DOCSLIB.ORG

Identification of the Porcine Cytomegalovirus Major Capsid Protein Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of the Porcine Cytomegalovirus Major Capsid Protein Gene FULL PAPER Virology Identification of the Porcine Cytomegalovirus Major Capsid Protein Gene Vasantha RUPASINGHE1), Kiyoko IWATSUKI-HORIMOTO2), Shunji SUGII1) and Taisuke HORIMOTO2)* 1)Department of Veterinary Microbiology, Graduate School of Osaka Prefecture University, 1–1 Gakuen, Sakai, Osaka 599–8531 and 2)Division of Virology, Institute of Medical Science, University of Tokyo, 4–6–1 Shirokanedai, Minato-ku, Tokyo 108–8639, Japan (Received 13 November 2000/Accepted 14 February 2001) ABSTRACT. A major capsid protein (MCP) gene homologue of porcine cytomegalovirus (PCMV) was identified. Sequence analysis indi- cated that the PCMV MCP gene is 4,026 nucleotides in length encoding a protein of 1,341 amino acid residues. The predicted molecular weight of the PCMV MCP is 151,456 Da, equivalent to those of other herpesvirus MCP counterparts. Phylogenetic analysis using her- pesviral MCP gene sequences confirmed that PCMV is a betaherpesvirus with higher homology with human herpesvirus-6 and -7 than human and mouse cytomegaloviruses. The serum of pig experimentally infected with PCMV did not react with bacterially expressed MCP, suggesting that the PCMV MCP may not be related to the humoral immune response in the course of PCMV infection. Also, we established polymerase chain reaction (PCR) protocols using primers corresponding to MCP gene sequences for detection of PCMV infection. The PCR protocol would be effective for the diagnosis of slow-growing PCMV infection, for which traditional methods involving virus-isolation are not useful. KEY WORDS: betaherpesvirus, major capsid protein, polymerase chain reaction, porcine cytomegalovirus. J. Vet. Med. Sci. 63(6): 609–618, 2001 Porcine cyomegalovirus (PCMV), first described in 1955 established a polymerase chain reaction (PCR) protocol for [6], usually induces a silent infection in adult pigs but often specific detection of PCMV infection. a fatal, generalized infection in piglets. In utero infection in sows can cross the placenta and infect the fetuses leading to MATERIALS AND METHODS fetal death or birth of weak piglets [3, 17]. As PCMV exhib- its a relatively protracted replication cycle, a slowly devel- Cells and virus: Pig fallopian tube fibroblast cells (PFT- oping cytopathology characterized by cytomegaly, and a F) [11] were grown in Dulbecco’s modified Eagle’s medium restricted host range, it is grouped into the subfamily Beta- (DMEM) supplimented with 5% fetal calf serum at 37°C. herpesvirinae [18]. Recently, we and other research groups The OF-1 strain of PCMV [11] was propagated in the PFT- confirmed that PCMV is a betaherpesvirus based on F cell line and used in this study. The virus was harvested sequence analyses of DNA polymerase gene fragments [19, exclusively from the culture supernatant at 7–10 days after 29]. infection as guided by the appearance of cytopathic effects The major capsid protein (MCP) gene appears to be con- (CPE). Other Japanese PCMV strains, J1, Chiba-2, Chiba- served among the herpesviruses [5, 15], suggesting that 3, Chiba-C, Hiroshima and Kagawa, and a British isolate, MCP should play essential roles in vital processes in the B6, were also used. All Japanese strains except J1 [21] were viral replication cycle such as assembly and maturation. isolated in our laboratory [24]. In addition, pseudorabies Herpes simplex virus-1 (HSV-1) has been shown to encode virus (strain Indiana) was propagated in the RK-13 cell line seven capsid proteins. Of these, MCP is the structural sub- and used. RK-13 cells were grown in DMEM with 10% unit of the hexons and pentons, and is the principal struc- fetal calf serum. tural element making up the matrix of the icosahedral capsid Preparation of PCMV DNA: Extrachromosomal DNA [16]. In addition, in some herpesviruses such as HSV-1 and containing viral DNA was extracted from virus-infected varicella-zoster virus (VZV), MCPs serve as an antigen for cells by a modification of Hirt’s method [9]. Briefly, cell the humoral immune response during the course of infec- pellets were suspended gently in 20 mM Tris-HCl buffer, tion, being highly reactive with human antisera as well as pH 7.5, containing 0.6% SDS and 0.01 M EDTA, and incu- being responsible for cell-mediated immunity [7, 20, 27]. bated at room temperature for 20 min. Then, 1/3 volume of The MCPs of many herpesviruses have been shown to 5N NaCl was added and mixed by inverting the tube. The have similar molecular masses, e.g., between 135 kDa and sample was incubated at 4°C for at least 8 hr, and the lysate 160 kDa for human herpesviruses [2, 4, 10, 14, 15]. In this recovered after centrifugation (15,000 rpm, 30 min) was fur- study, we identified the MCP gene of PCMV and expressed ther mixed with the same volume of 2 × lysis buffer (20 mM the protein in a bacterial expression system. In addition, we Tris-HCl, pH 7.5, 2 mM EDTA, 0.1% SDS, and 40 µg/ml also analyzed the evolutionary position of PCMV in the her- proteinase K) and incubated at 37°C for 1 hr. Following pesvirus group using MCP sequence information. We also phenol-chloroform extraction, DNA was ethanol-precipi- tated and suspended in deionized water. *CORRESPONDENCE TO: HORIMOTO, T., Division of Virology, Insti- Cloning of PCMV DNA fragments: The Hirt’s DNA from tute of Medical Science, University of Tokyo, 4–6–1 Shirokane- dai, Minato-ku, Tokyo 108–8639, Japan. virus-infected cells was digested with BamHI endonuclease 610 V. RUPASINGHE ET AL. and the digested fragments were directly ligated with reading frame (ORF) by PCR using a pair of primers, MCP/ BamHI-digested vector (pBluescript SK-; Stratagene, La I/E and MCP/T/X (Table 1). These primers included a Jolla, USA). These constructs were then used for transfor- unique restriction site for EcoRI and XhoI, respectively, to mation of Escherichia coli strain (DH5α). The transfor- facilitate cloning. PCR was performed using the B18 tem- mants were selected on 2YT agar plates with ampicillin. plate DNA with LA Taq DNA polymerase (Takara, Tokyo, DNA sequencing and genetic analyses: Plasmids were Japan); for 35 cycles of denaturation at 94°C for 1 min, isolated from each transformant by mini-preparation and annealing at 50°C for 1 min, and strand-extension at 72°C partially sequenced by the dye-terminator protocol using for 5 min. The amplified product was ligated into the M13 primers. Briefly, the plasmid DNA (0.5 µg) was mixed pCR2.1 vector (Invitrogen, Carlsbad, U.S.A.) and then the with 3.2 nmol of primer, -21M13 or M13 Rev, in a sequenc- construct was used for transformation of E. coli. The plas- ing mixture (BigDye-terminator reagent; Applied Biosys- mid extracted from the transformant was digested with tems Japan, Tokyo, Japan) and reacted in a thermal cycler EcoRI and XhoI, and the fragment containing MCP-ORF (MJ Research Inc., Waltham, U.S.A.) according to the man- was subcloned into EcoRI and XhoI sites of the expression ufacturer’s instructions. The reaction products were etha- vector pGEX 6P-3 (Amersham Pharmacia Biotech, Little nol-precipitated and suspended in template suppression Chalfont, England) in-frame with the glutathione s-trans- reagent (Applied Biosystems) for sequencing in an autose- ferase (GST) gene, generating pGEX/MCP. A series of quencer (ABI PRISM 310). deletion mutants of the carboxyl (C)-terminal portion of the Sequencing of the MCP gene, which was included in MCP-ORF were prepared by endonuclease digestion using clone B18 (with an insert consisting of a 9 kbp BamHI frag- combinations of XhoI with XbaI, BglII, NdeI or HindIII, ment), was performed by the “primer walking” method with unique recognition sites for which are present in the ORF. primers designed from the known sequence towards the The portion between two enzyme recognition sites was unknown region. The primers are listed in Table 1. The deleted and the resulting plasmid was self-ligated in a blunt- homology search was carried out using the BLAST program ended manner and used for transformation. These plasmids (DNA Data Bank of Japan [DDBJ]). Multiple alignment were used for expression of deletion forms of the fusion pro- with other herpesviral MCPs was performed using the tein, generating GST/MCP∆Xb/Xh, -∆Bg/Xh, -∆Nd/Xh and CLUSTAL W program [25] with bootstrap analysis -∆Hd/Xh. (DDBJ). A phylogenic tree was generated using Tree View Expression of GST/MCP fusion protein or GST/MCP software (ver. 1.5). deletion proteins was examined using anti-GST antibody by Expression of MCP in E. coli.: To generate a vector plas- immunoblotting assay. Briefly, the lysate of the isopropyl- mid for MCP expression, we amplified the MCP gene open β-D-thiogalactosidase (IPTG)-induced cells transformed Table 1. Oligonucleotide primers used in this study Primer Sequence (5’ → 3’)a) Positionb) (Polarity) Purpose B18F(10) TCCAATGCAGTCCGTAGACG PCP:downstream (-) Seq.c) B18F(11) AACTCGCCTTCTCTTCTATG PCP:829–810 (-) Seq. B18F(12) GAGGCAGTACCAGCTCCCAG PCP:388–369 (-) Seq. MCP/T/X AACTCGAGTTAGGCGCTCAGTATGCTGG MCP:4026–4007 (-) PCR cloning B18F(13) AACCTGGTCTCTAATAGAGC MCP:3935–3916 (-) Seq. B18F(14) TCACCGGGGTTATGATCGCC MCP:3463–3444 (-) Seq., PCR B18F(15) AGTGCATGGCCGACAGAGTG MCP:2962–2943 (-) Seq., PCR B18F(16) GTTCTCCGTCATGAAACAG MCP:2588–2569 (-) Seq., Probe B18F(17) GGCATCGTGTGCATGAACGG MCP:2175–2146 (-) Seq. B18R(5) TCGCAGTAGCAAGGCACCG MCP:upstream (+) Seq. MCP/I/E ATGAATTCATGGAAGACTGGAGGGCCACMCP:1–20 (+) PCR cloning B18R(6) AATGACACTCGGGAAAATGC MCP:255–274 (+) Seq. B18R(7) ACCTATAAATCTAGCGATGAG MCP:778–798 (+) Seq. B18R(8) CTTTGCCACCCGGCGGTCAAC MCP:1345–1365 (+) Seq. B18R(9) ATCCTGCTGTTCTGCAATAG MCP:1927–1946 (+) Seq. B18R(C1) GCGTCATACCCGCACTGACG MCP:2351–2370 (+) Seq., PCR B18R(10) TCTCACTCTCATACAGGATG MCP:2493–2512 (+) Seq., PCR B18R(11) ACAGACAATATCCTCTATAC MCP:3055–3074 (+) Seq., PCR MCP(P1) AGCGCGTAAAGACAGACATG MCP:3224–3243 (+) Probe B18R(C2) GATCATAACCCCGGTGACCG MCP:3447–3466 (+) Seq.
Load more

Recommended publications
  • Molecular Epidemiology of Porcine Cytomegalovirus (PCMV) in Sichuan Province, China: 2010–2012
    Molecular Epidemiology of Porcine Cytomegalovirus (PCMV) in Sichuan Province, China: 2010–2012 Xiao Liu1., Shan Liao1., Ling Zhu1., Zhiwen Xu1,2*, Yuancheng Zhou1 1 Animal Biotechnology Center, College of Veterinary Medicine, Sichuan Agricultural University, Ya’ an, China, 2 Key Laboratory of Animal Disease and Human Health, College of Veterinary Medicine, Sichuan Agricultural University, Ya’ an, China Abstract Porcine cytomegalovirus (PCMV) is an immunosuppressive virus that mainly inhibits the immune function of the macrophage and T-cell lymphatic systems, and has caused huge economic losses to the porcine breeding industry. Molecular epidemiological investigation of PCMV is important for prevention and treatment, and this study is the first such investigation in Sichuan Province, Southwest China. A PCMV positive infection rate of 84.4% (865/1025) confirmed that PCMV is widely distributed in Sichuan Province. A phylogenetic tree was constructed based on the PCMV glycoprotein B gene (gB) nucleotide and amino acid sequences from 24 novel Sichuan isolates and 18 other PCMV gB sequences from Genbank. PCMV does not appear to have evolved into different serotypes, and two distinct sequence groups were identified (A and B). However, whether PCMV from this region has evolved into different genotypes requires further research. Analysis of the amino acid sequences confirmed the conservation of gB, but amino acid substitutions in the major epitope region have caused antigenic drift, which may have altered the immunogenicity of PCMV. Citation: Liu X, Liao S, Zhu L, Xu Z, Zhou Y (2013) Molecular Epidemiology of Porcine Cytomegalovirus (PCMV) in Sichuan Province, China: 2010–2012. PLoS ONE 8(6): e64648. doi:10.1371/journal.pone.0064648 Editor: Andrew R.
    [Show full text]
  • Conference 17 11 February 2009
    The Armed Forces Institute of Pathology Department of Veterinary Pathology Conference Coordinator: Todd M. Bell, DVM WEDNESDAY SLIDE CONFERENCE 2008-2009 Conference 17 11 February 2009 Conference Moderator: Dr. Fabio Del Piero, DVM, DACVP material as well as clusters of erythrocytes (Fig. 1-1). The CASE I – S0 10582 (AFIP 3113965) neoplastic cells have indistinct cell borders, large amount of eosinophilic cytoplasm, one oval to elongated nucleus with rounded poles and finely granular heterochromatin Signalment: 20-year-old, gelding, Arabian horse and 1-2 small basophilic nucleoli. The cells have moderate (Equus caballus) anisokaryosis with rare mitotic figures per HPF (40X). There are scattered hemosiderin laden macrophages History: A cecal mass was submitted for within the mass. There are multifocal areas of chronic histopathology. hemorrhages with aggregations of siderophages present in the capsule. Gross Pathology: The submitted tissue was an approximately 4x5x4 cm round, firm, nodular, dark gray, Immunohistochemistry was performed. The submitted well encapsulated mass with intact surface mucosa. On mass was strongly positive for vimentin and c-kit and cut section the mass was distinct from the mucosa, white- slightly positive for NSE. It did not stain with desmin, tan and multilobulated. smooth muscle actin and S100. Unfortunately, no history was submitted with this mass to know the reason for Laboratory Results: None removal. Histopathologic Description: The mass is a well Contributor’s Morphologic Diagnosis: Cecum: demarcated, encapsulated, multilobulated, expansile Gastrointestinal stromal tumor with peripheral hemorrhage mass located from deep tunica muscularis to the serosa and siderophages compressing the adjacent tissues and muscle layers. The mass is composed of multiple large lobules separated Contributor’s Comment: Equine gastrointestinal by a thick dense fibrous connective tissue.
    [Show full text]
  • WSC 14-15 Conf 1 Layout
    Joint Pathology Center Veterinary Pathology Services WEDNESDAY SLIDE CONFERENCE 2015-2016 C o n f e r e n c e 2 16 September 2015 cellular mass. Neoplastic cells are closely CASE I: B15-894 (JPC 4050459). packeted into tubule-like nests and cords, within a dense fibrovascular stroma. Neoplastic cells Signalment: 12-year-old, male (intact), frequently line the fibrous stroma in palisades Labrador retriever (Canis familiaris) and occasional pile to form islands. Neoplastic cells are round, to polygonal, to elongate, with History: Little clinical history was provided with indistinct cell borders, and moderate amounts of the case. The non-retained testicle was described eosinophilic, flocculent to vacuolated cytoplasm. as “small.” Nuclei are centrally located and oval to elongate, with vesicular chromatin and 1-3 basophilic Gross Pathology: Received in two formalin nucleoli. The center of packets frequently contain filled jars, labeled prostate and retained testicle, similar cells with hypereosinophilic cytoplasm, were three pieces of firm, mottled, dark brown to grey tissue, up to 2.0 x 2.0 x 0.5 cm and a 4.0 x 3.5 x 2.0 cm testicle with epididymis, respectively. Near the tail of the epididymis, the testicle contained a well demarcated, ap-proximately 2.5 cm, oval, firm, white to tan mass that compressed the adjacent parenchyma and bulged from the cut surface. Laboratory Results: None. Histopathologic Description: Testicle: Com- pressing adjacent seminiferous tubules is a variably encapsulated, Retained test and prostate, dog: 50% of the testis (arrows) is replaced by a well-demarcated poorly demarcated, densely neoplasm composed of tubules.
    [Show full text]
  • South Dakota Animal Disease Research and Diagnostic Laboratory: Annual Report 2008 Animal Disease Research and Diagnostic Laboratory, South Dakota State University
    South Dakota State University Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange South Dakota Animal Disease Research and Veterinary and Biomedical Sciences Diagnostic Laboratory (ADRDL) 2008 South Dakota Animal Disease Research and Diagnostic Laboratory: Annual Report 2008 Animal Disease Research and Diagnostic Laboratory, South Dakota State University Follow this and additional works at: http://openprairie.sdstate.edu/vetbio_adrdl Part of the Veterinary Medicine Commons Recommended Citation Animal Disease Research and Diagnostic Laboratory, South Dakota State University, "South Dakota Animal Disease Research and Diagnostic Laboratory: Annual Report 2008" (2008). South Dakota Animal Disease Research and Diagnostic Laboratory (ADRDL). Paper 4. http://openprairie.sdstate.edu/vetbio_adrdl/4 This Report is brought to you for free and open access by the Veterinary and Biomedical Sciences at Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. It has been accepted for inclusion in South Dakota Animal Disease Research and Diagnostic Laboratory (ADRDL) by an authorized administrator of Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. For more information, please contact [email protected]. SOUTH DAKOTA ANIMAL DISEASE RESEARCH & DIAGNOSTIC LABORATORY ANNUAL REPORT 2008 Department of Veterinary Science Phone: 605-688-5171 South Dakota State University Fax: 605-688-6003 North Campus Drive, Box 2175 Web page address: Brookings, South Dakota 57007-1396 SDSU http://vetsci.sdstate.edu SOUTH DAKOTA ANIMAL DISEASE RESEARCH AND DIAGNOSTIC LABO RA TORY FY 2008 Annual Report July 1, 2007 - June 30, 2008 MISSION: VETERINARY SCIENCE DEPARTMENT To protect and improve the health of animals, the viability of the SD agricultural industry, and the welfare of society through high quality diagnostic, analytical, research, extension and teaching activities.
    [Show full text]
  • The Important Viral Infections of Pigs O.C
    REPRI NT The important viral infections of pigs O.C. Straub or a general ill thrift. Table 1 summarizes the agents respon- Introduction sible for these diseases. The importance of the many known viral diseasesof pigsvaries African swine fever from continent to continent and from country to country. Af- Casesof this important disease have been reported from Spain, rican swine fever, a most devastating disease against which Portugal, and Sardinia. Whereas its first appearance was char- no vaccine is available, fortunately plays a minor role in Italy acterized by massive hemorrhages and a 100%mortality, the because there are only a few infectious wild pigs still at large clinical picture has been changing with sometimes even a mild on the island of Sardinia. However, a few outbreaks occurred disease. Although limited to small pig breeders in Spain and on mainland Italy. Portugal and to wild pigs in Sardinia, there is a constant dan- ger that this virus may spread to other countries of the ECand The same is true for foot-and-mouth disease.Fortunately, this mainland Italy, especially since infected pigs may carry the virus has been eradicated in the European Communicyt (EC) virus for long periods without demonstrating typical clinical countries. symptoms. In this paper, these two diseases will be dealt with briefly. Foot-and-mouth disease (FMD) and swine Other viral diseases in pigs which deserve major attention will vesicular disease (SVD) be described and prophylactic measures where applicable will Clinically, it is almost impossible to differentiate these two be mentioned. Information will also be given on the collection diseases.
    [Show full text]
  • Epizootic Infection of a Minimal Disease Swine Herd with a Herpesvirus James P
    Epizootic Infection of a Minimal Disease Swine Herd with a Herpesvirus James P. Orr, Elizabeth Althouse, Gilles C. Dulac and Peter J.K. Durham Abstract A totally confined, farrow-to-finish, closed, minimal in herds previously free of infection (9). Infectious disease herd of pigs experienced high death and repro- bovine rhinotracheitis virus and PCMV have been ductive losses during a disease outbreak lasting five shown to cause generalized disease in fetal and weeks, and during the ensuing three months. The losses newborn pigs (4,5,10,11). In addition, IBR virus were caused by infection of pigs of all ages with a has caused genital infections of sows and boars in herpesvirus, with devastating effects on the lungs of Norway (11); porcine cytomegalovirus has occasionally immature pigs and on the reproductive performance been blamed for systemic disease in susceptible older of the sows. pigs (8). In this report, we describe the investigation of a disease outbreak in a minimal disease swine herd, Resume affecting a high percentage of individuals of all age Infection 6pizootique d'un troupeau de porcs groups, and caused by infection with a virus which was taux minimal de maladies, par un herpesvirus almost certainly porcine cytomegalovirus, although Cette etude portait sur un troupeau de porcs a taux attempts to isolate it were unsuccessful. minimal de maladies, completement ferme et garde en reclusion totale, qui comptait des porcelets, des porcs d'engraissement et des sujets de reproduction. Ce History and Clinical Findings troupeau connut un taux eleve de mortalite et de graves This disease outbreak affected a totally confined, problemes de reproduction, tant au cours d'une farrow-to-finish, closed herd of 250 sows.
    [Show full text]
  • Vpm 402: Veterinary Virology
    VPM 402: VETERINARY VIROLOGY LECTURE NOTES DR. M. A. OYEKUNLE (SP 1071) DR O. E. OJO DR. M. AGBAJE DEPARTMENT OF VETERINARY MICROBIOLOGY AND PARASITOLOGY COLLEGE OF VETERINARY MEDICIN UNIVERSITY OF AGRICULTURE, ABEOKUTA 1 VPM 402: VETERINARY VIROLOGY COURSE OUTLINE Topic Lecturer Herpesviridae: M. A. Oyekunle Infectious bovine rhinotracheitis Malignant catarrhal fever Equine rhinotracheitis Equine herpesvirus abortion Canine herpesvirus infection Feline viral rhinotracheitis Infectious laryngotracheitis Marek’s disease. Poxviridae: M. A. Oyekunle Orthopoxvirus Parapoxvirus Capripoxvirus Avipoxvirus Suispoxvirus Leporipoxvirus Asfarviridae: M. A. Oyekunle African swine fever Parvoviridae: M. A. Oyekunle Canine parvovirus infection Feline panleukopaenia Porcine parvovirus infection Arteriviridae: M. A. Oyekunle Equine viral arteritis Bunyaviridae: M. A. Oyekunle Rift valley fever Orthmyxoviridae: M. A. Oyekunle Avian influenza Swine influenza Equine influenza Paramyxoviridae: O. E. Ojo Rinderpest Peste des petits ruminants Canine distemper Newcastle disease Bovine respiratory syncytial virus Retroviridae: O. E. Ojo Avian leucosis Feline leukaemia Feline immunodeficiency virus infection Equine infectious anaemia Rhabdoviridae: O. E. Ojo 2 Rabies and other lyssaviruses infection Vesicular stomatitis Bovine ephemeral fever Caliciviridae: O. E. Ojo Swine vesicular exanthema Rabbit haemorrhagic disease Togaviridae: O. E. Ojo Equine encephalitides Reoviridae: O. E. Ojo Bluetongue African horse sickness Rota virus infections Birnaviridae: O. E.
    [Show full text]
  • Conference 8 19 November 2009
    The Armed Forces Institute of Pathology Department of Veterinary Pathology Conference Coordinator: Shannon Lacy, DVM, MPH WEDNESDAY SLIDE CONFERENCE 2009-2010 Conference 8 19 November 2009 Conference Moderator: Gary D. Coleman, DVM, PhD, Diplomate ACVP, Diplomate ACVPM CASE I: A08-352 (AFIP 3133678). Histopathologic Description: Labial mucosa: Multifocally submucosal nerves and hair follicles are partially to completely effaced by large aggregates of Signalment: 5-year-old, male, intact Rhesus macaque degenerate and non-degenerate neutrophils admixed with (Macaca mulatta). fewer histiocytes, lymphocytes and necrotic cellular debris (fig. 1-1). Frequently, histiocytes within the inflammatory History: This macaque presented for necropsy at the infiltrate are enlarged and contain large, eosinophilic, end of an experiment investigating vaccine candidates intranuclear, round to ovoid, 10-20 µm diameter inclusion for Simian Immunodeficiency Virus (SIV). The animal bodies and smaller eosinophilic intracytoplasmic inclusion had been losing weight for the previous four months but bodies (figs. 1-2 and 1-3). Nerve fibers are completely was clinically unremarkable. Experimental manipulation effaced by the infiltrate and there is a dual loss of the included biweekly phlebotomy. Two years prior to myelin sheath and the axon. Inflammatory cells frequently necropsy, the animal had been vaccinated with an infiltrate into the surrounding musculature. In these areas experimental vaccine and seven months prior to necropsy myofibers are variably swollen, hypereosinophilic and had been inoculated with SIVmac251. degenerate with sarcoplasmic vacuolation and loss of cross striations. Several large hair follicles are surrounded by a Gross Pathology: The animal was thin with few fat moderate amount of fibrosis and a similar neutrophilic and reserves and the right atrium was moderately dilated.
    [Show full text]
  • Porcine Cytomegalovirus
    PORCINE CYTOMEGALOVIRUS Prepared for the Swine Health Information Center By the Center for Food Security and Public Health, College of Veterinary Medicine, Iowa State University December 2015 SUMMARY Etiology • Porcine cytomegalovirus (PCMV) is an enveloped DNA virus belonging to the family Herpesviridae and the subfamily Betaherpesvirinae. • Infection with PCMV has previously been known as ‘inclusion body rhinitis’ based on the histopathological characteristics of the disease. Cleaning and Disinfection • Little is known about PCMV in the environment. The virus appears to survive in subzero temperatures. • Chloroform and ether inactivate PCMV. Povidone-iodine (7.5%) is effective against human cytomegalovirus (human herpesvirus 5). Most herpesviruses are also susceptible to 30% ethanol and isopropanol, 1% sodium hypochlorite, formaldehyde, 0.12% ortho-phenylphenol, and 0.04% glutaraldehyde. Epidemiology • Swine are the natural host for PCMV. • Infection with PCMV has not been documented in humans; however, concern about transmission through xenotransplantation exists. • PCMV is endemic in nearly all swine populations worldwide, including North America, with seroprevalence approaching 100% in many areas. • While neonates can develop fatal systemic disease, death is rare in older pigs. However, co- infections may increase morbidity and mortality when present. Transmission • PCMV is shed in nasal secretions, ocular secretions, urine, and cervical fluid. Transmission is primarily via direct contact, but congenital transmission also occurs. Infection in Swine/Pathogenesis • Clinical signs are rare except in neonates, where shivering, sneezing, respiratory distress, poor weight gain, and rhinitis have been observed, as well as conjunctival discharge and black discoloration around the eyes. Neurological signs can also occur. • In older pigs, PCMV has been associated with porcine respiratory disease complex (PRDC).
    [Show full text]
  • PCMV) in Wild Boars from Northeastern Patagonia, Argentina
    +Model RAM-436; No. of Pages 8 ARTICLE IN PRESS Revista Argentina de Microbiología xxx (xxxx) xxx---xxx R E V I S T A A R G E N T I N A D E MICROBIOLOGÍA www.elsevier.es/ram ORIGINAL ARTICLE Molecular detection of Porcine cytomegalovirus (PCMV) in wild boars from Northeastern Patagonia, Argentina a,b a,b a a Federico Andrés De Maio , Marina Winter , Sergio Abate , Diego Birochio , b,c a,b a,∗ Néstor Gabriel Iglesias , Daniel Alejandro Barrio , Carolina Paula Bellusci a Universidad Nacional de Río Negro, Sede Atlántica, Centro de Investigaciones y Transferencia Río Negro (CONICET-UNRN), Argentina b Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina c Universidad Nacional de Quilmes, Argentina Received 26 December 2019; accepted 18 December 2020 KEYWORDS Abstract Porcine cytomegalovirus (PCMV) is a recognized pathogen of domestic swine that is Infectious diseases of widely distributed around the world. PCMV is the etiological agent of inclusion body rhinitis swine; and has also been associated with other diseases that cause substantial losses in swine produc- Porcine tion. Wild boar populations can act as reservoirs of numerous infectious agents that affect pig cytomegalovirus; livestock, including PCMV. The aim of this work was to assess the circulation of this virus in free- Wild boars; living wild boars that inhabit Northeastern Patagonia (Buenos Aires and Río Negro Provinces), Northeast Patagonia Argentina. Nested-PCR assays were conducted to evaluate the presence of PCMV in samples of tonsil tissue collected from 62 wild boar individuals. It was found that the overall rate of infec- tion was about 56%, with significant higher values (almost 90%) in the age group corresponding to piglets (animals less than 6 months old).
    [Show full text]
  • Porcine Cytomegalovirus Infection Is Not Associated to the Occurrence of Post-Weaning Multisystemic Wasting Syndrome
    DOI: 10.1002/vms3.5 Original Article Porcine cytomegalovirus infection is not associated to the occurrence of post-weaning multisystemic wasting syndrome Samuel Paulo Cibulski*,†, Gabriela Pasqualim*, Thais Fumaco Teixeira*, Ana Paula Muterle Varela*, Diogenes Dezen‡, Carine Lidiane Holz§, Ana Claudia Franco† and Paulo Michel Roehe*,† *FEPAGRO – Saude Animal – Instituto de Pesquisas Veterinarias Desiderio Finamor (IPVDF), Estrada do Conde 6000, Eldorado do Sul, CEP 92990- 000, Rio Grande do Sul, Brazil, †Laboratorio de Virologia, Departamento de Microbiologia, Imunologia e Parasitologia, Instituto de Ci^encias Basicas da Saude, UFRGS, Av. Sarmento Leite 500, sala 208, Porto Alegre, CEP 90050-170, Rio Grande do Sul, Brazil, ‡Instituto Federal Catarinense, SC 283, Km 8, Vila Fragosos, Concordia, CEP 89700-000, Santa Catarina, Brazil and §CIRAD, Departament Systemes Biologiques, UR-15, Campus International de Baillarguet, 34398, Montpellier, France Abstract Porcine cytomegalovirus (PCMV) is a Betaherpesvirus that causes lifelong latent infections in swine; occasion- ally, it may be associated with inclusion body rhinitis in piglets and reproductive disorders in pregnant sows. Post-weaning multisystemic wasting syndrome (PMWS) a condition where porcine circovirus type 2 (PCV2) infection is necessary – though not sufficient – to trigger disease, has become one of the major health problems to the porcine productive chain. Despite the high expected prevalence of both PCMV and PCV2 in swine-rais- ing farms, no links between PCMV and PMWS have been investigated so far. In view of that, the present study was conducted to search for relations between PCMV infections and the occurrence of PMWS. Spleen and sera of PMWS-affected and non-PWMS-affected animals were examined.
    [Show full text]
  • HSV-1) Glycoprotein K (Gk) in the Morphogenesis of Infectious Virion Particles
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1999 Molecular Genetics and Functions of Herpes Simplex Virus Type 1 (HSV-1) Glycoprotein K (gK) in the Morphogenesis of Infectious Virion Particles. Timothy Paul Foster Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Foster, Timothy Paul, "Molecular Genetics and Functions of Herpes Simplex Virus Type 1 (HSV-1) Glycoprotein K (gK) in the Morphogenesis of Infectious Virion Particles." (1999). LSU Historical Dissertations and Theses. 7082. https://digitalcommons.lsu.edu/gradschool_disstheses/7082 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor qualify illustrations and photographs, print bleedthrough. substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
    [Show full text]