1 al., through on has et residue threonine It acts a phosphorylates myosin-2. MAPK it of that phosphorylation evidence found healing. of rate the affect to not 2012). appear does transcription, transcription through not inhibiting al., healing because wound does embryonic et ERK on effect phosphorylated (Brock its exert that (green wound Profilin embryonic migration find of and as signalling we area) (right) However, background phase such late (pink and contraction regulators, (left) in phase curve) cytoskeletal early (green of diagram Rho Schematic and (B) curve) healing. (blue wound healing. embryonic Cdc42 wound of Rac, during phases GTPases phases area) slow Rho background and small fast signalling, the curve) in (black transduction Signal 7. Fig. 5014 efn htP3 rmtsRcadCc2atvt during activity Cdc42 and Rac promotes PI3K that find We we pERK, for role cytoplasmic the analyse to turned we When ora fCl cec 2 (21) 126 Science Cell of Journal Drosophila oslclosure dorsal A ceai iga hwn h ciaino R rdcre n PI3K and curve) (red ERK of activation the showing diagram Schematic (A) Es uha o Nmule l,19;Sisne l,1998), al., (Co 2002), DOCK180 et 1999), al., al., Soisson et et (Shinohara 1998; (Yoshii SWAP-70 aPIX al., 2000), al., et et (Nimnual (Fleming Tiam-1 Sos as such GEFs, a netda h -o -elsaet l el nattlvlm f1 l Amounts nl. 10 of volume mRNA total a Capped in cells 2000). all pg al., to stage 500 et 2-cell were (Sive or injected 1- described the at as injected performed was was culture Embryo manipulation and culture Embryo Methods and Materials ti nrgigt pclt hte iikn h same the adult wounds. mimicking in chronic outcome or whether healing acute better from speculate a suffering patients facilitates to adults in intriguing dynamics achieved, the is is healing cellular shifts wound and it scarless ERK pathways perfect, Given that signalling mode. such low actomyosin these behaviours migration coordinate the and more-protrusive embryos induces PI3K a that to For PI3K high mode healing. low and contraction wound and mode, embryonic ERK the contraction in alter high to movement able example, tissue ERK are modulating we of by pathways, that mode transduction find signal We PI3K dominates wounds. and latter adult the of whereas driving majority major closure, the a wound and as embryonic considered in is migration force purse former The the actin-protrusion-guided exist. healing, both and zippering wound embryonic mechanism of string phases different in that 2013). al., leading al., et et (Funamoto of Pickering migration cell 2002; polarity of directionality the the and 3,4,5- cells determines edge phosphatidylinositol which product, (PIP3), its an trisphosphate establish to of functions PI3K gradient that be intracellular could another It implies pathway. on accumulation this PI3K of actin role the of and effect formation Because the filopodia cells, both margin. wound-edge of edge wound a leading polarisation the suggests at the required structures actin causes is dynamic at of signalling formation preferred accumulation PI3K inactivation that F-actin find and for also shows We number, activity defect. protrusive PI3K PI3K filopodia of wild-type hyperactivation intermediate protrusions, filopodia: largely is increased of signalling amount induces PI3K the of healing. level wound to the embryonic correlated that during find Cdc42 signalling we and mediates Furthermore, Rac GEFs to the PI3K of very from be which will It investigate 2002). al., to et interesting (Meller Zizimin1 and 1998) al., et (Han u idnsas aetomr mlctos is,w find we First, implications. more two have also findings Our spred1 RA(ia ta. 05,50p mdu oe or dose) (medium pg 500 2005), al., et (Sivak mRNA ˆ te ´ n ur,20) Vav 2002), Vuori, and healing. Journal of Cell Science o mgn -ci yaiso I3lclsto,albino with localisation, injected PIP3 were or dynamics F-actin imaging For yae eecnrfgda 4 at centrifuged were lysates 50 buffer, PK 0 pg 500 ( PI3K ( DN dose) (high ng 1 yIae e uniiainTo.T opnaefrtevraino protein of gel band of each variation of protein the value percentage for For the compensate experiments, determined To different was FI). scanned between band Tool. density were protein Quantification side band each experiments Gel of density ImageJ FI/distal independent distal the by the three and edge the images, on from at high-resolution FI FI (leading into films pMLC pMLC or or X-ray membrane F-actin F-actin quantification, the of plasma to ratio the relative shows side membrane a FI plasma across Relative edge (FI) edge. intensity leading wound fluorescence the pMLC at or edge, cell wound (GFP-moesin) the F-actin at measured accumulation myosin-2 we phosphorylated and F-actin quantify To statistics and MA). Quantification Billerica, (Milipore, films X-ray on substrate HRP Western at stored and ice dry in cooled sample, each for collected 2 were embryos Ten previously described blot as Western performed was down 2013). pull al., Rho et and (Soto Cdc42 Rac, Active down pull GST NIH with processed were Images 20 software. a Fluoview with ImageJ. imaged with in and microscope extracted layer, confocal superficial were the caps on animal forceps whole Wound the stage, ImageJ. Microsystems, (Leica NIH software with AF processed Leica were with percentage Images closure microscope 80 Switzerland). the M205 with Heerbrugg, captured Leica were the a images on in Time-lapse on 2002). wounded forceps, al., immunofluorescence) et or with (Davidson and imaging) F-actin pull-down hemisphere and blot, animal imaging western closure (for wound deeply embryo wild-type whole (for stage superficially blastula Late imaging and Wounding ddH ml 50 fish in 16.7% sucrose in g embedded 7.5 2000), (Sigma-Aldrich), al., gelatin et 40% (Sive ml MEMFA (20 with gelatin fixed were Embryos staining hematoxylin and Immunofluorescence 0 eaoyi ouin(im-lrc) ahdwt a ae,and to water, applied was tap (Fisher). Gold method reagent with with DPX ethanol-Histoclear AntiFade with stained The mounting washed with before were HCl. samples (Sigma-Aldrich), mounted slides dehydrate 0.1% staining, with were solution hematoxylin differentiated Samples hematoxylin for For BSA temperature. with imaging. 50% TBSN room for in 1:500 (Invitrogen) at at Probes) hour (Molecular 1 antibodies secondary 568 or rmpeiiae ok la yaewsaprtdadimdaeymxdwell mixed immediately and aspirated 2 of was volume lysate equal Clear with yolk. precipitated from D-AEgl n rnfre noPD ebae.Temmrnswere membranes 4 at The overnight membranes. TBST in PVDF BSA onto 5% with transferred blocked and gel, SDS-PAGE eoetetn mro.01 MOwsue scnrlfrtedu treatments. drug the for control as used was DMSO 0.1% embryos. treating before NaHCO nosok nDS,addltdi 5 vv omlapiinmdu (NAM) medium Ca(NO amphibian mM 1 normal KCl, (v/v) mM 75% 2 in NaCl, diluted mM [110 and DMSO, in made stocks were Technology) into Signaling (Cell LY294002 and (Sigma-Aldrich) PD184352 ng pg 150 500 MA), Cambridge, (Addgene, lsrp emr) inldtcinwscridotuigteImmobilon the using out carried (Dako, Cruz was anti-Mouse 1:100,000 (Santa detection were or Signal (Dako) RhoA antibodies anti-Rabbit Secondary Denmark). 1:40,000 1:1000 BSA. of Glostrup, with dilution and TBST a at in Technology) used CA) Signalling Cruz, Technology), Santa Signalling (Cell (Cell Biotechnology, (Cell Rac1 pAkt Cdc42 1:2000 1:1000 at 1:1000 used Technology), were antibodies Signalling primary 1:100,000 (Cell down, and pERK Technology) 1:10,000 Signaling of dilution a rznat frozen in DAPI 1:10,000 Primary BSA, with incubation. TBSN 4 at antibody in with BSA Technology) with TBST before TBST Signaling in (Cell Technology) were milk, Chain Signaling Light sections (Cell or pERK immunofluorescence, 1:200 BSA 1:500 BSA, at For with used were TBS. TBST antibodies 100% with in with permeabilised re-hydrated blocked were Samples and CM3050. acetone Leica Cryostat with sectioned 10CAAX p110 80 ˚ ni xrcin rznebyswr ooeie sn rsl prepared freshly using homogenized were embryos Frozen extraction. until C 3 Xenopus gfp Msdu hsht,p .]t 10 to 7.4] pH phosphate, sodium mM 2 , 2 80 - RA(ablaae l,20) 0 pg 200 2001), al., et (Carballada mRNA ) grp1 b ˚ ctnn(ba)i BTwt ikad120Sr9Moi II Myosin Ser19 1:200 and milk with TBST in (Abcam) -catenin ni s.10 use. until C m ufrfr1 mro DryadHl,20) Homogenized 2006). Hill, and (Dorey embryos 10 for buffer l hAmN ETlbay(icrs ta. 04] Inhibitors 2004)]. al., et (Gilchrist library [EST mRNA RhoA gfp P oan RA 0 pg 500 mRNA, domain) (PH 5 ˚ vrih.Smlswr hnsandwt lx lo 488 Fluor Alexa with stained then were Samples overnight. C - 1wudae tacrantm on)satn on area. wound point)/starting time certain a at area (1–wound moesin 6 D odn ufr olda 98 at boiled buffer, loading SDS D ˚ p85 ,1,0 p o 5mntst eaaecerlysate clear separate to minutes 15 for rpm 13,200 C, m RAor mRNA rti xrc a oddo ahwl fte8% the of well each on loaded was extract protein l RA(ablaae l,20) 0p API3K CA pg 50 2001), al., et (Carballada mRNA ) eou laevis Xenopus GST-rGBD L a gfp tbln(im-lrc) o S pull GST For (Sigma-Aldrich). -tubulin 3 ) 2 A ouina omtemperature room at solution NAM - MMgSO mM 1 , grp1 ˚ .Piayatbde eeue at used were antibodies Primary C. L RA epciey tblastula At respectively. mRNA, RA(lr ta. 09 and 2009) al., et (Clark mRNA mro sae995 were 9–9.5) (stage embryos m GST-PAK1 Dad2 r50 or 25 and PD M A ouin one by wounded solution, NAM gfp 6 / betv lmu IX81 Olympus objective mcherry eou laevis Xenopus 4 . MET,1mM 1 EDTA, mM 0.1 , ˚ o . iue and minutes 2.5 for C RA(70-110) mRNA - moesin 6 objective embryos 2 m mRNA, )and O) MLY TM fatv Taei oa Tae ttsia nlssue o ahexperiment each for used legends. analysis percentage figure Statistical the related GTPase. indicates in total which specified GTPase, in was band input pull-down GTPase to Gel GTPase active GTPase active pull-down ImageJ of each of GST of ratio the with intensity the normalised relative is were by the inputs and respective with calculated controls, and normalised loading GTPases were gel band. active bands protein of pAkt each same quantities of and The density pERK the absolute of the quantities from of The instead used, density was Tool protein Quantification total the C17 S a ucoe rmpET-A1pamdit C17 tteC the rGBD. at Jonathan and kind pCS107, into into PAK1 a subcloned by plasmid were of was pGEXTK-PAK1 probes termini was from (rGBD) Both provided subcloned 2005). Rhotekin was Bement, of plasmid GST 12217, and pCS107. RBD (Benink Bement PA). (GST-PAK) plasmid B. Center, from gift Cancer (Addgene 70–117 Chase Fox Addgene pGEXTK-PAK1 Chernoff, from assay, For purchased vector. pCS107 pull-down TEgg073116; into subcloned (Rac1, GST and pCS107 TEgg071k05) Full-length RhoA, vector TEgg040f06; 2001). in Cdc42, constructs al., as et ac.uk/online/xt-fl-db.html), (Carballada Kodjabachian Xenopus into Laurent subcloned from Xenopus and respectively. gifts Millard N-terminus, the Tom were at ( from of PI3K eGFP/mCherry domain gifts dominant-negative with PH The were vectors the pCS107 2013) and and 2008) al., pDEST Martin, et and (Millard (Pickering moesin Grp1 of domain binding The Constructs be-lno .T,Vron .M,Lu . at,J .adPrhrt .M. S. Parkhurst, and J. J. Watts, R., Liu, M., J. Verboon, T., M. Abreu-Blanco, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.133421/-/DC1 online available material Supplementary release. immediate Grant for Healing Programme The PMC from Trust in studentships Deposited by Wellcome supported Foundation. a were S.Z. by and J.L. supported (EA). was work This the wrote Funding and project the supervised pull-down E.A. GTPase manuscript. and manuscript. active project the the and throughout wrote discussions embryos helpful live provided to S.W. in assays. confocal F-actin optimised contributed in of construct, assay imaging GFP-moesin pull-down constructs, produced GTPase X.S. active pull-down embryos. and optimised blot and supplementary western and replicates), phosphoprotein 1C, experiments (biological Fig. westerns S4B the and produced immunostaining of S.Z. Fig. most manuscript. material analysed the helpful and wrote and performed for designed, Lab J.L. Amaya contributions the Author of members of all University for discussions. Matsubayashi, and Yutaka Manchester, France, thank of Manchester We and University Freon. University, Brisdon, Millard providing Alan for Tom and Aix-Marseille manuscript, constructs, providing helpful the Kodjabachian, for on UK, Laurent Manchester, suggestions of and University comments Millard, Tom thank We Acknowledgements TGATGTAGAGCTAAGGGTadreverse: and ATGCAGACAATTAAATGTGTAGT and ATCGGAATCGAT Full-length forward: Cdc42, TTATTACAACAGCAGGCATTTTCT; ATGCAGGCCATTAAATGTGTGGT ATCCGTCGAC ATCGGAATCGAT AATGTATGaadrvre TCTGCctaTCCACGCGGAA- CCAGATCCGA. ATCCGTCGAC reverse: atgTCCCC- and ATCGGAATCGAT TATACTAGGTTATTGGaa forward: GST, ATCCGCT- AGCgcctgtcttctccagcacctgggcct; reverse: AAAGAGCGGCCAGAGATTT- and rGBD, ATCGGAGAATTCatcctggaggacctcaatatgctcta CTGCTCCGACTTAGTGATATTT; ATCGGAGAATTC forward: ATCCGCTAGC reverse: TTAGATGAGAAGGCACGTGGTTTT; forward: and CTCT ATCCGTCGAC 70-117, reverse: pak1 and Full-length GCTT TCATAGCAGCCTACACTTGCGTTT; Xenopus ATCCGTCGAC reverse: rmr eeue sflos Full-length follows: as used were Primers 21) rspiaebyscoeeihla onsuigacmiaino cellular of string. combination purse a actomyosin using an wounds and epithelial protrusions close embryos Drosophila (2012). a1 d4 n hAcNswr bandfo h udnInstitute Gurdon the from obtained were cDNAs RhoA and Cdc42 Rac1, rpclsETlbay(icrs ta. 04 (http://genomics.nimr.mrc. 2004) al., et (Gilchrist library EST tropicalis hA owr:ACGACA ATGGCAGCCATCCGTAAGAA- ATCGGAATCGAT forward: RhoA, eprlrglto fcl oiiy5015 motility cell of regulation Temporal D 8)adcntttvl cieP3 p1 CAAX) (p110 PI3K active constitutively and p85) .Cl Sci. Cell J. Xenopus 125 5984-5997. , a tblncontrols. -tubulin a1 forward: Rac1, Xenopus Journal of Cell Science ihr,D . abat,C . dad,K . ikl,W .adMontague, and L. W. Rickoll, A., K. Edwards, G., C. Galbraith, P., D. Kiehart, Kohno, S., Tanimura, M., Lodyga, R., Seth, F., Waheed, P., Speight, E., Kakiashvili, ait,A,Wo,W,Wonr . ie,C,Tre,L,Wlo,C,Martinez- C., Wilson, L., Turner, C., Hiley, S., Woolner, W., Wood, A., Jacinto, oci . hr,S,Dn,M .adSrkn A. Sorokin, and J. M. Dunn, S., Chari, M., Foschi, P. C. Downes, and A. Gray, N., I. Fleming, S. C. Hill, and K. Dorey, R. Keller, and M. A. Ezin, A., L. Davidson, K. I. Gipson, and Y. Danjo, ait,A,Wo,W,Bly,T,Tran,M,Mrie-ra,A n Martin, and A. Martinez-Arias, M., Turmaine, T., Balayo, W., Wood, A., Jacinto, lr,A . ilr .L,Vuhn . u .Y,Pnet .adBmn,W M. W. Bement, and R. Penkert, Y., H. Yu, E., Vaughan, L., A. Miller, G., A. Clark, M. J. Slack, Krasnow, and and F. B. Karim, Christen, L., Ryner, J., Heller, E., Johnson, L., Keyes, K., N. Cho, isao,G,Cast .A,Trh,L,Dym .A,LBiad . Moreilhon, K., LeBrigand, A., M. Dayem, L., Turchi, A., A. Chassot, G., Fitsialos, Co aah,H,Tuhy,Y,Nkym,K,Sth .adNsia E. Nishida, and T. Satoh, K., Nakayama, Y., Tsuchiya, H., Hayashi, M., U. Krishna, D., R. Mosteller, Y., Xia, X., Shu, B., Das, K., Luby-Phelps, J., Han, hnSn,I .adCihl,A D. A. Chisholm, and D. I. Chin-Sang, and P. Y. Lemaire, and Wu, H. C., Yasuo, V. R., Carballada, Han, R., Renkawitz-Pohl, S., Berger, Y., Wang, R., A. Brock, ulu,C,Saiahn . acaMt,R,OBin .T,Sprie .and R. Superfine, T., E. O’Brien, R., Garcia-Mata, V., Swaminathan, C., Guilluy, ide . ien,I n udn .B. J. Gurdon, and I. Simeoni, A., Biddle, icrs,M . on .M,Vit . mt,J . aaouu .adAmaya, and N. Papalopulu, C., J. Smith, J., Voigt, M., A. A. Zorn, R. J., Firtel, M. and Gilchrist, L. Parry, S., Lee, R., Meili, S., Kohno, Funamoto, and K. Watanabe, Y., Kashimoto, S., Mure, S., Tanimura, H., S. Fujishiro, eik .A n eet .M. W. Bement, and A. S. H. Benink, M. Mooseker, and P. Forscher, M., W. Bement, 5016 uhgm,T,Mtuai .adIaa S. Ihara, and T. Matsuzaki, T., Fuchigami, ˆte nDrosophila. in A. R. the permeability. in paracellular role Sza tubular phosphorylation: of and myosin regulation and A. activation Rho Kapus, factor-alpha-induced D., necrosis O. Rotstein, M., rspiadra closure. dorsal P. Drosophila Martin, and A. Arias, yedtei- eunilyatvtsteEKcsaeadpopaiyioio 3- phosphatidylinositol and cascade ERK the kinase. activates sequentially - endothelin-1 and by 3-kinase-dependent phosphoinositide both involves components. independent Tiam1 factor exchange laevis. Xenopus 176. in ingression wound, and epithelial contraction apical the of edge movement. leading cell the coordinated at providing junctions adherens cadherin-mediated rspiadra closure. dorsal Drosophila P. eetv oe o R12 3,adpopaiyioio -iaesignaling 3-kinase phosphatidylinositol and p38, reveals wounding ERK1/2, scratch for vitro pathways. in roles to subjected selective keratinocytes epidermal of signature Busca G., Meneguzzi, C., embryos. Xenopus in signalling Nodal in EGF-CFCs for activity. exchange Sci. nucleotide Cell guanine J. with proteins DOCK180-related of superfamily responses. wound multicellular 1395. and single of Integration (2009). embryos. Xenopus in signalling pathway. VEGF A. M. I3kns nrgltn ciaino a-eae unsn rpopaae yVav. by triphosphatases guanosine Rac-related of Science activation D. regulating Broek, in and 3-kinase A. PI M. White, R., J. Falck, euaino h I-iaeAtptwyb R A iaei rwhfactor growth in kinase MAP ERK by pathway PI3-kinase/Akt signaling. the of regulation opoeei nC elegans. mesoderm C. Xenopus in during morphogenesis pathway FGF the in kinase MAP ERK induction. the to parallel in larvae. Drosophila J. M. Galko, epnet oc nintegrins. on force to response K. Burridge, eetasrpini rnpatdsmtcnce neednl fmoei factors. myogenic of independently nuclei somatic Development transplanted in transcription gene eprlrglto f3poponstdsb I3kns n TNmediates project. PTEN and E. 3-kinase PI by 3-phosphoinositides chemotaxis. of regulation temporal RhoA. toward activity exchange M. rudsnl elwounds. cell single around maintenance. polarity cell and closure wound Biol. string purse in involved structure flwincnetain stetigrfrrpdwudcouei eou laevis Xenopus in closure wound rapid for trigger the is embryos. concentrations ion low of ,J .adVoi K. Vuori, and F. J. ´, 20) eiigalresto ullnt lnsfo eou rpclsEST tropicalis Xenopus a from clones full-length of set large a Defining (2004). 20) yai ci-ae pteilahso n elmthn during matching cell and adhesion epithelial actin-based Dynamic (2000). 20) R12popoyaeGFH oehneisgaienucleotide guanine its enhance to GEF-H1 phosphorylate ERK1/2 (2008). 121 20) utpefre otiuet elsetmrhgnssfrdra closure dorsal for morphogenesis sheet cell to contribute forces Multiple (2000). MOJ. EMBO 20) eeomna oto fbodcl irto yteDrosophila the by migration cell blood of control Developmental (2002). e.Biol. Dev. 279 565-578. , olg Sci. Zoolog. ee Cells Genes ora fCl cec 2 (21) 126 Science Cell of Journal .Bo.Chem. Biol. J. Development 115 558-560. , Cell 136 21) rncitoa euaino rflndrn on lsr in closure wound during Profilin of regulation Transcriptional (2012). 21) h h EsLR n E-1rglt h mechanical the regulate GEF-H1 and LARG GEFs Rho The (2011). .Cl Biol. Cell J. 4901-4913. , Cell 16 2695-2703. , 109 .Cl Sci. Cell J. 271 6439-6451. , 611-623. , 108 28 498-516. , 20) oe rporltdpoenrvasa seta role essential an reveals protein Cripto-related novel A (2006). 13 128 633-641. , 865-876. , 941-947. , 282 ,R,Mr,B,Brr,P tal. et P. Barbry, B., Mari, R., `, ice.J. Biochem. ur Biol. Curr. ur Biol. Curr. 19) ci presrn’flmnsaeacoe yE- by anchored are filaments string’ ‘purse Actin (1998). 20) yai nlsso ci al ucinduring function cable actin of analysis Dynamic (2002). .Cl Biol. Cell J. 149 35-44. , 20) dniiaino neouinrl conserved evolutionarily an of Identification (2002). 15090-15102. , rnsGenet. Trends 125 19) pta epnet irbatgot factor growth fibroblast to response Spatial (1999). a.Cl Biol. Cell Nat. 471-490. , Development 20) ocnrcznso cieRo n Cdc42 and RhoA active of zones Concentric (2005). ice.Bohs e.Commun. Res. Biophys. Biochem. 5667-5676. , 20) omo h om eeiso epidermal of genetics worm: the of Form (2000). 351 12 10 .Cl Sci. Cell J. 168 1245-1250. , 1420-1426. , 20) eou oye eciaemuscle reactivate oocytes Xenopus (2009). si K. ´szi, 173-182. , 20) hshtdlnstl3kns acts kinase Phosphatidylinositol-3 (2001). 19) oeo usrtsadpout of products and substrates of Role (1998). 21) xouet xenlenvironment external to Exposure (2011). 429-439. , 20) euaino h Rac1-specific the of Regulation (2000). 16 20) mroi on eln by healing wound Embryonic (2002). 126 13 544-551. , .Bo.Chem. Biol. J. 19) ihscatvto fp21ras of activation Biphasic (1997). 722-727. , 119-125. , 111 20) E-1mdae tumor mediates GEF-H1 (2009). elMtl Cytoskeleton Motil. Cell 3323-3332. , 19) oe cytoskeletal novel A (1993). e.Biol. Dev. 20) Transcriptional (2007). 284 ur Biol. Curr. 20) pta and Spatial (2002). 11454-11466. , 368 292 20) Down- (2008). 162-167. , 303-316. , 19 53 1389- , .Cell J. 163- , aon,C,Bre .adWimn M. Whitman, and B. Burke, C., LaBonne, lme .L,Ci . inii .L,Glahr .J,d aeol,P and P. Lanerolle, de J., P. Gallagher, L., A. M., Giannini, Nakafuku, S., Y., Cai, L., Fukata, R. K., Klemke, Chihara, M., Amano, M., Ito, K., Kimura, i,M n cins W. McGinnis, and M. Kim, ina,A . asl,B .adBrSg,D. Bar-Sagi, and A. B. Yatsula, S., A. Nimnual, ia,J . eesn .F n my,E. Amaya, and F. L. Petersen, M., J. Sivak, J. Hardin, and S. J. Simske, od . ait,A,Goe . ole,S,Gl,J,Wlo,C n Martin, P. and Martin, and C. A. Wilson, Jacinto, S., J., Woolner, Gale, S., Woolner, R., Grose, A., Jacinto, W., Wood, J. Hardin, and N. A. Malik, M., E. Williams-Masson, ilr,T .adMri,P. Martin, and H. A. T. M. Millard, Schwartz, and A. M. Pozo, Del B., W. Kiosses, M., Irani-Tehrani, N., Meller, hnhr,M,Trd,Y,Iaas,A,Sioaa . ohzk,N,Higuchi, N., Mochizuki, A., Shinohara, A., Iwamatsu, A. Y., Hall, Terada, and M., D. Shinohara, Diekmann, L., C. Johnston, F., H. Paterson, J., A. Ridley, A. Hall, and J. A. Ridley, A. Hall, and D. C. Nobes, ag . srua,V,Xlugds . ar,N,Tiklova N., Sabri, N., Xylourgidis, V., Tsarouhas, S., Wang, asbysi . azl,W n atn P. Martin, and W. Razzell, Y., Matsubayashi, M. S. Parkhurst, and P. Martin, J. Lewis, and P. Martin, P. Martin, ikrn,K,AvsSla . oeda,D n ilr,T H. T. Millard, and D. Goberdhan, J., Alves-Silva, K., Pickering, P. Martin, and S. Nodder, aik,T,Ssk,A,Kt,R,Sod,T,Mtuoo . ioh,K., Miyoshi, A., Matsumoto, T., Shouda, R., Kato, A., Sasaki, M. W. T., Bement, and Wakioka, Y. H. Yu, L., A. Miller, M., E. Vaughan, E. Amaya, and N. Papalopulu, E., Dubaissi, R., Lea, J., Li, X., J. Soto, Kuriyan, and D. Bar-Sagi, M., Uy, S., A. Nimnual, M. M., R. S. Soisson, Harland, and M. R. Grainger, L., H. Sive, asbysi . bsy,M,Hno,S n ihd,E. Nishida, and S. Honjoh, M., Ebisuya, Y., Matsubayashi, tnstet M. Stanisstreet, nuto n xa atrigdrn eou development. Xenopus during patterning axial and induction kinase. A. D. Cheresh, al. et (Rho-kinase). K. kinase Rho-associated Okawa, and T., Rho 245-248. Nakano, by phosphatase J., myosin Feng, B., Yamamori, seta o on-eedn eeeainbtntfrdvlpeto nepidermal an of development for not but barrier. regeneration wound-dependent for essential oe neihla he uindnmcsuiso rspiadra closure. dorsal Drosophila of studies fusion—dynamic Biol. sheet epithelial in roles Biol. Cell P. 20) iii1 oe d4 ciao,rvasanwGFdmi o Rho closure. for dorsal Drosophila domain of GEF phase zippering new the a during reveals activator, Cdc42 novel proteins. a Zizimin1, (2002). ietdb pot n pe rtisdrn eoemformation. mesoderm during proteins Spred and Sprouty by directed embryos. elegans Caenorhabditis ruffling. membrane of signalling al. et mediates H. 416 that Itoh, S., factor Nagata, S., nucleotide-exchange Ihara, Y., Gotoh, M., Sos. exchanger Ras the through triphosphatases guanosine tpmcaimi eurdfrvnrlecoueo h .eeashypodermis. elegans C. the of enclosure ventral for required Development is mechanism step Drosophila. in healing wound epidermal and head C. Samakovlis, and M. Gallio, pteilsrthwudhaigrvashwclsmbls akfo h leading the from back mobilise fashion. cells myosin-II-dependent how a reveals in healing edge wound scratch epithelial healing. wound 75-81. 1486. h ml T-idn rti a euae rwhfco-nue membrane factor-induced growth regulates rac protein GTP-binding ruffling. small The factors. growth to response in fibers stress actin 70 and adhesions focal of assembly healing. wound Drosophila and during formation closure protrusion dorsal actin regulate phosphoinositides and Bazooka lamellipodia, fibers, stress actin with associated filopodia. complexes and focal multimolecular of snoa . oia . ao,R n ohmr,A. Yoshimura, and R. signalling. Ras Baron, of S., suppressor Sprouty-related Komiya, M., Tsuneoka, Rho levels, calcium modulating by assembly. healing F-actin wound and accelerate GTPases, product its and kinase Press. Laboratory Manual Laboratory A Laevis: Xenopus 701. rpgtsi pteilcl hesadrgltstermgaindrn wound during migration their regulates and sheets cell healing. epithelial in propagates morphogenesis. mro.(Berl.) Embryol. h Taecosakb Abr. by crosstalk GTPase Rho Morphol. Exp. Embryol. J. of Son human the from domains homology pleckstrin and Dbl protein. sevenless the of structure 389-399. , 20) on eln eaiuae opoeei nDoohl embryos. Drosophila in morphogenesis recapitulates healing Wound (2002). 759-763. , 282 .Cl Biol. Cell J. rc al cd c.USA Sci. Acad. Natl. Proc. ur Biol. Curr. Cell 19) on eln—iigfrpretsi regeneration. skin perfect for healing—aiming Wound (1997). 163-173. , a.Cl Biol. Cell Nat. 4 907-912. , 124 70 Cell 18) acu n on eln nXnpseryembryos. early Xenopus in healing wound and Calcium (1982). Nature Development 401-410. , 195 2889-2901. , 19) euaino elmtlt ymtgnatvtdprotein mitogen-activated by motility cell of Regulation (1997). Cell 81 14 137 215-228. , 53-62. , 731-735. , 95 360 19) ci alsadeiemlmvmn nembryonic in movement epidermal and cables Actin (1992). 481-492. , 4 19) h,rc n d4 Tae euaeteassembly the regulate GTPases cdc42 and rac, Rho, (1995). 259-268. , 639-647. , 19) h ml T-idn rti h euae the regulates rho protein GTP-binding small The (1992). 179-183. , 67 20) etn nosae pdra opoeei in morphogenesis epidermal shape: into Getting (2001). 19) on eln nebys review. a embryos: in healing Wound (1997). 21) hshrlto fGan edb R is ERK by head Grainy of Phosphorylation (2011). 131 195-205. , ur Biol. Curr. 20) yai nlsso iooilinteractions filopodial of analysis Dynamic (2008). 20) h yoiekns tthratvtsGrainy activates Stitcher kinase tyrosine The (2009). rc al cd c.USA Sci. Acad. Natl. Proc. 20) aall ewe iserpi n embryo and repair tissue between Parallels (2004). 3021-3034. , Bioessays Development 108 odSrn abr Y odSrn Harbor Spring Cold NY: Harbor, Spring Cold . 20) h ml TaeRcpasmultiple plays Rac GTPase small The (2005). 650-655. , .Cl Sci. Cell J. 19) oeo A iaei mesoderm in kinase MAP of Role (1995). 21 23 270-277. , Nature 12-23. , 20) G inlitrrtto is interpretation signal FGF (2005). 140 21) Wiewv’aayi of analysis wave’ ‘White (2011). 19) opigo a n Rac and Ras of Coupling (1998). a.Cl Biol. Cell Nat. 124 800-809. , 20) WP7 saguanine- a is SWAP-70 (2002). 19) natnmdae two- actin-mediated An (1997). 412 (2000). 1017-1021. , Development 647-651. , Science Development 110 20) R activation ERK (2004). 21) oto flocal of Control (2011). al eeomn of Development Early 19) euainof Regulation (1996). ,K,Nuia,N., Nautiyal, K., ´, 11029-11034. , 20) pe sa is Spred (2001). 11 279 e.Cell Dev. 890-895. , 21) Inositol (2013). 19) Crystal (1998). 135 21) Par3/ (2013). 560-563. , Science Science 121 621-626. , (1992). 1475- , 8 Nature 689- , Anat. Dev. 273 276 Nat. Cell , , Journal of Cell Science ohi . aaa . tui . ag D Wang, Y., J. Otsuki, M., M. Tanaka, Galko, S., and Yoshii, R. Ueda, K., Fujitani, Y., Wang, R., A. Brock, Y., Wu, ciae yitrcinwt hshtdlnstl3-kinase. H. phosphatidylinositol Sugimura, with interaction and by activated E. Kaneko, H., larvae. Drosophila in migration PDGF/VEGF-li blood-borne elgn ntae on-nue pdra cell epidermal wound-induced initiates ligand ke ur Biol. Curr. 19) lhPXncetd xhnefco is factor exchange nucleotide alphaPIX (1999). . u,R . h,Y,Tkd,R,Hanai, R., Takeda, Y., Zhu, J., R. Guo, Y., . 19 1473-1477. , Oncogene 18 5680-5690. , 20) A (2009). on,P . iha,A . ecu,A .adKeat .P. D. Kiehart, Y. Zheng, and and S. J. A. Chernoff, B., Ketchum, Zhang, M., A. Richman, E., P. Young, ciaigpoen n uaieefcos oprsnwt d4 n RhoA. and Cdc42 with comparison A effectors. Chem. putative Biol. J. and proteins activating opoeei nDoohl eursnnucemoi ev hi function. chain heavy myosin nonmuscle requires Dev. Genes Drosophila in Morphogenesis 7 eprlrglto fcl oiiy5017 motility cell of regulation Temporal 29-41. , 273 8776-8782. , 19) neato fRc ihGTPase- with Rac1 of Interaction (1998). (1993).