Phytoestrogens and the Intestinal Microbiome

Total Page:16

File Type:pdf, Size:1020Kb

Phytoestrogens and the Intestinal Microbiome Physiol. Res. 67 (Suppl. 3): S401-S408, 2018 https://doi.org/10.33549/physiolres.934022 REVIEW Phytoestrogens and the Intestinal Microbiome L. KOLÁTOROVÁ1, O. LAPČÍK1,2, L. STÁRKA1 1Department of Steroids and Proteofactors, Institute of Endocrinology, Prague, Czech Republic, 2Department of Chemistry of Natural Compounds, University of Chemistry and Technology, Prague, Czech Republic Received August 8, 2018 Accepted September 11, 2018 Summary Introduction The microflora of the digestive tract is composed of a unique set of bacteria, yeasts, viruses and other microorganisms, generally The term microflora generally refers to the living known as the microbiome. The microbiome exhibits considerable exogenic component of the gastrointestinal tract inter-individual variability, with up to two-thirds of the microflora composed of bacteria, viruses, protozoans, and yeasts. differing between individuals. Because of this, the variable Currently, the term microbiome is becoming more intestinal microflora is responsible for many differences in popular, encompassing the summary of all microbiotic metabolic, hormonal and immunological processes in humans genetic information. and animals. Significant differences have been observed in the There is a relatively long history of medical metabolism of phytoestrogens, naturally occurring substances research on the influence of gastrointestinal microbiota that possess estrogenic or anti-estrogenic activity. These on the metabolic functioning of the host organism. substances occur predominately in legumes, especially in soy and Veterinary medicine has dealt with this issue since the many soy products. Because of their effects, phytoestrogens are 1950s, while human medicine concentrated mainly on the used as an alternative therapy for menopausal disorders and microbial composition and activities in the oral-nasal benign prostate hyperplasia. In connection with the worldwide cavities, and only later expanded interest to include the expansion of soy products as part of healthy lifestyles including entire gastrointestinal tract. vegetarianism and veganism, phytoestrogens have become The first important work that focused on a regular part of everyday life. The activity of phytoestrogens is metabolic processes in the intestines was a study on the strongly dependent on the microbiome. Their metabolites have microbial transformation of glucose to propionate in 1963 stronger estrogenic activity than the natural substances (Baldwin et al. 1963). A foundational study on the themselves, and because of the variability in microbiomes, there intestinal microbiota in the Czech Republic was the study are large differences in the effects of phytoestrogens among on the colonization of the Escherichia coli bacteria in individuals. children, with the aim of reducing nosocomial infections (Lodinová et al. 1991). Today, the term microbiome, Key words meaning the sum of microbiotic genetic information, has Phytoestrogens • Daidzein • Equol • Microbiota about 40,000 citations in biomedical databases. This increase in research on the intestinal Corresponding author microbiota makes clear that the microbiome plays L. Kolatorova-Sosvorova, Department of Steroids and Proteofactors, an important role in the health of the host. Knowledge of Institute of Endocrinology, Narodni 8, 116 94 Prague, Czech the metabolism and regulation mechanisms of humans Republic. E-mail: [email protected] must include information about the organism itself plus information about cells that are present but that do not PHYSIOLOGICAL RESEARCH • ISSN 0862-8408 (print) • ISSN 1802-9973 (online) 2018 Institute of Physiology of the Czech Academy of Sciences, Prague, Czech Republic Fax +420 241 062 164, e-mail: [email protected], www.biomed.cas.cz/physiolres S402 Kolátorová et al. Vol. 67 come from the host’s body. The mass of the intestinal methylases, thiolases, lipases, nitroreductases, beta- microbiota ranges around 1-2 kg and current estimates glucuronidases, sulfatases and beta-lysases, as well as put the number of organisms at 1013, with 10 times the specific hydroxylases, oxidoreductases and lysases number of genes than the human genome (Sender et al. important in steroid metabolism. Some metabolic 2017). pathways, for instance steroid hormones in the microbiota, are similar or the same as in the host, while The development of the microbiota others are specific and determined by the microbial composition. The capabilities of these microorganisms The influence of the microbiota is determined have been richly used in the pharmaceutical industry to partly by its composition, which is the result of factors produce compounds that are much more difficult to both internal and external. The formation of the synthesize in other ways. microbiome begins already during embryonic Microorganisms influence digestion, cleave development, and a critical time is the period after birth, complex saccharides, produce short-chain fatty acids, when the mother’s milk plays an important protective support detoxification, and synthesize various vitamins. role in the child. The microbiome is generally stabilized They affect immunity and are part of the defense around the 2nd to 3rd year of life. Different people have mechanism against pathogens. They regulate epithelial greatly varied microbiotic compositions, but within an cell differentiation, and influence the development and individual the composition is quite stable. However, physiology of various systems as well as the appearance changes do appear under the influence of various factors. and progression of some diseases. They have indirect Antibiotic treatment has a marked impact on the effects on the central nervous system, influencing microbiota. Disruption of the intestinal equilibrium by perceptions such as taste (Podzimek et al. 2018), mood, antibiotics can lead to changes in up to 90 % of analyzed and behavior. metabolites such as bile acids, eicosanoids and steroid Just as the intestinal microbiota influence hormones. Subsequent disruption of metabolic pathways immunity, hormonal and nerve functions, so can the can be critically important to the host. immune and endocrine system in the mucus of the gastrointestinal tract influence the microbial composition The influence of the microbiota on metabolic and regulate “intestinal health” (Šefčíková et al. 2010, processes Šefčíková and Bujňáková 2017). The host thus gains possible defenses against invasive pathogens by the The microbiota has a diverse composition production of antimicrobial peptides in the epithelial including bacteria, protozoans, and viruses, and plays layer, such as defensin and cathelicidin. The microbiota a key role in metabolizing compounds traversing the and host influence each other in both directions. gastrointestinal tract, including food particles, medicines and toxins from the external environment, as well as Phytoestrogens compounds excreted into the gastrointestinal tract such as bile acids. From a chemical point-of-view, phytoestrogens Bacteria, the most frequent members of are a variable group of compounds. In contrast to the microbiota, can be taxonomically divided into the estrogens themselves, they are not steroids, but rather phyla Firmicultes, Bacteriodates, Protobacteria and products of several of the metabolic pathways of Actinobacteria. Microbial fermentation breaks down phenylpropanoids. This large group of compounds is dietary compounds and xenobiotics, and products can common in multicellular plants, but do not occur in include compounds with hormonal character. On the animals. Common characteristics of phytoestrogens other hand, hormones produced by humans are include the presence of at least one benzene ring (usually metabolically transformed by the microflora and can thus two), a relatively stable and flat molecule, and two or have different activity than the original hormone. The three hydroxyl groups with distances similar to the intestinal microbiota has even been called a new distances between C3 and C17 in 17β-estradiol (Mazur endocrine organ (Brown and Hazen 2015). and Adlercreutz 2000). The molecular weights are also The microbiota produces a wide range of similar to those of natural estrogens. Active compounds common enzymes, such as azoreductases, esterases, of this type are thought to act through the estrogen 2018 Phytoestrogens and Microbiome S403 receptors ERβ and ERα (Plišáková et al. 2010). 17β-hydroxysteroids, 3β-hydroxysteroids, and aromatase. Isoflavanoids, which are numerous in legumes, are the This lowers the production of the most biologically active most important, followed by flavonoids, lignans, sex hormones, testosterone and estradiol. Genistein, coumestans, ellagitannins, and stilbenes (Mazur and biochanin A and S-equol are inhibitors of 5α-reductases, Adlercreutz 2000). and lower the local concentrations of dihydrotestosterone, Direct estrogenic or anti-estrogenic activities are the main androgen in the prostate. Phytoestrogens also shown by only a fraction of the total number of known influence the biological availability of sex hormones compounds in this group. Of practical significance are through the inhibition of sulfatase and sulfotransferase. mainly genistein, daidzein and its metabolite S-equol, and Another important impact is the lowered activity of to a degree also coumestrol – which while being actively CYP24, an enzyme that plays a role in the degradation of estrogenic only occurs at very low concentrations. In calcitriol. Some isoflavones, genistein in particular, addition it
Recommended publications
  • FULLTEXT01.Pdf
    http://www.diva-portal.org This is the published version of a paper published in International Journal of Cancer. Citation for the original published paper (version of record): Murphy, N., Achaintre, D., Zamora-Ros, R., Jenab, M., Boutron-Ruault, M-C. et al. (2018) A prospective evaluation of plasma polyphenol levels and colon cancer risk International Journal of Cancer, 143(7): 1620-1631 https://doi.org/10.1002/ijc.31563 Access to the published version may require subscription. N.B. When citing this work, cite the original published paper. Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-151155 IJC International Journal of Cancer A prospective evaluation of plasma polyphenol levels and colon cancer risk Neil Murphy 1, David Achaintre1, Raul Zamora-Ros 2, Mazda Jenab1, Marie-Christine Boutron-Ruault3, Franck Carbonnel3,4, Isabelle Savoye3,5, Rudolf Kaaks6, Tilman Kuhn€ 6, Heiner Boeing7, Krasimira Aleksandrova8, Anne Tjønneland9, Cecilie Kyrø 9, Kim Overvad10, J. Ramon Quiros 11, Maria-Jose Sanchez 12,13, Jone M. Altzibar13,14, Jose Marıa Huerta13,15, Aurelio Barricarte13,16,17, Kay-Tee Khaw18, Kathryn E. Bradbury 19, Aurora Perez-Cornago 19, Antonia Trichopoulou20, Anna Karakatsani20,21, Eleni Peppa20, Domenico Palli 22, Sara Grioni23, Rosario Tumino24, Carlotta Sacerdote 25, Salvatore Panico26, H. B(as) Bueno-de-Mesquita27,28,29,30, Petra H. Peeters31,32, Martin Rutega˚rd33, Ingegerd Johansson34, Heinz Freisling1, Hwayoung Noh1, Amanda J. Cross29, Paolo Vineis32, Kostas Tsilidis29,35, Marc J. Gunter1 and Augustin Scalbert1 1 Section of Nutrition and Metabolism, International Agency for Research on Cancer, Lyon, France 2 Unit of Nutrition and Cancer, Cancer Epidemiology Research Programme, Catalan Institute of Oncology, Bellvitge Biomedical Research Institute (IDIBELL), Barcelona, Spain 3 CESP, INSERM U1018, Univ.
    [Show full text]
  • Daidzein Intake Is Associated with Equol Producing Status Through an Increase in the Intestinal Bacteria Responsible for Equol Production
    Article Daidzein Intake Is Associated with Equol Producing Status through an Increase in the Intestinal Bacteria Responsible for Equol Production Chikara Iino 1, Tadashi Shimoyama 2,*, Kaori Iino 3, Yoshihito Yokoyama 3, Daisuke Chinda 1, Hirotake Sakuraba 1, Shinsaku Fukuda 1 and Shigeyuki Nakaji 4 1 Department of Gastroenterology, Hirosaki University Graduate School of Medicine, Hirosaki 036-8562, Japan; [email protected] (C.I.); [email protected] (D.C.); [email protected] (H.S.); [email protected] (S.F.) 2 Aomori General Health Examination Center, Aomori 030-0962, Japan 3 Department of Obstetrics and Gynecology, Hirosaki University Graduate School of Medicine, Hirosaki 036-8562, Japan; [email protected] (K.I.); [email protected] (Y.Y.) 4 Department of Social Medicine, Hirosaki University Graduate School of Medicine, Hirosaki 036-8562, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-017-741-2336 Received: 9 January 2019; Accepted: 7 February 2019; Published: 19 February 2019 Abstracts: Equol is a metabolite of isoflavone daidzein and has an affinity to estrogen receptors. Although equol is produced by intestinal bacteria, the association between the status of equol production and the gut microbiota has not been fully investigated. The aim of this study was to compare the intestinal bacteria responsible for equol production in gut microbiota between equol producer and non-producer subjects regarding the intake of daidzein. A total of 1044 adult subjects who participated in a health survey in Hirosaki city were examined. The concentration of equol in urine was measured by high-performance liquid chromatography.
    [Show full text]
  • Enterorhabdus Caecimuris Sp. Nov., a Member of the Family
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central International Journal of Systematic and Evolutionary Microbiology (2010), 60, 1527–1531 DOI 10.1099/ijs.0.015016-0 Enterorhabdus caecimuris sp. nov., a member of the family Coriobacteriaceae isolated from a mouse model of spontaneous colitis, and emended description of the genus Enterorhabdus Clavel et al. 2009 Thomas Clavel,1 Wayne Duck,2 Ce´dric Charrier,3 Mareike Wenning,4 Charles Elson2 and Dirk Haller1 Correspondence 1Biofunctionality, ZIEL – Research Center for Nutrition and Food Science, Technische Universita¨t Thomas Clavel Mu¨nchen (TUM), 85350 Freising Weihenstephan, Germany [email protected] 2Division of Gastroenterology and Hepatology, Department of Medicine, University of Alabama at Birmingham, Birmingham, AL, USA 3NovaBiotics Ltd, Aberdeen, AB21 9TR, UK 4Microbiology, ZIEL – Research Center for Nutrition and Food Science, TUM, 85350 Freising Weihenstephan, Germany The C3H/HeJBir mouse model of intestinal inflammation was used for isolation of a Gram- positive, rod-shaped, non-spore-forming bacterium (B7T) from caecal suspensions. On the basis of partial 16S rRNA gene sequence analysis, strain B7T was a member of the class Actinobacteria, family Coriobacteriaceae, and was related closely to Enterorhabdus mucosicola T T Mt1B8 (97.6 %). The major fatty acid of strain B7 was C16 : 0 (19.1 %) and the respiratory quinones were mono- and dimethylated. Cells were aerotolerant, but grew only under anoxic conditions. Strain B7T did not convert the isoflavone daidzein and was resistant to cefotaxime. The results of DNA–DNA hybridization experiments and additional physiological and biochemical tests allowed the genotypic and phenotypic differentiation of strain B7T from the type strain of E.
    [Show full text]
  • WO 2018/064165 A2 (.Pdf)
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/064165 A2 05 April 2018 (05.04.2018) W !P O PCT (51) International Patent Classification: Published: A61K 35/74 (20 15.0 1) C12N 1/21 (2006 .01) — without international search report and to be republished (21) International Application Number: upon receipt of that report (Rule 48.2(g)) PCT/US2017/053717 — with sequence listing part of description (Rule 5.2(a)) (22) International Filing Date: 27 September 2017 (27.09.2017) (25) Filing Language: English (26) Publication Langi English (30) Priority Data: 62/400,372 27 September 2016 (27.09.2016) US 62/508,885 19 May 2017 (19.05.2017) US 62/557,566 12 September 2017 (12.09.2017) US (71) Applicant: BOARD OF REGENTS, THE UNIVERSI¬ TY OF TEXAS SYSTEM [US/US]; 210 West 7th St., Austin, TX 78701 (US). (72) Inventors: WARGO, Jennifer; 1814 Bissonnet St., Hous ton, TX 77005 (US). GOPALAKRISHNAN, Vanch- eswaran; 7900 Cambridge, Apt. 10-lb, Houston, TX 77054 (US). (74) Agent: BYRD, Marshall, P.; Parker Highlander PLLC, 1120 S. Capital Of Texas Highway, Bldg. One, Suite 200, Austin, TX 78746 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Genistein and 17‚-Estradiol, but Not Equol, Regulate Vitamin D Synthesis in Human Colon and Breast Cancer Cells
    ANTICANCER RESEARCH 26: 2597-2604 (2006) Genistein and 17‚-estradiol, but not Equol, Regulate Vitamin D Synthesis in Human Colon and Breast Cancer Cells DANIEL LECHNER1, ERIKA BAJNA1, HERMAN ADLERCREUTZ2 and HEIDE S. CROSS1 1Department of Pathophysiology, Medical University of Vienna, Währingergürtel 18-20, A-1090 Vienna, Austria; 2Institute for Preventive Medicine, Nutrition and Cancer, Folkhälsan Research Centre and Department of Clinical Chemistry, University of Helsinki, POB 63, 00014 Helsinki, Finland Abstract. Extrarenal synthesis of the active vitamin D Epidemiological studies have also demonstrated a low metabolite 1,25-dihydroxyvitamin-D3 (1,25-D) has been CRC incidence in Asian countries where a soy-rich diet is observed in cells derived from human organs prone to sporadic consumed (3, 4). A major component of soy beans are cancer incidence. Enhancement of the synthesizing hydroxylase phytoestrogens which bind to estrogen receptors (ER) and CYP27B1 and reduction of the catabolic CYP24 could support induce transcription of ER-responsive genes. This suggests local accumulation of the antimitotic steroid, thus preventing that mechanisms of CRC prevention could potentially be formation of tumors of, e.g., colon and breast. By applying shared by estrogens and phytoestrogens, though the quantitative RT-PCR and HPLC it was observed that in colon- negative effects of estrogen treatment may be avoided with (Caco-2) and breast-(MCF-7) derived cells, 17‚-estradiol and the plant-derived homolog. genistein induced CYP27B1 but reduced CYP24 activity, while It has been demonstrated that phytoestrogens possess equol was inactive. Mammary cells express both estrogen ER-‚-selective transcriptional activity (5, 6). Among receptors (ER) · and ‚, while colon cells express mainly ER‚, phytoestrogens, the isoflavones are the most prominent possibly explaining why MCF-7 cells were more affected.
    [Show full text]
  • Glossary of Terms
    Glossary of Terms Acceptable Daily Intake or Allowed Daily Intake (ADI) → Dose- Response Relationship/Curve Allergen The allergen is a material which triggers an allergic reaction. Allopathy The term allopathy was created by Christian Friedrich Samuel Hahnemann (1755– 1843) (from the Greek prefix άλλος, állos, “other”, “different” and the suffix πάϑος, páthos, “suffering”) in order to distinguish his technique (homeopathy) from the traditional medicine of his age. Today, allopathy means a medicine based on the principles of modern pharmacology. Anaphylactic shock Anaphylaxis (or an anaphylactic shock) is a whole-body, rapidly developing aller- gic reaction, which may lead to lethal respiratory and circulatory failure. Antibody Antibodies are proteins produced by the immune system to neutralize exogenous (external) substances. Chromatography, chromatogram Chromatography is the common name of different techniques used to separate mix- tures of compounds. HPLC stands for high-performance liquid chromatography. A chromatogram is the pattern of separated substances obtained by chromatography. Colloidal sol A colloidal sol is a suspension of very small solid particles in a continuous liquid medium. Colloidal sols are quite stable and show the Tyndall effect (light scatter- ing by particles in a colloid). They can be quite stable. Examples include blood, pigmented ink, and paint. Colloidal sols can change their viscosity quickly if they © Springer International Publishing Switzerland 2014 311 L. Kovács et al., 100 Chemical Myths, DOI 10.1007/978-3-319-08419-0 312 Glossary of Terms are thixotropic. Examples include quicksand and paint, both of which become more fluid under pressure. Concentrations: parts per notations In British/American practice, the parts-per notation is a set of pseudo-units to de- scribe concentrations smaller than thousandths: 1 ppm (parts per million, 10−6 parts) One out of 1 million, e.g.
    [Show full text]
  • Effects of Genistein and Equol on Human and Rat Testicular 3Β-Hydroxysteroid Dehydrogenase and 17Β-Hydroxysteroid Dehydrogenase 3 Activities
    Asian Journal of Andrology (2010): 1–8 npg © 2010 AJA, SIMM & SJTU All rights reserved 1008-682X/10 $ 32.00 1 www.nature.com/aja Original Article Effects of genistein and equol on human and rat testicular 3β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase 3 activities Guo-Xin Hu1, 2,*, Bing-Hai Zhao3,*, Yan-Hui Chu3, Hong-Yu Zhou2, Benson T. Akingbemi4, Zhi-Qiang Zheng5, Ren-Shan Ge1, 5 1Population Council, New York, NY 10065, USA 2School of Pharmacy, Wenzhou Medical College, Wenzhou 325000, China 3Heilongjiang Key Laboratory of Anti-fibrosis Biotherapy, Mudanjiang Medical University, Mudanjiang 157001, China 4Departments of Anatomy, Physiology and Pharmacology, Auburn University, Auburn, AL 36849, USA 5The Second Affiliated Hospital, Wenzhou Medical College, Wenzhou 325000, China Abstract The objective of the present study was to investigate the effects of genistein and equol on 3β-hydroxysteroid de- hydrogenase (3β-HSD) and 17β-hydroxysteroid dehydrogenase 3 (17β-HSD3) in human and rat testis microsomes. These enzymes (3β-HSD and 17β-HSD3), along with two others (cytochrome P450 side-chain cleavage enzyme and cytochrome P450 17α-hydroxylase/17-20 lyase), catalyze the reactions that convert the steroid cholesterol into the sex hormone testosterone. Genistein inhibited 3β-HSD activity (0.2 µmol L-1 pregnenolone) with half-maximal in- -1 hibition or a half-maximal inhibitory concentration (IC50) of 87 ± 15 (human) and 636 ± 155 nmol L (rat). Genistein’s mode of action on 3β-HSD activity was competitive for the substrate pregnenolonrge and noncompetitive for the co- factor NAD+. There was no difference in genistein’s potency of 3β-HSD inhibition between intact rat Leydig cells and testis microsomes.
    [Show full text]
  • A New Coumestan Glucoside from Eclipta Prostrata
    Natural Product Sciences 26(4) : 289-294 (2020) https://doi.org/10.20307/nps.2020.26.4.289 A New Coumestan Glucoside from Eclipta prostrata Young Ju Seo†, Hyun Woo Kil†, Taewoong Rho, and Kee Dong Yoon* College of Pharmacy and Integrated Research Institute of Pharmaceutical Sciences, The Catholic University of Korea, Bucheon-si, Gyeonggi-do 14662, Korea Abstract Eclipta prostrata is an annual herb, belonging to Asteraceae family, and has been traditionally used to improve immunity and treat hepatitis and bacterial disease in Korea. In this study, a new coumestan glucoside (1) along with ten known compounds (2 – 11) was isolated from E. prostrata. The chemical structures of isolates were elucidated to be wedelolactone-9-O--D-glucopyranoside (1), wedelolactone (2), demethylwedelolactone (3), apigenin (4), apigenin-7-sulfate (5), luteolin (6), luteolin-7-sulfate (7), luteolin-7-O--D-glucopyranoside (8), pratensein-7-O--D-glucopyranoside (9), 3,4-di-O-caffeoylquinic acid (10) and 3,5-di-O-caffeoylquinic acid (11) based on the spectroscopic evidence. Keywords Eclipta prostrata, Asteraceae, Phenolic compounds, Wedelolactone-9-O--D-glucopyranoside Introduction infrared spectroscopy (FT-IR). Eclipta prostrata is an annual herb, belonging to Experimental Asteracea family, and distributed in the tropical and subtropical areas, especially Asia and Africa.1 Eclipta General experimental procedures – The preparative prostrata has been traditionally used to improve immunity HPLC was performed using a Gilson HPLC system and treat hepatitis and bacterial diseases in Korea.2 In (Middleton, WI, USA) composed of a binary pump, a India, E. prostrata has been used to treat body pain, fever, liquid handler, and a UV/Vis detector with a Luna C18(2) hair loss, jaundice, liver enlargement and skin diseases.3 (21.2 × 250 mm I.D., 5 μm, Phenomenex, Torrance, CA, Recent biological evidence revealed that the E.
    [Show full text]
  • This Article Was Originally Published in Hormones, Brain and Behavior 2Nd
    This article was originally published in Hormones, Brain and Behavior 2nd edition, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non- commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who you know, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial Gore A C and Crews D Environmental Endocrine Disruption of Brain and Behavior. In: Donald W. Pfaff, Arthur P. Arnold, Anne M. Etgen, Susan E. Fahrbach and Robert T. Rubin, editors. Hormones, Brain and Behavior, 2nd edition, Vol 3. San Diego: Academic Press; 2009. pp. 1789-1816. Author's personal copy 56 Environmental Endocrine Disruption of Brain and Behavior A C Gore and D Crews, University of Texas at Austin, Austin, TX, USA ß 2009 Elsevier Inc. All rights reserved. Chapter Outline 56.1 Introduction to Endocrine Disruption 1790 56.1.1 Critical Issues about Endocrine Disruption 1791 56.1.1.1 Life stage and timing 1791 56.1.1.2 Latency of effects 1791 56.1.1.3 Sensitivity to EDCs 1792 56.1.1.4 Degradation and metabolism,
    [Show full text]
  • Supplementary Material Hydrogen-Rich Water-Alleviated
    10.1071/FP15204_AC © CSIRO 2015 Supplementary Material: Functional Plant Biology, 42(12), 1141–1157. Supplementary Material Hydrogen-rich water-alleviated ultraviolet-B-triggered oxidative damage is partially associated with the manipulation of the metabolism of (iso)flavonoids and antioxidant defence in Medicago sativa Yanjie XieA, Wei ZhangA, Xingliang DuanA, Chen DaiA, Yihua ZhangA, Weiti CuiA, Ren WangB and Wenbiao ShenA,C ACollege of Life Sciences, Laboratory Center of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. BInstitute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Nanjing 210014, China. CCorresponding author. Email: [email protected] 1 Table S1. The sequences of primers for real-time RT-PCR M. truncatula tentative consensus Primer name or accession number Sequences Forward: CTTGATGAGGTGAAGCGTAT PAL X58180 Reverse: ACCGTAACTGTCCGTGCC Forward: TGTTTGTGAATACATGGCACCTT CHS AW776018 Reverse: TGACTTTGGTTGACCCCATTCT Forward: TACTTGAGACCCTTGACTT CHI KF765782 Reverse: GGTGATTGCCTGTAGAAA Forward: CTTGATGAGGTGAAGCGTAT FLS XM_003601032 Reverse: ACCGTAACTGTCCGTGCC Forward: AATGGAGAAATCATAGAGGGCGAGCAG IFS AY167424 Reverse: GTTGATGAGCTCTGCCAAAGTCCATTC Forward: ACATGGAAAGCCTATGACTGTTC 6IOMT DQ419913 Reverse: ACACAACTCCAGTCCCACCTG Forward: TAATTGCTGATGCCAACG Cu/Zn-SOD AF056621 Reverse: ACCACAGGCTAATC TTCCAC Forward: TGTCATCAGCG GCGTA ATCAT Mn-SOD AY145894 Reverse: GGGCTTCCTTTGGTGGTTCA Forward: TCAATCGTACGTGGTGTGCT POD 1A X90692 Reverse: TGCACTTTGCTCGCTCACTA Forward: AGCTGCATTTGCTGCTCAAG POD 1B X90693
    [Show full text]
  • Human Skin Gene Expression, Attributes of Botanicals: Angelica Sinensis, a Soy Extract, Equol and Its Isomers and Resveratrol Edwin D
    Techno ne lo e g Lephart, Gene Technology 2014, 4:2 y G Gene Technology DOI; 10.4172/2329-6682.1000119 ISSN: 2329-6682 Review article Open Access Human Skin Gene Expression, Attributes of Botanicals: Angelica sinensis, a Soy Extract, Equol and its Isomers and Resveratrol Edwin D. Lephart* Department of Physiology and Developmental Biology and The Neuroscience Center, Brigham Young University, Provo, Utah, USA Abstract Because of its accessibility, skin was one of the first organs to be examined by gene technologies. Mircoarray/mRNA techniques have demonstrated the valuable aspects of this methodology for the elucidation of and the quantification for changes in human skin related-genes. It is important to review/understand how botanicals influence human skin gene expression (by stimulation or inhibition of certain genes) and to compare these biomarkers to the known mechanisms of skin aging. This review covers how human skin genes are modulated by 1) enhanced wound healing with an extract of a well-known medicinal plant in Asia, Angelica sinensis, 2) UV sunlight exposure that represents the main cause of photoaging or extrinsic skin aging and subsequent protection by a soy extract, 3) equol and their isomers that stimulate collagen and elastin while at the same time inhibit aging and inflammatory biomarkers and 4) resveratrol, the most high profile phytochemical known by the general public that displays some properties similar to equol with the additional benefit of stimulating the anti-aging surtuin or SIRT1 biomarker. Thus, the protective influences of botanicals/ phytochemicals elucidated herein provide potential applications to improve human skin health. Keywords: Botanicals; Phytochemicals; Polyphenols; Human skin; medicinal plant usage dating back to 1500 B.C.
    [Show full text]
  • A Comprehensive HPLC-DAD-ESI-MS Validated Method for the Quantification of 16 Phytoestrogens in Food, Serum and Urine
    applied sciences Article A Comprehensive HPLC-DAD-ESI-MS Validated Method for the Quantification of 16 Phytoestrogens in Food, Serum and Urine Susana Alejandra Palma-Duran 1,2, Graciela Caire-Juvera 3, Melissa María Campa-Siqueiros 3, Karina María Chávez-Suárez 3, María del Refugio Robles-Burgueño 2, María Lourdes Gutiérrez-Coronado 2, María del Carmen Bermúdez-Almada 2, María del Socorro Saucedo-Tamayo 3, Patricia Grajeda-Cota 1 and Ana Isabel Valenzuela-Quintanar 2,* 1 Biomolecular Medicine, Department of Metabolism, Division of Systems Medicine, Digestion, and Reproduction, Imperial College London, London SW7 2AZ, UK; [email protected] (S.A.P.-D.); [email protected] (P.G.-C.) 2 Department of Food Science, Centro de Investigación en Alimentación y Desarrollo, A.C. Hermosillo 83004, Mexico; [email protected] (M.d.R.R.-B.); [email protected] (M.L.G.-C.); [email protected] (M.d.C.B.-A.) 3 Department of Nutrition, Centro de Investigación en Alimentación y Desarrollo, A.C. Hermosillo 83004, Mexico; [email protected] (G.C.-J.); [email protected] (M.M.C.-S.); [email protected] (K.M.C.-S.); [email protected] (M.d.S.S.-T.) * Correspondence: [email protected]; Tel.: +52-(662)-2892400 Received: 8 October 2020; Accepted: 12 November 2020; Published: 17 November 2020 Abstract: There has been increased interest in phytoestrogens due to their potential effect in reducing the risk of developing cancer and cardiovascular disease. To evaluate phytoestrogens’ exposure, sensitive and accurate methods should be developed for their quantification in food and human matrices. The present study aimed to validate a comprehensive liquid chromatography-mass spectrometry (LC-MS) method for the quantification of 16 phytoestrogens: Biochanin A, secoisolariciresinol, matairesinol, enterodiol, enterolactone, equol, quercetin, genistein, glycitein, luteolin, naringenin, kaempferol, formononetin, daidzein, resveratrol and coumestrol, in food, serum and urine.
    [Show full text]