sign in sign up
<<
Home , Cataplexy, Narcolepsy

J Neurol Neurosurg : first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

Journal ofNeurology, Neurosurgery, and Psychiatry. Special Supplement 1989:101-108

Genetic factors in disorders

J D PARKES, C B LOCK From the University Department ofNeurology, King's College School ofMedicine and Dentistry, and Institute ofPsychiatry, London, UK

SUMMARY Several sleep disorders have a genetic basis. These conditions include the narcoleptic , sleep walking, periodic movements in sleep, circadian delay and familial . These disorders illustrate different control mechanisms involved in sleep and , including those determining the prevalence and timing of NREM and REM activity, somatomotor inhibition and excitation, autonomic discharge, and the circadian framework of sleep. The genetic defect in has been localised to the short arm of , but the chromosomal localisations of the genetic basis for the other disorders are not known. Also, with the possible exception ofacetylcholine, no definite involved in any aspect ofsleep regulation has been positively identified and the biochemical defect in narcolepsy is not known.

Several sleep disorders have a familial or genetic mechanisms during sleep. Sleep walking, often Protected by copyright. component. These conditions include the narcoleptic accompanied by sleep terrors, and usually arising from syndrome, idiopathic hypersomnolence, sleep walk- deep NREM sleep, is familial in between 10-20% of ing, periodic movements in sleep, various forms of all cases, with an increased incidence of sleep walking insomnia, and circadian delay syndromes.'-8 In in children when a parent has been a somnambulist.'4 addition, genetically determined sleep apnoea may Bakwin showed convincingly that monozygotic twins result from a number of neuromuscular and skeletal sleepwalk much more often than dizygotic twins, and disorders which cause an anatomically narrow upper identical twins have a very similar sleep structure.3 In airway. Medullary chemoreceptor sensitivity to pCO2 the families of children who sleepwalk, other is an inherited trait important in respiratory control individuals tend to be deep sleepers, with high systems during both sleep and wakefulness.9 In these thresholds for arousal from sleep.4 However, there is conditions, a wide variety ofdifferent mechanisms that no convincing evidence for any defect in NREM sleep control the normal sleep-wake cycle are selectively structure in children who sleepwalk, nor sign of involved, including NREM and REM and waking autonomic disorder in subjects with sleep prevalence systems, autonomic control mechanisms, terrors, despite the high degree of autonomic release and somatomotor inhibitory and excitatory systems. during this . In insects and mammals, both the genetic mechanisms The restless leg syndrome, often accompanied by oftime clocks in drosophilia and somatomotor inhibi- sleep myoclonus (periodic movements in sleep) is tion corresponding to in dogs have been familial in up to a third ofcases, usually transmitted as http://jnnp.bmj.com/ explored, although the exact anatomical localisation an autosomal-dominant trait.'5 Montagna et al of the human time clock is not known, and cataplexy described a family with the restless leg syndrome and has a different genetic basis in dogs and man.'0 Of the sleep myoclonus which they followed for over 20 human sleep disorders, narcolepsy has been most years. The propositus was a 68 year old Italian monk investigated, and this review deals mainly with the whose symptoms started at the age of 15 and gradually hunt for the narcolepsy gene, localised to the short arm got worse, causing severe insomnia and peculiar 6. sensory disturbances in the legs by the age of 48.5 of chromosome '1-13 on October 2, 2021 by guest. In contrast to narcolepsy, little is known of exact Roth has stressed the importance of familial factors genetic mechanisms in that involve in idiopathic , characterised by a lifelong autonomic function or somatomotor inhibitory tendency to excessive daytime drowsiness without accessory symptoms of narcolepsy, and with a family Address for reprint requests: J D Parkes, King's College Hospital, history of the condition in 39% of cases.2 However, London SE5 9RS, UK. subsequent studies ofsimilar cases have suggested that Accepted January 1989 in some instances "idiopathic" hypersomnia may 101 J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

102. Parkes, Lock result from monosymptomatic narcolepsy, as deter- an epitope ofDQ beta may explain the concurrence of mined by an HLA DR2 incidence as high as 60%.16 both diseases, rather than narcolepsy-cataplexy A delayed sleep phase syndrome has been described resulting from brainstem demyelination in multiple in a small number of patients who sleep quite sclerosis.' normally, awaken spontaneously, but are unable to go The biochemical basis for narcolepsy is unknown, to sleep at socially acceptable hours.! These subjects and the very idea of sleep may be have normal sleep itself, and normal polysomno- false. Sleep mechanisms are heterogenous, and it is not graphic recordings, but abnormal circadian sleep possible to explain sleep-wake behaviour in terms of timing. This condition, which may date from child- changes in only two or three known neurotrans- hood or early , is sometimes familial, mitters. Drucker-Colin, writing in 1976, observed that although insufficient cases have been described to there was no solid demonstration of the important determine the pattern of inheritance. regulation of the sleep-wake cycle by any known A rare familial form of insomnia with dysauto- neurotransmitter,23 and this is still true today, with the nomia and selective degeneration of thalamic nuclei possible exception of , which when was described by Lugaresi et al,' and the separate injected into pontine areas ofthe cat has major effects condition ofchildhood onset primary insomnia is also on REM sleep and sleep atonia.24 No conclusions as to sometimes familial.6 the physiological role of the many proposed "sleep peptides" in circadian control or the sleep-wake cycle are possible at present. For example, drowsiness or Familial andgeneticfactors in narcolepsy sleep have been reported following arginine vasotocin, Narcolepsy is characterised by a lifelong disorder of cholecystokinin octopeptide, beta endorphin, alpha REM sleep mechanisms, somatomotor inhibitory MSH and several of the family of interleukins.25 The mechanisms, and possibly autonomic systems without likely nature ofthe biochemical defect or defects in the major circadian disturbance. The main symptoms are narcoleptic syndrome cannot be deduced from these REM sleep-related attacks of daytime sleep, the data. In contrast, the pattern of inheritance may give Protected by copyright. periodic brief triggered attacks of loss of muscle tone an important clue. Dominant inheritance tends to be and of cataplexy, and pre- associated with an amino acid abnormality on cell sleep . In addition, patients suffer from severe surface proteins, recessive inheritance with daytime sleepiness and episodic automatic behaviour. intracellular enzymic defects. It is striking that very The evidence for an autonomic nervous system distur- few of the inborn errors defined at the biochemical bance of central origin is inconclusive, with the level are caused by dominant genes. occasional description of minor changes in pupillary responses, heart rate and blood pressure, pressor Familial narcolepsy responses and ejaculatory function.'78 The tendency The first case of familial narcolepsy came from to abnormal sleepiness can be demonstrated by sleep Westphal, who described a mother and son with both latency testing, with in many cases sleep-onset REM narcolepsy and sleep paralysis.26 Frequency estimates activity. Minnesota Multiphasic Personality Inven- of familial cases vary from 6-52%.272 Some of the tory (MMPI) scores in narcoleptics strongly suggest variation in estimate is due to incomplete case an increased prevalence ofpsychopathology, although ascertainment in first-degree relatives, or failure of these findings may be due to treatment disease recognition. Although controversial, the or the distinctive symptoms of cataplexy, hypnagogic pattern of inheritance appears to be autosomal- imagery and sleep paralysis.'9 dominant rather than multifactorial (table 1).2132 http://jnnp.bmj.com/ An anatomical basis for narcolepsy has not been Twin studies in narcolepsy show unequivocally the established, and no definite pathology has ever been importance of environmental as well as genetic described.' A variety of minor neuroradiological factors. Discordance for narcolepsy in presumed changes have been described in narcolepsy, including monozygotic twins has been reported by Mitchell and abnormal spin-echo signals in the ventral pons on MR Cummins,33 Schrader et al,' and Montplaisir and imaging,2' but some of these changes appear to be Poirier.35 A further monozygotic pair described by artefactual or have no relevance to the illness. A case Mamelak et alwas possibly concordant,36 as also in the for "secondary" narcolepsy (for example, narcolepsy case reported by Imlah of twins who simultaneously on October 2, 2021 by guest. with typical clinical features associated with brain developed narcolepsy and cataplexy at the age of 1.3 disease, , brain tumour, or Atypical features, possibly birth trauma, and variation syphilis) has been made, but there is little or no of disease severity in a twin pair, complicate these convincing evidence that this association is real, with reports (table 2).3' The report by Schrader et al is of the exceptions of encephalitis lethargica and possibly particular interest, one member only ofa monozygotic . Here a common genetic deter- twin pair having both multiple sclerosis and narco- minant of narcolepsy and multiple sclerosis, possibly lepsy-cataplexy.34 J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

Geneticfactors in sleep disorders 103 Table I Familial narcolepsy with both narcolepsy and cataplexy, a short sleep latency and REM sleep onset, who are DR2 negative. Percentage of White Caucasian subjects with unequivocal narco- Number of probands with probands with positivefamily Suggestedmode of lepsy and cataplexy, DR2 negative, have been narcolepsy history inheritance identified by Guilleminault," Andreas Zietz et al,4' and Sachs and Muller.43 Nealy et al described DR negative 250-300" 19 Dominant gene Incomplete penetrance narcolepsy in six of 18 Negroid subjects, but not all of 133 (family study) Dominant gene these had cataplexy.45 Further DR2 negative Negroid Incomplete penetrance 30 Dominant gene subjects with both narcolepsy and cataplexy have been 6432 33 Multifactorial described by Langdon et al," and Confavreux et al.42 502 52 Autosomal dominant All black, but not all white, subjects with narcolepsy 232" 6 Two-threshold Multifactorial and cataplexy who were DR2 negative in the study of Nealy et al were DQwl positive,45 while four of 118 narcoleptics (racial origin not specified: two without HLAfindings in narcolepsy cataplexy) who were DR2 negative in the study of DR2positive narcolepsy to be HLA data on over 500 Andreas-Zietz were DQw3 positive. Caucasian, European, North American, Japanese and Negroid narcoleptics had been reported by 1988. Ninety nine per cent of all white narcoleptics with cataplexy, with both the sporadic and familial form of HLA DR2 segregation distortion Initial evidence disease, are DR2 positive. With a single exception, no suggested that in narcoleptic males, but not in females, DR2 negative subject with narcolepsy has been the transmission of the DR2/DQw1 haplotype reported from Japan. Almost all ofthese DR2 positive deviates from Mandelian expectation, with higher subjects have also been DQwl positive."',3393 transmission by narcoleptic fathers than by mothers.47 A number ofdifferent techniques have been used to This finding has not been confirmed. Similar patterns Protected by copyright. identify and classify class II HLA proteins. Not all have been observed in some other HLA linked diseases subtypes are identified by all techniques. Mixed including type I diabetes. lymphocyte reactions may delineate class II groups not identified by serotyping. Most European and North American white subjects with narcolepsy who Restriction fragment length polymorphism studies in are DR2 positive are also Dw2, although in Japan narcolepsy The identification of the narcolepsy- DR2 is more often associated with Dwl2 than with HLA linkage led to intensive efforts to identify disease Dw2. However, in both groups, narcolepsy is unique or restricted HLA class II allelic variants by associated with DR2, Dw2/DQwl. serologic, cellular and restriction fragment length Approximately 25-35% ofsubjects with narcolepsy polymorphism (RFLP) typing methods, and many are DR2 homozygous, the remainder heterozygous. workers have now examined RFLPs in the DNA that There is general agreement that the HLA-DR2 encodes the DR/DQwl alleles. Using DQ region association with narcolepsy is the strongest HLA- probes, a polymorphism has been described in all disease association known, where patients with an Japanese narcoleptics studied, only present in 38% of unequivocal diagnosis of narcolepsy with cataplexy DR2 positive non-narcoleptic controls (a control are included. If patients with cataplexy are excluded, group was mainly Dwl2)."5' The DQ beta RFLP slightly lower figures obtain, and in some of these associated with narcolepsy is also that associated with http://jnnp.bmj.com/ examples, the clinical diagnosis of narcolepsy is DR2 positive multiple sclerosis and reflects the probably incorrect.43 association with DR2 Dw2 in both diseases. DR2 negative narcolepsy There are a few Approximately 45-50% of subjects with multiple unequivocal reports of both white and black subjects sclerosis in the UK are DR2 positive.

Table 2 Twins with narcolepsy on October 2, 2021 by guest. Authors Zygosity Concordance Observation Monozygous (?) Yes Atypical symptoms MitchellImlah3Sand Cummins33 Monozygous (?) No Narcolepsy attributable to birth trauma Vein' Uncertain No Atypical symptoms Mamelak' Monozygous (?) Probable Montplaisir and Poirer9' Monozygous (?) No Classic narcolepsy Schrader et al '3 Monozygous (?) No Association multiple sclerosis J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

104 Parkes, Lock Genetic sequence studies in narcolepsy 17. This is the mouse equivalent of the human MHC Gene sequence studies in narcolepsy have examined on chromosome 6 and in view of the conservation of the two expressed DR2 beta chains along with DQwl the organisation of the two regions in mouse and man alpha and beta chains.52 The coding regions of these it is possible that a brain specific nicotinic receptor four genes are similar to published nucleotide and gene is present on the human chromosome 6. As protein sequences from corresponding healthy non- stressed above, of the classic neurotransmitters, narcoleptic DR2 positive controls, with some minor acetylcholine is the only compound with definite exceptions. implications in REM sleep. The DR beta 2a clone from a narcoleptic subject had an extended 3' end, 42 bases longer than expected. This sequence contained an additional polyadenyla- Environmentalfactors and disease associations with tion signal, and a sequence characteristic of a narcolepsy retroviral direct terminal repeat.53 The significance of Despite the extremely strong genetic linkage, in the extended 3' end is uncertain; this may alter message addition, environmental factors are of considerable stability or translation. The retroviral sequence is importance in narcolepsy. This may explain the low probably not of significance, as this is also present in penetrance observed in families with narcolepsy. Only other DR beta genomic sequences (fig). This extension a small percentage of DR2 positive individuals, about contained a Bst N1 site. 0-2%, develop narcolepsy. DQ alpha and beta sequences were identical to Menstruation, pregnancy, sudden abrupt changes normal control sequences at the amino acid level. in the sleep-wake cycle, psychological stress, infectious However, DQ alpha contained a single transversion diseases, influenza, mumps, pneumonia, scarlet fever, mutation, GGG-GGC, at amino acid 23. Compared hepatitis, malaria, operation, anaesthetic and head with the DR Dw2 control cell line for PGF, this does injury, have all been described as antecedants to not an 1 result in amino acid change, but creates a Bal narcolepsy.255 However, any true relationship betweenProtected by copyright. restriction site. These differences may be useful as such illnesses and narcolepsy is in doubt. The genetic markers for distinguishing the narcoleptic occurrence of chronic daytime sleepiness and , DR2 haplotype and may indicate heterogenicity but not narcolepsy-cataplexy following infectious within DR2 Dw2. mononucleosis is well documented.' This post- It is still not clear whether the genetic susceptibility infective association is of considerable interest, with to narcolepsy is determined by the DR, DQ, or a reports ofsleep provoked by interleukin 1 in animals.25 linked gene, and there are still large unmapped gaps However, the incidence of previous infectious mono- within the flanking MHC region. Recently identified nucleosis in some populations as determined by EBV genes within the MHC include tumour necrosis factor IgG levels is over 50%, and most postviral fatigue alpha and beta (lymphotoxin) as well as a number of symptoms differ markedly in clinical characteristics other genes ofunknown function including "RD".' It from the narcoleptic syndrome. Billiard et al have is noteworthy that one of the genes for a nicotinic recently described elevated antistreptolysin and anti- receptor chain, Acra, is in the mouse on chromosome streptodonase beta levels in the majority ofnarcoleptic http://jnnp.bmj.com/ Comparison of narcoleptic DR beta 2a 3' extension with control DR beta genomic sequence (from DR4 haplotype)*

Narcoleplic AGTTAAAAATCAT1GTCCACCTGCTCCAAAGACAAAAAATAAAAA DR4 genomic sequence AGTT¶AAAATCG GTCATTTGCCCCAAGGACAAAAAATAAAAA *********** on October 2, 2021 by guest.

4= Bst N1 site (CCTGG); this restriction site is present only in this upper sequence. Direct terminal repeat of retrovirus - like sequence. -Polyadenylation*= signal. *DR2 genomic sequence not available J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

Geneticfactors in sleep disorders 105 Table 3 Association between "narcolepsy" and other disease

Disease associated with narcolepsy Notes Possible immune mechanisms Polycythemia Lymphoma Occasional association with "narcolepsy", but very uncommon in all Systemic lupus erythematosus instances, and presentation of narcolepsy usually atypical with exception of Multiple sclerosis multiple sclerosis Pernicious anaemia Probable sleep apnoea Acromegaly Probably always sleep apnoea Myotonic dystrophy Dysautonomias Thyroid disease Ocular disorders Extrinsic muscle paralysis 1-2% of subjects with narcolepsy may have oculomotor disorder unrelated to Cataract cataplexy Glaucoma Metabolic disorders Diabetes mellitus Not true narcolepsy. DR2 + ve rare in type I diabetes mellitus Thyroid disease Miscellaneous Essential tremor Single patient only Parkinsonism Two patients subjects, but not controls: the significance of this DQwl sub-type in this population, and mediated by finding is at present uncertain.57 autoantibodies to a keratinocyte surface antigen.?' With the exception of multiple sclerosis, and poss- association with HLA- Despite the autoimmune many Protected by copyright. ibly encephalitis lethargica, there are no unequivocal linked diseases, there is no convincing evidence of any associations between narcolepsy and other diseases immune abnormality in narcolepsy. Minor cerebro- (table 3). Pituitary and thyroid disease result in spinal fluid abnormalities, including lymphocytosis, daytime drowsiness as a consequence of sleep apnoea, protein increase, and oligoclonal bands in one instance not narcolepsy. Myotonic dystrophy (chromosome have been described in narcolepsy, but these findings 19) is associated in a third of subjects with severe are unusual. Estimates of T-cell activation and T-cell daytime drowsiness (not always attributable to sleep subsets as a possible indicator of immune mechanism apnoea). Here drowsiness is of unknown cause, but in narcolepsy have shown no abnormality.6' not associated with cataplexy. In Japanese patients with narcolepsy, there is a positive linkage with type 2 Prevalence ofnarcolepsy and HLA frequency diabetes (non-insulin dependent),58 and in Western Accurate surveys of the prevalence of narcolepsy series, DR2 Dw2 is negatively associated with type I worldwide are not available. However, available diabetes. Interestingly, six Czechoslovakian cases of reports suggest marked regional variations, from 2-3 so-called secondary narcolepsy and cataplexy, initially cases per 10 000 in Czechoslovakia, to 5-67 in the San attributed to previous encephalitis or brain tumour, Francisco area, and 16 in Japan (table 4).2746486245 were all DR2 positive.4' Only six subjects with narcolepsy have been identified in the Israeli population.62 The condition may be more in narcolepsy common in men than women, although sex incidence http://jnnp.bmj.com/ The extremely high HLA linkage, 99%, of DR2/ is equal in UK series. The age of onset varies from DQwl with narcolepsy, is unique for any disease early childhood to old age, with a median between 18 among the 60 or more conditions which show sig- and 25. The condition usually starts gradually, and nificant HLA associations with class 1 or class 2 antigens. The only conditions to approach narcolepsy HLA-DR in this are and Table 4 Reportedprevalence ofnarcolepsy and respect Goodpasture's syndrome frequency ankylosing spondylitis, with a reported HLA B27 association of 89%, 85% and 58% respectively in on October 2, 2021 by guest. Prevalence of Frequency of white, orientals and blacks (versus control values of narcolepsy HLA-DR2 9%, 15% and 4%).5 Pemphigus vulgaris, a severe (per 10 000) (%) of the skin, characterised by Israe626 0-2 11-12 intra-epidermal blistering, is also very strongly HLA- Czechoslovakia63 2 linked, but in contrast to narcolepsy, pemphigus is USA" 5-6 22-25 Japan4 16 34 relatively frequent among Jews, associated with a DR6 J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

106 Parkes, Lock Table 5 Types ofnarcolepsy

Familial* (n = 35) Nonfamilial (n = 78) DR2 status All positive except 2 subjects All positive RFLP-DR2 statust (restriction Similar HLA-DQ + DQa restriction fragments in familial and enzyme Bgl,, DQ: probe-band at 3 kb) nonfamilial cases (also in individual DR2-negative subjects) Onset Age (mean: range) 21 5 (7-48) years 23 (3-70) years Sudden or slow Sudden onset in 14% Sudden onset in 15% Previous infection History of infection in 10% History of infection in 8% Recovery Nil Single instance Blood/CSF abnormalities Antibodies in blood? Not found Not found T-cell abnormality? Not demonstrated Not demonstrated a- I -Trypsin phenotype Association unremarkable Association unremarkable Immunoglobulin allotype Association unremarkable Association unremarkable CSF abnormality Occasional increased cell count, Minor abnormalities in minor increase in protein about 20% of cases "Sleep factors" present Not detected Not detected in blood/CSF? Benzodiazepine receptor-binding Not excessive Not excessive activity in CSF

*Familial: definite narcolepsy, cataplexy, or both, present in first-degree relative (parent, sib or child). tDR2 RFLP status: similar RFLP present in DR2-positive subjects with multiple sclerosis.

correct diagnosis may take several years. However, the evidence for this in primates and man is uncertain. 10-15% of cases have an abrupt onset. a Spontaneous VIP is potent hypnogen, but if the autosomal- Protected by copyright. remission is very rare.' Yoss and Daly,67 and Billiard dominant pattern of inheritance of narcolepsy is et al,68 could find no evidence of complete recovery. correct, it is unlikely that the VIP gene is primarily Age of onset, sex distribution and severity of involved in the disease, since this is not a cell surface symptoms do not appear to vary between populations, protein. It seems probable that the genetic deter- and in our experience are similar in both DR2 positive minant ofnarcolepsy will prove to be a DR/DQ linked and DR2 negative subjects. gene, the genetic product being a neurotransmitter receptor involved in sleep-wake systems. A possible Familialfactors in narcolepsy candidate for such a linked gene product would be a Clinical factors, age of onset, severity of illness, brain specific nicotinic receptor. Alternatively, since presence or absence of precipitating factors at disease the DR and DQ molecules in narcolepsy are identical onset are similar in familial (n = 35) and non-familial with those in normal individuals at a protein level, (n = 78) subjects with narcolepsy in our clinical narcolepsy may depend on the functional properties of experience (table 5). Analysis ofpaternal and maternal the normal DR2 or DQwl molecules. Muramyl age at birth ofindex cases, family size and birth month peptides, possibly involved in normal sleep mechan- also showed no major differences in the two groups, in isms, show selective binding to specific DR contrast to what might be expected if genetic new haplotypes.7' Whatever the outcome in the search for a mutation or seasonally determined environmental narcolepsy gene this is likely to reveal brain neuro- factors accounted for non-familial narcolepsy. transmitter mechanism in REM sleep. http://jnnp.bmj.com/ The HLA association with narcolepsy remains mysterious. Narcolepsy is unique amongst HLA- Work reported here was supported by a grant from the linked diseases with possible dominant inheritance, King's College Hospital and Medical School Joint and also by virtue of the negative rather than positive Research Committee. autoimmune associations. It seems likely that the narcolepsy gene is not DR2/DQwl, but a linked non- HLA gene encoding a product affecting sleep, and References possibly altered in the DR2 haplotype. Candidate on October 2, 2021 by guest. I Honda Y. Clinical features of narcolepsy: Japanese experience. In: genes here might include that encoding vasoactive Honda Y, Juji T, eds. HLA in Narcolepsy. Berlin: Springer- intestinal peptide, located on chromosome 6,69 Verlag, 1988. although this gene is probably at a very considerable 2 Roth B. Narcolepsy and Hypersomnia. Basle: Karger, 1980. distance from the HLA locus. VIP is present in high 3 Bakwin H. Sleep walking in twins. Lancet 1970;ii:446-7. 4 Kales A, Soldatos CR, Bixler EO, et al. Hereditary factors in sleep concentration in the animal suprachiasmatic walking and night terrors. Br J Psychiatry 1980;137:111-8. nucleus,70 a possible candidate time clock, although 5 Montagna P, Coccagna G, Cirignotta F, Lugaresi E. Familial J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

Geneticfactors in sleep disorders 107 restless leg syndrome. In: Guilleminault C, Lugaresi E, eds. 33 Mitchell SA, Cummins LE. Idiopathic narcolepsy in one of SleepI Wake Disorders. Natural History, Epidemiology and monozygotic twins. Paper presented at Association for Psycho- Long-term Evolution. New York: Raven Press, 1983:231-5. physiological Study of Sleep, Washington DC. 1965. 6 Haury P, Olmstead E. Childhood-onset insomnia. Sleep 1980; 34 Schrader H, Gotlibsen OB, Skomedal GN. Multiple sclerosis and 3:59-66. narcolepsy/cataplexy in a monozygotic twin. 1980; 7 Lugaresi E, Medori R, Montagna P, et al. Fatal familial insomnia 30:105-8. and dysautonomia with selective degeneration of thalamic 35 Montplaisir J, Poirier G. Narcolepsy in monozygotic twins. nuclei. N Engl J Med 1986;315:997-1003. Neurology 1987;37:1089. 8 Weitzman ED, Czeisler CA, Coleman RM, et al. Delayed sleep- 36 Mamelak M, Caruso VJ, Stewart K. Narcolepsy: a family study. phase syndrome: a chronobiological disorder with sleep onset Biol Psychiat 1979;14:821-34. insomnia. Arch Gen Psychiatry 1981;38:737-46. 37 Imlah NW. Narcolepsy in identical twins. J Neurol Neurosurg 9 Strohl KP, Saunders ND, Feldman NT, Hallet M. Obstructive Psychiatry 1961;24:158-60. sleep apnoea in family members. N Engl J Med 1978;299: 38 Vein: cited by Roth B. Narcolepsy and Hypersomnia. Basle: 969-73. Karger. 1980:3 10. 10 Kilduff TS, Bowersox SS, Kaitin KI, Baker TL, Ciaranello RD, 39 Mueller Eckhardt G, Meier-Ewert K, Schendel DJ, Reinecker FB, Dement WC. Muscarinic cholinergic receptors and the canine Multhoff G, Mueller-Eckhardt C. HLA and narcolepsy in a model of narcolepsy. Sleep 1986;9:102-6. German population. Tissue Antigens 1987;28:163. 11 Honda Y. Dol Y, Juji T, Satake M. Narcolepsy and HLA. Folia 40 Poirier G, Montplaisir J, Decary F, Manege D. Lebrun A. HLA PsYchiat Neurol Jpn 1984;36:360. antigen in narcolepsy and idiopathic 12 Langdon N, Welsh KI, Dam MV, Vaughan RW, Parkes JD. hypersomnolence. Sleep 1986;9:153-8. Genetic markers in narcolepsy. Lancet 1 984;ii: 1178-80. 41 Andreas-Zietz A, Scholz S, Roth B, et al. DR2-negative 13 Billiard M, Seignalet J. Extraordinary association between HLA narcolepsy. Lancet 1986;ii:684-5. DR2 and narcolepsy. Lancet 1985;i:226-7. 42 Confavreux D, Gebuhrer L, Betuel H, et al. HLA-DR2 negative 14 Davies E, Hayes M, Kirman BH. Somnambulism. Lancet 1941; narcolepsy. J Neurol Neurosurg Psvchiatrv 1987;50:635-6. 1:186. 43 Sachs C, Moller E. The occurrence of HLA-DR2 in clinically 15 Ambrosetto C. Lugaresi E. Coccagna G, Tassinari CA. Clinical established narcolepsy. Acta Neurol Scand 1987;75:437-9. and polygraphic remarks in the restless leg syndrome. Riv Patol 44 Guilleminault C. HLA-DR2 and narcolepsy: not all narcoleptic- Nerv Ment 1965;86:244-51. cataplectic patients are DR2. Human Immunol 1986;17:1-2. 16 Honda Y, Juji T, Matsuki K, et al. HLA-DR2 and Dw2 in 45 Nealy S, Roseberg R, Spire J-P, Antel J, Arnason BGW. HLA disorders ofexcessive without 1858-60. narcolepsy and other antigens in narcolepsy. Neurology 1987;37: Protected by copyright. cataplexy. Sleep 1986;9:133-42. 46 Langdon N, Lock C, Welsh K, et al. Immune factors in narcolepsy. 17 Guilleminault C, Quesa-Salva MA, Mancuso J, Hayes B. Sleep 1986;9:143-8. Narcolepsy, cataplexy heart rate and blood pressure. Sleep 47 Mueller-Eckhardt GM, Strohmayer P, Schendel DJ, Meier-Ewart 1986;9:222-6. K, Mueller-Eckhardt C. Possible male segregation distortion of 18 Karacan I. Erectile dysfunction in narcoleptic patients. Sleep 1986; DR2 haplotypes in narcolepsy patients. Human Immunol 1987; 9:227-31. 20:189-93. 19 Baker TL, Guilleminault C. Nino-Murcia G, Dement WC. 48 Honda Y, Juji T, Matsuki K. HLA-DR2 and Dw2 in narcolepsy Comparative polysomnographic study of narcolepsy and and in other disorders of excessive somnolence without idiopathic central nervous system hypersomnia. Sleep 1986; cataplexy. Sleep 1986;9:133-42. 9:232-42. 49 Mercadet A, Gebuhrer L, Betuel H. et al. DNA polymorphism 20 Erlich SG, Itabashi HH. Narcolepsy: a neuropathologic study. related to HLA-DR2 Dw2 in patients with narcolepsy. Sleep 1986;9:126-32. Immunogenetics 1985;22:679-83. 21 Rivera VM, Meyer JS, Hata T, Ishikawa Y, Imai A. Narcolepsy 50 Billiard M, Seignalet J, Besset A, Cadilhac J. HLA-DR2 and following cerebral hypoxic ischaemia. Ann Neurol 1986;19: narcolepsy. Sleep 1986;9:145-52. 505-8. 51 Holloman JD, Bell JI, KilduffTS, Dement WC, Guilleminault C, 22 Marcadet A, Massart C, Semona G. Association of class II HLA- McDevitt HO. HLA-DR restriction-fragment-length polymor- DQ beta restriction fragments with multiple sclerosis. phism in narcolepsy. J Neurosci Res 1987;18:239-44. Immunogenetics 1985:22:93-6. 52 Lock CB, So AKL, Welsh KI, Parkes JD, TrowsdaleJ. MHC class 23 Drucker-Colin RR. Is there a sleep neurotransmitter? Prog II sequences of an HLA-DR2 narcoleptic. Immunogenetics Neurohiol 1976:6:1-22. 1988;27:449-52. 24 Shute CCD, Lewis PR. The ascending cholinergic reticular system. 53 Anderson G, Larhammar D, Widmark E, Servenius B, Peterson

Brain 1976:90:497-520. PA, Rask L. Class II genes of the human major histo- http://jnnp.bmj.com/ 25 Tobler 1, Borbely AA, Schwyzer M, Fontana A. lnterleukin-l compatability complex. J Biol Chem 1987;262:8748-58. derived from astrocytes enhances slow-wave activity in sleep 54 Levy-Strauss M, Carroll MC, Steinmetz M. Meo T. A previously EEG of the rat. Eur J Pharmacol 1984:10:191-2. undetected MHC gene with an unusual periodic structure. 26 Westphal C. Eigentiimliche mit Einschlafen verbundene Anfalle. Science 1988;240:201-4. Arch Psi'chiatr Nerirenkr 1877:7:631-5. 55 Parkes JD. Sleep and its Disorders. London: WB Saunders, 1985. 27 Honda Y. Census of narcolepsy, cataplexy and sleep life amongst 56 Guilleminault C, Mondini S. Mononucleosis and chronic daytime teenagers in Fujisawa city. Sleep Res 1979;8:191. sleepiness. Arch Intern Med 1986;146:1333-5. 28 Baraitser M. Parkes JD. Genetic study of narcoleptic syndrome. 57 Billiard M, Laaberki MF, Seignalet J. Reygrobellet C, Besset A. J Med Genet 1978:15:254-9. Bacterial and viral studies in narcoleptic subjects. In: Abstracts

29 Krabbe E, Magnussen G. Familial narcolepsy. Acta PsYchiatr 9th European Congress of Sleep Research, Jerusalem, Israel. on October 2, 2021 by guest. Neurol 1942:17:149-73. September 4-9, 1988. 30 Daly D. Yoss R. A family with narcolepsy. Proc Staff Meet Mavo 58 Honda Y. Dol Y, Ninomiya R, Ninomiya C. Increased frequency Clin 1959;34:313-20. of non-insulin dependent diabetes mellitus among narcoleptic 31 Yoss RE, Daly DD. Hereditary aspects of narcolepsy. Trans Am patients. Sleep 1986;9:254-9. Neurol Assoc 1960:85:235-40. 59 Tiwari JL, Terasaki PI. HLA and Disease Associations. New York: 32 Bruhova S, Roth B. Heredofamilial aspects of narcolepsy and Springer Verlag, 1985. hypersomnia. Arch Suisse Neurol Neurochir PsYchiat 1972; 60 Sinha A, Brautbar C. Szafer F. et al. A newly characterized HLA 110:45-54. DQ allele associated with pemphigus vulgaris. Science 1988; J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.52.Suppl.101 on 1 June 1989. Downloaded from

108 Parkes, Lock 239:1026-9. 68 Billiard M, Besset A, Cadilhac J. The clinical and polygraphic 61 Matsuki K. Lymphocyte subsets in HLA DR2 positive narcoleptic development of narcolepsy. In: Guilleminault C, Lugaresi E, patients. Folia Psychiatr Neuro Jpn 1985;39:499-505. eds. Sleep- Wake Disorders. New York: Raven Press, 1983. 62 Lavie P, Peled R. Narcolepsy is a rare disease in Israel. Sleep 1987; 69 Gozes I, Avidor R, Yahau Y, Katznelson D, Croce C, Huebner K. 10:608-9. The gene encoding vasoactive intestinal peptide is located on 63 Roth B. Narcolepsy and Hypersomnia. Basle: Karger, 1980: 310. human chromosome 6p21-6qter. Hum Genet 1987;75:41-6. 64 Dement W, Zarcone V, Varner V, et al. The prevalence of 70 Sofroniew MY, Windl A. Neuroanatomical organisation and narcolepsy. Sleep Res 1972;1: 148. connections ofthe suprachiasmatic nucleus. In: AschoffJ, Daan 65 Oksenberg J, Amar A, Cohen N. "BG" in Israel. Tissue Antigens S, Groos G, eds. Vertebrate Circadian Systems. Berlin: Springer 1983;21:271-80. Verlag, 1985. 66 Ohta T, Honda Y, Kameyama T, Kurita H, Takahashi Y. A long- 71 Alvarez CE, Sayegh MH, Silverman DH, Johnson TS, Karnovsky term prognosis of narcolepsy. Sleep Res 1979;8:206. M, Milford EL. HLA-DR restricted binding of sleep inducing 67 Yoss RE, Daly DD. Criteria for the diagnosis of the narcoleptic muramyl peptides to B-cells ofnormal and narcoleptic subjects. syndrome. Proc Mayo Clin 1957;32:320-8. Human Immunol 1988;23:76-9. Protected by copyright. http://jnnp.bmj.com/ on October 2, 2021 by guest.