Identifying modes of zinc-dependent gene regulation in S. pombe
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Kate M. Ehrensberger
Graduate Program in Molecular Genetics
The Ohio State University
2014
Dissertation Committee:
Amanda J. Bird, Ph.D. (Advisor)
R. Keith Slotkin, Ph.D.
Jian-Qiu Wu, Ph.D.
Mark L. Failla, Ph.D.
Copyright by
Kate M. Ehrensberger
2014
Abstract
Zinc is an essential trace metal that is necessary for cell growth and viability, but is toxic when in excess. Thus, cells have evolved a variety of mechanisms to maintain a relatively constant level of intracellular zinc. In eukaryotic cells factors exist that directly
‘sense’ intracellular zinc concentrations. These factors regulate the expression of many genes, including those necessary for zinc transport, zinc sequestration, and zinc conservation. Much of what we understand about zinc sensing has come from research in the budding yeast, Saccharomyces cerevisiae, where the transcription factor Zap1 senses and responds to zinc deficiency. However, Zap1, and its homologs, are only found in the budding yeast and some pathogenic fungi. This suggests that other unknown factors and/or alternative mechanisms are in place to sense zinc deficiency in other higher eukaryotic species.
This dissertation has used two distinct approaches to better understanding how zinc-dependent changes in gene regulation occur using the fission yeast model system,
Schizosaccharomyces pombe. The first part of this study examines and characterizes a zinc-regulated natural antisense transcript produced at the adh1 locus (adh1AS). Using the adh1AS transcript, we have been able to demonstrate how cellular zinc levels can affect the expression of the adh1 sense-antisense pair. Through this research we have
ii shown that the adh1AS transcript is necessary for the zinc-dependent regulation of adh1.
In addition, data presented within this study has shown that that adh1AS transcript is regulated at both the transcriptional and post-transcriptional levels by zinc. Our data suggests that post-transcriptional regulation of the adh1AS transcript is dependent on the expression of adh1; however, the precise mechanism remains unclear.
The second half of this study describes the discovery and characterization of
Loz1, a novel protein involved in zinc sensing in S. pombe. We have found that Loz1 is involved in the transcriptional regulation of genes involved in zinc homeostasis. When zinc is replete, Loz1 represses the expression of target genes such as adh4, vel1, zrt1, and the adh1AS transcript. Through a screening method and by analyzing Loz1 protein truncations, we have determined that the zinc finger domains of Loz1 are critical for its function. In addition, we have found that mutations within the zinc fingers lead to either a total loss or partial loss of zinc-dependent regulation of target gene expression.
The data presented within this dissertation begins to identify mechanisms of zinc- dependent gene regulation in the fission yeast, S. pombe. Through this research we have characterized mechanisms of zinc-dependent regulation in place at the adh1 locus. Our results suggest a novel mechanism of strand-specific RNA accumulation in response to changes in nutrient levels. In addition, the discovery and characterization of Loz1 has provided insight as to how S. pombe senses and responds to changes in intracellular zinc at the transcriptional level. Together, these studies provide insight into the mechanisms by which cells sense and maintain zinc levels, and provide a base for further studying zinc sensing in S. pombe and other higher eukaryotic species.
iii
This dissertation is dedicated to my family.
iv
Acknowledgments
I would like to thank my advisor, Amanda Bird, for all of her guidance and support throughout the past years. In addition, I would also like to thank all of the members of the Bird lab, both past and present, for all of their help and assistance, especially Mark Corkins.
I would also like to thank my family, and especially my husband, Mark, for all their love and support over the past years. And lastly, I would like to thank my dog, Zoe, who has kept me sane during my graduate school career, and who acted as my assistant in writing this dissertation.
v
Vita
2004-2008………..…...B.S. Molecular Biology/Biotechnology, Clarion University of PA
2009 to present ………Graduate Teaching Associate, Department of Molecular Genetics,
The Ohio State University
Publications
Corkins, M.E., May, M., Ehrensberger, K.M., Hu, Y.-M., Lui, Y.-H., Bloor, S.D., Jenkins, B., Runge, K.W., and Bird, A.J. (2013) Zinc finger protein Loz1 is required for zinc-responsive regulation of gene expression in fission yeast. Proc. Natl. Acad. Sci. U.S.A. 110, 15371-15376.
Ehrensberger, K.M., Mason, C., Corkins, M.E., Anderson, C., Dutrow, N., Cairns, B.E., Dalley, B., Milash, B., and Bird, A.J. (2013) Zinc-dependent regulation of the adh1 antisense transcript in fission yeast. J. Biol. Chem. 288, 759-769.
Ehrensberger, K.M. and Bird, A.J. (2011) Hammering out details: regulating metal levels in eukaryotes. Trends Biochem. Sci. 36, 524-531.
Fields of Study
Major Field: Molecular Genetics
vi
Table of Contents
Abstract………………………………………………………………………...………….ii
Dedication...... iv
Acknowledgements…………………………………………………………………...…...v
Vita………………………………………………………………………………………..vi
List of Tables…………...………………………………………………………………..xii
List of Figures……………………………………..……………………………...... …...xiii
Chapter 1…………………………………………………………………………………..1
Introduction………...……………………………………………………………………...1
1.1 Why is zinc important?...... 1
1.2 Zinc deficiency and zinc toxicity...... 2
1.3 Maintaining zinc homeostasis in eukaryotes...... 4
1.3.1 Sensing zinc deficiency in eukaryotes...... 6
1.3.2 Sensing zinc toxicity in eukaryotes...... 8
1.4 Non-coding RNAs and antisense transcripts...... 11
1.5 Regulation of gene expression by antisense transcripts...... 14
vii
1.6 Overview...... 16
Chapter 2...... 18
Materials and methods...... 18
2.1 Yeast strains, growth conditions and medium...... 18
2.1.1 Transformations and strain creation...... 18
2.1.2 nmt1 inducible promoter system...... 19
2.2 RNA isolation and northern blot...... 19
2.3 LacZ assays...... 21
2.4 Chromatin immunoprecipitation...... 22
2.5 RT-PCR...... 23
2.6 Protein purification and western blot...... 23
2.7 Crossing strains and tetrad analysis...... 25
2.7.1 Linkage mapping...... 25
2.8 Microscopy...... 26
2.9 Serial dilution growth assays...... 26
2.10 Site-directed mutagenesis...... 26
2.11 Primers...... 27
2.12 Plasmids...... 27
Chapter 3...... 28
Zinc-dependent regulation of adh1 in S. pombe...... 28
3.1 Introduction...... 28
3.2 Results...... 29
viii
3.2.1 An antisense transcript is generated at the adh1 locus...... 29
3.2.2 The adh1AS transcript is necessary for the zinc-dependent
regulation of adh1...... 32
3.2.3 adh1 is regulated by zinc in a mechanism independent of its
promoter...... 35
3.3 Discussion...... 37
Chapter 4...... 38
Determining the mechanism of regulation of the adh1 sense-antisense pair...... 38
4.1. Introduction...... 38
4.2 Results...... 41
4.2.1 The adh1AS transcript is regulated at the transcriptional level
by zinc...... 41
4.2.2 The adh1AS transcript is regulated by zinc independent of
its own promoter...... 43
4.2.3 Mapping the sequence of the adh1AS transcript necessary
for zinc-dependent regulation...... 46
4.2.4 Regulation of the adh1AS transcript is dependent on adh1
expression...... 47
4.2.5 Regulation of the adh1 sense-antisense pair...... 53
4.2.6 Regulation of the adh1AS transcript is not dependent
on the RNAi machinery...... 54
ix
4.2.7 Screening for genes involved in adh1 sense-antisense
regulation...... 57
4.3 Discussion...... 63
Chapter 5...... 68
Discovery of Loz1: A novel protein involved in zinc homeostasis...... 68
5.1 Introduction...... 68
5.2 Results...... 69
5.2.1. A spontaneous, second-site mutation in an adh1Δ strain led
to a loss of zinc sensing...... 69
5.2.2 Linkage mapping to determine the site of the loz1-1
mutation...... 70
5.2.3 Loz1 is transcriptional regulator of zinc-dependent
gene expression...... 72
5.2.4 Loz1 autoregulates its own expression...... 77
5.3 Discussion...... 78
Chapter 6...... 81
Functional characterization of Loz1...... 81
6.1 Introduction...... 81
6.2 Results...... 82
6.2.1 A screen to identify genes associated with zinc sensing...... 82
6.2.3 Mutations in loz1 lead to a range of loss-of-function
phenotypes...... 88
x
6.2.4 Characterization of loz1 alleles...... 92
6.2.5 Regulation of loz1 gene expression...... 100
6.2.6 Mapping the minimal zinc-responsive region of Loz1...... 103
6.3 Discussion...... 106
Chapter 7...... 111
Concluding remarks...... 111
References...... 115
Appendix...... 128
Additional tables...... 128
xi
List of Tables
Table 1. Genes screened for involvement in adh1 sense-antisense regulation...... 58
Table 2. Results from linkage analysis to determine the position
of the loz1-1 mutation...... 72
Table 3. Isolated loz1 alleles containing missense or nonsense mutations...... 86
Table 4. Isolated loz1 alleles containing insertions, deletions, or duplications...... 87
Table 5. S. pombe strains used in this study...... 128
Table 6. Primers and oligos used in this study...... 132
Table 7. Plasmids used in this study...... 134
xii
List of Figures
Figure 1. Mechanisms of activation and repression by Zap1...... 7
Figure 2. Schematic of Zap1, from S. cerevisiae, and human MTF-1...... 11
Figure 3. Mechanisms of transcriptional and post-transcriptional gene
regulation by NATs...... 14
Figure 4. An antisense transcript is produced at the adh1 locus in S. pombe...... 31
Figure 5. The adh1AS transcript is necessary for the zinc-dependent
regulation of adh1...... 32
Figure 6. The regulation of adh1 is independent of SPCC13B11.02c...... 34
Figure 7. The adh1 sense transcript is regulated independent of it own promoter...... 36
Figure 8. Model for RNAi-directed heterochromatin formation at S. pombe
centromeres...... 40
Figure 9. The adh1AS transcript is regulated at the transcriptional level...... 44
Figure 10. The adh1AS transcript is regulated at multiple levels by zinc...... 45
Figure 11. Expression of adh1 is necessary for the zinc-dependent regulation of
the adh1AS transcript...... 49
Figure 12. Basal levels of adh1 expression are detected in the nmt1-adh1 strain...... 52
Figure 13. adh1AS plasmid truncations can effect the regulation of other genes...... 55
xiii
Figure 14. The RNAi machinery is not involved in regulation of the
adh1AS transcript...... 56
Figure 15. Cid14 and Mei2 may have a role in the zinc-dependent regulation
of adh1 sense and antisense transcripts...... 60
Figure 16. Pop2 may play a role in the post-transcriptional regulation
of the adh1AS transcript...... 62
Figure 17. Origins of different tetrad types...... 71
Figure 18. The loz1-1 mutant allele shows a misregulation of genes regulated by
changes in intracellular zinc levels...... 73
Figure 19. The loz1-1 allele is not involved in the zinc-dependent post-transcriptional
regulation of the adh1AS transcript...... 75
Figure 20. Loz1 is involved in the transcriptional regulation
of zinc-regulated genes...... 76
Figure 21. Loz1 autoregulates its own expression...... 78
Figure 22. The loz1-1 mutation rescues the adh1Δ growth phenotype
on antimycin A...... 83
Figure 23. Schematic of screening method to determine mutants with
aberrant zinc sensing...... 85
Figure 24. Schematic of the Loz1 protein...... 88
Figure 25. Schematic of the adh1 locus in a WT cell and a loz1 adh1Δ double
mutant strain...... 90
xiv
Figure 26. Growth assay to measure adh1AS expression in loz1 adh1Δ
double mutants...... 91
Figure 27. Mutations in loz1 result in a misregulation of target genes...... 93
Figure 28. Northern analysis of loz1 site-directed mutagenesis plasmids
expressed in the loz1Δ strain...... 96
Figure 29. Loz1 protein accumulates under high and low zinc conditions in loz1Δ cells
expressing loz1 site-directed mutagenesis plasmids...... 97
Figure 30. Wild type and mutant Loz1 protein is expressed in the nucleus...... 99
Figure 31. The zhf1 promoter is not regulated by changes in
intracellular zinc levels...... 101
Figure 32. Loz1 function is regulated independent of autoregulation...... 102
Figure 33. ploz1 truncations rescue the zinc-dependent regulation of
Loz1 target genes...... 104
Figure 34. A pzhf-loz1 truncation consisting of amino acids 427-522 rescues the zinc-
dependent regulation of Loz1 target genes...... 106
xv
Chapter 1
Introduction
1.1 Why is zinc important?
Zinc is an essential trace element that is critical for cell viability and proliferation, but can be toxic when in excess (Stefanidou et al, 2006). Functionally, zinc has structural, catalytic, and regulatory roles, acting as a cofactor to over 300+ enzymes including carbonic anhydrase, Cu-Zn superoxide dismutase, RNA polymerases, and alcohol dehydrogenases (McCall et al, 2000; Stefanidou et al, 2006). Bioinformatic studies also approximate that 10% of the identified human proteome encodes a protein containing a zinc-binding domain. These domains include the Cys2-His2 type zinc finger or zinc knuckle motifs (Andreini et al, 2006).
Recent studies have also shown that zinc can act as a signaling molecule. Releases of zinc, known as zinc sparks, from an egg cell following fertilization are critical for developmental progression in mammals. These zinc sparks occur very briefly, but are intense, and their occurrence is dependent on an influx of calcium into the cell (Kim et al,
2011). In addition, zinc can act also as a neurotransmitter, being released from neurons upon stimulation (Colvin et al, 2003; Smart et al, 2004).
1
1.2 Zinc deficiency and zinc toxicity
It is estimated that approximately 20% of the world’s population is moderately zinc deficient (Campanini, 2002; Wessels and Brown, 2012). Zinc deficiency is commonly caused by a lack of zinc-rich foods in one’s diet, but it can also be due to genetic mutations in genes involved in zinc homeostasis (Prasad et al, 1961; Barnes and
Moynahan, 1973). Symptoms of moderate zinc deficiency include dermatitis, diarrhea, hair loss, and loss of appetite. Although more rare, severe zinc deficiency is characterized by growth retardation, hypogonadism, skin abnormalities, neurological impairment, and anemia (Prasad, et al, 1961; Ackland and Michalczyk, 2006; Plum et al, 2010). Immune system function is also affected by zinc, and zinc-deficient individuals are known to have suppressed immune systems (Shankar and Prasad, 1998; Rink and Gabriel, 2000; Prasad,
2009).
To date, two hereditary zinc disorders in humans have been linked to mutations in the ZIP family of zinc transporters. Acrodermatitis enteropathica, leads to a systemic zinc deficiency, while the spondylocheiro dysplastic form of Ehlers–Danlos syndrome is believed to be caused by zinc deficiency within specific cell types and/or specific cellular organelles.
Acrodermatitis enteropathica (AE) is a genetic disorder that leads to systemic zinc deficiency. Using strategies of linkage mapping and sequencing of candidate genes, the gene responsible for AE was mapped to SLC39A4 (also referred to as hZIP4), a zinc transporter found in enterocytes which transports zinc across the apical membrane (Wang et al, 2001; Wang et al, 2002; Küry et al, 2002; Jeong and Eide, 2013). Consistent with
2 this role, introducing AE mutations into cultured mouse cells resulted in a decrease in the overall uptake of zinc into intestinal cells (Wang et al, 2004).
In contrast to other apical zinc transporters found in enterocytes, studies have shown that ZIP4 is regulated by zinc at multiple levels, including the stabilization of mRNA when zinc levels are low, and the removal and subsequent degradation of Zip4 from the plasma membrane when zinc is in excess (Kim et al, 2004; Mao et al, 2007;
Weaver et al, 2007; Jeong and Eide, 2013). This zinc-dependent regulation ensures that
ZIP4 is actively expressed when zinc levels are low, and thus provides an explanation for why zinc supplements can reverse the clinical symptoms associated with the disorder.
The spondylocheiro dysplastic form of Ehlers–Danlos syndrome has been linked to mutations in the zinc transporter SLC39A13, also referred to as hZIP13 (Fukada et al,
2008; Giunta et al, 2008). In human cells, ZIP13 localizes to the Golgi apparatus (Bin et al, 2011) and to zinc-rich vesicles in the cytoplasm (Jeong et al, 2012). Ehlers-Danlos syndrome is a connective tissue disorder, and presents symptoms of short stature, short, hypermobile digits, muscle atrophy, particularly in the hands, and protruding eyes.
Since zinc has been shown to inhibit the hydroxylation of lysyl and prolyl residues, it was originally hypothesized that the spondylocheiro dysplastic form Ehlers–
Danlos syndrome was causes by a zinc overload in the endoplasmic reticulum (ER), which, in turn, resulted in the underhydroxylation of lysyl and prolyl residues in bone and cartilage (Tuderman et al, 1977; Puistola et al, 1980; Giunta, 2008). More recent studies suggest that the spondylocheiro dysplastic form of Ehlers–Danlos syndrome results from the inability to release zinc from stores that supply the ER with zinc (Jeong et al, 2012).
3
Thus, in contrast to mutations in ZIP4, it is hypothesized that mutations in ZIP13 lead to decreased levels of zinc within a specific organelle.
Although zinc is not as toxic as other transition metals, cases of zinc toxicity have been reported in humans. Acute zinc toxicity is characterized by symptoms of nausea, vomiting, and diarrhea (Brown et al, 1964). Furthermore, chronic exposure to high levels of zinc can lead to copper deficiency (Prasad, 1978; Fosmire, 1990).
Zinc induced-copper deficiency is believed to result from metallothioneins (MTs) binding and sequestering copper within the cell. The expression of MTs are induced by high levels of zinc; but, because MTs bind copper with a higher affinity than zinc, the copper becomes bound and the zinc remains ‘free’ in the cytoplasm (Waalkes et al, 1984;
Plum et al, 2010). Zinc-induced copper deficiency is also causative of iron-deficient anemia, as copper is required for iron uptake and heme synthesis (Lee et al, 1968; Roeser et al, 1970; Hirase et al, 1992; Vashchenko and MacGillivray, 2013). Therefore, these examples demonstrate that there is an interrelationship between trace metals within the cell.
1.3 Maintaining zinc homeostasis in eukaryotes
Because zinc is both necessary and toxic to cell growth and proliferation, it is important to tightly regulate the levels of zinc within the cytosol. Cells have evolved multiple mechanisms in order to maintain a relatively constant level of zinc within the cell; these include regulating gene expression at both the transcriptional and post- translational levels (Rutherford and Bird, 2004; Waldron et al, 2009).
4
Examples of post-translational regulation include the removal and degradation of high affinity zinc transporters from the plasma membrane when zinc is in excess (Gitan et al, 1998; Kim et al, 2004; Mao et al, 2007). For example, in the budding yeast,
Saccharomyces cerevisiae, expression of the high affinity zinc transporter, ZRT1, is induced under conditions of low zinc. However, when zinc is in excess, transcription of
ZRT1 is no longer induced, and the transporter is endocytosed and degraded in the vacuole (Zhao and Eide, 1996; Zhao and Eide, 1997; Gitan et al, 1998).
In species ranging from yeast to humans, genes involved in zinc homeostasis are also regulated at the transcriptional level (Rutherford and Bird, 2004; Ehrensberger and
Bird, 2011). In Arabidopsis thaliana, two transcription factors, bZip19 and bZip23, have been found to be necessary for the expression of genes involved in zinc uptake during zinc deficiency (Assunção et al, 2010). Transcriptome profiling of zebrafish gill tissue showed that over 500 genes were differentially regulated based on the presence or absence of zinc supplementation (Zheng et al, 2010). And, in humans, genes are regulated due to both zinc deficiency and zinc toxicity (Kindermann et al, 2004; Ryu et al, 2011; Günther et al, 2012a).
Although several factors have been found to be involved in zinc-dependent gene regulation, to date, only two transcription factors have been shown to directly sense zinc.
Zap1 from the budding yeast, S. cerevisiae, has been found to sense zinc deficiency, while the metal-responsive transcription factor-1 (MTF-1) senses zinc toxicity in mammals and multiple fish species (Eide, 2009; Günther et al, 2012a).
5
1.3.1 Sensing zinc deficiency in eukaryotes
Zap1 is responsible for the regulation of genes involved in zinc uptake, release of zinc from vacuolar stores and zinc conservation (Eide, 2009). During zinc deficiency
Zap1 acts as an activator, inducing expression of the high affinity zinc transporter gene,
ZRT1, and the zinc uptake transporters, ZRT2 and FET4; Zap1 is also responsible for activating the expression of ZRT3, a zinc transporter involved in zinc export from the vacuole (Fig. 1A) (Zhao and Eide, 1996a; Zhao and Eide, 1996b; MacDiarmid et al,
2000; Waters and Eide, 2002). Although Zap1 acts as an activator, it is also involved in the repression of the alcohol dehydrogenases, ADH1 and ADH3, which are two of the most abundant zinc-binding enzymes in yeast (Lyons et al, 2000). Zap1 represses the expression of ADH1 and ADH3 through the induction of intergenic transcripts, which act via a mechanism of transcriptional interference; the intergenic transcripts produced at both loci run though the promoters regions, and their presence blocks access to other cofactors necessary for transcription (Fig. 1B) (Bird et al, 2006). The repression of ADH1 and ADH3 during zinc deficiency results in lower Adh1 and Adh3 protein levels, conserving zinc for essential zinc binding proteins.
In addition to the genes mentioned above, Zap1 is also responsible for its own autoregulation, and the regulation of ~80 additional target genes involved in various cellular processes (Zhao et al, 1998; Lyons et al, 2000; Wu et al, 2008). When zinc levels are low, Zap1 activates target gene expression by binding to specific sequences, called
6
Figure 1. Mechanisms of activation and repression by Zap1. (A) Zap1 activates the expression of the high affinity zinc transporter, ZRT1, under low zinc conditions by binding to ZREs in the promoter region. The ZRT1 promoter contains three ZREs (B) Zap1 represses the expression of ADH1 under conditions of low zinc though an intervening transcript named ZRR1. The transcription of ZRR1 prevents transcriptional activators from binding to the promoter and inducing ADH1 expression. All ZREs are depicted as blue rectangles, and binding sites for other transcription factors in the ADH1 promoter are shown as red rectangles.
zinc-responsive elements or ZREs, that are located in the promoter regions of target genes (Zhao et al, 1998). These ZREs share a common consensus sequence, however
Zap1-binding sites can vary from the consensus (Eide, 2009). In addition, highly induced targets of Zap1 have been found to contain multiple ZREs that act in an additive manner
(Zhao et al, 1998; Lyons et al, 2000).
ZAP1 encodes an 880 amino acid, zinc finger protein that senses zinc though two activation domains, activation domain 1 (AD1) and activation domain 2 (AD2) (Fig. 2)
7
(Bird et al, 2000; Bird et al, 2003; Herbig et al, 2005; Eide, 2009; Frey and Eide, 2011).
In addition, recent evidence has shown that DNA binding by Zap1 is directly regulated by changes in intracellular zinc levels (Frey et al, 2011).
Studies have shown that the activation domains of Zap1 are independently regulated by zinc (Bird et al, 2000; Herbig et al, 2005; Eide, 2009). AD1 has no known zinc-binding motif, but binds multiple zinc ions in vitro (Herbig, 2005). Although the precise mechanism by which AD1 senses zinc is unknown, recent studies have revealed that AD1 plays the primary role in the regulation of Zap1 target genes, while AD2 is involved in regulation when zinc deficiency is combined with other environmental stressors, such as heat stress (Frey and Eide, 2011).
In contrast to AD1, the mechanism of AD2 function has been well characterized.
AD2 contains two zinc fingers (ZF1 and ZF2) that bind zinc in a labile form (Bird et al,
2003; Wang et al, 2006). Using fluorescence resonance energy transfer (FRET) sensors it was found that zinc binding to the Zap1 ZF1/ 2 pair induced a conformational change in the protein (Qiao et al, 2006). This evidence supports the hypothesis that, under high zinc conditions, the binding of zinc to the ZF1/2 pair of Zap1 forms a closed conformation; however, under low zinc conditions, when Zap1 is active, the ZF1/2 pair changes conformation exposing regions of the protein important for the recruitment of other factors necessary for transcriptional activation.
1.3.2 Sensing zinc toxicity in eukaryotes
MTF-1 was first discovered by the Schaffner lab in 1988 using human cell culture extracts (Westin and Schaffner, 1988). Since then, homologs have been found and
8 characterized in mice, several species of fish and Drosophila (Séguin and Prévost, 1988;
Radtke et al, 1993; Auf der Maur et al, 1999; Dalton et al, 2000; Zhang et al, 2001;
Cheung et al, 2010). Like Zap1, mammalian MTF-1 is a zinc finger protein that acts as transcriptional activator (Fig. 2). However, unlike Zap1, MTF-1 is active under high zinc conditions.
Most notably, MTF-1 is responsible for the activation of metallothionein genes, but it is also responsible for the regulation of genes involved in zinc efflux, hypoxia, and oxidative stress (Günter et al, 2012a). MTF1-1 regulates its target genes by binding to specific sequences called metal response elements, or MREs, that are typically found in multiple repeats in the promoter regions of target genes (Stuart et al, 1984; Searle et at,
1985; Stuart et al, 1985; Westin and Schaffner, 1988).
Various studies have shown that MTF-1 activity is regulated at multiple levels.
Initial reporter gene analysis demonstrated that mouse MTF-1 (mMTF-1) is not regulated by increased zinc levels, suggesting that the regulation of MTF-1 most likely occurs at either the post-transcriptional or protein level (Auf der Maur et al, 2000).
More recent studies have shown that the localization of MTF-1, the DNA binding of MTF-1 to the promoters of target genes and transactivation domain function are regulated by cellular zinc levels (Heuchel et al, 1994; Radtke et al, 1995: Smirnova et al,
2000; Saydam et al, 2001; Günther et al, 2012a). Under high zinc conditions, when MTF-
1 is active, the protein is localized to the nucleus; however, under low zinc conditions,
MTF-1 is exported to the cytoplasm. Newer evidence has shown that the nuclear export signal (NES), but not nuclear export itself, is important for metal-responsiveness of the
9
MTF-1; and this region of the human protein was shown to be sufficient to confer zinc- responsiveness when fused the Gal4 DNA binding domain (DBD) (Lindert et al, 2009).
MTF-1 contains three transactivation domains (acidic domain, proline-rich domain, and serine/theonine-rich domain) that play a role in zinc sensing (Radtke at al,
1995). MTF-1 protein constructs fused to the Gal4 DBD showed that the acidic domain and the proline-rich domain play a role in zinc-responsiveness; however, this effect was only seen in the context of the full-length protein. In addition, a cysteine cluster, located
C-terminal to the transactivation domains, has been found to be important for the metal- induced transcription of target genes (Chen et al, 2004).
MTF-1 is also known to interact with many different proteins, including coactivators and other specific stress-response factors (Günter et al, 2012a). As of now, it unclear what type of role, if any, these proteins play in MTF-1’s ability to sense zinc, or if these interacting partners could affect MTF-1 activity in specific cell types and tissues.
Also of special interest is the ability of Drosophila MTF-1 (dMTF-1) to play a role in copper sensing (Selvaraj et al, 2005). dMTF-1 is involved in the sensing zinc toxicity, copper toxicity, and copper deficiency. A cysteine-rich domain which forms a tetranuclear Cu(I) cluster, as well as a second cysteine-rich domain, located at the extreme C-terminus of the protein, have been found to be important for the regulation of genes involved in zinc and copper toxicity (Chen et al, 2008; Günther et al, 2012b). Thus, dMTF-1 acts as a special type of sensor that has the ability to discriminate between and respond to multiple metals.
10
Figure 2. Schematic of Zap1, from S. cerevisiae, and human MTF-1. In both diagrams, zinc fingers are depicted by yellow rectangles. Regions important for zinc sensing are shown in blue.
1.4 Non-coding RNAs and antisense transcripts
In comparing the human genome to other species such as mice, Caenorhabditis elegans, and Drosophila, the number of protein coding genes is quite similar, eventhough humans, as a species, are more complex organisms (ensmbl.org). Much of this complexity arises through different protein splice variants created by alternative splicing, post-translational modification to proteins, and from the production of non-coding transcripts. Non-coding RNAs (ncRNAs) are defined as RNA molecules that do not encode a protein product. Although many initially believed that ncRNAs were just ‘junk’
11 transcripts, newer studies have found that ncRNAs play a large role in the regulation of genes.
Non-coding RNAs can be found in both prokaryotic and eukaryotic species
(Mattick and Makunin, 2006). Although they are not as common in prokaryotes, ncRNAs have been found to represent upwards of 90% of the human transcriptome (Prasanth and
Spector, 2007; Beiter et al, 2009; ensmbl.org). These ncRNAs are divided into many different classes based on their origin, sequence, and functionality. Some classes, such as tRNAs, rRNAs, and snRNAs, have been well characterized and are known to play
‘housekeeping’ roles in the cell (Kannanganattu and Spector, 2007). Other classes, including micro RNAs (miRNAs), small interfering RNAs (siRNAs), and long non- coding RNAs (lncRNAs), typically play more regulatory roles in the cell, regulating gene expression at multiple levels.
Small regulatory RNAs, including miRNAs, siRNAs, and PIWI-interacting RNA, are 20-30 nucleotide (nt) RNA molecules that are involved in gene silencing via the RNA interference (RNAi) pathway. These small RNAs are classified based on their size, biogenesis, and association with a protein from the Argonaute family. For example, miRNAs form a hairpin loop which must be processed by Drosha and Dicer before being loaded onto Argonaute; following processing mature miRNAs are ~21-24 nts in length.
In contrast endogenous siRNAs typically arise from a double stranded RNA (dsRNA) duplex that is processed by Dicer into ~21 nt RNA molecules; mechanisms of siRNA gene silencing include mRNA degradation, translational repression, and heterochromatin formation (Carthew and Sontheimer, 2009). siRNAs can also be created synthetically,
12 and are widely used in laboratory settings to knock-down genes in many different systems.
Long non-coding RNAs are defined as non-coding RNAs greater than 100 nt in length. Different groups of lncRNAs include, but are not limited to, intergenic transcripts, stable spliced introns, and antisense transcripts (Wiluz et al, 2009). Studies have shown that lncRNAS can act through multiple mechanisms to regulate gene expression. For example, one of the most well known lncRNA, Xist, is involved in X- chromosome inactivation. When expressed during development, expression of Xist modifies chromatin structure of the inactive X-chromosome, thus rendering it to a silenced or heterochromatic state (Ng et al, 2007; Nagano and Fraser, 2011). In addition,
Xist is regulated by a natural antisense transcript, Tsix, which represses Xist expression in cis (Nagano and Fraser, 2011).
Natural antisense transcripts (NATs) are defined as RNAs that are expressed from the opposite strand of a protein-coding, sense transcript (Beiter et al, 2009). NATs can be classified into two groups: cis-NATs and trans-NATs. cis-NATs are expressed from the same genomic loci which they regulate, and they share perfect sequence complementarity to their sense counterpart. In contrast, trans-NATs, originate from a different locus, and typically share stretches of imperfect sequence complementarity to their sense counterparts (Li et al, 2006). Because trans-NATs are more difficult to identify, most of what we know about gene regulation via NATs has come from studies with cis-NATs
(Beiter et al, 2009).
13
Figure 3. Mechanisms of transcriptional and post-transcriptional gene regulation by NATs (modified from Beitner et al, 2009). (A) During transcriptional interference, the polymerase transcribing the antisense strand can interfere with the polymerase elongating the sense strand (left). In addition, transcription of the antisense strand may inhibit binding of transcription factors and/or RNA polymerase, and initiation of transcription at sense strand promoter (right). (B) Chromatin silencing can occur via recognition of histone modifying complexes. (C) A double stranded RNA duplex can be processed by Dicer, into siRNAs, which, in turn, direct a RNAi response.
1.5 Regulation of gene expression by antisense transcripts
NATs have been shown to regulate their sense counterparts via several different mechanisms. These mechanisms include regulation at both the transcriptional and post- transcriptional levels (Fig. 3). At the transcriptional level, NATs can regulate sense transcription directly via transcriptional interference, as well as though the silencing of chromatin (Fig. 3, A and B) (Beiter et al, 2009). For example, in budding yeast, entry into meiosis is determined by an antisense transcript generated at the IME4 locus (Hongay et
14 al, 2006). In haploid cells, IME4 expression is reduced by the presence of an antisense transcript. However, in MAT a/α diploid cells, expression of the IME4 antisense transcript is transcriptionally repressed, and cells are able to progress into meiosis. Because the
IME4 antisense transcript can only confer regulation in cis, it has been proposed that the
IME4 antisense transcript transcriptionally interferes with IME4 sense expression
(Hongay et al, 2006).
Because every sense-antisense (SAS) pair shares sequence complementarity, it has the ability to form an RNA duplex. The formation of a SAS duplex can regulate gene expression at a post-transcriptional level through mechanisms of RNA masking, RNA editing, and RNAi (Beiter et al, 2009). In RNA masking, the formation of a dsRNA duplex can inhibit the binding of trans-acting factors or ‘mask’ cis-acting elements within the RNA sequence. For example, in mammals it has been shown that production of an antisense transcript can interfere with the alternative splicing of the thyroid hormone receptor, TRα2 mRNA (Hasting et al, 2000). In addition there are reports showing that antisense transcripts can play a role in RNAi in several model system (Beiter et al, 2009;
Werner and Swan, 2010). The duplex created by a SAS pair can be cleaved by Dicer into endogenous siRNAs which can then act in gene silencing (Fig. 3C).
The production of antisense transcripts is important in the regulation of several cellular processes including, developmental regulation, X-chromosome inactivation, and genomic imprinting. In addition, newer studies have shown that the misregulation of antisense transcripts can be detrimental to normal cellular function. For example, in acute myeloid leukemia (AML), RNAs antisense to the tumor suppressor genes, p15 and
15 p21, silence each respective loci by stimulating heterochromatin formation (Morris et al,
2008; Yu et al, 2008). In addition, recent data has revealed that an abnormal ratio of sense to antisense transcripts exists in neoplastic breast epithelial cells (Maruyama et al,
2012). Thus, it is essential to appreciate how the levels of antisense transcripts are regulated in order to fully understand how they function to regulate gene expression of their sense counterparts.
1.6 Overview
Although there is much data describing how Zap1 senses zinc in S. cerevisiae, there are no Zap1 homologs in higher eukaryotic species. In our lab, we have chosen to use the model system Schizosaccharomyces pombe in order to determine how cells sense intracellular zinc levels. S. pombe contains no Zap1 homolog, but shows similar expression of zinc-regulated genes, as compared to the budding yeast (Dainty et al, 2008;
Ehrensberger et al, 2013). Thus, using S. pombe as a model system, we hope to provide insight into the mechanisms by which other higher eukaryotic species sense and respond to changes in intracellular zinc levels.
The goal of this study was to characterize mechanisms of zinc-dependent regulation in order to better understand how S. pombe senses zinc. The first part of this dissertation focuses on a specific example of zinc-dependent regulation at the alcohol dehydrogenase 1 (adh1) locus that involves a sense-antisense pair. Characterization of the adh1 SAS pair suggests a novel mechanism of strand-specific RNA accumulation in response to changes in nutrient levels, and provides insight into how antisense transcripts can be regulated at multiple levels.
16
The later part of this dissertation focuses on the characterization of Loz1, a novel transcriptional repressor that responds to changes in intracellular zinc levels. Data presented in this study begins to address how loz1 is regulated in response to zinc and defines regions critical for Loz1 function. By further characterizing Loz1 function, we can better understand if Loz1 acts as a novel zinc sensor in S. pombe, and if other species sense zinc using similar mechanisms.
17
Chapter 2
Materials and Methods
2.1 Yeast strains, growth conditions and medium
All S. pombe strains used in this study can be found in Table 5 of the Appendix.
All strains used were grown at 31oC in either yeast extract + supplements (YES; 0.5%
Yeast Extract, 3% glucose, 750 µg/ml histidine, 750 µg/ml uracil, 750 µg/ml leucine, 750
µg/ml adenine) or a derivative of Edinburgh minimal medium (EMM) that lacks zinc
(ZL-EMM) (Forsburg and Rhind, 2006; Moreno et al, 1991; Ehrensberger et al, 2013).
Unless indicated, S. pombe strains were pre-grown to exponential phase in YES, washed twice in a ZL-EMM, and then grown for ~16-18 hours in ZL-EMM with or without the indicated zinc supplement (ZnSO4); cultures were inoculated at approximately an optical density (OD600) of 0.5 in a volume of 5 mL (Ehrensberger et al, 2013). For growth experiments involving adh1AS plasmid truncations, cells were pre-grown in EMM, washed twice in ZL-EMM, and grown for 6-8 hours in ZL-EMM or ZL-EMM + zinc supplement.
2.1.1 Transformations and strain creation
Yeast transformations were performed using a modified lithium acetate protocol to create competent cells (Kanter-Smoler et al, 1994). All integrating plasmids were
18 created from the JK148 backbone, and were digested with NruI, NdeI, or BsiWI (NEB) prior to integration at the leu1 locus (Keeney and Boeke, 1994).
Standard methods were used to create a gene knock-outs (Bähler et al, 1998). All yeast knock-outs were created using the pFA6a-kanMX6 plasmid (Bähler et al, 1998) In creation of the nmt1-adh1 and pop2Δ strains, it was necessary to perform overlap PCR to create longer homology to the gene of interest, in order for homologous recombination to take place.
2.1.2 nmt1 inducible promoter system
The nmt1 inducible promoter system was used to induce or repress expression of the adh1 sense and antisense transcripts (Maundrell, 1990). Because the addition of thiamine represses gene expression from the nmt1 promoter, strains containing genes expressed from the nmt1 promoter were grown entirely in EMM. For growth experiments using the nmt1-adh1 and nmt1-adh1AS strains, cells were pre-grown in
EMM, washed twice in ZL-EMM, and grown for 6-8 hours in ZL-EMM or ZL-EMM + zinc supplement with or without the addition of 15 µM thiamine (Maundrell, 1990).
2.2 RNA isolation and northern blot
Total RNA was purified using a modified hot acidic phenol method (Collart and
Oliviero, 2001). Cell pellets were resuspended in equal volumes of TES (10 mM Tris-Cl pH 7.4, 10 mM EDTA, 0.5% SDS) and phenol/chloroform pH 4.3, and incubated at 65oC for ~1 hour. Samples were centrifuged at max speed for 5 min. The upper, aqueous layer was removed and placed in a fresh tube. 500 µL of phenol/chloroform was added, to the aqueous layer. The sample was then vortexed and centrifuged for 5 min at max speed
19 before the upper, aqueous layer was removed and placed in fresh tube. 400 µL chloroform was added to the sample. The sample was vortexed, centrifuged for 5 min at max speed, and the upper, aqueous layer was removed and place in a fresh tube. The sample was precipitated with 50 µL 3 M sodium acetate (pH 5.2) and 900 µL 200 proof ethanol. RNA pellets were resupended in ddH2O at a concentration of ~1-3 µg/µL; RNA concentrations were obtained using a NanoDrop 1000 series (Thermo Fisher Scientific).
Northern blots were run using a ~1.2% agarose gel + 3.7% formaldehyde buffered with 1X MOPS buffer (20 mM MOPS pH 7.0, 2 mM sodium acetate, 1 mM EDTA).
RNA was loaded at a concentration of ~5-15 µg in an equal volume of 2X RNA loading dye (90% formamide, 1X MOPS buffer, 1X loading dye). Gels were run overnight at
~17-20V, and then post-stained with ethidium bromide for visualization of ribosomal
RNAs.
RNA was transferred to a nylon membrane (Ambion® BrightStar®-Plus) using a capillary protocol using an alkaline transfer solution of 3 M NaCl/ 0.01 M NaOH. RNAs were crosslinked to the membrane using a UV crosslinker (Stratagene® UV Stratalinker
1800).
Membranes were probed with radiolabeled, strand-specific RNA probes created using a MAXIscript T7 kit (Ambion). Primers used to create probe templates are listed in
Table 6 in the Appendix. Probes were hybridized to membrane overnight at 60oC using either using UltraHyb buffer (Ambion) or a northern hybridization buffer (0.5 M sodium phosphate pH 7.2, 7% SDS, 1 mM EDTA). Blots were washed in 2X SSC (0.316 M
NaCl, 0.03 M sodium citrate dihydrate) / 0.1% SDS and exposed to a phosphor screen
20
(Amersham Bioscinces/GE Healthcare Life Sciences). RNAs were detected using a
Typhoon Phosphoimager using ImageJ® software.
2.3 LacZ assays
To create a lacZ reporter construct (pJK148-lacZ), the lacZ gene was subcloned from Yep353, a S. cerevisiae plasmid construct, into pJK148 via ApaI and EcoRI sites
(Myers et al, 1986; Keeney and Boeke, 1994). With the exception of adh1AS-lacZ construct, lacZ fusion reporters were made by creating translational fusions with the promoter of interest to the lacZ gene.
For all beta-galactosidase assays, cells were grown overnight in ZL-EMM with or without zinc supplement. Following overnight growth, cells were spun down, washed, and resuspended in lacZ buffer (60 mM Na2HPO4 7H2O, 40 mM NaH2PO4H2O, 10 mM KCl, 1 mM MgCl2 ). Cell optical density was measured at an absorbance of 600 nm, and ~2-4 OD of cells, in a volume of 2 mL, was used to perform the assay.
50 µL 0.1% SDS and 50 µL chloroform were added to cell suspensions to permeablize cells. Cell suspensions were vortexed for 10 seconds before 500 µL of the cell suspension was placed in 3 x 1.5 mL microfuge tubes; this was done to perform assay in triplicate. 100 µL of 4 mg/mL ONPG was added to cell suspension to begin reaction (time=T0), and reaction was stopped using 250 µL 1 M Na2 CO3 after yellow color appeared. Cell debris was pelleted, and absorbance was measure at 420 nm
(Guarente, 1983; Miller, 1972). Beta-galactosidase activity (expresses in arbitrary units) was calculated using the given formula: (ΔAbs420 x 1000) / (time (min) x mL of culture x absorbance of culture at 600 nm).
21
2.4 Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) assays were performed using an adapted protocol from the Cairns lab (Roberts et al, 2003). For ChIP assays, cells were either grown 6-8 hours in ZL-EMM + Zn or overnight in ZL-EMM + Zn. Following growth in zinc-limiting or zinc-replete media, cells were crosslinked for 30 min using 1% formaldehyde, and then quenched by adding 125 mM glycine and incubating for an additional 10 min. Crosslinked cells were harvested and washed twice in cold PBS (pH
7.4). Cell pellets were then stored in 2 mL screw cap tubes at -80oC until ready for use.
Cell pellets were resuspended in LB140 (50 mM HEPES-KOH pH 7.5, 140 mM
NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.4 mM DTT). Acid washed 0.5 mm zirconia beads (Ambion) were added to cell suspension, and cells were lysed using a bead beater by beating for 8 x 2 min. Following bead beating, lysate was collected. Insoluble material (containing chromatin) was separated from soluble protein by centrifugation; pellet was washed once in LB140 and was resuspended in a volume of 800 µL.
Chromatin was sheared using a sonicator (Misonix XL-2000) at a setting of 2 for cycles of 8 x 30 seconds. Chromatin/sheared extract was collected (supernatant fraction) by centrifugation.
Antibodies for immunopreciptation were coupled to Dynabeads Protein A (Life
Technologies) in a suspension of PBS (pH 7.4) and 5 mg/mL BSA; to bind antibody to beads, suspension was incubated for 4+ hours. Immunoprecipitations (IPs) were set up by adding sheared extract to bead-antibody suspension. All IPs were performed by incubating samples overnight.
22
Bead-antibody-chromatin samples were washed using a magnetic rack and solutions of WB140 (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1%
Triton X-100, 0.1% SDS) and WB500 (50 mM HEPES-KOH pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS). Samples were eluted from beads using 2 x
100 µL TES (10 mM Tris-Cl pH 7.4, 10 mM EDTA, 0.5% SDS), and reverse crosslinked by incubating at 65oC for 5 hours. Following reverse croslinking, DNA was purified using a QIAquick PCR Purification Kit (Qiagen). Semi-quantitative PCR, as well as q-
PCR using SYBR Green (Applied Biosystems), were performed to quantify products. All primers used for ChIP analysis are listed in Table 6 of the Appendix.
2.5 RT-PCR
For semi-quantitative RT-PCR, total RNA was extracted from cells grown overnight in either zinc-limiting or zinc-replete media using standard phenol extraction.
These samples were then treated with DNAse I to remove any DNA contaminant. For each reverse transcriptase (RT) reaction, 2 µg of DNAse-treated RNA was reverse transcribed using either Tetro Reverse Transcriptase (Bioline) or M-MLV Reverse
Transcriptase (Invitrogen) using manufacturer’s protocols. Semi-quantitative PCR was performed to quantify products. PCR products were run on a 2% agarose gel and stained with ethidium bromide. Bands were quantified using Image J®. Primers used for reverse transcriptase reactions are listed in Table 6 of the Appendix.
2.6 Protein purification and western blot
All protein purifications were carried out using a modified trichloroacetic acid
(TCA) protocol from the Herskowitz lab (Peter et al, 1993). For protein purifications,
23 cells were grown overnight in ZL-EMM with or without a zinc supplement. Following growth in zinc-limiting or zinc-replete media, cells were resuspended in 500 µL TCA buffer (0.02 M Tris-Cl pH 7.4, 0.05 M ammonium acetate, 0.002 M EDTA). 300 µL acid washed 0.5 mm glass beads and 500 µL cold 20% TCA was added to cell suspension.
Cells suspension was vortexed for 2 x 30 seconds, and placed on ice between cycles. The liquid top layer was then transferred to a fresh microfuge tube, and proteins were pelleted by spinning at top speed for 10 min. All residual TCA was removed, and proteins were reususpended in ~50-200 µL TCA-Laemmli buffer (Peter et al, 1993). Following resuspension, protein samples were boiled to denature for ~5-10 min, and then stored at
-20oC until ready for use.
Protein gels were cast at 8-10% acrylamide, and, ~5-10 µL of protein samples were loaded onto gels (Sambrook and Russel). Protein gels were run using Mini-
PROTEAN® Tetra Cell system (BioRad) and SDS-PAGE running buffer (0.025 M Tris- base, 0.2 M glycine, 0.02% SDS). Gels were transferred to Immuno-blot PVDF membrane (BioRad) or Immobilon-FL membrane (Millipore) using a Mini Trans-Blot® system (BioRad) and western transfer buffer containing 10-20% methanol.
Membranes were blocked for 30-60 min with either Odyssey Blocking Buffer
(LI-COR) or TBST (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 0.1% Tween) + 5% milk.
Membranes were probed with primary antibodies overnight at 4oC or rocking at room temperate for 2+ hours. Following incubation with primary antibody, membranes were washed 3 x 10 min with TBST, and then probed with secondary antibody. Membranes were incubated with secondary antibody for 1-1.5 hours, and then washed 3 x 10 min
24 with TBST. Blots were developed using either LI-COR® system or enhanced chemiluminescence (ECL) method (Thermo Scientific).
2.7 Crossing strains and tetrad analysis
S. pombe strains of opposite mating types were crossed using malt extract (ME) plates supplemented with adenine, histidine, uracil, and leucine (Forsburg and Rhind,
2006). Transient diploids were isolated on YES plates using a tetrad dissection microscope (Nikon Eclipse 50i), and in some cases, complementation of adenine markers was used to select for diploid cells. Diploids were allowed to sporulate spontaneously.
Individual spores were dissected apart and incubated at 31oC until colonies formed.
Colonies generated from spores were struck onto appropriate selection plates.
2.7.1 Linkage mapping
Linkage mapping was used to map the original loz1-1 allele. The loz1-1 strain was crossed to multiple strains from the S. pombe haploid deletion mutant library
(Bioneer). Tetrads were dissected as previously described. Only zygotes producing 3-4 spores were used for analysis.
All colonies obtained were struck onto YES and YES containing 100 µg/mL
G418 sulfate to select for colonies containing the mutant allele from the deletion library.
RNA was also extracted from all colonies obtained, and northern blots were used to identify colonies containing the loz1-1 allele. Tetrads were classified as parental ditype
(PD), non-parental ditype (NPD), or tetratype (TT). Map distance between linked genes were calculated as follows:
25
(Sherman, 1998)
2.8 Microscopy
GFP-tagged strains were screened for positive integration using fluorescence microscopy. For all microscopy, cells were placed on untreated glass slides diluted in sterile ddH20. Slides were visualized at 100X using an inverted fluorescence microscope
(Olympus IX70 or Nikon ECLIPSE Ti).
2.9 Serial dilution growth assays
Depending on the media type they were to be plated on, cells were grown overnight in either YES or a derivative of EMM. Cell optical density was measured at an absorbance of 600 nm, and cultures were diluted in YES or EMM to an OD600 of 1 in a volume of 1 mL. A series of 10-fold serial dilutions were carried out, and dilutions were plated at a volume of 5 µL onto appropriate plates.
For growth assays plated onto minimal media, pombe glutamate media (PGM) was used rather than EMM (Eckwall et al, 1996; Forsburg, 2003). And, all plates containing G418 sulfate, contained the antibiotic at a concentration of 100 µg/mL.
2.10 Site-directed mutagenesis
Site-directed mutagenesis was performed by modifying the Quikchange® site- directed mutagenesis protocol (Stratagene). Primers for site-directed mutagenesis were
~30 bp in lengths, and both forward and reverse primers contained the same nucleotide sequence; however, the sequence of the reverse primer was the reverse, complement of
26 the forward primer. All primers used for site-directed mutagenesis can be found in Table
6 of the Appendix. Polymerase chains reactions (PCRs) using the Quikchange® method were run using ~30 ng template DNA and Pfu Turbo polymerase (Stratagene) and performed according to the manufacturer’s recommendations. PCR products were digested with DpnI (NEB) to remove the non-mutated, template plasmid backbones prior to transformation into E. coli.
2.11 Primers
All primers and oligos used in this study were created by Sigma-Aldrich®. A list of primers and oligos used for ChIP, RT-PCR, RNA probe template creation, and site- directed mutagenesis can be found in Table 6 of the Appendix.
2.12 Plasmids
All expression plasmids used in this study were derived from the pRep3x plasmid backbone or the pJK148 backbone (Forsburg 2003; Keeney and Boeke, 1994). A list of all plasmids used in this study can be found in Table 7 of the Appendix.
27
Chapter 3
Zinc-dependent regulation of adh1 in S. pombe
3.1 Introduction
Alcohol dehydrogenases (EC 1.1.1.1) are a class of enzymes responsible for the interconversion of alcohols to acetaldehydes or ketones (expasy.org). In yeast, alcohol dehydrogenases are important in fermentation. They catalyze the conversion of acetaldehyde to ethanol. The budding yeast, S. cerevisiae, contains five classical alcohol dehydrogenase genes (ADH1, ADH2, ADH3, ADH4 and ADH5), four of which convert acetaldehyde to ethanol, and one (ADH2) which catalyzes the reverse reaction (de Smidt et al, 2008).
In S. cerevisiae, studies have shown that the expression of ADH1, ADH3, and
ADH4 are regulated by intracellular zinc levels (Yuan, 2000; Bird et al, 2006). All three enzymes have the ability to catalyze the same reaction, but show differential regulation patterns in response to zinc. ADH1 and ADH3 are expressed under conditions of high zinc, while ADH4 is expressed when intracellular zinc levels are low. Thus, changes in intracellular zinc levels are marked by a switch in alcohol dehydrogenase expression (Wu et al, 2008).
It is hypothesized that the alcohol dehydrogenase isoenzyme switch occurs in order to conserve cellular zinc. Adh1 and Adh3 are both known to bind two zinc ions in
28 their monomeric forms; however, it remains unclear what cofactor Adh4 requires for its catalytic activity (Williamson and Paquin, 1987; Leskovac et al, 2002). Adh4 shares homology to the iron-dependent alcohol dehydrogenase from Zymomonas mobilis
(Williamson and Paquin, 1987). Although it has been proposed that Adh4 is an iron- requiring enzyme, other studies have reported that Adh4 requires zinc for activity in vitro
(Williamson and Paquin, 1987; Drewke and Ciriacy, 1988). Adh4 has been found to act as a dimer; thus even if it binds zinc in vivo, it would bind less total zinc ions than Adh1, which acts as a tetramer (Drewke and Ciriacy, 1988; Leskovac et al, 2002).
Both Adh1 and Adh4 have homologs in S. pombe (Russell and Hall, 1983;
Sakurai et al, 2004). In addition, array data from our lab has shown that the expression of adh1 and adh4 are regulated by changes in intracellular zinc levels (Ehrensberger et al,
2013). Due to the tight regulation of each of these genes by zinc, we focused on the regulation of adh1 and adh4 in order to better understand how gene expression is regulated by zinc in S. pombe. This chapter focuses on how adh1 is regulated by zinc.
Data from this chapter shows that adh1 expression is indirectly regulated by changes in intracellular zinc levels, and that the adh1 antisense transcript is necessary for its zinc- dependent regulation.
3.2 Results
3.2.1 An antisense transcript is generated at the adh1 locus
In order to identify genes regulated by zinc in S. pombe, transcriptome profiling arrays were performed on cells grown under zinc-replete and zinc-deplete conditions
(Ehrensberger et al, 2013). This analysis revealed that one of the most highly induced
29 transcripts expressed under zinc-limiting conditions was an antisense transcript produced at the adh1 locus (adh1AS). The arrays also revealed that adh1 mRNA levels were highly repressed under this condition (Fig. 4A) (Ehrensberger et al, 2013). Because the two transcripts showed reciprocal regulation in response to changes in zinc levels, we hypothesized that adh1 expression was controlled by the adh1AS transcript.
To determine if an antisense transcript was produced at the adh1 locus, total RNA was purified from JW81, wild type (WT), cells grown in ZL-EMM + 200 µM Zn.
Northern blot analysis using strand-specific RNA probes was used to measure the abundance of adh1 sense and antisense transcripts produced under each condition.
Multiple adh1AS probes were used to assure the regulation throughout the entire transcript (Fig. 4, B and C). In addition, RNA probes that hybridized to adh4 and pgk1
(phosphoglycerate kinase 1) were used as controls. The adh4 probe was used to confirm that the cells had reach zinc deficiency, while the pgk1 probe was used to show that there was equal loading of each sample (Fig. 4B).
In cells grown in zinc-replete media (+Zn), adh1 mRNA accumulated, while in cells grown in zinc-deplete media (-Zn), the adh1AS transcript accumulated to high levels
(Fig. 4B). In addition, to the larger adh1AS transcript, when northern blots were probed with adh1AS probes overlapping with the adh1 open reading frame (ORF), a second, smaller transcript was produced in both high and low zinc conditions (Fig. 7A, adh1AS-2 probe). This smaller adh1AS transcript ran at the same position as the adh1 sense transcript suggesting that multiple adh1AS transcripts may be produced at the adh1 locus.
30
Figure 4. An antisense transcript is produced at the adh1 locus in S. pombe. (A) Array data showing relative transcript levels of adh1 mRNA and the adh1AS transcript (from Ehrensberger et al, 2013). Data is expressed on a log2 scale and signal intensity is expressed as a ratio of the normalized signal obtained in low zinc/ the normalized signal obtained in high zinc. Chromosomal locations are shown as numerical values. SPCC13B11.02c is sequence orphan which overlaps with the 5’ end of the adh1AS transcript (B) Northern blot of WT cells grown in low and high zinc. (C) Schematic of adh1 locus. Binding sites for strand-specific RNA probes are shown as blue rectangles.
31
Figure 5. The adh1AS transcript is necessary for the zinc-dependent regulation of adh1. (A) Northern blot analysis determined that in the absence of the adh1AS transcript, adh1 mRNA levels become constitutive in cells grown under both high and low zinc conditions. (B) Schematic representations of the adh1 locus in yeast strains used in panel A. In the SPCC13B11.02cΔ strain, the SPCC13B11.02c open reading frame was replaced by the kanamycin-resistance cassette (kanMX6).
3.2.2 The adh1AS transcript is necessary for the zinc-dependent regulation of adh1
Further characterization of the adh1AS transcript revealed that the major adh1AS transcript was 3412 base pairs (bp) in length and mapped to 1590025-1593436 on chromosome 3 (Ehrensberger et al, 2013). The 5’ region of the mapped adh1AS transcript was predicted to overlap with SPCC13B11.02c, a sequence orphan of unknown function (Fig. 4A) (pombase.org). Because of this overlap, we hypothesized that a
32
SPCC13B11.02cΔ strain would lack the 5’ end and promoter region of the adh1AS transcript, and therefore, the adh1AS transcript would not be expressed in this strain.
When northern blot analysis was used to examine adh1 sense and antisense transcript levels in SPCC13B11.02cΔ cells, deletion of this ORF eliminated the presence of the adh1AS transcript in low zinc (Fig. 5, A and B). Northern blot analysis also showed that in the absence of the adh1AS transcript, adh1 mRNA accumulated in cells grown under both high (ZL-EMM +200 µM Zn) and low zinc (ZL-EMM) conditions (Fig. 5A).
These results are consistent with the hypothesis that the adh1AS transcript is necessary for the zinc-dependent regulation of adh1 mRNA.
To verify that the results obtained with the SPCC13B11.02cΔ strain were due to the absence of the adh1AS transcript, and not the SPCC13B11.02c protein product, a plasmid construct was made containing the annotated SPCC13B11.02c ORF. The
SPCC13B11.02c ORF was amplified via a polymerase chain reaction (PCR) with primers containing BamHI and SmaI sites. The SPCC13B11.02c ORF was digested and inserted into similar sites in the pRep3x-pgk1 multi-copy plasmid vector (Ehrensberger et al,
2013). As determined by northern analysis, cells grown in ZL-EMM + 200 µM zinc showed no zinc-dependent regulation of adh1 mRNA (Fig. 6). This result suggested that the regulation of adh1 was independent of SPCC13B11.02c, but was dependent on the expression of the adh1AS transcript.
33
Fig. 6. The regulation of adh1 is independent of SPCC13B11.02c. Northern blot analysis confirms that the regulation of adh1 mRNA is due to the presence of the adh1AS transcript, and not SPCC13B11.02c. In addition to the probes shown above, blots were probed with adh1AS-2; however, the adh1AS transcript was not produced in either of the sample strains.
34
3.2.3. adh1 is regulated by zinc in a mechanism independent of its promoter
To determine how the adh1 sense transcript is regulated by zinc, a yeast strain was created in which the endogenous adh1 promoter and 5’ untranslated region (UTR) was replaced with the conditional nmt1 promoter (Ehrensberger et al, 2013). In S. pombe, the nmt (no message in thiamine) promoter is regulated by thiamine. When thiamine levels are low, nmt1 expression is induced; however, when thiamine levels are high, nmt1 is repressed (Maundrell, 1990). Thus in S. pombe, the nmt1 promoter can be utilized to control the levels of expression of a specific gene.
To determine if the adh1 promoter was necessary for the zinc-dependent regulation of adh1 mRNA levels, the nmt1-adh1 strain was grown in EMM + 100 µM zinc, with or without the addition of 15 µM thiamine for ~6 hours. In the nmt1-adh1 cells grown in the absence of thiamine, adh1 mRNA levels were regulated by zinc, suggesting that the zinc-dependent regulation of adh1 was independent of its native promoter (Fig.
7A, lanes 5 and 6). In nmt1-adh1 cells grown in the presence of thiamine, transcription of adh1 was repressed, and no bands were detected. This showed that the adh1 ORF was under the regulation of the nmt1 promoter (Fig. 7A, lanes 7 and 8).
As a second approach to determine how adh1 expression was regulated by changes in intracellular zinc levels, an adh1 reporter gene construct was created. In this construct, ~1.35 kb of the adh1 promoter was fused to the lacZ reporter gene. WT cells transformed with the reporter were grown in ZL-EMM + 200 µM zinc, and beta- galactosidase activity was measured. As controls, cells were also transformed with an empty vector (pJK148), and the reporter constructs, pgk1-lacZ and nmt1-lacZ. Relative
35
Figure 7. The adh1 sense transcript is regulated independent of its own promoter. (A) Northern analysis of RNA purified from WT and nmt1-adh1 cells. In nmt1-adh1 cells, the adh1 mRNA levels are regulated by zinc (modified from Ehrensberger et al, 2013). (B) Schematic of the adh1 locus in an nmt1-adh1 strain. (C) WT cells transformed with adh1-lacZ, nmt1-lacZ and pgk1-lacZ constructs, as well as an empty vector (pJK148) control. The adh1-lacZ construct shows no zinc-dependent regulation. pgk1-lacZ and nmt1-lacZ constructs were analyzed as controls; the promoters of these genes are not regulated by changes in intracellular zinc levels.
to the control promoters that were not regulated by changes in intracellular zinc levels
(pgk1 and nmt1), the adh1 promoter showed little regulation in response to changes in zinc (Fig. 7C). This data, along with northern blot data obtained from the nmt1-adh1 strain, suggests that adh1 is not directly regulated by zinc, but is indirectly regulated by zinc via the production of the adh1AS transcript.
36
3.3 Discussion
Adh1 is a zinc-dependent alcohol dehydrogenase. In S. cerevisiae, expression of
ADH1 is regulated by zinc through a mechanism of transcriptional interference (Bird et al, 2006). Here, this data shows that in S. pombe, adh1 expression is also regulated by zinc by a mechanism that involves a natural antisense transcript.
Northern blot analysis, along with array data, has shown that the adh1AS transcript accumulates to high levels in cell grown under conditions of low zinc. In contrast, adh1 mRNA shows a reciprocal expression pattern, accumulating specifically in cells grown in zinc-rich media (Fig. 4). This reciprocal expression pattern is mediated through the expression of the adh1AS transcript, as the adh1 promoter shows no zinc- dependent regulation (Fig. 7C). In addition, this mechanism of antisense-mediated gene repression is not dependent on the adh1 promoter, as the endogenous adh1AS transcript produced in the nmt1-adh1 strain was able to repress the expression of adh1 in cells grown in low zinc media (Fig. 7A).
Antisense transcripts are known to exist in S. pombe; and, studies have shown that antisense transcription can be specific to cellular processes, such as progression of cells into meiosis (Hongay at al, 2006; Dutrow et al, 2008; Ni et al, 2010; Bitton et al, 2011;
Chen et al, 2012). Our data shows that the adh1 sense-antisense pair is regulated by changes in intracellular zinc levels. These results are novel in that they show that a sense-antisense pair can be regulated in response to changes in nutrient levels. In addition, this data provides insight into the mechanisms by which gene expression can be regulated in response to changes in intracellular zinc levels.
37
Chapter 4
Determining the mechanism of regulation of the adh1 sense-antisense pair
4.1 Introduction
Although many studies have focused on how natural antisense transcripts effect expression of their sense counterparts, to date, few studies have addressed how individual antisense transcripts are regulated. Studies in S. cerevisiae have shown that the IME4 sense-antisense pair shows reciprocal regulation based on haplotype. In diploid cells, the
IME4 antisense transcript is transcriptionally repressed by the a1/α2 protein heterodimer, and the IME4 sense strand is induced; as a result, cells enter into meiosis. However, in haploid cells, the IME4 antisense transcript interferes with IME4 sense transcription, and cells remain in a haploid state (Hongay at al, 2006). Although the mechanism by which the IME4 antisense transcript interferes with IME4 sense transcription remains unclear, studies with the IME4 sense-antisense pair demonstrate how an antisense transcript can be regulated at the transcriptional level in response to a specific cellular activity (i.e. whether a cell enters meiosis/mitosis).
Natural antisense transcripts are known to regulate their sense counterparts using transcriptional and post-transcriptional mechanisms (Beiter et al, 2009). In the case of
IME4, it is hypothesized the IME4 antisense transcript acts in cis via a mechanism of transcriptional interference (Hongay et al, 2006). Studies with the PHO84 sense-
38 antisense pair from S. cerevisiae have shown that the PHO84 antisense transcript can work in trans, expressed from a plasmid-based construct, to silence its sense counterpart
(Camblong et al, 2009). In trans, the PHO84 antisense transcript acts to repress PHO84 expression at the transcriptional level; however, transcriptional gene silencing in cis and in trans are regulated through different mechanism (Camblong et al, 2007; Camblong et al, 2009). In addition, new studies with the PHO84 antisense transcript indicate that antisense-mediated repression of PHO84 is dependent on antisense transcription, but not the actual presence of the antisense transcript, as the PHO84 antisense transcripts are exported to the cytoplasm (Castelnuovo et al, 2013).
S. pombe contains the necessary cellular machinery to direct an RNAi response, and studies from the Moazed lab and others have demonstrated that RNAi is used for the transcriptional silencing of centromeres, telomeres, and the silent mating type locus (Fig.
8) (Moazed, 2009). The S. pombe RNAi machinery possesses the capability to produce siRNAs that could also target other heterochromatic regions or silence genes though either transcriptional or post-transcriptional mechanisms. Given this evidence, it seems plausible that RNAi could play a role in the regulation sense-antisense pairs located at other gene loci.
Because we observed that the adh1AS transcript is necessary for the zinc- dependent regulation of adh1 expression, we sought to characterize the mechanism by which the adh1 sense-antisense pair was regulated in response to changes in intracellular zinc levels. Data presented in this chapter shows that the adh1AS transcript is regulated at multiple levels by zinc. Although the mechanism by which the adh1AS regulates the
39 accumulation of adh1 mRNA remains unclear, data suggests that the adh1AS regulates the adh1 sense gene expression by a threshold response, in which a set level of the adh1AS transcript must be met in order to decrease expression of adh1.
Figure 8. Model for RNAi-directed heterochromatin formation at S. pombe centromeres (from Motamedi et al, 2004). In S. pombe, RNAi is a cyclic process which involves the amplification of siRNAs by RNA-directed RNA polymerase (Rdp1). siRNAs act to silence centromeric DNA repeats via the RNA-induced transcriptional silencing (RITS) complex, as shown in orange.
40
4.2 Results
4.2.1 The adh1AS transcript is regulated at the transcriptional level by zinc
In S. pombe, reporter gene studies from the Whitehall lab suggested that adh4 mRNA was regulated transcriptionally by zinc (Danity et al, 2008). Since the adh1AS transcript was regulated in response to changes in intracellular zinc levels, we hypothesized that the adh1AS transcript was also regulated at the transcriptional level by zinc. To test this hypothesis, a reporter gene construct was created in which ~650 bp of sequence located upstream of the predicted adh1AS transcriptional start site was fused to the lacZ reporter gene. WT cells transformed with the adh1AS reporter construct were grown in ZL-EMM + 200 µM zinc, and beta-galactosidase activity was measured. In addition, WT cells were transformed with an empty vector (pJK148), adh4-lacZ, adh1- lacZ, and sod1-lacZ constructs as controls. The adh4-lacZ reporter construct was used to show that the cells had reach zinc deficiency, while the adh1 and sod1 (Cu-Zn superoxide dismutase 1) reporters were used as controls not effected by changes in intracellular zinc levels. In cells transformed with the adh1AS-lacZ construct, beta-galactosidase activity was approximately 10-fold higher in low zinc, as compared to high zinc (Fig. 9A). This data suggests that the adh1AS transcript is regulated at the transcriptional level by zinc.
As a second method to determine if the adh1AS transcript was regulated at the transcriptional level by changes in intracellular zinc, ChIP analysis was performed using an anti-RNA polymerase II phospho-S5 antibody (Abcam, ab5131). This antibody marks an active RNA polymerase II complex (Phatnani and Greenleaf, 2006). Therefore, co-
41 immunoprecipitation of a DNA fragment with this antibody would denote DNA that was being actively transcribed under a given condition.
For ChIP analysis, WT cells were grown by multiple methods to become zinc- replete or zinc-deplete; however, all growth methods showed similar results. In earlier trials, EDTA was added to EMM to chelate zinc ions. In this EDTA growth method, cells were pre-grown overnight in EMM, and then a subculture of these cell were grown in EMM + 10 µM EDTA for ~ 4 hours before fixation. Because EDTA can chelate zinc, as well as other metals, in later methods, cells were pre-grown to exponential phase in
YES, washed twice in ZL-EMM, and then grown in ZL-EMM + 200 µM Zn overnight
(~16-18 hours) before fixation. In the data presented here, cells were grown overnight in
EMM, washed twice in ZL-EMM, and then grown in ZL-EMM + 200 µM Zn for 8 hours before fixation.
Data from ChIP analysis showed that the adh1AS transcript, like many other non- coding RNA transcripts, was transcribed by RNA polymerase II (Berretta and Morillon,
2009). In addition, the adh1AS transcript preferentially immunoprecipitated with RNA polymerase II in cells grown under low zinc conditions; this was apparent throughout the entire length of the transcript (Fig. 9, adh1A-adh1E). In primers specific to the adh1AS transcript (Fig. 9, adh1A, adh1B, and adh1E), this regulation was clear. However in cells grown under high zinc conditions, RNA polymerase II also co-immunoprecipitated with primers adh1D and adh1C (Fig. 9B). Because ChIP is not a strand specific assay, and because the entire adh1 mRNA sequence overlaps with the adh1AS transcript, it could not be determine which strand (sense or antisense) of the adh1 locus immunoprecipitated
42 with primers adh1C and adh1D. However, northern analysis would suggest that the adh1 sense strand immunoprecipitated in high zinc, while the adh1AS transcript immunoprecipitated in low zinc. In addition, other known zinc-regulated transcripts, as shown by our arrays and others (adh4 and vel1 (SPBC1348.06c, a homolog of VEL1 in S. cerevisiae)), were pulled-down preferentially with RNA polymerase II in cells grown under zinc-limiting conditions (Dainty et al, 2008; Ehrensberger et al, 2013). In contrast, pgk1, a gene that is not regulated by zinc, immunoprecipitated equally in cells grown under both low and high zinc conditions (Fig. 9B)
4.2.2 The adh1AS transcript is regulated by zinc independent of its own promoter
To characterize how the adh1 sense-antisense pair was regulated by changes in intracellular zinc levels, a transgene construct was made in which the full-length adh1AS sequence (pRep3x-pgk1-adh1AS 1-3412) was expressed from the constitutive pgk1 promoter (Fig. 10A). Because the adh1AS transcript was regulated at the transcriptional level, we hypothesized that the adh1AS transcript would not be regulated when expressed from a constitutive promoter. However, when transformed into the SPCC13B11.02cΔ strain, which lacks the endogenous adh1AS transcript, the plasmid-based adh1AS transcript was regulated by changes in intracellular zinc levels (Fig. 10B, construct 1).
This result was surprising because it showed that the adh1AS transcript was not only regulated at the transcriptional level, but it was also regulated independent of its own promoter by a second zinc-dependent mechanism.
43
Figure 9. The adh1AS transcript is regulated at the transcriptional level. (A) WT cells transformed with lacZ constructs. The adh1AS-lacZ construct is regulated by changes in intracellular zinc levels. (B) ChIP performed using an anti-RNA polymerase II antibody. Data indicates that the adh1AS transcript preferentially pulls-down with RNA polymerase II in cells grown in zinc-limiting media. Data from ChIP was quantified for significance using semi-quantitative methods and qPCR (qPCR performed by Mark Corkins). Individual data sets could not be directly compared because of differences in numerical values obtained, however, trends observed between sets were very similar. (C) Schematic of primer sets used for ChIP analysis at the adh1 locus. All primer sets used for ChIP analysis created an ~200-250 bp fragment when used for PCR. PCR reactions used for ChIP analysis consisted of 28-35 cycles of the following reaction: 94oC for 30 s, 60oC for 30 s, 72oC for 30 s, followed by a final elongation of 72oC for 3 min.
As a second approach to confirm that the adh1AS transcript was regulated independent of its promoter, a yeast strain was created in which the endogenous adh1AS promoter was replaced with the conditional, nmt1 promoter. Although the nmt1 promoter is not regulated by changes in intracellular zinc levels, in the nmt1-adh1AS strain, the adh1AS transcript was more abundant in cells grown in low zinc, as compared to high zinc (Ehrensberger et al, 2013). This result was consistent with the previous result, and 44 suggests that the adh1AS transcript is regulated at multiple levels in response to changes in intracellular zinc.
Figure 10. The adh1AS transcript is regulated at multiple levels by zinc. (A) Schematic of pgk1-driven adh1AS transgenes used in panels B and C. Numerical values are expressed in nucleotides. (B) and (C) Northern blots of SPCC13B11.02CΔ cells transformed with adh1AS transgenes. SPCC13B11.02CΔ cells were transformed with empty vector (pRep3x-pgk1) or adh1AS transgenes, as depicted in panel A. Total RNA was purified from cells that were grown in either ZL-EMM + 100 µM Zn (panel B) or ZL-EMM + 200 µM Zn (panel C). Individual blots were probed with adh1AS probes specific the expressed transgenes. 45
4.2.3 Mapping the sequence of the adh1AS transcript necessary for zinc-dependent regulation
Because the full-length adh1AS transgene construct showed zinc-dependent regulation when expressed from the constitutive pgk1 promoter, additional transgene constructs were created to map a minimal zinc-responsive region required for this regulation. In these transgene constructs, truncations of the adh1AS sequence were expressed from the pgk1 promoter (Fig. 10A). When expressed in SPCC13B11.02cΔ cells, adh1AS truncations overlapping with the adh1 ORF and extending into the mapped,
3’ end of the adh1AS transcript showed robust zinc-dependent regulation (Fig. 10B, constructs 1, 2, and 4). These constructs also had the ability to regulate adh1 mRNA levels in a zinc-dependent manner.
In contrast, truncations that overlapped with the adh1 ORF, and had no sequence complementarity to the adh1 promoter, showed little zinc-dependent regulation.
However, these constructs still retained the ability to decrease adh1 mRNA levels under both low and high zinc conditions (Fig. 10B, constructs 3 and 5). Very low levels of zinc-dependent regulation were apparent in adh1AS truncations which shared no sequence complementarity to the adh1 ORF, and, cells expressing these constructs accumulated adh1 mRNA to high levels under both high and low zinc conditions (Fig.
10C, constructs 6 and 7). These results suggest that zinc-dependent regulation of the adh1AS transcript is dependent on a region that overlaps with the adh1 ORF and promoter. In addition, these results suggest that a decrease in adh1 levels via the adh1AS transcript requires a region of the adh1AS transcript that overlaps with the adh1 ORF.
46
4.2.4 Regulation of the adh1AS transcript is dependent on adh1 expression
Because the minimal zinc-responsive region of the adh1AS transcript overlapped with adh1 mRNA, we hypothesized that expression of adh1 was necessary for the zinc- dependent regulation of the adh1AS transcript. To test this hypothesis, constructs were generated that allowed for the full-length adh1AS transgene to be expressed in the absence of adh1 expression.
Since the entire adh1 gene overlaps with the adh1AS sequence, the full-length adh1AS transgene contains all of the necessary elements to express adh1. Therefore, site- directed mutagenesis was utilized to create derivatives of the full-length adh1AS transgene that showed reduced, or no, expression of adh1 mRNA or protein. In one construct (AS mTATA), the consensus TATA box sequence was mutated such that it would be less recognizable to the basal transcription machinery, and thus, transcription would be decreased. In a second construct (AS mATG), the ATG, methionine start codon of adh1 was mutated to TTC (phenylalanine). In this construct, we predicted that adh1 mRNA would be produced; however, translation would not be initiated and Adh1 protein would not be produced.
To study the effects of the above mutations, each plasmid was transformed into two different strain backgrounds: nmt1-adh1 and adh1Δ. These strains were chosen since adh1 expression could be repressed with the addition of thiamine in the nmt1-adh1 strain, and no adh1 mRNA is produced in adh1Δ cells which lack the entire adh1 open reading frame. These strains therefore allowed the levels of the transgene-derived adh1 transcript to be analyzed in the absence of endogenous adh1 expression. In addition,
47 because each of these strains produced no endogenous adh1 mRNA as detectable by northern analysis (Fig. 11), we predicted that these two strain backgrounds would show similar phenotypes when transformed with the adh1AS transgene constructs.
When the nmt1-adh1 strain was transformed with the full-length adh1AS plasmid
(denoted as AS), the adh1AS transgene (upper band, adh1AS-2) preferentially accumulated in cells grown in zinc-limiting media (Fig. 11A, AS). In addition the adh1AS transgene was able to express adh1 mRNA from the plasmid-based construct.
Similar results were obtained in nmt1-adh1 cells transformed with the AS mATG plasmid; however, both the adh1 and the adh1AS transcripts showed reduced zinc- dependent regulation (Fig. 11A, AS mATG). In contrast, when the nmt1-adh1 strain was transformed with the AS mTATA plasmid, the adh1AS transgene showed very little zinc- dependent regulation, and no adh1 mRNA was detected (Fig. 11A, AS mTATA). These results suggest that the regulation of the adh1AS transcript is dependent on active transcription from the sense strand.
As a second approach to determine if bidirectional transcriptional (i.e. transcription from both the sense and antisense strand) was necessary for zinc-dependent regulation at the adh1 locus, the full-length adh1AS plasmid and its plasmid derivatives were transformed into the adh1Δ strain. When plasmids were transformed into the adh1Δ strain and grown under high and low zinc conditions, none of the adh1AS transgenes showed zinc-dependent regulation (Fig. 11B, adh1AS-2). In addition, adh1Δ cells transformed with the AS mATG plasmid failed to express the adh1AS transgene, and thus are not shown.
48
Figure 11. Expression of adh1 is necessary for the zinc-dependent regulation of the adh1AS transcript. Northern blots of nmt1-adh1 and adh1Δ cells transformed with adh1AS transgenes. Cells were transformed with empty vector (pRep3x-pgk1) or adh1AS transgenes (pRep3x-pgk1-adh1AS 1-3412, pRep3x-pgk1-adh1AS mTATA, or pRep3x- pgk1-adh1AS mATG). RNA was purified from cells that were grown in either ZL-EMM + 100 µM Zn + 15 µM thiamine (panel A) or ZL-EMM + 200 µM Zn (panel B). (A) In the nmt1-adh1 strain transformed with the adh1AS transgenes, two adh1AS transcripts are produced. The endogenous adh1AS transcript, which share sequence complementarity to adh1 and the nmt1 promoter, produces a smaller adh1AS transcript as compared to the adh1AS transcripts produced from the plasmid-based adh1AS constructs. (B) Because adh1Δ cells have a slow growth phenotype, cells were grown for ~24 hours in ZL-EMM + 200 µM Zn in order to obtain cells that expressed adh4 under zinc-limiting conditions.
49
The results obtained from the adh1Δ strain were surprising because they were inconsistent with data obtained from the nmt1-adh1 strain. One possible reason why the results showed inconsistencies could have been due to a phenotypic difference observed between the adh1Δ and nmt1-adh1 strains. Although the nmt1-adh1 strain reduces adh1 transcription such that no adh1 mRNAs are detected by northern blot analysis, basal levels of adh1 were potentially still produced in the nmt1-adh1 strain. This was determined by performing serial dilution growth assays and semi-quantitative RT-PCR.
To determine if there were differences in adh1 gene expression between the adh1Δ and nmt1-adh1 strains, serial dilution growth assays were used to compare growth rates of each of the strains on plates containing antimycin A. For growth assays, adh1Δ and nmt1-adh1 cells were transformed with the full-length adh1AS plasmid and its derivatives (AS mTATA and AS mATG). Transformants were grown on EMM + 10
µg/mL antimycin A. Plates used for nmt1-adh1 growth assays were also supplemented with 50 µM thiamine to repress expression of adh1 mRNA.
Because Adh1 is the main alcohol dehydrogenase used for fermentation, the adh1Δ strain presents a slow growth phenotype, and adh1Δ cells are unable to grow on media containing antimycin A (Fig. 12A). Antimycin A is a drug which blocks respiration; thus cells grown on media containing antimycin A rely on fermentation for growth. The full-length adh1AS transgene (AS) was able to rescue the adh1Δ growth phenotype on antimycin A. However, the AS mATG plasmid construct was unable to rescue the growth phenotype presumably because Adh1 protein was not produced from this construct (Fig. 12A). The AS mTATA plasmid construct containing the adh1 TATA
50 box mutation, weakly complemented the adh1Δ strain (Fig. 12A, AS mTATA) suggesting that the plasmid-based construct expressed adh1 at a very low level.
When the nmt1-adh1 strain was grown on media containing high levels of thiamine and antimycin A, the nmt1-adh1 strain grew at a similar rate compared to the
WT strain (Fig. 12A). Therefore, although adh1 mRNA cannot be detected by northern analysis in nmt1-adh1 cells grown in the presence of thiamine, this growth assay suggests that in the presence of thiamine, the nmt1-adh1 strain expresses adh1 mRNA at a low, basal level.
As a different approach to quantify the levels of adh1 transcript expressed in the nmt1-adh1 strain in the presence of thiamine, strand-specific RT-PCR was performed using WT, nmt1-adh1, and adh1Δ strains. The adh1 sense strand was specifically amplified using primers listed in Table 6 of the Appendix. Random hexamers, as supplied by the manufacturers, were used as control reactions. Relative levels of adh1 sense
(adh1S) transcripts and pgk1 transcripts were quantified using semi-quantitative PCR and
ImageJ® software. Normalized adh1S transcript abundance values are expressed as a ratio of signal strength obtained from adh1S / signal strength obtained from pgk1.
Strand-specific RT-PCR showed that in the presence of thiamine, the nmt1-adh1 strain expresses adh1 mRNA at a low level. However, the levels of adh1 expressed in this strain background were much lower, as compared to a WT strain, but were still regulated by zinc (Fig. 12B). No adh1 sense transcripts were observed in the adh1Δ strain, and therefore this data was omitted from the overall quantification. Together these data suggest that low, basal levels of adh1 sense transcripts are produced in the nmt1-
51 adh1 strain in the presence of thiamine, and this contributes to the differences in regulation observed between the nmt1-adh1 and adh1Δ strains. In addition, this data shows that the regulation of the adh1AS transcript requires expression of the adh1 sense strand.
Figure 12. Basal levels of adh1 expression are detected in the nmt1-adh1 strain. (A) Growth assays showing phenotypic differences between the nmt1-adh1 and adh1Δ strains. (B) Semi-quantitative RT-PCR to determine relative levels of adh1 sense transcripts produced from WT, nmt1-adh1 and adh1Δ strains. Prior to RT reaction, total RNA was purified from WT cells that were grown in either ZL-EMM + 200 µM Zn, and total RNAs were purified from nmt1-adh1 and adh1Δ strains as described in Figure 11. 52
4.2.5 Regulation of the adh1 sense-antisense pair
Results thus far have shown that the adh1AS transcript is necessary for the zinc- dependent regulation of adh1, and that the adh1AS transcript can work in cis to regulate endogenous adh1 expression. By expressing adh1AS transgenes in the SPCC13B11.02cΔ strain, our data has also shown that transcripts produced from the adh1AS transgene can regulate adh1 mRNA levels in cis at the plasmid-based adh1 locus, and in trans at the endogenous adh1 locus (Fig. 10).
To provide insight into how the adh1AS transcript could act to regulate adh1 sense expression in trans, adh1AS transgene constructs were transformed into several different strains. When the adh1AS transgene constructs were transformed into the nmt1- adh1 strain, an unexpected result was obtained. The adh1AS transcript produced in this strain is different from the WT adh1AS transcript in that it shares sequence complementarity to the adh1 ORF and the nmt1 promoter/kanMX6 cassette (Fig. 7).
Despite this difference, the endogenous adh1AS transcript that is produced in the nmt1- adh1 strain is able to regulate adh1 mRNA levels independent of its native promoter (Fig.
7A). When nmt1-adh1 cells were grown in the absence of thiamine, adh1AS truncations that were previously shown to regulate adh1 mRNA levels in a zinc-dependent manner
(Fig. 10, constructs 1, 2, and 4) had no additional effects on the levels of adh1 mRNA, as adh1 mRNA was regulated by the endogenous adh1AS transcript (Fig. 13, empty vector).
However, these constructs were able to modestly reduce nmt1 mRNA levels in a zinc- dependent fashion (Fig. 13, constructs AS1-3412, AS1-3348, and AS1026-3348). This result was surprising because the endogenous adh1AS transcript expressed in the nmt1-
53 adh1 strain background was not sufficient to regulate nmt1 mRNA (Fig. 7A and Fig. 13, empty vector). These results suggest that the regulation of nmt1 transcripts is specific to the presence of the adh1AS overexpression constructs. Although the endogenous adh1AS transcript expressed in the nmt1-adh1 strain contained sequence complementarity to nmt1 promoter, the plasmid-based constructs shared no sequence complementarity to the nmt1 gene. Thus, the mechanism by which the truncated adh1AS plasmid constructs act to regulate nmt1 expression in trans appears complex, but requires a second adh1 locus as expressed from the transgene.
4.2.6 Regulation of the adh1AS transcript is not dependent on the RNAi machinery
Through the use of transgenes, it was determined that bidirectional transcription was necessary for the zinc-dependent regulation of the adh1AS transcript (Fig. 11A, AS mTATA). In S. pombe studies have shown that bidirectional transcription is necessary for an RNAi response via the production of siRNAs (Colmenares et al, 2007; Bühler et al, 2008). Since siRNAs have been shown to be generated at the adh1 locus, we hypothesized that RNAi could be involved in the zinc-dependent regulation of the adh1 sense-antisense pair (Bühler et al, 2008).
To study the effects of the RNAi machinery on adh1 sense-antisense regulation, we first examined the endogenous adh1 sense-antisense pair in deletion mutants known to play a role in RNAi. In addition, an antisense transgene construct (pRep3x-pgk1- adh1AS 1026-3348) that had previously shown zinc-dependent regulation was transformed in dcr1Δ, rdp1Δ, ago1Δ, and clr4Δ strains. Use of this truncation construct allowed the regulation of the adh1AS transcript to be examined independent of
54 transcriptional regulation. Northern blot analysis examining both the endogenous and the plasmid-based adh1AS transcripts suggested that zinc-dependent regulation at the adh1 locus was independent of the RNAi machinery (Fig. 14).
Figure 13. adh1AS plasmid truncations can effect the regulation of other genes. Northern blot of nmt1-adh1 cells transformed with truncated adh1AS transgenes expressed from the strong, constitutive pgk1 promoter. nmt1-adh1 cells were transformed with empty vector (pRep3x-pgk1) or adh1AS transgenes (constructs 1-5 as shown in Figure 9A). Total RNA was purified from cells that were grown in ZL- EMM + 100 µM Zn in the absence of thiamine. In the absence of thiamine, the endogenous adh1 is expressed from the nmt1 promoter. Ribosomal RNAs were stained with ethidium bromide and are shown as a loading control. 55
Figure 14. The RNAi machinery is not involved in regulation of the adh1AS transcript. Northern blots of dcr1Δ, rdp1Δ, ago1Δ, and clr4Δ strains transformed with empty vector (pRep3x-pgk1) or pRep3x-pgk1-adh1AS 1026-3348, denoted as AS. RNA was purified from cells that were grown in ZL-EMM + 200 µM Zn. The adh1AS-2 probe detects both the endogenous adh1AS (upper band) and adh1AS transcript produced from the plasmid- based transgene.
Since published studies have shown that siRNAs are generated at the adh1 locus, we attempted to determine the levels and strand-specificity of siRNA generated under both high and low zinc conditions (Bühler et al, 2008). Using a polyethylene glycol
(PEG) precipitation protocol to enrich for siRNAs, we were unable to observe siRNAs generated from either strand at the adh1 locus. Therefore, these results were inconclusive.
56
In S. pombe, RNAi is known to silence genes through formation of heterochromatin (Moazed, 2009). In addition, because some natural antisense transcripts have been shown to act via a mechanism of chromatin remodeling, ChIP was performed to determine if histone proteins at the adh1 locus were modified differently (either with active marks or repressive marks) based on changes in intracellular zinc levels. For ChIP analysis, cells were grown under high zinc (ZL-EMM + 200 µM Zn) or low zinc (ZL-
EMM) conditions and then analyzed for changes in chromatin structure under each given condition using antibodies raised against H3K9ac (Millipore, 07-352), H3K9me2
(Abcam, ab1220), and H3K36me3 (Abcam, ab9050). When comparing histone marks from cells grown under high or low zinc conditions, there were no evident changes.
Therefore, these results, along with northern blots results obtained with the RNAi mutants suggest that the adh1 sense-antisense pair is not regulated via a mechanism of
RNAi or through heterochromatin formation.
4.2.7 Screening for genes involved in adh1 sense-antisense regulation
To determine a possible mechanism for adh1 sense-antisense regulation, several deletion strains were either created in our lab or obtained from the S. pombe haploid deletion mutant library (Bioneer). Strains were grown in ZL-EMM + zinc supplement
(ranging from 100-200 µM Zn), total RNA was purified, and northern blots were run to determine the effect of each deletion on the zinc-dependent regulation of the endogenous adh1 sense-antisense pair. A list of strains screened for involvement in the zinc- dependent regulation of the adh1 sense-antisense pair can be found in Table 1.
57
Table 1. Genes screened for involvement in adh1 sense-antisense regulation.
Common Gene Name Function Reference Name predicted Puf family RNA-binding SPBC56F2.08c pombase.org protein SPAC1687.22c puf3 Puf family RNA-binding protein pombase.org predicted Puf family RNA-binding SPAC6G9.14 pombase.org protein predicted Puf family RNA-binding SPAC4G8.03c pombase.org protein SPCP1E11.11 puf6 Puf family RNA-binding protein pombase.org poly(A) polymerase; involved in Stevenson and Norbury, SPAC19D5.03 cid1 checkpoint response to replication 2006 stress poly(A) polymerase; involved in Stevenson and Norbury, SPAC821.04c cid13 regulation of suc22 mRNA 2006 poly(A) polymerase; part of TRAMP Stevenson and Norbury, SPAC12G12.13c cid14 complex involved in RNA degradation 2006 poly(A) polymerase; predicted role in Stevenson and Norbury, SPAC17H9.01 cid16 mitochondrial RNA processing 2006 CCR4-Not complex CAF1 family SPCC18.06c pop2 pombase.org ribonuclease subunit Caf1 nuclear exosome 3'-5' exoribonuclease SPAC1F3.01 rrp6 pombase.org subunit SPAC17A5.14 xrn1 5’-3’cytoplasmic exonuclease pombase.org SPBC119.11c pac1 double-strand-specific ribonuclease pombase.org enhancer of RNA-mediated gene SPBPB21E7.07 aes1 pombase.org silencing NADPH quinone oxidoreductase; SPCC1442.16c zta1 pombase.org predicted ARE-binding protein SPCC188.13c dcr1 dicer; involved in RNAi pombase.org SPAC6F12.09 rdp1 RNA-directed RNA polymerase pombase.org SPCC736.11 ago1 argonaute; involved in RNAi pombase.org SPBC428.08c clr4 histone H3 lysine methyltransferase pombase.org chromatin remodeler involved in SPAC29B12.08 clr5 Hansen et al, 2011 histone deacetylation SPAC21E11.03c pcr1 stress-responsive transcription factor Sansó et al, 2008 SPBC29B5.01 atf1 stress-responsive transcription factor Sansó et al, 2008 MAP kinase; activated in response to SPAC24B11.06c sty1 pombase.org stress SPAC1783.07c pap1 stress-responsive transcription factor pombase.org cAMP-dependent protein kinase SPAC8C9.03 cgs1 pombase.org regulatory subunit cAMP-dependent protein kinase SPBC106.10 pka1 pombase.org catalytic subunit RNA-binding protein involved in SPAC27D7.03c mei2 pombase.org meiosis SPAC1006.03c red1 RNA elimination defective protein pombase.org
58
Strains were screened that were known to play a role in RNA stability, RNA degradation, RNAi, and stress responses. Although many genes were screened for involvement in zinc-dependent regulation of the endogenous adh1 sense-antisense pair, most results were negative or inconclusive. However, preliminary data obtained from two deletion strains, cid14Δ and mei2Δ, showed misregulation of endogenous adh1 sense mRNA and the adh1AS transcript, respectively (Fig. 15).
Mei2 is an RNA binding protein whose activity governs whether a cell enters meiosis. During meiosis, Mei2 is responsible for sequestering Mmi1, which is involved in the elimination of meiosis-specific transcripts during mitosis (Yamamota, 2010).
Therefore, because the adh1AS transcript does not accumulate to high levels under low zinc condition in a mei2Δ strain, as in a WT strain, this may implicate a new role for
Mei2 outside of meiosis (Fig. 15).
Cid14 is known to be involved in RNA degradation and is homologous to the
Trf4/5 components of the TRAMP complex from S. cerevisiae (Stevenson and Norbury,
2006). In S. pombe, Cid14 has been found to play a role in siRNA formation by degrading small RNAs that would otherwise enter the RNAi pathway (Bühler et al,
2008). Results obtained from northern blot analysis revealed that in a cid14Δ mutant, adh1 sense transcripts accumulate to modest levels under low zinc conditions (Fig. 15).
This suggests that Cid14 could have a role in the regulation of adh1 sense transcripts at the adh1 locus.
59
Figure 15. Cid14 and Mei2 may have a role in the zinc-dependent regulation of adh1 sense and antisense transcripts. Northern blots of WT, cid14Δ, and mei2Δ strains. For northern analysis, total RNA was purified from cells grown in ZL-EMM + 200 µM Zn. In a cid14Δ mutant, adh1 mRNA accumulates to modest levels in cells grown under low zinc conditions. In a mei2Δ strain, low levels of adh1AS transcripts are produced in cells grown under low zinc conditions, and adh1 mRNA levels become constitutive in both high and low zinc.
60
Pop2 (also referred to as Caf1), is involved in RNA degradation, and acts as a deadenylase in the Ccr4-Not2 complex. Studies have shown that Pop2 preferentially binds Zn2+ and Mn2+; however, when zinc is in excess, its enzymatic activity decreases
(Andersen et al, 2009). Consistent with this data, we have also showed that a pop2Δ strain is sensitive to low zinc (Fig. 16B, EMM + 100 µM EDTA).
When pop2 was screened for its involvement in the regulation of the adh1 sense- antisense pair, both the endogenous adh1 sense and antisense transcripts were regulated as in a WT cell. However, when the pop2Δ strain was transformed with a pRep4x-pgk1- adh1AS 1026-3348 (denoted as AS) to examine the regulation of the adh1AS transcript independent of its zinc-dependent transcriptional regulation, the adh1AS transgene construct accumulated under both high and low zinc conditions (Fig. 16A). The pRep4x- pgk1-adh1AS 1026-3348 plasmid was created by subcloning the pgk1-adh1AS 1026-3348 fragment into similar sites of pRep4x (Forsburg, 1993). This result suggests that Pop2 may play a role in the post-transcriptional regulation of the adh1AS transcript.
61
Figure 16. Pop2 may play a role in the post-transcriptional regulation of the adh1AS transcript. (A) WT and pop2Δ strains transformed with empty vector (pRep4x) or pRep4x-pgk1-adh1AS 1026-3348, denoted as AS. RNA was purified from cells that were grown in ZL-EMM + 200 µM Zn. The adh1AS-2 probe detects both the endogenous adh1AS (upper band) and adh1AS transcript produced from the plasmid-based transgene. (B) The pop2Δ strain shows a growth defect on plates containing EDTA, which chelates zinc.
For mRNAs, stability is typically governed by the presence of the 5’ m7G-cap and poly(A) tail, and this is also true for many non-coding RNAs (Prasanth et al, 2007; Beiter et al, 2009; Berretta and Morillon, 2009). Because northern analysis suggested that Pop2 plays a role in the post-transcriptional regulation adh1AS transcript, assays were also 62 conducted to determine if the adh1AS was polyadenylated, and if so, to determine the length of its poly(A) tail. Poly(A) tail determination was performed on the adh1AS transcript using a kit from Affymetrix. Results from several trials using different strain backgrounds and growth conditions showed that multiple adh1AS transcripts are produced at the adh1 locus, and that poly(A) tail length varies greatly (from ~2-20 As) among samples.
4.3 Discussion
This data shows that the adh1AS transcript is regulated by zinc at multiple levels.
The mechanism by which the adh1AS transcript is regulated at the transcriptional level has recently been characterized. Data presented later in this study identifies Loz1 as a transcription factor involved in the zinc-dependent regulation of the adh1AS transcript, as well as other genes involved in zinc homeostasis (see Chapter 5)
The mechanism by which the adh1AS transcript is regulated independent of its promoter (and thus transcriptional regulation) is more complex. Northern analysis using truncated adh1AS transgenes mapped two regions of the adh1AS transcript: a region necessary for zinc-dependent regulation and a region necessary for the regulation of adh1 mRNA (Fig. 10). In addition to the adh1AS transgenes shown in this study (Fig. 10), additional adh1AS trangenes were created to further define a minimal zinc-responsive region. A truncated adh1AS transgene containing adh1AS sequence from 1-2820, showed little zinc-dependent regulation as compared to the full-length adh1AS construct.
Therefore, these results suggest that the sequence near the far 3’ end (or even the
63 terminator sequence) of the adh1AS transcript is required for zinc-dependent post- transcriptional regulation.
Although bidirectional transcription seems to be a requirement for the zinc- dependent regulation of adh1AS transgenes expressed from the constitutive pgk1 promoter, a threshold of adh1 sense transcription may be required for this mechanism.
When the full-length adh1AS transgene was expressed in an adh1Δ strain, no zinc- dependent regulation was observed (Fig. 11B). However, in the presence of thiamine, the nmt1-adh1 shutdown strain showed strong zinc-dependent regulation (Fig. 11A). We predicted that these differences were due to the low, basal levels of adh1 sense transcription present in the nmt1-adh1 strain (in the presence of thiamine) (Fig. 12). In all of the adh1AS transgene constructs used in this study, adh1AS expression was driven from the strong, constitutive pgk1 promoter. Therefore the levels of adh1AS transcripts produced in the absence of a functional, endogenous adh1 gene (as seen in the adh1Δ strain) may be too much for a functional copy of adh1 (as produced from the adh1AS transgene) to overcome. Therefore, by driving expression of the full-length adh1AS transcript from a weaker, constitutive promoter, it may be possible to restore zinc- dependent regulation in an adh1Δ strain.
This study has found that the adh1AS transcript can work both in cis and in trans to regulate adh1 expression. However, we have found that regulation in trans is not as strong as regulation in cis. For example, when adh1AS trangenes were introduced into the
SPCC13B11.02cΔ strain, adh1AS transcripts expressed from the transgene were able to reduce adh1 sense transcripts in trans produced at the endogenous locus in low zinc, but
64 this switch was not as clear as cis-based regulation observed in a WT cell (Fig. 10). In addition, when adh1AS trangenes were introduced into the nmt1-adh1 strain, adh1AS transcripts expressed from the transgene were able to modestly reduce nmt1 levels (Fig.
13). Although the endogenous adh1AS transcript expressed in the nmt1-adh1 strain contains sequence complementarity to nmt1 promoter, it alone had no effect on the expression of nmt1 (Fig. 7A and Fig. 13, empty vector). Therefore, this suggests that the presence of an additional copy of the adh1 locus (expressed from a transgene) could effect the regulation of other genes that share sequence complementarity. Although no mechanisms have been directly tested, we hypothesize that overexpression of the adh1AS transcript from the transgene may act to ‘flood’ the cell, and in turn, no adh1 mRNA can be produced. To cope with the high abundance of adh1AS transcripts produced from the transgene, cells may elicit RNAi and create siRNAs at the endogenous adh1 locus.
Because the endogeous adh1 locus shares sequence complementarity to nmt1 promoter, these siRNAs could, therefore, effect nmt1 expression.
Because adh1 sense expression was found to be necessary for regulation of the adh1AS transcript, this suggests that the second mechanism of adh1AS regulation may be either at the post-transcriptional or co-transcriptional level. In addition, although RNAi seemed to fit all preliminary criteria for regulation of the adh1 sense-antisense pair, northern analysis has shown that deletion of key players involved in the RNAi pathway
(dcr1, rdp1, ago1, and clr4) does not effect the zinc-dependent regulation of adh1 sense or antisense transcripts (Fig. 14). Therefore, RNAi does not likely play a role in regulation at the adh1 locus, unless it is redundant with a second mechanism.
65
Data obtained from adh1AS transgenes expressed from the pgk1 promoter in the pop2Δ strain support a mechanism of zinc dependent post-transcriptional regulation (Fig.
16A). Pop2 acts in the RNA degradation pathway by deadenylating transcripts prior to their exonucleolytic decay (Decker and Parker, 2002). Because Pop2’s activity is regulated by zinc, it seemed to be an obvious candidate for adh1AS regulation. Data shown here would suggest that Pop2 acts to degrade the adh1AS transcripts when cellular zinc becomes replete (Fig. 16A). However, increasing zinc concentrations have been shown to decrease Pop2’s activity in vitro (Andersen et al, 2009). This in vitro data would therefore suggest that Pop2 would be highly active in zinc-limiting cells, but would be less active when cellular zinc was in excess. Because this is the opposite effect that we observed in a pop2Δ mutant, there may be differences in Pop2 activity in vitro and in vivo, or Pop2 may act indirectly to affect adh1AS levels by regulating another unknown factor involved in the zinc-dependent regulation of the adh1AS transcript.
Studies with the adh1 sense-antisense pair have shown that antisense transcripts can be regulated multiple levels to assure that they function efficiently to regulate their sense counterpart. In addition we show that bidirectional transcription is important for zinc-dependent regulation of the adh1AS transcript. Bidirectional transcription at other gene loci has been shown to result in RNAi-mediated gene silencing (Moazed, 2009).
However, we found no evidence to suggest that bidirectional transcription from both sense and antisense promoters results in RNAi-mediated degradation. We have found that other factors known to be involved in RNA degradation and RNA stability (Cid14, Mei2, and Pop2) may be involved in regulation of the adh1 sense-antisense pair (Fig. 15 and
66
16), however, the mechanism(s) by which these factors act remains unclear. Therefore, results from this study suggest a novel mechanism of strand-specific RNA accumulation in response to changes in nutrient levels, and provide insight into the mechanisms by which antisense transcripts can be regulated at multiple levels.
67
Chapter 5
Discovery of Loz1: A novel protein involved in zinc homeostasis
5.1 Introduction
Zinc, like other essential trace metals, is necessary for cell growth and viability but is toxic when in excess. Thus, cells have evolved a variety of mechanisms to maintain relatively constant levels of intracellular zinc. To date, two transcription factors,
Zap1 and MTF-1, have been shown to directly sense and respond to changes in intracellular zinc levels (Eide, 2009; Günther et al, 2012a).
In many species, genes involved in zinc homeostasis are regulated at the transcriptional level (Rutherford and Bird, 2004; Ehrensberger and Bird, 2011). However, direct homologs of the only known sensor of zinc deficiency, Zap1, are only found in the budding yeast and some pathogenic fungi (Eide, 2009; Staats et al, 2013). Because S. pombe does not contain a Zap1 homolog, but shows similar regulation of genes involved in zinc homeostasis, we utilized the fission yeast to study zinc homeostasis and to search for novel factors involved in sensing zinc deficiency.
Data produced from our lab has shown that alcohol dehydrogenase expression is regulated by changes in intracellular zinc levels (Ehrensberger et al, 2013). In studying the function of adh1, our lab discovered a spontaneous mutation that led to a loss of transcriptional regulation of zinc-regulated genes. Data presented in this chapter maps
68 the position of this mutation to SPAC25B8.19c, a gene which we named loz1, for loss of zinc sensing 1, and reveals that Loz1 is necessary for the transcriptional repression of known target genes (adh4, vel1, adh1AS, and zrt1) when cellular zinc is in excess.
5.2 Results
5.2.1 A spontaneous, second-site mutation in an adh1Δ strain led to a loss of zinc sensing
In S. pombe genes can be knocked-out to study their function using a reverse genetics approach. In knocking-out the adh1 ORF with a kanamycin-resistant cassette
(kanMX6), a single transformant was obtained that showed increased expression of adh4 and the high affinity zinc transporter, zrt1, when cells were grown in a zinc-rich medium; a condition in which adh4 and zrt1 would typically not be expressed.
Because the loss of adh1 function was not expected to cause misregulation of adh4 and other genes involved in zinc homeostasis, the adh1Δ strain was backcrossed to a wild-type strain to determine if the loss of adh1 function was responsible for the observed phenotype. By analyzing tetrads produced from the cross, it was determined that the loss of adh1 function was not responsible for the phenotype; but instead, the adh1Δ strain had picked up a second-site mutation that segregated independently from the adh1Δ::kanMX6 allele. This second-site mutation was referred to as loz1-1, for loss of zinc sensing, allele 1, because the loz1-1 phenotype produced a gene expression pattern similar to that of zinc-limited cells, even when cell were grown under zinc-replete conditions (Corkins et al, 2013).
69
5.2.2 Linkage mapping to determine the site of the loz1-1 mutation
Linkage analysis was used to determine the location of the loz1-1 allele. The loz1-1 allele was initially crossed to gene deletions (obtained from the Bioneer S. pombe haploid deletion mutant library) located on each of the three S. pombe chromosomes.
Because tightly linked genes will co-segregrate together and non-linked genes will segregate independently, tetrads were analyzed for recombination. A high recombination frequency (or the production of tetratype or non-parental ditype tetrads from an individual cross) is consistent with non-linked genes, whereas, formation of predominantly parental ditype tetrads is consistent with linked genes, located on homologous chromosomes (Fig. 17)
Initial linkage analysis suggested that the loz1-1 allele was located on chromosome 1. By crossing the loz1-1 allele to gene deletions located on both arms of chromosome 1, it was deduced that the loz1-1 allele was on the right arm of chromosome.
Further linkage and sequence analysis completed by others in the lab determined that the loz1-1 mutation was located within the SPAC25B8.19c open reading frame (Table 2).
Therefore our lab named this gene loz1, for loss of zinc sensing 1 (Corkins et al, 2013).
70
Figure 17. Origins of different tetrad types (modified from Sherman, 1998). Types of tetrads as obtained from the cross AB x ab. Because double crossovers are a rare event, in linkage analysis, when the parental ditype (PD) > non-parental ditype (NPD), this suggests that alleles are linked, or located on the same chromosome.
71
Table 2. Results from linkage analysis to determine the position of the loz1-1 mutation. The loz1-1 allele was crossed to the Bioneer S. pombe haploid deletion mutant library strains shown below. Tetrads were characterized as parental ditype (PD), non-parental ditype (NPD) or tetratype (TT). Map distances were calculated for linked genes as shown in the methods section. Only map distances between loz1-1 and genes located on chromosome 1 are shown.
Number Map Chromosome Gene Common Start PD TT NPD of number name name distance tetrads (cM) SPAC25B8.01 dap1 4155473 6 0 0 6 0 1 SPAC25B8.19c loz1 4192642 N/A N/A N/A N/A N/A SPAC694.02 4200185 6 0 0 6 0 SPAC694.04c 4206795 8 3 0 11 13.64 SPAC1F7.11c 4245302 11 1 0 12 4.16 SPAC2C4.09 4276024 5 1 1 7 50.00 SPAC25G10.02 cce1 4297129 4 3 0 7 21.43 SPAC25G10.05c his1 4304689 4 2 0 6 16.67 SPAC27F1.08 pdt1 4331339 4 7 0 11 31.82 SPAC23D3.04c gpd2 4342487 8 8 0 16 25.00 SPAC1527.03 4384659 5 7 1 13 50.00 SPBC577.02 rpl3801 754652 0 2 5 7 2 SPBC18E5.11c edc3 2094393 0 2 6 8 SPCC162.01c 1587869 1 7 3 11 3 SPCC1442.16c zta1 1794979 1 3 0 4 SPCC126.09 2131761 1 7 1 9 SPAC22E12.11c set3 5039902 1 4 0 5
5.2.3 Loz1 is transcriptional regulator of zinc-dependent gene expression
To confirm that the loz1-1 allele led to a loss of zinc-dependent gene regulation, wild type and loz1-1 cells were grown under zinc-limiting or zinc-replete conditions, and total RNA was purified. By northern analysis we determined that the loz1-1 allele led to a misregulation of genes known to be regulated by changes in intracellular zinc levels; these genes included adh4, vel1, zrt1 and the adh1AS transcript (Fig. 18 and data not
72 shown). This data, therefore, suggested that Loz1 (SPAC25B8.19c) was either involved in the transcriptional or post-transcriptional regulation of these target genes.
Figure 18. The loz1-1 mutant allele shows a misregulation of genes regulated by changes in intracellular zinc levels. For northern blot analysis, total RNA was purified from WT and loz-1 cells grown in ZL-EMM + 100 µM Zn. 73
To determine if the loz1-1 allele was involved in the transcriptional or post- transcriptional regulation of the adh1AS transcript, adh1AS transgenes constructs that had previously shown zinc-dependent regulation when expressed from the constitutive pgk1 promoter were transformed into the loz1-1 SPCC13B11.02cΔ double mutant (Fig. 10, constructs 1 and 4). In this strain, no endogenous adh1AS transcripts are produced, so the ability of the loz1-1 mutant allele to regulate the adh1AS transgenes could be directly examined. When the adh1AS transgenes (pRep3x-pgk1-adh1AS 1-3412 and pRep3x- pgk1-adh1AS 1026-3348) were transformed into the loz1-1 SPCC13B11.02cΔ strain, both adh1AS transgene constructs showed strong zinc-dependent regulation (Fig. 19, adh1AS-
2). These results suggested that the loz1-1 allele does not affect the zinc-dependent post- transcriptional regulation of the adh1AS transcript. In addition, in this strain (even in the presence of the empty vector), adh1, adh4, and vel1 mRNA levels were also regulated by zinc, with transcripts accumulating to higher levels in high zinc as compared to low zinc
(Fig. 19). This result was surprising because the lack of the endogenous adh1AS transcript in the SPCC13B11.02cΔ strain (in the single mutant background) had not previously effected the regulation of adh4 or vel1 (Fig. 5A and data not shown).
To determine if Loz1 was involved in the zinc-dependent transcriptional regulation of known zinc-regulated genes, lacZ reporter constructs for adh4, vel1, and sod1, as well as an empty vector (pJK148), were transformed into WT and loz1Δ strains
(Corkins et al, 2013). In loz1Δ cells transformed with the adh4-lacZ and vel1-lacZ reporter constructs, beta-galactosidase activity was constitutive in cells grown under both
74
Figure 19. The loz1-1 allele is not involved in the zinc-dependent post-transcriptional regulation of the adh1AS transcript. Northern blot analysis of loz1-1 SPCC13B11.02CΔ cells transformed with adh1AS transgenes. loz1-1 SPCC13B11.02CΔ cells were transformed with pRep3x-pgk1 (empty vector), pRep3x-pgk1-adh1AS 1-3412 (AS1- 3412) or pRep3x-pgk1-adh1AS 1026-3348 (AS1026-3348). RNA was purified from cells that were grown in ZL-EMM + 100 µM Zn.
75
Figure 20. Loz1 is involved in the transcriptional regulation of zinc-regulated genes. LacZ assay of WT and loz1Δ cells transformed with lacZ reporter gene constructs. Cells were grown in either ZL-EMM + 200 µM Zn before beta-galactosidase activity was measured.
high and low zinc conditions (Fig. 20). Activity from the control sod1-lacZ reporter was unaffected by changes in intracellular zinc levels or the deletion of the loz1 gene. The loss of zinc-dependent regulation, as seen in loz1Δ cells transformed with the adh4-lacZ and vel1-lacZ reporters, suggests that Loz1 acts as a repressor; and therefore, loss of Loz1 activity causes constitutive activation of its target genes.
76
5.2.4 Loz1 autoregulates its own expression
Our lab has previously shown that in a wild type cell, loz1 mRNA is regulated by zinc, accumulating to higher levels when zinc is limiting (Corkins et al, 2013). Because
Loz1 is important for zinc-dependent gene regulation in S. pombe, this suggests that Loz1 regulates its own expression. To test this hypothesis, a reporter gene construct was created that fused the loz1 promoter to the lacZ gene. The loz1-lacZ reporter was transformed into WT, loz1-1, and loz1Δ cells, cells were grown in ZL-EMM + 0, 50, 200, or 500 µM zinc, and beta-galactosidase activity was measured. WT cells were also transformed with an empty vector (pJK148) as a negative control. Consistent with northern blot analysis, wild type cells transformed with the loz1-lacZ reporter showed higher beta-galactosidase activity in cells grown under low zinc conditions, as compared to cells grown under high zinc conditions. In the loz1-1 strain, this zinc-dependent regulation was partially lost, and in the loz1Δ strain beta-galactosidase activity was high and constitutive under all growth conditions (Fig. 21). Therefore, these results suggest that Loz1 autoregulates its own expression, repressing transcription when cellular zinc is in excess.
77
Figure 21. Loz1 autoregulates its own expression. WT, loz1-1, and loz1Δ cells transformed with loz1-lacZ reporter.
5.3 Discussion
Here we show that a spontaneous, second-site mutation in an adh1Δ strain led to a loss of zinc sensing. Although the phenotype of the original adh1Δ transformant (i.e. the loz1-1 adh1Δ strain) was surprising, as loss of adh1 function would not be expected to cause misregulation of adh4 and other genes involved in zinc homeostasis, this result was consistent with data produced from the Giga-Hama lab from Japan. In an adh1Δ strain which they independently created, the Giga-Hama lab observed increased adh4 expression in cells grown in rich media using RT-PCR (Sakurai et al, 2004). At this time, we have not been able to obtain the adh1Δ strain from the Giga-Hama lab to determine if it also contains a second-site mutation in loz1. However, data from both our
78 lab and the Giga-Hama lab would suggest that spontaneous mutations in an adh1Δ strain may occur as survival mechanism to increase fermentation or reduce the buildup of acetaldehyde by increasing the expression of adh4 in high zinc.
Data presented here shows that Loz1 is a novel protein that affects the transcriptional regulation of genes involved in zinc homeostasis. Other data produced in the lab further defines Loz1 as a transcription factor that binds in a site-specific manner to the promoter region of adh4 (and other target genes) to repress its activity (Corkins et al, 2013). Other known zinc sensors (Zap1 and MTF-1) contain multiple zinc fingers that are directly involved in zinc sensing (Eide, 2009; Günther et al, 2012a). Since Loz1 contains two Cys2-His2-type zinc fingers at its extreme C-terminus, one possibility is that the double zinc finger motif is important in Loz1 zinc-dependent gene regulation in S. pombe.
A surprising result was obtained when the loz1-1 allele was cross to the
SPCC13B11.02cΔ strain, which lacks the endogenous adh1AS transcript. These double mutant cells showed differences in the regulation of adh4 and vel1 expression as compared the loz1-1 single mutant cells (compare Fig. 18, loz1-1 to Fig. 19, empty vector). This suggests that changes observed in regulation were due to the absence of the endogenous adh1AS transcript in the loz1-1 SPCC13B11.02cΔ strain. However, the absence of the endogenous adh1AS transcript in SPCC13B11.02cΔ single mutant cells had not previously affected the regulation these genes (Fig. 5A and Fig. 10). Thus, the differences in regulation could be due to decreased activation of target genes under zinc- limiting conditions, or they could suggest that the endogenous adh1AS transcript
79 genetically interacts with Loz1. Because the loz1-1 allele is only a weak, loss-of-function allele, the SPCC13B11.02cΔ strain could be crossed to a loz1Δ strain (i.e. a null allele) to better test these hypotheses.
The isolation of the loz1-1 loss-of-function allele provides insight into how genes are transcriptionally regulated by changes in intracellular zinc levels in S. pombe. It also defines the mechanism in place to regulate zinc-dependent expression the adh1AS transcript. However, it is yet to be determined whether Loz1 acts as a novel zinc sensor, directly sensing changes in intracellular zinc level, or if it simply acts as a single factor in a larger complex that plays a role in the zinc sensing pathway. Further experimentation and characterization of the Loz1 protein is necessary to address these questions.
80
Chapter 6
Functional characterization of Loz1
6.1 Introduction
Because zinc is necessary for cell survival and proliferation, but can be toxic in excess, it is important to tightly regulate intracellular zinc levels, and thus, maintain zinc homeostasis. In species ranging from yeast to humans, cellular mechanisms are in place to regulate genes necessary for zinc transport, zinc sequestration, and zinc conservation
(Ehrensberger and Bird, 2011). Although several proteins are known to play a role in maintaining zinc homeostasis, currently only two transcription factors, Zap1 and MTF-1, are known to directly sense and respond to changes in intracellular zinc levels (Eide,
2009; Ehrensberger and Bird, 2011; Günther et al, 2012a).
Although Zap1 and MTF-1 are both zinc sensors, they each sense zinc through different mechanisms. Zap1 senses changes in intracellular zinc levels though two activation domains, AD1 and AD2 (Bird et al, 2000; Bird et al, 2003; Herbig et al, 2005;
Eide, 2009; Frey and Eide, 2011). Although it is not well known how AD1 senses zinc,
AD2 has been shown to bind zinc in a labile fashion (Bird et al, 2003; Wang et al, 2006).
When the ZF1/2 pair of AD2 is in its zinc-bound form, the protein forms a closed conformation; however, when no zinc is bound, it forms in open conformation that recruits other cofactors necessary for activation of transcription (Qiao et al, 2006). In
81 addition, recent evidence also suggests that DNA binding by Zap1 is also regulated by zinc (Frey at al, 2011).
In contrast to Zap1, MTF-1 is regulated at multiple levels by zinc (Günther et al,
2012a). Studies have shown that the localization of MTF-1, the DNA binding of MTF-1 to the promoters of target genes, and transactivation domain function are regulated by cellular zinc levels (Heuchel et al, 1994; Radtke et al, 1995: Smirnova et al, 2000;
Saydam et al, 2001). In addition, metal-dependent phosphorylation of MTF-1 has also been shown to be important for its activity (LaRochelle et al, 2001).
Because there had been no previously described zinc sensor in S. pombe, and because mutations in loz1 resulted in the misregulation of genes involved in zinc homeostasis, we hypothesized that Loz1 was a novel zinc sensor that utilized its double zinc finger domains to sense zinc. Therefore, to test this hypothesis, we sought to characterize Loz1 function at multiple levels. This chapter focuses on how loz1 is regulated at the RNA and protein level, as well as how mutations in loz1 effect the expression of target genes. Data presented in this chapter suggests that the Loz1 double zinc finger domain at its extreme C-terminus is critical for the zinc-dependent regulation of target genes, and its expression is sufficient for zinc-responsive repression of certain target genes.
6.2 Results
6.2.1 A screen to identify genes associated with zinc sensing
The original loz1-1 allele was isolated from a spontaneous mutation that occurred in the adh1Δ strain. This second-site mutation in the adh1Δ strain caused misregulation
82 of genes involved in zinc homeostasis. We had previously shown that antimycin A, a drug that inhibits respiration, inhibits the growth of an adh1Δ strain (Fig. 12A). However, adh1Δ cells containing the loz1-1 mutation were able to survive when grown on media containing antimycin A. In addition, we observed that the growth rate of this strain was slower as compared to a WT strain (Fig. 22). Because overexpression of adh4 has also been shown to rescue the adh1Δ growth phenotype on antimycin A, we hypothesized that increased adh4 expression that resulted from the second-site loz1-1 mutation, gave rise to this phenotype (Corkins et al, 2013).
Figure 22. The loz1-1 mutation rescues the adh1Δ growth phenotype on antimycin A. Serial dilution growth assays were used to determine the phenotype of WT, adh1Δ and loz1-1 adh1Δ cells grown in the presence of antimycin A (10 µg/mL). Antimycin A is a drug that inhibits respiration. Thus, yeast strains grown in the presence of antimycin A must rely on fermentation for growth.
83
Because the original loz1-1 allele was created by a spontaneous mutation and the loz1-1 mutation was able to rescue the adh1Δ growth phenotype on antimycin A, we used this knowledge to devise a screening method to search for second-site mutations in an adh1Δ strain which led to growth on antimycin A. We hypothesized that adh1Δ cells that could survive on antimycin A would, like the loz1-1 mutant, display increased adh4 expression under all growth conditions and gene expression patterns consistent with aberrant zinc sensing.
For the screen, the adh1Δ strain was grown overnight in YES medium. adh1Δ cells were grown to approximately an OD600 of 1, and 200 µL of cell suspension were plated onto YES plates. Plates were incubated until a lawn of cells formed, and then cells were replica plated on YES + antimycin A. Colonies obtained were grown in YES, total
RNA was purified, and strains were screened for aberrant zinc sensing using northern blot analysis. Positive colonies were then sequenced at the loz1 locus to determine if the second-site mutations fell within the loz1 open reading frame (Fig. 23).
From the screen, 35 mutant strains were obtained that had the ability to grow on plates containing antimycin A and also displayed misregulation of genes involved in zinc homeostasis. All mutants screened were found to contain mutations in the loz1 open reading frame. These mutations included insertions, deletions, duplications, nonsense mutations (changing the codon to a pre-mature stop codon), and missense mutations
(Tables 3 and 4). All missense mutations, or point mutations that led to a single amino acid substitution, were positioned within the double zinc finger domain of Loz1. Since all mutations that led to aberrant zinc sensing were located within in the loz1 gene and all
84 missense mutations were clustered within the zinc finger domains, this data suggested that the zinc finger domains of Loz1 were particularly important for its function in zinc- dependent gene expression (Fig. 24).
Figure 23. Schematic of screening method to determine mutants with aberrant zinc sensing. Northern blot shows screening process completed for strains loz-28 adh1Δ to loz-34 adh1Δ .
85
Table 3. Isolated loz1 alleles containing missense or nonsense mutations. With the exception of the loz1-1 and loz1-K5 alleles, all other loz1 alleles were isolated by the described screening method. Alleles loz1-4 to loz1-25 were isolate by other lab members.
86
Table 4. Isolated loz1 alleles containing insertions, deletions, or duplications. All loz1 alleles were isolated by the described screening method.
87
Fig. 24. Schematic of the Loz1 protein. The C-terminus of the protein contains a double Cys2-His2 zinc finger domain. Cysteine and histidine residues are shown in red, and the canonical linker sequence, connecting the zinc fingers, is shown in blue. Missense mutations obtained from the screen are shown with the resulting amino acid substitution at each position.
6.2.2 Mutations in loz1 lead to a range of loss-of-function phenotypes
Our previous studies have shown that in a WT cell, the adh1AS transcript is regulated in response to changes in intracellular zinc levels. However, in a loz1 mutant background, zinc-dependent transcriptional repression is lost under zinc-replete conditions, and the adh1AS transcript is expressed under both high and low zinc conditions. The constitutive expression of the adh1AS transcript in loz1 mutant cells, in turn, decreases adh1 expression in high zinc (Fig. 18).
In our studies, we observed that certain loz1 adh1Δ double mutants strains were unable to grow on media containing G418 sulfate. This was surprising because in the
88 adh1Δ strain, the adh1 ORF is replaced with the kanMX6 cassette, which confers G418 sulfate resistance. Since loz1 adh1Δ double mutant cells express the adh1AS transcript at high levels under both high and low zinc conditions, and because the endogenous adh1AS transcript produced in the loz1 adh1Δ strain shares homology to the kanMX6 cassette, we hypothesized that high levels of the adh1AS transcript produced in certain loz1 adh1Δ double mutants strains acted to ‘silence’ expression of kanMX6 cassette, and as a result, these cells became sensitive to G418 (Fig. 25).
To characterize the phenotypes the loz1 adh1Δ mutants obtained from the screen, growth assays were conducted to determine the ability of loz1 adh1Δ double mutants to grow in the presence of G418 sulfate. We hypothesized that strong mutants would totally silence expression of kanMX6 cassette, and these null-like mutants would be sensitive to
G418 under all growth conditions. In contrast, we predicted that the G418 resistance phenotype of weaker mutants could be rescued by adding additional zinc to the growth medium, as this additional zinc would cause enough repression of the adh1AS transcript to allow expression of the kanMX6 antibiotic resistance cassette.
89
Figure 25. Schematic of the adh1 locus in a WT cell and a loz1 adh1Δ double mutant strain. (A) In a WT cell, the adh1AS transcript regulates adh1 expression. (B) In the adh1Δ strain, the adh1AS transcript shares homology to the kanMX6 cassette. High levels of the adh1AS transcript act to ‘silence’ expression of antibiotic resistance cassette, and cells do not confer G418 resistance.
When, loz1 adh1Δ double mutants were plated onto media containing G418 sulfate, only two strains (loz1-1 adh1Δ and loz1-5 adh1Δ) were able to grow (Fig. 26 and data not shown). We identified these strains as ‘weak’ mutants because they conferred
G418 resistance without any additional zinc supplement. In addition, the loz1-1 adh1Δ strain demonstrated zinc-dependent regulation of the adh1AS transcript (in ZL-EMM +
200 µM Zn) by northern blot analysis (Corkins et al, 2013). When high levels of zinc were added to the media, four additional strains were able to grow under his growth 90 condition (loz1-25 adh1Δ, loz1-K27 adh1Δ, loz1-K33 adh1Δ, and loz1-K35 adh1Δ) (Fig.
26 and data not shown). These were identified as ‘moderate’ mutant as adh1AS levels could be repressed in these strains when intracellular zinc levels were very high. This data suggests that loz1 adh1Δ double mutants obtained from the screen show a range of loss-of-function phenotypes (i.e. loss of Loz1 transcriptional repression), which range from weak (growth on G418) to strong (no growth on G418 + zinc).
Figure 26. Growth assay to measure adh1AS expression in loz1 adh1Δ double mutants. (A) For growth assay, strains were grown as previously described for serial dilution growth assays. All loz1 adh1Δ mutant strains have the ability to grow on media containing antimycin A; however, only weak and moderate loz1 alleles confer the ability to grow on media containing G418 + 2 mM Zn (B) Mutations in loz1 mutants used in panel A. (C) Classification of loz1 mutants as obtained from G418 resistance assay.
91
In addition to the G418 resistance assay, northern blot analysis was used to examine Loz1 target gene expression in several loz1 adh1Δ mutant strains. When expression of adh4, zrt1, and the adh1AS transcript were analyzed in loz1 adh1Δ double mutants classified as ‘weak’ or ‘moderate’ with point mutations located within the zinc finger domains, the expression of adh4 and adh1AS transcript were modestly regulated in response to changes intracellular zinc levels. However these alleles showed very little to no zinc-dependent regulation of zrt1 expression (Fig. 27, adh1Δ loz1-25). In contrast, strong alleles showed a null-like phenotype, as very little zinc-dependent regulation of adh4, zrt1, or the adh1AS transcript was observed. (Fig. 27, adh1Δ loz1Δ, adh1Δ loz1-K5, and adh1Δ loz1-23). These results are consistent with the results obtained from G418 resistance growth assays, and suggest that mutants obtained from the screen display loss- of-function phenotypes, ranging from weak to strong.
6.2.4 Characterization of loz1 alleles
Results from northern blot analysis and our G418 resistance assay suggest that different loz1 alleles have varying affects on Loz1 function. Therefore, to verify the phenotypes of loz1 mutants obtained from the screen, site-directed mutagenesis was used to create plasmid constructs containing similar point mutations. Mutations were created using the ploz1-GFP plasmid backbone, in which the loz1 open reading frame is expressed from the endogenous loz1 promoter (Corkins et al, 2013). This plasmid also contained a C-terminal monomeric eGFP (meGFP) tag which could be used for western blotting and protein localization. Mutations were created to directly mimic the loz1-25,
(loz1 S489F), loz1-1 (loz1 R510G) and the loz1-K33 (loz1 M513I) alleles. In addition, a
92 mutant at the loz1-K5 residue was created, substituting the original cysteine residue in the first zinc finger domain to a glycine (loz1 C470G).
Figure 27. Mutations in loz1 result in a misregulation of target genes. (A) Northern blot analysis showing target gene expression in loz1 adh1Δ double mutants isolated from the screen. For northern analysis, RNA was purified from cells that grown in ZL-EMM + 500 µM Zn (B) Mutations in loz1 mutants used in panel A.
93
To determine the effects of each point mutation on Loz1 function, loz1 site- directed mutagenesis plasmids were transformed into the loz1Δ strain. Cells were grown under zinc-limiting (ZL-EMM) or zinc-replete (ZL-EMM + zinc supplement) conditions, and total RNAs were purified for northern analysis. Using northern blot analysis, it was determined that mutant plasmids, for the most part, showed similar regulation of Loz1 target genes, as compared the endogenous loz1 mutant alleles (Fig. 28). However, as compared to the endogenous mutant alleles, in loz1Δ cells transformed with loz1 mutagenesis plasmids containing mutations previously classified as ‘weak’ (plozR510G-
GFP) or ‘moderate’ (plozS489F-GFP and ploz1M513I-GFP), we observed stronger zinc- dependent regulation of adh4, with adh4 levels showing increased repression in cells grown under high zinc conditions. In addition, in loz1Δ cells expressing plozR510G-GFP, zrt1 levels were also regulated by zinc (Fig. 28 and data not shown).
In loz1Δ cells expressing ploz1S489F-GFP or the ploz1M513I-GFP plasmid, adh4 expression was regulated in response to zinc. However, zrt1 expression was not well regulated in these strains (Fig. 28, ploz1S489F and ploz1M513I). In contrast, loz1Δ cells transformed the ploz1C470G plasmid expressed loz1 mRNA to high, constitutive levels, but showed no zinc-dependent regulation of Loz1 target genes (Fig. 28, ploz1C470G). Together, these results suggest that plasmid-based expression vectors containing partially functional loz1 mutations, overcomplement the loz1Δ phenotype, while null-like mutations show a total loss-of-function phenotype when expressed from a plasmid construct.
94
To determine why differences in target gene expression patterns existed between the endogenous loz1 mutant alleles and loz1Δ cells expressing the loz1 mutagenesis plasmid constructs, stop codons were introduced prior to the GFP coding sequence of plasmids expressing wild type loz1 or the loz1-1 mutant allele. We hypothesized that the presence of the GFP tag could increase stability or functionality of the protein product, and thus, by removing the tag, we could create a loz1 mutant plasmid more similar to its endogenous counterpart. By inserting a stop codon prior to the GFP coding sequence, it was determined that the meGFP tag was responsible for the increase in regulation of target gene expression, as this new ploz1-1 plasmid (without a functional GFP tag) functioned more similarly to the endogenous loz1-1 mutant strain (Corkins et al, 2013).
Our previous data has shown that specific amino acid substitutions within the loz1 double zinc finger domains cause a loss of Loz1 function in zinc-dependent gene regulation. In addition, because loz1 mRNAs were produced in all loz1 mutants (both plasmid-based and endogenous), we predicted that loss of Loz1 function was due to mutant protein products. To determine if loz1 mutations affected Loz1 protein levels, loz1Δ cells expressing the loz1 site-directed mutagenesis plasmids were grown under zinc-limiting and zinc-replete conditions, and crude protein extracts were purified for western blot analysis. Western blot analysis using an anti-GFP antibody (Sigma, G1544) showed that Loz1 proteins, expressed from ploz1 mutant plasmids, accumulated in cells grown under both high and low zinc conditions (Fig. 29). In contrast, cells expressing a
GPF-tagged, wild type loz1 ORF, from the ploz1-GFP plasmid, showed strong zinc- dependent regulation of Loz1, with Loz1 protein accumulating to higher levels in zinc-
95 limiting cells as compared to zinc-replete cells (Fig. 29, ploz1). These results, along with results obtained from northern analysis, suggest that loz1 mutagenesis plasmids express
Loz1 protein at high levels in cells grown under both high and low zinc conditions; however, Loz1 protein expressed in these cells is non-functional and unable to regulate target gene expression.
Figure 28. Northern analysis of loz1 site-directed mutagenesis plasmids expressed in the loz1Δ strain. The loz1Δ strain was transformed with vector (pJK148), ploz1-GFP, ploz1C470G-GFP, ploz1S489F-GFP, or ploz1M513I-GFP. RNA was purified from cells that were grown in ZL-EMM + 200 µM Zn.
96
Figure 29. Loz1 protein accumulates under high and low zinc conditions in loz1Δ cells expressing loz1 site-directed mutagenesis plasmids. (A). The loz1Δ strain was transformed with the ploz1-GFP or the ploz1R510G-GFP plasmid. WT cells were transformed with empty vector (pJK148) as a negative control. Crude protein extracts were purified from cells grown in ZL-EMM + 0, 50, 200 µM Zn. (B) The loz1Δ strain was transformed with ploz1-GFP, ploz1C470G-GFP, ploz1S489F-GFP, or ploz1M513I- GFP. Crude protein extracts were purified from cells grown in ZL-EMM + 200 µM Zn. For western blot analysis, an anti-GFP antibody (Sigma, G1544) was used to detect Loz1 protein, and an anti-actin antibody (Abcam, ab3280) was used as a loading control.
Because Loz1 protein accumulated to high, constitutive levels in loz1Δ cells expressing ploz1C470G-GFP, ploz1S489F-GFP, and ploz1M513I-GFP, but this protein was partially functional (as shown by northern analysis) we hypothesized that the loss of protein function was due to a cellular mislocalization of Loz1 protein (Fig. 28 and 29).
To test this hypothesis, fluorescence microscopy was used to determine localization of
Loz1 protein in loz1Δ cells expressing ploz1-GFP, ploz1C470G-GFP, ploz1S489F-GFP, or ploz1M513I-GFP. As shown previously, in cells expressing ploz1-GFP, Loz1 protein is localized to the nucleus under both high and low zinc conditions (Fig. 30) (Corkins et al, 2013). In loz1Δ cells expressing the mutant plasmids, ploz1C470G-GFP, ploz1S489F- 97
GFP, or ploz1M513I-GFP, Loz1 protein also localized to the nucleus under all conditions
(Fig. 30 and data not shown). In addition, at high resolution, the mutant plasmid constructs showed punctate expression of Loz1 within the nucleus. This may be due to the high levels of Loz1 expression as seen with western blotting. Overall, these results show that both wild type and mutant forms of Loz1 protein localize to the nucleus, suggesting that the inability of Loz1 mutants to regulate zinc-dependent gene expression is not a result of protein mislocalization. Therefore, mutations in loz1 alter some other aspect of Loz1 function.
98
Figure 30. Wild type and mutant Loz1 protein is expressed in the nucleus. The loz1Δ strain was transformed with ploz1-GFP, ploz1C470G-GFP, or a vector control (pJK148). Cells were grown in ZL-EMM + 200 µM Zn prior to microscopy. Fluorescence microscopy was performed using a Nikon ECLIPSE Ti inverted microscope (Wu lab, OSU). Differential interference contrast (DIC) microscopy was used to determine cell boundaries and a Hoechst stain was used to stain the nucleus.
99
6.2.5 Regulation of loz1 gene expression
The two known zinc sensors, Zap1 and MTF-1, are regulated by changes in intracellular zinc at multiple levels (Eide 2009; Günther et al, 2012a). Since Loz1 plays a role in zinc sensing in S. pombe, we predicted that loz1 expression could also be regulated at multiple levels by zinc. Our previous data has shown that loz1 expression is regulated at the transcriptional level (Fig. 21). Therefore, a plasmid construct was created to examine loz1 RNA and protein levels independent of Loz1 autoregulation. In this construct (pzhf-loz1-GFP), the zhf1 promoter was fused to the loz1 open reading frame.
We have found that the zhf1 promoter is not regulated by changes in intracellular zinc levels, and that it drives gene expression at similar level, as compared a to the loz1 promoter (Fig. 31).
To determine how Loz1 functions to regulate target gene expression, loz1Δ cells were transformed with the pzhf-loz1-GFP plasmid. In these cells, loz1 should be expressed at constant level from the zhf1 promoter. The loz1Δ strain was also transformed with the ploz1-GFP plasmid and the empty vector (pJK148) as controls.
Cells were grown in ZL-EMM + 0, 50, 200, or 500 µM zinc, and total RNA was purified.
Using northern blot analysis, loz1Δ cells transformed with the pzhf-loz1-GFP showed zinc-dependent regulation of Loz1 target genes (adh4 and zrt1) similar to loz1Δ cells transformed with the ploz1-GFP plasmid (Fig. 32A, compare ploz1 and pzhf-loz1). In addition, loz1 mRNA was also regulated by zinc in loz1Δ cells expressing loz1 from the pzhf-loz1-GFP (Fig. 32A, loz1 probe). Together, these results suggest that, when expressed from a constitutive promoter, loz1 mRNA is regulated post-transcriptionally.
100
In addition, these results show that zinc-dependent regulation of Loz1 target genes does not require Loz1 autoregulation.
Figure 31. The zhf1 promoter is not regulated by changes in intracellular zinc levels. WT cells were transformed with empty vector (pJK148), adh4-lacZ, loz1-lacZ, and zhf1- lacZ contructs. Cells were grown in ZL-EMM + 0, 50, 200, or 500 µM zinc and beta- galactosidase activity was measured. The zhf-lacZ reporter contains 1 kb of zhf1 promoter sequence located upstream of the annotated zhf1 translational start site (pombase.org).
101
Figure 32. Loz1 function is regulated independent of autoregulation. (A) Northern analysis of loz1Δ cells transformed with the vector (pJK148), ploz1-GFP (denoted as ploz1), or pzhf-loz1-GFP (denoted as pzhf1-loz1). loz1 mRNA produced from cells transformed with the pzhf-loz1-GFP plasmid is smaller in size as compared to loz1 mRNA produced from cells transformed with the ploz1-GFP plasmid; this is due to differences in the 5’ untranslated regions (UTRs) (B) Western blot of loz1Δ cells transformed with ploz1-GFP (denoted as ploz1) or pzhf-loz1-GFP (denoted as pzhf1- loz1). WT cells were also transformed with vector (pJK148) as a negative control. For western blotting, cells were grown in ZL-EMM + 0, 50, or 200µM zinc. An anti-GFP antibody (Sigma, G1544) was used to detect Loz1 protein, and an anti-actin antibody (Abcam, ab3280) was used as a loading control.
To test whether Loz1 protein levels were also regulated by zinc, western blot analysis was used to examine protein levels in loz1Δ cells expressing the pzhf-loz1-GFP plasmid. In loz1Δ cells expressing pzhf-loz1-GFP, no changes in protein levels were
102 detected (Fig. 32B). This result suggests that, although loz1 mRNA is regulated in loz1Δ cells expressing pzhf-loz1-GFP, Loz1 protein accumulates in cells grown under both high and low zinc conditions. Therefore, we predict that Loz1 function is regulated at a post- translational level.
6.2.6 Mapping the minimal zinc-responsive region of Loz1
Our data suggests that Loz1 is regulated at multiple levels by zinc and that the zinc finger domains are important for Loz1 function. To determine if the zinc finger domains were also required for zinc sensing, several plasmid truncations of ploz1-GFP were created to map a minimal region of the Loz1 protein that was sufficient for zinc- dependent regulation of target genes. When Loz1 protein truncations were expressed from the loz1 promoter, a truncation consisting of amino acids 427-522 was found to restore the zinc-dependent regulation of adh4 (Fig. 33, construct 4). Other larger constructs containing additional N-terminal sequence of the Loz1 protein also restored regulation (Fig. 33, construct 2 and 3). In contrast, a smaller truncation consisting of only the Loz1 double zinc finger domain was unable to restore zinc-dependent regulation of adh4 or any other known target genes (Fig. 33, construct 5).
When other Loz1 target genes were examined in loz1Δ cells expressing the truncated constructs, strong zrt1 expression was only observed in cells expressing the full-length Loz1 construct (Fig. 33, construct 1). In addition, zinc-dependent regulation of the adh1AS transcript was only detected in cells expressing full-length protein or a truncation consisting of amino acids 125-522 (Fig. 33, constructs 1 and 2). These results suggest that Loz1 target genes require different regions of the protein for zinc-dependent
103 regulation. Results shown here are also consistent with those obtained from the screen, which suggest that the C-terminus of the protein (which includes the double zinc finger domains) is critical for Loz1 function.
Figure 33. ploz1 truncations rescue the zinc-dependent regulation of Loz1 target genes. (A) Northern analysis of loz1Δ cells transformed with the vector (pJK148) or ploz1 constructs shown in panel B. RNA was purified from cells that were grown in ZL-EMM + 200 µM Zn. (B) Schematic of Loz1 protein truncations used in panel A. Numerical values are expressed in amino acids. All constructs also contained a C-terminal meGFP tag that is not shown in drawing.
104
To confirm that the previous results were due to protein function and not a directly a result of Loz1 autoregulation, similar constructs were created in which Loz1 protein truncations were expressed from the constitutive zhf1 promoter. Like the truncated ploz1 constructs, truncated pzhf-loz1 constructs showed similar zinc-dependent regulation of Loz1 target genes. adh4 expression was well regulated in loz1Δ cells expressing a truncated Loz1 protein consisting of amino acids 427-522. In addition, zrt1 expression was modestly regulated in these cells (Fig. 34, construct 2). In contrast, loz1Δ cells expressing a truncated Loz1 protein consisting of amino acids 448-522 showed very little zinc-dependent regulation of Loz1 target genes (Fig. 34, construct 3). Therefore, these results support previous results obtained using ploz1 truncated protein constructs, and suggest that the truncated Loz1 protein consisting of amino acids 427-522 confers a minimal zinc-responsive region, necessary for the zinc-dependent regulation of adh4.
105
Figure 34. A pzhf-loz1 truncation consisting of amino acids 427-522 rescues the zinc- dependent regulation of Loz1 target genes. (A) Northern analysis of loz1Δ cells transformed with the vector (pJK148) or pzhf-loz1 constructs shown in panel B. RNA was purified from cells that were grown in ZL-EMM + 200 µM Zn. (B) Schematic of Loz1 protein truncations used in panel A. Numerical values are expressed in amino acids. All constructs also contained a C-terminal meGFP tag that is not shown in drawing.
6.3 Discussion
Data presented here shows that Loz1 is necessary for the zinc-dependent regulation of genes involved in zinc homeostasis, as mutations in loz1 led to aberrant zinc sensing. In addition, mutations in loz1 also rescue the adh1Δ growth phenotype on antimycin A (Fig. 22). Although it is unknown how loz1 mutations give the adh1Δ strain the ability to grow in the presence of antimycin A, we hypothesize that it is due to the 106 increased expression of adh4. Supporting this hypothesis, studies have shown that amplification of adh4 in S. cerevisiae confers antimycin A resistance in an adh1Δ mutant
(Walton et al, 1986; Dorsey et al, 1992). We have also found that overexpression of adh4 in S. pombe gives an adh1Δ mutant the ability to grow in the presence of antimycin A
(Corkins et al, 2013).
Given that loz1 adh1Δ double mutants cells are resistant to antimycin A, we devised a screen to search for other genes involved in zinc sensing or other mutant alleles of loz1. From the screen, we obtained 35 mutants, all which contained mutations in the loz1 open reading frame (Table 3 and 4). Through northern analysis and a G418 resistance assay, we determined that all mutations were loss-of-function; however, mutations in loz1 varied from weak to strong. Through our G418 resistance assay, we obtained two mutants that we classified as ‘weak’ (loz1-1 adh1Δ and loz1-5 adh1Δ) and four mutants which we classified as ‘moderate’ (loz1-25 adh1Δ, loz1-K27 adh1Δ, loz1-
K33 adh1Δ, and loz1-K35 adh1Δ). Surprisingly, of these six mutants, three of these contained nonsense mutations, substituting a codon to a pre-mature stop codon.
Because introducing a pre-mature stop codon into the loz1 ORF should create a truncated protein and elicit nonsense mediated decay, we predicted that all nonsense mutations would show a ‘strong’ or null-like phenotype. However, though our G418 silencing assay (to indirectly measure adh1AS expression) and preliminary northern analysis, it appears that at least the loz1-K27 allele shows modest regulation of Loz1 target genes (adh1AS and adh4). An explanation for these results is that read-through translation is taking place. To test this hypothesis, a N-terminal tagged version of the
107 loz1-K27 allele could be created and analyzed for size (does it create a full-length Loz1 protein?), as well as functionality to confirm its phenotype. In addition, site-directed mutagenesis could be utilized to create the loz1-K27 mutation in a plasmid expression vector that could be expressed in the loz1Δ strain.
To confirm that mutations within the loz1 ORF were responsible for the phenotypes observed in mutants obtained from the screen, site-directed was used to create plasmids expressing specific point mutations. For the most part, loz1 mutagenesis expression vectors showed a phenotype similar to that of the endogenous mutants obtained from the screen. The presence of an meGFP tag fused to the C-termini of each of the vectors led to overcomplementation (i.e. increased repressive action of the Loz1 protein under conditions of high zinc, as shown with the wild type ploz1-GFP construct
(Fig. 33A, adh1AS-1 and adh4)), as introducing a stop codon into the GFP coding sequence in loz1Δ cells expressing ploz1-GFP and ploz1R510G-GFP conferred phenotypes more similar to their endogenous counterparts (Corkins et al, 2013).
By expressing loz1 site-directed mutagenesis plasmids in the loz1Δ strain, we found that Loz1 protein accumulates to higher levels in theses cells, as compared to wild type cells or loz1Δ cells expressing a wild type copy of loz1 (ploz1-GFP) (Fig. 29)
(Corkins et al, 2013). In addition, in cells expressing the loz1 mutagenesis constructs,
Loz1 protein accumulated within the nucleus (Fig. 30). This data shows that mutations in loz1 do not cause a mislocalization of Loz1 protein within the cells, but instead, loss of zinc-dependent regulation of target genes is due to another reason. Preliminary in vitro data from our lab suggests that functionality in these mutants is due to DNA binding, as
108 these mutants either bind to DNA with a very low affinity or not at all (Corkins et al,
2013; MEC and AJB unpublished observation).
Studies shown here suggest that Loz1 is regulated at multiple levels by zinc. Our previous data from loz1-lacZ assays suggest that Loz1 autoregulates its own expression
(Fig. 21). In addition, we have shown that loz1 expression is regulated post- transcriptionally, as loz1 mRNA was regulated by changes in intracellular zinc levels when loz1 was expressed from the constitutive, zhf1 promoter (Fig. 32A). Consistent with regulation at the RNA level, studies shown here also demonstrate that wild-type
Loz1 protein accumulates to higher levels when zinc is limiting (Fig. 32B). Although
Loz1 protein accumulates to higher levels when cellular zinc is limiting, Loz1 is active when zinc is in excess. Therefore, there must be a mechanism in place to activate Loz1 in high zinc, even though Loz1 protein levels are lower under this condition.
Studies with Loz1 protein truncation have shown that a Loz1 truncation containing amino acids 427-522 is sufficient to confer zinc-dependent regulation of adh4
(Fig. 33 and 34). However this region was not sufficient for zinc-dependent regulation of zrt1 or the adh1AS transcript (Fig. 33A). This suggests that although Loz1 is necessary for the regulation of all of these genes, Loz1 targets require different regions of the Loz1 protein for zinc-responsiveness. As of yet, we do not know if Loz1 requires a cofactor(s) for its activity. Thus, one explanation for the differences in regulation, as seen by comparing expression of adh4, zrt1, and the adh1AS transcript in loz1Δ cells expressing ploz1 427-522-GFP, is that Loz1 requires different cofactors that interact with different regions of the protein at each loci.
109
Known double zinc finger domains which bind to DNA are known to contain an
‘accessory’ region located N-terminal to their zinc finger domains (Fairall et al, 1992;
Bowers et al, 1999). Results shown here through Loz1 protein truncation studies, as well as electromobility shift assays performed in Corkins et al, 2013, support the hypothesis that Loz1 also requires an accessory region for DNA binding and functionality. By Loz1 protein truncation studies, we found that the ploz1 448-522-GFP construct was unable to rescue the zinc-dependent regulation of Loz1 target genes. However, the ploz1 427-522-
GFP construct, which contains an additional 21, N-terminal residues, showed strong zinc- dependent regulation of adh4 (Fig. 33A). This suggests that the additional 21, N-terminal residues contained in the ploz1 427-522-GFP plasmid are necessary for Loz1 function.
However it remains unclear if this ‘accessory’ region functions to regulate gene expression in response to changes in intracellular zinc levels.
110
Chapter 7
Concluding remarks
Zinc, like other essential trace metals, is essential for cell growth and viability but is toxic when in excess. Thus, cells have evolved a variety of mechanisms to maintain relatively constant levels of intracellular zinc. In species ranging from yeast to humans, cellular mechanisms are in place to regulate genes necessary for zinc transport, zinc sequestration, and zinc conservation (Ehrensberger and Bird, 2011). To date, most of what we know about sensing zinc deficiency has come from research in the budding yeast, S. cerevisiae. In S. cerevisiae, the transcription factor Zap1 is responsible for regulating gene expression in response to changes in intracellular zinc levels (Eide,
2009). Although much has been learned about sensing zinc deficiency using S. cerevisiae as a model species, Zap1, and its homologs, are only found in the budding yeast and other pathogenic fungal species (Staats et al, 2013). Therefore, since S. pombe does not contain a Zap1 homolog, but shows similar regulation of genes involved in zinc homeostasis, we utilized the fission yeast to study mechanisms of zinc homeostasis and to search for novel factors involved in sensing zinc deficiency.
In the first part of this study, the adh1 sense-antisense pair was used to study zinc dependent gene regulation in S. pombe. We have found that the adh1AS transcript is necessary for the zinc-dependent regulation adh1 (Fig. 5). Our data also shows that the
111 adh1AS transcript is regulated at multiple levels. It is regulated at the transcriptional level by changes in intracellular zinc (Fig. 9). In addition to this transcriptional regulation, when the adh1AS transcript is placed under a heterologous promoter, it preferentially accumulates under zinc-limiting conditions (Fig. 10). We have found that this second level of regulation is dependent on expression of adh1 (Fig. 11). Although bidirectional transcription seems to be a requirement for the zinc-dependent regulation of adh1AS transgenes expressed from the constitutive pgk1 promoter, this mechanism of zinc- dependent regulation remains unclear. Our data shows that this regulation is independent of RNAi, and supports a mechanism that requires a threshold of adh1 sense transcription under high zinc conditions (Fig. 11 and 14). Therefore, results from this study demonstrate a novel mechanism of strand-specific RNA accumulation in response to changes in nutrient levels, and provide insight into the mechanism by which antisense transcripts can be regulated at multiple levels.
The second half of this study, focuses on discovery and characterization of Loz1, a novel zinc finger protein involved in zinc-dependent gene regulation is S. pombe. By studying the function of adh1, our lab discovered a spontaneous mutation that led to a loss of zinc sensing at the transcriptional level. We found that this mutation mapped to the SPAC25B8.19c locus, and thus, we named this gene loz1, for loss of zinc sensing 1.
By characterizing Loz1 function, we have found that Loz1 is a transcription factor that represses target gene expression when intracellular zinc levels are replete (Corkins et al,
2013).
112
In addition, we have found that Loz1’s double zinc finger domain, at the extreme
C-terminus of the protein, is critical for zinc-dependent regulation of target genes. Data presented here shows that endogenous mutations lying within the zinc fingers, and mutations introduced into the loz1Δ strain on plasmid-based vectors, produce either a partially functional or non-functional Loz1 protein (Fig. 27 and 28). We hypothesize that the differences in functionality are due to the specific positions of the mutated residues, as certain residues within zinc finger domains are known to be critical for zinc binding,
DNA binding, and structural integrity. In addition, mapping studies suggest that a Loz1 truncation consisting of amino acids 427-522 is sufficient for the zinc-dependent regulation of adh4 (Fig. 33 and 34). However, additional regions of the protein are necessary for the zinc-dependent regulation of other target genes (adh1AS and zrt1) (Fig.
33A). Taken together, this data suggests that the Loz1 double zinc finger domain is critical, and in some cases sufficient, for the zinc-dependent regulation of target genes.
Although experiments shown here suggest that Loz1 is important for zinc sensing in S. pombe, further characterization is necessary to determine how its activity is regulated in response to changes in intracellular zinc levels. Considering that both MTF-1 and Zap1 are regulated on the DNA binding level one prediction is that Loz1 DNA binding is regulated by zinc (Frey et al, 2011; Günther et al, 2012a). Since Loz1 is active when zinc is in excess, we hypothesize that Loz1 binds to DNA with higher affinity when intracellular zinc levels are high. As an alternate hypothesis, Loz1 may not act as a zinc sensor. If this is the case, Loz1 activity may be regulated by another factor(s) that senses
113 zinc. Thus, more studies are necessary to determine how Loz1 activity is regulated by zinc, and if Loz1 is a novel zinc sensor in S. pombe.
Overall, the goal of this study was to characterize mechanisms of zinc-dependent regulation, in order to provide insight as to how S. pombe senses and responds to changes in intracellular zinc levels. Through this research we have characterized mechanisms of zinc-dependent regulation at the adh1 locus, and have shown that antisense transcripts can be regulated in response to changes in nutrient levels. In addition, the discovery and characterization of Loz1 has provided insight as to how S. pombe senses and responds to changes in intracellular zinc at the transcriptional level. Thus, this research is relevant in identifying different cellular mechanisms in place to ensure zinc homeostasis, as well as finding additional novel proteins involved in sensing zinc deficiency in other higher eukaryotic species.
114
References
Ackland M.L. and Michalczyk, (2006) A. Zinc deficiency and its inherited disorders- a review. Genes Nutr. 1, 41-50.
Andersen, K.R., Jonstrup, A.T., Van, L.B., and Brodersen, D.E. The activity and selectivity of fission yeast Pop2p are affected by a high affinity for Zn2+ and Mn2+ in the active site. RNA 15, 850-861.
Andreini, C., Banci, L., Bertini, I., and Rosato, A. (2006) Counting the zinc-proteins encoded in the human genome, J. Proteome Res. 5, 196–201.
Assunção, A.G., Herrero, E., Lin, Y.-F., Huettel, B., Talukdar, S., Smaczniak, C., Immink, R.G.H., van Eldik, M., Fiers, M., Schat, H., and Aarts, M.G.M. (2010) Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency. Proc. Natl. Acad. Sci. U.S.A. 107, 10296–10301.
Auf der Maur, A. Belser, T., Elgar, G., Georgiev, O., and Schaffner, W. (1999) Characterization of the transcription factor MTF-1 from the Japanese pufferfish (Fugu rubripes) reveals evolutionary conservation of heavy metal stress response, Biol. Chem. 380, 175–185.
Auf der Maur, A., Belser, T., Wang, Y., Günes, C., Lichtlen, P., Georgiev, O., and Schaffner, W. (2000) Characterization of the mouse gene for the heavy metal-responsive transcription factor MTF-1. Cell Stress Chaperones 5, 196–206.
Bähler, J., Wu, J.-Q., Longtine, M.S., Shah, N.G., McKenzie, A., 3rd, Steever, A.B., Wach, A., Philippsen, P., and Pringle, J.R. (1998) Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–951.
Barnes, P.M. and Moynahan, E.J. (1973) Zinc deficiency in acrodermatitis enteropathica. Proc R Soc Med. 66, 327–329.
Beiter, T., Reich, E., Williams, W., and Simon, P. (2009) Antisense transcription: A critical look in both directions. Cell. Mol. Life Sci. 66, 94-112.
Berretta J. and Morillon, A. (2009) Pervasive transcription constitutes a new level of eukaryotic genome regulation. EMBO Rep. 10, 973-982. 115
Bin, B.H., Fukada, T., Hosaka, T., Yamasaki, S., Ohashi, W., Hojyo, S., Miyai, T., Nishida, K., Yokoyama, S., and Hirano, T. (2011) Biochemical characterization of human ZIP13 protein: a homo-dimerized zinc transporter involved in the spondylocheiro dysplastic Ehlers-Danlos syndrome. J. Biol. Chem. 286, 40255-40265.
Bird, A.J., Gordon, M., Eide, D.J. and Winge, D.R. (2006) Repression of ADH1 and ADH3 during zinc deficiency by Zap1-induced intergenic RNA transcripts. EMBO J. 25, 5726-5734.
Bird, A.J., McCall, K., Kramer, M., Blankman, E., Winge, D.R., and Eide, D.J. (2003) Zinc finger can act as Zn+2 sensors to regulate transcriptional activation domain function. EMBO J. 22, 5137 – 5146.
Bird, A.J., Zhui, H., Luo, H., Jensen, L.T., Srinivasan, C., Evans-Galea, M., Winge, D.R., and Eide, D.J. (2000) A dual role for zinc fingers in both DNA binding and zinc sensing by the Zap1 transcriptional activator. EMBO J. 19, 3704–3713.
Bitton, D.A., Grallert, A., Scutt, P.J., Yates, T., Li, Y., Bradford, J.R., Hey, Y., Pepper, S.D., Hagan, I.M., and Miller, C.J. (2011) Programmed fluctuations in sense/antisense transcript ratios drive sexual differentiation in S. pombe. Mol. Syst. Biol. 7, 559.
Bowers, P.M., Schaufler, L.E., and Klevit, R.E. (1999) A folding transition and novel zinc finger accessory domain in the transcription factor ADR1. Nat. Struct. Biol. 6, 478- 485.
Bühler, M., Spies, N., Bartel, D.P., and Moazed, D. (2008) TRAMP-mediated RNA surveillance prevents spurious entry of RNAs into the Schizosaccharomyces pombe siRNA pathway. Nat. Struct. Mol. Biol. 15, 1015-1023.
Cablong, J., Beyrouthy, N., Guffanti, E., Schlaepfer, G., Steinmetz, L.M., and Stutz, F. (2009) Trans-acting antisense RNAs mediate transcriptional gene cosuppression in S. cerevisiae. Genes Dev. 23, 1534–1545
Camblong, J., Iglesias, N., Fickentscher, C., Dieppois, G., and Stutz, F. (2007) Antisense RNA stabilization induces transcriptional gene silencing via histone deacetylation in S. cerevisiae. Cell 131, 706–717.
Campanini, B., Editor. (2002) The World Health Report 2002: Reducing Risks, Promoting Healthy Life. World Health Organization, Geneva, Switzerland. p. 55-56.
Carthew, R.W and Sontheimer, E.J. (2009) Origins of mechanisms of miRNAs and siRNAs. Cell 136, 642-655.
116
Castelnuovo, M., Rahman, S., Guffanti, E., Infantino, V., Stutz, F. and Zenklusen, D. (2013) Bimodal expression of PHO84 is modulated by early termination of antisense transcription. Nat. Struct. Mol. Biol. 20, 851-858. Chen, H.N., Rosebrock, A.P., Khan, S.R., Futcher, B., and Leatherwood, J.K. (2012) Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe. PLoS One 7, e29917.
Chen, X. Hua, H., Balamurugan, K., Kong, X., Zhang, L., George, G.N., Georgiev, O., Schaffner, W., and Giedroc, D.P. (2008) Copper sensing function of Drosophila metal- responsive transcription factor-1 is mediated by a tetranuclear Cu(I) cluster. Nucl. Acids Res. 36, 3128–3138.
Chen, X., Zhang, B., Harmon, P.M., Schaffner, W., Peterson, D.O., and Giedroc, D.P. (2004) A novel cysteine cluster in human metal-responsive transcription factor 1 is required for heavy metal-induced transcriptional activation in vivo. J. Biol. Chem. 279, 4515-4522.
Cheung, A.P.-L., Au, C.Y.-M., Chan, W.W.-L., and Chan, K.M. (2010) Characterization and localization of metal-responsive-element-binding transcription factors from tilapia, Aquat. Toxicol. 99, 42–55.
Collart, M.A. and Oliviero S. (2001) Preparation of yeast RNA. Curr. Protoc. Mol. Biol. Chapter 13: Unit13.12.
Colmenares, S.U., Buker, S.M., Bühler, M., Dlakic, M., and Moazed, D. (2007) Coupling of double-stranded RNA synthesis and siRNA generation in fission yeast RNAi. Mol. Cell 27, 449-461.
Colvin, R.A, Fontaine, C.P, Laskowski, M., and Thomas, D. (2003) Zn2+ transporters and Zn2+ homeostasis in neurons. Eur. J. Pharmacol. 479, 171-185.
Corkins, M.E., May, M., Ehrensberger, K.M., Hu, Y.-M., Lui, Y.-H., Bloor, S.D., Jenkins, B., Runge, K.W., and Bird, A.J. (2013) Zinc finger protein Loz1 is required for zinc-responsive regulation of gene expression in fission yeast. Proc. Natl. Acad. Sci. U.S.A. 110, 15371-15376.
Dainty, S.J., Kennedy, C.A., Watt, S., Bähler, J., and Whitehall, S.K. (2008) Response of Schizosaccharomyces pombe to zinc deficiency. Eukaryot. Cell 7, 454–464.
Dalton, T.P, Solis, W.A., Nebert, D.W., Carvan M.J., 3rd. (2000) Characterization of the MTF-1 transcription factor from zebrafish and trout cells. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 126, 325–335.
117
Decker, C.J. and Parker, R. (2002) mRNA decay enzymes: Decappers conserved between yeast and mammals. Proc. Natl. Acad. Sci. U.S.A. 99, 12512-12514. de Smidt, O., du Preez, J.C., and Albertyn, J. (2008) The alcohol dehydrogenases of Saccharomyces cerevisiae: a comprehensive review. FEMS Yeast Res. 8, 967-978.
Dorsey, M., Peterson, C., Bray, K., and Paquin, C.E. (1992) Spontaneous amplification of the ADH4 gene in Saccharomyces cerevisiae. Genetics 132, 943-950.
Drewke, C. and Ciriacy, M. (1988) Overexpression, purification and properties of alcohol dehydrogenase IV from Saccharomyces cerevisiae. Biochim. Biophy.s Acta. 950, 54-60.
Dutrow, N., Nix, D.A., Holt, D., Milash, B., Dalley, B., Westbroek, E., Parnell, T.J., and Cairns, B.R. (2008) Dynamic transcriptome of Schizosaccharomyces pombe. Nat. Genet. 40, 977-986.
Ekwall, K., Nimmo, E.R., Javerzat, J.P., Borgstrom, B., Egel, R., Cranston, G., and Allshire, R. (1996) Mutations in the fission yeast silencing factors clr4+ and rik1+ disrupt the localisation of the chromo domain protein Swi6p and impair centromere function. J. Cell. Sci. 109, 2637-2648.
Ehrensberger, K.M. and Bird, A.J. (2011) Hammering out details: regulating metal levels in eukaryotes. Trends Biochem.. Sci. 36, 524-531.
Ehrensberger, K.M., Mason, C., Corkins, M.E., Anderson, C., Dutrow, N., Cairns, B.E., Dalley, B., Milash, B., and Bird, A.J. (2013) Zinc-dependent regulation of the adh1 antisense transcript in fission yeast. J. Biol. Chem. 288, 759-769.
Eide, D.J. (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 284, 18565–18569.
Fairall, L., Harrison, S.D., Travers, A.A., and Rhodes D. (1992) Sequence-specific DNA binding by a two zinc-finger peptide from the Drosophila melanogaster Tramtrack protein. J. Mol. Biol. 226, 349–366.
Forsburg, S.L. (1993) Comparison of Schizosacchromyces pombe expression systems. Nucleic Acids Res. 21, 2955-2956.
Forsburg, S.L. (2003) S. pombe strain maintenance and media. Curr. Protoc. Mol. Biol. Chapter 13: Unit 13.15.
Forsburg, S.L. and Rhind, N. (2006) Basic methods for fission yeast. Yeast 23, 173-183. 1 18
Fosmire, G.J. (1990) Zinc toxicity. Am. J. Clin. Nutr. 51, 225-227.
Frey, A.G., Bird, A.J., Evans-Galea, M.V., Blankman, E., Winge, D.R., and Eide, D.J. (2011) Zinc-regulated DNA binding of the yeast Zap1 zinc-responsive activator. PLoS One 6, e22535.
Frey, A.G. and Eide, D.J. (2011) Roles of two activation domains in Zap1 in the response to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 286, 6844-6854.
Fukada, T., Civic, N., Furuichi, T., Shimoda S, Mishima K, Higashiyama H, Idaira Y, Asada Y, Kitamura, H., Yamasaki, S., Hojyo, S., Nakayama, M., Ohara, O., Koseki, H., Dos Santos, H.G., Bonafe, L., Ha-Vinh, R., Zankl, A., Unger, S., Kraenzlin, M.E., Beckmann, J.S., Saito, I., Rivolta, C., Ikegawa, S., Superti-Furga, A., and Hirano, T. (2008) The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways. PLoS One 3, e3642.
Gitan, R.S., Luo, H., Rodgers, J., Broderius, M., and Eide, D. (1998) Zinc-induced inactivation of the yeast ZRT1 zinc transporter occurs through endocytosis and vacuolar degradation. J. Biol. Chem. 30, 28617-28624.
Giunta C., Elçioglu, N.H., Albrecht, B., Eich, G., Chambaz, C., Janecke, A.R., Yeowell, H., Weis, M., Eyre, D.R., Kraenzlin, M., and Steinmann, B. (2008) Spondylocheiro dysplastic form of the Ehlers-Danlos syndrome—an autosomal-recessive entity caused by mutations in the zinc transporter gene SLC39A13. Am. J. Hum. Genet. 82, 1290–1305.
Guarente, L. (1983) Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101, 181–191.
Günther, V., Lindert, U., and Schaffner, W. (2012) The taste of heavy metals: gene regulation by MTF-1. Biochim Biophys. Acta. 1823, 1416-1425.
Günther, V., Waldvogel, D., Nosswitz, M., Georgiev, O., and Schaffner, W. (2012) Dissection of Drosophila MTF-1 reveals a domain for differential target gene activation upon copper overload vs. copper starvation. Int. J. Biochem. Cell Biol. 44, 404-411.
Hansen, K.R., Hazan, I., Shanker, S., Watt, S., Verhein-Hansen, J., Bähler, J., Martienssen, R.A., Partridge, J.F., Cohen, A., and Thon, G. (2011) H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases. PLoS Genet. 7, e1001268.
Hastings, M.L., Ingle, H.A., Lazar, M.A. and Munroe, S.H. (2000) Post-transcriptional regulation of thyroid hormone receptor expression by cis-acting sequences and a naturally occurring antisense RNA. J. Biol. Chem. 275, 11507 – 11513.
119
Heuchel, R., Radtke, F., Georgiev, O., Stark, G., Aguet, M., and Schaffner, W. (1994) The trancription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO J. 13, 2870–2875.
Hirase, N., Abe, Y., Sadamura, S., Yufu, Y., Muta, K., Umemura, T., Nishimura, J., Nawata, H., and Ideguchi H. (1992) Anemia and neutropenia in a case of copper deficiency: role of copper in normal hematopoiesis. Acta. Haematol. 87, 195-197.
Hongay, C.F, Grisafi, P.L., Galitski, T., and Fink, G.R. (2006) Antisense transcription controls cell fate in Saccharomyces cerevisiae. Cell 127, 735-745.
Jeong, J. and Eide, D.J. (2013) The SLC39 family of zinc transporters. Mol. Aspects Med. 34, 612-619.
Jeong, J., Walker, J.M., Wang, F., Park, J.G., Palmer, A.E., Giunta, C., Rohrbach, M., Steinmann, B., and Eide, D.J. (2012) Promotion of vesicular zinc efflux by ZIP13 and its implications for spondylocheiro dysplastic Ehlers-Danlos syndrome. Proc. Natl. Acad. Sci. U.S.A. 109, E3530-E3538.
Kanter-Smoler, G., Dahlkvist, A., and Sunnerhagen, P. (1994) Improved method for rapid transformation of intact Schizosaccharomyces pombe cells. Biotechniques 16, 798- 800.
Keeney, J.B. and Boeke, J.D (1994) Efficient targeted integration at leu1-32 and ura4- 294 in Schizosaccharomyces pombe. Genetics 136, 849-856.
Kim, A.M., Bernhardt, M.L., Kong, B.Y., Ahn, R.W., Vogt, S., Woodruff, T.K., O'Halloran, T.V. (2011) Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in mammalian eggs. ACS Chem. Biol. 6, 716–723.
Kim, B.E., Wang, F., Dufner-Beattie, J., Andrews, G.K., Eide, D.J., and Petris, M.J. (2004) Zn2+-stimulated endocytosis of the mZIP4 zinc transporter regulates its location at the plasma membrane. J. Biol. Chem. 279, 4523–4530.
Kindermann, B., Döring, F., Pfaffl, M., and Daniel, H. (2004) Identification of genes responsive to intracellular zinc depletion in the human colon adenocarcinoma cell line HT-29. J. Nutr. 134, 57-62.
Kon, N., Krawchuk, M.D., Warren, B.G., Smith, G.R., and Wahls, W.P. (1997) Transcription factor Mts1/Mts2 (Atf1/Pcr1, Gad7/Pcr1) activates the M26 meiotic recombination hotspot in Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. U.S.A. 94, 13765-13770.
120
Küry, S., Dréno, B., Bézieau, S., Giraudet, S., Kharfi, M., Kamoun, R., and Moisan, J.P. (2002) Identification of SLC39A4, a gene involved in acrodermatitis enteropathica. Nat. Genet. 31, 239-240.
LaRochelle O, Gagné V, Charron J, Soh JW, Séguin C. (2001) Phosphorylation is involved in the activation of metal-regulatory transcription factor 1 in response to metal ions. J. Biol. Chem. 276, 41879-41888.
Lee, G.R., Nacht, S., Lukens, J.N., and Cartwright, G.E. (1968) Iron metabolism in copper-deficient swine. J. Clin. Invest. 47, 2058-69.
Leskovac, V., Trivić, S., and Pericin, D. (2002) The three zinc-containing alcohol dehydrogenases from baker's yeast, Saccharomyces cerevisiae. FEMS Yeast Res. 2, 481- 494.
Li, Y.Y., Qin, L., Guo, Z.M., Liu, L., Xu, H., Hao, P., Su, J., Shi, Y., He, W.Z. and Li, Y.X. (2006) In silico discovery of human natural antisense transcripts. BMC Bioinformatics 7, 18.
Lindert, U., Cramer, M., Meuli, M., Georgiev, O., and Schaffner, W. (2009) Metal- responsive transcription factor 1 (MTF-1) activity is regulated by a nonconventional nuclear localization signal and a metal-responsive transactivation domain. Mol. Cell. Biol. 29, 6283–6293.
Lyons, T.J., Gasch, A.P., Gaither, L.A., Botstein, D., Brown, P.O., and Eide D.J. (2000) Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc Natl Acad Sci U S A. 97, 7957-7962. . MacDiarmid, C.W., Gaither, L.A, and Eide, D. (2000) Zinc transporters that regulate vacuolar zinc storage in Saccharomyces cerevisiae. EMBO J. 19, 2845–2855.
Mao, X., Kim, B.-E., Wang, F., Eide, D.J. and Petris, M.J. (2007) A histidine-rich cluster mediates the ubiquitination and degradation of the human zinc transporter, hZIP4, and protects against zinc cytotoxicity. J. Biol. Chem. 282, 6992–7000.
Maruyama, R., Shipitsina, M., Choudhurya, S., Wud Z., Protopopovf, A., Yaog, J., Loh, P.-K., Bessarabovai, M, Ishkini, A., Nikolskyj, Y., Liud, X.S., Sukumarh, S., and Polyak, K. Altered antisense-to-sense transcript ratios in breast cancer. Proc. Nat. Acad. Sci. U.S.A. 109, 2820-2824.
Mattick, J.S. and Makunin, I.V. (2006) Non-coding RNA. Hum. Mol. Genet. 15, R17- R29.
121
Maundrell, K. (1990) nmt1 of fission yeast. A highly transcribed gene completely repressed by thiamine. J. Biol. Chem. 265, 10857-10864.
McCall, K.A., Huang, C., and Fierke C.A. (2000) Function and mechanism of zinc metalloenzymes. J. Nutr. 130, 1437S-1446S.
Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p.352-355.
Moazed, D. (2009) Small RNAs in transcriptional gene silencing and genome defense. Nature, 457, 413- 420.
Moreno, S., Klar, A., and Nurse, P. (1991) Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795–823.
Morris, K.V., Santoso, S., Turner, A.M., Pastori, C., and Hawkins P.G. (2008) Bidirectional transcription directs both transcriptional gene activation and suppression in human cells. PLoS Genet. 4, e1000258.
Motamedi, M.R., Verdel, A., Colmenares, S.U., Gerber, S.A., Gygi, S.P., and Moazed, D. (2004) Two RNAi complexes, RITS and RDRC, physically interact and localize to noncoding centromeric RNAs. Cell 119, 789-802.
Myers, A.M., Tzagoloff, A., Kinney, D.M., and Lusty, C.J. (1986) Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene 45, 299 –310.
Nagano, T. and Fraser, P. (2011) No-nonsense functions for long noncoding RNAs. Cell 145, 178-181.
Ng, K., Pullirsch, D., Leeb, M., and Wutz, A. (2007) Xist and the order of silencing. EMBO Rep. 8, 34-39.
Ni, T., Tu, K., Wang, Z., Song, S., Wu, H., Xie, B., Scott, K.C., Grewal, S.I., Gao, Y., and Zhu, J. (2010) The prevalence and regulation of antisense transcripts in Schizosaccharomyces pombe. PLoS One 5, e15271.
Peter, M., Gartner, A., Horecka, J., Ammerer, G., and Herskowitz, I. (1993) FAR1 links the signal transduction pathway to the cell cycle machinery in yeast. Cell 73, 747–760.
Plum, L.M., Rink, L. and Haase, H. (2010) The Essential Toxin: Impact of Zinc on Human Health. Int. J. Environ. Res. Public Health 7, 1342-1365.
122
Prasad, A.S. (2009) Zinc: role in immunity, oxidative stress and chronic inflammation. Curr. Opin. Clin. Nutr. Metab. Care 12, 646–652. Prasad, A.S., Brewer, G.J., Schoomaker, E.B., and Rabbani, P. (1978) Hypocupremia induced by zinc therapy in adults. JAMA 240, 2166-2168.
Prasad, A.S., Halsted, J.A., and Nadimi, M. (1961) Syndrome of iron deficiency anemia, hepatosplenomegaly, hypogonadism, dwarfism and geophagia. Am. J. Med. 31, 532-546.
Prasanth, K.V. and and Spector, D.L. (2007) Eukaryotic regulatory RNAs: an answer to the ‘genome complexity’ conundrum. Genes Dev. 21, 11-42.
Qiao, W., Mooney, M., Bird, A.J., Winge, D.R., and Eide, D.J. (2006) Zinc binding to a regulatory zinc-sensing domain monitored in vivo by using FRET. Proc. Natl. Acad. Sci. U.S.A. 103, 8674-8679.
Phatnani, H.P. and Greenleaf, A.L. (2006) Phosphorylation and functions of the RNA polymerase II CTD. Puistola, U., Turpeenniemi-Hujanen, T.M., Myllylä, R., and Kivirikko, K.I. (1980) Studies of the lysyl hydroxylase reaction. II. Inhibition kinetics and the reaction mechanism. Biochim. Biophys. Acta. 611, 51–60.
Radtke, F., Georgiev, O., Müller, H.P., Brugnera, E., and Schaffner W. (1995) Functional domains of the heavy metal-responsive transcription regulator MTF-1. Nucleic Acids Res. 23, 2277-2286.
Radtke, F. Heuchel, R., Georgiev, O., Hergersberg, M., Gariglio, M., Dembic, Z., and Schaffner, W. (1993) Cloned transcription factor MTF-1 activates the mouse metallothionein I promoter, EMBO J. 12, (1993) 1355–1362.
Rink, L. and Gabriel, P. (2000) Zinc and the immune system. Proc. Nutr. Soc. 59, 541- 552.
Roeser, H.P., Lee, G.R., Nacht, S., and Cartwright, G.E. (1970) The role of ceruloplasmin in iron metabolism. J. Clin. Invest. 49, 2408-2417.
Roberts,D.N., Stewart, A.J., Huff, J.T., and Cairns, B.R. (2003) TheRNA polymerase III transcriptome revealed by genome-wide localization and activity-occupancy relationships. Proc. Natl. Acad. Sci. U.S.A. 100, 14695–14700.
Russell, P.R. and Hall, B.D. (1983) The primary structure of the alcohol dehydrogenase gene from the fission yeast Schizosaccharomyces pombe. J. Biol. Chem. 258, 143–149. Rutherford, J.C. and Bird, A.J. (2004) Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot. Cell 3, 1-13.
123
Ryu, M.-S., Langkamp-Henken, B. Chang, S.M., Shankar, M.N. and Cousins, R.J. (2011) Genomic analysis, cytokine expression, and microRNA profiling reveal biomarkers of human dietary zinc depletion and homeostasis. Proc. Natl. Acad. Sci. U.S.A. 108, 20970- 20975.
Sakurai, M., Tohda, H., Kumagai, H., and Giga-Hama, Y. (2004) A distinct type of alcohol dehydrogenase, adh4+, complements ethanol fermentation in an adh1-deficient strain of Schizosaccharomyces pombe. FEMS Yeast Res. 4, 649-654.
Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory Manual. Volume 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p.A8.40-45.
Sansó, M., Gogol, M., Ayté, J., Seidel, C., and Hidalgo, E. (2008) Transcription factors Pcr1 and Atf1 have distinct roles in stress- and Sty1-dependent gene regulation. Eukaryot. Cell 7, 826-835.
Saydam, N., Georgiev, O., Nakano, M.Y., Greber, U.F., and Schaffner, W. (2001) Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. J. Biol. Chem. 276, 25487–25495.
Searle, P.F., Stuart, G.W., and Palmiter, R.D. (1985) Building a metal-responsive promoter with synthetic regulatory elements. Mol. Cell. Biol. 5, 1480–1489.
Séguin, C. and Prévost, J. (1988) Detection of a nuclear protein that interacts with a metal regulatory element of the mouse metallothionein 1 gene. Nucleic Acids Res. 16, 10547- 10560.
Selvaraj, A., Balamurugan, K., Yepiskoposyan, H., Zhou, H., Egli, D., Georgiev, O., Thiele, D.J., and Schaffner, W. (2005) Metal-responsive transcription factor (MTF-1) handles both extremes, copper load and copper starvation, by activating different genes. Genes Dev. 9, 891-896.
Shankar, A.H. and Prasad, A.S. (1998) Zinc and immune function: the biological basis of altered resistance to infection. Am. J. Clin. Nutr. 68(suppl), 447S–463S.
Sherman, F. (1998). An Introduction to the Genetics and Molecular Biology of the Yeast Saccharomyces cerevisiae. Modified from The Encyclopedia of Molecular Biology and Molecular Medicine. 6, 302-325.
Smart, T.G, Hosie, A.M., and Miller P.S. (2004) Zn2+ ions: modulators of excitatory and inhibitory synaptic activity. Neuorscientist 10, 432-442.
124
Smirnova, I.V., Bittel, D.C., Ravindra, R., Jiang, H., and Andrews, G.K. (2000) Zinc and cadmium can promote rapid nuclear translocation of metal response element-binding transcription factor-1, J. Biol. Chem. 275, 9377–9384.
Staats, C.C., Kmetzsch, L., Schrank, A., and Vainstein, M.H. (2013) Fungal zinc metabolism and its connections to virulence. Front. Cell. Infect. Microbiol. 3, 65.
Stefanidou, M., Maravelias, C., Dona, A., and Spiliopoulou., C. (2006) Zinc: a multipurpose trace element. Arch. Toxicol. 80, 1–9.
Stevenson, A.L. and Norbury, C.J. (2006) The Cid1 family of non-canonical poly(A) polymerases. Yeast 23, 991-1000.
Stuart, G.W., Searle, P.F. Chen, H.Y., Brinster, R.L., and Palmiter, R.L. (1984) A 12- base-pair DNA motif that is repeated several times in metallothionein gene promoters confers metal regulation to a heterologous gene. Proc. Natl. Acad. Sci. U.S.A. 81, 7318– 7322.
Stuart, G.W., Searle, P.F., and Palmiter,R.D. (1985) Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature 317, 828–831.
Tuderman, L., Myllylä, R., and Kivirikko, K.I. (1977) Mechanism of the prolyl hydroxylase reaction. 1. Role of cosubstrates. Eur. J. Biochem. 80, 341–348.
Vashchenko, G. and MacGillivray, R.T. (2013) Multi-copper oxidases and human iron metabolism. Nutrients 5, 2289-2313.
Waalkes, M.P., Harvey, M.J., and Klaassen, C.D. (1984) Relative in vitro affinity of hepatic metallothionein for metals. Toxicol. Lett. 20, 33-39.
Waldron, K.J., Rutherford, J.C., Ford, D., and Robinson, N.J. (2009) Metalloproteins and metal sensing. Nature 460, 823-830.
Walton, J.D., Pacquin, C.E., Kaneko, K., and Williams, V.M. (1986) Resistance to antimycin A in yeast by amplification of ADH4 on a linear, 42 kb palidromic plasmid. Cell 46, 857-863.
Wang, F., Kim, B.E., Dufner-Beattie, J., Petris, M.J., Andrews, G., and Eide, D.J. (2004) Acrodermatitis enteropathica mutations affect transport activity, localization and zinc-responsive trafficking of the mouse ZIP4 zinc transporter. Hum. Mol. Genet. 13, 563–571.
125
Wang K., Pugh, E.W., Griffen, S., Doheny, K.F., Mostafa, W.Z., Al-Aboosi, M.M., El- Shanti, H., and Gitschier, J. (2001) Homozygosity mapping places the acrodermatitis enteropathica gene on chromosome 8q24.3. Am. J. Hum. Genet. 68, 1055–1060.
Wang, K., Zhou, B., Kuo, Y.M., Zemansky, J., and Gitschier, J. (2002) A novel member of a zinc transporter family is defective in acrodermatitis enteropathica. Am J Hum Genet. 71, 66–73.
Waters, B.M. and Eide, D.J. (2002) Combinatorial control of yeast FET4 gene expression by iron, zinc, and oxygen. J. Biol. Chem. 277, 33749–33757.
Weaver, B.P., Dufner-Beattie, J., Kambe, T., and Andrews, G.K. (2007) Novel zinc- responsive post-transcriptional mechanisms reciprocally regulate expression of the mouse Slc39a4 and Slc39a5 zinc transporters (Zip4 and Zip5). Biol. Chem., 388, 1301–1312.
Wessels, K.R. and Borwn, K.H. (2012) Estimating the global prevalence of zinc deficiency: results based on zinc availability in national food supplies and the prevalence of stunting. PLoS One 7, e50568.
Westin, G. and Schaffner, W. (1988) zinc-responsive factor interacts with a metal- regulated enhancer element (MRE) of the mouse metallothionein-I gene. EMBO J. 7, 3763–3770.
Williamson, V.M. and Paquin, C.E. (1987) Homology of Saccharomyces cerevisiae ADH4 to an iron-activated alcohol dehydrogenase from Zymomonas mobilis. Mol. Gen. Genet. 209, 374-381.
Wilusz, J.E., Sunwoo, H., and Spector, D.L. (2009) Long noncoding RNAs: functional surprises from the RNA world. Genes Dev. 23, 1494–1504.
Wu, C.-Y., Bird, A.J., Chung, L.M., Newton, M.A., Winge, D.R, and Eide, D.J. (2008) Differential control of Zap-1-regulated genes in response to zinc deficiency in Saccharomyces cerevisiae. BMC Genomics 9, 370.
Wu, J.-Q., Kuhn, J.R., Kovar, D.R., and Pollard., T.D. (2003) Spatial and temporal pathway for assembly and constriction of the contractile ring in fission yeast cytokinesis. Dev. Cell 5, 723-734.
Yamamota, M. (2010 The selective elimination of messenger RNA underlies the mitosis- meiosis switch in fission yeast. Proc. Jpn. Acad. Ser. B. Phys. Biol. Sci. 86, 788-797. Yu, W., Gius, D., Onyango, P., Muldoon-Jacobs, K., Karp, J., and Feinberg, A.P., and Cui H. (2008) Epigenetic silencing of tumour suppressor gene p15: by its antisense RNA. Nature 451, 202-206.
126
Yuan, D.S. (2000) Zinc-regulated genes in Saccharomyces cerevisiae revealed by transposon tagging. Genetics 156, 45-58.
Zhang, B., Egli, D., Georgiev, O., and Schaffner, W. (2001) The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals, Mol. Cell. Biol. 21, 4505–4514.
Zhao, H. and Eide, D. (1996) The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. Proc. Natl. Acad. Sci. U S A. 93, 2454-2458.
Zhao, H. and Eide, D. (1996) The ZRT2 gene encodes the low affinity zinc transporter in Saccharomyces cerevisiae. J. Biol. Chem. 271, 23203–23210.
Zhao, H. and Eide, D.J. (1997) Zap1p, a metalloregulatory protein involved in zinc- responsive transcriptional regulation in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 5044–5050.
Zhao, H., Butler, E., Rodgers, J., Spizzo, T., Duesterhoeft, S., and Eide, D. (1998) Regulation of zinc homeostasis in yeast by binding of the ZAP1 transcriptional activator to zinc-responsive promoter elements. J. Biol. Chem. 273, 28713–28720.
Zheng, D., Kille, P., Feeney, G.P.., Cunningham, P., Handy, R.D. and Hogstrand, C. (2010) Dynamic transcriptomic profiles of zebrafish gills in response to zinc supplementation. BMC Genomics 11, 553.
127
Appendix
Additional tables
Table 5. S. pombe strains used in this study.
Strain Genotype Reference
JW81 h- ade6-M210 leu1-32 ura4-D18 Wu et al, 2003
SPCC13B11.02cΔ h+ ade6-M210 leu1-32 ura4-D18 SPCC13B11.02cΔ::kanMX4 Bioneer
SPAC25B8.19cΔ h+ ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 Bioneer
SPAC27D7.03cΔ h+ ade6-M210 leu1-32 ura4-D18 mei2Δ::kanMX4 Bioneer
SPAC8C9.03Δ h+ ade6-M210 leu1-32 ura4-D18 cgs1Δ::kanMX4 Bioneer
SPBC106.10Δ h+ ade6-M210 leu1-32 ura4-D18 pka1Δ::kanMX4 Bioneer
SPAC1783.07cΔ h+ ade6-M210 leu1-32 ura4-D18 pap1Δ::kanMX4 Bioneer
SPAC24B11.06cΔ h+ ade6-M210 leu1-32 ura4-D18 sty1Δ::kanMX4 Bioneer
SPAC1006.03cΔ h+ ade6-M210 leu1-32 ura4-D18 red1Δ::kanMX4 Bioneer
SPAC29B12.08Δ h+ ade6-M210 leu1-32 ura4-D18 clr5Δ::kanMX4 Bioneer
SPAC1687.22cΔ h+ ade6-M210 leu1-32 ura4-D18 puf3Δ::kanMX4 Bioneer
SPCC1442.16cΔ h+ ade6-M210 leu1-32 ura4-D18 zta1Δ::kanMX4 Bioneer
SPBC56F2.08cΔ h+ ade6-M210 leu1-32 ura4-D18 SPBC56F2.08cΔ::kanMX4 Bioneer
SPAC6G9.14Δ h+ ade6-M210 leu1-32 ura4-D18 SPAC6G9.14Δ::kanMX4 Bioneer
SPAC4G8.03cΔ h+ ade6-M210 leu1-32 ura4-D18 SPAC4G8.03cΔ::kanMX4 Bioneer
SPCP1E11.11Δ h+ ade6-M210 leu1-32 ura4-D18 puf6Δ::kanMX4 Bioneer
SPY86 h+ ade6-216 leu1-32 ura4DS/E imr1R(NcoI)::ura4+ oriI dcr1Δ::TAP-kanR Motamedi et al, 2004
SPY87 h+ ade6-216 leu1-32 ura4DS/E imr1R(NcoI)::ura4+ oriI rdr1Δ::TAP-kanR Motamedi et al, 2004
WSP0643 h- ade6-M210 leu1-32 ura4-D18 his3-D1 aft1-D15::ura4F Kon et al, 1997
WSP0649 h- ade6-M210 leu1-32 ura4-D18 his3-D1 pcr1-D15::his3F Kon et al, 1997 Continued
128
Table 5 continued
This study; ABY2 h- ade6-M210 leu1-32 ura4-D18 pac2Δ::kanMX6 generated by AJB ABY11 h- ade6-M210 leu1-32 ura4-D18 psod1-lacZ::leu1+ Corkins et al, 2013 This study; ABY31 h- ade6-M210 leu1-32 ura4-D18 ago1Δ::kanMX6 generated by Carter Mason This study; ABY32 h- ade6-M210 leu1-32 ura4-D18 clr4Δ::kanMX6 generated by AJB This study; ABY34 h- ade6-M210 leu1-32 ura4-D18 rrp6Δ::kanMX6 generated by Carter Mason This study; ABY38 h- ade6-M210 leu1-32 ura4-D18 cid14Δ::kanMX6 generated by Carter Mason ABY46 h- ade6-M210 leu1-32 ura4-D18 pJK148::leu1+ Ehrensberger et al, 2013
ABY59 h- ade6-M210 leu1-32 ura4-D18 3nmt1-adh1AS::kanMX6 Ehrensberger et al, 2013
ABY66 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-1 Corkins et al, 2013 This study; ABY71 h- ade6-M210 leu1-32 ura4-D18 aes1Δ::kanMX6 generated by Sang-Yong Choi This study; ABY73 h- ade6-M210 leu1-32 ura4-D18 xrn1Δ::kanMX6 generated by Carter Mason This study; ABY77 h- ade6-M210 leu1-32 ura4-D18 pop2Δ::kanMX6 generated by KME ABY80 h- ade6-M210 leu1-32 ura4-D18 padh4-lacZ::leu1+ Ehrensberger et al, 2013
ABY83 h+ ade6-M201 leu1-32 ura4-D18 adh1Δ::kanMX6 Ehrensberger et al, 2013
ABY84 h- ade6-M210 leu1-32 ura4-D18 loz1-1 Corkins et al, 2013
ABY98 h- ade6-M210 leu1-32 ura4-D18 pvel1-lacZ::leu1+ Ehrensberger et al, 2013 This study; ABY137 h- ade6-M210 leu1-32 ura4-D18 cid13Δ::kanMX6 generated by Yi-Hsuan Liu This study; ABY142 h- ade6-M210 leu1-32 ura4-D18 cid1Δ::kanMX6 generated by Yi-Hsuan Liu This study; ABY143 h- ade6-M210 leu1-32 ura4-D18 cid16Δ::kanMX6 generated by Yi-Hsuan Liu ABY153 h+ ade6-? leu1-32 ura4-D18 3nmt1-adh1::kanMX6 Ehrensberger et al, 2013 This study; ABY210 h- ade6-M210 leu1-32 ura4-D18 loz1-1 SPCC13B11.02cΔ::kanMX6 generated by KME This study; ABY231 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-9 isolated by AJB This study; ABY232 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-12 isolated by AJB This study; ABY236 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-4 isolated by AJB This study; ABY237 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-5 generated by AJB This study; ABY238 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-8 isolated by AJB This study; ABY239 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-15 isolated by AJB ABY252 h- ade6-M210 leu1-32 ura4-D18 padh1AS-lacZ::leu1+ Ehrensberger et al, 2013
ABY310 h- ade6-M210 leu1-32 ura4-D18 padh1-lacZ::leu1+ Ehrensberger et al, 2013 Continued
129
Table 5 continued
This study; ABY350 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-23 isolated by MEC This study; ABY352 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-25 isolated by MEC This study; ABY382 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K5 isolated by KME ABY385 h+ ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 pJK148::leu1+ Corkins et al, 2013
ABY387 h+ ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 psod1-lacZ::leu1+ Corkins et al, 2013
ABY393 h+ ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 padh4::leu1+ Corkins et al, 2013
ABY395 h+ ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 pvel1-lacZ::leu1+ Corkins et al, 2013
ABY425 h- ade6-M210 leu1-32 ura4-D18 loz1-13MYC:kanMX6 Corkins et al, 2013 This study; ABY432 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K13 isolated by KME This study; ABY433 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K18 isolated by KME This study; ABY434 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K23 isolated by KME ABY450 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX4 ploz1-GFP::leu1+ Corkins et al, 2013 This study; ABY455 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K19 isolated by KME This study; ABY456 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K20 isolated by KME This study; ABY457 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K31 isolated by KME ABY463 h- ade6-M210 leu1-32 ura4-D18 ploz1-lacZ::leu1+ Corkins et al, 2013 This study; ABY476 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K26 isolated by KME This study; ABY477 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K33 isolated by KME This study; ABY478 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K35 isolated by KME This study; ABY479 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K39 isolated by KME This study; ABY480 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K40 isolated by KME This study; ABY481 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K17 isolated by KME This study; ABY482 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K25 isolated by KME This study; ABY483 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K32 isolated by KME This study; ABY484 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K37 isolated by KME This study; ABY485 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K38 isolated by KME This study; ABY486 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K21 isolated by KME This study; ABY491 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K22 isolated by KME This study; ABY492 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K24 isolated by KME Continued
130
Table 5 continued
This study; ABY493 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K27 isolated by KME This study; ABY495 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K16 isolated by KME This study; ABY496 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K14 isolated by KME This study; ABY501 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K28 isolated by KME This study; ABY502 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K30 isolated by KME This study; ABY503 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K34 isolated by KME This study; ABY504 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K36 isolated by KME ABY527 h- ade6-M210 leu1-32 ura4-D18 ppgk1-lacZ::leu1+ Ehrensberger et al, 2013
ABY528 h- ade6-M210 leu1-32 ura4-D18 pnmt1-lacZ::leu1+ Ehrensberger et al, 2013
ABY540 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 Corkins et al, 2013
ABY583 h- ade6-M210 leu1-32 ura4-D18 loz1-1 ploz1-lacZ::leu1+ Corkins et al, 2013 This study; ABY589 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1R510G-GFP::leu1+ generated by KME ABY600 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1-lacZ::leu1+ Corkins et al, 2013 This study; ABY602 h- ade6-M210 leu1-32 ura4-D18 adh1Δ::kanMX6 loz1-K29 isolated by KME This study; ABY621 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 pzhf-loz1-GFP::leu1+ generated by KME This study; ABY624 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1C470G-GFP::leu1+ generated by KME This study; ABY627 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1 448-522-GFP::leu1+ generated by KME/MEC This study; ABY633 h- ade6-M210 leu1-32 ura4-D18 pzhf1-lacZ::leu1+ generated by KME This study; ABY670 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1 427-522-GFP::leu1+ generated by KME This study; ABY693 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1M513I-GFP::leu1+ generated by KME This study; ABY698 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 pzhf-loz1 427-522-GFP::leu1+ generated by KME This study; ABY701 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1 280-522-GFP::leu1+ generated by KME This study; ABY727 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1 125-522-NLS-GFP::leu1+ generated by KME This study; ABY733 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 pzhf1-loz1 448-522-GFP::leu1+ generated by KME This study; ABY766 h- ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 ploz1S489F-GFP::leu1+ generated by KME
131
Table 6. Primers and oligos used in this study.
Function Name Sequence Adh4F 5’-GACGCTTCAGAATATTCCAATTC-3’ RNA Adh4RT7 5’-TAATACGACTCACTATAGGGAGCTCGCTTAACGAACACTTATCG-3’ probes Adh1F 5’-CCAGAATTCCGTCGGTAACCGTATTGACTCT-3’ Adh1RT7 5’-TAATACGACTCACTATAGGGAGCCGTACCATCGAAAAACGACA-3’ Adh1AS-1F 5’-GACTACCTCGAGATGAAGATGTGTATGAACTGAATATC-3’ Adh1AS- 5-TAATACGACTCACTATAGGGAGGTCCATTATACTACTAATGCAATGC-3’ 1RT7 Adh1AS-2F 5’-CGATCGGTACCCCGTACCATCGAAAAACGACA-3’ Adh1AS- 5’-TAATACGACTCACTATAGGGAGCGTCGGTAACCGTATTGACTCT-3’ 2RT7 Adh1AS-4F 5’-CACCCACAGCTCTCGACCATG-3’ Adh1AS- 5’-TAATACGACTCACTATAGGGAGCCTAATACGGCATACTACTAG-3’ 4RT7 Nmt1F 5’-CCTGTCACCAGTTTTGGATC-3’ Nmt1RT7 5’-TAATACGACTCACTATAGGGAGCATGCATTCAATGCCAATG-3’ Pgk1F 5’-GGAGGATGCTCTTTCCCACGTC-3’ Pgk1RT7 5’-TAATACGACTCACTATAGGGAGCAAATTCACGAATGTTAGAGAAC-3’ Loz1ZFF 5’-CTTATCCAGTCTCGGTTCCGCTT-3’ Loz1ZFRT7 5’-TAATACGACTCACTATAGGGAGATGGCTACAAACCATGAATGC-3’ Zrt1F 5’-GGCAGCTGGTTTAGGTGTTCGTG-3’ Zrt1RT7 5’-TAATACGACTCACTATAGGGAGCACCAAATCAAGCCCATTTACC-3’ Zym1F 5’-CGATGGAACACACTACCCAATGTAAG-3’ Zym1RT7 5’-TAATACGACTCACTATAGGGAGCGATGATGCCCTTACTCTACGC-3’ Adh1 A-F 5’-CTACATCTATTCCACGACTTG-3’ ChIP Adh1 A-R 5’-GGATTTGTTTCAAGATGATGTTG-3’ Adh1 B-F 5’-CTAGTACATCCTGTAGTAGTCATTC-3’ Adh1 B-R 5’-CAGTCCATTTGTGCGTACGTAAG-3’ Adh1 C-F 5’-CGGTAACCGTATTGACTCT-3’ Adh1 C-R 5’-GCCGTACCATCGAAAAACGACA-3’ Adh1 D-F 5’-CTGAAGATTCCCGAAATGTGTC-3’ Adh1 D-R 5’-CTGCTTGTCAGGAATAGTCAT-3’ Adh1 E-F 5’-GATAGAGAGAAATTGAGTGGT-3’ Adh1 E-R 5’-CATGATAGCCATTTTCTTAGTTG-3’ Adh4F 5’-CGGTGGATCTTCTAGAAGATCTTG-3’ Adh4R 5’-GAAGCGTCTTGAGTATGAAGAG-3’ Vel1F 5’-GCAGTTGTTACCACTTTTGGTGAC-3’ Vel1R 5- GAACATCGTATGGAAATGTCTTC-3’ Pgk1 ChIPF 5’- GTTACGTCACAGTGAAATGCTC-3’ Pgk1 ChIPR 5’- GTAGACAAAGACATGGTTATG -3’ Continued
132
Table 6 continued
Adh1S RT 5’-CTTACTTGGAAAGGTCCAAGACG-3’ RT-PCR Adh1 L-F 5’-CAAGTGGATGAACTCTTCTTG-3’ Adh1 L-R 5’-CAGCCTTGTCATCACCAGTATC -3’ Pgk1 qRT-F 5’-GGCCAAGGCCAAGAAGAACAAC-3’ Pgk1 qRT-R 5’-CCGTACTTCTTGGCAACAG-3’ AS mTATA-F 5’-GACGCCTCCCATGGCAAAAATAGTGGGTGGTGGAC-3’ Site- AS mTATA-R 5’-GTCCACCACCCACTATTTTTGCCATGGGAGGCGTC-3’ directed AS mATG-F 5’-CTAACCACATATTCACTATTCCTGACAAGC-3’ mutagenesis AS mATG-R 5’-GCTTGTCAGGAATAGTGAATATGTGGTTAG-3’ loz1 C470G-F 5’-GTTCGATATAGAGGTACGGAATGTTTAC-3’ loz1C470G-R 5’-GTAAACATTCCGTACCTCTATATCGAAC-3’ loz1S489F-F 5’-CATACATATTTCCATACAGGAGAAAGG-3’ loz1S489F-R 5’-CCTTTCTCCTGTATGGAAATATGTATG-3’ loz1 R510G-F 5’-GCGTTCAATGTAGGCAGTAATATG-3’ loz1R510G-R 5’-CATATTACTGCCTACATTGAACGC-3’ loz1M513I-F 5’-CGCAGTAATATACGGCGACATCAACG-3’ loz1M513I-R 5’-CGTTGATGTCGCCGTATATTACTGCG-3’
133
Table 7. Plasmids used in this study.
AJB Database Function Plasmid Name Reference Number Published pJK148 12 Keeney and Boeke, 1994 plasmid pRep4x 14 Forsburg, 1993 backbones pFA6a-kanMX6 16 Bähler et al, 1998 Multi-copy pRep3x-pgk1 promoter 138 Ehrensberger et al, 2013 expression pREP3x-pgk1- 191 This study vectors SPCC13B11.02c pREP3x-pgk1-adh1AS 146 Ehrensberger et al, 2013 1-3412 pREP3x-pgk1-adh1AS 148 Ehrensberger et al, 2013 1-3348 pREP3x-pgk1-adh1AS 139 Ehrensberger et al, 2013 1-2078 pREP3x-pgk1-adh1AS 149 Ehrensberger et al, 2013 1026-3348 pREP3x-pgk1-adh1AS 141 Ehrensberger et al, 2013 1026-2078 pREP4x-pgk1-adh1AS 210 This study 1026-3348 pREP3x-pgk1-adh1AS 256 Ehrensberger et al, 2013 1-1025 pREP3x-pgk1-adh1AS 150 Ehrensberger et al, 2013 2079-3412 pREP3x-pgk1-adh1AS 158 This study mATG pREP3x-pgk1-adh1AS 161 Ehrensberger et al, 2013 mTATA LacZ pJK148-sod1-lacZ 38 Corkins et al, 2013 constructs pJK148-adh4-lacZ 112 Ehrensberger et al, 2013 pJK148-vel1-lacZ 122 Ehrensberger et al, 2013 pJK148-adh1AS-lacZ 172 Ehrensberger et al, 2013 pJK148-adh1-lacZ 181 Ehrensberger et al, 2013 pJK148-pgk1-lacZ 257 Ehrensberger et al, 2013 pJK148-nmt1-lacZ 258 Ehrensberger et al, 2013 pJK148-loz1-lacZ 246 Corkins et al, 2013 pJK148-zhf1-lacZ 307 This study Continued
134
Table 7 continued
Integrating ploz1-GFP 247 Corkins et al, 2013 expression pzhf1-loz1-GFP 287 This study plasmids ploz1 125-522-GFP-NLS 389 This study ploz1 280-522-GFP 370 This study ploz1 427-522-GFP 340 This study ploz1 448-522-GFP 294 This study pzhf1-loz1 427-522-GFP 366 This study pzhf1-loz1 448-522-GFP 399 This study Loz1 ploz1 C470G-GFP 290 This study mutagenesis ploz1 S489F-GFP 429 This study plasmids ploz1 R510G-GFP 271 This study ploz1 M513I-GFP 315 This study
135