Myasthenia Gravis Patients Human Thymus and Thymomas from And

Home , Calcitonin, Thymus hyperplasia

Functional Expression of Receptors for Calcitonin Gene-Related Peptide, Calcitonin, and Vasoactive Intestinal Peptide in the Human Thymus and Thymomas from This information is current as Myasthenia Gravis Patients of September 29, 2021. J.-C. Marie, A. Wakkach, A.-M. Coudray, E. Chastre, S. Berrih-Aknin and C. Gespach J Immunol 1999; 162:2103-2112; ; http://www.jimmunol.org/content/162/4/2103 Downloaded from

References This article cites 57 articles, 18 of which you can access for free at:

http://www.jimmunol.org/content/162/4/2103.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Functional Expression of Receptors for Calcitonin Gene-Related Peptide, Calcitonin, and Vasoactive Intestinal Peptide in the Human Thymus and Thymomas from Myasthenia Gravis Patients1

J.-C. Marie,2,3* A. Wakkach,2† A.-M. Coudray,* E. Chastre,* S. Berrih-Aknin,† and C. Gespach4*

The molecular and functional expression of serpentine membrane receptors for vasoactive intestinal peptide (VIP), calcitonin gene-related peptide (CGRP), and calcitonin (CT) were characterized in human thymus and thymomas from myasthenia gravis

(MG) patients and thymic epithelial cells either in primary culture (PTEC) or transformed by the siman virus 40 large T (SV40LT) Downloaded from oncogene (LT-TEC). Using RT-PCR combined with Southern analysis, we identiﬁed the PCR products corresponding to the receptor (-R) transcripts for VIP, CGRP, and CT in thymus from control subjects and MG patients with either hyperplasia or thymoma. Similar expressions of the VIP- and CGRP-R transcripts were observed in PTEC, whereas the CT-R message was not detected. In LT-TEC, the signals for VIP-R, CGRP-R, and CT-R transcripts were seen with a lower intensity than those in control and MG thymus. In agreement with our molecular analysis, 1) VIP was the most potent peptide among VIP-related peptides

(VIP > PACAP > PHM > PHV) to stimulate cAMP production through speciﬁc type 1 VIP receptors in both PTEC and LT-TEC; http://www.jimmunol.org/ 2) cAMP generation was induced by CGRP in PTEC and by CT in LT-TEC; 3) in frozen thymic sections and by ﬂow cytometry, type 1 VIP-R, CGRP-R, and CT-R were localized in epithelial cells; and 4) in parallel, the transcription of the acetylcholine receptor ␣ subunit (the main autoantigen in MG) was induced by CGRP and CT in PTEC and LT-TEC, respectively. Our data suggest that the neuroendocrine peptides VIP, CGRP, and CT may exert functional roles during MG and malignant transformation of the human thymus. The Journal of Immunology, 1999, 162: 2103–2112.

he thymus is an essential organ in the differentiation and ment through the release of cytokines and inhibition of stromal maturation of lymphoid precursor cells into mature T epithelial cell proliferation (10). by guest on September 29, 2021 T lymphocytes (1–4). These precursors, derived from bone The cellular heterogeneity of the thymus and the cross-talk be- marrow stem cells, are subjected to positive and negative selec- tween the different cell types constitute the main limit in under- tions by thymic stromal cells, including dendritic cells, macro- standing the physiology and pathophysiology of the thymus. phages, and epithelial cells (5–7). In this context, thymic epithelial Pathological thymi, including thymic hyperplasia and thymoma, cells have been shown to protect thymocytes from apoptosis (8) are frequently found in myasthenia gravis (MG),5 and MG patients and to promote the maturation of the double-positive (CD4ϩ and ϩ ϩ Ϫ are improved after thymectomy (11). Autosensitization to acetyl- CD8 ) thymocytes into single-positive cells CD4 CD8 , choline receptors (AChR), which is the main autoantigen impli- CD4ϪCD8ϩ (9). In turn, thymocytes also modulate their environ- cated in MG, is thought to take place in the thymus (12). AChR ␣ subunit (␣-AChR) transcripts have been shown to be up-regulated by the neuropeptide calcitonin gene-related peptide (CGRP) in *Institut National de la Santeét de la Recherche Me´dicale, Unit 482, Signalisation et chicken myocytes in primary culture (13). Thus, such an effect Fonctions Cellulaires, Applications au Diabe`te et aux Cancers Digestifs, Hoˆpital Saint-Antoine, Paris, France; and †Laboratoire d’Immunologie, Centre National de la occurring in the thymus would represent an important neuroendo- Recherche Scientifique-Unite´Propre de Recherche et de l’Enseignement Supe´rieur crine control in MG and thymic neoplasia. CGRP is a 37-amino Associeé, Hoˆpital Marie Lannelongue, Le Plessis-Robinson, France acid peptide generated by tissue-specific alternative processing of Received for publication February 23, 1998. Accepted for publication November the calcitonin/CGRP gene transcript in central and peripheral neu- 30, 1998. rons (14, 15). Several neuroendocrine peptides, such as vasoactive The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance intestinal peptide (VIP), are also involved in the regulation of im- with 18 U.S.C. Section 1734 solely to indicate this fact. mune responses (16, 17). VIP is a 28-amino acid neuropeptide 1 This work was supported by the Institut National de la Santeét de la Recherche Me´dicale, the Centre National de la Recherche Scientifique, and research grants from Association Française contre les Myopathies, la Ligue Contre le Cancer, and Caisse Nationale d’Assurance Maladie des Travailleurs Salarie´s. 2 J.-C.M. and A.W. contributed equally. 5 Abbreviations used in this paper: MG, myasthenia gravis; AChR, acetylcholine receptors; ␣-AChR, ␣ subunit of AChR; CGRP, calcitonin gene-related peptide; VIP, 3 Current address: Laboratoire de Physiopathologie de la Nutrition, Centre National vasoactive intestinal polypeptide; PACAP-38, pituitary adenylate cyclase-activating de la Recherche Scientifique et de l’Enseignement Supe´rieur Associeé 7059, Univer- polypeptide; CT, calcitonin; PTEC, thymic epithelial cells in primary culture; LT- site´Paris 7, 75251 Paris Cedex 05, France. TEC, thymic epithelial cells transformed by the simian virus 40 large T oncogene; 4 Address correspondence and reprint requests to Dr. C. Gespach, Institut National de PHM, peptide with NH2-terminal histidine and C-terminal methionine; PHV, peptide la Santeét de la Recherche Me´dicale, Unit 482, Signalisation et Fonctions Cellulaires, with NH2-terminal histidine and C-terminal valine; TGLP-1, truncated glucagon-like Applications au Diabe`te et aux Cancers Digestifs, Hoˆpital Saint-Antoine, 75571 Paris peptide-1; IAPP, islet amyloid polypeptide; pAbs, polyclonal Abs; RAMPS, receptor Cedex 12, France. E-mail address: [email protected] activity-modifying proteins; RCP, receptor component protein.

structurally related to glucagon, pituitary adenylate cyclase-acti- software. The percentage of contaminating macrophages in thymic epithe- vating peptide (PACAP), and secretin (18). These regulatory pep- lial cell cultures was determined using anti-HLA-DR Abs (Dako, Trappes, tides exert their biological activities through activation of specific France). Most contaminant fibroblasts were eliminated by selective trypsinization. They represent Ͻ10% of the total cell population as as- membrane receptors (19). These receptors have seven transmem- sessed by FACS analysis using anti-collagen III Ab (ICN, Costa Mesa, brane domains and are positively coupled to adenylyl cyclase. Sub- CA). The thymic epithelial cell population (at least 90% enriched), ob- types of VIP and CGRP/calcitonin (CT) receptors were identified tained after selective resistance to trypsin, was then used for PTEC culture on the basis of pharmacological and molecular analysis. VIP- and and SV40-LT transformation (see below). To obtain evidence of VIP-R expression in PTEC and LT-TEC1 cells in CGRP-immunoreactive fibers were identified in the thymus, and culture, we used the rabbit polyclonal Ab (pAb) A directed against the first both neuropeptides were reported to inhibit IL-2 production and extracellular loop of this serpentine receptor (26) at a dilution of 1/100 in proliferation of thymocytes in vitro (20–22). Further, VIP has been PBS. Primary and SV40-LT-transformed thymic cells were then washed, shown to rescue the immature double-positive CD4ϩCD8ϩ thy- incubated with goat anti-rabbit bound to tetramethylrhodamine isothiocya- mocytes from the glucocorticoid-induced apoptosis (23, 24). Thus, nate (Immunotech, Marseille, France), and washed twice in PBS. To our knowledge, there is no available CGRP-R or CT-R Ab. We it can be postulated that VIP exerts its protective effects against therefore biotinylated the CGRP and CT peptides according to the immu- apoptosis in thymocytes through an indirect action on thymic ep- noprobe biotinylation kit, as described by the manufacturer (Sigma, Saint- ithelial cells. Quentin Fallavier, France). Biotinylated CGRP or CT was incubated for 60 In the current hypotheses that neuroendocrine peptides exert a min with PTEC and LT-TEC1 cells, then unbound probe was eliminated by three washes, and fluorescence was revealed by avidin-phycoerythrin (Im- regulatory role on the development of the thymus and its immune munotech). After three additional washes, thymic cells were analyzed by function, our aim was to characterize the molecular and functional flow cytometry. expression of VIP and CGRP/CT receptors in human thymus un- Downloaded from der physiological and physiopathologic conditions. We, therefore, Histochemistry on frozen thymic sections investigated 1) the expression of the genes encoding VIP-R, The expression of the type 1 VIP-R in normal human thymus was inves- CGRP-R, and the closely related CT-R in human thymus from tigated by immunohistochemistry, using rabbit pAbs A and B directed controls and MG patients (hyperplasia and thymomas) as well as in against the first extracellular and the intracellular loops, respectively, of the thymic epithelial cells either in primary culture (PTEC) or trans- transmembrane receptor (26) at a dilution of 1/100 in PBS. Briefly, thymic sections were fixed with 4% paraformaldehyde for 10 min, incubated for 60 formed by the SV40LT oncogene (LT-TEC); 2) the functional ex- http://www.jimmunol.org/ min with the primary type 1 VIP-R pAbs, washed three times and then pression and pharmacological properties of VIP-R, CGRP-R, and revealed by goat anti-rabbit bound to tetramethylrhodamine isothiocyanate, CT-R in PTEC and LT-TEC cultures regarding cAMP generation as described above. Double labeling with anti-keratin Abs (a mix of mAbs and regulation of the transcripts encoding the ␣-AChR. CK1 and MNF116) revealed by goat anti-mouse Igs coupled to fluorescein (Silenius, Eurobio, Les Ulis, France) was performed to visualize the epithelial network in the thymus. Controls were performed by omitting the primary Abs. Materials and Methods The expression of CGRP-R and CT-R was analyzed on normal human Materials frozen thymic sections using the corresponding biotinylated peptides as described above. Briefly, histochemistry was performed by incubating All peptides used, human PACAP-38, human peptides with NH2-terminal paraformaldehyde-fixed thymic sections with the probes overnight in the by guest on September 29, 2021 histidine and C-terminal methionine (PHM) or C-terminal valine (PHV), presence of the protease inhibitors aprotinin, pepstatin, and PMSF (Sigma, pancreatic glucagon, human truncated glucagon-like peptide-1 (TGLP-1), France). The sections were then incubated with streptavidin coupled to and islet amyloid polypeptide (IAPP), were of synthetic origin (Peninsula Texas Red (Amersham). Double staining with anti-keratin Abs was per- Laboratories, Merseyside, U.K.), except for VIP, which was isolated from formed as described above. Controls were performed by omitting the bi- pig upper intestine (Laboratory of Prof. V. Mutt, Karolinska Institute, otinylated peptides. Stockholm, Sweden). Adenosine 3Ј,5Ј-cyclic phosphoric acid, 2Ј-O-succi- nyl 3-[125I]iodotyrosine methyl ester (sp. act., 74 TBq/mmol) was obtained from Amersham International (Orsay, France). All other chemicals used Transformation of thymic epithelial cells by the SV40LT were of reagent grade. oncogene

6 Thymic tissues Thymic epithelial cells (4 ϫ 10 cells) were harvested by trypsinization; washed in a solution containing 10 mM Na2HPO4/NaH2PO4, 250 mM Fresh samples of thymus were obtained from patients undergoing correc- sucrose, and 1 mM MgCl2 (pH 7.45); and incubated for 10 min at 4°C in tive cardiovascular surgery (age range, 2 mo to 27 yr) or from patients the same buffer in the presence of the pMK16 plasmid (10 ␮g/ml) recom- undergoing therapeutic total thymectomy for MG (age range, 15–50 yr) at bined with the origin-defective mutant of the SV40 (27). Cells were tran- Hoˆpital Marie Lannelongue (Le Plessis Robinson, France). A fragment of siently permeabilized by eight square electric pulses generated by an elec- each specimen was flash-frozen in liquid nitrogen and then either stored at tropulsator (100 ␮s, 1350 V/cm, 1 Hz; Bioblock, Rungis, France) as Ϫ80°C in RNase-free conditions and/or prepared for propagation in pri- previously described (28, 29). After 3 wk in culture, four independent mary culture. proliferative clones of epithelial cells were isolated using cloning rings and amplified. The resulting SV40LT-transformed cell lines were designated Cell culture LT-TEC1 to LT-TEC4 and were cryopreserved. The expression of the SV40LT oncogene in LT-TEC was checked by Northern blot (28, 29) and PTEC were established as previously described (25). Briefly, small frag- immunofluorescence, using a mAb against the viral antigen (dilution, 1/10; ments of thymic tissue (1 mm3) were washed in RPMI 1640 (Life Tech- PharMingen, San Diego, CA) and revealed with an anti-mouse IgG cou- nologies, Cergy-Pontoise, France) and transferred into 75-cm2 culture pled to fluorescein (Eurobio). dishes in culture medium supplemented with 20% horse serum (Boehringer Mannheim, Mannheim, Germany), 0.2% Ultroser (Life Technologies), 2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin. Ex- Expression of VIP-R, CGRP-R, and CT-R genes by RT-PCR and plant cultures were maintained at 37°C in a humidified atmosphere con- Southern blot

taining 5% CO2 for 8–12 days. Thereafter, the confluent monolayers were passaged using trypsin-EDTA treatment (Life Technologies). Total RNA was isolated by guanidinium isothiocyanate extraction and ce- sium chloride density gradient ultracentrifugation. RNA samples (5 ␮g) Flow cytometric analysis were reverse transcribed for 60 min at 37°C, using 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies). The The epithelial nature of the thymic cell cultures was established by flow cDNAs (0.5–2 ␮g) were diluted in 25 ␮l of 20 mM Tris-HCl buffer (pH ␮ cytometry using a mix of MNF116 and CK-1 anti-keratin Abs (Dako, 8.5) containing 16 mM (NH4)2SO4, 2.5 mM MgCl2, 150 g/ml BSA, 12.5 Copenhagen, Denmark) on fixed (2% paraformaldehyde) and permeabil- pmol of each primer, 100 ␮M of each deoxyribonucleotide triphosphate, ized cells (0.1% saponin). Flow cytometry was performed on a FACScali- and 1.25 U of Bio-Taq polymerase (Bioprobe Systems, Montreuil sous bur flow cytometer (Becton Dickinson, Grenoble, France), using CellQuest Bois, France). The Journal of Immunology 2105

FIGURE 1. Immunocytochemical characterization of PTEC by ﬂow cytometry. The epithelial nature of the PTEC is evidenced using a pool of anti-cytokeratin Abs (MNF116 and CK-1). Contaminating cells are ﬁbro- blasts stained with the anti-type III collagen Ab (Ͻ8%) and macrophages stained with the HLA-DR Ab (Ͻ2%).

The amplification of the CGRP-R and CT-R cDNA (30, 31), respec- as previously described (35). Briefly, the subconfluent cells in culture (10– tively, consisted of 30 and 40 cycles of denaturation for 1 min at 92°C, 25 ϫ 104 cells/well) were preincubated for 10 min at 20°C in 0.9 ml of annealing for 30 s at 53 and 58°C, and a 1-min extension at 72°C in an Krebs-Ringer phosphate buffer (pH 7.5) containing 1 mM isobutylmeth- automated thermal cycler (PHC-3; Techne, Osi, Paris, France). The reac- ylxanthine as a phosphodiesterase inhibitor, and 2% BSA (w/v). Thereaf- tion was initiated by a 5-min incubation at 94°C and was ended after a ter, 0.1 ml of the same buffer containing the peptides at different concen- 7-min extension at 72°C. For Southern analysis, PCR products were re- trations was added, and the cultured cells were incubated for an additional solved on a 1.5% agarose gel stained with ethidium bromide, transferred to 60 min. The cAMP produced was then quantitated by RIA (28). For each Hybond Nϩ membranes by alkali blotting, and hybridized overnight with experiment, the mean cell number per well was determined after trypsiniza- the CGRP-R internal probe or the cDNA of the CT-R gene labeled with tion of four separate wells. Data are expressed as picomoles of cAMP Downloaded from [␣-32P]dCTP (Megaprime, Amersham, Aylesbury, U.K.). Membranes were produced per 106 cells. washed twice at room temperature in 2ϫ SSC (20ϫ SSC is 3 M NaCl and 0.3 M sodium citrate, pH 7.0)/0.1% SDS, followed by a 45-min incubation at 55°C in 0.1ϫ SSC/0.1% SDS. Amplification of the type VIP-R cDNA Results (19, 32) consisted of 30 cycles of 1 min at 94°C, annealing for 1 min at 56°C, and a 1-min extension at 72°C in the presence of 0.5 ␮Ci of Establishment of SV40LT-transformed thymic epithelial cells [␣-33P]dATP. PCR products were resolved by agarose gel electrophoresis, When seeded for primary culture, most normal thymic explants http://www.jimmunol.org/ transferred to nylon membranes, and subjected to autoradiography. Auto- were rapidly surrounded by epithelial cell monolayers. As shown radiography was performed for 3–8 h at Ϫ70°C, using Kodak Biomax MR films (Eastman Kodak, Rochester, NY) and a Chronex Quanta III intensi- in Fig. 1, primary cultures of PTEC obtained from human thymus fying screen (NEN, Boston, MA). are highly enriched in epithelial cells as assessed by flow cytom- The sequences of the sense and antisense oligonucleotides for the am- etry (Ͼ90%). The percentage of fibroblasts detected by the anti- plification of the receptor transcripts were 5Ј-GACATCCAGCAAGCAA collagen III Ab was consistently Ͻ10%, and the percentage of CAGA-3Ј and 5Ј-CAATGCCAAGCAATGGCACC-3Ј for the CGRP-R, Ͻ 5Ј-GTATTGTCCTATCAGTTCTGCC-3Ј and 5Ј-GAGATAATACCAC macrophages detected by the HLA-DR Ab was 2%. CGCAAGCG-3Ј for the CT-R, 5Ј-GGGCTCGGTGGGCTGTAAGG-3Ј, Most contaminant fibroblasts were then removed by a series of and 5Ј-GACCAGGGAGACTTCGGCTTG-3Ј for the VIP-R, and 5Ј-TG scrapings and selective trypsinizations. The resulting packed polygo- CATCAGAAGAGGCCATCAAGCA-3Ј and 5Ј-GTTCAAGGGCTTTAT nal epithelial cells containing 90–95% epithelial cells were subjected by guest on September 29, 2021 Ј TCCATCTCTC-3 for insulin (33). The expected sizes of the PCR prod- to electropermeabilization in the presence of the pMK16 vector re- ucts were 707 bp (CGRP-R), 529 bp (CT-R), 754 bp (VIP-R), and 446 bp Ϫ (insulin). The corresponding internal probes for the Southern analysis were combined with the origin-defective (ori ) SV40 genome. Fast grow- 5Ј-TCACCTCACTGCAGTGGC-3Ј for the CGRP-R, 5Ј-GAGGATTAT ing colonies were selected and amplified. The resulting transfected GGTCTGCTCAG-3Ј for the VIP-R, and 5Ј-TTCTGCCATGGCCCTGT cells were designated LT-TEC1 to LT-TEC4. Primary and SV40LT- GGAT-3Ј for insulin. transformed thymic epithelial cells in culture exhibited similar mor- To evaluate the integrity and the relative amounts of RNA samples, a 574-bp sequence of the GAPDH mRNA was amplified using the sense phological appearances by phase-contrast microscopy (Fig. 2, a and primer 5Ј-ATCACCATCTTCCAGGAGCG-3Ј and the antisense primer b). The epithelial nature of PTEC and LT-TEC cells was confirmed 5Ј-CCTGCTTCACCACCTTCTTG-3Ј. by the expression of cytokeratins, using their respective corresponding cytospin slide preparations (Fig. 2, c and d), distinguishing them Competitive RT-PCR for quantification of the ␣-AChR mRNA from bone marrow-derived stromal components. The standard ␣-AChR mRNA was constructed by site-directed mutagen- The large T oncogene was functionally inserted in SV40LT- esis, introducing a new BstUI restriction site (34). Immediately before RT, transfected thymic cells, as shown by Northern blot and immuno- the standard RNA was diluted to 0.05 ϫ 10Ϫ18 M. Two micrograms of total RNA together with a known amount of standard RNA was reverse tran- fluorescence analysis (Fig. 3). The transcript of SV40LT was iden- scribed in a 50-␮l reaction mixture containing the downstream primer tified as a main band of 2.5 kb in the LT-TEC1 and LT-TEC2 cell GAAGCAGTACGTCGCGGACG (50 pmol). The PCR conditions were as lines and simian kidney fibroblasts COS-7, which were used as a previously described (12), and a trace amount of 32P-labeled 5Ј primer positive control (36). No hybridization was detected in nontrans- (GGAATCCAGATGACTATGGCGG) was added to the reaction mixture fected primary thymic epithelial cells. Intense nuclear staining of (2–3 ϫ 106 cpm/tube). The corresponding PCR product was 431 bp. After amplification, the products were digested with BstUI and separated by elec- the LT Ag was observed in Lab-Tek (Corning Costar, Brumath, trophoresis with a 1.5% agarose gel containing ethidium bromide. Then, France) chamber preparations from LT-TEC1 cell cultures, using the standard control was revealed as two bands of 279 and 152 bp. The indirect immunofluorescence revelation (Fig. 3). bands were excised, and the amount of radioactivity was determined by scintillation counting and is expressed as counts per minute. Expression of the CGRP-R/CT-R and VIP-R genes in human To analyze the regulation of the AChR ␣-chain transcripts by CGRP and CT, PTEC and LT-TEC1 were distributed and incubated overnight in thymus and thymic epithelial cells by RT-PCR and Southern blot Ϫ six-well plates (5 ϫ 105/well). Then, each peptide (10 9 M) was added to To characterize the expression of the genes encoding the receptors the culture for a 24-h period. Treated and control cultures were harvested, for CGRP, calcitonin, and VIP, RNA samples from human thymus and RNA was extracted. and derived epithelial cells in culture were examined by RT-PCR Cellular cAMP production and Southern blot (Fig. 4). The PCR products corresponding to the The cAMP production in primary and SV40LT-transformed thymic epi- CGRP-R transcripts were widely observed among the samples thelial cells was measured after incubation in the presence or the absence tested (707 bp), including four different resections of control thy- (control) of the neuroendocrine peptides investigated in the present study mus, thymi from three patients with MG, and thymi from two 2106 NEUROENDOCRINE PEPTIDE RECEPTORS IN HUMAN THYMUS

FIGURE 2. Morphology by phase-contrast microscopy and cytokeratin expression in human PTEC and their SV40LT-transformed counterparts LT- TEC1 in culture. Epithelial morphology of PTEC and LT-TEC1 in culture (a and b) and expression of the epithelial marker cytokeratins by immunocytochem- istry in their corresponding cytospin slide preparations (c and d) are shown. Magniﬁcation, ϫ150. Downloaded from

patients with thymoma. Again, the CGRP-R transcript was clearly dulla and the cortex areas of the thymus. In the medulla, nonepi- detected in two different primary cultures of PTEC, whereas the thelial cells such as thymocytes were also labeled. signal was weaker in their SV40LT-transformed counterparts LT- Expression of CGRP-R and CT-R revealed on thymic sections http://www.jimmunol.org/ TEC (lanes 1–3) or in human colonic cancer cells Caco-2 and by the biotinylated peptides is shown in Fig. 5. In both cases, many HT29 (lanes 1 and 2, respectively). epithelial cells were double stained with anti-keratin Abs. Other As seen in control thymus, hyperplasia, and thymoma from MG cell types also harbor these neuroendocrine peptide receptors. patients, two bands of CT-R transcripts (529 and 578 bp) were also detected in LT-TEC and human colonic cells, but were absent in PTEC1 and PTEC2. In contrast, the signal for VIP-R transcript (754 bp) was seen in all preparations from human thymus, includ-

ing control and MG thymomas, thymic epithelial cells in culture, by guest on September 29, 2021 and Caco-2 cells, with quite similar intensities (Fig. 4).

Histochemical localization of type 1 VIP-R, CGRP-R, and CT-R in human thymus The expression and cellular localization of type 1 VIP-R were also characterized by immunohistochemistry in normal human thymus. As shown in Fig. 5, type 1 VIP-R-positive cells were mostly epithelial cells, as assessed by double labeling with the type 1 VIP-R pAbs (A and B) and anti-keratin Abs. The arrows indicate the double-stained cells. The staining was observed in both the me-

FIGURE 4. Southern analysis performed on RT-PCR products of human CGRP-R, CT-R, and type 1 VIP-R transcripts during MG and cancer progression in human thymus. RNA samples isolated from human thymus, thymus from patients with MG, PTEC or LT-TEC cell lines, and human colonic cell lines Caco-2, and HT-29 (as positive controls for type 1 VIP-R expression) were subjected to RT-PCR, using a set of primers specific for FIGURE 3. Expression of the SV40LT oncogene in human thymic ep- each target transcript. PCR products were then resolved on a 1.5% agarose ithelial cells LT-TEC1 and -2. Northern blot analysis of the SV40LT tran- gel, transferred to nylon membrane, and hybridized with the corresponding script was performed. Total RNA samples (20 ␮g) extracted from human probes. For the VIP-R, experiments were performed in control thymus, PTEC, LT-TEC1 and -2, and SV40LT-transformed COS-7 cells as a pos- thymomas, PTEC-1, LT-TEC1, and Caco-2 cells. Expression of the itive control were loaded onto a 1% agarose-formaldehyde gel. Autora- CGRP-R and CT-R genes was detected in the Caco-2 and HT-29 human diography was performed for 18 h. Indirect immunofluorescence staining colonic epithelial cell lines. As controls, comparative PCR amplification of the large T tumor Ag was positive in the nuclei of LT-TEC1 cells, using was performed using the glyceraldehyde 3-phosphate dehydrogenase cytospin preparations. (GAPDH) primers to verify the integrity of the RNA preparations. The Journal of Immunology 2107

FIGURE 5. Histochemical localization of the type 1 VIP-R, CGRP-R, and CT-R in the normal human thymus. Frozen sections from

control human thymus were double stained Downloaded from with the type 1 VIP-R polyclonal Abs (pool of the pAbs A and B, see Materials and Methods) and the CK1 anti-cytokeratin Ab. The VIP-R Abs stain epithelial cells in both the cortex and the medulla as well as most thymocytes in the medulla. Controls obtained by omitting the primary VIP-R Abs were http://www.jimmunol.org/ negative. Staining of thymic sections performed with biotinylated CGRP or CT and revealed by streptavidin coupled to Texas Red detected numerous epithelial cells (keratin positive) displaying these neuropeptide receptors. The arrows indicate the double- stained epithelial cells. Controls obtained by omitting the biotinylated peptides CGRP and CT were negative. by guest on September 29, 2021

Flow cytometric analysis of the neuroendocrine receptors for 47%). Using anti-type I VIP-R Abs, we detected two cell popula- VIP, CGRP, and CT in derived thymic epithelial cells in culture tions in PTEC and LT-TEC1: one brightly stained in 35 and 10% of cells, and the second one displaying a dim expression in 25 and PTEC and LT-TEC1 cells were incubated either with the rabbit 37% of cells, respectively (Fig. 6). Double labeling of PTEC with pAb directed against the extracellular domain of the type 1 VIP-R anti-keratin Abs showed that gated type I VIP-Rbright cells were (pAb A) or with the biotinylated peptide CGRP. FACS analyses 100% keratin positive (mean ﬂuorescence intensity, 1000), while indicated the high percentage of keratin-positive cells in PTEC the gated type I VIP-Rdim cells were 84% keratin positive (mean (92%) and LT-TEC1 cultures (73%), as shown in Fig. 6. Most ﬂuorescence intensity, 236; data not shown). interestingly, PTEC, but not LT-TEC cells, did express CGRP-R, Taken together, our qualitative and quantitative data in Figs. 1, while similar percentages of thymic cells positive for type 1 VIP-R 5, and 6 support our conclusion that functional CGRP/CT recep- were observed in PTEC and LT-TEC1 cells (respectively, 60 and tors and type 1 VIP receptors are expressed on epithelial cells in 2108 NEUROENDOCRINE PEPTIDE RECEPTORS IN HUMAN THYMUS Downloaded from

FIGURE 6. FACS analysis of the PTEC and LT-TEC1 cell lines show- ing CGRP-R and type 1 VIP-R and the percentage of keratin-positive cells. PTEC and LT-TEC1 were incubated either with the polyclonal anti-VIP-R FIGURE 7. Comparative effects of VIP and related peptides on cAMP Ab A and revealed with goat anti-rabbit bound to FITC or with biotinylated production in PTEC and LT-TEC1 cultures. PTEC and LT-TEC1 were CGRP and revealed with avidin-phycoerythrin. The labeling with anti- incubated with increasing concentrations of VIP, PACAP, PHM, PHV, and keratin Ab shows the high percentage of epithelial cells in PTEC and secretin. The experiment was performed as described in Materials and http://www.jimmunol.org/ LT-TEC1 cultures (92 and 73%, respectively). The unshaded areas corre- Methods. The data are expressed as picomoles of cAMP produced per spond to the control data obtained by omitting the ﬁrst layer (either the million cells and are the mean Ϯ SEM values from four experiments per- primary Ab or the biotinylated peptides). formed in triplicate.

the human thymus and derived primary epithelial cells PTEC in dently stimulated cAMP production in PTEC. The CGRP-related culture. peptides, human and salmon CT, were ineffective, as were human and rat islet amyloid polypeptide IAPP (data not shown). Similar Effects of CGRP, CT, VIP, and their related peptides on cAMP results based on receptor binding assays were obtained in 293 cells by guest on September 29, 2021 production in human thymic epithelial cells in culture expressing the recombinant human CGRP type 1 receptor and in Since the transcripts encoding CGRP-R, CT-R, and VIP-R are clearly identified in human thymus, we investigated the effects of these peptides and their naturally occurring analogues on cellular cAMP production in PTEC and SV40LT-transformed LT-TEC thymic epithelial cells. The rationale behind such an approach was to evaluate the functional status of the CGRP-R, CT-R, and VIP-R, which, upon coupling with trimeric GTP-binding proteins, are known to increase adenylyl cyclase activity (37). VIP-related peptides. As shown in Fig. 7, VIP was the most potent effector among the VIP-related peptides tested in stimulating cAMP production in both PTEC and LT-TEC1 cell lines. A dose- dependent effect by VIP was observed in primary and SV40LT- transformed thymic epithelial cells, with respective EC50 values of 0.22 Ϯ 0.02 and 0.06 Ϯ 0.01 nM VIP. The maximal effective concentration of VIP (10Ϫ9 M) raised basal cAMP levels by ap- proximately 2-fold (from 5.4 Ϯ 0.6 to 9.0 Ϯ 0.4 pmol cAMP/106 PTEC cells) and 13-fold (from 3.5 Ϯ 0.4 to 44.8 Ϯ 4.2 pmol cAMP/106 LT-TEC1 cells; n ϭ 4). In contrast, the following nat- ural VIP analogues were much less potent than VIP, according to their respective relative potencies: VIP Ͼ PACAP Ͼ PHM, PHV. Thus, PACAP was about 7 and 45 times less potent than VIP in LT-TEC1 and PTEC, respectively. Secretin and the other VIP- related peptides, pancreatic glucagon and TGLP-1 (18), were also FIGURE 8. Comparative effects of human CGRP, CT, and related pep- ineffective in the same biochemical assay. These pharmacological tides on cAMP production in PTEC and LT-TEC1 cultures. PTEC and profiles demonstrate the presence of a high affinity, VIP-preferring LT-TEC1 were incubated with increasing concentrations of human CGRP receptor (type I) in both primary and SV40LT-transformed human (hCGRP), chicken CGRP (cCGRP), human CT (hCT), and salmon CT thymic epithelial cells. (sCT). The data are expressed as picomoles of cAMP produced per million CGRP-related peptides. As shown in Fig. 8, human CGRP and cells and are the mean Ϯ SEM values from four experiments performed in the potent agonist of CGRP-R, chicken CGRP (37), dose depen- triplicate. The Journal of Immunology 2109 Downloaded from http://www.jimmunol.org/

FIGURE 9. Regulation of the ␣-AChR gene by human CGRP and CT in PTEC and LT-TEC. The ␣-AChR mRNA transcript level was determined by competitive RT-PCR. A, Identical aliquots of total RNA extracted from TEC cultures were mixed with dilutions of internal control constructed by directed mutagenesis. After RT-PCR, amplicons can be distinguished by enzymatic digestion with BstUI. Following electrophoresis, the bands corresponding to the ␣-AChR transcript and internal control were excised from the gel, and radioactivity was determined by scintillation counting. Data are plotted as attomoles of internal control against counts per minute values. Molar equivalence occurs at the intersection point. In this example, the reaction is equivalent for the two types of mRNA at 0.1 attomol of internal standard. This value thus represents the quantity of mRNA encoding the ␣-AChR in TEC. B, The analysis of ␣-AChR transcript levels indicates that CGRP, but not human CT, induces a signiﬁcant increase in ␣-AChR mRNA (ϳ3-fold). Conversely, in LT-TEC1 CGRP exerts no effect, while human CT induces a signiﬁcant 2.3-fold up-regulation of this message. by guest on September 29, 2021

the human neuroblastoma SK-N-MC cell line (30). Chicken CGRP Regulation by CGRP and CT of the gene encoding ␣-AChR in was about 6 times more efficient than the corresponding human PTEC and LT-TEC1 peptide in stimulating cAMP production in PTEC according to We previously demonstrated that the AChR is expressed in PTEC Ϯ Ϯ their respective EC50 values (37 5 and 193 21 pM). Both (12). Since the ␣-AChR mRNA and number of surface AChR are peptides at 10 nM exerted similar maximal stimulations, i.e. a 10- known to be up-regulated by CGRP in cultured chicken myotubes fold increase over control cAMP levels. These data confirm our (13), we addressed the question of whether PTEC and LT-TEC are molecular detection of CGRP type 1 receptors by RT-PCR and sensitive to the actions of these neuropeptides for AChR gene ex- flow cytometry in PTEC (Figs. 4 and 6) and the absence of CT-R pression. We used quantitative RT-PCR technology for quantifi- by RT-PCR in PTEC. cation of the ␣-AChR (Fig. 9A) as previously described (12). Us- In contrast to the above results, transformation of PTEC by the ing this method, Fig. 9B demonstrates that human CGRP SV40LT Ag resulted in the molecular expression of CT-R detected (10Ϫ9 M), but not human CT at the same concentration, up-regu- by RT-PCR (Fig. 4) and their functional coupling to cAMP pro- lated ␣-AChR gene expression threefold in PTEC. An inverse sit- duction in the LT-TEC1 cell line (Fig. 8). Salmon CT, a potent uation was observed in LT-TEC1, since ␣-AChR gene expression agonist of CT-R, was more efficient than human CT to stimulate increased threefold in the presence of human CT, whereas CGRP Ϯ cAMP generation with respective EC50 values of 98 15 pM was ineffective despite expression of the CGRP-R gene by RT- Ϯ salmon CT and 227 28 pM human CT. Human and salmon CT PCR in LT-TEC1–3 (Fig. 4). On the other hand, we observed that displayed maximal stimulation within the 1–10 nM concentration VIP (10Ϫ9 M), was unable to increase the accumulation of the range, corresponding to a 2- to 1.5-fold increase over control val- transcripts encoding the ␣-AChR in both PTEC and LT-TEC1 ues, respectively. Human CGRP was ineffective in stimulating (data not shown) despite the presence of functional VIP-R coupled cAMP production over control cAMP levels in LT-TEC1, and this to cAMP generation. observation was consistent with the absence of CGRP binding to LT-TEC1 cells (Fig. 6). Chicken CGRP at 100 nM exerted a 2-fold increase in cAMP levels in this system (3.5. Ϯ 0.4 pmol/million Discussion cells), according to the interaction of this peptide with CT-R. Sim- In the present study we demonstrate the expression of the genes ilar results were obtained in two other SV40-LT-transformed thy- encoding CGRP-R, CT-R, and VIP-R in normal and pathological mic epithelial cell lines, LT-TEC2 and LT-TEC3. human thymi as well as in thymic epithelial cells either in primary 2110 NEUROENDOCRINE PEPTIDE RECEPTORS IN HUMAN THYMUS culture (PTEC) or transformed by the SV40LT oncogene (LT- and lymphoid organs, including bone marrow, lymph node spleen, TEC). This, as with our recent demonstration of AChR gene ex- and thymus (41, 42). Unlike VIP, which is located in the deep pression in PTEC (12), further documents the diversity of mem- thymic cortex, CGRP was recently identified in a subpopulation of brane receptors for neuroendocrine hormones in human thymus. thymic epithelial cells, in nerve fibers at the cortico-medullary The functional activities of these receptors provide new insights junction, and in perivascular and paravascular plexus supplying into the regulatory role of these peptides and neurotransmitters in arteries, veins, and the microvasculature (43, 44). Thus, the pres- immune functions. ence of CGRP- and VIP-immunoreactive cells and nerve fibers in Interestingly, we observed that CGRP, but not CT, up-regulated the thymus suggests a possible autocrine/paracrine release and transcript levels of the ␣-AChR in PTEC. Accordingly, PTEC are function of these neuroendocrine peptides in the thymic microen- positive for the expression of CGRP-R transcripts and negative for vironment (8, 23, 45). In the case of CGRP, it has also been shown the detection of CT-R transcripts in our RT-PCR/Southern blot to regulate several immune and inflammatory responses in vitro, assay. These results are also consistent with the presence of func- including inhibition of mitogen-stimulated proliferation of T cells, tional, high affinity CGRP-R and the absence of CT-R mediating inhibition of Ag presentation, and modulation of B cell differentiation cAMP generation in PTEC. In contrast, 1) transformation of PTEC (46). More recently, CGRP was shown to enhance the apoptosis of by the SV40LT oncogene was associated with the expression of thymocytes (47) as opposed to the protection exerted by VIP. It can be both CGRP-R and CT-R transcripts detected by RT-PCR in LT- questioned whether these neuropeptides would also affect pro- TEC1 and LT-TEC2; 2) human CT, but not CGRP, increased tran- grammed cell death of thymic epithelial cells, which have now been script levels of the ␣-AChR in SV40LT-transformed thymic epi- shown to contain specific VIP and CGRP receptors. Whether these thelial cells. To explain that CT-R expression is found in the interactions could be related to cell death of thymic lymphocytes and Downloaded from thymus but not in PTEC, two hypotheses could be raised: 1) thy- epithelial cells and thus to the physiological involution of the thymus mic cells bearing CT-R in control and MG patients (hyperplasia, observed after puberty remains to be investigated. thymomas) are not represented in PTEC due to progressive selec- Since the VIP-R present in PTEC and LT-TEC are not coupled tion in primary culture; and 2) culture conditions are associated with the induction of the gene encoding the ␣-AChR, one can with a down-regulation of the CT-R gene in PTEC. This observa- speculate that this transcriptional up-regulation induced by CGRP tion can be extended to other surface proteins, such as class II HLA and CT is not dependent on the elevation of cAMP, but is probably http://www.jimmunol.org/ Ags in human thymic epithelial cells, whose expression can be lost activated by another signaling pathway. Accordingly, the cAMP- when cells are cultured without IFN-␥ (25). Similarly, the insulin elevating agent forskolin was shown to down-regulate the tran- gene expression recently demonstrated in the human thymus (33) script levels of the AChR ␣- and ⑀-chains in PTEC and the TE671 was undetectable in both PTEC and LT-TEC thymic epithelial rhabdomyosarcoma cell line (12, 48). Unlike VIP type 1 receptors, cells in culture (data not shown), whereas the same message was the activation of either CT-R or CGRP-R results in coupling to ␣ ␣ clearly identified in all thymi included in Fig. 4. several G proteins, such as Gs and Gq/Gi , which activate several We also noticed changes in the expression patterns of CGRP-R downstream signaling pathways, such as adenylyl cyclase and the and CT-R in SV40LT-transformed LT-TEC vs PTEC. It should be phospholipase C/protein kinase C/inositol trisphosphate/calcium emphasized that in our studies similar culture conditions were used cascade (49–51). At least two subtypes, CGRP1 and CGRP2 re- by guest on September 29, 2021 for both PTEC and LT-TEC. Thus, the differences observed might ceptors, have been identified, and the existence of multiple human be related to the differentiation status of primary and SV40LT- CT receptor isoforms is also suggested in ovarian, breast cancer, transformed thymic epithelial cells. The proliferative thymic epi- and giant cell tumor of the bone (30, 31, 51–57). In the rat, the C1b thelial progenitor cells (38) are much more susceptible to under- isoform contains a 37-amino acid insert in the putative first extra- going the immortalization process and may be blocked in a more cellular loop that confers altered ligand binding characteristics, but immature stage by the SV40-LT oncogene. This latter hypothesis does not modify their ability to generate multiple second messen- is further substantiated by the recent characterization of the whn gers (54, 55). In contrast, the 16-amino acid insertion in the first gene, that encodes a key trans-acting factor in the initiation and the intracellular loop in the human CT receptor abolishes stimulation maintenance of the differentiated phenotype of thymic epithelial of the phospholipase C signal transduction pathway while allowing cells (39). The PTEC and LT-TEC cell lines may therefore provide stimulation of the cAMP pathway (52, 53, 56). These data are in suitable models to identify and to study the role of individual tran- agreement with the observation that the CT-R can exert opposite scription factors, neuroendocrine receptors, and their signaling biological effects via selective transduction pathways during the pathways in thymus development and their heterotypic interactions cell cycle, with the receptor coupling through a Gs protein during with thymocytes. G2 phase and through Gi/Gq proteins during S phase (49, 50). We showed here that both PTEC and LT-TEC contained func- Another level of regulation related to the cAMP/signaling re- tional, specific, high affinity, type I VIP receptors mediating cAMP sponses and expression of the AChR ␣-chain evoked by CGRP- generation. These results are in agreement with the accumulation R/CT-R in human thymus emerges from the interaction of these of the corresponding VIP-R transcripts evaluated by RT-PCR/ membrane receptors with endogenous proteins. In this connection, Southern blot and flow cytometry in thymic epithelial cells in cul- the CGRP-R family has been recently shown to interact with new ture (PTEC and LT-TEC) as well as in human control thymus and single transmembrane domain proteins called RAMPS, i.e. recep- thymus from MG patients with either hyperplasia or thymoma. In tor activity-modifying proteins, that regulate the ligand specificity, this context, we have previously demonstrated that the immortal- transport, glycosylation, and presentation of these serpentine re- ization of rat and human intestinal epithelial cells by SV40-LT was ceptors at the cell surface (58). Furthermore, a novel accessory associated with retention of functional VIP-R and a limited mor- factor, designated receptor component protein (RCP), is required phological and functional differentiation (28, 29). In the thymus, for conferring endogenous CGRP receptor activity in Xenopus oo- VIP-positive nerve fibers are distributed in the capsular and sub- cytes (59). This intracellular membrane-associated protein RCP is capsular regions as well as in the connective tissue trabeculae sep- also required for CGRP-R function in NIH-3T3 cells. Thus, dif- arating the lobules (40). Also, VIP gene expression was detected in ferential expression of RAMPS and RCP-like proteins may be in- rat thymocyte subsets (CD4ϩ, CD8ϩ, and CD4ϩCD8ϩ cells). volved in differential binding and signaling by the neuroendocrine CGRP is also distributed in cells and nerve fibers in hemopoietic peptides CGRP/CT during MG or neoplasic transformation of the The Journal of Immunology 2111 human thymus; the expression of these receptor-regulating factors tide encoded by the calcitonin gene via tissue-specific RNA processing. Nature remains to be investigated in PTEC and LT-TEC cell lines. In this 304:129. 16. Boudard, F., and M. Bastide. 1991. Inhibition of mouse T-cell proliferation by connection, accumulating evidence suggests that elevated expres- CGRP and VIP: effects of these neuropeptides on IL-2 production and cAMP sion of the peptides CGRP and CT is associated with positive or synthesis. J. Neurosci. Res. 29:29. negative mitogenic responses in several human tumors, such as 17. De la Fuente, M., M. Delgado, and R. P. Gomariz. 1996. VIP modulation of immune cell functions. Adv. Neuroimmunol. 6:75. breast, renal, lung, and gastric carcinoma (60), as well as in the 18. Bonetto, V., H. Jo¨rnvall, V. Mutt, and R. Sillard. 1995. Two alternative process- thymus CD4ϩ T cell population (21). ing for a preprohormone: a bioactive form of secretin. Proc. Natl. Acad. Sci. USA In conclusion, this study clearly demonstrates the functional ex- 92:11985. 19. Couvineau, A., C. Rouyer-Fessard, J. J. Maoret, P. Gaudin, P. Nicole, and pression of CGRP-R, CT-R, and type 1 VIP-R in human thymus M. Laburthe. 1996. Vasoactive intestinal peptide (VIP)1 receptor: three nonad- and thymic epithelial cells at various stages of the neoplastic trans- jacent amino acids are responsible for species selectivity with respect to recognition of peptide histine isoleucineamide. J. Biol. Chem. 271:12795. formation associated with MG. Thus, CGRP-R and CT-R might be 20. Bulloch, K., J. Hausman, T. Radojcic, and S. Short. 1991. Calcitonin gene-related involved in MG via induction of the AChR Ag in both epithelial peptide in the developing and aging thymus. An immunocytochemical study. and myoid thymic cells. Furthermore, thymic epithelial cells, thy- Ann. NY Acad. Sci. 621:218. 21. Bulloch, K., B. S. McEwen, A. Diwa, and S. Baird. 1995. Relationship between mocytes, and mesenchymal cells are known to affect each other’s dehydroepiandrosterone and calcitonin gene-related peptide in the mouse thymus. functions, including growth, differentiation, and apoptosis. There- Am. J. Physiol. 268:E168. fore, we now propose that these neuroendocrine peptides, by act- 22. Xin, Z., H. Tang, and D. Ganea. 1994. Vasoactive intestinal peptide inhibits interleukin (IL)-2 and IL-4 production in murine thymocytes activated via the ing on thymic epithelial cells, can be considered novel modulators TCR/CD3 complex. J. Neuroimmunol. 54:59. of the cross-talk between these cell lineages. 23. Ernstro¨m, U., G. Gafvelin, and V. Mutt. 1995. Rescue of thymocytes from cell Note added in proof. A recent paper by Throsby et al. (61) indi- death by vasoactive intestinal peptide. Regul. Pept. 57:99. Downloaded from 24. Delgado, M., E. Garrido, C. Martinez, J. Leceta, and R. P. Gomariz. 1996. Va- cates that both dendritic cells and macrophages are the sites of soactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide preproinsulin synthesis in the murine thymus. This report is con- (PACAP27 and PACAP38) protect CD4ϩCD8ϩ thymocytes from glucocorti- sistent with our findings related to the absence of insulin transcrits coid-induced apoptosis. Blood 87:5152. 25. Berrih, S., F. Arenzana-Seisdedos, S. Cohen, R. Devos, D. Charron, and by RT-PCR/Southern blot in our preparations of primary PTEC J. L. Virelizier. 1985. Interferon-␥ modulates HLA class II antigen expression on and LT-TEC, while this message was clearly identified in all hu- cultured human thymic epithelial cells. J. Immunol. 135:1165. man thymi included in Fig. 4. 26. Goetzl, E. J., D. R. Patel, J. L. Kishiyama, A. C. Smoll, C. W. Turck, N. M. Law, http://www.jimmunol.org/ S. A. Rosenzweig, and S. Q. Sreedharan. 1994. Specific recognition of the human neuroendocrine receptor for VIP by anti-peptide antibodies. Mol. Cell. Neurosci. Acknowledgments 5:145. 27. Glutzman, Y., R. J. Frisque, and J. Sambrook. 1980. Origin-defective mutants of We thank Dr. Edward Goetzl (University of California, San Francisco) for SV40. Cold Spring Harbor Symp. Quant. Biol. 44:293. providing the type 1 VIP-R Abs, and Mrs. C. Bruand for expert assistance 28. Emami, S., L. Mir, C. Gespach, and G. Rosselin. 1989. Transfection of fetal rat intestinal epithelial cells by viral oncogenes: establishment and charac- in PTEC cultures and for performing the micrographs. We thank Dr. Dartt terization of the E1A-immortalized SLC-11 cell line. Proc. Natl. Acad. Sci. (Shepens Eye Research Institute, Boston, MA) Dr. A. Couvineau (Institut USA 86:3194. National de la Santeét de la Recherche Me´dicale, Unit 410) and Dr. J. L. 29. Chastre, E., Y. Di Gioia, P. Barbry, B. Simon-Bouy, E. Mornet, P. Fanen, Frendo (Institut National de la Santeét de la Recherche Me´dicale, Unit G. Champigny, S. Emami, and C. Gespach. 1991. Functional insertion of the SV40 large T oncogene in cystic fibrosis intestinal epithelium. J. Biol. Chem. by guest on September 29, 2021 349) for discussions. 266:21239. 30. Aiyar, N., K. Rand, N. A. Elshourbagy, Z. Zeng. J. E. Adamour, D. J. Bergsma, and Y. Li. 1996. A cDNA encoding the calcitonin gene-related peptide type 1 References receptor. J. Biol. Chem. 271:11325. 1. Shortman, K. 1992. Cellular aspects of early T-cell development. Curr. Opin. 31. Frendo, J. L., F. Pichaud, R. Delage-Mourroux, Z. Bouizar, N. Segond, Immunol. 4:140. M. S. Moukhtar, and A. Julienne. 1994. An isoform of the human calcitonin 2. Egertron, M., R. Scollay, and K. Shortman. 1990. Kinetics of mature T cell receptor is expressed in TT cells and in medullary carcinoma of the thyroid. development in the thymus. Proc. Natl. Acad. Sci. USA 87:2579. FEBS Lett. 342:214. 3. van Ewijk, W. 1991. T cell differentiation is influenced by thymic microenvi- 32. Maoret, J. J., D. Pospaı¨, C. Rouyer-Fessard, A. Couvineau, C. Laboisse, ronments. Annu. Rev. Immunol. 9:591. T. Voisin, and M. Laburthe.1994. Neurotensin receptor and its mRNA are ex- 4. Fehling, H. J., and H. von Boehmer. 1997. Early ab T cell development in the pressed in many human colon cancer cell lines but not in normal colonic epithe- thymus of normal and genetically altered mice. Curr. Opin. Immunol. 9:263. lium: binding studies and RT-PCR experiments. Biochem. Biophys. Res. Com- 5. Huesmann, M., B. Scott, P. Kisielow, and H. Von Boehmer. 1991. Kinetics and mun. 203:465. efficacy of positive selection in the thymus of normal and T cell receptor trans- 33. Pugliese, A., M. Zeller, A. Fernandez, L. Zalcberg, R. Bartlett, C. Ricordi, genic mice. Cell 66:533. M. Pietropaolo, G. Eisenbarth, S. Bennett, and D. Patel. 1997. The insulin gene 6. Nossal, G. J. V. 1994. Negative selection of lymphocytes. Cell 76:229. is transcribed in the human thymus and transcription levels correlate with allelic 7. Von Boehmer, H. 1994. Positive selection of lymphocytes. Cell 76:219. variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat. 8. Gao, Y., Y. Kinoshita, F. Hato, K. Tominaga, and Y. Tsuji. 1996. Suppression of Genet. 15:293. glucocorticoid-induced thymocyte apoptosis by co-culture with thymic epithelial 34. Guyon, T., P. Levasseur, F. Truffault, C. Cottin, C. Gaud, and S. Berrih-Aknin. cells. Cell. Mol. Biol. 42:227. 1994. Regulation of acetylcholine receptor ␣ subunit variants in human myas- 9. Anderson, G., E. J. Jenkinson, N. C. Moore, and J. J. T. Owen. 1993. MHC class thenia gravis: quantification of steady-state levels of messenger RNA in muscle II-positive epithelium and mesenchyme cells are both required for T-cell devel- biopsy using the polymerase chain reaction. J. Clin. Invest. 94:16. opment in the thymus. Nature 362:70. 35. Barakat, A., G. Skoglund, C. Boissard, G. Rosselin, and J.-C. Marie. 1994. Cal- 10. Meilin, A., J. Shoham, L. Schreiber, and Y. Sharabi. 1995. The role of thymo- citonin gene-related peptide and islet amyloid polypeptide stimulate insulin se- cytes in regulating thymic epithelial cell growth and function. Scand. J. Immunol. cretion in RINm5F cells through a common receptor coupled to a generation of 42:185. cAMP. Biosci. Rep. 14:1. 11. Berrih-Aknin, S., E. Morel, F. Raimond, D. Safar, C. Gaud, J. P. Binet, 36. Gluzman, Y. 1981. SV40-transformed simian cells support the replication of P. Levasseur, and J. F. Bach. 1987.The role of the thymus in myasthenia gravis: early SV40 mutants. Cell 23:175. immunohistological and immunological studies in 115 cases. Ann. NY Acad. Sci. 37. Marie, J.-C., C. Boissard, G. Skoglund, G. Rosselin, and B. Breánt. 1996. Glu- 505:50. cagon acts through its own receptors in the presence of functional glucagon-like 12. Wakkach, A., T. Guyon, C. Bruand, S. Tzartos, S. Cohen-Kaminsky, and peptide-1 receptors on hamster insulinoma. Endocrinology 137:4108. S. Berrih-Aknin. 1996. Expression of acetylcholine receptor genes in human 38. Blackburn, C., C. Augustine, R. Harvey, M. Malin, R. Boyd, J. Miller, and thymic epithelial cells. J. Immunol. 157:3752. G. Morahan. 1996.The nu gene acts cell-autonomously and is required for 13. Fontaine, B., A. Klarsfeld, and J. P. Changeux. 1987. Calcitonin gene-related differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci. USA peptide and muscle activity regulate acetylcholine receptor ␣-subunit mRNA 93:5742. levels by distinct intracellular pathways. J. Cell Biol. 105:1337. 39. Nehls, M., B. Kyewski, M. Messerle, R. Waldschu¨tz, K. Schu¨ddekopf, 14. Amara, S. G., V. Jonas, M. G. Rosenfeld, E. S. Ong, and R. M. Evans. 1982. A. J. H. Smith, and T. Boehm. 1996. Two genetically separable steps in the Alternative RNA processing in calcitonin gene expression generates mRNAs differentiation of thymic epithelium. Science 272:886. encoding different polypeptide products. Nature 298:240. 40. Gomariz, R. P., M. Delgado, J. R. Naranjo, B. Mellstrom, A. Tormo, F. Mata, and 15. Rosenfeld, M. G., J. J. Mermod, S. G. Amara, L. W. Swanson, P. E. Sawchenko, J. Leceta. 1993. VIP gene expression in the rat thymus and spleen. Brain Behav. J. Rivier, W. W. Vale, and R. M. Evans. 1983. Production of a novel neuropep- Immun. 7:271. 2112 NEUROENDOCRINE PEPTIDE RECEPTORS IN HUMAN THYMUS

41. Bulloch, K., T. Radojcic, R. Yu, J. Hausman, L. Lenhard, and S. Baird. 1991. The 52. Moore, E., R. Kuestner, S. Stroop, F. Grant, S. Matthewes, C. Brady, P. Sexton, distribution and function of calcitonin gene-related peptide in the mouse thymus and D. Findlay. 1995. Functionally different isoforms of the human calcitonin and spleen. Prog. Neuroendocrinol. Immunol. 4:186. receptor result from alternative spicing of the gene transcript. Mol. Endocrinol. 42. Kendall, M. D., and A. A. Al-Shawaf. 1991. Innervation of the rat thymus gland. 9:959. Brain Behav. Immun. 5:9. 53. Gorn, A. H., S. Rudolph, M. R. Flannery, C. C. Morton, S. Weremowicz, 43. Bodo, K., B. von. Gaudecker, A. Kranz, B. Krisch, and R. Mentlein. 1995. Cal- J. T. Wang, S. M. Krane, and S. R. Goldring. 1995. Expression of two skeletal citonin gene-related peptide and its receptor in the thymus. Peptides 16:1497. calcitonin receptor isoforms cloned from a giant cell tumor of bone. J. Clin. 44. Weihe, E., S. Mu¨ller, T. Fink, and H. J. Zentel. 1989. Tachykinins, calcitonin Invest. 95:2680. gene-related peptide and neuropeptide Y in nerves of the mammalian thymus: 54. Sexton, P. M., S. Houssami, J. M. Hilton, L. M. O’Keeffe, R. J. Center, interaction with mast cells in autonomic and sensory neuroimmunomodulation? M. T. Gillespie, P. Darcy, and D. M. Findlay. 1993. Identification of brain iso- Neurosci. Lett. 100:77. forms of the rat calcitonin receptor. Endocrinology 7:815. 45. Mathew, R. C., G. A. Cook, A.M. Blum, A. Metwali, R. Felman, and 55. Houssami, S., D. M., Findlay, C. L. Brady, D. E. Myers, T. J. Martin, and J. V. Weinstock. 1992. Vasoactive intestinal peptide stimulates T lympho- P. M. Sexton. 1994. Isoforms of the rat calcitonin receptor: consequences for cytes to release IL-5 in murine Schistosomiasis mansoni infection. J. Immu- ligand binding and signal transduction. Endocrinology 135:183. nol. 148:3572. 56. Nussenzveig, D. R., C. N. Thaw, and M. C. Gershengorn. 1994. Inhibition of 46. McGillis, J. P., S. Humphreys, V. Rangnekar, and J. Ciallella. 1993. Modulation inositol phosphate second messenger formation by intracellular loop one of a of B lymphocyte differentiation by calcitonin gene-related peptide (CGRP) II: human calcitonin receptor. J. Biol. Chem. 269:28123. inhibition of LPS-induced ␬ light chain expression by CGRP. Cell. Immunol. 57. Chen, W. J., S. Amour, J. Way, G. Chen, C. Watson, P. Irving, J. Cobb, 150:405. S. Kadwell, K. Beaumont, T. Rimele, et al. 1997. Expression cloning and receptor 47. Sakuta, H., K. Inaba, and S. Muramatsu. 1996. Calcitonin gene-related peptide pharmacology of human calcitonin receptors from MCF-7 cells and their rela- enhances apoptosis of thymocytes. J. Neuroimmunol. 67:103. tionship to amylin receptors. Mol. Pharmacol. 52:1164. 48. Luther, M. A., R. Schoepfer, P. Whiting, B. Casey, Y. Blatt, M. S. Montal, 58. McLatchie, L. M., N. J. Fraser, M. J. Main, A. Wise, J. Brown, N. Thompson, M. Montal, and J. Lindstrom. 1989. A muscle acetylcholine receptor is expressed R. Solari, M. G. Lee, and S. M. Foord.1998. RAMPS regulate the transport and in the human cerebellar medulloblastoma cell line TE671. J. Neurosci. 9:1082. ligand specificity of the calcitonin-receptor-like receptor. Nature 393:333. 49. Chakraborty, M., D. Chatterjee, S. Kellokumpu, H. Rasmussen, and R. Baron. 59. Hall, J. M., and D.M. Smith. 1998. Calcitonin gene-regulated peptide: a new 1991. Cell cycle-dependent coupling of the calcitonin receptor to different G concept in receptor-ligand specificity? Trends Pharmacol. Sci. 19:303. Downloaded from proteins. Science 251:1078. 60. Shah, G. V., W. Rayford, M. J. Noble, M. Austenfeld, J. Weigel, S. Vamos, and 50. Horne, W. C., J. F. Shyu, M. Chakraborty, and R. Baron. 1994. Signal transduc- W. K. Mebust. 1994. Calcitonin stimulates growth of human prostate cancer cells tion by calcitonin multiple ligands, receptors, and signaling pathways. Trends through receptor-mediated increase in cyclic adenosine 3Ј,5Ј-monophosphates Endocrinol. Metab. 5:395. and cytoplasmic Ca2ϩ transients. Endocrinology 134:596. 51. Wimalawansa, S. 1996. Calcitonin gene-related peptide and its receptors: mo- 61. Throsby, M., F. Homo-Delarche, D. Chevenne, R. Goya, M. Dardenne, and J. M. lecular genetics, physiology, pathophysiology, and therapeutic potentials. En- Pleau. 1998. Pancreatic hormone expression in the murine thymus: localization in docr. Rev. 17:533. dendritic cells and macrophages. Endocrinology 139:2399. http://www.jimmunol.org/ by guest on September 29, 2021