Iranian Journal of Basic Medical Sciences ijbms.mums.ac.ir

Phytoestrogens by inhibiting the non-classical oestrogen receptor, overcome the adverse effect of bisphenol A on hFOB 1.19 cells Zar Chi Thent 1, Gabriele Ruth Anisah Froemming 2, 3, Aletza Binti Mohd Ismail 1, Syed Baharom Syed Ahmad Fuad 1, Suhaila Muid 1, 3* 1 Faculty of Medicine, Universiti Teknologi MARA, Sungai Buloh Campus, 47000 Selangor, Malaysia 2 Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak (UNIMAS), 94300 Kota Samarahan, Sarawak, Malaysia 3 Institute for Pathology, Laboratory and Forensic Medicine (IPPerForM), Universiti Teknologi MARA, Sungai Buloh Campus, 47000 Selangor, Malaysia

A R T I C L E I N F O A B S T R A C T Article type: Objective(s): Since bisphenol A (BPA) induces bone loss and phytoestrogens enhance the Original article osteoblastogenesis by binding to the non-classical and classical oestrogen receptors, respectively, the present study was aimed to observe the osteoprotective effect of phytoestrogens on BPA-induced Article history: osteoblasts in hFOB 1.19 cells. Received: Dec 24, 2019 Accepted: Apr 29, 2020 Materials and Methods: control (Ctrl) group. Meanwhile, treated groups received phytoestrogens; Daidzein (Dz), Genistein Keywords: All groups of hFOB 1.19 cells were induced with 12.5 μg/ml of BPA except the Bisphenol A Results: We found that the protein expression of non-classical oestrogen-related receptor (ERRG) was ERRG, (Gt), Equol (Eq) and 17β-oestradiol (Est) in different concentrations for 24 hr duration. hFOB 1.19 cells Oestrogens receptors highly expressed in BPA group, whereas classical oestrogen receptor alpha (ERα) and oestrogen receptor Phytoestrogens beta (ERβ) were relatively increased with phytoestrogens treatment under BPA exposure. The dense actin cytoskeletal filaments were also observed. qRT-PCR showed up-regulation of mitogen-activated proteinwhich was kinase supported 3 (MAPK3) by theand increased G protein-coupled expressions receptor of oestrogen 30 (GPR30) receptor expressions; 1 (ESR1) significant and oestrogen down- regulationreceptor 2 of(ESR2). ERRG and up-regulation of ERα and ERβ were observed in phytoestrogens-treated cells, Conclusion: Phytoestrogens improved the deteriorative effect of BPA via down-regulation of ERRG in

them as potential therapeutic strategy in combating the adverse bone effects of BPA. hFOB 1.19 cells. This study showed that the efficacy of consumption of phytoestrogens in rendering ►Please cite this article as: Thent ZC, Froemming GRA, Ismail ABM, Fuad SBSA, Muid S. Phytoestrogens by inhibiting the non-classical oestrogen receptor, overcome the adverse effect of bisphenol A on hFOB 1.19 cells. Iran J Basic Med Sci 2020; 23:1155-1163. doi: 10.22038/ijbms.2020.45296.10545

Introduction bone mineralization (5). Oestrogen has a key role in bone remodelling process The alterations in cell function such as changes in by exerting effects on cell-cell communication and shape, cell-cell communication, cell structure, gene expression, cell metabolism and cell function are mainly controlled the cellular metabolism, which leads to developing by the oestrogenic hormones. Hormonal modulations which coordinate cells. Oestrogen deficiency can disturb affect the physical components of a cell that consist of (1). It is believed that bisphenol A (BPA) mimics the nucleus, cytoskeleton and the extracellular matrix. All osteoporosisoestrogen action; by significantly however, it interacts reducing differently the bone masswith these components orchestrate cellular events necessary the ligand binding domain of the oestrogen receptor and recruits different transcriptional co-regulators. The industrial chemical like BPA used in the production forof BPA gene to expression ERRG depletes that preserve the oestrogen, the cell specificitywhich results and of plastic products can bind to the non-classical tissuein reduction phenotypic in the properties cellular pool (6). ofHigh osteoblast affinity bindingand an oestrogen receptor like oestrogen-related receptor increase in differentiation of osteoclast progenitors. gamma (ERRG) as well as to the G-protein coupled Oestrogen replacement therapy has been an effective receptor 30 (GPR30) and, therefore, activate oestrogen- strategy for prevention and treatment of bone loss sensitive genes via the non-genomic pathways (2). BPA (7). Due to the undesirable side effects of hormonal replacement therapy, phytoestrogens, the naturally receptor with unclear physiological ligand (3). BPA occurring selective oestrogen receptor modulators, bindsis a weak with endocrine high affinity disruptor to ERRG, (EDC) which due to is aits nuclear 1000– have been recommended as alternatives for the 10,000 fold lower binding capacity to the classical treatment of bone loss and osteoporosis (8). Among

the bone mineralization in ovariectomized animals oestrogen receptors α and β (ESRα & β) compared to theand phytoestrogens,postmenopausal isoflavones women (9, are10). shown Daidzein, to enhancea major 17β-oestradiol(BMP2)-induced (Est) osteoblast (4). Inhibition differentiation, of ERRG osteocalcinexpression significantlyexpression, alkaline increased phosphatase bone morphogenetic (ALP) activity protein and 2 binding to the oestrogen receptors (11, 12). It regulates isoflavone found in soybean, exerts oestrogenic action by *Corresponding author: Suhaila Muid. Faculty of Medicine, Universiti Teknologi MARA; Institute for Pathology, Laboratory and Forensic Medicine (IPPerForM), Universiti Teknologi MARA, Sungai Buloh Campus, 47000 Selangor, Malaysia. Tel/Fax: +60-177731077; Email: [email protected] Thent et al. Protective effect of Phytoestrogens the expressions of interleukin-6, osteoprotegerin, and Before commencing the experiments, cultured cells were fed twice a week. The adhered cells were then ligand in the human foetal osteoblast (hFOB1.19) cell line receptor(13). On the activator other hand, of nuclear Equol, factora metabolite kappa of B daidzein, (NF-κB) (Accutase). Following 6 days of differentiation period, was shown to inhibit bone loss in ovariectomized releasedthe treatment from wasthe flaskstarted. using cells detachment solution animals through activating the oestrogen receptor (14). Findings of an in vitro study showed that equol inhibited Cell culture treatment the osteoclastogenesis induced by vitamin D supplement The cells were counted using a hemocytometer and (15). Genistein is a non-steroidal phyto-oestrogen that were seeded at a density of 1×104 cells/cm2 in 96-well controls the osteoblast metabolism through oestrogen plates. Prior to the treatment, a stock solution (50 receptor -dependent pathways (16). Although several mg/ml) of BPA, Dz, Gt and Est were prepared using studies have highlighted on the oestrogenic effect of differentiation medium. The entire prepared medium phytoestrogens towards bone loss, there is paucity of research investigated the effect of each phytoestrogen Germany). hFOB 1.19 cells were induced with BPA and on BPA-induced osteoblasts cells under oestrogen wastreated sterilized with phytoestrogens using 0.2 mm including syringe filter Dz, Gt, (Sartorius, Eq, and

We aimed to study the bone-sparing effect of All the groups were stimulated with BPA 12.5 µg/ml pathwayphytoestrogens and thus, through awaits ER-dependent further clarification. signal pathways. Est.except Single the Controlconcentration (Ctrl) group. of BPA Ctrl 12.5 group μg/ml only was received used. We investigated the effects of each phytoestrogen on differentiation medium. All the treated groups were hFOB 1.19 cells and the possible signal pathways of compared with (untreated) BPA group. Three (3) non- toxic concentrations of each phytoestrogen were chosen kinase/extracellular regulated kinase (MAPK/ERK). following MTT assay; Dz (5, 10, 20); Gt (10, 20, 40); Eq ESRTaken α, together, ESRβ, andour data mitogen-activated explained that phytoestrogens protein kinase (1, 2, 4) and Est (2, 4, 16) µg/ml were considered as overcome bone loss effect of BPA via up-regulation treatment groups. The treatment was continued for 24 of classical oestrogen receptor and down-regulation hr. of non-classical oestrogen receptor and showed the potential value of phytoestrogens as a nutraceutical Analysing the protein expression of oestrogen agent for clinical application in BPA-related bone loss. receptors

Materials and Methods phytoestrogens including Dz, Gt, and Eq on the BPA- Materials inducedIn this hFOB study, 1.19 the cells potential was observed biological by influence analysing of Human foetal osteoblasts 1.19 (hFOB 1.19) cells were the sequential expression and regulation of human purchased from Addexbio, USA. Cell culture reagents- related receptor gamma (ERRG) by using commercially F-12 (DMEM/F12), penicillin, streptomycin and foetal oestrogenavailable kits. receptors These such proteins as ERβ, are ERα major and phenotypic oestrogen- Dulbecco’sbovine serum Modified were sourced Eagle Medium:from Biosera Nutrient Laboratories, Mixture markers for osteoblast formation. Prior to the investigation, the cells (1×106) were seeded in T-25 purchased from Sigma, St. Louis, MO, USA. Bisphenol A France. Ascorbic acid and β-glycerophosphate were were treated with different concentrations of Dz, Gt, Eq oestradiol (Est) were sourced from Abcam (Cambridge, cultureand Est flasks.in the Followingpresence of the BPA differentiation except in the period, Ctrl group. cells (BPA),UK). Enzyme Daidzein linked (Dz), immunosorbent Genistein (Gt), Equol assay (Eq) (ELISA) and 17-β kits Following 24 hr of incubation period, the cultured cells underwent total protein extraction by using ReadyPrep protein extraction kit. Then, the protein expression of forfrom the Fine protein Biotech, expression China. of Total oestrogen protein receptor extraction β (ERβ), kit each oestrogen receptors was estimated using sandwich oestrogenwas purchased receptor from α (ERα)Bio-Rad, and USA, ERRG and were actin purchased staining ELISA. We followed the manufacturer’s instruction from CellLight® Reagent *BacMam 2.0, ThermoFisher and at the end of investigations, colour changes from yellow to blue were noted. The OD value was recorded Institute of Medical Molecular Biotechnology (IMMB), at 450 nm with a microplate reader (Brand, Country) Scientific.Universiti TeknologiAll other chemicals MARA (UiTM). used were sourced from and the colour intensity represented the expression concentration of each protein marker in the sample. Cell culture and sub-culturing In the current study, hFOB 1.19 cells, passage 4, Cytoskeleton (Actin) staining were used. These immortalized cells are ideal for the Both the treated and untreated cultured adherent cells were seeded at the density of 1×105 in the 6-well undergo well differentiation when grown in the medium plate. For the actin staining, the total percentage of cell expression of all the specific molecular markers and 6 days. The subculturing was performed by growing period. The integrity and the morphology of actin containingactive hFOB ascorbic 1.19 cells acid in a andgrowth β glycerolphosphate medium consisting for of confluentwere examined 70% was with used phalloidin following staining.24 hr of incubationThen, the DMEM F-12 supplemented with 10% fetal bovine serum appropriate volume of CellLight reagent for the number (FBS) and 1% penicillin/streptomycin (antibiotic/ of cells was calculated. antimycotic). The cells were incubated in 95% air and ° 5% CO2 at 37 ® Number of cells × desired PPC Volume of Cell Light Reagent (ml) = 8 ® C until 80% confluence was reached. 1×10 Cell Light particles/ml 1156 Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 Protective effect of Phytoestrogens Thent et al.

A CellLight® reagent for hFOB 1.19 cells about 20 Results particles per cell (PPC) was used following optimization. In our earlier study, we optimised the concentrations With gentle mixing, the calculated volume of CellLight® of BPA and phytoestrogens by using the hemocytometer. reagents was directly added to the cells in the complete We observed cell viability rate in hFOB 1.19 cells medium and mixed gently. Then, the cells were incubated stimulated with different concentrations of BPA for 24 overnight at 37 °C. Following the incubation, the cells

showed IC50 value (Figure 1). For the treatment groups, (Meiji Techno MT6000 Epi-Fluorescence Microscope). hrthe and three found non-toxic that the concentrations12.5 μg/ml concentration of Dz (5,10,20); of BPA were viewed under inverted fluorescence microscope Gt (10,20,40); Eq (1,2,4) and Est (2,4, 16) µg/ml were Gene expression analysis by quantitative real time chosen following the MTT assay (17). Treatments were PCR (qRT-PCR) 7 Cells were harvested at an amount of 1×10 in group. given along with 12.5 μg/ml of BPA except in the Ctrl buffer was added in the cell pellet. Then, total RNA cryovials,was obtained and thenusing 350 All μlprep of RNeasy RNA extraction Lysis Buffer kit (RLT) from Qiagen (Germany). Total RNA quality was measured, and RNA concentration was determined using the Nanodrop 2000 Spectrophotometer (Thermo Fisher, USA). Approximately 400 ng of total RNA was reverse transcribed to cDNA by using qPCRBIO cDNA synthesis with SYBR Green Master Mix from PCR biosystem (UK) kitand (PCR primers biosystem, for target UK). Then,and reference1 μl of cDNA genes was (Tablemixed 1 shows the list of genes and sequences). qPCR was performed using the CFX96 system from Bio-Rad (USA) and gene expression analysis was performed using TM CFX Manager software (Bio-Rad, USA) with Ct of the sample normalized against reference genes (HPRT1Δ and ACTB1).

Statistical analysis In this study, data analysis was performed using one-way ANOVA followed by Bonferroni test by using SPSS version

22.0. All the experiments were performed in triplicate. Data A. were presented as mean±standard error of mean (SEM). A P<0.05.

Table 1. List of genes and the primer sequence used in qRT-PCR for genesignificant experssion difference analysis was considered *

Gene name Primer sequence (5’ to 3’) HPRT Forward ATAAGCCAGACTTTGTTGG Reverse ATAGGACTCCAGATGTTTCC ACTB Forward GACGACATGGAFAAAATCTG B. Reverse ATGATCTGGGTCATCTTCTC ESR1 Forward GGAGTGTACACATTTCTGTC Reverse CAAAGTGTCTGTGATCTTGTC ESR2 Forward AAATCTTTGACATGCTCCTG Reverse AGGGTACATACTGGAATTGAG ERAlpha Forward CATCCCAGGCTTCTCATC Reverse ACTAAGTCCTCAGCGAAG

ERBeta Forward GTGGAAGAGAAATGAGCTTG Reverse AAACTTTTATTCACCAGCCC ESRRG Forward GTGATGTGTACCATACTGTG C. Reverse TTAGCAGTCAAAAGTGGAAG GPER Forward AGGTACCCAGAGAGTGAG Figure 1. Protein expression of oestrogen receptors in hFOB 1.19 cells induced with BPA following treatment with Dz, Gt and Eq. (A) Reverse AGTGGGAAGAACAGATGC

MAPK1 Forward GAAGCATTATCTTGACCAGC compared to the BPA group. The IC50 value of BPA on hFOB 1.19 cells Reverse TCCATGGCACCTTATTTTTG ERα,was shown.(B) ERβ Data and were(C) ERRG. expressed The expressions as mean±SEM of treated (n=9). Ingroups 1A and were B, a * P< P<0.05 MAPK3 Forward TTCGAACATCAGACCTACTG compared to BPA group, abP<0.01 compared between phytoestrogens Reverse TAGACATCTCTCATGGCTTC groups,0.05 ac wasP<0.05 considered compared to to be the significant Ctrl group difference. In 1C, MAPK7 Forward AGCACTTTAAACACGACAAC Reverse TAGACAGATTTGAATTCGCC Dz:gamma, Daidzein, BPA: BisphenolGt: Genistein, A Eq: Equol, ERα: oestrogen receptor alpha, ERβ: oestrogen receptor beta, ERRG: oestrogen-related receptor

Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 1157

Thent et al. Protective effect of Phytoestrogens

Figure 2. the (a) Ctrl Immunofluorescence group images of the CellLight phalloidin stained hFOB 1.19 cells. a) Ctrl b) BPA c) Dz5 d) Gt40 e) Eq4 and f) Est 16 μg/ ml treated cells showing apparent difference in the density of f-actin filaments. All groups of cells were exposed with BPA 12.5 μg/ml except for

Dz: Daidzein, Gt: Genistein, Eq: Equol, Est: 17β-oestradiol, BPA: Bisphenol A, Ctrl: Control Protein expression of oestrogen receptors cytoskeleton are important in forming a pre-stressed The protein expression of phytoestrogens on BPA- mechanical network that maintains the structure and stimulated hFOB 1.19 cells was analysed by using stiffness of the cell (18). Therefore, it is crucial to observe commercially available kit. The expression of classical the actin structures to understand the underlying reason for the changes in the osteoblasts elasticity. Fluorescence classical oestrogen receptor of ERRG were determined. images of CellLight phalloidin-stained cells (Figure oestrogenFollowing 24receptors hr incubation including period, ERα, the and BPA ERβgroup and showed non- the BPA group of cells as compared to the Ctrl group. (2.7±0.33 ng/ml and 3.0±0.51 ng/ml, respectively) 2) showed that the actin filaments were less dense in nowhen significant compared difference to Ctrl ingroup expression (2.46±0.37 of ERα ng/ml and ERβand of hFOB 1.19 cells, which can result in decreasing the 4.2±0.08 ng/ml, respectively) (Figure 1A, B). While in BPA induced decrease in the density of actin filaments the experimental groups treated with phytoestrogens, stiffnessDz5, Gt 40, of theEq4 cells. and EstBased have on potential the findings osteogenic from protein effect expressionagainst BPA. of Therefore, ERRG, we theassumed cells from that 16these μg/ml treatment of the Dz, Gt and Eq, no significant changes were observed in groups were selected to observe the density of actin expression of ERα and ERβ as compared to the BPA group (Figurethe other 1A, B).phytoestrogens However, Gt40 groups group showed(P<0.05). significant It was of phytoestrogens with the BPA enhanced the density increaseobserved inthat ERβ both protein BPA and expression phytoestrogens as compared had similar to filament under fluorescence microscope. Co-treatment effects on classical oestrogen receptors. However, the ofin Dz5 actin and filaments Gt40 groups in osteoblast-like (Figure 2C, cells.D), whereas Prominently Eq 4 noted in the phytoestrogen-treated groups (Figure 1A, increase in the density of actin filaments were found insignificantB). To gain further up-regulation insight into of both the difference ERα and ERβbetween was 2E). Moreover, Est16 group was also observed to have xenoestrogen (BPA) and phytoestrogens, their effect on group showed less prominent actin filaments (Figure (Figure 2F). up-regulation (P<0.05) of ERRG level (3.8±0.04 ng/ increased actin filament density under BPA exposure ERRGml) when was observed.compared The to theBPA Ctrl group group showed (2.2±0.29 significant ng/ Regulation of phytoestrogens on BPA-induced gene ml) (Figure 1C). However, phytoestrogens-treated cells expression showed down-regulation of ERRG level, particularly in Genes for cell proliferation and differentiation Dz5 (2.4±0.28 ng/ml) and Gt40 (2.7±0.14 ng/ml) groups Using qRT-PCR, we found that BPA dramatically (P<0.05) compared to BPA group (Figure 1C). Treatment reduced MAPK1, MAPK3, MAPK7 and GPR30 over 24 with Eq also showed down-regulation of ERRG level, hr period. Each gene displayed a different sequential temporal pattern of gene induction (Figure 3). other phytoestrogen-treated cells. We also observed MAPK1, MAPK3, MAPK7 and GPR30 are associated thoughthe oestrogenic the effect potency was insignificantof Est group comparedand it showed to theno with osteoblast proliferation and differentiation. The expression level in BPA alone group was compared treated cells (Figure 1C). with Ctrl group under normalized fold change. The BPA significance difference compared to the phytoestrogens- group showed down-regulation of MAPK1, MAPK3, Actin cytoskeletal structure MAPK7 and GPR30 expression compared to Ctrl group P<0.05) decreased

It has been reported that the filaments of actin (Figure 3). However, significantly ( 1158 Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 Protective effect of Phytoestrogens Thent et al.

A.

Figure 3. Gene expression of osteoblast proliferation and differentiation markers in BPA-induced phytoestrogen-treated hFOB 1.19 cells. Total RNA extracted from all groups of hFOB 1.19 cells was primer sequences. Table 1: The gene expression was normalized reverseagainst referencetranscribed genes and amplified(HPRT1 and with ACTB1) real-time for PCRall group using ofspecific cells. Data are expressed as mean±SEM triplicate independent biological samples. *P< BPA: Bisphenol A 0.05; is considered significant. expressions of MAPK1 and GPR30 were noticed in B. BPA group compared to low concentration of Dz5

Figure 4. qRT-PCR analysis of oestrogen and oestrogen-related treated groups, we found that phytoestrogens as well receptors in BPA-induced phytoestrogen-treated hFOB 1.19 cells and high concentration of Gt40 μg/ml groups. For the in expressions of MAPK1 and MAPK7 levels compared underB; oestrogen BPA exposure. receptors: Specific ESR1, primerESR2. All sequences: the genes Tableexpression 1: were in usedeach as Est groups did not show any significant differenceP<0.05) forgroup each was gene normalized A; oestrogen-related against HPRT1 receptor and ACTB1 genes: (reference ERα, ERβ, genes). ERRG, upregulated expression of MAPK3 and GPR30 were For BPA group, the cells were normalized again with Ctrl group and to the BPA group. Interestingly, the significant ( all the other treated groups were normalized with BPA group under normalized fold change. Data are expressed as mean±SEM triplicate among the treatment groups (Figure 3). Est groups independent biological samples. *P< observedshowed relatively in Dz5 and increased Gt40 μg/ml expressions groups when of MAPK3 compared and GPR30. oestrogen receptor 1, ESR2: oestrogen0.05; receptor is considered 2, ERRG: oestrogen- significant ERα:related oestrogen receptor receptorgamma, BPA:alpha, Bisphenol ERβ: oestrogen A, Ctrl: Controlreceptor beta, ESR1: Gene expression of the oestrogen receptors Since BPA decreased cell proliferation and it is believed that phytoestrogens exert osteoprotective differentiation associated genes, we also observed effect via increasing the expression of both ESR1 and the expression of oestrogen and oestrogen-related ESR2. receptors following 24 hr of incubation period. As observed in Figure 4A, B, we found that exposure with Discussion BPA is exposed to the industrial human populations constantly as it is easily found in environment in the BPA4A). aloneHowever, had relativelygenes associated similar expression with oestrogen of ERα and form of plastic products, and factory or industrial ERβoestrogen-related genes when comparedreceptors tolike the oestrogen Ctrl group receptor (Figure. 1 wastes. BPA acts as a selective oestrogen receptor (ESR1) and oestrogen receptor 2 (ESR2) were found modulator and thus it is recognized as a xenoestrogen P<0.05) in BPA group in general. Moreover, BPA does not show any structural P<0.05) of homology with endogenous oestrogen E2 (19). toERRG be was significantly observed decreasedin BPA group ( compared to the Ctrl However, it affects the ESR in similar or stronger way (Figuregroup. On 4B). the other A significant hand, treatment up-regulation with phytoestrogen ( than E2 through non-classical oestrogen triggered caused increased expression of classical oestrogen pathways, which results in a larger ability to recruit co-activators (20). In general, BPA exhibits oestrogen 4A). However, the non-classical ERRG was relatively antagonistic effects depending on both the ER subtype relateddecreased receptor in (P< genes0.05) includingall the phytoestrogen ERα and ERβ and (Figure Est- treated groups compared to the BPA group (Figure target organs of oestrogen is bone. In the bone cells, 4A). When compared with BPA group of cells (Figure and the tissue involved (21). One of the most significant 4A), we found that in general, Dz5 and Gt40 groups BPA(22). significantlyOn the other suppressed hand, phytoestrogens ALP activities, exhibit while the E2 the expression of ERRG gene under BPA exposure. In expressionosteoprotective was effect found and to was be shown significantly to improve increased bone maintainedaddition, ESR1 the and bone ESR2 health were by found significantly to be well decreasing expressed loss by exerting the oestrogenic effect mediated through following phytoestrogens treatment (Figure 4B). To oestrogen receptors (23). Although osteogenic actions P<0.05) of BPA and phytoestrogens have been reported in expression in Dz5 group, whereas Gt40 group showed several studies, the detailed mechanism of their effect bemore more pronounced specific, effect ESR1 on showed ESR2 expression. significant Therefore, ( towards oestrogen and its related receptors has not

Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 1159 Thent et al. Protective effect of Phytoestrogens been elucidated. effects of daidzein on cell apoptosis, ALP activity, and Under BPA exposure, bone metabolism is disturbed as it inhibits the osteoblasts proliferation (30). Our study also showed that lower concentration and differentiation (24). This study investigated the collagen content were mediated by both ERα and ERβ oestrogen-mediated pathway of BPA and phytoestrogens levels in the presence of BPA. Similar results were found in hFOB 1.19 cells. We found that BPA has similar effect of Dz (5 μg/ml) increased the ERα and ERβ protein

ininhibited mRNA the expression bone loss of in bothovariectomized ERα and ERβmice following (31) and on ERα, but it relatively reduced the protein level of treatmentpromoted osteoblastwith 5 μg/ml proliferation of Dz. Equol, and a differentiation metabolite of Dz,via ERβand whentheir precursorcompared cells.to the TheyCtrl group. play a It crucial is well roleknown in activating the ER pathway (32), which further supported that both ERα and ERβ are expressed in osteoblasts development and maintenance processes (25), whereas bone remodelling in which ERα is responsible for bone our results. Eq (4 μg/ml) showed increase in ERα and ERβother protein phytoestrogen as well as groups. mRNA Simultaneously,expressions. However, we found the ERβ prevents the stimulation of ERα in bone formation results were not significant when it compared to the bythe regulatingbone metabolism, the activity osteogenic of ERα (26).cytokines However, expression other researchersand osteoblast have function reported (27). that Moreover,both ERα and it was ERβ shown act on thatIn high contrast concentration to the BPA of Estalone (16 group, μg/ml) all induced the treated both ERαgroups and (phytoestrogensERβ expressions underand BPAEst exposure.groups) showed thatBPA activationwas shown of to ERβ have was similar able to effect inhibit like the endogenous decreasing expressions under BPA exposure. It showed that osteoblast viability due to ERα depletion. Although significantlyphytoestrogens decreased act on the ERRG osteoblasts protein by and binding mRNA to gain further access, we analysed the effect of BPA on the classical oestrogen receptors rather than the non- oestrogen,ERRG in hFOB it affects 1.19 onlycells. the The ERα cells and induced not the with ERβ. BPA To classical oestrogen receptor like ERRG. ESR1 and ESR2 P<0.05) in mRNA expressions were upregulated in phytoestrogen- ERRG compared to Ctrl group. Previous data showed treated cells. So far, to our knowledge, little or no 12.5that BPA μg/ml exerts showed anti-oestrogenic significant effect increase via non-classical ( studies reported the molecular mechanism behind the oestrogen pathway (20). Our result is in agreement effect of phytoestrogens towards BPA-induced bone with previous study, which reported that BPA binds loss. Our previous data also showed the increased cell viability, proliferation and differentiation of BPA- unclear physiological ligand (3). Using an ERRG global induced osteoblasts following treatment with different withknock-out high affinitymouse, to Cordelli the ERRG, and a nuclearAubin (2014)receptor found with concentrations of phytoestrogens (17). From the present that ERRG does not seem to be required for bone study, we underlined that phytoestrogens acts on BPA- development in mice, although the receptor acts in a induced osteoblasts as an ER agonist through activating runt related transcription factor 2 (RUNX2) -dependent the oestrogen and oestrogen-related receptors manner (4). In an earlier study, Byung-Chul Jeong et al. (2009) found that inhibition of ERRG expression downregulating the ERRG expression in hFOB 1.19 withcells. Moreover, significantly the upregulatingdirect effect of ERβ phytoestrogens expression and on (BMP2)-induced osteoblast differentiation, osteocalcin osteoblastogenesis was observed via upregulating the significantlyexpression, ALP increased activity bone and morphogeneticbone mineralization protein (5). 2 classical oestrogen receptors and downregulating the Therefore, binding of BPA to ERRG receptor results in non-classical oestrogen receptor. reducing the osteocalcin expression, and ALP activity In regulating the bone remodelling, cytoskeletal and causes bone demineralisation. Our qRTPCR analysis organisation plays an important role. With cellular also showed up-regulation of ERRG expression following mechanical adaptation through cytoskeletal 24 hr of BPA exposure. rearrangement of osteoblasts, there is an increased However, following treatment with phytoestrogens bone formation and function. In our study, the BPA group protein levels were relatively increased. Our study is in results in relatively deformed and less stiff osteoblasts. inaccordance the presence with of previousBPA (12.5 study μg/ml), in bothwhich ERα researcher and ERβ showedThe stiffness a smaller of amountosteoblasts of dense and actin the filaments, morphological which in MC3T3-E1 cells (28). They proved that mRNA (33). Eventually, it is possible that the lower binding showed that genistein (Gt) induced ERα expression appearance of cytoskeleton are influenced by oestrogen expressionin Gt treatment. of ERα Inwas the increased present following study, we Gt foundtreatment. that affinityreceptor ofcaused BPA toanti-oestrogenic classical oestrogen effect receptorsthat induced and However, the study did not highlight the ERβ expression highermechanical binding changes affinity to the toosteoblasts non-classical and exerted oestrogen the downstream effects. However, in the treated groups, high concentration of Gt (40 μg/ml) insignificantly increasedcells induced the ERαwith proteinBPA. The expression, mRNA expression and significant also effect was observed with ERβ expression in hFOB 1.19 Dz5,data showed Gt40, Eq4 that and Dz Estinduced (16 μg/ml)rapid changes groups in showed actin densercytoskeleton actin in filaments osteoblasts in (34). osteoblast However, cells. in Previousterms of showedexpression. up-regulation In an earlier of both study, ERα daidzein and ERβ; (Dz) however, was the effect of phytoestrogens towards the density and thereported pronounced to enhance effect cell proliferation was observed via in ER-dependent ERβ mRNA MEK/ERK and phosphatidylinositol-3-kinase/ protein that the effect of phytoestrogens towards cytoskeleton kinase B (PI3K/Akt) pathways in MG-63 cells (29). The filamentarrangement composition, of osteoblast-like less data was cells found. is induced We observed with

1160 Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 Protective effect of Phytoestrogens Thent et al.

BPA. Though, we did not quantify the relative density and stiffness of the actin cytoskeleton in the hFOB 1.19 cells. differencethe GPR30 was expression observed and in Dz5 induced and Gt40 cell μg/ml proliferation groups. The ERK/MAPK pathway plays an important role andThese early findings differentiation evidenced inthat hFOB phytoestrogens 1.19 cells under activated BPA in osteoblast differentiation. Blocking or suppressing exposure. The increased MAPK3 expression was also the MAPK pathway causes disturbance in the bone found in Dz5 and Gt40-treated groups (as mentioned metabolism (35). We found out that the BPA group above). In general, phytoestrogens rescued the BPA- showed decreased MAPK1, MAPK3 and MAPK7 mRNA induced osteoblast-like cells from reduced proliferation expressions compared to the Ctrl group. Similar and differentiation via upregulating the MAPK3 and GPR30 expressions. BPA downregulated the differentiation signals, such Our study has few limitations. First, we did not detect findingas MAPK was and also ERK observed in MC3T3-E1 in previous cells study(24). in Earlier which the direct effects of phytoestrogens on osteoblasts. study on mice observed that the ERK/MAPK signaling Second, hFOB 1.19 cells are different from primary pathway involves in osteoblast differentiation (36). osteoblasts as they are immortalized cells and proliferate Increased MAPK signaling promotes differentiation of rapidly. These cells can form mineralized nodules under mesenchymal cells into osteoblasts (37). Blocking of special culture conditions. However, hFOB 1.19 cell lines are easily available, homogeneous and consistent mature osteoblasts cells (38). Therefore, it is believed that in vitro model to study the human osteoblast cells (45). MAPKBPA inhibited supressed the osteoblast-specificosteoblast differentiation gene expression by reducing in Additionally, the osteoblasts from human cancellous the MAPK expression in hFOB 1.19 cells. However, in hFOB cells from human trabecular bone preserve the bonenative largelyregulatory express pathways ERβ thanon direct ERα treatment (46, 47). with The theSurprisingly, treated groups, the phytoestrogens-treated significantly increased cellsMAPK3 showed gene oestrogen. Moreover, these types of commercial cells expressionmore pronounced was observed effect inon Dz5, MAPK3 and Gt40 expression μg/ml groups. rather than Est groups. MAPK1 expression was downregulated (45, 48). The concentration of BPA used in the present in all the treated groups. Genistein was reported to linestudy are needs reported further to expressinvestigations the ERα to anddetermine ERβ genes the stimulate the osteoblast differentiation through p38 lethal concentration (LD50) in in vivo studies and later, MAPK-Cbfa1 (Core binding factor 1) pathway in mouse maximum and minimum toxicity concentrations in bone marrow-derived mesenchymal stem cells (BMSC) (39). We showed that low concentration of Dz (Dz= this study pave the way for further investigation to Dz5 ug/ml) and high concentration of Gt (Gt=Gt 40ug/ theidentify human the clinicaldirect effects trials. of Therefore, phytoestrogens our findings and their in ml) stimulated the cell differentiation via activation of oestrogenic effect on the primary osteoblasts. Study like MAPK3 expression in osteoblast-like cells under BPA exposure. Future study on detailed mechanism and the to be drawn with regards to the effect of phytoestrogens action of phytoestrogens on different MAPK expressions thisin overcoming needs further the confirmationadverse reaction for any of BPAfirm on conclusion bone by is mandatory. activating the classical oestrogen receptors. We also analysed the mRNA expression of cell surface GPR30 in hFOB 1.19 cells. We found that the Conclusion We investigated that BPA reduced osteoblast GPER1 expression. GPR30 is well-expressed in all proliferation and differentiation due to its higher BPAbone groupcells such showed as osteoblasts, significant decreaseosteoclasts, in osteocytes GPR30 or and chondrocytes (40). Several experimental studies receptor like ERRG receptor. In contrast, different showed the effect of GPR30 on bone health (41). bindingtypes of phytoestrogens affinity to theincreased non-classical the hFOB oestrogen1.19 cells GPR30 involves in proliferation and differentiation of the osteoblasts cells. From the present qRT-PCR result, and supressing the ERRG receptor expression. The it was shown that BPA caused decreased osteoblast differentiationoestrogenic activity via activating of phytoestrogens the ERα and was ERβ triggered receptors by proliferation and differentiation via down-regulation of GPR30 expression. Prior study suggested that GPR30 regulates the bone homeostasis and believed that this theof daidzeinincreased anddensity high of actinconcentration filaments inof osteoblast-like genistein is receptor is involved in endochondral bone formation cellsrequired under for BPA augmenting exposure. Specifically,the osteoblast low differentiation concentration via MAPK pathway and GPR30 receptor expression. The (42). Moreover, it was reported that GPR30-mediated osteoprotective effect of Eq may in part enlighten the activation of adenylyl cyclase affects the activation of ERK/MAPK, which shows the link between GPR30 and ERK/MAPK pathway (43). Our data supported lackcompared of benefits to Dz of and Eq inGt bone in maintaining research. These the bone interesting health. findingsTherefore, also it is explainedcrucial to study the lessthe molecular positive effect mechanism of Eq MAPK expression were found along with down- of different types of phytoestrogens to explore their theregulation findings of GPR30 of previous in BPA study group that when downregulated compared to therapeutic roles in the in vitro and in vivo studies, as the Ctrl group. GPR30 is involved in early osteogenic well as in clinical trials. Considering that oestrogen and differentiation, and silencing this gene in MC3T3-E1 oestrogen-related receptors to be the most preferred molecular targets, phytoestrogens possess multiple In the present study, both the phytoestrogens and Est- positive effects that make it a potential alternative cellstreated caused cells showed significant up-regulation reduction of in GPR30 cell growth expression (44). supplement in overcoming the bone damage due to BPA exposure. in hFOB 1.19 cells under BPA exposure. The significant Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 1161 Thent et al. Protective effect of Phytoestrogens

Acknowledgment 459–465. The funding of this work was provided by the 15. Ohtomo T, Uehara M, Peñalvo JL, Adlercreutz H, Katsumata S, Ministry of Higher Education (FRGS) (600-RMI/FRGS Suzuki K, et al. Comparative activities of daidzein metabolites, 5/3 (0010/2016)). The results described in this paper equol and O-desmethylangolensin, on bone mineral density and lipid metabolism in ovariectomized mice and in osteoclast were part of student thesis. The authors would like to cell cultures. Eur J Nutr 2008; 47: 273–279. acknowledge Faculty of Medicine, Institute for Medical 16. Wang TTY, Sathyamoorthy N, Phang JM. Molecular effects Molecular Biotechnology (IMMB), Universiti Teknologi of genistein on estrogen receptor mediated pathways. MARA (UiTM) for providing the research materials and Carcinogenesis 1996; 17: 271–275. support throughout the study. 17. Thent ZC, Froemming GRA, Ismail ABM, Fuad SBSA, Muid S. Employing different types of phytoestrogens improve bone Conflicts of Interest mineralization in bisphenol A induced osteoblast. Life Sci 2018; 210: 214-223. 18. Houben F, Ramaekers FCS, Snoeckx LHEH, Broers JL. Role of interest. nuclear lamina-cytoskeleton interactions in the maintenance The authors declare that there are no conflicts of of cellular strength. Biochim Biophys Acta 2007; 1773: 675- References 686. 1. Centrella M, McCarthy TL. Estrogen receptor dependent 19. Zhao HY, Bi YF, Ma LY, Zhao L, Wang TG, Zhang LZ, et al. gene expression by osteoblasts - Direct, indirect, circumspect, The effects of bisphenol A,BPA, exposure on fat mass and and speculative effects. Steroids 2012; 77: 174–184. serum leptin concentrations have no impact on bone mineral 2. Tohmé M, Prud’Homme SM, Boulahtouf A, Samarut E, densities in non-obese premenopausal women. Clin Biochem Brunet F, Bernard L, et al 2012; 45: 1602–1606. vivo receptor of bisphenol A. FASEB J 2014; 28: 3124–3133. 20. Alonso-Magdalena P, Ropero AB, Soriano S, García-Arévalo 3. Matsushima A, Teramoto. Estrogen-related T, Okada H, receptorLiu X, Tokunaga γ is an in M, Ripoll C, Fuentes E, et al. Bisphenol-A acts as a potent T, Kakuta Y, et al estrogen via non-classical estrogen triggered pathways. Mol Cell Endocrinol 2012; 355: 201–207. Res Commun 2008;. 373: ERRγ 408–413. tethers strongly bisphenol A and 21. Kurosawa T, Hiroi H, Tsutsumi O, Ishikawa T, Osuga Y, 4.4-α-cumylphenol in an induced-fit manner. Biochem Biophys Fujiwara T, et al. The Activity of Bisphenol A Depends on Both development but is a RUNX2-dependent negative regulator of the Estrogen Receptor Subtype and the Cell Type. Endocrine J postnatalCardelli bone M, Aubinformation JE. ERRγin male is mice. not required PLoS ONE for 2014; skeletal 9: 2002; 49: 465–471. e109592. 22. Suzuki N, Hattori A. Bisphenol a suppresses osteoclastic 5. Jeong BC, Lee YS, Park YY, Bae IH, Kim DK, Koo SH, et al. The Life Sci 2003; 73: 2237–2247. negatively regulates BMP2-induced osteoblast differentiation 23.and Soto osteoblastic AM, Sonnenschein activities inC, theChung cultured KL, Fernandez scales of MF, goldfish. Olea orphanand bone nuclear formation. receptor J Biol estrogen Chem 2009; receptor-related 284 :14211-14218. receptor γ N, Serrano FO. The E-SCREEN assay as a tool to identify 6. Bidwell JP, Fey EG, van Wijnen AJ, Penman S, Stein JL, Lian estrogens, An update on estrogenic environmental pollutants. J.B, et al. Nuclear Matrix Proteins Distinguish Normal Diploid Environ Health Perspect 1995; 103: 113–122. Osteoblasts from Osteosarcoma Cells. Cancer Res 1994; 54: 24. Hwang JK, Min KH, Choi KH, Hwang YC, Jeong IK, Ahn 28–32. KJ, et al. Bisphenol A reduces differentiation and stimulates 7. Felson D, Zhang Y, Hannan M, Kiel DP, Wilson PW, Anderson apoptosis of osteoclasts and osteoblasts. Life Sci 2013; 93: JJ. The effect of postmenopausal estrogen therapy on bone 367–372. density in elderly women. N Engl J Med 1993; 329:1141-1146. 25. Roepke TA, Bosch MA, Rick EA, Lee B, Wagner EJ, Seidlova- 8. Zavatti M, Resca E, Bertoni L, Maraldi T, Guida M, Carnevale Wuttke D, et al. Contribution of a membrane estrogen receptor G, et al. Ferutinin promotes proliferation and osteoblastic to the estrogenic regulation of body temperature and energy homeostasis. Endocrinol 2010; 151: 4926–4937. cells. Life Sci 2013; 92: 993–1003. 26. Roman-Blas JA, Castañeda S, Largo R, Herrero-Beaumont 9.differentiation Shedd-Wise KM,in human Alekel amnioticDL, Hofmann fluid H, and Hanson dental KB, pulp Schiferl stem DJ, Hanson LN, et al Res Ther 2009; 11:241. Loss Study, 3-Yr Effects on pQCT Bone Mineral Density and 27.G. Osteoarthritis Bhargavan B, associatedSingh D, Gautam with estrogen AK, Mishra deficiency. JS, Kumar Arthritis A, Goel Strength Measures in. PostmenopausalThe Soy Isoflavones Women. for ReducingJ Clin Densitom Bone A, et al. Medicarpin, a legume phytoalexin, stimulates osteoblast 2011; 14: 47–57. differentiation and promotes peak bone mass achievement in 10. Chang KL, Hu YC, Hsieh BS, Cheng HL, Hsu HW, Huang LW, et al action of medicarpin. J Nutr Biochem 2012; 23: 27–38. bone loss in ovariectomized rats. Nutrition 2013; 29: 250–257. 28.rats, Liao Evidence MH, Tai for YT, estrogen Cherng receptorYG, Liu SH, β-mediated Chang YA, osteogenic Lin PI, et 11. Kuiper. Combined GG, Carlsson effect of B, soyGrandien isoflavones K, Enmark and vitamin E, Häggblad D3 on J, al. Genistein induces oestrogen receptor-a gene expression Nilsson S, et al. in osteoblasts through the activation of mitogen-activated and transcript tissue distribution of estrogen receptors alpha protein kinases/NF-kB/ activator protein-1 and promotes cell and beta. Endocrinol Comparison 1997; 138: of the863–870. ligand binding specificity mineralisation. Br J Nutr 2014; 111: 55-63. 12. An J, Tzagarakis-Foster C, Scharschmidt TC, Lomri N, 29. Jin X, Sun J, Yu B, Wang Y, Sun WJ, Yang J, et al. Daidzein stimulates osteogenesis facilitating proliferation, activity and recruitment of coregulators by phytoestrogens. J differentiation, and antiapoptosis in human osteoblast-like LeitmanBiol Chem DC. 2001; Estrogen 276: 17808–17814. receptor β-selective transcriptional MG-63 cells via estrogen receptor–dependent MEK/ERK and 13. PI3K/Akt activation. Nutr Res 2017; 42: 20–30. interleukin-6 and osteoprotegerin synthesis during osteoblast 30. Sun J, Sun WJ, Li ZY, Li L, Wang Y, Zhao Y, et al. Daidzein cell Chendifferentiation XW, Garner via SC, Andersonan estrogen-receptor-dependent JJB. Isoflavones regulate increases OPG/RANKL ratio and suppresses IL-6 in MG-63 pathway. Biochem Biophysic Res Commun 2002; 295: 417- osteoblast cells. Int Immunopharmacol 2016; 40: 32–40. 422. 31. Fujioka M, Uehara M, Wu J, Adlercreutz H, Suzuki K, 14. Kolios L, Sehmisch S, Daub F, Rack T, Tezval M, Stuermer Kanazawa K, et al. Equol, a metabolite of daidzein, inhibits KM, et al. Equol but not genistein improves early metaphyseal bone loss in ovariectomized mice. J Nutr 2004; 134: 2623- fracture healing in osteoporotic rats. Planta Med 2009; 75: 2627.

1162 Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 Protective effect of Phytoestrogens Thent et al.

32. Wang J, Xu J, Wang B, Shu FR, Chen K, Mi MT. Equol bone. J Endocrinol 2008;197:R1-6. promotes rat osteoblast proliferation and differentiation 41. Windahl SH, Andersson N, Chagin AS, Mårtensson UE, through activating estrogen receptor. Genetics Mol Res 2014; Carlsten H, Olde B, et al. The role of the G protein-coupled 13: 5055–5063. receptor GPR30 in the effects of estrogen in ovariectomized 33. mice. Am J Physiol Endocrinol Metab 2009; 296: E490-E496. mechanical properties of human fetal osteoblasts through 42. Hertrampf T, Gruca MJ, Seibel J, Laudenbach U, Fritzemeier cytoskeletalMuthukumaran changes. P, BiochemLim CT, LeeBiophysic T. Estradiol Res Commun influences 2012; the KH, Diel P. The bone-protective effect of the phytoestrogen 423: 503–508. 34. de Wilde A, Heberden C, Chaumaz G, Bordat C, Lieberherr strongly enhanced by physical activity. Bone 2007; 40:1529- M. Signaling networks from Gbeta1 subunit to transcription genistein1535. is mediated via ERα-dependent mechanisms and factors and actin remodeling via a membrane-located ERbeta- 43. Khan K, Pal S, Yadav M, Maurya R, Trivedi AK, Sanyal S, et al. related protein in the rapid action of daidzein in osteoblasts. J Prunetin signals via G-protein-coupled receptor, GPR30,GPER1, Cell Physiol 2006; 209: 786-801. Stimulation of adenylyl cyclase and cAMP-mediated activation 35. Yoon S, Seger R. The extracellular signal-regulated kinase, of MAPK signaling induces Runx2 expression in osteoblasts to Multiple substrates regulate diverse cellular functions. Growth promote bone regeneration. J Nutr Biochem 2015; 26:1491- Factors 2006; 24: 21–44. 1501. 36. Murakami S, Balmes G, McKinney S, Zhang Z, Givol D, 44. Teplyuk NM, Galindo M, Teplyuk VI, Pratap J, Young DW, de Crombrugghe B. Constitutive activation of MEK1 in Lapointe D, et al. Runx2 regulates G protein-coupled signaling chondrocytes causes Stat1-independent achondroplasia-like pathways to control growth of osteoblast progenitors. J Biol Chem 2008; 283: 27585–27597. Genes Development 2004; 18: 290–305. 45. Yen M, Chien CC, Chiu I, Huang HI, Chen YC, Hu HI, et al. 37.dwarfism Matsushita and rescuesT, Chan theYY, Fgfr3-deficientKawanami A, Balmes mouse G, phenotype. Landreth Multilineage differentiation and characterization of the human GE, Murakami S. extracellular signal-regulated kinase 1, ERK1, fetal osteoblastic 1.19 cell line, a possible in vitro model of human and ERK2 Play essential roles in osteoblast differentiation mesenchymal progenitors. Stem Cells 2007; 25: 125-131. and in supporting osteoclastogenesis. Mol Cell Biol 2009; 29: 46. Miki Y, Suzuki T, Nagasaki S, Hata S, Akahira J, Sasano H. 5843–5857. Comparative effects of raloxifene, tamoxifen and estradiol 38. Xiao G, Gopalakrishnan R, Jiang D, Reith E, Benson MD, on human osteoblasts in vitro, Estrogen receptor dependent Franceschi RT. Franceschi, Bone morphogenetic proteins, or independent pathways of raloxifene. J Steroid Biochem extracellular matrix, and mitogen-activated protein kinase Molecul Biol 2009; 113: 281–289. 47. Turner RT, Rickard DJ, Iwaniec UT, Spelsberg TC. Estrogens expression and differentiation in MC3T3-E1 cells. J Bone Min and Progestins in ‘Principles of Bone Biology 3rd edition’ signalingRes 2002; pathways17: 101–110. are required for osteoblast-specific gene (Bilezikian J.P, et al. eds.): Academic Press, San Diego. 2008. 39. Ganai AA, Khan AA, Malik ZA, Farooqi H. Genistein modulates p.855–879. 48. Waters KM, Rickard DJ, Lawrence RB, Khosla S, attenuating d-Galactosamine induced fulminant hepatic failure Katzenellenbogen JA, Katzenellenbogen BS, et al. Estrogen thein Wistar expression rats. Toxicolof NF-κB Appl and Pharmacol MAPK ,p-38 2015; and ERK1/2,283: 139–146. thereby regulation of human osteoblast function is determined by the 40. Heino TJ, Chagin AS, Sävendahl L. The novel estrogen stage of differentiation and the estrogen receptor isoform. J receptor G-protein-coupled receptor 30 is expressed in human Cell Biochem 2001; 83: 448–462.

Iran J Basic Med Sci, Vol. 23, No. 9, Sep 2020 1163