Black Rockfish S. Melanops, While Spatially-Mapped and Observed in Some of the Same Schools and Locations As Blue Rockfish, Were

Part One: Survey of Punta Gorda Ecological Reserve

Black rockfish S. melanops, while spatially-mapped and observed in some of the same schools and locations as blue rockfish, were more widely distrib- uted in areas also occupied by kelp greenling H. decagrammus and canary rockfish S. pinniger (Figure 26a–c). Cluster analyses by habitat and relief suggest that these three species are more closely associated to each other than to blue rockfish S. mystinus (Figures 22, 23, 24, and 25). While they do cluster together, each has a unique habitat preference. All three were found over Rocksand1 and Rocksand3 substrates, however kelp greenling showed a preference for low-relief habitats common to canary rockfish (“boulderlow” and “rocklow”), differing from black rockfish, which shares blue rockfish’s preference for “rockhigh” habitat. Given these differences, spatial distribution patterns reveal that low-relief “generalists” common to areas with both sand and rock, such as kelp greenling, are more pervasive at PGER than canary rockfish, which were found in “rock-sand” interface areas. Our visual observations and orientation analysis, which indicate that canary rockfish are in contact with or near sand substrate adjacent to reefs, validates the results from both cluster analysis and mapped distributions.

Macroinvertebrates PGER is dominated by filtering organisms that are able to withstand a high particulate load and a strong, current-dominated environment. Colonial suspension feeders such as cnidarians, sponges, and tunicates were the most numerous organisms on hard substrates. Other organisms observed in moderate numbers at PGER include predatory and filter-feeding sea stars and the deposit-feeding sea cucumber. These organisms must respond to a variety of abiotic and biotic environmental influences in order to endure in this harsh environment. Abiotic factors may include water flow (Harris 1991), seston flux (Lesser, et al 1994), and sand inundation (McQuaid and Dower 1990, Antonio 1986). Biotic factors may include predation (Duggins 1983), prey availability (Annett and Pierotti 1984), competition (Chadwick 1991), and community composition (Anthony 1997). Psammophilic macroinvertabrates: Greater than 50% (22/42) of the species observed was found at least once on sand. This indicates that most of the species present at PGER were tolerant of sand (e.g., sessile species—the sponge, P. pachymastia) or would move over sand (e.g., motile species—the sea star, H. leviuscula). However, several sessile species had much higher densities in areas of strong sand movement and could be considered psammophilic. These species include the sponges P. pachymastia and T. aurantia. Cnidarians included the unidentified gorgonian and the urticina, U. piscivora, and chordates such as the tunicates P. planum and S. montereyensis. Sandy sites may serve as refuges that protect these species from potential competitors or predators (Antonio 1986). The sea cucumber P. californicus, and the leather star D. imbricata, were found on sand ranging from 9–28% of

Karpov 48 Part One: Survey of Punta Gorda Ecological Reserve

the time. Comparatively, the urchin S. franciscanus was never seen on sand (0%) and Stimpson’s sunstar Solaster stimpsonii was only seen twice on sand (2 observations). The few invertebrates that were found out on the sand habitat were in close proximity to areas of rocky reef (Figures 35b, c and 36b). This associa- tion between sand epifauna and reef is likely due to the increased sand stability created by the rocks’ deflection of ocean currents and waves. In addition, areas of sand which had ripples <10 cm high had higher densities of invertebrate species than area with sand ripples >10 cm. For example, the sea pen Pstilosarcus gurneyi, which occurred in very low densities, was only found in sand habitat with small ripples and in areas of sand-impacted bedrock that had high sand cover. Large volumes of sand have apparently moved through PGER’s deeper waters, impacting the boundaries of the rocky reef. Only high-relief rock outcroppings and boulders remained exposed and unworn. Within areas of higher-relief rock, fine sand and detritus filled the cracks, crevices, and depres- sions. Low-relief rock < 1m high dominates most of the central reef at PGER. The outer boundaries of this reef area were often covered by sand; only the tops of the rocks and boulders lacked some degree of coverage. Organisms living on these rock tops were inundated by sand. Examples of commonly- identified organisms in this habitat were the sponge P. pachymastia and the unidentified gorgonian. Moderate-relief rock from 1 to 3 m high was some- what to very sparsely covered by sand and represented the second most abundant deep-water habitat type within the reserve. Commonly identified species found in this habitat included the following: sponges A. erathacus, C. arb, Halichondria sp., and T. aurantia; the hydroids Aglaophenia sp., G. annulata, and Plumularia sp.; the anthozoans C. californica, E. scotinus, and U. piscivora; the scallop C. giganteum; the barnacle B. nubilus; the asteroids D. imbricata, H. leviuscula, Mediaster aequalis, P. brevispinus, and Pycnopodia helianthoides; and the tunicates Aplidium sp., Cystodytes lobatus, and P. planum. High-relief rock represented the smallest proportion of deep-water habitat within PGER, but it contained some of the most diverse invertebrate assemblages. These habitats were most common within the boundaries of the rocky reef, and consisted of rocky outcroppings that were greater than 3 m high. Commonly-identified species included the above mentioned species found in the exposed low-relief Bedrock and Boulder habitat with the following addi- tions: the hydrocorals S. californicus and Stylantheca porphyra; the anemone M. giganteum; the sea cucumber, P. californicus; and the sea stars S. stimpsonii and O. koehleri.

Karpov 49 Part One: Survey of Punta Gorda Ecological Reserve

Comparison Few published studies pertain to the subtidal ecology of Northern California. of PGER with Those that do are in areas far to the north and south of PGER. To the north, Previously the only published reports are Areas of Special Biological Significance (ASBS) Examined reports on the Kelp Beds at Trinidad Bay ASBS (Anonymous 1979c) and Areas of Redwood National Park ASBS (Anonymous 1981b). To the south, published ASBS descriptions of the Pygmy Forest Ecological Staircase ASBS (Anony- Special mous 1981a), the Kelp Beds at Saunders Reef ASBS (Anonymous 1980), Biological Gerstle Cove ASBS (Anonymous 1979a), and Bodega Marine Life Refuge Significance ASBS (Anonymous 1979a) are representative of the few subtidal descriptions (ASBS) in south of Punta Gorda. These ASBS reports are predominantly anecdotal, with Sonoma, varying detail and little temporal information. Waters deeper than 12m were Mendocino, not described in much detail, if at all. The lack of well-described subtidal Humboldt and habitats makes comparisons between ASBS sites difficult and subject to Del Norte interpretation. Therefore, we cannot make comparisons between the deep subtidal areas of PGER and the Areas listed above. The following compari- Counties sons of ASBS reports and PGER focus on descriptions of the habitat types observed and similarities in the biota found in waters shallower than 18 m (Table 25). Differences are examined based on species of management importance.

Kelp beds at Trinidad Bay ASBS To the north, Trinidad Head is the only major headland between Cape Mendocino and Point St. George (Figure 1). The sheltering effects of Trinidad Head place Trinidad Bay proper in the lee of northwesterly swell, which continues throughout most of the year. Due to the sheltering effects of the headland, the bay proper is distinctly different from most sites studied in Northern California. Invertebrates found within Trinidad Bay are apparently representative of the types of species found in deeper waters with higher rates of deposition (Table 25). The western section of Trinidad Head is highly exposed to northwesterly swell, as are other Northern California ASBS sites. The subtidal waters are strongly influenced by local rivers to the south, which discharge large amounts of fresh water and eroded materials. Waves from the south, along with local currents, trap much of the depositional material in the bay, reducing the photic zone throughout the area. The photic zone extends to a depth of about 6 m as indicated by algal species such as the bull kelp N. luetkeana, which is common in protected areas on rock tops that ascend into the photic zone. Subtidal biota are highly influenced by wave exposure and sediment deposition. The wave-protected areas of the bay proper are composed of a sand/silt bottom with sheer-faced sea stacks and boulder piles. Wave energy is reduced to a moderate surge that scours the bases of rocky oucroppings. The rocky habitats are highly depositional and contain many invertebrate species not found in the more exposed areas of the bay. Examples of invertebrates include the brachiopod Terebratalia transversa and the tunicate Chelyosoma productum.

Karpov 50 Part One: Survey of Punta Gorda Ecological Reserve

Wave exposed areas of Trinidad Bay are composed of sand bottom with sheer- faced sea stacks, which rise nearly to or above the surface of the water, and boulder piles near the base of the sea stacks. The sand habitat is reported to be highly turbid with a mixture of infaunal and epifaunal species. Epifaunal species were associated with areas of semi-stable sand and included the olive snail Olivella biplicata, the Dungeness crab Cancer magister, and the sand dollar Dendraster excentricus. The rocky substrate was dominated by filter feeding invertebrates such as the hydroid Aglaophenia sp., the sea strawberry G. rubiformis, the anemone M. senile, the barnacle B. crenatus, and the sea cucumber Eupentacta quinquessemita which formed large aggregations on the lee side of sheer-faced rocks. Few urchins or abalone were found in Trinidad Bay.

Redwood National Park ASBS Moving farther north, Redwood National Park is located in northern Humboldt county and southern Del Norte county (Figure 1). The uplifted coastline here is highly exposed to wave impact and ocean currents. Fresh water and materials discharged from nearby creeks and rivers significantly influence the subtidal environment, and strong nearshore water movements result in high turbidity and a shallow photic zone. Subtidal substrates were reported to consist of sand and gravel with interspersed rock and boulder habitats, and biological assemblages were similar to those found outside Trinidad Bay. Sand habitat dominated, and was reported to be highly turbid with few motile epifaunal species such as the olive snail and Dungeness crab. Outcroppings of rock were highly scoured at the rock/sand interface. Rocky substrate above the scour zone or in areas protected from wave impact were reported to be dominated by suspension feeders such as the sponge P. pachymastia, the hydroid Aglaophenia sp., sea strawberry G. rubiformis and anemone M. senile, and the blood star H. leviuscula. Algal species were restricted to rocky substrate, which extended into the photic zone (~ 5.5 m deep). Winter storms were reported to remove much of the patchy algal cover, resulting in increased algal build-up on sand beaches. Few red urchins and no abalone were reported within Redwood National Park.

The Pygmy Forest Ecological Staircase ASBS To the south of PGER, The Pygmy Forest Ecological Staircase (Jug Handle Cove) is located in Mendocino County, just south of Fort Bragg (Figure 1). Jug Handle Cove consists of a northern headland and a sand beach cove. The headland is an irregular, vertically dropping wall extending to about 5 m deep, where boulder piles and submerged pinnacles dominate. The sand beach consists of clean, medium-sized sand grains with emergent boulders on the borders of the cove. Emergent bedrock and boulders within large areas of sand and gravel dominated the subtidal waters. Areas of sand habitat were reported to be unstable due to heavy wave action, which shifted the sand, subjecting organisms to scour and periodic burial. The epifauna of the sand habitat included the olive snail, Dungeness crab, and sand dollar (Table 25).

Karpov 51 Part One: Survey of Punta Gorda Ecological Reserve

Within Jug Handle Cove, rocky substrate dominates and is exposed to varying wave energy. Algal species are common on rocks from the intertidal to depths of approximately 5 m. Invertebrate species common to rocky substrate include the anemone A. xanthogrammica and the white spotted rose Urticina lofotensis; the polychaete Serpula vermicularis; the red abalone H. rufescens; the urchin S. franciscanus; and the sea star P. helianthoides.

Saunders Reef ASBS Located in Mendocino County, Saunders Reef lies to the south east of Point Arena (Figure 1). The coastline is composed of marine terraces and sea cliffs, which fall onto cobble-boulder beaches with little sand. Scattered small sand beaches exist in areas protected from the strong wave energy, where small streams provide a supply of sand. The subtidal area is primarily composed of vertical rock walls, boulder piles, and rocky outcroppings. The rocky substrate is separated by sand and gravel, which is highly influenced by water movement as indicated by large ripple marks. Rock bases that surrounded the sand and gravel habitats are often scoured clean or showed signs of intermittent burial, such as protruding algal holdfasts. Algal species were common in waters shallower than 12 m, where the canopy-forming alga, bull kelp, produced significant cover. Suspension-feeding invertebrate species, such as the anemones C. californica and Eupentacta quinquesemita, are common, and often form thick turfs on rock surfaces that are free of algae. Also commonly found are several herbivorous species such as red abalone and red sea urchin (Table 25). At depths greater than 8 m, red urchins are extremely common on rocky substrate and sometimes form patches of almost complete cover. Red abalone were also found on rocky substrate, forming patches in areas where urchins were not present and drift algae was common.

Gerstle Cove ASBS Moving farther south, Gerstle Cove is a semi-protected rock-and-boulder cove located in Sonoma county (Figure 1). The cove is exposed to southerly swell, but protected from the northwesterly swell. Erosion of the shoreline provides large slump blocks and boulders, which dominated the subtidal area. The gently-sloping subtidal terrain also includes wash rocks and emergent sea stacks immediately offshore. Algal species are common on rock surfaces shallower than 5 m and include the canopy-forming bull kelp. Small amounts of sand and gravel were intermixed between rocky substrate. Commonly found on rocky substrate were suspension-feeding invertebrates such as the anemone C. californica, the blood star,H. leviscula, and the tunicate S. montereyensis (Table 25). Herbivorous species include the gumboot chiton Cryptochiton stelleri, and the lined chiton Tonicella lineata; the blue topsnail Calliostoma ligatum; the abalone H. rufescens; and the urchin S. franciscanus, which were all common. Predatory species included the sea stars P. helianthoides, and P. brevispinus.

Karpov 52 Part One: Survey of Punta Gorda Ecological Reserve

Bodega Marine Life Refuge ASBS Located in Sonoma County, Bodega Marine Life Refuge is 1.7 miles northwest from the town of Bodega Bay (Figure 1). This granitic peninsula is subjected to intense northwesterly swell, which averages a daily height of 2.5 m. A prevailing nearshore current from the north generates localized gyres in certain areas of Horseshoe Cove. The subtidal area is composed of terraced granitic rock with areas of unstable sand. Rock habitat is estimated to account for over 80% of the subtidal substrate, with the remaining 20% being sand- filled channels. Vertical topographical relief of rocky substrate was usually on the order of 1 to 2 m. Sand habitats appeared to be in a constant state of flux due to swell intensity and tidal range. Some of the common subtidal invertebrate species found were the sponge P. pachymastia; the anemone A. xanthogrammica and the urticina U. lofotensis; the chiton C. stelleri; the snail T. brunnea; and the tunicates P. planum and S. montereyensis. Also common was the abalone H. rufescens and the urchin S. franciscanus. A cursory comparison of the most common and abundant species found in the above ASBS sites to those found in the shallow waters (6 to 18 m) of PGER was made (Table 25). These species were selected based on the video methodologies used to gather the shallow water data of PGER. Species selected from ASBS sites were chosen based on their known physical appearance, which would allow regular identification by video, and based on the ASBS reports, which rank species encountered as being scarce, uncommon, common, or abundant. This qualitative ranking system was based on SCUBA diver observations. The common or abundant ranking is not a measure of density, but rather an indicator of relative abundance within that specific site. This ranking system was based in part on the contributing specialist’s famil- iarity with the species of that area. Most of the species mentioned occur throughout Northern California. All sites showed significant overlap in invertebrate species encountered. Suspension- feeding invertebrates, along with many predatory species, were common in both the northern and southern ASBS sites studied. The success of suspension- feeding invertebrates suggests that the nearshore waters of Northern California are rich with planktonic microorganisms and drifting organic particles. Much of this wide distribution is due to broadcast spawning events, which produce large amounts of larvae, which drift with currents and wind. Asexual repro- duction allows developing larval forms to spread and cover large areas of substrate, increasing their genetic output. Predatory species also flourish in nearshore waters due to the success of suspension-feeding invertebrates, which serve as a food source for many predatory species. Differences in the composition of species encountered within the locations described above are most likely due to increased rocky habitat with greater algal cover in the ASBS sites. Herbivorous species, such as red abalone and red urchins, were not reported to be common in areas north of PGER. These areas were dominated by sand and experienced heavy abrasion. Abalone

Karpov 53 Part One: Survey of Punta Gorda Ecological Reserve

and urchins were common in subtidal waters south of PGER, which were dominated by rock and boulder habitat. All areas south of PGER were reported to have dense, shallow water algal cover along with areas of drift kelp. Rocky areas located in sand-dominated sites had increased turbidity and less algal cover. These sites also had little habitat for cryptic species, such as juvenile red abalone and red urchins, as much of the bedrock and boulders were highly sand-impacted and scoured smooth. Based on these ASBS reports, the subtidal biota of PGER appears to be similar to that of Trinidad Bay and Redwood National Park, except that PGER has a deeper photic zone. These sites are dominated by colonial suspension- feeding invertebrates and are heavily impacted with sand. This is consistent with an earlier observation, which described subtidal biota of Humboldt and Del Norte counties as being distinct from that of Mendocino and Sonoma counties (Anomynous, 1981b). Locations in Mendocino and Sonoma counties were dominated by non-sand-impacted rock habitat, which was rich with herbivorous species such as abalone and urchins. PGER was dominated by suspension-feeding invertebrates, which were found on sand-impacted rock. Few herbivorous species were seen within PGER, with most herbivores found toward the top of Gorda Rock where algal cover was significant.

Species of Abalone and sea urchin Management Low numbers of the two primary northern herbivores, red sea urchin S. Concern franciscanus and red abalone H. rufescens, are likely owing to low algal productivity both at the reserve and in the surrounding areas. No red abalone and few red sea urchins were found at PGER. Both species are found to the south at comparable depths in areas with higher relative abundance of macroalgae, e.g. at Point Cabrillo Marine Reserve (PCMR) (Ault and DeMartini 1987) and Bodega Marine Life Reserve (BMLR) (Karpov et al. 2001) (Table 8). Abalone taken at PGER for genetic studies could only be located inshore at depths of less than 3 meters (an area not included as part of the reserve). Shore-picking sportsmen commonly take abalone in this zone during minus tides. Sea urchin were only found near Gorda Rock. While both species rely on macroalgae for food, sea urchin are more omnivorous, resilient and able to survive long periods in areas devoid of algae (Leighton 1968, Karpov et al. 2001, Kato and Schroeter 1985). Clear differences are apparent when comparing PGER algal abundances from our study to PCMR and BBMR (Table 8). Both of the southern reserves have more standing algae that includes surface canopy, which is markedly absent from PGER Abalone abundance was greatest at PCMR relative to BMLR, with both sites supporting high abundances of red sea urchin (Karpov et al. In Press). BMLR may support large sea urchin abundances by relying on drift kelp from adjacent areas. However, no such drift would be available at PGER. Habitats with abundant preferred algae were found to produce sea urchin with larger gonads (Vadas 1977), more

Karpov 54 Part One: Survey of Punta Gorda Ecological Reserve

gametes (Keats et al. 1984), and grow faster than algae-poor habitats. Cryptic habitat such as crevice and moveable boulder were also markedly absent at shallow depths in the Reserve boundary. Such areas are important for both small sea urchin and juvenile abalone (Ault and DeMartini 1987, Leighton 1968). The lack of standing or drift algae and juvenile habitat explains why only isolated pockets of sea urchin were found at Gorda Rock and within the Reserve, and why red abalone were found only inshore, outside of the Reserve. Our results clearly indicate that PGER is not a source area for these species.

California sea cucumber The only invertebrate of management importance found at PGER was the sea cucumber (Figure 39). We found no correlation to high-relief habitat as reported by Zhou and Shirley (1996) from a submersible survey off Alaska. They found the largest concentrations (0.234 m2) on rock wall. The densities observed at PGER were on RockSand1 and Rock (0.035 and 0.031 m2) at depths ranging from 30–40 m were comparable those at comparable depths off Alaska by Zhou and Shirley (1996) with 0.07 m2 and Woodby et al. (2000) with 0.03 m2. Unlike our study, Bradbury et al. (1998) found little difference between deep-water rock and soft-bottom densities in a broad scale study off the San Juan Islands in Washington. The densities at PGER were almost an order of magnitude higher (0.242 m2) on Rock habitat, with high densities even on sand habitat (0.137). Together, these results suggest PGER may not be an important area for this species (Figure 24).

Nearshore reef fishes Nearshore reef fishes were discussed in the Remotely-Operated Vehicle Surveys section of the Discussion. Please see page 45.

PGER—Value PGER is a poor candidate for an Ecological Reserve (Table 26). Foremost as a MPA? among the reserve’s disqualifying characteristics is its poor accessibility for scientific research. Also, while species of finfish of management importance were present, the amount of essential fish habitat was limited due to the sand dominance of this area. Poor access, few invertebrate species of management concern, limited reef habitat, low algal productivity, and difficulty of enforceability all conspire to undermine the value of this as either a potential control study area or a source population for species of management concern. Serious consideration should be given to replacing this with one or more sites that are accessible, with essential habitat of value for species of management importance. A lack of important herbivores such as abalone and sea urchin is not surprising. Our findings show the PGER is a high-energy area, low in standing algal biomass, with an invertebrate community largely adapted to moving

Karpov 55 Part One: Survey of Punta Gorda Ecological Reserve

sand habitat and to feeding on drift algae and plankton. No surface canopy of algae was observed, with minimal evidence of substory algae or drift algae. A comparison to other areas such as PCER, Van Damme State Park, and Bodega Bay Ecological reserve show such algae to be more abundant (Table 8). High turbidity and sand shift preclude algal production in PGER. Another concern is habitat stability. Yearly sand shift may cover and uncover significant portions of available habitat (Antonio 1986). Reef areas were clearly influenced by sand transport, and scouring at the bases of rocks is apparent (Figure 40) as evidence of sand shift. Psamophilic invertebrates such as the aggregated nipple sponge were often found in areas impacted by sand shift (Figure 41). Algal attachments were also occasionally observed buried in sand (Figure 42). This study presented a unique opportunity to study one of the more remote areas of Northern California. During this three-year period, under extreme conditions, our team developed new methods previously unavailable for defining marine habitat and quantifying resident species. Based on the findings in this study, we recommend that the Fish and Game Commission give serious consideration to selecting an alternate site as a ????. While the biota and habitats at PGER have their own intrinsic value, accessible areas exist in Northern California that are better suited as control study areas or source populations for species of management concern.

Karpov 56 PartPart TwoTwo Abalone DNA Studies1

Abstract s underscored by recent State legislation, there is a great need for AA marine resource information to aid managers in making sound marine management decisions. We undertook a quantitative inventory of Punta Gorda Ecological Reserve (PGER), the northernmost marine protected area in California, to provide some of this previously unknown information. The recently established reserve comprises about half of the Northern Califor- nia marine reserve area. Although the area has historically supported harvest of finfish and invertebrates, the resource value of PGER has never been quantified and is largely unknown. This project is the first to successfully identify DNA markers in red abalone. We found that there were unique markers that distinguished northern populations (north of Point Conception) from southern populations (south of Point Conception). We suggest the best type of tissue for abalone DNA studies (gonad), and outline a new, nonlethal method for taking gonad samples. We initiated a genomic library of abalone tissue from PGER (and other northern coastal sites), assisting in completion of a statewide library. Ultimately, DNA fingerprinting technology may allow us to distinguish between abalone populations, monitor the success or failure of abalone restocking and conservation efforts, and provide forensic markers for law enforcement of protected stocks.

Introduction The red abalone, H. rufescens, ranges from Sunset Bay, Oregon to Bahia Tortugas, Baja California. North of Point Conception, it is found in the intertidal zone and subtidally to depths of 20 m (60 feet). Recent declines in abalone stocks have led to the closure of the fishery in central and Southern California at a time when some areas were near extirpation (Edwards 1913, Karpov et al. 2001, Tegner et al. 1996). This has led to a heightened interest in discovering the genetic differences between abalone stocks on a spatial scale. Identifying source populations is essential if populations are considered

1This work is also presented in Kirby et al. 1998.

Karpov 57 Part Two: Abalone DNA Studies

for refuge status. In addition genetic differences, if significant between areas, could be used forensically to identify animals taken illegally from closed areas. Red abalone management in southern and Central California, where stock protection was based on size limit alone, failed (Haaker 1996, Karpov et al. 2001, Tegner et al. 1992). White abalone H. sorenseni, once harvested commercially, has declined to the point of possible extinction (Davis et al. 1996, Tegner et al. 1996). Only three living abalone were found after survey- ing 30,600 m2 of suitable habitat at 15 locations (Haaker 1996). The closure of the red abalone fishery in Southern California increases the possibility of poaching from the north coast, and underscores the need for potential source populations for restocking efforts. As the red abalone fishery continues to decline in central and Southern California, the Northern California populations will become increasingly important. Subtidal emergent surveys and invasive surveys must be conducted to assess stock size and habitat suitability for source populations of red abalone (Tegner et al. 1989). For an area to qualify as a source population of red abalone it must include “nursery” areas for juveniles and suitable habitat for adults (Ault and DeMartini 1987). In addition, sufficient aggregations of adults of both sexes are required for localized spawning to occur. Rocky subtidal areas, covered with crustose red algae, are considered to be juvenile red abalone “nurseries” (Morse et al. 1979). These are areas where post-larvae settle and remain at sizes of less than 4 cm (Hines and Pearse 1982). Juveniles, at less than 15 cm move to cryptic habitat below boulders and in crevices. Adult abalone habitat ideally includes “emergent”, identified as both crevice (Tegner 1989) and/or exposed areas where drift algae can aggregate (Ault and DeMartini 1987, Tegner et al. 1992). Currently, the California Department of Fish and Game (CDFG) cannot determine whether a fished abalone originated from commercially fished areas outside of California or was poached from inside the state. The work of Dr. Vicky Kirby in identifying DNA markers in red abalone will provide a precise forensics tool that can be used to identify poached abalone. These abalone DNA markers, called microsatellites, are small tandem repeats of DNA that are employed as genetic markers in forensic and populations studies in a variety of organisms (Gertsch, et al., 1995; Hughes and Queller, 1993; Nielsen, et al., 1994; O’Reilly and Wright 1995). The acceptance of DNA fingerprints is due primarily to their comparative ease of assay and accuracy. Research priorities: As California stocks of abalone and other invertebrates decline due to disease and overfishing, alternate management strategies such as refugia need to be examined. MPAs may protect and prevent the extinction of species such as the white abalone, Haliotis sorenseni (Tegner et al 1996). In addition to providing metapopulations, studies on such refuges could provide testbeds for new management approaches to stock assessment for nonmotile invertebrates where models such as egg-per-recruit have failed (Davis 1989, Tegner et al. 1989).

Karpov 58 Part Two: Abalone DNA Studies

The purpose of our abalone DNA study at PGER was primarily to determine the value of this MPA to abalone management efforts by evaluating if red abalone populations at PGER were distinct from other areas of the state and if genetic markers could be discovered for future research and forensic application. An additional goal was to establish whether there were specific, genetic differences between PGER abalone and abalones coastwide. A statewide DNA-based analysis that includes PGER may discriminate unique differences in populations that could help identify if PGER abalone are locally recruited or from other “source” areas (Pulliam 1988). In addition to evaluating the reserve and providing a basis for future comparisons, we also sought to improve on DNA analysis methods as the first step to future, habitat-based stock assessment. Finally, an overriding goal of our project was to evaluate for our Fish and Game Commission if PGER actually met the criteria outlined in the initial EIR as a quality MPA with protective value, research potential, and enforceability (Table 1).

Methods Twelve adult red abalone H. rufescens were collected from PGER (Konstantin Karpov Pers. Comm.) for genomic DNA library construction. Tissues Collecting and collected from the adult abalone were stored at −70°C and consisted of foot Archiving muscle, hypobranchial-gill glands, digestive gland and ovary. Testes from Tissues males could not be used due to poor condition of the gonad, e.g. under- developed or out of season. Tissue samples for microsatellite analysis were collected in the field from adult abalone collected by CDFG wardens or sports fishermen. A CDFG warden or a researcher interviewed the fisherman, measured the abalone, collected a tissue sample and where possible, sexed the abalone. Collected tissues consisted of a small sliver (1 cm square or less) of mantle, foot muscle, and/or gonad biopsy (described below). These samples were kept on ice or dry ice in the field and stored at –20°C within 4 to12 hours of collection. In addition to the Punta Gorda abalone samples, mantle tissues were also collected from another 400 abalone from a total of nine coastal or island sites and two abalone aquaculture facilities. These sites were divided into Northern and Southern California regions for population analysis. For microsatellite DNA analysis, a 1–5 mg aliquot of the tissue (mantle, foot, or gonad biopsy) was collected from the frozen field sample and immersed in test tubes containing 200 mL of 5% Chelex-100 (BioRad) in distilled water (wt./vol.). After 20 min. incubation at 65°C, the samples were vortexed for 3 seconds and then incubated for 10 minutes at 95°C. After this second incubation, samples were vortexed for 10 seconds and then centrifuged for 3 minutes at 10,000 g. These chelexed samples were stored at −20°C for later DNA polymerase chain reaction analysis (PCR).

Karpov59 Part Two: Abalone DNA Studies

Sample collection methods Nonlethal gonad biopsies were conducted to confirm sex of individuals and to collect gonad tissue. Gonad tissue was aspirated into a 1 cc syringe with a 25-gauge needle held at an approximately 15–30° angle, depending upon the size of the gonad. By passing the needle just under the surface of the clear connective tissue covering the gonad, samplers watched and controlled the needle’s path to make sure that it was parallel to the gonad. Slight back- pressure was exerted on the syringe plunger to collect tissue into the needle. We also initiated a study to determine the optimal type, storage condition, and quality of tissue that could be used for abalone DNA analysis. Tissues from the Punta Gorda adult abalone were collected from the foot muscle, mantle, epipodium, tentacles, and gonads. We treated mantle tissue in a variety of ways to simulate various field conditions, including (1) immediately freezing; (2) on ice for 24 hours, and then freezing; (3) air drying, and (4) storing in 80% ethanol. Previous research has shown that non-lethal tissue biopsies as small as 1–5 mg. (a very small tentacle or sliver of tissue) provide ample amounts of DNA for individual typing.

Constructing genomic libraries Size-selected genomic DNA libraries were constructed for Punta Gorda Reserve red abalone H. rufescens collected from sport fishermen’s take inshore of the reserve boundary in the intertidal zone. One library was used to optimize and validate the following procedure: tissues from foot, hypo-branchial- gill glands, digestive gland, and ovary were homogenized in liquid nitrogen with a mortar and pestle, digested with proteinase K at 65° for 2 hours, and phenolchloroform extracted (Ausubel et al. 1995). DNA was ethanol-precipi- tated, and its purity was spectrophotometrically measured. Ovary was found to have the highest yield and cleanest DNA. All other sample types had high levels of RNA and mucopolysacchirides that either contaminated the DNA sample or resulted in very low yield after further extraction. DNA was then extracted from the gonads of two adults and stored at −70°C. The remaining adult abalone from Punta Gorda were dissected and their tissues (foot, hypobranchial-gill glands, digestive gland, gonad) were stored at −70°C for extraction as needed Screening genomic libraries for microsatellite DNA: The genomic DNA from the Punta Gorda red abalone was digested with Sau3A restriction enzyme and separated on an agarose gel. The 200–700 bp bands were identified via ultraviolet light, then excised and purified by Centricon spin columns. Bands of this size were selected to allow for efficient sequencing of the cloned DNA library fragments that would be used for microsatellite sequencing.

Cloning and hybridization The resulting size-selected genomic DNA was ligated to KS- pUC18 vector (Stratagene) at various DNA:vector ratios to optimize ligation effi- ciency. The abalone DNA constructs were inserted into competent Bluescript

Karpov 60 Part Two: Abalone DNA Studies

Escherichia coli bacteria via heat shock (Sambrook et al. 1989). After incubation at 37°C overnight, colonies were lifted onto nylon membranes for hybridization. Hybridization temperatures were calculated on the basis of the GC content of the probe; various temperatures were tested to optimize the hybridization. Dinucleotide and trinucleotide repeats (Gibco-BRL) were end-labeled with P32 and used to probe the UV cross-linked nylon membranes (Sambrook et al., 1989). Putative positives were replated on a master plate and reprobed to confirm hybridization. Positive clones were cultured in 5 mL of DYT media, and plasmid DNA was recovered by alkaline mini-prep analysis.

Identification of microsatellites A total of 206 positive clones were isolated and archived for DNA sequencing to search for the presence of microsatellites as well as to identify primer sequences that could be used to design species specific PCR primers. Of these, 18 DNA library clones were sequenced with the Sequenase 2.0 kit (US Biochemical) using S35-dATP. Sequences were read directly off the autoradio- graphs. Those microsatellite sequences having sufficient flanking DNA at both the 5´ and 3´ ends were chosen for primer design. Although a total of seven primer pairs were tested for PCR product, only Hruf200 produced non- ambiguous microsatellite alleles that could be consistently scored. Ambiguous microsatellite alleles include bands too faint to clearly identify as non-artifact and shadow bands where two bands 1bp apart give equally strong signals. Microsatellite primers were tested for band amplification with hot start PCR as described by Nielsen et al. (1994). One microliter of chelexed sample was added to a PCR mixture of 1.25 µL of 10x PCR buffer, 1.25 µL of 10 mM each dNTP, 1.25 µL of 10 mM primer A, 0.63 µl of primer B, 0.63 µL of primer B end-labeled with γ-32P-ATP, 0.06 µL of Taq polymerase µ (Promega), and 3.5 L of ddH2O. Primer sequences for the Hruf200 locus were (from the 5´ to the 3´):

Hruf200A: GAGATAGTTCGATTCAAGAT Hruf200B: CCATTATAAAGGGCCGGACTA

After denaturing for 5 min. at 94°C, the samples were cycled for 30 cycles, for 40 sec at 94°C, 60 sec at 48–54°C, and for 120 sec at 72°C. Initial PCR cycles used touchdown cycling to identify the appropriate annealing temperatures. After PCR amplification, the samples were mixed with loading dye then denatured at 95°C for 5 min. The samples were then electrophore- sed on standard 8% acrylamide:7.2 M urea denaturing gels (40 x 30 cm), mounted on Whatman paper, dried and autoradiographed (Kodak XAR-5) for 24–72 hr at room temperature. Hruf 200 alleles were scored using an M13-labeled sequence ladder (Sequenase V 2.0; US Biochemical) as a size standard (Yanisch-Perron et al. 1985). Only unambiguous microsatellite bands were scored for this report. If the bands were too faint to positively

Karpov 61 Part Two: Abalone DNA Studies

identify a microsatellite as homozygous or heterozygous, that sample was not scored and the sample was tagged for reanalysis. For shadow bands, the darkest band was scored as the allele. If bands were of equal darkness, they were not scored for that sample.

Statistical analysis Frequency distributions of allele sizes for Hruf200 were analyzed. Het- erozygosities and genotype frequencies were obtained for all samples from Northern California (including Punta Gorda) with an unbiased estimate of the Fisher’s exact test (GENEPOP; Raymond and Rousset 1994). Combined and regional groups were tested for Hardy-Weinberg equilibrium with the c2 test.

Results This is the first project to successfully identify microsatellites and microsatellite locus in red abalone H. rufescens. The microsatellite marker Hruf200 was Abalone identified and characterized, and tissue samples for this locus were analyzed. Microsatellites A total of 26 different microsatellites from 31 clones were identified with both T3 and T7 promoter primers. Perfect, imperfect and compound repeat

core sequences were observed. (GT/TG)n microsatellite repeats together with

the (AC/CA)n repeats represented 83% of the abalone microsatellites. Dinucle- otides were the most common type of microsatellite (75% of the total). An initial population analysis used 170 samples randomly selected from Northern and Southern California, including all of the Punta Gorda abalone. Of these samples, 74 amplified a microsatellite band that could be unambiguously scored for basepair size. This data set was analyzed for frequency distributions of allele sizes for Hruf 200. Heterozygosities and genotype frequencies were obtained for samples as a group and separately for Northern and South- ern California using an unbiased estimate of the Fisher’s exact test (GENEPOP). Combined and regional groups were tested for Hardy-Weinburg equilibrium. There was a relatively high level of variability at Hruf200. The genotype frequencies for all regions combined conformed to Hardy-Weinburg, as do those for Southern California abalone. However, the Northern California data did not conform, which indicated that further samples were needed for statistical analysis. Thus, we decided to expand our analysis of tissue samples. We have since expanded our database by amplifying Hruf 200 microsatellite locus for 432 alleles. Fifty-four alleles were amplified for each geo- graphical region including Punta Gorda, Shelter Cove, and Hardy Cove-Van Damme for Northern California for a total of 216 alleles. Southern California regions included Santa Barbara and abalone created from Channel Island Abalone (aquaculture facility) for a total of 216 alleles. With this increase in sample size, there were changes in the distribution of Hruf 200 alleles. For the samples that could be sized unambiguously, it was determined that there were

Karpov 62 Part Two: Abalone DNA Studies

26 alleles at the Hruf 200 locus which ranged in size from 95 to 153 base pairs. A frequency distribution analysis indicated that the most common alleles were 99–103 bp for both geographic groups, with secondary clusters around 115–127 bp and 135–145 bp. The northern populations had a consistently greater proportion of alleles: 135–145 bp (13% vs. 5%). Punta Gorda’s abalone (n = 12) were not distinguishable from other Northern California abalone populations but they did contain alleles that were unique to these northern populations. Northern California red abalone had unique alleles of 107,123, 127,129, 133, and 149 bp. In contrast, South- ern California abalone had only one unique allele of 153 bp (n = 1). With such a wide spread in allele size, additional samples from California abalone should be analyzed to determine if differences between alleles 120’s and 140’s can be used to identify population differences.

Sample To determine if there may be any gender-influenced differences, to confirm Collection sex of individuals, and to collect gonad tissue, we tested our gonad biopsy Methods protocol that we had developed. If care is taken to avoid puncturing the digestive gland, the biopsy is nonlethal and can be done several times on the same abalone. Of the 205 live abalone biopsies performed at our laboratory, only one animal has died. It was one of the very first abalone used to test our biopsy protocol. These biopsies were examined both by color and/or by examination under the microscope for detection of egg (green) or sperm (white fluid). In almost all biopsies, abalone gender was correctly determined just by looking at the color of the sample in the collection buffer. The gonad biopsy is more reliable for determining the sex of animals than the standard visual examination. We noted that in the field, most individuals (n = 16) that were very difficult to sex or appeared to be unripe female (by visual examination) were actually immature males on the basis of biopsy. At the same time of the year, CDFG field researchers had observed that there seemed to be mostly females in the field at one of the Channel Islands. Because some abalone have a fair amount of dark pigment in the connective tissue covering the gonad, a male with poor gonad development could be visually mistaken for a female. Also, in the case of a male with a completely refractive gonad, the hepatopancreatic organ (digestive gland) shows through the connective tissue, giving a dark appearance. It may be that in some areas, the males are not developing gonads at the same time as the females. This has been observed in abalone aquaculture with abalone 5 inches or less in size. Animals of the same age did not have sexually mature gonads during the same season. There have been seasons where the captive females were ripe but the males lagged by two months, and vice-versa. There have also been times where no reproductive males could be identified from a collection of tens of thousands of males.

Karpov 63 Part Two: Abalone DNA Studies

We also initiated a study to determine the optimal type, condition and quality of tissue that could be used for abalone DNA analysis. Tissues from Punta Gorda adult abalone were collected from the foot muscle, mantle, epipodium, tentacles, and gonad. We treated mantle tissue in a variety of ways to simulate various field conditions, including (1) immediately freezing; (2) keeping on ice for 24 hours, and then freezing; (3) air drying; (4) storing in 80% ethanol. Mantle, epipodium, foot muscle and gonad tissue kept under these conditions all amplified the Hruf 200 microsatellite. Although this analysis was only done on 4 tissues from one abalone, it suggests that any of these tissues collected in the above manner may be used for Hruf 200 microsatellite analysis. However, this may not be true for other microsatellite loci, and will have to be evaluated for each new microsatellite locus identified.

Discussion In addition to the identification of microsatellite markers in abalone, our project objectives included the evaluation of their potential use for population analysis in red abalone H. rufescens. Punta Gorda abalone were used to construct the first abalone DNA libraries, from which we have shown that DNA microsatellites exist in red abalone. Further, we have identified the first DNA microsatellite marker, designated as Hruf200. GT/CA repeats, such as Hruf200, represented 83% of the microsatellites observed. This is consistent with the literature, where GT/CA repeats predominate in other classes of marine organisms including fish and shrimp. Microsatellites have not been reported for shellfish. Hruf200 was polymorphic, with 21 alleles detected in 74 abalone. Almost all of the original 170 samples amplified microsatellite alleles with Hruf200, but they could not be unambiguously scored. Prelimi- nary re-analysis of some of these samples suggests that too much DNA was used in the PCR; many of these samples were the first samples that we chelexed. We later determined that a much smaller quantity of DNA was adequate for chelex extraction. Several alleles were observed to occur only in the Northern California populations or only in the Southern California populations. These alleles were generally rare and may or may not prove to be unique to the respective populations. However, there are over 400 more samples in our DNA archive to be analyzed with Hruf200 to determine if allelic variation at this locus can be used as a population marker for Punta Gorda or Northern California abalone. When we initiated this project, there was no literature available on tech- nique for abalone microsatellite analysis. Since this was also the first attempt to develop species-specific microsatellite primers for red abalone, we con- cluded that our first investigations should include building genomic libraries for microsatellite screening, determining the type of tissues and their necessary condition for microsatellite analysis, and then initiating screening of genomic libraries. Punta Gorda abalone were used to construct the first genomic library, which was then used to identify the existence of micro-

Karpov 64 Part Two: Abalone DNA Studies

satellites in abalone. Although only one library is necessary for screening, we have taken the long-term approach by building libraries for different geo- graphical regions of California to eventually screen for site-specific loci. We also determined that mantle, epipodium, foot muscle or gonad biopsy can be used for Hruf 200 microsatellite analysis. These tissues can be either fresh, frozen, alcohol preserved or dried. As we continue to sequence microsatellite clones, we expect to find more polymorphic loci or markers for the analysis of population structure in red abalone. Microsatellite markers have been successfully used as fish population markers, and it is generally accepted that 10 microsatellite loci are needed to statistically distinguish populations. These markers continue to be used by the CDFG to identify the rivers and hatcheries that individual trout originate from in California. Ultimately we feel that DNA fingerprinting technology that utilizes the analysis of microsatellites will provide information to address questions related to: (1) distin- guishing between abalone populations, (2) monitoring the success or failure of abalone restocking and conservation efforts, and (3) providing forensic markers for law enforcement of protected stocks.

Karpov 65 FiguresFiguresFigures

Karpov 66 Figure 1. Coastline of Northern California from the Farallon Islands to the Oregon border. Locations of PGER and other locations mentioned in the text are identified.

Del Norte County 125 W 122 W

Redwood National Park ASBS

Kelp Beds at Trinidad Bay ASBS

Eureka Northern California

Humboldt Blunts Reef Buoy County NAD-1927 Datum, Albers Equal Area Projection 0 25 50 75 100 km Punta Gorda Ecological Reserve Punta Gorda Gorda Rock Buoy

Delgada Submarine Canyon

40 N Shelter Cove Buoy

Mendocino County

Fort Bragg Pigmy Forest Ecological Staircase ASBS Point Cabrillo Ecological Reserve Point Cabrillo Van Damme State Park

Saunders Reef ASBS

Sonoma County

Gerstle Cove ASBS

Bodega Marine Life Refuge

Marin County 38 N

Southeast Farallon Island

Karpov 67 Figure 2. Boundary of PGER with east and west boundary determined from the 6 and 60 m contour interpreted from bathymetry mapping of this study.

124 23' 45" W 124 21' 23" W

40 16' 13" N

6m contour Punta Gorda

60m contour

Gorda Rock

40 14' 28" N

0 300 600 900 1200 Meters PGER Boundary Albers Equal Area Projection Shoreline NAD 1927 Datum

Karpov 68 Figure 3. Prevailing northwest winds and northeast current at PGER superimposed over reserve boundary.

Prevail Winds ing

Punta Offshore Transport Gorda

Prevailing Current

Gorda Rock Reserve Boundary

Karpov 69 Figure 4. Remote operated vehicle (ROV) components.

Umbilical

Horizontal Thrusters

Vertical Thruster

Sonar

Cameras

Karpov 70 Figure 5. System schematic for ROV data integration.

Sea-Surface Punta Gorda ROV Study Buoy Video/GPS/Data Integration GPS DGPS GPS Time (UTC) + Antenna Ant. Trimble Buoy /ROV Position Shipboard (Post-Differential) GeoExplorer II GPS Time GPS (UTC) Trimble Real-Time Video Horita GeoExplorerII Differential (DGPS) GPS 3 Ship Postion Buoy (LAT/LON) GPS attachment point at x 2 ROV Pilot Trimble bottom Video + VideoEvent Log + depth Video Time Code Time Code (UTC) + ProBeacon (UTC) + Position + DGPS Monitor Position + ROV Data ROV Data

ROV Data (under development) Voice/Audio VCR 1 Video Super-VHS ROV Recorder Laptop ROV Observer Pisces Computer Umbilicus ROV Data Display Microphone Generator VCR 2 Super-VHS ROV Recorder Mission Products: Video - Video Image/Narrative Monitor - Event Log File

DOE Phantom HD-2 - ROV Track Map Frame ROV Video Sub-sea - ROV Sensor Data Grabber Camera

Version 1.0 19981014pv

Karpov 71 Figure 6. ROV segment lengths, si, as determined by each continuous substrate type. As substrate type changes, a new substrate type is determined. UTC time code, depth and heading are displayed on taped image.

"Boulder"

Length of Substrate Segment Segment S1

PathPath ofof ROVROV Segment S2 "Boulder"

Segment S3

Strip Transect Segmentation by Substrate

Karpov 72 Figure 7. System schematic of data entry workstation for post-processing of digital videotape.

Data Entry Work Station

Computer Monitor, data base entry form Video “X-keys” keypad Sony Video Monitor

Sony DSR-20 digital VCR

Audio SMPTE Longitudinal Time Code Horita time-code wedge

Time ASCII characters

Personal Computer

Karpov 73 Figure 8. Average daily wave height (meters) for 1997 thru 1999 at NOAA buoy number 46030, Blunts Reef, 13 km north of Punta Gorda.

Blunt's Reef Buoy Data 1997-1999 6

2 Missing Missing Data Data

Mean Daily Wave Height (meters) (meters) Height Wave Daily Mean 1

0 1997 1998 1999 2000

Karpov 74 Figure 9. Bathymetry in meters (tidally corrected to MLLW) as generated by Surfer software package (Golden Software, Inc., Golden CO) from depth soundings recorded at PGER August 23–25, 1997.

124 23' 45" W 124 21' 23" W

40 16' 13" N

Punta Gorda

Gorda Rock

40 14' 28" N

N Bathymetry 10m 20m 30m 40m 50m 2 m bathymetry contours 0 300 600 900 1200 Meters PGER Boundary

Albers Equal Area Projection Shoreline NAD 1927 Datum

Karpov 75 Figure 10. RoxAnn seabed classification values superimposed over polygons of like substrate as determined with “bye-eye” clustering RoxAnn class identification values at Punta Gorda Ecological Reserve.

Karpov 76 Figure 11. Mosaic of analog sidescan sonar images from PGER with reserve boundary superimposed.

Karpov 77 Figure 12. Digitized mosaic of analog sidescan sonar images from PGER with reserve boundary superimposed.

Karpov

Karpov 78 Figure 13. Substrate classification using the “bye-eye” method of combining RoxAnn seabed classification polygons with sidescan sonar image at PGER.

g 124 23' 45" W 124 21' 23" W

40 16' 13" N

Punta Gorda

Gorda Rock

40 14' 28" N

PGER Boundary Substrate Classification boulder boulder field coarse matrix N coarse sediment fine matrix fine sediment rock outcrop sediment ripples unknown reef

0 300 600 900 1200 Meters Shoreline

Albers Equal Area Projection NAD 1927 Datum

Karpov 79 Figure 14. Histogram comparison of ROV observed primary substrates determined from 33,605 dGPS positions to interpretation of sidescan sonar mosaic image based on “by eye”classification. Pie charts represent the percentage of ROV modified primary substrate type to each sidescan sonar interpreted substrate classification.

Number of Positions 0 5000 10000 15000 20000

Boulder Field Coarse Matrix Coarse Sediment Fine Matrix Fine Sediment Rock Outcrop Sediment Ripples

Rock Boulder RockSand 1 RockSand 2 RockSand 3 Sand

Boulder Field Coarse Matrix Coarse Sediment

0% 19% 7% 0%5% 2% 0% 12% 46%

30% 81% 98%

Fine Sediment Fine Matrix Rock Outcrop

14% 0% 15% 19% 3% 28% 0% 42% 8% 16%

8% 4%

81% 25% 19% 18%

Sediment Ripples

0% 23% 12% 16%

10%

39%

Rock Boulder RockSand 1 RockSand 2 RockSand 3 Sand

Karpov 80