Oncogene (1999) 18, 2627 ± 2633 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc Analysis of the human proopiomelanocortin gene promoter in a small cell lung carcinoma cell line reveals an unusual role for E2F transcription factors

A Picon1, X Bertagna1 and Y de Keyzer*,1

1CNRS UPR 1524, Universite Rene Descartes, Institut Cochin de GeÂneÂtique MoleÂculaire (ICGM), CHU Cochin-Port Royal, Paris, France

The small cell lung carcinoma (SCLC) cell line DMS-79 lesser extent vasopressin (Abe et al., 1984; Baylin and has been used as a model for studying the molecular Mendelsohn, 1980; Gould et al., 1984). The ectopic mechanism underlying the ectopic ACTH syndrome. We ACTH syndrome is most frequently associated with previously showed that two domains of the human neuroendocrine tumors of the lung such as carcinoids Proopiomelanocortin (POMC) gene promoter were or small cell lung carcinoma (SCLC) and occurs in 9 ± speci®cally active in DMS-79 cells. The present study 18% of patients with Cushing's syndrome (Becker and focuses on the more distal one, Domain IV (7376/ Gazdar, 1984; Orth, 1995; Wajchenberg et al., 1994). 7417). DNaseI footprinting experiments identi®ed a The rapidly growing SCLCs usually display limited single binding site for DMS-79 cell proteins in this neuroendocrine properties, and those responsible for domain. Gel-shift and sequence analysis indicated that ectopic ACTH secretion contain only low to very low E2F proteins might bind this site. Indeed, proteins from levels of mRNA coding for proopiomelanocortin DMS-79 cells which bind this site (i) have in vitro DNA (POMC), the precursor to ACTH (de Keyzer et al., binding properties indistinguishable from those of E2F 1985, 1996). We investigated the mechanisms of proteins (ii) form, like E2F proteins, multiprotein POMC gene transcription in non-pituitary tumors, complexes which can be dissociated by sodium deox- using the SCLC cell line DMS-79 (Bertagna et al., ycholate and (iii) are recognized by antibodies directed 1978; Sorenson et al., 1981) as an in vitro model for the against E2F proteins. Further, we show that the rat study of the ectopic ACTH syndrome. POMC distal promoter domain contains a homologous The activity of the POMC gene promoter in the sequence which constitutes a natural mutant of the pituitary context has been extensively studied both in human POMC E2F binding site, since it does not bind the murine corticotroph cell line AtT-20 and in E2F. We show by transient transfection that this natural transgenic mice models (Hammer et al., 1990; mutant, in the context of the rat POMC promoter, is not Jeannotte et al., 1987; Tremblay et al., 1988). Multiple active in DMS-79 cells by contrast to the human POMC cis-regulatory elements have been identi®ed whose E2F binding site. We conclude that E2F binding is coordinate activities were required for POMC gene required for the activity of Domain IV in DMS-79 cells transcription (Therrien and Drouin, 1991). Two trans- and contributes to the expression of the POMC gene in acting factors exert important synergistic actions: SCLC. Further studies are required to elucidate the role CUTE (Corticotroph Upstream Transcription Ele- of E2F factors in POMC gene transcription in SCLC ment-binding protein), which belongs to the basic cells, but our results have identi®ed mechanisms di€erent helix ± loop ± helix family and Ptx1 (Pituitary homeo from those in pituitary corticotroph cells that are used by box 1) of the homeodomain family (Lamonerie et al., these SCLC tumor cells. 1996; Poulin et al., 1997; Therrien and Drouin, 1993). Our previous functional analysis of the human Keywords: Ectopic ACTH syndrome; SCLC; proopio- POMC gene promoter (Picon et al., 1995) showed melanocortin; gene expression regulation; E2F; DNA that the same (+21/7417) region conferred full binding proteins activity both in DMS-79 and in AtT-20 cells. However, two main di€erences were noted between the two cell lines: (i) the synergy between CUTE and Ptx1 was not observed in DMS-79 cells, and (ii) the Introduction sequence 7376/7417, designated Domain IV, was only active in DMS-79 cells. These results demon- Ectopic hormone secretion syndromes are intriguing strated that POMC gene transcription in DMS-79 cells situations where a bioactive hormone is produced by a was achieved through mechanisms distinct from those tumor arising outside the specialized endocrine gland. in the pituitary. Among the peptide hormones that are most frequently We have now investigated which trans-acting ectopically expressed are ACTH, calcitonin and, to a factor(s) interact with Domain IV sequence and may contribute to the aberrant activity of the POMC gene promoter in DMS-79 cells. We show that Domain IV can bind factors of the E2F family of transacting *Correspondence: Y de Keyzer, CHU Cochin, 3eÁ me e tage, 24 rue du factors, which are known for their role in the control Faubourg Saint-Jacques, 75014 Paris, France Received 21 August 1998; revised 23 November 1998; accepted 15 of cell proliferation and di€erentiation (Lam and La December 1998 Thangue, 1994). In addition, the presence of a binding Proopiomelanocortin transcription in SCLC APiconet al 2628 site for E2F is required for the activity of Domain IV large footprint was present in Domain IV, extending in DMS-79 cells. slightly downstream of the 7376 border.

The IVA site binds several proteins Results We performed gel-shift assays using IVA as a probe to characterize DMS-79 cell proteins that bound to the Identi®cation of the IVA binding site protected sequence. Three speci®c complexes were Among the four domains previously de®ned in the detected (Figure 2a, horizontal arrows) that could be human POMC gene promoter (Picon et al., 1995), competed for by an excess of IVA oligonucleotide but Domain IV (7376/7417) had the distinctive property not by a similar excess of an unrelated sequence. A of being active in DMS-79 cells but not in AtT-20 cells. fourth complex (ns) was observed in all experiments We explored the regions of this domain interacting but appeared to be nonspeci®c, since it was either with DMS-79 cell proteins by in vitro DNaseI una€ected or barely a€ected by any competitor or footprinting experiments (Figure 1a). With DNA treatment. fragment (7227/7417) on either the upper (Up) or To determine the core recognition sequence in site lower (Low) strand, DMS-79 cell protein extracts (D) IVA, we used a series of block-mutated oligonucleo- modi®ed the DNaseI digestion pattern when compared tides in gel-shift assays (Figure 2b). Several complexes to the free probe (f). Two regions, IIIB and IVA, formed with MUT1 and MUT2 probes (Figure 2c), but indicated by vertical lines, were detected on both none was competed by an excess of IVA oligonucleo- strands and had the typical features of protein tide. The absence of a IVA speci®c complex with these footprints: they were totally protected from DNaseI probes indicated that the block-mutation had disrupted digestion and delineated by hypersensitive sites. Sites their IVA binding site. By contrast, the MUT3 probe IIIB and IVA extended from 7312 to 7340 and from generated complexes with the same retardation pattern 7371 to 7403, respectively, in the human POMC as the IVA probe. These complexes were competed for gene promoter sequence (Figure 1b). Thus a single similarly by an excess of MUT3 and IVA oligonucleo- tides. Therefore, the region disrupted in the MUT3 probe was not important for binding of IVA speci®c factors. In agreement with these data, competitive binding assays showed that oligonucleotides MUT1 and MUT2 did not compete for IVA complex formation, in contrast to MUT3. The observation that all IVA speci®c complexes were a€ected equally by the various mutants IVA oligonucleotides suggested

Figure 1 Binding sites for DMS-79 cell proteins within region (7227/7417) of the human POMC gene promoter by DNaseI Figure 2 Gel-shift analysis of sequence IVA. (a) Gel-shift assays footprinting. (a) DNaseI footprinting analysis. Probes extending performed with DMS-79 cell extracts and the IVA probe. A 200- from 7227 to 7417 on the upper strand (Up) and lower strand fold molar excess of unlabeled oligonucleotide (competitor) was (Low) were used with DMS-79 cells extracts (D). Positions of the added when speci®ed. (b) Alignment of IVA and IVA mutant footprints are indicated by vertical bars and labels. M: A+G oligonucleotide sequences. Bold lowercase indicates that a chemical sequencing ladder (Maxam and Gilbert, 1980); f: free mutation has been introduced in the sequence. (c) Gel-shift probe. (b) DMS-79 cell DNaseI footprints identi®ed in (a) are assays performed with DMS-79 cell extracts and the probe shown as lines below the DNA sequence and labeled according to indicated at the top. A 200-fold molar excess of unlabeled their positions within the promoter (domains III and IV). The oligonucleotide (competitor) was added when speci®ed. Arrow: numbers indicate the position relative to the cap site speci®c complex; ns: nonspeci®c complex; f: free probe Proopiomelanocortin transcription in SCLC APiconet al 2629 that their formation was dependent on the same whereas E2FMUT, an E2F mutant oligonucleotide sequence motif and, therefore, that they all contained unable to bind E2F (Helin et al., 1992), had no e€ect an identical protein important for speci®c DNA on IVA proteins binding. In addition, the E2F probe binding or, closely related proteins. The ineffectiveness formed speci®c complexes with DMS-79 cell proteins of MUT1 and MUT2 indicated that the IVA binding that had the same apparent mobility as IVA complexes site motif is CCGCCAAAT, itself contained in a larger and were abolished by an excess of E2F or IVA symmetrical sequence: ATATTTACCGCCAAAT. oligonucleotides, but not by an unrelated sequence. Published work on the rat POMC gene promoter Thus, proteins present in DMS-79 cells were able to (Philips et al., 1997) and database search suggested that bind the E2F or the IVA probes in a similar fashion in this sequence might constitute a binding site for two vitro. distinct protein families. The IVA sequence containing To compare further IVA complexes to E2F the symmetrical site is highly homologous (20 of 22 bp) complexes, we used site-speci®c methylation of the to the rat POMC promoter element DE2A/B, which E2F oligonucleotide. Yee et al. (1987) demonstrated has been shown to bind in vitro translated Nur77 that methylation of cytosines within the E2F binding proteins and to represent a new binding site for this site with HhaI methylase inhibited E2F binding. Since family, called the NurRE (Philips et al., 1997) (Table the HhaI methylase recognition sequence is not present 1). The IVA binding site also has sequence homologies in the IVA sequence, we used mE2F, an E2F with binding sites for the E2F factors, since it is oligonucleotide with a HhaI-like methylated sequence, composed of a GC-rich core sequence ¯anked on both in competitive binding studies. In contrast to E2F sides by AT-rich stretches. oligonucleotide, mE2F oligonucleotide did not inhibit formation of IVA complexes (Figure 4), suggesting that, like E2F-binding proteins, the IVA-binding IVA complexes have DNA binding properties similar to proteins had no anity for this methylated E2F that of E2F sequence. We tested in competitive binding studies various E2F proteins can bind to DNA not only as dimers oligonucleotides known to bind Nur77 or E2F factors but also as complexes of higher order that can be (Figure 3). Several Nur binding oligonucleotides dissociated in the presence of DOC (Wong et al., (NBRE, COUP (Wilson et al., 1991) and hP-NBRE 1995). Treatment of DMS-79 cell extracts with DOC (Okabe et al., 1998)) had no e€ect on IVA complex abolished the slower migrating complexes (Figure 4), formation. In contrast, the E2F oligonucleotide (Helin indicating that these IVA protein-DNA complexes also et al., 1992) was as ecient as the IVA sequence itself, contained higher order complexes.

Table 1 Alignment of sequence IVA with both Nur RE and E2F binding site sequences NurRE TGATATTTACCTCCAAATGCCA IVA GACGGTGATATTTACCGCCAAATGCGAAC E2F ATTTAAGTTTCGCGCCCTTTCTCAA

Figure 4 E€ect of sequence methylation and of DOC treatment Figure 3 Competitive gel-shift analysis of sequence IVA. Gel- on the formation of IVA complexes. Gel-shift assays were shift assays were performed with DMS-79 cell extracts and the performed with DMS-79 cell extracts and probe IVA. A 100- IVA or E2F probe, as indicated at the top. A 200-fold molar fold molar excess of unlabeled competitor oligonucleotide was excess of unlabeled competitor oligonucleotide was added when added when speci®ed. DMS-79 cells extracts were treated with speci®ed. Arrow: speci®c complex; ns: nonspeci®c complex; f: free DOC when indicated. Arrow: speci®c complex; ns: nonspeci®c probe complex; f: free probe Proopiomelanocortin transcription in SCLC APiconet al 2630

Figure 5 Gel-shift analysis of in vitro translated chDP-1 and chE2F-1 binding to the IVA sequence. Gel-shift assays were performed with in vitro translated chDP-1 and chE2F-1 and probe IVA. A 200-fold molar excess of unlabeled competitor oligonucleotide was added when speci®ed. Arrow: speci®c Figure 6 Supershift analysis of IVA complexes. Gel-shift assays complex; ns: nonspeci®c complex; f: free probe were performed with DMS-79 cell extracts and the probe indicated at the top. Antibodies against E2F-4 or DP-1 were added when indicated. Arrow: speci®c complex; ns: nonspeci®c complex; f: free probe; star: supershifted complex caused by anti- In vitro translated DP-1 and E2F-1 proteins bind site E2F-4 antibodies; vertical bar: supershifted complexes caused by IVA anti-DP-1 antibodies To demonstrate that the IVA site is actually an E2F binding site, we performed gel-shift assays with in vitro transversion (G?T) in the center of the E2F binding translated chE2F-1 together with chDP-1, one of the site. A 200-fold excess of rIVA oligonucleotide had no usual partners of the E2F family of trans-acting factors e€ect on the formation of E2F complexes, like an (Loiseau et al., 1997), and the IVA probe. In vitro unrelated sequence, whereas a similar excess of either translated chDP-1 and chE2F-1 interacted with the E2F or IVA oligonucleotide completely abolished it IVA probe and formed a speci®c complex (Figure 5, (Figure 7a). Therefore, the rIVA sequence, although horizontal arrow) that was eciently competed for by highly homologous to the IVA sequence, was unable to an excess of unlabeled IVA or unlabeled E2F bind E2F proteins. oligonucleotide. The rIVA sequence was functionally analysed in DMS-79 cells by transient transfection. The alignment E2F-4 and DP-1 are part of the IVA complexes of rat and human sequences analysed in this assay is shown in Figure 7b. The rat POMC minimal promoter Antibodies against E2F-4 and DP-1 were used in (construct 1) was eightfold less active than the sequence supershift gel-shift assays to establish their presence in extending up to 7323 (construct 2, Figure 7c). IVA complexes. Addition of the anti E2F-4 antibodies Addition of the distal rat POMC gene promoter to the E2F probe gel-shift assay decreased the amount domain (up to 7480) did not increase activity in of the upper complex simultaneously with appearance DMS-79 cells (construct 3). In contrast, addition of of a supershifted complex (Figure 6, star). A super- Domain IV (construct 6) to human POMC promoter shifted complex of slower mobility (Figure 6, vertical Domains I ± III (construct 5), resulted in a ca. 1.3-fold bar) was also formed with the anti-DP-1 antibody and increase as previously described (Picon et al., 1995). the intensity of all IVA complexes was decreased. Thus, in the context of the rat POMC gene promoter, Similar e€ects were observed on complexes formed a sequence highly homologous to the IVA sequence with the IVA probe, demonstrating that the upper IVA that does not bind E2F proteins has no functional complex, at least, contained E2F-4 proteins and that activity in DMS-79 cells, suggesting that the activity of DP-1 proteins were present in all IVA complexes. Domain IV in DMS-79 cells is dependent on E2F Altogether, these results suggested that other E2F proteins binding. proteins (E2F-1, E2F-2, E2F-3 or E2F-5) were present in all IVA speci®c complexes. Discussion The rat POMC promoter is not a target for E2F The DMS-79 human SCLC cell line was taken here as As previously indicated, the IVA sequence is highly a model for the ectopic expression of the POMC gene, conserved in the rat POMC gene sequence. However, that is occasionally observed in highly proliferative the rat POMC gene promoter IVA (rIVA) sequence bronchial tumors such as SCLCs, and is responsible for constitutes a natural mutant, since it exhibits a the ectopic ACTH syndrome. Indeed, DMS-79 cells Proopiomelanocortin transcription in SCLC APiconet al 2631 domains of the human POMC gene promoter were active in DMS-79 cells: Domain II (795/7161) and Domain IV (7376/7417). The main contribution to POMC gene transcription was obtained with Domain II, but all the factors that bound to it in DMS-79 cells were also found in AtT-20 cells (A Picon, unpublished data). We therefore focused on Domain IV where only one footprint was observed. Gel-shift assays with the IVA oligonucleotide and nested oligonucleotides (7357/7382), (7367/7394), (7384/7412), (7396/ 7422), spanning the whole domain, identi®ed the same IVA site as a single binding site for DMS-79 cell proteins. ATATTTACCGCCAAAT was de®ned as the binding motif which potentially binds two distinct protein families. The Nurr1/Nur77 subgroup which belongs to the nuclear receptor superfamily contains at least three members. These factors were shown to participate in the activity of the POMC gene promoter (Murphy and Conneely, 1997; Okabe et al., 1998; Philips et al., 1997). Particularly, Philips et al. (1997) described in the distal part of the rat POMC gene promoter an element, called the Nur Response Element (NurRE), that is bound by dimers of in vitro translated Nur77 proteins and mediates transactivation by Nur77. The distinct Nur proteins are believed to bind as monomers or dimers to the NurRE, so several speci®c complexes with the same binding speci®city could be expected, consistent with the gel-shift pattern observed with the IVA probe. The second candidate is the E2F family, which plays an important role in growth regulatory processes by Figure 7 Comparative analysis of the IVA sequence and its controlling numerous cell cycle regulated promoters related sequence in rat POMC gene promoter. (a) Gel-shift assays (for a review see Slansky and Farnham, 1996). E2F performed with DMS-79 cells extracts and probe E2F. A 200-fold binding units are heterodimers composed of an E2F molar excess of unlabeled competitor oligonucleotide was added when speci®ed. Arrow: speci®c complex; ns: nonspeci®c complex; subunit and a DP subunit. There are at least ®ve f: free probe. (b) Sequence alignment of rat (italic) and human distinct E2F proteins and three DP proteins, and E2F distal POMC gene promoter domains. Sequence of the E2F dimers are also known to bind DNA as multiprotein binding site and its related sequence in the rat promoter are complexes (Slansky and Farnham, 1996). Thus, the underlined. Bold lowercase letters point to the nucleotide mismatch. Numbers indicate the position relative to the cap interactions between E2F factors and the IVA site site. The dashes indicate sequence homologies. (c) Functional 5'- could also result in a multiple band gel-shift pattern deletion analysis of rat and human POMC gene promoters in like that obtained with DMS-79 cell proteins. DMS-79 cells. 5'-deletion mutants of the rat POMC gene Competitive binding studies showed that Nur promoter (Therrien and Drouin, 1991) were tested in constructs proteins were not part of the IVA complexes. Gel- 1 ± 3 whereas 5'-deletion mutants of the human POMC gene promoter were tested in constructs 4 ± 6. Part of the exon and shift studies with antibodies to Nur proteins, the high- promoter domains are depicted as hatched and open boxes, anity NBRE binding site (Wilson et al., 1991) and respectively. The arrow indicates the position of the cap site and DMS-79 cell proteins showed there was little or no the numbers indicate the position relative to the cap site. The Nurr1/Nur77 proteins in DMS-79 cell extracts, activity is plotted relative to that of the minimal construct although the same experiments detected these proteins (constructs 1 or 4). The data represent the means+s.e.m. (n=6). The luciferase activity is normalized with that of an internal in both mouse AtT-20 and human HeLa cell lines (A control plasmid, RSV ± CAT Picon, unpublished data). In contrast, we demonstrated not only that in vitro translated E2F proteins bound to the IVA sequence, but also that E2F proteins were part of each DMS-79 cell IVA-speci®c complex on the basis have many of the abnormal features of POMC gene of binding, biochemical (DOC) and immunological expression detected in such tumors: (i) very low level of (supershift) evidences. POMC mRNA; (ii) greatly reduced or altered Transactivation via E2F binding sites has been processing of the precursor protein (Bertagna et al., demonstrated in the promoters of N-myc,c-myc, cdc- 1978) and (iii) constitutive secretion of POMC peptides 2 and IGF-1 genes (for a review see Slansky and that does not respond to either glucocorticoid Farnham, 1996). Thus, it was possible that E2F inhibition (Gaitan et al., 1995) or activation of the binding between 7381 and 7394 also induced the cAMP pathway (A Picon, unpublished data). activity of the POMC gene promoter in SCLC cells. Our previous studies demonstrated that POMC gene Despite high sequence homologies between the distal transcription in DMS-79 cells was achieved through a rat POMC gene promoter domain and the IVA site, mechanism distinct from that occurring in the pituitary the rat POMC gene sequence did not bind E2F since the synergy between CUTE and Ptx1 did not proteins, thus constituting a natural mutant of the occur in DMS-79 cells (Picon et al., 1995). Two human POMC E2F binding site. In contrast to the Proopiomelanocortin transcription in SCLC APiconet al 2632 human IVA site, addition of rIVA sequence (7323/ 1995)), TATGGTGTCAAAGGTCAAACTTCT (COUP 7480) to the remaining rat POMC promoter did not from the chicken ovalbumin upstream promoter, (Therrien increase activity, suggesting that an ecient E2F and Drouin, 1991)), ATTTAAGTTTCGCGCCCTTTCT- binding site is required for the activity of distal CAA (E2F consensus, (Helin et al., 1992)) and ATT- POMC gene promoter sequences in DMS-79 cells. TAAGTTTCGATCCCTTTCTCAA (E2F MUT, a mutant of the E2F consensus sequence, (Helin et al., 1992)). For Therefore, it is tempting to speculate that the sequence interference by methylation, a double-stranded E2F oligonu- di€erence between the human and rat IVA binding cleotide containing a Hhal methylation pattern (mE2F) was sites renders the human POMC gene promoter constructed by annealing two oligonucleotides, each contain- sensitive to E2F proteins in tumor cells that can form ing one 5-methyl-2'-deoxycytidine (5-Me-dC) with the active E2F complexes. However, additional studies are following sequences: ATTTAAGTTTCG(5-Me-dC)GCCCT- needed to con®rm the lack of activity of Domain IV TTCTCAA and TTGAGAAAGGG(5-Me-dC)GCGAAA- mutants in which the E2F binding site is inactivated. CTTAAAT. E2F is part of a pathway that is involved in the control of cell proliferation and di€erentiation and is regulated at di€erent levels by cyclins and their Cells and whole-cell protein extracts dependent kinases. E2F is the direct target of DMS-79 cells were grown as previously described (Picon et retinoblastoma protein (pRB) and related proteins, al., 1995). Whole-cell microextracts were prepared essentially which block the transactivating activity of E2F factor as described (Helin et al., 1993), with slight modi®cations. by interacting with it, but without a€ecting its DNA 26107 cells were collected by centrifugation with PBS. Cells binding ability (for a review see Lam and La Thangue, were washed twice in PBS and resuspended at 48Cin20mM 1994). Inactivation of the Rb gene, believed to be a key HEPES (pH 7.6), 100 mM NaCl, 1.5 mM MgCl2, 0.2 mM step in tumorigenesis, is particularly frequent in EDTA, 25% glycerol, 0.5 mM DTT, 5 mg/ml aprotinin, SCLCs; 80 ± 90% of these tumors do not express a 0.5 mg/ml leupeptin, 5 mg/ml pepstatin, 0.5 mM PMSF. functional pRB (Harbour et al., 1988; Helin et al., This suspension was adjusted to 300 mM NaCl, submitted to three freeze/thaw cycles and incubated on ice for 20 min. 1997). Rygaard et al. (1990) established by RNA and Cellular protein extracts were obtained after centrifugation protein blotting analysis that Rb gene products are for 15 min at 12 000 g and stored at 7808C. undetectable in DMS-79 cells. Disruption of regulation Whole-cell extracts were prepared from 1.5 ± 26108 cells of the E2F pathway might explain the aberrant activity by the same method, except that proteins were precipitated

of Domain IV in DMS-79 cells. This domain accounts by addition of (NH4)2SO4 to 45% saturation. Proteins were for 25 ± 30% of POMC promoter activity in transfected then suspended in dialysis bu€er containing 20 mM HEPES DMS-79 cells and E2F is clearly not the sole (pH 8.0), 0.2 mM EDTA, 0.2 mM EGTA, 25% glycerol, determinant of POMC gene transcription in these 60 mM KCl, 0.5 mM DTT, 5 mg/ml aprotinin, 0.5 mg/ml leupeptin, 5 mg/ml pepstatin, 0.5 mM PMSF and (NH ) SO cells. It is possible that general neuroendocrine factors, 4 2 4 such as those binding in Domain II, provide a basal was eliminated by dialysis twice for 2 h against 250 volumes. After centrifugation 5 min at 12 000 g, the supernatant activity, further enhanced in those tumoral cells with containing the proteins was stored at 7808C. Protein inactivated pRB and active E2F. Whether or not E2F concentrations were determined with the protein bioassay factor is a key component of POMC gene expression in kit (Bio-Rad Laboratories, Richmond, CA, USA). these tumor cells, the presence of activated E2F complexes satis®es at least one condition for aberrant POMC gene expression. Because of the additional DNaseI footprinting assays frequent lack of pRB control in SCLCs, one might expect frequent expression of the POMC gene in this The plasmid carrying the human POMC gene promoter region (+121/7417) was linearized with the appropriate tumor type. In fact since ectopic ACTH production restriction enzyme and labeled with DNA polymerase I large associated with SCLCs may cause only mild hypoka- fragment and a32P-dNTP (Sambrook et al., 1989). The probe lemia and occurs in patients with rapidly progressive was released by a second restriction enzyme and puri®ed on a cancer, it is estimated to represent the most under- 5% polyacrylamide gel. 26104 c.p.m. of probe were diagnosed form of Cushing's syndrome, accounting for incubated with 60 mg of whole-cell extract in 16 mlof1mM as much as three-quarters of all cases of ectopic ACTH HEPES (pH 8.0), 0.1 mM EDTA, 50 mM NaCl, 50 mM KCl,

secretion (Orth, 1995). It will be interesting to 5mM MgCl2,, 18% glycerol, 1 mM DTT and 125 ng poly (dI- determine if loss of pRB function is associated with dC). The reaction mixtures were preincubated for 15 min on ice, then adjusted to 2.5 m CaCl and further incubated for POMC gene expression in these tumors. M 2 1 min at 258C before addition of 1 ml of DNaseI dilutions selected to produce an even pattern of digestion products. After 1 min at 258C the reactions were stopped with 10 mM Materials and methods EDTA and 0.1% SDS. Proteins were digested for 30 min at 428C with proteinase K (150 mg/ml), and DNaseI digestion Plasmids and oligonucleotides products were separated on 8% polyacrylamide/7 M urea sequencing gels. Plasmids 417hPOLU, 376hPOLU and 39hPOLU were previously described (Picon et al., 1995). Oligonucleotides used for gel-shift analysis are shown in Figure 2b or have the following sequences: GGGGTAGGAACCAATGAAAT- In vitro transcription and translation GAAAGGTTA (NFY from the rat albumin gene promoter, 0.5 mg of chicken DP-1 (chDP-1) or chicken E2F-1 (chE2F-1) (Raymondjean et al., 1988)), CGGGAAGGTCAAAGTCC- plasmids (Loiseau et al., 1997) were simultaneously CGCGCCCA (hP-NBRE, human POMC sequence from 747 transcribed and translated with [35S]methionine using the to 771), GAGTTTTAAAAGGTCATGCTCAATTT (NBRE TNT kit (PROMEGA) according to the supplier recommen- consensus, (Wilson et al., 1991)), GATCAAAGTCAGGTCA- dations. The eciency of the reactions was checked on 8% CAGTCACCTGATCAAAGTT (ERE, (Hedvat and Irving, SDS ± PAGE gels. Proopiomelanocortin transcription in SCLC APiconet al 2633 Gel-shift assays Transfection and enzymatic assays Double stranded oligonucleotides were 5' end-labeled with T4 Electroporation, cell extracts, luciferase and CAT assays were polynucleotide kinase and g32P-ATP (Sambrook et al., 1989) performed as previously described (Picon et al., 1995). to a speci®c activity of ca.108 c.p.m./mg. Five fmoles of probes were incubated with either 5 mg of whole-cell microextracts or 1 mlofin vitro translation reaction mixture for 10 min at 48Cin20mlof10mM HEPES (pH 8.0),

0.1 mM EDTA, 50 mM NaCl, 50 mM KCl, 5 mM MgCl2 18% glycerol, 100 mg/ml bovine serum albumin and 1 mg poly (dA- dT). For competitive binding experiments, the probe and competitor were mixed prior to the addition of proteins. For supershift experiments, antibodies against DP-1 and E2F-4 Acknowledgements (Santa Cruz Biotechnology, ref. K-20 and C-108, respec- We are indebted to Dr GD Sorenson and Dr O Pettengill tively) were preincubated with the extracts for 1 h on ice for having provided us with the DMS-79 cell line. We wish prior to probe addition. The samples were separated on 5% to thank Drs DN Orth for his valuable comments on the polyacrylamide gels bu€ered with 0.56TBE. manuscript and M Raymondjean for helpful discussions and comments. We thank Dr J Drouin for rat POMC plasmidsandDrsGBrunandLLoiseauforchDP-1and Sodium deoxycholate treatment chE2F-1 plasmids. This work was supported in part by Whole-cell microextracts were treated for 20 min with 0.8% INSERM CJF92-08 and the Association pour la Recherche sodium deoxycholate (DOC) and then for 10 min with NP-40 Contre le Cancer, (contract 6501 to YdK). A Picon is the 1.5% before addition of the DNA-binding reaction mixture recipient of a doctoral fellowship of the Association pour as previously described (Wong et al., 1995). la Recherche Contre le Cancer.

References

Abe K, Kameya T, Yamaguchi K, Kikuchi K, Adachi I, Maxam AM and Gilbert W. (1980). Methods Enzymol., 65, Tanaka M, Kimura S, Kodama T, Shimosato Y and 499 ± 560. Ishikawa S. (1984). In: The endocrine lung in health and Murphy EP and Conneely OM. (1997). Mol. Endocrinol., 11, disease. WB Saunders Company: New York, pp. 549 ± 39 ± 47. 595. Okabe T, Takayanagi R, Adachi M, Imasaki K and Nawata Baylin SB and Mendelsohn G. (1980). Endocr. Rev., 1, 45 ± H. (1998). J. Endocrinol., 156, 169 ± 175. 77. Orth DN. (1995). N. Engl. J. Med., 332, 791 ± 803. Becker KL and Gazdar AF. (1984). In: The endocrine lung in Philips A, Lesage S, Gingras R, Maira M-H, Gauthier Y, health and disease. WB Saunders Company. Hugo P and Drouin J. (1997). Mol. Cell. Biol., 17, 5946 ± Bertagna X, Nicholson WE, Sorenson GD, Pettengill OS, 5951. Mount CD and Orth DN. (1978). Proc. Natl. Acad. Sci. Picon A, Leblond-Francillard M, Ran-Sanson M-L, Lenne USA, 75, 5160 ± 5164. F, Bertagna X and de Keyzer Y. (1995). J. Mol. Endo., 15, de Keyzer Y, Bertagna X, Lenne F, Girard F, Luton J-P and 187 ± 194. Kahn A. (1985). J. Clin. Invest., 76, 1892 ± 1898. Poulin G, Turgeon B and Drouin J. (1997). Mol. Cell. Biol., de Keyzer Y, Vieau D, Picon A and Bertagna X. (1996). 17, 6673 ± 6682. Endocr. Rel. Cancer, 3, 99 ± 112. Raymondjean M, Cereghini S and Yaniv M. (1988). Proc. Gaitan D, DeBold CR, Turney MK, Zhou P, Orth DN and Natl. Acad. Sci. USA, 85, 757 ± 761. Kovacs WJ. (1995). Mol. Endocrinol., 9, 1193 ± 1201. Rygaard K, Sorenson GD, Pettengill OS, Cate CC and Gould VE, Warren WH and Memoli VA. (1984). In: The Spang-Thomsen M. (1990). Cancer Res., 50, 5312 ± 5317. endocrine lung in health and disease.BeckerKLand Sambrook J, Fritsch EF and Maniatis T. (1989). In: Gazdar AF (eds). WB Saunders Company: New York, Molecular cloning: A laboratory manual. Cold Spring pp. 406 ± 445. Harbor: Cold Spring Harbor Laboratory Press. Hammer GD, Fairchild-Huntress V and Low MJ. (1990). Slansky JE and Farnham PJ. (1996). Curr. Top. Microbiol. Mol. Endocrinol., 4, 1689 ± 1697. Immunol., 208, 1±30. HarbourJW,LaiS-L,Whang-PengJ,GazdarAF,MinnaJD Sorenson GD, Pettengill OS, Brinck-Johnsen T, Cate CC and Kaye FJ. (1988). Science, 241, 353 ± 357. and Maurer LH. (1981). Cancer, 47, 1289 ± 1296. Hedvat CV and Irving SG. (1995). Mol. Endocrinol., 9, Therrien M and Drouin J. (1991). Mol. Cell. Biol., 11, 3492 ± 1692 ± 1700. 3503. Helin K, Lees JA, Vidal M, Dyson N, Harlow E and Fattaey Therrien M and Drouin J. (1993). Mol. Cell. Biol., 13, 2342 ± A. (1992). Cell, 70, 337 ± 350. 2353. Helin K, Wu C-L, Fattaey AR, Lees JA, Dynlacht BD, Tremblay Y, Tretjako€ I, Peterson A, Antakly T, Zhang CX Ngwu C and Harlow E. (1993). Genes Dev., 7, 1850 ± 1861. and Drouin J. (1988). Proc. Natl. Acad. Sci. USA, 85, Helin K, Holm K, Niebuhr A, Eiberg H, Tommerup N, 8890 ± 8894. Hougaard S, Skovgaard Poulsen H, Spang-Thomsen M Wajchenberg BL, Mendonca BB, Liberman B, Albergaria- and Norgaard P. (1997). Proc. Natl. Acad. Sci. USA, 94, Pereira MA, Carneiro PC, Wakamatsu A and Kirschner 6933 ± 6938. MA. (1994). Endocr. Rev., 15, 752 ± 787. Jeannotte L, Tri®ro MA, Plante RK, Chamberland M and Wilson TE, Fahrner TJ, Johnston M and Milbrandt J. Drouin J. (1987). Mol. Cell. Biol., 7, 4058 ± 4064. (1991). Science, 252, 1296 ± 1300. Lam EW-F and La Thangue NB. (1994). Curr. Opin. Cell. Wong K-K, Zou X, Merrell KT, Patel AJ, Marcu KB, Biol., 6, 859 ± 866. Chellapan S and Calame K. (1995). Mol. Cell. Biol., 15, Lamonerie T, Tremblay JJ, Lanctoà t C, Therrien M, Gauthier 6535 ± 6544. Y and Drouin J. (1996). Genes Dev., 10, 1284 ± 1295. Yee AS, Reichel R, Kovesdi I and Nevins JR. (1987). EMBO Loiseau L, Pasteau S and Brun G. (1997). Gene Expr., 6, J., 6, 2061 ± 2068. 259 ± 273.