DOCSLIB.ORG

Funktionsaufklärung Von CYR61 Und CTGF in Mesenchymalen Stammzellen Und Lungenendothelzellen

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Funktionsaufklärung Von CYR61 Und CTGF in Mesenchymalen Stammzellen Und Lungenendothelzellen Funktionsaufklärung von CYR61 und CTGF in mesenchymalen Stammzellen und Lungenendothelzellen DISSERTATION zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Roderich Laug aus Halle/S. Würzburg, 2014 Eingereicht bei der Fakultät für Chemie und Pharmazie am Gutachter der schriftlichen Arbeit 1. Gutachter: 2. Gutachter: Prüfer des öffentlichen Promotionskolloquiums 1. Prüfer: 2. Prüfer: 3. Prüfer: Datum des öffentlichen Promotionskolloquiums Doktorurkunde ausgehändigt am 1. Zusammenfassung .......................................................................................................................................... 1 1.1. Summary ................................................................................................................................................. 2 2. Einleitung ....................................................................................................................................................... 4 2.1. CCN-Familie ........................................................................................................................................... 4 2.1.1. Entdeckung ....................................................................................................................................... 4 2.1.2. Struktureller Aufbau ......................................................................................................................... 5 2.1.3. Funktionen der Proteine ................................................................................................................... 6 2.2. CYR61 und CTGF: Mitglieder der CCN-Familie im Fokus ................................................................... 8 2.2.1. CYR61-cysteine rich protein 61 ....................................................................................................... 8 2.2.1.1. CYR61 und die Angiogenese .................................................................................................... 9 2.2.1.2. CYR61 und die Lunge ............................................................................................................. 10 2.2.1.3. CYR61 und das muskuloskelettale System ............................................................................. 10 2.2.2. CTGF-connective tissue growth factor .......................................................................................... 11 2.2.2.1. CTGF und die Lunge ............................................................................................................... 11 2.2.2.2. CTGF und das muskuloskelettale System ............................................................................... 12 2.3. Zellsysteme ............................................................................................................................................ 13 2.3.1. hMSC und das muskuloskelettale System ...................................................................................... 13 2.3.2. HPMEC-ST1.6R Lungenendothelzellen ........................................................................................ 14 2.4. Ziele dieser Arbeit ................................................................................................................................. 15 3. Material und Methoden ................................................................................................................................ 18 3.1. Material ................................................................................................................................................. 18 3.1.1. Verbrauchsmaterial ........................................................................................................................ 18 3.1.2. Geräte ............................................................................................................................................. 19 3.1.3. Chemikalien und Reagenzien ......................................................................................................... 20 3.1.4. Zellkultur ........................................................................................................................................ 22 3.1.5. Bakterienzellen ............................................................................................................................... 22 3.1.6. Antikörper ...................................................................................................................................... 23 3.1.7. cDNA Klon..................................................................................................................................... 23 3.1.8. rekombinante Proteine .................................................................................................................... 23 3.1.9. Lentivirales System ........................................................................................................................ 24 3.1.10. Kits ............................................................................................................................................... 25 3.1.11. Enzyme ......................................................................................................................................... 25 3.1.12. Primer ........................................................................................................................................... 27 3.1.13. Puffer und sonstige Lösungen ...................................................................................................... 30 3.1.14. Software und online Quellen ........................................................................................................ 35 3.2. Methoden ............................................................................................................................................... 36 3.2.1. Zellkultur ........................................................................................................................................ 36 3.2.1.1. Kultivierung von HPMEC-ST1.6R-Zellen .............................................................................. 36 3.2.1.2. Isolierung und Kultivierung von hMSC .................................................................................. 36 3.2.1.3. Kultivierung von HEK293T-Zellen ........................................................................................ 37 3.2.1.4. Kultivierung von EAhy926-Zellen .......................................................................................... 37 3.2.1.5. Kultivierung von SF21-Insektenzellen .................................................................................... 37 3.2.2. Zellbiologische Methoden .............................................................................................................. 38 3.2.2.1. Herunterregulation der Expression von ctgf und cyr61 ........................................................... 38 3.2.2.2. Behandlung mit rekombinanten Proteinen .............................................................................. 39 3.2.2.3. Kryokonservierung eukaryontischer Zellen ............................................................................ 39 3.2.2.4. Zellzahlbestimmung ................................................................................................................ 40 3.2.3. Molekularbiologische Methoden .................................................................................................... 41 3.2.3.1. Reverse Transkriptase Polymerase Kettenreaktion (RT-PCR)................................................ 41 3.2.3.2. RNA-Isolierung aus Zellen...................................................................................................... 41 3.2.3.3. Restriktionsverdau ................................................................................................................... 42 3.2.3.4. Präparationen von Plasmid-DNA ............................................................................................ 42 3.2.3.5. Agarose-Gelelektrophorese ..................................................................................................... 43 3.2.3.6. DNA-Sequenzierung ............................................................................................................... 43 3.2.3.7. Transformation in prokaryontische Zellen .............................................................................. 44 3.2.3.8. Microarray-Analyse ................................................................................................................. 45 3.2.4. Proteinanalytik ................................................................................................................................ 46 3.2.4.1. Proteinisolierung aus Zellen .................................................................................................... 46 3.2.4.2. Proteinbestimmung nach Bradford .......................................................................................... 46 3.2.4.3. SDS-PAGE .............................................................................................................................. 47 3.2.4.4. Westernblot ............................................................................................................................. 48 3.2.4.5. Silbergelfärbung ...................................................................................................................... 49 3.2.5. Klonierung des offenen Leserahmens von CTGF .........................................................................
Load more

Recommended publications
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0127257 A1 Schiemann Et Al
    US 2014O127257A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0127257 A1 Schiemann et al. (43) Pub. Date: May 8, 2014 (54) DERMATOLOGICALLY EFFECTIVE YEAST Publication Classification EXTRACT (51) Int. Cl. (75) Inventors: Yvonne Schiemann, Essen (DE); Mike A61E36/064 (2006.01) Farwick, Essen (DE); Thomas Haas, CI2P I/02 (2006.01) Muenster (DE); Mirja Wessel, Bochum A61E36/06 (2006.01) (DE) (52) U.S. Cl. CPC ............... A61K 36/064 (2013.01); A61K 36/06 (73) Assignee: EVONIK DEGUSSA GMBH, Essen (2013.01); CI2P I/02 (2013.01) (DE) USPC ...................................... 424/195.16; 435/171 (21) Appl. No.: 14/128,244 (22) PCT Fled: Jun. 14, 2012 (57) ABSTRACT (86) PCT NO.: PCT/EP2012/061263 The invention relates to a method for producing a dermato S371 (c)(1), logically active yeast extract, comprising the following steps: (2), (4) Date: Dec. 20, 2013 providing a preculture of the yeast cells, culturing the cells for (30) Foreign Application Priority Data at least fifteen minutes at a pH of 1.8-4, harvesting the cells and lysing the cells, and a yeast extract produced thereby and Jun. 29, 2011 (EP) .................................. 11171953.0 products comprising said yeast extract. Patent Application Publication May 8, 2014 Sheet 1 of 3 US 2014/O127257 A1 -0-Yarrowia------------ lipolytica -- Pichia CBS 1991 - A - Saccharomyces Cerevisiae Fig. 1 US 2014/O127257 A1 May 8, 2014 DERMATOLOGICALLY EFFECTIVE YEAST skin. Against the background of consumers’ uncertainty with EXTRACT respect to genetic engineering techniques, there is a particular demand for corresponding agents that can be regarded, 0001.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Meta-Analysis of Genome-Wide Association Studies for Personality
    Molecular Psychiatry (2012) 17, 337–349 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp ORIGINAL ARTICLE Meta-analysis of genome-wide association studies for personality MHM de Moor1, PT Costa2, A Terracciano2, RF Krueger3, EJC de Geus1, T Toshiko2, BWJH Penninx4,5,6, T Esko7,8,9, PAF Madden10, J Derringer3, N Amin11, G Willemsen1, J-J Hottenga1, MA Distel1, M Uda12, S Sanna12, P Spinhoven5, CA Hartman4, P Sullivan13, A Realo14, J Allik14, AC Heath10, ML Pergadia10, A Agrawal10, P Lin10, R Grucza10, T Nutile15, M Ciullo15, D Rujescu16, I Giegling16, B Konte16, E Widen17, DL Cousminer17, JG Eriksson18,19,20,21,22, A Palotie17,23,24,25, L Peltonen17,23,24,25,{, M Luciano26, A Tenesa27, G Davies26, LM Lopez26, NK Hansell28, SE Medland28, L Ferrucci2, D Schlessinger2, GW Montgomery28, MJ Wright28, YS Aulchenko11, ACJW Janssens11, BA Oostra29, A Metspalu7,8,9, GR Abecasis30, IJ Deary26,KRa¨ikko¨nen31, LJ Bierut10, NG Martin28, CM van Duijn11,32 and DI Boomsma1,32 1Department of Biological Psychology, VU University Amsterdam, Amsterdam, The Netherlands; 2National Institute on Aging, NIH, Baltimore, MD, USA; 3Department of Psychology, University of Minnesota, Minneapolis, MN, USA; 4Department of Psychiatry, University Medical Center Groningen, Groningen, The Netherlands; 5Departments of Clinical Psychology and Psychiatry, Leiden University, Leiden, The Netherlands; 6Department of Psychiatry, EMGO þ Institute, Neuroscience Campus Amsterdam, VU University Medical Center Amsterdam, Amsterdam, The Netherlands;
    [Show full text]
  • Cell Adhesion Molecules in Normal Skin and Melanoma
    biomolecules Review Cell Adhesion Molecules in Normal Skin and Melanoma Cian D’Arcy and Christina Kiel * Systems Biology Ireland & UCD Charles Institute of Dermatology, School of Medicine, University College Dublin, D04 V1W8 Dublin, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +353-1-716-6344 Abstract: Cell adhesion molecules (CAMs) of the cadherin, integrin, immunoglobulin, and selectin protein families are indispensable for the formation and maintenance of multicellular tissues, espe- cially epithelia. In the epidermis, they are involved in cell–cell contacts and in cellular interactions with the extracellular matrix (ECM), thereby contributing to the structural integrity and barrier for- mation of the skin. Bulk and single cell RNA sequencing data show that >170 CAMs are expressed in the healthy human skin, with high expression levels in melanocytes, keratinocytes, endothelial, and smooth muscle cells. Alterations in expression levels of CAMs are involved in melanoma propagation, interaction with the microenvironment, and metastasis. Recent mechanistic analyses together with protein and gene expression data provide a better picture of the role of CAMs in the context of skin physiology and melanoma. Here, we review progress in the field and discuss molecular mechanisms in light of gene expression profiles, including recent single cell RNA expression information. We highlight key adhesion molecules in melanoma, which can guide the identification of pathways and Citation: D’Arcy, C.; Kiel, C. Cell strategies for novel anti-melanoma therapies. Adhesion Molecules in Normal Skin and Melanoma. Biomolecules 2021, 11, Keywords: cadherins; GTEx consortium; Human Protein Atlas; integrins; melanocytes; single cell 1213. https://doi.org/10.3390/ RNA sequencing; selectins; tumour microenvironment biom11081213 Academic Editor: Sang-Han Lee 1.
    [Show full text]
  • Découverte De Nouveaux Transcrits De Fusion Dans Des Tumeurs
    Découverte de nouveaux transcrits de fusion dans des tumeurs pédiatriques en rechute et caractérisation fonctionnelle d’un nouvel oncogène LMO3-BORCS5 Celia Dupain Jourda To cite this version: Celia Dupain Jourda. Découverte de nouveaux transcrits de fusion dans des tumeurs pédiatriques en rechute et caractérisation fonctionnelle d’un nouvel oncogène LMO3-BORCS5. Cancer. Université Paris Saclay (COmUE), 2018. Français. NNT : 2018SACLS310. tel-02426230 HAL Id: tel-02426230 https://tel.archives-ouvertes.fr/tel-02426230 Submitted on 2 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Découverte de nouveaux transcrits de fusion dans des tumeurs pédiatriques en rechute et caractérisation fonctionnelle d’un nouvel oncogène LMO3-BORCS5 NNT: 2018SACLS310 NNT: Thèse de doctorat de l'Université Paris-Saclay préparée à l’Université Paris-Sud École doctorale n°568 : Signalisations et réseaux intégratifs en biologie (Biosigne) Spécialité de doctorat: Aspects moléculaires et cellulaires de la biologie Thèse présentée et soutenue à Villejuif, le 16 octobre
    [Show full text]
  • Robust Distal Tip Cell Pathfinding in the Face of Temperature Stress Is
    GENETICS | INVESTIGATION Robust Distal Tip Cell Pathfinding in the Face of Temperature Stress Is Ensured by Two Conserved microRNAS in Caenorhabditis elegans Samantha L. Burke,* Molly Hammell,† and Victor Ambros*,1 *Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts 01605, and †Watson School of Biological Sciences, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 ABSTRACT Biological robustness, the ability of an organism to maintain a steady-state output as genetic or environmental inputs change, is critical for proper development. MicroRNAs have been implicated in biological robustness mechanisms through their post- transcriptional regulation of genes and gene networks. Previous research has illustrated examples of microRNAs promoting robustness as part of feedback loops and genetic switches and by buffering noisy gene expression resulting from environmental and/or internal changes. Here we show that the evolutionarily conserved microRNAs mir-34 and mir-83 (homolog of mammalian mir-29) contribute to the robust migration pattern of the distal tip cells in Caenorhabditis elegans by specifically protecting against stress from temperature changes. Furthermore, our results indicate that mir-34 and mir-83 may modulate the integrin signaling involved in distal tip cell migration by potentially targeting the GTPase cdc-42 and the beta-integrin pat-3. Our findings suggest a role for mir-34 and mir- 83 in integrin-controlled cell migrations that may be conserved through higher organisms. They also provide yet another example of microRNA-based developmental robustness in response to a specific environmental stress, rapid temperature fluctuations. KEYWORDS mir-34; mir-83; mir-29; distal tip cell migrations; robustness HE ability of a living system to maintain a steady-state as stage-specific diapause (Baugh and Sternberg 2006; Fu- Toutput in the face of environmental and physiological kuyama et al.
    [Show full text]
  • Canine Chondrodysplasia Caused by a Truncating Mutation in Collagen-Binding Integrin Alpha Subunit 10
    Canine Chondrodysplasia Caused by a Truncating Mutation in Collagen-Binding Integrin Alpha Subunit 10 Kaisa Kyo¨ stila¨ 1,2,3, Anu K. Lappalainen4, Hannes Lohi1,2,3* 1 Research Programs Unit, Molecular Neurology, University of Helsinki, Helsinki, Finland, 2 Department of Veterinary Biosciences, University of Helsinki, Helsinki, Finland, 3 Department of Molecular Genetics, Folkha¨lsan Institute of Genetics, Helsinki, Finland, 4 Department of Equine and Small Animal Medicine, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland Abstract The skeletal dysplasias are disorders of the bone and cartilage tissues. Similarly to humans, several dog breeds have been reported to suffer from different types of genetic skeletal disorders. We have studied the molecular genetic background of an autosomal recessive chondrodysplasia that affects the Norwegian Elkhound and Karelian Bear Dog breeds. The affected dogs suffer from disproportionate short stature dwarfism of varying severity. Through a genome-wide approach, we mapped the chondrodysplasia locus to a 2-Mb region on canine chromosome 17 in nine affected and nine healthy 26 Elkhounds (praw = 7.42610 ,pgenome-wide = 0.013). The associated locus contained a promising candidate gene, cartilage specific integrin alpha 10 (ITGA10), and mutation screening of its 30 exons revealed a nonsense mutation in exon 16 (c.2083C.T; p.Arg695*) that segregated fully with the disease in both breeds (p = 2.5610223). A 24% mutation carrier frequency was indicated in NEs and an 8% frequency in KBDs. The ITGA10 gene product, integrin receptor a10-subunit combines into a collagen-binding a10b1 integrin receptor, which is expressed in cartilage chondrocytes and mediates chondrocyte-matrix interactions during endochondral ossification.
    [Show full text]
  • Integrin- `10 Dependency Identifi Es RAC and RICTOR As Therapeutic Targets in High-Grade Myxofi Brosarcoma
    Published OnlineFirst August 30, 2016; DOI: 10.1158/2159-8290.CD-15-1481 RESEARCH ARTICLE Integrin-`10 Dependency Identifi es RAC and RICTOR as Therapeutic Targets in High-Grade Myxofi brosarcoma Tomoyo Okada 1 , Ann Y. Lee 1 , Li-Xuan Qin 2 , Narasimhan Agaram 3 , Takahiro Mimae 1 , Yawei Shen 1 , Rachael O’Connor 1 , Miguel A. López-Lago 4 , Amanda Craig 1 , Martin L. Miller 5 , Phaedra Agius 1 , Evan Molinelli 5 , Nicholas D. Socci 5 , Aimee M. Crago 1 , 6 , Fumi Shima 7 , Chris Sander 5 , and Samuel Singer 1 , 6 Downloaded from cancerdiscovery.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Published OnlineFirst August 30, 2016; DOI: 10.1158/2159-8290.CD-15-1481 ABSTRACT Myxofi brosarcoma is a common mesenchymal malignancy with complex genomics and heterogeneous clinical outcomes. Through gene-expression profi ling of 64 pri- mary high-grade myxofi brosarcomas, we defi ned an expression signature associated with clinical out- come. The gene most signifi cantly associated with disease-specifi c death and distant metastasis was ITGA10 (integrin-α10). Functional studies revealed that myxofi brosarcoma cells strongly depended on integrin-α10, whereas normal mesenchymal cells did not. Integrin-α10 transmitted its tumor-specifi c signal via TRIO and RICTOR, two oncoproteins that are frequently co-overexpressed through gene amplifi cation on chromosome 5p. TRIO and RICTOR activated RAC/PAK and AKT/mTOR to promote sarcoma cell survival. Inhibition of these proteins with EHop-016 (RAC inhibitor) and INK128 (mTOR inhibitor) had antitumor effects in tumor-derived cell lines and mouse xenografts, and combining the drugs enhanced the effects.
    [Show full text]
  • Meta-Analysis of Genome-Wide Association Studies for Personality Europe PMC Funders Group
    Europe PMC Funders Group Author Manuscript Mol Psychiatry. Author manuscript; available in PMC 2013 September 27. Published in final edited form as: Mol Psychiatry. 2012 March ; 17(3): 337–349. doi:10.1038/mp.2010.128. Europe PMC Funders Author Manuscripts Meta-analysis of genome-wide association studies for personality Marleen H.M. de Moor1,†, Paul T. Costa2, Antonio Terracciano2, Robert F. Krueger3, Eco J.C. de Geus1, Tanaka Toshiko2, Brenda W.J.H. Penninx4,5,6, Tõnu Esko7,8,9, Pamela A F Madden10, Jaime Derringer3, Najaf Amin11, Gonneke Willemsen1, Jouke-Jan Hottenga1, Marijn A. Distel1, Manuela Uda12, Serena Sanna12, Philip Spinhoven5, Catharina A. Hartman4, Patrick Sullivan13, Anu Realo14, Jüri Allik14, Andrew C Heath10, Michele L Pergadia10, Arpana Agrawal10, Peng Lin10, Richard Grucza10, Teresa Nutile15, Marina Ciullo15, Dan Rujescu16, Ina Giegling16, Bettina Konte16, Elisabeth Widen17, Diana L Cousminer17, Johan G. Eriksson18,19,20,21,22, Aarno Palotie17,23,24,31, Leena Peltonen17,23,24,31,**, Michelle Luciano25, Albert Tenesa26, Gail Davies25, Lorna M. Lopez25, Narelle K. Hansell27, Sarah E. Medland27, Luigi Ferrucci2, David Schlessinger2, Grant W. Montgomery27, Margaret J. Wright27, Yurii S. Aulchenko11, A.Cecile J.W. Janssens11, Ben A. Oostra28, Andres Metspalu7,8,9, Gonçalo R. Abecasis29, Ian J. Deary25, Katri Räikkönen30, Laura J. Bierut10, Nicholas G. Martin27, Cornelia M. van Duijn11,*, and Dorret I. Boomsma1,* 1Department of Biological Psychology, VU University Amsterdam, 1081 BT, Amsterdam, The Netherlands 2National Institute
    [Show full text]