This Article Was Originally Published in Hormones, Brain and Behavior 2Nd
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Glossary of Terms
Glossary of Terms Acceptable Daily Intake or Allowed Daily Intake (ADI) → Dose- Response Relationship/Curve Allergen The allergen is a material which triggers an allergic reaction. Allopathy The term allopathy was created by Christian Friedrich Samuel Hahnemann (1755– 1843) (from the Greek prefix άλλος, állos, “other”, “different” and the suffix πάϑος, páthos, “suffering”) in order to distinguish his technique (homeopathy) from the traditional medicine of his age. Today, allopathy means a medicine based on the principles of modern pharmacology. Anaphylactic shock Anaphylaxis (or an anaphylactic shock) is a whole-body, rapidly developing aller- gic reaction, which may lead to lethal respiratory and circulatory failure. Antibody Antibodies are proteins produced by the immune system to neutralize exogenous (external) substances. Chromatography, chromatogram Chromatography is the common name of different techniques used to separate mix- tures of compounds. HPLC stands for high-performance liquid chromatography. A chromatogram is the pattern of separated substances obtained by chromatography. Colloidal sol A colloidal sol is a suspension of very small solid particles in a continuous liquid medium. Colloidal sols are quite stable and show the Tyndall effect (light scatter- ing by particles in a colloid). They can be quite stable. Examples include blood, pigmented ink, and paint. Colloidal sols can change their viscosity quickly if they © Springer International Publishing Switzerland 2014 311 L. Kovács et al., 100 Chemical Myths, DOI 10.1007/978-3-319-08419-0 312 Glossary of Terms are thixotropic. Examples include quicksand and paint, both of which become more fluid under pressure. Concentrations: parts per notations In British/American practice, the parts-per notation is a set of pseudo-units to de- scribe concentrations smaller than thousandths: 1 ppm (parts per million, 10−6 parts) One out of 1 million, e.g. -
Table 1); Two in for Several Hours (Boccia Et Al., 2007)
Hormones and Behavior 57 (2010) 255–262 Contents lists available at ScienceDirect Hormones and Behavior journal homepage: www.elsevier.com/locate/yhbeh Manipulation of the oxytocin system alters social behavior and attraction in pair-bonding primates, Callithrix penicillata Adam S. Smith a,⁎, Anders Ågmo b, Andrew K. Birnie a, Jeffrey A. French a,c a Department of Psychology and Callitrichid Research Facility, University of Nebraska at Omaha, Omaha, Nebraska, USA b Department of Psychology, University of Tromsø, Norway c Department of Biology, University of Nebraska at Omaha, Omaha, Nebraska, USA article info abstract Article history: The establishment and maintenance of stable, long-term male-female relationships, or pair-bonds, are Received 12 August 2009 marked by high levels of mutual attraction, selective preference for the partner, and high rates of sociosexual Revised 3 December 2009 behavior. Central oxytocin (OT) affects social preference and partner-directed social behavior in rodents, but Accepted 8 December 2009 the role of this neuropeptide has yet to be studied in heterosexual primate relationships. The present study Available online 16 December 2009 evaluated whether the OT system plays a role in the dynamics of social behavior and partner preference during the first 3 weeks of cohabitation in male and female marmosets, Callithrix penicillata. OT activity was Keywords: Central oxytocin activity stimulated by intranasal administration of OT, and inhibited by oral administration of a non-peptide OT- Pair-bonding behavior receptor antagonist (L-368,899; Merck). Social behavior throughout the pairing varied as a function of OT Sexual behavior treatment. Compared to controls, marmosets initiated huddling with their social partner more often after OT Partner preference treatments but reduced proximity and huddling after OT antagonist treatments. -
A New Coumestan Glucoside from Eclipta Prostrata
Natural Product Sciences 26(4) : 289-294 (2020) https://doi.org/10.20307/nps.2020.26.4.289 A New Coumestan Glucoside from Eclipta prostrata Young Ju Seo†, Hyun Woo Kil†, Taewoong Rho, and Kee Dong Yoon* College of Pharmacy and Integrated Research Institute of Pharmaceutical Sciences, The Catholic University of Korea, Bucheon-si, Gyeonggi-do 14662, Korea Abstract Eclipta prostrata is an annual herb, belonging to Asteraceae family, and has been traditionally used to improve immunity and treat hepatitis and bacterial disease in Korea. In this study, a new coumestan glucoside (1) along with ten known compounds (2 – 11) was isolated from E. prostrata. The chemical structures of isolates were elucidated to be wedelolactone-9-O--D-glucopyranoside (1), wedelolactone (2), demethylwedelolactone (3), apigenin (4), apigenin-7-sulfate (5), luteolin (6), luteolin-7-sulfate (7), luteolin-7-O--D-glucopyranoside (8), pratensein-7-O--D-glucopyranoside (9), 3,4-di-O-caffeoylquinic acid (10) and 3,5-di-O-caffeoylquinic acid (11) based on the spectroscopic evidence. Keywords Eclipta prostrata, Asteraceae, Phenolic compounds, Wedelolactone-9-O--D-glucopyranoside Introduction infrared spectroscopy (FT-IR). Eclipta prostrata is an annual herb, belonging to Experimental Asteracea family, and distributed in the tropical and subtropical areas, especially Asia and Africa.1 Eclipta General experimental procedures – The preparative prostrata has been traditionally used to improve immunity HPLC was performed using a Gilson HPLC system and treat hepatitis and bacterial diseases in Korea.2 In (Middleton, WI, USA) composed of a binary pump, a India, E. prostrata has been used to treat body pain, fever, liquid handler, and a UV/Vis detector with a Luna C18(2) hair loss, jaundice, liver enlargement and skin diseases.3 (21.2 × 250 mm I.D., 5 μm, Phenomenex, Torrance, CA, Recent biological evidence revealed that the E. -
Supplementary Material Hydrogen-Rich Water-Alleviated
10.1071/FP15204_AC © CSIRO 2015 Supplementary Material: Functional Plant Biology, 42(12), 1141–1157. Supplementary Material Hydrogen-rich water-alleviated ultraviolet-B-triggered oxidative damage is partially associated with the manipulation of the metabolism of (iso)flavonoids and antioxidant defence in Medicago sativa Yanjie XieA, Wei ZhangA, Xingliang DuanA, Chen DaiA, Yihua ZhangA, Weiti CuiA, Ren WangB and Wenbiao ShenA,C ACollege of Life Sciences, Laboratory Center of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. BInstitute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Nanjing 210014, China. CCorresponding author. Email: [email protected] 1 Table S1. The sequences of primers for real-time RT-PCR M. truncatula tentative consensus Primer name or accession number Sequences Forward: CTTGATGAGGTGAAGCGTAT PAL X58180 Reverse: ACCGTAACTGTCCGTGCC Forward: TGTTTGTGAATACATGGCACCTT CHS AW776018 Reverse: TGACTTTGGTTGACCCCATTCT Forward: TACTTGAGACCCTTGACTT CHI KF765782 Reverse: GGTGATTGCCTGTAGAAA Forward: CTTGATGAGGTGAAGCGTAT FLS XM_003601032 Reverse: ACCGTAACTGTCCGTGCC Forward: AATGGAGAAATCATAGAGGGCGAGCAG IFS AY167424 Reverse: GTTGATGAGCTCTGCCAAAGTCCATTC Forward: ACATGGAAAGCCTATGACTGTTC 6IOMT DQ419913 Reverse: ACACAACTCCAGTCCCACCTG Forward: TAATTGCTGATGCCAACG Cu/Zn-SOD AF056621 Reverse: ACCACAGGCTAATC TTCCAC Forward: TGTCATCAGCG GCGTA ATCAT Mn-SOD AY145894 Reverse: GGGCTTCCTTTGGTGGTTCA Forward: TCAATCGTACGTGGTGTGCT POD 1A X90692 Reverse: TGCACTTTGCTCGCTCACTA Forward: AGCTGCATTTGCTGCTCAAG POD 1B X90693 -
Steinach and Young, Discoverers of the Effects of Estrogen on Male Sexual Behavior and the “Male Brain”1,2
History of Neuroscience History, Teaching, and Public Awareness Steinach and Young, Discoverers of the Effects of Estrogen on Male Sexual Behavior and the “Male Brain”1,2 Per Södersten DOI:http://dx.doi.org/10.1523/ENEURO.0058-15.2015 Section of Applied Neuroendocrinology, Karolinska Institutet, S-141 04 Huddinge, Sweden Abstract In the 1930s, Eugen Steinach’s group found that estradiol induces lordosis in castrated rats and reduces the threshold dose of testosterone that is necessary for the induction of ejaculation, and that estradiol-treated intact rats display lordosis as well as mounting and ejaculation. The bisexual, estrogen-sensitive male had been demonstrated. Another major, albeit contrasting, discovery was made in the 1950s, when William Young’s group reported that male guinea pigs and prenatally testosterone-treated female guinea pigs are relatively insensitive to estrogen when tested for lordosis as adults. Reduced estrogen sensitivity was part of the new concept of organization of the neural tissues mediating the sexual behavior of females into tissues similar to those of males. The importance of neural organization by early androgen stimulation was realized immediately and led to the discovery of a variety of sex differences in the brains of adult animals. By contrast, the importance of the metabolism of testosterone into estrogen in the male was recognized only after a delay. While the finding that males are sensitive to estrogen was based on Bernhard Zondek’s discovery in 1934 that testosterone is metabolized into estrogen in males, the finding that males are insensitive to estrogen was based on the hypothesis that testosterone–male sexual behavior is the typical relationship in the male. -
Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species
Molecules 2014, 19, 3883-3897; doi:10.3390/molecules19043883 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Structures of Two New Flavonoids and Effects of Licorice Phenolics on Vancomycin-Resistant Enterococcus Species Eerdunbayaer 1, Mohamed A. A. Orabi 1,2, Hiroe Aoyama 1, Teruo Kuroda 3 and Tsutomu Hatano 1,* 1 Department of Natural Product Chemistry, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mails: [email protected] (E.); [email protected] (M.A.A.O.); [email protected] (H.A.) 2 Faculty of Pharmacy, Al-Azhar University, Assiut 71524, Egypt 3 Drug Discovery Technology Center, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Tsushima-naka, Kita-ku, Okayama 700-8530, Japan; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-86-251-7936; Fax: +81-86-251-7926. Received: 28 February 2014; in revised form: 17 March 2014 / Accepted: 21 March 2014 / Published: 28 March 2014 Abstract: Since our previous study revealed that several licorice phenolics have antibacterial effects on methicillin-resistant Staphylococcus aureus (MRSA), and suppressive effects on the oxacillin resistance of MRSA, we further investigated effectiveness of licorice constituents on vancomycin-resistant Enterococcus (VRE) bacteria, and purified 32 phenolic compounds. Two flavonoids among them were characterized structurally, and identified their structures as demethylglycyrol (31) and 5,7-di-O-methylluteone (32), respectively. Examination of antibacterial effects of licorice phenolics showed that 3-arylcoumarins such as licoarylcoumarin (9) and glycycoumarin (26), and 2-arylcoumarones such as gancaonin I (17), have moderate to potent antibacterial effects on the VRE strains used in this study. -
Spring 2017 – Epigenetics and Systems Biology Discussion Session (Epigenetics and Evolutionary Biology) Michael K
Spring 2017 – Epigenetics and Systems Biology Discussion Session (Epigenetics and Evolutionary Biology) Michael K. Skinner – Biol 476/576 Week 16 (April 27) Epigenetics and Evolutionary Biology Primary Papers 1. Soyer and O’Malley (2013) Bioessays 35:696-705 2. Skinner, et al. (2014) BMC Genomics 15:377 3. Skinner (2015) GBE 7:1296-1302 Discussion Student 32 – Ref #1 above • What is the evolutionary systems biology referred to? • How can systems biology help understand evolution? Student 36 – Ref #2 above • What is sexual selection? • How did epigenetic transgenerational inheritance change mate preference? • Does this provide evidence for environmental induction of epigenetic transgenerational inheritance and a role in evolutionary biology? Student __ – Ref #3 above • What are the neo-Lamarckian concepts and role of environmental epigenetics? • What are the neo-Darwinian concepts and role phenotypic variation? • What is the integration involved in the unified theory of evolution and role of epigenetics? Prospects & Overviews Evolutionary systems biology: What it is and why it matters Review essays Orkun S. Soyer1) and Maureen A. O’Malley2) Evolutionary systems biology (ESB) is a rapidly growing The emergence of ESB integrative approach that has the core aim of generating mechanistic and evolutionary understanding of geno- At its most basic, evolutionary systems biology (ESB) is the type-phenotype relationships at multiple levels. ESB’s synthesis of system-level approaches to biological function more specific objectives include extending knowledge with evolutionary explanations of multilevel properties. “System” in this context refers to dynamically interacting gained from model organisms to non-model organisms, components that produce behavior not revealed by analyses predicting the effects of mutations, and defining the core of isolated components. -
The Neuroendocrinology of Reproduction: an Overview1
BIOLOGY OF REPRODUCTION 20, 111-127 (1979) The Neuroendocrinology of Reproduction: An Overview1 ROGER A. GORSKI Department of Anatomy and Brain Research Institute, UCLA School of Medicine, Los Angeles, California 90024 Downloaded from https://academic.oup.com/biolreprod/article/20/1/111/4559056 by guest on 27 September 2021 INTRODUCTION isms, it may be useful to divide the reproductive Each of the preceding speakers in this process into several distinct phases (Table symposium has already reviewed one important 1). A very early step in the reproductive process facet of the neuroendocrinology of reproduc is the differentiation of the two individuals tion. Therefore, it is clearly unnecessary to which will eventually be capable of reproducing present a thorough review of this entire field when mature. Although the concept of the and my approach will be to attempt to present sexual differentiation of the reproductive one overall perspective of the role of the brain system is well-known for the internal reproduc in the reproductive process while attempting to tive organs and the external genitalia (Wilson, emphasize that which has not already been dis 1978), this same concept applies to brain cussed. At best, this discussion will complement function as well. With respect to the peripheral the other presentations, which together do reproductive system, remember that for a form a rather complete overview of the neuro period during development, the male and endocrinology of reproduction. To begin with, female are morphologically indistinguishable. it will be helpful to consider the role of the After subsequent differntiation of the gonadal brain in the reproductive process in very anlage into testis or ovary, the secretory activity general terms. -
Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza Glabra L., Paeonia Lactiflora Pall., and Eriobotrya Japonica (Thunb.) Lindl
Medicines 2019, 6, 43; doi:10.3390/medicines6020043 S1 of S35 Supplementary Materials: Antioxidant, Cytotoxic, and Antimicrobial Activities of Glycyrrhiza glabra L., Paeonia lactiflora Pall., and Eriobotrya japonica (Thunb.) Lindl. Extracts Jun-Xian Zhou, Markus Santhosh Braun, Pille Wetterauer, Bernhard Wetterauer and Michael Wink T r o lo x G a llic a c id F e S O 0 .6 4 1 .5 2 .0 e e c c 0 .4 1 .5 1 .0 e n n c a a n b b a r r b o o r 1 .0 s s o b b 0 .2 s 0 .5 b A A A 0 .5 0 .0 0 .0 0 .0 0 5 1 0 1 5 2 0 2 5 0 5 0 1 0 0 1 5 0 2 0 0 0 1 0 2 0 3 0 4 0 5 0 C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( M ) C o n c e n tr a tio n ( g /m l) Figure S1. The standard curves in the TEAC, FRAP and Folin-Ciocateu assays shown as absorption vs. concentration. Results are expressed as the mean ± SD from at least three independent experiments. Table S1. Secondary metabolites in Glycyrrhiza glabra. Part Class Plant Secondary Metabolites References Root Glycyrrhizic acid 1-6 Glabric acid 7 Liquoric acid 8 Betulinic acid 9 18α-Glycyrrhetinic acid 2,3,5,10-12 Triterpenes 18β-Glycyrrhetinic acid Ammonium glycyrrhinate 10 Isoglabrolide 13 21α-Hydroxyisoglabrolide 13 Glabrolide 13 11-Deoxyglabrolide 13 Deoxyglabrolide 13 Glycyrrhetol 13 24-Hydroxyliquiritic acid 13 Liquiridiolic acid 13 28-Hydroxygiycyrrhetinic acid 13 18α-Hydroxyglycyrrhetinic acid 13 Olean-11,13(18)-dien-3β-ol-30-oic acid and 3β-acetoxy-30-methyl ester 13 Liquiritic acid 13 Olean-12-en-3β-ol-30-oic acid 13 24-Hydroxyglycyrrhetinic acid 13 11-Deoxyglycyrrhetinic acid 5,13 24-Hydroxy-11-deoxyglycyirhetinic -
Phytoestrogens in Foods in the Nordic Market
TemaNord 2017:541 Phytoestrogens in foods on the Nordic market the Nordic on foods in 2017:541 Phytoestrogens TemaNord Nordic Council of Ministers Nordens Hus Ved Stranden 18 DK-1061 Copenhagen K www.norden.org Phytoestrogens in foods on the Nordic market Phytoestrogens are plant-derived compounds that may bind to estrogen receptors, but with less affinity than the natural ligand estradiol. They may be biologically active as such or after metabolization in our body. To investigate the occurrence and level of phytoestrogens, scientific literature was screened for data on isoflavones, lignans, stilbenes and coumestans in raw and processed foods of plant origin. The review presents data based both on analytical methods hydrolysing glucosides and non-destructive methods. Many phytoestrogens are phytoalexins. Their production is induced when plants are exposed to abiotic and/or biotic stress. This could explain the rather different levels reported in plants by various investigators, and indicates that many samples are required to describe the levels generally occurring in foodstuffs. The influence of food processing was also considered. Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson TemaNord 2017:541 Phytoestrogens in foods on the Nordic market A literature review on occurrence and levels Linus Carlsson Forslund and Hans Christer Andersson ISBN 978-92-893-5046-4 (PRINT) ISBN 978-92-893-5047-1 (PDF) ISBN 978-92-893-5048-8 (EPUB) http://dx.doi.org/10.6027/TN2017-541 TemaNord 2017:541 ISSN 0908-6692 Standard: PDF/UA-1 ISO 14289-1 © Nordic Council of Ministers 2017 Cover photo: Unsplash.com Print: Rosendahls Printed in Denmark Although the Nordic Council of Ministers funded this publication, the contents do not necessarily reflect its views, policies or recommendations. -
Supporting Document 1
Supporting document 1 Safety assessment – Application A1085 Food derived from Reduced Lignin Lucerne Line KK179 Summary and conclusions Background A genetically modified (GM) lucerne line, KK179, has been developed that has reduced biosynthesis of guaiacyl lignin (G lignin), a major subunit of lignin. Lignin is a non- carbohydrate phenolic polymer deposited in plant cell walls, particularly in the vascular tissue, and is a contributor to the quality of forage eaten by grazing animals. The Applicants claim that growers will have the option of being able to harvest KK179 several days later than conventional lucerne without appreciable loss of forage quality typical in conventional lucerne at the same growth stage. The reduced level of lignin in lucerne KK179 has been achieved through the introduction of a partial caffeoyl CoA 3-O-methyltransferase (CCOMT) gene sequence derived from lucerne (Medicago sativa). The gene transcript acts, via suppression of the endogenous CCOMT gene, to reduce the lignin level. It is not intended that KK179 enter the food supply. However, a food approval is sought in case this inadvertently occurs. In conducting a safety assessment of food derived from lucerne line KK179, a number of criteria have been addressed including: a characterisation of the transferred genetic material and its origin, function and stability in the lucerne genome; compositional analyses; and evaluation of intended and unintended changes. This safety assessment report addresses only food safety and nutritional issues associated with the GM line. It therefore does not address: environmental risks related to the environmental release of GM plants used in food production the safety of animal feed or animals fed with feed derived from GM plants the safety per se of food derived from the non-GM (conventional) plant. -
Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy
Send Orders for Reprints to [email protected] Anti-Cancer Agents in Medicinal Chemistry, 2014, 14, 000-000 1 Plant Coumestans: Recent Advances and Future Perspectives in Cancer Therapy Tereza Nehybová1, Jan Šmarda1 and Petr Beneš1,2,* 1Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic and Masaryk Memorial Cancer Institute, RECAMO, Žlutý kopec 7, 656 53 Brno, Czech Republic; 2International Clinical Research Center, Center for Biological and Cellular Engineering, St. Anne's University Hospital, Brno, Czech Republic Abstract: Natural products are often used in drug development due to their ability to form unique and diverse chemical structures. Coumestans are polycyclic aromatic plant secondary metabolites containing a coumestan moiety, which consists of a benzoxole fused to a chromen-2-one to form 1-Benzoxolo[3,2-c]chromen-6-one. These natural compounds are known for large number of biological activities. Many of their biological effects can be attributed to their action as phytoestrogens and polyphenols. In the last decade, anticancer effects of these compounds have been described in vitro but there is only limited number of studies based on models in vivo. More information concerning their in vivo bioavailability, stability, metabolism, toxicity, estrogenicity, cellular targets and drug interactions is therefore needed to proceed further to clinical studies. This review focuses on coumestans exhibiting anticancer properties and summarizes mechanisms of their toxicity to cancer cells. Moreover, the possible role of coumestans in cancer prevention is discussed. Keywords: Cancer, cellular target, coumestrol, coumestan, glycyrol, psoralidin, therapy, wedelolactone. INTRODUCTION also acts as antioxidant [18, 36] and prevents bone resorption by Natural products are often used in drug development due to inhibiting differentiation and function of osteoclasts and by their ability to form unique and diverse chemical structures.