DOCSLIB.ORG

Supporting Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Supporting Information Ischenko et al. 10.1073/pnas.1219592110 SI Materials and Methods and soft agar colony formation assays were performed as de- We used previously described LSL KrasG12D mice (1) and LSL scribed previously (3). We used replication-defective retroviral p53R172H mice (2). MEFs were prepared from embryonic day vectors encoding constitutively active mutants KrasG12D, 13 to 14 embryos. Adult fibroblasts and pancreatic epithelial cells KrasG12V, HrasG12V, NrasG12D, EGFR XZ066, Mek2 were prepared from 4- to 6-wk-old mice. All fibroblast cells, KW71, Myr Akt1, Myr PDK1, Rac G12V, CDC42 Q61L, RalA unless otherwise specified, were grown in DMEM (Gibco) sup- Q75L, CDK2, CDK4, c-Myc, L-Myc, Bmi1, FoxC2, Stat3, plemented with 5% FBS (Sigma) and 1× antibiotic–antimycotic. Twist1, Ezh2, and dominant-negative mutants c-MycΔMBII and Epithelial cells were grown on gelatinized plates in CnT-17 Myc W136E. Mission lentiviral vectors expressing shMyc were media (CellnTec). Cells (2 × 104) were injected s.c. into nude purchased from Sigma. mice at four sites on the back of the mouse. We defined tumor For expression microarrays, total cellular RNA was extracted by latencies as the period between injection of tumorigenic cells using the RNeasy Mini Kit (Qiagen). One-color hybridizations of into mice and the appearance of tumors of ≥1 mm in diameter. labeled cRNAs (two technical replicas) were performed against the The survival end point was a tumor diameter of 1 cm. For mouse MouseRef-8 Expression BeadChip 25K microarray (Illu- sphere-forming assays, single cell suspensions were cultured in mina) at Roswell Park Cancer Institute (Buffalo, NY). Microarray ultralow-attachment six-well plates (Corning) with CnT-17 me- signals were processed with GenomeStudio Gene Expression dia at 2 × 104 to 105 cells per well. For flow cytometry, cells were Module (GSGX; Illumina), version 1.6.0. Differentially expressed lifted with Accutase (Sigma), stained with antibodies to Thy1.2, genes were defined based on greater than two- or fourfold change. Sca1, EpCam, CD104, CD49f, CD44, and CD24 (BD Pharmin- Data were background-corrected and quantile-normalized. A gen), and analyzed by using FACSCalibur (BD) with CellQuest small offset was applied to bring values above 0. The heat maps software. Standard protocols were followed for Western blot (Fig. S3) were generated by calculating ratios of expression in each analysis. We used antibodies specific for Kras (Ab1), Ras Asp12 sample vs. control. The log2 values were then supplied to the heat (Ab-1), Pan-Ras (F132-62; all from Millipore), Hras (6100001; map function of the R statistical package. Module expression BD), c-Myc (N-262; all from Santa Cruz), Max (4732), and analysis was conducted as described previously (4). Average gene MAPK (05-157; Upstate). The Ras activation assay was per- expression values (log2) of all genes were set as baseline 0. The formed by using an agarose-bound GST-fused Ras-binding do- gene expression values (log2) of each module relative to the main of Raf-1 (Cell Biolabs). Briefly, cells were plated at equal overall average were represented as mean ± SEM. Definition of density, grown in 2% (wt/vol) FBS (fibroblasts) or CnT-17 media each module is as follows: the Kras module comprises 220 targets (epithelial cells), washed with cold PBS solution, and lysed. The derived from preclinical and clinical datasets (5); the AP1 module activated Ras was pulled down with agarose-conjugated Raf-1 is composed of 124 targets of the Jun and Fos family proteins (6– Ras-binding domain, followed by SDS/PAGE gel electrophoresis 8); the Myc module comprises 500 targets of Myc, Max, N-Myc, and immunoblotting with anti-Kras, Hras, and Pan-Ras anti- Dmap1, E2F1, E2F4, and Zfx (4); the PRC module is composed bodies. Real-time RT-PCR was performed by using whole-cell of 560 targets of PRC cluster proteins, Phc1, Rnf2, Eed, and RNAs prepared from primary cells or tumors. RNAs were pre- Suz12 (4). Statistical analyses were performed by using a Student pared by using the TRIzol reagent (Invitrogen). Focus formation t test. P ≤ 0.05 was considered statistically significant. 1. Tuveson DA, et al. (2004) Endogenous oncogenic K-ras(G12D) stimulates proliferation 5. Loboda A, et al. (2010) A gene expression signature of RAS pathway dependence and widespread neoplastic and developmental defects. Cancer Cell 5(4):375–387. predicts response to PI3K and RAS pathway inhibitors and expands the population of 2. Olive KP, et al. (2004) Mutant p53 gain of function in two mouse models of Li- RAS pathway activated tumors. BMC Med Genomics 3:26. Fraumeni syndrome. Cell 119(6):847–860. 6. Ozanne BW, et al. (2000) Transcriptional regulation of cell invasion: AP-1 regulation of 3. Petrenko O, Fingerle-Rowson G, Peng T, Mitchell RA, Metz CN (2003) Macrophage a multigenic invasion programme. Eur J Cancer 36(13 Spec No):1640–1648. migration inhibitory factor deficiency is associated with altered cell growth and 7. Leaner VD, Kinoshita I, Birrer MJ (2003) AP-1 complexes containing cJun and JunB reduced susceptibility to Ras-mediated transformation. J Biol Chem 278(13): cause cellular transformation of Rat1a fibroblasts and share transcriptional targets. 11078–11085. Oncogene 22(36):5619–5629. 4. Kim J, et al. (2010) A Myc network accounts for similarities between embryonic stem 8. Florin L, et al. (2004) Identification of novel AP-1 target genes in fibroblasts regulated and cancer cell transcription programs. Cell 143(2):313–324. during cutaneous wound healing. Oncogene 23(42):7005–7017. Ischenko et al. www.pnas.org/cgi/content/short/1219592110 1of7 A Cre WT LSL KrasD12 WT KrasD12 25 p53-/- LSL KrasD12 20 p53-/- KrasD12 15 10 Adi Zaltsman 5 Fold cell increase 0 0 5 10 15 20 25 Passages B LSL KrasG12D p53KO MEFs p4 KrasG12D p53KO MEFs p4 C Cl11 Cl17 Cl15 Cl1 Cl6 Cl8 Control Cl7 Cl2 Cl3 Control Cl22 Cl21 Cl11 Cl12 KrasG12D Total Kras MAPK Fig. S1. (A) Growth curves of WT LSL KrasG12D (inactive allele), KrasG12D (activated allele), LSL KrasG12D p53−/− (p53KO; inactive allele), and KrasG12D p53KO (active allele) MEFs. (B) Morphological changes in LSL KrasG12D p53KO MEFs (Left) caused by activation of the mutant Kras allele (Right). (C) Immunoblot analysis of KrasG12D and total Kras expression in control LSL KrasG12D p53KO and clonal KrasG12D p53KO fibroblasts. Ischenko et al. www.pnas.org/cgi/content/short/1219592110 2of7 D E F G H Fig. S2. (A–C) To assess whether KrasG12D-expressing cells need to undergo many rounds of DNA replication to acquire a malignancy-associated phenotype, we compared KrasG12D p53KO MEFs that were grown for 12 passages under various serum conditions (0.1–10% FBS). Cells maintained in low serum underwent fewer population doublings compared with cells cultured in high serum (A). However, this growth disadvantage had no effect on the capacity of cells to form transformed foci (B) or tumors in nude mice (C), thus indicating that KrasG12D-mediated transformation is relatively independent of cell division rate. (D–F) We next used the Luria–Delbrück fluctuation method, which estimates the mutation rate of dividing cells (D). The premise of the method is that, among a large set of identical cultures, the number of transformed colonies arising in each culture will follow the Poisson distribution. However, the number of colonies per culture will vary greatly if random mutations conferred a strong proliferative and/or survival advantage. We monitored 10 parallel cultures of KrasG12D MEFs over a 2-mo time period (E)toconfirm that new malignant cells develop from premalignant cells via a Poisson process (with variance equal to the mean) and not the Luria–Delbrück process (with variance much larger than the mean) (F). (G and H) To assess the role of added genomic instability, we cultured LSL KrasG12D p53KO MEFs for 2, 10, or 20 passages (6, 30, and 60 d, respectively) to render them increasingly aneuploid, before induction of Cre-mediated re- combination and activation of KrasG12D allele (G). However, we observed no obvious effects of long-term growth on the ability of KrasG12D p53KO MEFs to form transformed foci. Overexpression of exogenous KrasG12D in p53KO MEFs produced similar results (H), effectively excluding the possibility that appreciable DNA damage had been caused by transient expression of Cre in LSL KrasG12D p53KO MEFs. Ischenko et al. www.pnas.org/cgi/content/short/1219592110 3of7 A More differentiated cells: Thy1+Sca1- (Thy1-SP) and Thy1+Sca1+ (DP) Thy1-Sca1- (DN) Less differentiated cells: cell population Thy1-Sca1+ (Sca1-SP) B Thy1-Sp DP Sca1-SP DN Thy1 24% 7% 14% 41% 1.2% 0% 4% 0% 65% 3.5% 42% 3% 86% 13% 94% 1.2% Sca1 Fig. S3. (A) The distribution of Thy1-single positive (SP), double positive (DP), Sca1-SP, and double negative (DN) subpopulations in total, unsorted KrasG12D p53KO MEFs. (B) Experimental design to track cells responsible for tumor initiation among KrasG12D p53KO fibroblasts. FACS analysis of Thy1 and Sca1 ex- pression in tumors derived from FACS-sorted Thy1-SP, double positive, Sca1-SP, and DN subpopulations of KrasG12D p53KO fibroblasts. Ischenko et al. www.pnas.org/cgi/content/short/1219592110 4of7 18 51 A B C Metabolism and transport 33 69 Signal transduction Cell adhesion and cytoskeleton 46 Transcription factors Tumorigenic cells 16 Extracellular matrix (320 genes) Growth factors Cell growth 8 Proteolysis 30 Other 4 Unknown 46 27 4 9 6 10 7 12 Morphologically 9 25 21 transformed cells Morphologically transformed Morphologically transformed (132 genes) non-tumorigenic cells tumorigenic cells D SOX5 KLF5 FOXG1 DLX1 DLX2 SIX2 ETV4 HOXD9 HOXB5 HOXC10 HOXB2 HOXC6 IRF9 DDIT4L STAT3 SMAD6 E2F2 DMRTA2 ANKRD1 FOSB FOS JUN PAWR BARX1 HOXB6 STAT2 HOXB9 CREB3L1 HEY1 IRX1 HOXD4 HOXB7 TCFL5 HOXB4 HOXC9 HOXD8 TCF3 HOXD10 SSBP2 PKNOX2 LMCD1 NFATC4 EYA4 RUNX1T1 PITX2 MEOX1 Morph.
Load more

Recommended publications
  • Implications of Zonal Architecture on Differential Gene Expression
    www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • Transcriptional Regulatory Networks in Neocortical Development
    Review From trans to cis: transcriptional regulatory networks in neocortical development 1 1 1,2 Mikihito Shibata , Forrest O. Gulden , and Nenad Sestan 1 Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA 2 Department of Psychiatry and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale School of Medicine, New Haven, CT 06510, USA Transcriptional mechanisms mediated by the binding of tions among TFs and CREs form the central core of tran- transcription factors (TFs) to cis-acting regulatory ele- scriptional regulatory networks (TRNs) (Box 1) [1]. ments (CREs) in DNA play crucial roles in directing gene Interactions between TFs and CREs are complex, dynam- expression. While TFs have been extensively studied, ic,andmodulatedbyvariousepigeneticprocesses[12].While less effort has gone towards the identification and func- individual CREs may be regulated by the competitive or tional characterization of CREs and associated epigenet- cooperative binding of many TFs, multiple CREs may also ic modulation. However, owing to methodological and confer transcriptional control over the expression of any analytical advances, more comprehensive studies of single gene [12]. Furthermore, TFs and CREs regulate regulatory elements and mechanisms are now possible. transcription together with their cognate transcriptional We summarize recent progress in integrative analyses of cofactors, chromatin regulators, epigenetic modifications, these regulatory components in the development of the RNA-binding proteins, and non-coding RNAs [2,13]. This cerebral neocortex, the part of the brain involved in combinatorial and multi-level transcriptional regulation cognition and complex behavior. These studies are greatly increases the complexity of gene expression regula- uncovering not only the underlying transcriptional reg- tion, facilitating the unique spatio-temporal patterns nec- ulatory networks, but also how these networks are essary for tissue development and function [3].
    [Show full text]
  • Up-Regulation of Homeodomain Genes, DLX1 and DLX2, by FLT3 Signaling
    SUPPLEMENTARY APPENDIX Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling Julia Starkova,1,3 Sharvari Gadgil,2 Yi Hua Qiu,4 Nianxiang Zhang,4 Ivana Hermanova,3 Steven M. Kornblau,4 and Harry A. Drabkin1,3 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic, and 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Citation: Starkova J, Gadgil S, Hua Qiu Y, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling. Haematologica 2011;96(6):820-828. doi:10.3324/haematol.2010.031179 Online Supplementary Figure S1. Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phases of the cell cycle after 0, 2, 5 and 24 h treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment. A B Online Supplementary Figure S2. AP1-binding site in the DLX1 promoter. Online Supplementary Figure S3. Diagram of the described interaction between FLT3 and DLX1. Online Supplementary Table S1. Primes sequences. Online Supplementary Table S2. DDCt values of normalized HOX gene expression in MV4; II cells after PKC412 treatment.
    [Show full text]