Effect of Radiation on Varietal Improvement of Regenerated Plants of Lilium and Their Characterization Through Molecular Markers ______

EFFECT OF RADIATION ON VARIETAL IMPROVEMENT OF REGENERATED PLANTS OF LILIUM AND THEIR CHARACTERIZATION THROUGH MOLECULAR MARKERS ______

A THESIS SUBMITTED TO LAHORE COLLEGE FOR WOMEN UNIVERSITY IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN BOTANY

FARAH ASLAM

DEPARTMENT OF BOTANY LAHORE COLLEGE FOR WOMEN UNIVERSITY, LAHORE, PAKISTAN 2016

CERTIFICATE

This is to certify that the research work described in this thesis submitted by Ms. Farah Aslam to Department of Botany, Lahore College for Women University has been carried out under my direct supervision. I have personally gone through the raw data and certify the correctness and authenticity of all results reported herein. I further certify that thesis data have not been used in part or full, in a manuscript already submitted or in the process of submission in complete fulfillment of the award of any other degree from any other institution or home or abroad. I also certify that the enclosed manuscript has been prepared under my supervision and I endorse its evaluation for the award of PhD degree through the official procedure of University.

______Name: Prof. Dr. Shagufta Naz Supervisor Date:

Verified By

______Name: Prof. Dr. Farah Khan Chairperson Department of Botany Stamp

______Controller of Examination Stamp Date: ______

Dedicated

Holy Prophet Hazrat (ﷺ) Muhammad

My loving mother Uncle Khalid Pervaiz & my niece Maira

ACKNOWLEDGMENTS

“For instance, there is a tradition that one who treads a path in search of knowledge has his way paved to paradise by God as a reward for this noble deed” (Bukhari, Muslim)

In the name of Allah, most compassionate, Merciful. All praise and love be to Allah, Lord of world’s most kind and merciful, who is the entire source of knowledge delivered to mankind. My all efforts are nothing without blessing of Almighty Allah to complete my research work. My all love and respect for Holy prophet, Hazrat Mohammad (PBUH), who is forever a model of guidance and knowledge for all mankind eternally.

I offer indebted thanks to acting Vice Chancellor, Prof. Dr. Uzma Qurashi for providing me excellent research facilities and support to continue my research.

I am also very grateful to Prof. Dr. Farah Khan, Head of Botany department, Lahore College for Women University, for her valuable guidance and kind behavior during my PhD tenure.

I would like to pay my regards and gratitude to my most respected teacher and research supervisor Prof. Dr. Shagufta Naz, Head of Biotechnology department, Lahore College for Women University, for her enthusiastic guidance, keen attention, continued interest, analytical ideas, critical suggestions, polite and forbidding behavior (where and when necessary) during my research work. Her advice and counsel were always a valuable addition to any decision making process and her encouragement always succeeded in helping me to reach the next milestone.

Also, special thanks to my senior teachers Dr. Sumera Javed, Dr. Kiran Shahzadi, Dr. Saiqa Ilyas and Mrs. Amina Tariq for their kind support and technical help. I would like to appreciate my friends especially, Ambreen, Rukhama and also to Intiaz, Ayesha, Sannia and Noureen Ashraf, Research assistant, for her moral support, generous advices and cooperation.

Words are inadequate to express my profound and warmest gratitude to my respected Ammi, Abu sisters and brothers Saba, Hafsa, Ali and Kashif bhai the love and inspiration of whom encouraged me at each step of life and their prayers made it possible for me to carry out my work progressively. No words to express heartfelt gratitude to my family. I would also like to express my gratitude to my little love, Maira, who give me

hope in the life. I am also thankful to Iqra for her help during my research work. Thanks are extended to Abdul-Rehman, Atif, Ansar and Fouzia attendants of Plant Biotechnology lab and plant tissue culture laboratory, Bagh-e-Jinnah, Lahore. Last but not the least; I would like to show my greatest appreciation and sincere regards for whole team of Higher Education Commission, Govt. of Pakistan, for providing me scholarship as well as for their efforts, encouragement and guidance.

Thanks

Farah Aslam

CONTENTS

TitleTitles Page No. List of Tables i

List of Figures v List of Abbreviations No No. xiv Abstract xvi Chapter 1 : Introduction 1 1.1: Aims and Objectives 5 Chapter 2: Review of Literature 6 2.1: Family Liliaceae 6 2.1.1: Lilium Genus 6

2.1.2: Habitat 6

2.1.3: Habit and Taxonomy 7 2.2: Economic importance 7

2.2.1: Used as ornamental plant 7

2.2.2: Medicinal importance 7

2.2.3: Nutritive value 8

2.2.4 Other uses 9 2.3: Plant tissue culture 9

2.3.1: Why plant tissue culture techniques 9

2.4: Induced mutagenesis 12

2.4.1: Why mutagenesis 12

2.4.2: Gamma irradiation 13

2.4.3: In vitro mutagenesis 14

2.6: Why molecular characterization 15

2.6.1: RAPD analysis 16

2.7.1: SSR analysis 18

Chapter 3: Materials and Methods 20

3.1: In vitro propagation by using plant tissue culture 20 technique

3.1.1: Plant material 20 3.1.2: Sterilization 21 3.1.3: Surface sterilization of explants 21 3.1.4: Glassware sterilization 21 3.1.5: Instruments sterilization 22 3.1.6: Laminar air flow cabinet sterilization 22

3.1.7: Sterilization of culture room and inoculation room 22 3.18: MS medium preparation and sterilization 22 3.1.9: Preparation of stock solutions of plant hormones 23 3.1.10: Explant inoculation 23 3.1.11: Study of parameters 23 3.1.11.1: Micropropagation 23 3.1.11.1.1: Shoot and root formation 23

3.1.11.1.2: Acclimatization of plantlets 24

3.1.11.1.3: Data recorded 24

3.2: Induced mutagenesis 24

3.2.1: In vivo mutagenesis 24

3.2.1.1: Gamma irradiation treatment 24

3.2.1.2: Maintenance of experiment under in vivo 24 conditions

3.2.1.3: Data analysis for morphological study 25

3.2.1.3.1: Morphological characters 25 3.2.1.3.2: Germination response, percentage 25 and survival rate 3.2.1.3.3: Number of leaves 25 3.2.1.3.4: Leaf length and leaf width 25

3.2.1.3.5: Shoot length (cm) 25

3.2.2: In vitro mutagenesis 26

3.2.2.1: Data analysis 26

3.2.2.1.1: Multiple shoot formation 26

3.2.2.1.2: Morphological study of regenerated 26

plantlets in green house

3.3: Molecular characterization of Lilium (Control and 26 irradiated genotypes) 3.3.1: DNA extraction 26

3.3.1.1: Determination of genomic DNA 27

3.3.2: RAPD analysis 27

3.3.2.1: Polymerase Chain Reaction (PCR) for RAPD 27

analysis 3.3.2.1.1: Data analysis for RAPD 28

3.3.3: SSR analysis 28

3.3.3.1: Polymerase Chain Reaction (PCR) for SSR 28

analysis 3.3.3.1.1: Data analysis for SSR 29 3.4: Statistical analysis 29

30 Chapter 4: Results

4.1: Micropropagation of different Lilium Cultivars 30 4.1.1: Oriental (O) group 31 4.1.1.1: In vitro propagation of Oriental cultivars 31

4.1.2: Oriental x Trumpet (OT) group 37 4.1.2.1: In vitro propagation of Oriental x Trumpet 37

cultivars 4.1.3: Longiflorum x Oriental (LO) group 43 4.1.3.1: In vitro propagation of Longiflorum x 43 Oriental cultivar 4.1.4: Longiflorum (L) group 46 4.1.4.1: In vitro propagation of Longiflorum cultivar 46 4.1.5: Root initiation 49 4.1.6: Acclimatization of mericlones 52 4.2: Induced mutagenesis 55 4.2.1: Oriental (O) group 56 4.2.1.1: In vivo mutagenesis 56 4.2.1.1.1: Morphological study of Oriental 56 cultivars

4.2.1.2: In vitro mutagenesis 67 4.2.1.2.1: Shoot multiplication 67

4.2.1.2.2: Studies on morphology of M1V4 and 76

M1V5 generation of in vitro derived mutants 4.2.2: Oriental x Trumpet (OT) group 85 4.2.2.1: In vivo mutagenesis 85 4.2.2.1.1: Morphological study of Oriental x 85 Trumpet cultivars 4.2.2.2: In vitro mutagenesis 95 4.2.2.2.1: Shoot multiplication 95

4.2.2.2.2: Studies on morphology of M1V4 and 103 M V generation of in vitro derived 1 5 mutants 4.2.3: Longiflorum x Oriental (LO) group 112

4.2.3.1: In vivo mutagenesis 112

4.2.3.1.1: Morphological study of Longiflorum 112 x Oriental cultivar 4.2.3.2: In vitro mutagenesis 116 4.2.3.2.1: Shoot multiplication 116

4.2.3.2.2: Studies on morphology of M1V4 and 121

M1V5 generation of in vitro derived mutants 4.2.4: Longiflorum (L) group 126 4.2.4.1: In vivo mutagenesis 126 4.2.4.1.1: Morphological study of 126 Longiflorum cultivar 4.2.4.2: In vitro mutagenesis 130 4.2.4.2.1: Shoot multiplication 130

4.2.4.2.2: Studies on morphology of 135

M1V4 and M1V5 generation of in vitro derived mutants

4.3: Molecular characterization by using random 140 amplified polymorphic DNA (RAPD) markers 4.3.1: Oriental (O) group 141 4.3.1.1: Molecular characterization of mutants by 141 using RAPD markers 4.3.1.2: Phylogenetic relationship among mutants 149 4.3.2: Oriental x Trumpet (OT) group 151 4.3.2.1: Molecular characterization of mutants using 151 RAPD markers 4.3.2.2: Phylogenetic relationship among mutants 159 4.3.3: Longiflorum x Oriental (LO) 161 4.3.3.1: Molecular characterization of mutants by 161 using RAPD markers 4.3.3.2: Phylogenetic relationship among mutants 164 4.3.4: Longiflorum (L) group 165 4.3.4.1: Molecular characterization of mutants by 165 using RAPD markers 4.3.4.2: Phylogenetic relationship among mutants 168 4.4: Molecular characterization by simple sequence 169 repeats (SSR) markers

4.4.1: Oriental (O) group 170 4.4.1.1: Molecular characterization of mutants by 170 using SSR markers 4.4.1.2: Phylogenetic relationship among mutants 176 4.4.2: Oriental x Trumpet (OT) group 178 4.4.2.1: Molecular characterization of mutants using 178 SSR markers 4.4.2.2: Phylogenetic relationship among mutants 184

4.4.3: Lilium Longiflorum x Oriental (LO) group 186 4.4.3.1: Molecular characterization of mutants by 186 using SSR markers 4.4.3.2: Phylogenetic relationship among mutants 188 4.4.4: Longiflorum (L) group 189 4.4.4.1: Molecular characterization of mutants by 189 using SSR markers 4.4.4.2: Phylogenetic relationship among mutants 191 192 Chapter 5: Discussion 5.1: Micropropagation of different Lilium cultivars 192 5.2: Induced mutagenesis 200 5.3: Molecular characterization of Lilium cultivars by 205 RAPD markers 208 5.4: Molecular characterization of Lilium cultivars by

RAPD markers References 212

Annexures xix Plagiarism 5.4: Report Molecular characterization of Lilium cultivars by xxii

List of Publications SSR markers and reprints xxiv

List of Tables

Table No. Title Page No.

3.1.1 List of coded Lilium cultivars included in different groups 20 4.1.1.1 Effect of various concentrations of BAP, Kin, IAA and TDZ on 34 shoot initiation of Oriental cultivars 4.1.2.1 Effect of various concentrations of BAP, Kin, IAA and TDZ on 40 shoot initiation of Oriental x Trumpet cultivars 4.1.3.1 Effect of various concentrations of BAP, Kin, IAA and TDZ on 44 shoot initiation of Longiflorum x Oriental cultivar 4.1.4.1 Effect of various concentrations of BAP, Kin, IAA and TDZ on 47 shoot initiation of Longiflorum cultivar of Lilium 4.1.5 Effect of various combinations of soil, compost and leaf manure on 53 acclimatization of microplants of Lilium cultivars 4.2.1.1.1 The effect of different doses of gamma irradiations on the 60 germination response, germination percentage and survival percentage of Oriental cultivars 4.2.1.1.2 Effects of different doses of gamma rays on the length, number and 63 width of leaves of Oriental cultivars 4.2.1.2.1 Effect of different doses of gamma rays on regeneration potential of 70 stationary in vitro cultures of Oriental cultivars 4.2.1.2.2 Effect of different doses of gamma rays on regeneration potential of 72 shaking cultures (rpm) of in vitro Oriental cultivars 4.2.1.2.3 Effect of different sucrose concentrations on bulblet formation of in 74 vitro irradiated plants of Oriental cultivars 4.2.1.2.4 Effect of different doses of gamma irradiations on plant height and 78 number, length and width of leaves of M1V4 generation of Oriental cultivars derived from in vitro mutagenesis 4.2.1.2.5 Effect of radiation on flower formation of in vitro derived mutants 82 of M1V5 generation of Oriental cultivars 4.2.2.1.1 The effect of different doses of gamma irradiations on the 88 germination response, germination percentage and survival percentage of Oriental x Trumpet cultivars 4.2.2.1.2 Effects of different doses of gamma rays on the length, number and 91 width of leaves of Oriental x Trumpet cultivars

4.2.2.2.1 Effect of different doses of gamma rays on regeneration potential of 97 stationary in vitro cultures of Oriental x Trumpet cultivars

4.2.2.2.2 Effect of different doses of gamma rays on regeneration potential of 99 shaking (rpm) cultures of in vitro Oriental x Trumpet cultivars 4.2.2.2.3 Effect of different sucrose concentrations on bulblet formation of in 101 vitro irradiated plants of Oriental x Trumpet cultivars 4.2.2.2.4 Effect of different doses of gamma irradiations on plant height and 105 number of leaves of M1V4 generation of Oriental x Trumpet cultivars derived from in vitro mutagenesis 4.2.2.2.5 Effect of radiation on flower formation of in vitro derived mutants 109 of M1V5 generation of Oriental x Trumpet cultivar 4.2.3.1.1 Effect of different doses of gamma irradiations on the germination 113 response, germination percentage and survival percentage of Longiflorum x Oriental cultivars 4.2.3.1.2 Effects of different doses of gamma rays on the length, number and 114 width of leaves of Longiflorum x Oriental cultivar 4.2.3.2.1 Effect of different gamma rays doses on the regeneration potential 117 of stationary in vitro cultures of Longiflorum x Oriental cultivar 4.2.3.2.2 Effect of different gamma rays doses on the regeneration potential 118 of shake cultures of in vitro cultures Longiflorum x Oriental cultivar 4.2.3.2.3 Effect of different sucrose concentrations on bulblet formation of in 119 vitro irradiated plants of Longiflorum x Oriental cultivar 4.2.3.2.4 Effect of different doses of gamma irradiations on plant height and 122 number of leaves of M1V4 generation of Longiflorum x Oriental cultivar derived from in vitro mutagenesis 4.2.3..2.5 Effect of radiation on flower formation of in vitro derived mutants of 125 M1V5 generation of Longiflorum x Oriental cultivar 4.2.4.1.1 Effect of different doses of gamma irradiations on the germination 127 response, germination percentage and survival percentage of Longiflorum cultivar 4.2.4.1.2 Effects of different doses of gamma rays on the length, number and 128 width of leaves of Longiflorum cultivar 4.2.4.2.1 Effect of different gamma rays doses on the regeneration potential 131 of stationary in vitro cultures of Longiflorum cultivar 4.2.4.2.2 Effect of different gamma rays doses on the regeneration potential 132 of shaking (rpm) cultures of in vitro cultures of Longiflorum cultivar 4.2.4.2.3 Effect of different sucrose concentrations on bulblet formation of in 133 vitro Irradiated plants of Longiflorum cultivar

iii

4.2.4.2.4 Effect of different doses of gamma irradiations on plant height and 136 number of leaves of M1V4 generation of Longiflorum cultivar derived from in vitro mutagenesis 4.2.4.2.5 Effect of radiation on flower formation of in vitro derived mutants 139 of M1V5 generation of Longiflorum cultivar 4.3.1.1 DNA bands amplified and polymorphism generated in Samur La 143 pink (V1) included in Oriental group 4.3.1.2 DNA bands amplified and polymorphism generated in Heaven 144 white (V2) included in Oriental group 4.3.1.3 DNA bands amplified and polymorphism generated in Kabana lily 145 (V3) included in Oriental group 4.3.1.4 DNA bands amplified and polymorphism generated in Montezuma- 146 O-red (V4) of Oriental group 4.3.2.1 DNA bands amplified and polymorphism generated in Star fighter- 153 O-red/white (V5) included in Oriental x Trumpet group 4.3.2.2 DNA bands amplified and polymorphism generated in Advantage 154 La salmon (V6) included in Oriental group 4.3.2.3 DNA bands amplified and polymorphism generated in Golden tycon 155 yellow (V7) included in Oriental x Trumpet group 4.3.2.4 DNA bands amplified and polymorphism generated in Orange pixie 156 (V8) included in Oriental x Trumpet group 4.3.3.1 DNA bands amplified and polymorphism in Courier La white (V9) 162 included in Longiflorum x Oriental group 4.3.4.1 DNA bands amplified and polymorphism generated in Easter lily 166 (V10) included in Longiflorum group 4.4.1.1 Primer sequences, number of alleles, allele size, PIC values and 172 Observed heterozygosity detected by 05 microsatellites in Samur La pink (V1) 4.4.1.2 Primer sequences, number of alleles, allele size, PIC values and 173 Observed heterozygosity detected by 05 microsatellites in Heaven white (V2) 4.4.1.3 Primer sequences, number of alleles, allele size, PIC values and 174 Observed heterozygosity detected by 05 microsatellites in Montezuma-O-Red (V3) 4.4.1.4 Primer sequences, number of alleles, allele size, PIC values and 175 Observed heterozygosity detected by 05 microsatellites in Kabana lily (V4)

4.4.2.1 Primer sequences, number of alleles, allele size, PIC values and Observed180 heterozygosity detected by 05 microsatellites in Star fighter-O-red /white (V5) 4.4.2.2 Primer sequences, number of alleles, allele size, PIC values and Observed181 heterozygosity detected by 05 microsatellites in Advantage La salmon (V6) 4.4.2.3 Primer sequences, number of alleles, allele size, PIC values and 182 Observed heterozygosity detected by 05 microsatellites in Golden tycon yellow (V7) 4.4.2.4 Primer sequences, number of alleles, allele size, PIC values and 183 Observed heterozygosity detected by 05 microsatellites in Orange pixie (V8) 4.4.3.1 Primer sequences, number of alleles, allele size, PIC values and 187 Observed heterozygosity detected by 05 microsatellites in Courier La white (V9) 4.4.4.1 Primer sequences, number of alleles, allele size, PIC values and 190 Observed heterozygosity detected by 05 microsatellites in Easter lily (V10)

List of Figures

Figure No. Title Page No.

4.1.1.1a Bulb scale of Lilium (1X) 35 4.1.1.1b Shoot formation of V1 in MS + BAP 3.0 (mg/L) (1X) 35 4.1.1.1c Shoot formation of V1 in MS + (BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 35 after 30 days of culturing (1X) 4.1.1.1d Shoot formation of V1 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 35 30 days of culturing (1X) 4.1.1.1e Shoot formation of V2 in MS + BAP 3.0 (mg/L) (1X) 35 4.1.1.2f Shoot formation of V2 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 35 after 30 days of culturing (1X) 4.1.1.1g Shoot formation of V2 in MS + BAP 1.0 mg/L + TDZ 4.0 µM after 30 35 days of culturing (1X) 4.1.1.1h Cultures of V3 showing growth in MS + BAP 3.0 (mg/L) (1X) 36 4.1.1.1i Cultures of V3 showing shoot formation in MS + BAP 2.0 (mg/L) 36 after 30 days of culturing (1X) 4.1.1.1j Shoot formation of V3 in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) 36 after 30 days of culturing (1X) 4.1.1.1k Shoot formation of V3 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 36 30 days of culturing (1X) 4.1.1.1l Cultures of V4 showing growth in MS + BAP 4.0 (mg/L) (1X) 36 4.1.1.1m Cultures of V4 showing shoot formation in MS + BAP 1.0 after 30 36 days of culturing (1X) 4.1.1.1n Shoot formation of V4 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 36 after 30 days of culturing (1X) 4.1.1.1o Shoot formation of V4 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 36 30 days of culturing (1X) 4.1.2.1a Cultures of V5 showing shoot formation in MS + BAP 3.0 (mg/L) 41 after 30 days of culturing (1X) 4.1.2.1b Shoot formation of V5 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 41 after 30 days of culturing (1X)

4.1.2.1c Shoot formation of V5 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 41 30 days of culturing (1X) 4.1.2.1d Shoot formation of V6 in MS + BAP 4.0 (mg/L) (1X) 41 4.1.2.1e Cultures of V6 showing decreased shoot formation in MS + BAP 1.0 41 (mg/L) after 30 days of culturing (1X) 4.1.2.1f Shoot formation of V6 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 41 after 30 days of culturing (1X) 4.1.2.1g Shoot formation of V6 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 41 30 days of culturing (1X) 4.1.2.1h Shoot formation of V7 in MS + BAP 3.0 (mg/L) (1X) 41 4.1.2.1i Cultures of V7 showing decreased shoot formation in MS + BAP 1.0 41 (mg/L) after 30 days of culturing (1X) 4.1.2.1j Shoot formation of V7 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 42 after 30 days of culturing (1X) 4.1.2.1k Shoot formation of V7 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 42 30 days of culturing (1X) 4.1.2.1l Cultures of V8 showing growth in MS + BAP 4.0 (mg/L) (1X) 42 4.1.2.1m Cultures of V8 showing shoot formation in MS + BAP 1.0 (mg/L) 42 after 30 days of culturing (1X) 4.1.2.1n Shoot formation of V8 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) 42 after 30 days of culturing (1X) 4.1.2.1o Shoot formation of V8 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 42 30 days of culturing (1X) 4.1.3.1a Shoot formation in MS + BAP 3.0 (mg/L) (1X) 45 4.1.3.1b Cultures of V9 showing decreased shoot formation in MS + BAP 1.0 45 (mg/L) after 30 days of culturing (1X) 4.1.3.1c Shoot formation in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 45 30 days of culturing (1X) 4.1.3.1d Shoot formation in MS + BAP 0.1 + Kin 0.2 + IAA 2.0 (mg/L) after 45 30 days of culturing (1X) 4.1.3.1e Shoot formation in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 45 days of culturing (1X)

vii

4.1.4.1a Shoot formation in MS + BAP 3.0 (mg/L) (1X) 48 4.1.4.1b Shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing 48 (1X) 4.1.4.1c Shoot formation in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 48 days of culturing (1X) 4.1.5a-b Effect of various concentrations of BAP + Kin + IAA on average 50 number of roots during micropropagation of different Lilium cultivars. 4.1.5c V1 showing maximum number of roots in MS + BAP 0.2 + Kin 0.2 + 51 IAA 4.0 (mg/L) (1X) 4.1.5d Root formation in V2 in MS + BAP 0.2 + Kin 0.2 + IAA 4.0 (mg/L) 51 (1X) 4.1.5e Root formation in V3 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) 51 (1X) 4.1.5f Root formation in V4 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) 51 (1X) 4.1.5g Root formation in V5 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) 51 (1X) 4.1.5h Root formation in V6 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) 51 (1X) 4.1.5i Root formation in V7 in MS + BAP 0.1 + Kin 0.1+ IAA 2.0 (mg/L) 51 (1X) 4.1.5j Root formation in V8 in MS + BAP 0.2 + Kin 0.1+ IAA 3.0 (mg/L) 51 (1X) 4.1.5k Root formation in V8 in MS + BAP 0.2 + Kin 0.1+ IAA 3.0 (mg/L) 51 (1X) 4.1.5l Root formation in V10 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) 51 (1X) 4.1.6a Growth of plants shifted in mixture of Sand + Soil + Cocopeat after 10 54 days of shifting (1X) 4.1.6b Hardening of plants shifted in mixture of Sand + Soil + Vermicompost 54 after 10 days of shifting (1X) 4.1.6c Growth of plants in open field (1X) 54

viii

4.2.1.1.1a Germination rate of control plants of V1 after 16 days (1X) 61 4.2.1.1.1b Germination rate of V1 at dose of 10 Gy after 8 days (1X) 61 4.2.1.1.1c Germination rate of control plant of V2 after 10 days (1X) 61 4.2.1.1.1d Germination rate of V2 at 10.0 Gy after 29 days (1X) 61 4.2.1.1.1e Germination rate of control plant of V3 after 18 days (1X) 61 4.2.1.1.1f Germination rate at dose of 10 Gy of V3 after 32 days (1X) 61 4.2.1.1.1g Germination rate of control plant of V4 after 14 days (1X) 61 4.2.1.1.1h Germination rate of V4 at dose of 10 Gy after 35 days (1X) 61 4.2.1.1.2a Leaf length and width of control plant of V1 (1X) 64 4.2.1.1.2b Leaf length and width at 10.0 Gy of V1 (1X) 64 4.2.1.1.2c Leaf length and width of control plant of V2 (1X) 64 4.2.1.1.2d Leaf length and width of V2 at 10 Gy (1X) 64 4.2.1.1.2e Leaf length and width of V3 at 00 Gy (1X) 64 4.2.1.1.2f Leaf length and width at 10.0 Gy of V3 (1X) 64 4.2.1.1.2g Leaf length and width of non-irradiated plants of V4 (1X) 64 4.2.1.1.2h Leaf length and width of non-irradiated plants of V4 (1X) 64 4.2.1.1.3 Effect of different doses of gamma rays on plant height of Oriental 65 cultivars 4.2.1.1.4 Plant height of Oriental cultivars at different doses of gamma rays 66 a-g (1X) 4.2.1.2.1 Effect of different doses of gamma irradiations on in vitro growth of 71 a-d stationary cultures of Oriental cultivars (1X) 4.2.1.2.2 Effect of different doses of gamma irradiations on in vitro growth of 73 a-d shaking cultures of Oriental cultivars (1X) 4.2.1.2.3 Effect of different amount of sucrose g/L on bulblet formation of 75 a-d Oriental cultivars (1X) 4.2.1.2.4 Effect of different doses of gamma irradiations on plant height, leaf 79 a-h length and width (cm) of M1V4 generation of Oriental cultivars (1X)

4.2.1.2.5a Effect of radiation on number of roots of M1V4 generation of in vitro 80 derived mutants of Oriental cultivars

4.2.1.2.5b Effect of radiation on root length of M1V4 generation of in vitro 80

derived mutants of Oriental cultivars

4.2.1.2.5 Rooting of M1V4 generation of Oriental cultivars (1X) 81 c-f 4.2.1.2.6 Flowers of M1V5 generation of Oriental cultivars (1X) 83 a-d 4.2.1.2 Flowers of M1V5 generation of Oriental cultivars (1X) 83 e-h 4.2.2.1.1 Germination response of Oriental x Trumpet cultivars at different 89 a-d doses of gamma rays (1X) 4.2.2.1.1 Germination rate of Oriental x Trumpet cultivars of at different doses 90 4.2.2.1.1 of gamma rays (1X) e-h 4.2.2.1.2 Leaf length and width at different gamma rays doses (1X) 92 a-g 4.2.2.1.3 Effect of different doses of gamma rays on plant height of 93

Oriental x Trumpet cultivars 4.2.2.1.4 Plant height of Oriental x Trumpet cultivars at different doses of 94 a-g gamma rays (1X) 4.2.2.2.1 Effect of different doses of gamma irradiations on in vitro growth of 198 a-d stationary cultures of Lilium Oriental x Trumpet cultivars (1X) 4.2.2.2.2 Effect of different doses of gamma irradiations on in vitro growth of 100 a-d shaking cultures of Lilium Oriental x Trumpet cultivars (1X) 4.2.2.2.3 Effect of different amount of sucrose g/L on bulblet formation of 102 a-d Oriental x Trumpet cultivars (1X) 4.2.2.2.4 Effect of different doses of gamma irradiations on plant height, leaf 106 a-h length and width (cm) of M1V4 generation of Lilium Oriental x Trumpet cultivars (1X)

4.2.2.2.5a Effect of radiation on number of roots of M1V4 generation of in vitro 107 derived mutants of Oriental x Trumpet cultivars

4.2.2.2.5b Effect of radiation on root length of M1V4 generation of in vitro 107 derived mutants of Oriental x Trumpet cultivars 4.2.2.2.5 Rooting of M1V4 generation of Oriental x Trumpet cultivars of Lilium 108 c-f (1X) 4.2.2.2.6 Flowers of M1V5 generation of Oriental x Trumpet cultivars of Lilium 110 a-d (1X)

4.2.2.26 Flowers of M1V5 generation of Oriental x Trumpet cultivars of 111 e-h Lilium (1X) 4.2.3.1.1 Germination rate of Longiflorum x Oriental cultivar of Lilium at 113 a-b different doses of gamma rays (1X) 4.2.3.1.2 Leaf length and width at different gamma rays doses (1X) 114 a-b 4.2.3.1.3 Effect of different doses of gamma rays on plant height of 115 Longiflorum x Oriental cultivar of Lilium 4.2.3.1.4 Plant height of Longiflorum x Oriental cultivar of Lilium at different 115 a-b doses of gamma rays (1X) 4.2.3.2.1 Regeneration frequency of stationary cultures of Longiflorum x 117 a-b Oriental cultivar of Lilium at different doses of gamma rays (1X) 4.2.3.2.2 Regeneration frequency of shaking cultures of Longiflorum x Oriental 118 a-b cultivar of Lilium at different doses of gamma rays (1X) 4.2.3.2.3 Effect of different amount of sucrose g/L on bulblet formation of 120 a-d Longiflorum x Oriental cultivar (1X) 4.2.3.2.4 Plant height and leaf length of V9 in vitro regenerated plant (1X) 122 a-b 4.2.3.2.5 Effect of radiation on number of roots of M1V4 generation of 123 a in vitro derived mutants of Longiflorum x Oriental cultivar (1X) 4.2.3.2.5b Maximum number of roots of in vitro derived V9 at 10.0 Gy (1X) 123

4.2.3.2.5c Effect of radiation on root length of M1V4 generation of in vitro 124 derived mutants of Longiflorum x Oriental cultivar (1X) 4.2.3.2.5d Highest root length (cm) of in vitro derived V9 at 10.0 Gy (1X) 124 4.2.3.2.6 Flower morphology of V9 plants (1X) 125 a-b 4.2.4.1.1 Germination rate of Longiflorum cultivar of Lilium at different doses 127 a-b of gamma rays (1X) 4.2.4.1.2 Leaf length and width at different gamma rays doses (1X) 128 a-b 4.2.4.1.3 Effect of different doses of gamma rays on plant height of 129

Longiflorum cultivar of Lilium 4.2.4.1.4 Plant height of Longiflorum cultivar of Lilium at different 129 a-b doses of gamma rays (1X)

4.2.4.2.1 Regeneration frequency of stationary cultures of Easter lily Plants 131 a-b (1X) 4.2.4.2.2a Regeneration frequency in control plants of shaking cultures of Easter 132 lily (1X) 4.2.4.2. Effect of different amount of sucrose g/L on bulblet formation of 134 3a-d Lilium Longiflorum x Oriental cultivar (1X) 4.2.4.2.4 Plant height and leaf length of in vitro regenerated plants of V10 (1X) 136 a-b 4.2.4.2.5a Effect of radiation on number of roots of M1V4 generation of 137 in vitro derived mutants of Longiflorum cultivar 4.2.4.2.5b V10 showing rooting in control plants (1X) 137

4.2.4.2.5c Effect of radiation on root length of M1V4 generation of in vitro 138

derived mutants of Longiflorum cultivar (1X) 4.2.4.2.5d Root length of V10 in control plant (1X) 138 4.2.4.2.6 Flower morphology of control and mutant of V10 (1X) 139 4.3.1.1 Agarose gel showing RAPD amplification profile by Primer 148 LP-04; L, 1 kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink 4.3.1.2 Agarose gel showing RAPD amplification profile by Primer 148 LP-07; L, 1kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink 4.3.1.3 Agarose gel showing RAPD amplification profile by Primer 148 LP-10; L, 1kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink 4.3.1.4 Agarose gel showing RAPD amplification profile by Primer 149 LP-02; L, 1kb (+) bp Standard Ladder; C) Heaven white control; 2.0-10.0) corresponds to irradiated genotypes of Heaven white 4.3.1.5 Agarose gel showing RAPD amplification profile by Primer LP-10; 149 L, 1kb (+) Standard Ladder; C) Kabana lily control; 2.0-10.0) corresponds to irradiated genotypes of Kabana lily 4.3.1.6 Agarose gel showing RAPD amplification profile by Primer LP-10; 149 a-b L, 1kb (+) Standard Ladder; C) Kabana lily control; 2.0-10.0) corresponds to irradiated genotypes of Kabana lily

xii

4.3.1.7a-d Phylogenetic relationship of 4 Lilium Oriental cultivars included the 150 irradiated and non-irradiated genotypes of Samur La pink, Heaven white, Kabana lily and Montezuma-O-Red/white by using RAPD markers 4.3.2.1 Agarose gel showing RAPD amplification profile by Primer LP-03 & 157 a-b LP-08; L, 1kb (+) bp Standard Ladder; C) Star fighter-O-red/white; 2.0-10.0) corresponds to irradiated genotypes of Star fighter-O-red/w 4.3.2.2 Agarose gel showing RAPD amplification profile by Primer LP-10; 157 L, 1kb (+) bp Standard Ladder; C) Advantage La salmon; 2.0- 10.0) corresponds to irradiated genotypes of Advantage La salmon 4.3.2.3 Agarose gel showing RAPD amplification profile by Primer LP-06 & 158 a-b LP-08; L, 100 bp Standard Ladder; C) Golden tycon yellow ; 2.0 -10.0) corresponds to irradiated genotypes of Golden tycon yellow 4.3.2.4 Agarose gel showing RAPD amplification profile by Primer LP-09; 158 L, 100 bp Standard Ladder; C) Orange pixie; 2.0-10.0) corresponds to irradiated genotypes of Orange pixie 4.3.2.5 Phylogenetic relationship of 4 Oriental x Trumpet cultivars included 160 a-d the irradiated and non-irradiated genotypes of Star fighter-O- Red/white, Advantage La salmon, Golden tycon yellow and Orange pixie by using RAPD markers 4.3.3.1 Agarose gel showing RAPD amplification profile by Primer LP-01; L, 163 1kb (+) Standard Ladder; C) Courier La white; 2.0-10.0) corresponds to irradiated genotypes of Courier La white 4.3.3.2 Agarose gel showing RAPD amplification profile by Primer LP-05; L, 163 1kb (+) bp Standard Ladder; C) Courier La white; 2.0-10.0) corresponds to irradiated genotypes of Courier La white 4.3.3.3 Phylogenetic relationship among control and mutants of Longiflorum 164 x Oriental cultivar by using RAPD markers 4.3.4.1 Agarose gel showing RAPD amplification profile by Primer LP-04; L, 167 1kb (+) bp Standard Ladder; C) Easter lily; 2.0-10.0) corresponds to irradiated genotypes of Easter lily

xiii

4.3.4.2 Agarose gel showing RAPD amplification profile by Primer LP-11; L, 167 1kb (+) bp Standard Ladder; C) Easter lily; 2.0-10.0) corresponds to irradiated genotypes of Easter lily 4.3.4.3 Phylogenetic relationship among control and irradiated cultivar of 168 Easter lily of longiflorum group by using RAPD markers 4.4.1.2 Dendrogram showing relationships among irradiated and non-irradiated 177 a-b genotypes of Samur La pink and Heaven white cultivars included in Oriental group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps) 4.4.2.2 Dendrogram showing relationships among irradiated and non- 185

irradiated genotypes of Star fighter-O-red/white and Advantage La salmon cultivars included in Oriental x Trumpet group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps) 4.4.3.2 Dendrogram showing relationships among irradiated and non-irradiated 188 genotypes of Courier La white included in Longiflorum x Oriental group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps) 4.4.4.2 Dendrogram showing relationships among irradiated and non- 191 irradiated genotypes of Easter lily included in Longiflorum group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps)

xiv

List of Abbreviations

% Percentage ± More or less µM Micromole AMOVA Analysis of molecular variance ANOVA Analysis of variance ASSR Anchored simple sequence repeat BAP 6-benzyl amino purine BME β-mercaptoethanol bp Base pair cm Centimeter Conc. Concentration cpDNA Analysis of chloroplast DNA CTAB Cetyl Trimethyle ammonium bromide DNA Deoxyribonucleic acid DNMR Duncan’s new multiple range dNTPs Deoxynucleotide triphosphate EDTA Ethylene diamine tetraacetic acid EST Expressed Sequence Tag EU Europe Fig. Figure g Gram g/L Gram per litre Gy Gray H obs Observed heterozygosity hrs Hours IAA Indole-3-Acetic acid IBA Indole-3-Butyric acid Ibs/inch2 Pounds per square inch ISSR Intersimple sequence repeat KGy Kilo Gray Kin Kin

L. Linnaeus

M1V1, M1V2….. Vegetative generations 1, 2… of the mutants on mutagenic treatment mg/L Milligram per litre min Minutes mL Millilitre mM Millimolar MS Murashige and Skoog’s basal medium NAA Naphthalene acetic acid PPM Plant preservative mixture PCR Polymerase Chain Reaction pH Power of hydrogen ion concentration PIC Polymorphic Information Content PPM Plant preservative mixture RAPD Random amplified polymorphic DNA RFLP Restriction fragment length polymorphism Rpm Revolution per minute SSR Simple Sequence Repeat TAE Tris acetate EDTA TDZ 1-phenyl-3-(1, 2, 3- thiadiazole) urea TE Tris - EDTA UPGMA Un-Weighted Pair Group Method with Arithmetic Averages UV Ultra violet radiation V Voltage μM Micromola

xvi

ABSTRACT

Lilium is one of the six major bulbous genera crops and also one of the leading cut flowers all over the world. It has three important markets: fresh-cut flowers, potted flowering plants and bulbs for domestic gardens and formal landscapes. So keeping in view the importance of this ornamental plant, the present study was conducted to induce mutation (in vivo and in vitro mutagenesis) in different cultivars of Lilium to get the new varieties having better morphological traits including plant height, leaf and flower size, flower shape and flower colour. For this purpose an efficient protocol has been optimized for micropropagation of ten cultivars present in four major groups (Oriental, Oriental x Trumpet, Longiflorum x Oriental and Longiflorum) of Lilium to get the shoots that were further used as plant material for in vitro mutagenesis.

MS medium fortified with BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) has been found to be best for shoot initiation. Effect of shaking cultures and sucrose concentration was also observed in the present study. It was observed that cultures inoculated in the same medium but in agitation position with 120 (rpm) showed higher regenerated frequency as compared to stationary cultures. Similarly moderate sucrose concentration (60 g/L) proved to be better as compared to 30 and 90 (g/L). Healthy regenerated plantlets were acclimatized in sterile mixture of sand, soil and cocopeat in the ratio of 1:1:1.

Mutagenesis was induced in all the groups of Lilium including by treating the bulbs (in vivo mutagenesis) and regenerated shoots (in vitro mutagenesis) through plant tissue culture during the first phase of current study with different doses of gamma rays 2.0-10.0 (Gy). It was noticed that growth of plants in both in vivo and in vitro mutagenesis was affected by gamma rays. Except in Samur La pink cultivar of Lilium, higher doses have inhibitory effect on plant growth, but in Samur La pink of Oriental group of Lilium, stimulatory effect was observed at higher doses of gamma rays. Superior mutants were selected on the basis of change in flower morphology. Larger flowers with smooth petals were obtained at 10.0 (Gy) dose of gamma irradiation. Similarly changes in flower morphology were also noticed in Montezuma-O-red, Advantage La salmon, Golden tycon yellow and Easter lily cultivars of Lilium at different gamma irradiation doses. It is evident from the results of present investigation that mutagenesis combined with plant tissue technique lead to varietal improvement of different cultivars of Lilium.

xvii

Further study was also carried out to make the molecular characterization of control and mutants of same cultivar to detect the genetic polymorphism and variations. Two different molecular marker systems including Random Amplified Polymorphic DNA (RAPDs) and Simple Sequence Repeats (SSRs) were selected for the purpose.

Among the molecular markers, Randomly Amplified Polymorphic DNA (RAPDs) was used as a marker of choice in the present investigation. It was noticed that mutagenesis caused changes at genetic level and separated the control genotypes from the irradiated ones into different groups depending on the genetic variation occurred at different doses. Mostly control and mutants treated at lower doses of gamma rays were combined in one group while genotypes treated at higher doses were separated in another group.

Other molecular marker system selected for the present investigations was Simple Sequence Repeats (SSRs) due to high level of polymorphism and reliability. Genetic polymorphism along with the respective allele sizes, PIC (Polymorphic Information

Content) values and Hobs (Observed heterozygosity) of the cultivars was also recorded. These markers also separated the control and mutant genotypes on the basis of doses of gamma rays like RAPDs.

It is evident from the above results that mutagenesis (in vivo and in vitro) caused genetic variations proved by RAPDs and SSRs which lead to production of new varieties having improved morphological traits.

INTRODUCTION

The ornamental industry has become an important economic force in recent years, in the UK alone this industry is estimated to be around £2.1 billion, while the international trade is around £60-75 billion. Imports of flowers and plants slightly increased in recent years in quantity and value. Cut flowers are mainly responsible for the increases in the import of flowers and plants. Compared to the previous year, the import of cut flowers to the EU during the first half of 2013 rose by 8% by value, and 15% compared to 2011 (Schreiner et al., 2013). Introducing new cultivars with important changes in the main agronomic features such as pathogen resistance, new flower colour development contributing vital role in the success of floriculture industry.

Lilium contains large beautiful ornamental flowers which increases its demand at commercial level (Pizano, 2003). The five nations with major demand for ornamentals are United States, France, United Kingdom, Germany and Netherlands, importing nearly 70% of the total worldwide. In the production of ornamental plants, countries like Netherlands, Colombia, Israel and Kenya are the global leaders, with Ecuador, India and Malaysia rapidly growing in importance. The plant is not the native of Pakistan; so far it is imported from the other countries.

The annual sales from potted plants worldwide are approximately £13 billion and are increasing each year. Quality and diversity of ornamental plants and flowers has also increased recently due to an increased knowledge and demand from the final consumer. This diversity is not always easy to achieve. The main innovations that the market seeks are the development of new varieties and an attractive price to encourage consumers. Their choice is influenced mainly by flower colour and pattern, plant architecture and by resistance to pests and disease. The Netherlands controls 93% of the world trade in the ornamental bulb industry, including bulbs, corms and tubers and by 2005 was exporting $92 million in bulbs (Grassotti and Gimelli, 2010). The genera that are most widely produced, utilizing more than 20,921 hectares of land are: Gladiolus, Hyacinthus, Iris, Lilium, Narcissus and Tulipa. These six genera effectively represent 90% of the world's flower production from bulbs (Chandler and Tanaka, 2007). Due to presence of beautiful, highly scented and attractive large cut flowers of Lilium, this genus becomes a perfect objective for utilization by the ornamental market.

Among the bulbous plants, Lilium is the most important sixth major bulbous crop having great importance all over the world (Kumar et al., 2007). It has three important markets: fresh-cut flowers, potted flowering plants and bulbs for domestic gardens and formal landscapes. In The Netherlands in 2005, 4,280 hectares were dedicated to Lilium bulb production giving a yield of 2.2 billion bulbs for that year; an additional 200 hectares were dedicated to the cultivation of Lilium for cut flower production, giving more than 410 million stems. Increases in production are principally due to the availability of novel varieties produced by breeders primarily in upright Longiflorum and Oriental lilies (Van Tuyl, 1996). Japan is the second most important Lilium bulb producer after The Netherlands, dedicating 430 hectares for production of about 67 million bulbs, and 550 hectares to produce 157 million cut stems (Grassoti and Gimelli, 2010). Japan has played an important role in breeding and developing Easter lily, Asiatic and Oriental hybrids (Xia et al., 2013).

The Lilium genus approximately contains 100 species which are spread around the cold and temperate regions of the northern hemisphere (Nishikawa et al., 2001). The Royal Horticultural Society is the international registration authority for cultivated lilies and it has established nine divisions, and subdivisions that are based on flower form (trumpet, bowl, flat or recurved) and floral habit (out-, up- or facing-down).

Lilium has white-yellow, non-tunicated bulbs composed of numerous modified leaves or scales and a compressed stem or basal plate. The bulb is globose and the scales contain stored reserves. The scape, or stalk, is erect and stout. The number of leaves depends on the cultivar (Miller et al., 1993). Leaves can be lanceolate, linear or elliptical. Flowers are white for L. longiflorum and fragrant, funnel-shaped and multi-coloured for Oriental hybrids. The perianth segments, or tepals, are composed of three sepals and three petals with an oblanceolate shape. The six anthers are yellow orange; the stamens are shorter than the pistil. The colour of flowers varies from deep purple to flaming red and white; there are no blue floral forms to date. Flowers can be heavily scented, with diverse shapes; flowering times have been considerably extended due to selection for diversity in modern hybrids (Beattie and White, 1993).

The main goals for lily breeding programs are focused on forcing a shorter time for initiation of flowering, delayed senescence and an extended post-harvest life, low nutritional requirements, introduction of wider colours and forms in flowers, improved

fragrance, elimination of staining pollen and pest, disease and virus resistance (Miller, 1993). Objective is the development of varieties that can resist, or be tolerant to pathogens (Moose and Mumm, 2008).

Advances in biotechnology, especially by using the tissue culture techniques as an substitute to the conventional practices have shown several benefits including increase in the multiplication level to many times and the out product obtained is free of microorganisms.

Propagation of Lilium by vegetative method produces normally three to four bulbs per scale depend on the size and variety of the bulb. The efficiency of the bulbs to multiply is also very slow and also the regenerated plantlets are more vulnerable to diseases. To overcome the problems, it is very important to organize the methods for multiplication and propagation by using plant tissue culture techniques (Nesi et al., 2009). In vitro propagation of lilies by using plant tissue culture practice has been reported by Chang et al. (2000) since lilies as well as other bulbous plants exhibit high regeneration potential. By using plant tissue culture techniques, flower formation from the bulb scales becomes very easy and this practice has been manipulated by many scientists for regeneration of lily plants on large scale (Varshney et al., 2000; Nhut et al., 2002; Van Tuyl and Lim, 2003).

To get the successful output at commercial level, it is very important to bring varietal improvement and increasing productivity and reduce time for bulb production by using in vitro techniques.

Nuclear techniques have been widely used to produce new genotypes with better traits in agriculture. The phenomena involved the treatment of plant material (seeds and bulbs) with radiations which lead to cause variations at genetic level (Ashraf and Foolad, 2005)

Gamma rays are types of electromagnetic radiation which are most energetic than others (Kovacs and Keresztes, 2002). The technology of using gamma radiation results in the modification of physiological characters (Troja et al., 2008). These rays are ionizing and produce free radicals in cells when come in contact with different atoms and molecules. These generated radicals can affect the main components within plant cells in different aspects depends on the dose of irradiation at morphological, anatomical and physiological level (Kovacs and Keresztes, 2002; Kim et al., 2004; Wi et al., 2007; Ashraf, 2009; Ilyas and Naz, 2014).

Mutant varieties with higher yield of essential oil and curcuminiods in turmeric has been developed by using mutagenesis technique through gamma irradiation (Ilyas and Naz, 2014). The main plan of induced mutagenesis in plant breeding programme is the varietal improvement of plants with better traits that increase their quality value (Ahloowalia and Prakash, 2004).

To access whether regenerated plantlets which are morphologically different from each other are either differ genetically or not, molecular techniques (RAPD & SSR) have been used.

The use of molecular markers becomes an efficient method for the characterization of different important plant species and cultivars (Pounders et al., 2007; Wang et al., 2009). Therefore, these markers are useful in the breeding programme which meant to produce new cultivar containing improved traits and characters (Heffner et al., 2009; Diaz et al., 2011). Plant genetic diversity was also screened by using various molecular methods to improve taxonomical features or also to establish improved cultivars (Gismondi and Canini, 2013; Gismondi et al., 2014) by using various techniques.

These molecular markers helps in the generation of phylogenetic and population genetic studies which have shown the accuracy and effectiveness of these practices (Archak et al., 2003).

Many reports have described the beneficial use of some other markers like ISSR (intersimple sequence repeat) which cause amplification of the sequence between the two simple repeats. Genetic analysis by using the ASSR markers was also reported (Yamagishi et al., 2002).

Work has been done to determine the optimum doses of acute gamma radiation for many crops which describe the morphological variations as affected and developed from acute gamma irradiation and analysis of the data by using the microsatellite DNA markers. Inter simple sequence repeats (ISSRs) are used as important markers for genotype identification and also for analysis of genetic variability even in individuals which showed great

relationship among them (Tóth et al., 2000). Simple sequence repeats (Microsatellites) are often tandem repeat motifs of 1-6 bp in length (Taheri et al., 2014).

Aims and objectives

Keeping the above points in view, present work was focused on to study the effect of radiation on varietal improvement of regenerated plants of Lilium and their characterization through molecular markers. The objectives of the present study were as following:

 Development of an efficient method for multiplication of Lilium varieties by use of plant tissue culture technology.

 Induction of mutation to get new varieties of the parent plant.

 Mutants produced have improved morphological characteristics including plant height, leaf length (cm), leaf width (cm), flower size and pattern.

 To evaluate the changes in plant morphology of produced mutants, genetic analysis through RAPD and SSR.

REVIEW OF LITERATURE

The present study was done to induce mutation in different cultivars of Lilium to get the new variety having better morphological traits including plant height, leaf and flower size, flower shape and flower colour. Mutants with improved characteristics were further multiplied through plant tissue culture technique. DNA analysis by RAPD and SSR markers was used to analyze mutagenesis to evaluate the genetic polymorphism of Lilium.

2.1: Family Liliaceae

Approximately Liliaceae contains 250 genera and 3500 species worldwide and in subtropical and temperate regions; it divides into 57 genera and 726 species. Liliaceae family consists of all the members having great economic importance. Main among them includes species of various families Aloe, Fritillaria, Allium, Hemerocallis, Lilium, and Tulipa. Introduced cultivated ornamentals in China include genera Ornithogalum Linnaeus, Sansevieria Thunberg, Ruscus Linnaeus and Yucca Linnaeu (Dhyani and Sims, 2007).

2.1.1: Lilium Genus

The genus Lilium divides into seven sections (De Jong, 1974) with almost 100 species. This genus attained huge importance in the world flower market due to diversity and commercial availability of large no of hybrids and cultivars, mainly used as cut flower and also economic importance of the genus increased due to medicinal and nutritive value. Lilium flower is mainly a trumpet shaped flower with several colors includes red, yellow, pink, orange and certain varieties of lilies have different pattern like deeper color on their inner petal sides. These varieties are native of northern hemisphere, but also exist in northern sub tropics too. Mainly garden plants are very important culturally. The plant can exist in all kinds of climate and found mostly in all United states (Wawrosch et al., 2001).

2.1.2: Habitat

Family Liliaceae is distributed widely throughout the cold and temperate regions. Species which are mostly native of the temperate northern hemisphere, however the array spreads towards the northern subtropics area (Barba-Gonzalez et al., 2005). Usually the bulbs are intensely submerged; exceptions are also found in the occurrence of some species near the soil surface. Stem to root formation present in numerous cultivars. Naturally bulb grows at some depth in the soil, and as the bulb emerges from the soil, it puts out adventitious roots

above the bulb every year. Another type of roots formed is basal roots but these one are in addition to the basal roots.

2.1.3: Habit and Taxonomy

The plant is a bulbous, perennial herb. Leaves are basal arranged in a rosette, oblanceolate and linner manner with simple erect peduncle containing bract like leaves. Peduncle is simple erect with many covering or bract like leaves. Scapiform inflorescence is present. Flowers are actinomorphic and bisexual. Ovary is superior (Chen et al., 2003).

2.2: Economic importance:

2.2.1: As an ornamental plant

Freshly cut flowers are living tissues that grow as a part of a plant and are separated from it (Chow et al., 2008). Many horticulturists harvest their own cut flowers from local gardens, but there is also an important vendible market and supply industry for ornamental cut flowers in maximum countries (Grassotti and Gimelli, 2010). The plants harvested differ by culture, climate conditions and the level of prosperity locally. Frequently the plants are raised definitely for the purpose depends on the growing conditions of field as well green house. Harvesting of cut flowers can also be done from the wild. Plants are commonly used in floristry, especially for decoration purposes inside a house or building. Normally the cut flowers are decorated in a pot. Cut flowers used for different decoration purposes at wedding events and also in larger buildings. This species is a valuable one from the perspective of horticulture, because of its aromatic prosperities, color spectrum, and adapt to different environmental conditions, and is commercially used as a cut or vase flower to enhance the beauty of gardens (Ko et al., 2002). A large number of metabolic products are obtained from the petals which lead to improved its economic position to numerous times (Mimaki et al., 1999; Rubin et al., 2015).

2.2.2: Medicinal importance

Health benefits of lily flower mainly involve help in regulation of the heart rate by letting the heart to function better and frequently. The whole process takes place without increase in oxygen amount that is necessary and essential to function by the heart muscle (Jovtchev et al., 2014). Other application of lily flower for its role in therapeutic uses is that it helps in curing the blisters that result due to burns and also in inhibiting the scar tissue formation.

This herbal medication contains lily flower roots to prepare a balm used on the damaged area to get relief. Lily flowers are also helpful during weak contractions at the time of birth during delivery. Other important herbal medicines obtained from lily flowers are helpful in the treatment of various diseases like leprosy, strokes, angina and many others. Dried flowers of Lilium plants are very useful as very effective purgative and diuretic (Francis et al., 2004). In addition to these uses, flowers and roots of lilies are used in the treatment of insect and spider bites. In particular countries roots and flower of a lily variety named as wood lily, these plant parts are used in a number of medical treatments including coughs, fevers, various types of stomach syndromes as well as for infections, lesions and to wash bumps that might have inflated and swollen. Other parts instead of root and flower like bulbs are also very useful in treating certain disorders. Fresh and dried bulb scales are identified to be very effective in cure of ulcer diseases and irritations because of their acerbic and comforting characteristics. Applying the lily flower on solid lumps and tumors will help in unstiffen them directly. Many other treatments and uses of lily flower include the extract of fresh scales of Lilium bulbs being used in treating dropsy certainly. Lily flower is also useful in cure of various skin diseases. It is used in various cosmetics to treat cuperosis. A mixture of this plant mixed with another plant root (sweet viburnum roots) was also used to treat irregular menstruation and pain during menstrual cycle. Additionally, roots of the plant in mixture with roots of blackberry plant, raspberries, and some other plants were also used to cure coughs, fevers, and other diseases (Eisenreichová et al., 2004).

2.2.3: Nutritive value

Plants belong to family Liliaceae are very nutritive in nature. Dried bulbs of lilies are very rich in sodium and also contain a large amount of fiber in it. Same to above, lily bulbs contain large amounts of proteins, starch and minute amounts of other essential nutrients like iron, calcium, phosphorous, and vitamins B1 B2 and Vitamin C. Different plant parts (Seeds, bulbs and flowers) are commonly used as food in many countries. In actual, the bulbs of Lilium are the mostly element utilized by the Native American Inhabitants. These bulbs are commonly prepared and consumed with other foods, such as fish and venison. Moreover, the bulbs are also used as flavouring and stiffening agents due to their strong bitter and spicy flavor for stews (Pieroni, 2000).

2.2.4: Other Uses

In addition to medicinal, health and other nutritive benefits, lily flower also has definite many other uses. An essential oil made from flowers of the plants which is very useful in the treatment of aromatherapy to treat persons having depression because it have properties to help in making a sensation of modesty, pleasure as well assense of confidence. In perfume industry, lily flowers are also used to produce oil which is also a significant element (Plants and Khare, 2007).

Stems of lily flower are very sweet in nature and have chewy properties as well also have a slight vegetable flavor similar to some other plants, so due to these characteristics, used by the Asian people for cooking. The Japanese peoples use the bulb scales which are sweet in taste and pulpy in nature to make a number of dishes (Varshney et al., 2001)

2.3: Plant tissue culture

2.3.1: Why plant tissue culture techniques

Progresses in the field of biotechnology, especially in case of in vitro propagation techniques are vital to improve the yield and quality of different plants. These methods for propagation of bulbous and many other plants are used as a substitute to the routine techniques with many benefits and advantages: the multiplication rate increased many times and the production of disease free material

Basically micropropagation is used to get disease free material by using apical meristems, shoot tips for commercialization purpose (Ahloowalia and Prakash, 2004). Different scientists used different plant parts for tissue culture like scales of Easter lily used as explant were inoculated on MS medium fortified with various kinds of growth regulators (6-benzyladenine and naphthalene acetic acid). MS medium added with 15 μM BAP and NAA (0.5 μM) was used to achieve the large number of plants i.e. (100%) after a period of one month. Rooting is best in medium containing auxins. 5 μM indole-3-butyric acid was very effective for formation of roots. A large number of adventitious shoots were obtained

from the callus and (70%) organogenesis results on MS medium fortified with 2, 4-D (18µM) with multiple numbers of shoots (Kanchanapoom et al., 2011).

In vitro propagation of two cultivars of Lilium has been done by using cost-effective and simple technique. After seventeen days of culturing, approximately seven bulblets were produced by using scale of the bulb as explant and the medium used for the purpose was MS with naphthaleneacetic acid (NAA) i.e. 0.5mM and 30 gram sucrose. MS medium containing same amount of growth regulator but with increased amount of sucrose i.e. 6 to 9 % resulted in increase in no of bulblets depends on the cultivar. Culture conditions given for the experiment were 16/8 h photoperiod. Different growth regulators were also used by other scientists for the mass multiplication of bulblets by using the in vitro regenerated explants which are scale of the bulb (secondary explants). Medium used for inoculation contain Kin 23 (mM) + NAA 0.5 (mM) and also scale propagation was carried out by using the liquid stationary technique added with MS basal medium. After acclimatization in green house, all bulblets developed into fully mature plants which flowered in the first season (Varshney et al., 2000). By using seeds as an explant, Skoric et al. (2012) established a protocol for bulblet formation of two Lilium species (Lilium martagon var. cattaniae). Due to exogenous supply of BAP, production of adventitious bulblets resulted from the scale of the bulb on MS medium fortified with BAP 0.2 mg/L + IAA 2.0 mg/L. It was noted that an average of about five bulblets were produced after 2 months of inoculation and well rooted plants were successfully hardened in green house for acclimatization.

Rapid initiation and propagation in some species of Lilium has been described well by using micropropagation technique of plant tissue culture technology. Plant regeneration was obtained from in vitro regenerated plant leaves of four hybrids species, inoculated on MS basal medium combined with different cytokinins (TDZ and BAP) and auxins (NAA and IBA) at various concentrations. Direct plant regeneration occurred with all tested media for different Lilium species and Oriental specie ‘Star Gazer’. Callus developed on TDZ-enriched medium from leaf segments of L. longiflorum cv. ‘Snow Queen’ regenerated by direct organogenesis. This occurred on a medium with auxin/ cytokinin balance which was lower than other genotypes (Bacchetta et al., 2003) and in hybrid lilies also (Lian et al., 2002). Han et al., (2005) inoculated scales of Lilium bulbs on MS medium containing BAP to induce shoot formation. Results were achieved after six weeks showing highest

frequency of plantlet formation that is 92.3 % in the MS medium containing 0.4–8.9 μM BAP. MS medium containing BAP i.e. 2 µM was mainly successful in shoot formation from scales of Lilium.

In vitro culturing by using scales is most suitable method for getting productive vegetative growth of Lilium plant (Bahr and Compton, 2004). Shoot formation was achieved by using in vitro produced leaves of L. davidii var. by inoculating them on different 26 media based on NN (Nitsch and Nitsch, 1969) medium, containing various amount and concentrations of cytokinin i.e. TDZ combined with different amount of auxin i.e. α-naphthaleneacetic acid (NAA). No callus formation was observed in the study and plant formation occurs directly from the inoculated explant. Plant regeneration mostly shoot regeneration mainly starts from the lower portion of the leaf. Maximum regeneration frequency observed was (93.3%) and also the maximum no of shoots produced per leaf L). Culturing of these regenerated shoots in the MS half strength medium contained indole-3-butyric acid (IBA) differ in the range i.e. 0.1-0.5 (mg/L) in concentration. Whole process completed in 30 days and after acclimatization 92% of regenerated plants persisted (LingFei et al., 2009).

Many species of Lilium longiflorum Thunb., are generally reproduced by means of vegetative propagation because of its great importance in ornamental industry as pot plant. In vitro technique commonly used for mass propagation of the plant has been carried out through micropropagation and also through callogenesis. Different techniques are further used for increasing the number of bulblets produced through callogenesis including cell suspension culture. By using the above method, large no of bulblets were obtained from the produced calli within one month. The shaking culture practice of calli is perfectly suitable for obtaining constant regenerants on commercial level in this species (Priyadarshi and Sen, 1992). Takayama and Misawa (1982) observed the consequence of Naphthalene acetic acid, and Kin and other cytokinins on plant regeneration from scales of Lilium bulb and noticed that out of different hormones tested BAP showed stimulating effects on growth of plant including both shoot and root formation. Different concentration of Cytokinins and auxins were also used by another scientist Azadi and Khosh-Kui (2007), they used various concentrations of BAP + NAA for the induction of multiplication in in vitro formed plants of Lilium. MS medium containing (0.1 BAP + 0.1 NAA) mg/L proved superior to all others concentrations. Plant formation from explants i.e. bulbs of Lilium depends on factors such as hormone amount, sucrose amount and light duration (Kumar et al., 2007).

Lilium nepalense D. Don is very expensive ornamental plant of Nepal. Micropropagation of this plant has been done by using twin scales as explant. Shoot formation occurred from these twin scales which axillary and multiplication is of was done by using MS medium fortified with zeatin 20 μM. Time period for shoot formation was one month and number of shoots formed was seven from one inoculated explant. Rooting of the plants was done in the medium added with auxin hormone and after roots formed, the plantlets were successfully hardened in green house and field. Initial trials in Nepal showed that this methodology is very successful for the mass production of Lilium plants at commercial level and this method can be used as an substitute to conserve the plant natural resources (Wawrosch et al., 2001).

Joshi and Dhar (2009) used different sucrose concentrations and studied that from various sucrose concentrations used the concentration at 4.5% (w/v) showed higher frequency of bulblet formation (i.e., 71 and 79 plant formation on callus and bulblet scale explants, respectively). Lian et al., (2002) described that bulblet size increased by increasing the sucrose amount in the medium i.e. 90 g/L of sucrose. More bulblet growth by using high sucrose concentration was also reported by Han et al., (2005). Chang et al., (2000) done callogenesis of Lilium cultivar (Lilium speciosum) by using ray bud as starting plant material. Callus developed into plants after shifting the calli on medium containing naphthalene acetic acid 0.1 mg/L.

El-Naggar et al. (2012) reported that concentration of BAP at 0.5 (mg/L) produced the maximum shoots while lower concentration i.e. BAP 2.0 mg/L reduced the shoot formation frequency. It was reported by Pelkonen and Kauppi (1999) that many other in vitro propagation techniques have been widely used to get disease free planting material of Lilium but propagation by means of somatic embryos and organogenesis have not been described in detail. The percentage of the in vitro regenerated explants increased with addition of various polyamines when scales were used as explants in the Lilium longiflorum specie (Tanimoto and Matsubara, 1995).

2.4: Induced mutagenesis

2.4.1: Why Mutagenesis

The technology of plant mutagenesis has become the fast and recent advancement in creating high-resolution in the plant breeding by using various molecular and biochemical

practices. Mutation induction is a vast alternative technique in different plant breeding programme for causing changes at DNA level and lead to production of variants with improved genetic traits. Novel screening ways combined with variation resulted due to mutagenesis in many populations and characteristics which are not easily identified by conventional breeding approaches are now being easily detect and characterized by using different molecular techniques (Sikora et al., 2012).

Induced mutagenesis has become an essential step in the improvement of different plant crops and is now very effective in practical use due to the development and combination of many other important selection systems like in vitro propagation including micropropagation and some other in vitro culture methods alongwith use of molecular markers and practices in enhancing the important crop breeding functions (Roychowdhury and Tah, 2011). Through induced mutation, plants improved characters include compact growth, attractive variegated leaves and novel flower colour and shapes are resulted (Ahmad et al., 2012).

Mutation breeding is an established method for crop improvement and show a significant role in the production of new varieties having numerous new characteristics including new flower colours and shapes in many crops mainly in ornamental plants. As mutation appears as a chimera after action with physical and/or chemical mutagens, it is the main tailback with vegetatively propagated plants. A little part of a plant undergo mutation cannot be cut off using the presented predictable breeding methods. Induced mutagenesis is an established method for plant improvement, and the technique has been successfully subjected for production of new and fresh ornamental varieties in particular (Matsumura et al., 2010).

2.4.2: Gamma irradiation

Gamma rays generally effect the growth of plants both in positive and negative way. It is described in some reports that exposure of the plants to higher dose of gamma rays will inhibit the growth of plants while exposure to lower dose will stimulate the growth of the plan (Thapa, 2004; Kumari et al., 2009). Gamma rays are types of electromagnetic radiation which are most energetic than others (Kovacs and Keresztes, 2002). These rays are ionizing and produce free radicals in cells when come in contact with different atoms and molecules. These generated radicals can affect the main components within plant cells

in different aspects depends on the dose of irradiation at morphological, anatomical and physiological level. Mutations induced by treating with different rays of radiation and also through insertion of different chemical mutagens played an important role in the improvement of the yield and quality of many ornamental plants (Mangaiyarkarasi et al., 2014).

2.4.3: In vitro mutagenesis

Mutagenesis combined with In vitro techniques developed an accurate method for improving the vegetatively propagated crops. In vitro mutagenesis resulted in causing changes and allows selection and mass multiplication of the wanted genotypes in short time period as compared to other conventional methods. Radiation and plant tissue culture techniques has obvious reward in propagation and is successful way to get the best phenotypes and fast breeding. It can make some new and distinctive variations when the usual changeability does not give the genes for the preferred characters (Velmurugan et al., 2010). New flower colour/shape variants in some beautiful ornamental plants have been effectively produced through radiation. Therefore, this technique has developed into an extremely significant technique for plant propagation, together with breeding. Through mutagenesis many different varieties are produced in the globe in which attractive crops and cut crops are 552 varieties (Podgorsak, 2005) and total are 2335.

Xi et al., (2012) established a regimented procedure of in vitro mutagenesis for Lilium longiflorum. Result of phytohormones including different concentrations of BAP and NAA on bud formation from the bulblet-scale thin cell layers was tested. It was observed that best results for bud formation were observed on the MS medium containing BAP 2.0 mg/L + NAA 0.1 mg/L. Highest frequency observed was 96% and no of buds formed were 3. Doses of gamma rays given to observe the effect of radiation ranges from 0 to 2.5 Gy and study was done to study the growth of bud formation from the bulblet- scale thin layers. It was noticed that production rate appreciably decreased by increasing the gamma rays dose. From the above experiment it is indicated that better results are obtained after applying dose of 1.0 gamma ray. Data was evaluated by using finger printing and mutants transferred to greenhouse, show different characters than those of control. The use mutagenesis is to produce the new varieties in less period of time having new characters is described by Jain (1999). Only some reports are available on the efficient work being done on the relative analysis of the unique and altered cultivars.

Datta (2009) studied that a large variety of mutants showing changed flower colour and shape have been produced by mutagenesis in different Lilium plants. Induced mutagenesis work was conducted from 1971 to July 2007, using both physical and chemical mutagens for improvement of a wide range of crops viz. vegetables, medicinal, pulse, oil-bearing, and ornamental crops. All classical and superior methods were widely used for the success of induced mutagenesis for the production of new varieties having great economic importance.

Radiation technology by use of gamma rays along with in vitro technique have been used to produce plants from different plant parts including nodes, intenodes, stem for in vitro management of chimera and for in vitro mutagenesis (Datta et al., 2005).

Misra et al., (2003) used mutagenic agents, such as radiation and certain chemicals for the induction of mutation and creates variations at genetic level from which preferred variants having desired traits might be chosen.

Stanilova et al., (1994) described different ways for plant formation, and morphogenetic potential of the Lilium by using in vitro techniques. Plant different organs were studied to determine their morphogenetic potential including stem, bulb, ovaries and leaves. It was observed that bulb lower part have the maximum reformation capacity. MS medium containing BAP 1mg/L and Kinetin 1mg/L and LS medium containing NAA 0.5 mg/L and Kinetin 0.1 mg/ were positive for organ formation directly by using these plant parts. A invigorating effect of a low dose of gamma rays i.e. 5 Grey growth strength and quantity of the bulblets produced by the different plant parts under controlled plant tissue culture conditions is observed.

2.6: Why molecular characterization

The use of molecular markers becomes an efficient practice for the characterization and identification of different important plant species and cultivars (Pounders et al., 2007; Wang et al., 2009). Therefore, these markers are useful in the breeding programme which meant to produce new cultivar containing improved traits and characters (Heffner et al., 2009). Plant genetic diversity was also screened by using various molecular methods to improve taxonomical features or also to establish improved cultivars (Gismondi and Canini, 2013; Gismondi et al., 2014) by using various techniques.

Arzate-Fernandez et al. (2005) used different molecular markers such as (RFLP, cpDNA, RAPD, SSR and ISSR) which allowed the scientists to examine the plant diversity at genetic level among various species in the natural environment (Wolff and Morgan- Richards, 1998; Archak et al., 2003).

Use of different DNA molecular markers helps in the construction of phylogenetic and population genetic studies which have shown the accuracy and effectiveness of these practices. Cultivars traditional populations becomes helpful in providing the beneficial resource for plant breeding and genetic diversity preservation (Reddy et al., 2002). Kölliker et al. (2003) described that the investigation, assessment, and management of plant assortment at genetic level under natural conditions are imperious towards promising the production of ecological system (Kölliker et al., 2003).

To estimate the variations created by induced mutagenesis, RAPD (DNA molecular markers) are widely used among the control and variants within and among cultivars and species as well and also to detect the relationship between the interspecific hybrids in the Lilium genus (Huang et al., 2009). Reports have also found which described the beneficial use of some other markers like ISSR (intersimple sequence repeat) which cause amplification of the sequence between the two simple repeats. Genetic analysis by using the ASSR markers was also described earlier by many researchers.

2.6.1: RAPD Analysis

Numerous DNA markers have been identified through the establishment of recombinant DNA technology to study different varieties. These markers help in testing the genetic fidelity in in vitro regenerated plants and also to characterize the genetic resources of plant and tagging. (Gupta et al., 1999).

According to analysis, many DNA markers were widely used to notice the polymorphism in the DNA regions. For the purpose of evaluating clonal fidelity in in vitro regenerated plants, different DNA molecular markers commonly used by many researchers include (RFLPs), (RAPDS) and (AFLPs). From these, RAPD analysis is mostly well appropriate and best for plant breeding programme due to its properties because it is very easy to perform, quick, consistent and cost effective (Williams et al., 1990). To detect the relationship between cultivars and species of same or different variety and also to examine the diversity at molecular level, RAPD markers are considered to be the best one and more

suitable due to their reproducible properties and cost effectiveness properties (Lanying et al., 2008; Arya et al., 2010).

Genetic analysis through the use of RAPD markers is very effective method in detecting the polymorphism percentage among irradiated and control genotypes of treated plants of gamma irradiation. Dhakshanamoorthy et al., (2011) described that the mutants produced by gamma radiation treatment are analyzed by different RAPD marker to detect the variants containing different morphological traits. RAPD are DNA markers which consist of fragments having 10 nucleotide bases. These Random DNA molecular markers are extensively used to select the clonal fidelity of produced bulblets of Asiatic group of Lilium which are regenerated by micropropagation (Varshney et al., 2001).

Genetic relationships were estimated by molecular characterization through RAPD analysis by 10 decamer primers in Lilium cultivars (Haruki et al., 1998). Varshney et al., (2001) used RAPD markers to screen the improved plantlets of Lilium which are produced through adventitious propagation way. Ikinci and Oberprieler (2010) analyzed distribution of genetic variation between populations of Lilium albanicum and Lilium chalcedonicum by means of (RAPD) amplified profiles. Analysis of plants collected from four different populations, containing 33 individuals was carried out. Eleven primers yielded 88 polymorphic bands. UPGMA clustering indicated a clear separation among the populations of the 2 species and all the analyzed individuals clustered in three groups, one comprising L. chalcedonicum and the other two groups encompassing three populations of L. albanicum. The analysis of the data carried out by using (AMOVA) represents that total variation of 33% is present between the species. The highest amount of genetic differentiation, 51% observed between the populations individually. Data obtained from the amplified profiles and phylogenetic trees generated by RAPD markers among populations of (Lilium martugon) described the variation within the same cultivar and also among different cultivars of same group (Persson et al., 1998).

Ohsawa and Ide (2008) assessing different seven morphological characters to find out the genetic variation of total seven populations of Lilium from the different altitudes (Low, middle and high). Characterization by using morphological parameters divided the population into two groups of all altitudes (Low, middle and high). Molecular characterization by using nine RAPD markers also separated the populations regarding to their altitude level. Similarly when (AMOVA) was applied on the observed data, it was

noticed that differentiation among different groups, within same groups of the population and between individuals present within same population was (5.09, 2.82 and 92.09) percentage separately.

Another study describing the role of (RAPD) markers was also carried out (Yamagishi et al., 2002). Two major cultivars of Asiatic lily were examined in the experiment (Montreux’ and ‘Connecticut King’). Different markers were used to check the polymorphism percentage. Results indicated the presence of 68 polymorphic bands from the total bands. It was observed that the efficacy of the experiment increased by increasing the length of the primer.

2.7.1: SSR Analysis

To make the availability about the concept of variations and differentiations to the breeders, it is very much necessary to understand the diversity of whole population (Jabbarzadeh et al., 2013). Moreover, effective uses of methods which are very accurate in characterization of that diversity as well in identification are required. Some methods which are linked with important molecular techniques, allows the breeders to use the more efficient one for the germplasm used in plant breeding practice (Jain et al., 1999; Cobos et al., 2009). Inter simple sequence repeats (ISSRs) are used as important markers for genotype identification and also for analysis of genetic variability even in individuals which showed great relationship among them (González et al., 2005; Hundsdoerfer et al., 2005).

Simple sequence repeats (Microsatellites) are often tandem repeat motifs of 1-6 bp in length which are frequently present in the genome of all prokaryotes and eukaryotes analyzed by Zane et al., (2002). These markers (ISSR) are actually DNA sequences comprised of same units of two inverted SSR whose amplification is accomplished by using single PCR primer. To avoid general hybridization and slippage in the microsatellite region, the primer is comprised by few SSR units with an affixed end (Weising et al., 2005). Molecular characterization through these markers provides allelic difference with multi locus profiles. Results obtained through SSR analysis are very effective, highly reproducible, very abundant and polymorphic in nature (Bornet and Branchard, 2004). The main usefulness of this practice is due to its universality easily development and less cost

issues as compared toother markers (Weising et al., 2005; Agostini et al., 2008; Jabbarzadeh et al., 2013).

The method of utilizing the Simple Sequence Repeat markers have been used for characterization of the diversity and structure of two Lilium species (L. philadelphicum and L. japonicum Thunb) (Horning et al., 2003) latter one is the extinct cultivar of Japan which also have very beautiful cut flowers (Kawase et al., 2010).

Tang et al., (2014) used interspecific simple sequence repeat markers for the first time to examine the plant genetic diversity structure of twenty eight populations which are sampled from southeast of Qinghai–Tibet plateau. Out of different primers used, total fifteen primers were selected to generate total 147 polymorphic bands. It was concluded that average He value was less within populations i.e. 0.173 but was higher at species level i.e. 0.392.

Ţukauskienė et al., (2014) analyzed the diversity and structure by using SSR molecular markers. For the purpose, he collected the thirty five total samples from Vytautas Magnus University Kaunas Botanical Garden. Total six markers were screened to make molecular characterization by using this technique. Results showed very large genetic diversity at different levels of the group. An average of 1.21 alleles with an average of observed heterozygosity i.e. 0.15 and 95 percentage of polymorphic loci was obtained. Dendrograms resulted by UPGMA cluster analysis showed a classified structure between the species.

Sakazono et al., (2013) used total 61 microsatellite primers to detect genetic changes in Longiflorum cultivar and reported that only 10 out of 61 were able to evaluate the variation among two populations of the cultivar. Number of alleles obtained by each primer also varied among different populations i.e. an average of 3.2 were produced out of total 10.3 alleles per locus with Hobs values ranged from 0.245 to 0.73.

Due to large size genome of Ester lily included in the Longiflorum group, it is very tough to apply molecular tools to characterize its diversity through AFLPs. Many repetitive DNA sequences are present within the genome. Anderson et al., (2010) described that use of ISSR markers are helpful for analyzing the genetic diversity of this specie.

Yamagishi et al., (2002) used ISSR markers to analyze the lily genome and found total 52 percent polymorphism between the two cultivars.

MATERIALS & METHODS

The present study was conceded to generate the better varieties of Lilium by using induced mutagenesis technique. For the purpose, optimum doses of gamma rays were used to produce mutants. Further plant tissue culture technique was applied to allow mass multiplication of mutant varieties having better morphology and in vitro produced plants were hardened in green house. Morphological parameters were used to screen out the best mutant varieties. Additionally, at molecular level characterization was done by using RAPD and SSR markers to detect variations between controls as well radiated mutants. After collection of explants from different sources, the whole study was done in the Plant Biotechnology Laboratory, Department of Biotechnology, Lahore College for Women University, Lahore, Pakistan.

3.1: In vitro propagation by using plant tissue culture technique

3.1.1: Plant material

Bulbs of different Lilium cultivars were procured from different nurseries of Lahore (More Green seed, Chanan Din seed and Bagh-e-Jinnah). Four major groups were used for the analysis in the current research work as shown in Table 3.1.1.1.

Table 3.1.1.1: List of coded Lilium cultivars included in different groups

Group name Coded name Varietal name Collection place

Samur La pink More Green, Lhr V1

Heaven white More Green, Lhr V2 Oriental (O) Kabana lily Chanan Din, Lhr V3

Montezuma-O-red More Green, Lhr V4

Star fighter-O-red/white More Green, Lhr V5

Advantage La salmon More Green, Lhr V6 Oriental x

Trumpet Golden tycon yellow More Green, Lhr V7 (OT)

Orange pixie Chanan Din, Lhr V8

Longiflorum x Courier La white More Green, Lhr Oriental V9 (LO) Easter lily Bagh-e-Jinnah, Lhr Longiflorum V10 (L)

3.1.2: Sterilization

Sterilization is very essential to get successful plant tissue culture results. It is mainly used to eradicate all type of contaminants and to make the environment bacterial and fungal free. Main purpose of this step in plant tissue culture is to obtain disease free planting material of Lilium. Sterilization done at each step and procedure used for the purpose vary for sterilization of explant, glass ware used, culture medium, inoculation and culture area.

3.1.3: Surface sterilization of explants

Washed the bulbs properly under running tap water for 20 minutes in order to remove traces of dirt and immersed in detergent for five minute. Wash six times with distilled water, and then dipped for one min in 96% ethanol. Removed the bulb roots by using sterile sharp scalpel, blade and gently separated the scales from their attachment points. Further sterilization of the excised scales was carried out for 20 minute in 80% sodium hypochlorite (commercial bleach) followed by washing for four times in double distilled water to remove bleach traces. Finally, put the washed expalnts in 0.1% (w/v) mercuric chloride (HgCl2) solution for seven minutes and rinsing was done in autoclaved water for six times.

3.1.4: Glassware sterilization

Different glassware used for plant tissue culture including test tubes, jars, beakers, conical flasks, measuring cylinders and pipette were first of all cleaned with a household detergent followed by washing with running tap water. Than dip all the washed glassware in chromic acid (60g K2Cr2O7 + 300 ml H2SO4 + 700 ml H2O) for about 10-15 hours. Properly washed the glassware with tap water and then with distilled water to remove contaminants of chromic acid. Finally proper sterilization of the glassware was done by placing all the apparatus in autoclave (121°C) temperature and (15 Ibs/inch2) pressure for fifteen minutes.

3.1.5: Instruments sterilization

Appliances used for inoculation (scalpels, forceps, spatula and blades) were treated in autoclave at temperature of 121°C and pressure of 15 Ibs/inch2 for twenty minutes. Before using, final sterilization was done by flaming the instruments after dipping in (95%) ethanol.

3.1.6: Laminar air flow cabinet sterilization

Ultra violet (UV) rays were used to make sterilization of laminar air flow cabinet for 15 minutes before the inoculation and also for subculturing of the explants. Both walls of laminar air flow chamber were cleaned with cotton dipped in ethanol (90 %).

3.1.7: Sterilization of inoculation and culture room area

Regular spray of ethanol (90 %) was done for sterilization of culture and inoculation rooms. This process repeated twice a day. Similarly racks of both rooms were also cleaned with ethanol dipped cotton in a week and for getting the more accuracy in terms of contamination free environment. Formalin solution (50 %) was also kept in culture room in petriplates after every 10 days.

3.1.8: MS medium preparation and sterilization

For In vitro propagation, the use of MS basal medium (Murashige and Skoog, 1962) with phytohormones is very necessary to give nutrients to the plants. This medium (appendix I & II) comprised of different salts like macronutrients required in large amounts, micronutrients required in small amounts, Iron EDTA and vitamins. Sucrose is also very important as source of carbon i.e. 30-90 (g/L). Distilled water used for the preparation of all stock solutions and placed at 4 ºC in autoclaved brown coloured bottles. Plant growth regulators were also added in combinations like BAP + Kin (mg/L) and BAP (mg/L) + TDZ (µM) or alone i.e. BAP (mg/L) and also with auxins i.e. BAP + Kin + IAA (mg/L). Distilled water was used to raise the volume of MS medium. 1.0 (mg/L) plant preservative mixture (PPM) was added in the inoculating medium to make the media free of contamination. Medium pH was adjusted to 5.5-5.8 by adding some drops of acid (1N HCL) or base (1N NaOH) depends on acidity or basicity of the medium. To prepare the solid media, addition of phytagel (1.5 g/L) i.e. also called gelrite was done. To dissolve the phytagel in the medium, heating was required to make the media clear for at least 5-7

(min). Liquid medium was prepared by adding the media in the autoclaved jars and also put sterilized cotton pieces in each jar. Finally autoclave both solid and liquid medium and store them in culture room. For multiple shoot formation, shaking flasks were also used for medium pouring.

3.1.9: Preparation of stock solutions of plant hormones

Stock solutions of phytohormones (appendix III) were prepared by weighing 10 mg of desired hormone in small amount of water. To dissolve the solution, few drops of 0.1N HCl or 0.1N NaOH were added according to cytokinins or auxins respectively. Then finally raise the volume up to 10 ml with distilled water and storage was done by putting the solutions at 4 ºC in brown (amber coloured bottles).

3.1.10: Explant inoculation

Whole process of inoculation was carried out in the laminar air flow chamber. For the purpose, MS media fortified with cytokinins and auxins was used for inoculation of surface sterilized explants (bulb scales). Incubation of the inoculated cultures was done at 20±2ºC with a photoperiod of 8 (hrs) dark and 16 (hrs) light. Light intensity was adjusted at 2000- 3000 lux.

3.1.11: Study of parameters

For in vitro mass multiplication, different parameters including effect of different concentrations of cytokinins and auxins on shoot formation, root formation and effect of shaking cultures and sucrose amount on the multiplication rate and bulblet formation were studied in different experiments to improve the cultural conditions.

3.1.11.1: Micropropagation

3.1.11.1.1: Shoot and root formation

Lilium bulb scales used as explant were inoculated in the MS medium fortified with different phytohormones. First of all explants were inoculated in the medium comprising of shoot initiation hormones. After the optimization of shoot initiation, media subculturing was done by shifting the explants in the multiplication medium. Subculturing of the cultures was made on the regular bases in the ideal optimized multiplication media. Data about number of days to shoot initiation, regeneration frequency, shoot length (cm) and

number of shoots/explant was observed after one month. Data was also observed on the basis of days for root formation, number of roots and root length (cm).

3.1.11.1.2: Acclimatization of plantlets

The Lilium mericlones were transferred to small pots containing clean sand for 15 days. After that media containing different combinations of soil, sand, vermicompost and cocopeat was used for further hardening in green house for at least 60 days. Data about survival percentage for each combination was recorded.

3.1.11.1.3: Data recorded

Data about total number of regenerated shoots alongwith shoot length (cm) and total roots was noted after 2 months of culture.

3.2: Induced mutagenesis

In vivo and in vitro mutagenesis was carried out in the present study and plant parts used for the investigation include:

1. Bulbs of different Lilium varieties under in vivo conditions in field

2. In vitro regenerated shoots

3.2.1: In vivo mutagenesis

3.2.1.1: Gamma irradiation treatment

Bulbs of different Lilium cultivars were irradiated with cobalt-60 by gamma rays. The experiment was held at Pakistan Radiation Services (PARAS) in Lahore, Pakistan. Doses of gamma rays used for the purpose are (2.0, 4.0, 6.0, 8.0, 10) Gy (1Gy = 100 rad).

3.2.1.2: Maintenance of experiment under in vivo conditions

Experiment was conducted in green house of Bagh-e-Jinnah, PHA Lahore and achieved for three years from 15 October 2012 to 15 October 2015 at same conditions. Treated plants were shifted in pots containing soil. After two weeks, bulbs started germination but sprouting varied depends on cultivar and radiation dose. In some cultivars germination start at lower dose while in others at higher dose, good results were obtained. Finally when flowering start comparison was made among control as well mutants by morphological study after 8 months of planting. Conditions to grow plants were 22 °C with16 h of light and 8 h of dark periods. Spray of Hoagland solution and distilled water was given twice a

day to the plants. Different parameters including, Shoot length, leaf length, leaf width, flower morphology and average number of leaves per treated plant were calculated. DNA analysis by using molecular (RAPD and SSR) was done by using fresh leaves of control/mutant cultivars.

3.2.1.3: Data analysis for morphological study

3.2.1.3.1: Morphological characters

Following are the morphological characters which were recorded for the analysis;

3.2.1.3.2: Germination response, percentage and survival rate

Data about germination response was recorded after one month of sowing. Percentage of surviving plants at given doses of gamma rays was noticed after 8 weeks of planting and the morphological analysis was repeated every month for changes in the growth potential. The data was expressed as germination percentage.

3.2.1.3.3: Number of leaves

Total number of leaves produced by both control and mutants were calculated after 8 month of planting which are expressed as total number of leaves per plant.

3.2.1.3.4: Leaf length and leaf width (cm)

All samples for each treatment were analyzed in triplicate. Average leaf length and leaf width of each plant was calculated after 8 months of planting and measuring scale was used to analyze.

3.2.1.3.5: Shoot length (cm)

Data was recorded after one month but final calculation of shoot length was done after 8 month of planting. Shoot length was measured by using scale in centimeter.

3.2.2: In vitro mutagenesis

In vitro regenerated shoots from scales of bulb were irradiated with cobalt-60 by gamma rays. The experiment was held at Pakistan Radiation Services (PARAS) in Lahore, Pakistan. Doses of gamma rays used for the purpose were (2.0, 4.0, 6.0, 8.0, 10) Gy. These treated shoots were used as explant for multiplication by using plant tissue culture technique in plant biotechnology laboratory, Biotechnology Department, Lahore College for Women University Lahore, Pakistan.

3.2.2.1: Data analysis

3.2.2.1.1: Multiple shoot formation

Data about total number of shoots along with shoot length was observed in the optimized MS multiplication medium with plant hormone after one to two months of culturing.

3.2.2.1.2: Morphological study of regenerated plantlets in green house

Plant height, average number of leaves, leaf length and leaf width with flower morphology of in vitro regenerated control/mutant varieties including flower size, colour and shape was studied.

3.3: Molecular characterization of Lilium (Control and irradiated genotypes)

Young healthy leaves of both non-irradiated and treated genotypes were selected to carry out the molecular characterization of Lilium control and mutants in this section.

3.3.1: DNA extraction

Samples used for DNA extraction contained young, fresh and healthy leaves of all control and mutant varieties of Lilium. First of all, cleaned the leaves by rinsing with ethanol and storage was made at -80 ºC in cold cabinet for 24 hours for extraction of total genomic DNA. Method used for the purpose was modified form of Doyle and Doyle method (1987) of 2X CTAB (Appendix IV) to obtain excellent quality and quantity of DNA.

First of all β-mercaptoethanol (1 %) was added into 2X CTAB (Cetyl trimethyl ammonium bromide). Heat the solution at 65 ºC in water bath. Stored cold leaves were grind in cooled pestle and mortar to make the fine crushed powder of the material. Add hot CTAB (2X) in the powder in an eppendorf tube and inverted the tube gradually for 3-4 times and incubation was done for 30 minutes at 65oC. Chloroform/isoamylalcohol (24:1) solution was added. Allow the solution to mix gently after inverting the eppendorf tubes. Centrifuge the tubes for 10 (min) at 7000 rpm and shift the supernatant solution to new tube. Repeat the above step. Chilled 2-propanol (0.6 volumes) was added to precipitate the DNA and centrifugation was done for 5 minutes at 5000 rpm. Pellet was settled down at the base of the tube. Washing of the pellet was done by using absolute ethanol (70 %) and spinned at 5000 rpm for 2 minute. Place the tubes in open air to dry the pellet and store in TE buffer

(1X) (Appendix V) or dH2O.

3.3.1.1: Determination of genomic DNA

To determine the presence and absence of genomic DNA, samples were run in 0.8 % agarose gel. 6X loading dye was added in the samples and ladder was also run as standard.

Horizontal gel electrophoresis apparatus was used for the purpose. It consists of plastic tray with plastic combs used to make wells. First of all cleaned the tray with distilled water and dried it carefully. Placed the tray on plain surface and pour the gel. After that insert plastic combs to form the vertical wells.

Agarose gel was prepared by taking 0.8 gram of agarose in 100 ml of TAE buffer (1X). Completely dissolve the agarose gel powder by heating the solution and allow cooling at room temperature. Ethidium bromide 0.2 (µg/mL) was added which allow visualization of gel under UV transilluminator. Polymerization of gel was made by remaining the gel for about half an hour. Put the gel tray in to gel apparatus containing 1X TAE buffer (Appendix VI).

Samples were load into wells after preparation with loading dye i.e. (1µL) DNA and 6X loading dye i.e. 2 µL (Appendix VII) in eppendrof tube. Ladder was also loaded in the first well as standard to determine size of the band. Run the gel for at least 30 minutes at 110 V. Visualization was done by putting the gel on UV transilluminator photographs were made by using gel doc (gel documenting system). For further usage, prepare the DNA dilutions and stored at 4oC.

3.3.2: RAPD analysis

Diluted DNA (10 ng/μL) was used for further RAPD-PCR reactions. Method used for RAPD analysis is described by (Naz et al., 2013) with some modifications (10 ng μL-1 of template DNA, 0.5 μM of single primer, Taq DNA polymerase 0.4 U & 0.1 μM of dNTPs). Initially 25 decamer primers were used for screening. After the initial screening, 11 primers were selected for further analysis. PCR products were separated by using 0.1% agarose gel electrophoresis technique and staining was made by using ethidium bromide. Visualization of bands was made under UV transilluminator apparatus.

3.3.2.1: Polymerase Chain Reaction (PCR) for RAPD analysis

RAPD-PCR based amplification was carried out in thermal cycler (Primus-96). Initial denaturation step was done at 94ºC for 4 minutes for one cycle and after this step, total 35

cycles were repeated with the following conditions; Denaturation for 30 sec at 94 ºC. Primer annealing temperature (Tm) is different for each primer for 1 minute and last one include final extension of the primer at 72 ºC for 1 minute and 30 seconds. Final polymerization was done by giving extension for 7minutes at 68 ºC and stored the amplified PCR products at 4.0 ºC. Experiment was repeated thrice to verify the actual results.

3.3.2.1.1: Data analysis for RAPD

Data analysis was made on the basis of presence and absence of clear and repeatable amplified products by using 1 for presence and 0 for absence. DNAMAN software was used to check the similarity and phylogenetic tress were made by using a distance (Nie and Lie’s Coefficients) to determine the genetic similarity and variation among control and mutants.

3.3.3: SSR analysis

Among 10 EST-SSR primers used for the DNA analysis, only 5 were able to identify polymorphism between the samples. The primers were synthesized by Macrogen Technology (Lahore, Pakistan). PCR amplifications were accomplished in 20 µl reaction mixture using thermal cycler (Primus-96). For genotyping, labeled (6-FAM/ HEX) primers were utilized. The master mixture contained template DNA (20ng), 10X PCR buffer (500 mM KCl and 100 mM Tris-HCl; pH 9.1), 1.5 mM MgCl2, 0.5µL each primer, 1.6 µL of dNTPs and 0.1U Taq (Thermo Kit, USA).

3.3.3.1: Polymerase Chain Reaction (PCR) for SSR analysis

Conditions were optimized separately for each primer. Different annealing temperature range from 57oC to 63oC were tested for the experiment. Only this step was different for each marker while other conditions were constant i.e. 94 oC for 5 minute; 35 cycles at 94 oC for 30 seconds , primer temprature i.e. from 58 oC to 60 oC for 45 seconds followed by 72oC for 45 second again and final extension step was done for 5 min at 72oC. The confirmation of all amplifications was performed by running PCR product (5µl) on agarose gels (0.8%). PCR products labelled with different dye for different primers or for the same primers were pooled together. Capillary electrophoresis of the PCR products was accomplished on a 3500 × l DNA Analyzer (Applied Biosystems Inc.). To examine the

allelic diversity in the 10 Lilium control cultivars and their mutants, peak scanner (V. 1.0) software package was used .

3.3.3.1.1: Data analysis for SSR

After running the samples in the gel, data was analyzed by using the peak scanner (V1.0) software. The LIZ 500 was selected as size standard. Peaks showing different alleles vary in size were detected according to their dye colour. Data was analyzed thrice to get the accurate results. H obs and PIC values were calculated by using the microsatellite tool kit software (Park, 2001a; Park, 2001b). Pairwise similarity between the multi-locus genotypes was estimated by using the ‘‘proportion of shared alleles’’ (ps) (Bowcock et al., 1994). The genetic distance between all pairwise combinations of the 60 genotypes including control and mutants with 10 SSR markers was calculated by using –ln (ps) option of MICROSAT (version 2.0) described by (Minch, 1997; Minch et al., 1997). PHYLIP software (version 3.6) described by (Felsenstein, 2006) and Tree View (Page, 1996) was used to construct the phylogenetic trees utilizing the un-weighted pair-group method with arithmetic means algorithm (UPGMA) (Sneath and Sokal, 1973).

3.6: Statistical analysis

Completely randomized block design was used for the present study. Duncan’s New multiple range test was used to analyze the changes in different parameters, this test is being used to determine significant differences among treatments at 5% probability level.

RESULTS 4.1: Micropropagation of different Lilium Cultivars

To optimize the best protocol for shoot initiation for in vitro propagation of different Lilium varieties, micropropagation technique was carried out. For the purpose, scales from the fresh and healthy Lilium bulbs were used as explants. Bulbs were procured from different seed nurseries of Lahore in the season of October to November. All excised scales were sterilized to make the material contamination free, because due to underground presence of the bulbs, their sterilization is difficult to make them pathogen free. Surface sterilization was carried out by using 80% sodium hypochlorite (commercial bleach). Addition of 1.0 (mg/L) PPM (plant preservative mixture was added in the inoculating medium. 75% explants remained contamination free in order to get maximum plantlets of Lilium.

To obtain the best results for in vitro propagation of Lilium, different concentrations and combinations of cytokinins and auxins were added in MS basal medium in present study. Different combinations and concentrations of cytokinins alone i.e. BAP (6-Benzyl amino purine), BAP + TDZ (Thidiazuron) and cytokinins along with auxins i.e. BAP + Kin (Kinetin) + IAA (Indole 3-acetic acid) were tested to obtain the best medium. Different parameters including frequency of shoot induction (%), average number of shoots and average shoots length (cm) were studied.

The main groups of Lilium cultivars selected in the current study are as following:

4.1.1. Lilium Oriental (O)

4.1.2. Lilium Oriental x Trumpet (OT)

4.1.3. Lilium Longiflorum x Oriental (LO)

4.1.4. Lilium Longiflorum (L)

4.1.1: Oriental (O) group of Lilium

4.1.1.1: In vitro propagation of Oriental cultivars

Various concentrations of BAP, BAP + Kin + IAA and BAP + TDZ on initiation frequency (%), average number of shoots per explant and the average shoot length (cm) of V1 (Samur La pink), V2 (Heaven white), V3 (Kabana lily ) and V4 (Montezuma-O-red) are shown in Table 4.1.1.1. Scales are used as explant (Fig. 4.1.1.1.a). By using different BAP concentrations data regarding frequency of shoot induction (%), average number of shoots per explant and maximum shoot length was recorded.

In case of V1 variety, the frequency of shoot induction ranged from 50-70 % by using different concentrations of BAP 1.0-4.0 (mg/L). It was observed that increased concentration of BAP induced positive effect lead to increase in the rate of initiation gradually with maximum frequency i.e. 70 % and highest shoot length 5.4a±0.07 cm. Further increase in BAP concentration i.e. at 4.0 (mg/L), decreased the number of shoots produced i.e. 1.6b±0.04. BAP 3.0 (mg/L) produced maximum number of shoots 2.1a±0.12 with lower frequency of shoots induction 65% shown in Fig. 4.1.1.1b. Bulb scales of V1 inoculated in MS basal medium supplemented with different combinations of BAP, Kin and IAA gave the best results at BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) shown in Fig. 4.1.1.1.c. At this concentration (85 %) frequency of shoot initiation with 3.2a±0.06 number of shoots per explant and 5.5a±0.08 cm average shoot length was observed. It was noticed that by increasing the concentration of Kin showed no positive effect regarding shoot initiation but increased BAP and IAA concentration produced stimulatory effect on number of shoots per explant and frequency of shoot induction. Minimum number of shoots i.e. 2.3d±0.09 was observed in BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L). In response to different concentrations of BAP + TDZ, frequency of shoot induction in V1 ranged from 62-75% after one month of inoculation. Highest rate (75%) was achieved in MS with BAP 3.0 mg/L + TDZ 2.0 µM shown in Fig. 4.1.1.1d. The combination of BAP 3.0 mg/L + TDZ 2.0 µM produced 75 % highest rate of shoot induction with larger number of shoots i.e. 3.1a±0.06.

The frequency of shoot induction ranged from 60-78 % by using different concentrations of BAP 1.0-4.0 (mg/L) in V2. It was observed that increased concentration of BAP induced positive effect lead to increase in the rate of initiation gradually with maximum frequency

i.e. 78 % at the concentration of 4.0 (mg/L) BAP after 4-5 weeks of inoculation. Highest shoot length of 6.1a±0.04 cm was also achieved at this concentration. BAP 3.0 (mg/L) produced maximum number of shoots 2.4a±0.10 shown in Fig. 4.1.1.1e.

Addition of Kin and IAA in combination with different BAP concentrations increased the rate of initiation and gave maximum frequency (80 %) at BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) shown in Fig. 4.1.1.1.f. At this concentration shoot initiation with 3.8a±0.10 number of shoots per explant and 5.5a±0.07 average shoot length was observed. It was noticed that by increasing the concentration of Kin and BAP in the MS medium showed no positive effect regarding shoot initiation but increased IAA concentration produced stimulatory effect on number of shoots per explant and frequency of shoot induction. Minimum number of shoots i.e. 3.0c±0.11 was observed in BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L). Addition of TDZ was also done to evaluate the synergistic effect of both hormones on shoot initiation. Different concentrations of BAP + TDZ influenced the rate of shoot induction, shoot length (cm) and average number of shoots per explant. Total frequency of shoot induction in V2 ranged from 53-65%. Highest rate (65%) was achieved in MS with BAP 2.0 (mg/L) + TDZ 2.0 (µM). The combination of BAP 1.0 (mg/L) + TDZ 4.0 (µM) produced 62 % (Fig. 4.1.1.1g) rate of shoot induction with larger number of shoots i.e. 2.5a±0.08.

Bulb scales of V3 variety inoculated in MS basal medium supplemented with different concentrations of BAP alone gave the best results at BAP 3.0 (mg/L) shown in Fig. 4.1.1.1.h. At this concentration (68%) frequency of shoot initiation with 2.3a±0.09 number of shoots per explant and 5.0a±0.08 cm average shoot length was observed. It was noticed that by increasing the concentration of BAP, good effect was achieved regarding shoot initiation. At BAP 2.0 (mg/L) minimum number of shoots i.e. 1.7c±0.04 was observed (Fig.4.1.1.1i). The role of Kin + IAA along with BAP on regeneration percentage of V3 was also carried out as well. It was observed that frequency of shoot induction in V3 ranged from 73-84% in MS media with different concentrations of BAP + Kin + IAA. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 84 % and minimum percentage was produced in MS + BAP 0.1 + Kin 0.2 + IAA 2.0 (mg/L) i.e. 73%. Maximum numbers of shoots per explant i.e. 3.8a±0.10 were also obtained at the same concentration best for shoot induction percentage (Fig. 4.1.1.1j). Addition of TDZ was also done to evaluate the synergistic effect of both hormones on shoot initiation.

Different concentrations of BAP + TDZ influenced the rate of shoot induction, average number of shoots per explant and shoot length (cm). Total frequency of shoot induction in V8 ranged from 49-72%. Highest rate (72%) was achieved in MS with BAP 2.0 mg/L + TDZ 2.0 µM shown in Fig. 4.1.1.1k. Higher concentrations of BAP reduced the number of shoots i.e. 1.9b±0.02.

V4 variety inoculated in MS basal medium supplemented with different concentrations of BAP alone gave best results at BAP 4.0 (mg/L) shown in Fig. 4.1.1.1.l. At this concentration (79%) frequency of shoot initiation with 2.5a±0.08 number of shoots per explant and 5.2a±0.06 cm average shoot length was observed. It was noticed that by increasing the concentration of BAP, good effect was achieved regarding shoot initiation. At BAP 1.0 (mg/L) minimum number of shoots i.e. 1.5c±0.09 was observed (Fig.4.1.1.1m). Addition of Kin + IAA along with BAP also produced pronounced effect on regeneration potential. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 86% and minimum percentage was produced in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 74%.

Maximum numbers of shoots per explant i.e. 3.2a±0.06 were also obtained at the same concentration best for shoot induction percentage (Fig. 4.1.1.n). Total frequency of shoot induction in V4 ranged from 41-78 % by using BAP + TDZ. Highest rate (78%) was achieved in MS with BAP 3.0 (mg/L) + TDZ 2.0 (µM) shown in Fig. 4.1.1.1o.

Table 4.1.1.1: Effect of various concentrations of BAP, Kin, IAA and TDZ on shoot initiation of Oriental cultivars

Conc. of different Frequency of shoot No. of shoots Shoot length (cm) Sr. hormones induction per explant No. (%) BAP Kin IAA TDZ V1 V2 V3 V4 V1 V2 V3 V4 V1 V2 V3 V4 (mg/L) (mg/L) (mg/L) (µM) 1 1.0 - - - 50 62 46 68 1.0c±0.04 1.1d±0.05 1.9b±0.02 1.5c±0.09 3.6c±0.10 4.6c±0.05 3.6c±0.10 4.4b±0.05 2 2.0 - - - 55 60 50 63 1.2c±0.04 1.3c±0.17 1.7c±0.04 1.6c±0.04 4.1b±0.07 5.0b±0.08 3.8c±0.10 3.8c±0.10 3 3.0 - - - 65 74 68 65 2.1a±0.12 2.4a±0.10 2.3a±0.09 2.3b±0.09 5.2a±0.06 5.2b±0.06 5.0a±0.08 3.4c±0.04 4 4.0 - - - 70 78 62 79 1.6b±0.04 1.6b±0.04 1.8b±0.04 2.5a±0.08 5.4a±0.07 6.1a±0.04 4.3b±0.07 5.2a±0.06 5 0.1 0.1 2.0 - 76 71 84 74 2.3d±0.09 3.1b±0.06 3.8a±0.10 2.1c±0.12 5.4a±0.07 5.2b±0.07 5.3b±0.06 5.0c±0.08 6 0.1 0.1 3.0 - 85 80 75 86 3.2a±0.06 3.8a±0.10 3.1c±0.06 3.2a±0.06 5.5a±0.08 5.5a±0.07 5.5a±0.07 5.7a±0.09 7 0.1 0.2 2.0 - 78 74 73 78 2.5c±0.08 3.2b±0.06 3.0c±0.11 3.0a±0.11 5.2b±0.06 5.1b±0.08 5.0c±0.08 5.2b±0.06 8 0.2 0.1 2.0 - 78 76 77 74 3.0b±0.11 3.0c±0.11 3.3b±0.04 2.5b±0.08 5.2b±0.06 5.6a±0.07 5.6a±0.07 5.1c±0.08 9 1.0 - - 2.0 62 55 49 50 1.9c±0.02 1.8b±0.04 1.5c±0.09 2.4a±0.10 4.2b±0.05 5.0a±0.08 5.4b±0.07 4.8c±0.06 10 1.0 - - 4.0 64 62 56 41 2.1b±0.03 2.5a±0.08 2.4a±0.10 2.1b±0.12 5.3a±0.06 5.2a±0.06 5.6a±0.07 4.4d±0.05 11 2.0 - - 2.0 72 65 72 76 2.4b±0.10 1.9b±0.02 2.5a±0.08 1.9c±0.02 5.0a±0.08 5.2a±0.06 5.3b±0.06 5.6a±0.07 12 3.0 - - 2.0 75 53 70 78 3.1a±0.06 1.5c±0.09 1.9b±0.02 1.8c±0.04 5.2a±0.06 3.8b±0.10 5.0c±0.08 5.0b±0.08

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

4.1.1.4a 4.1.1.4b 4.1.1.4c 4.1.1.1d

4.1.1.1g 4.1.1.1e 4.1.1.1f

Fig. 4.1.1.1a-4.1.1.1g: Micropropagation of Oriental cultivars of Lilium in MS medium fortified with various concentrations of BAP, BAP + Kin + IAA and BAP + TDZ

a) Bulb scale of Lilium (1X); b) Shoot formation of V1 in MS + BAP 3.0 (mg/L) (1X); c) Shoot formation of V1 in MS + (BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); d) Shoot formation of V1 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X); e) Shoot formation of V2 in MS + BAP 3.0 (mg/L) (1X); f) Shoot formation of V2 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); g) Shoot formation of V2 in MS + BAP 1.0 mg/L + TDZ 4.0 µM after 30 days of culturing (1X)

4.1.1.1h 4.1.1.1i 4.1.1.1j 4.1.1.1k

4.1.1.1l 4.1.1.1 4.1.1.1n 4.1.1.1o

Fig. 4.1.1.1h-4.1.1.1o: Different stages of micropropagation of Oriental cultivars of Lilium in MS medium fortified with various concentrations of BAP, BAP + Kin + IAA and BAP + TDZ h) Cultures of V3 showing growth in MS + BAP 3.0 (mg/L) (1X); o) Cultures of V3 showing shoot formation in MS + BAP 2.0 (mg/L) after 30 days of culturing (1X); j) Shoot formation of V3 in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) after 30 days of culturing (1X); k) Shoot formation of V3 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X); l) Cultures of V4 showing growth in MS + BAP 4.0 (mg/L) (1X); m) Cultures of V4 showing shoot formation in MS + BAP 1.0 after 30 days of culturing (1X); n) Shoot formation of V4 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); o) Shoot formation of V4 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X)

4.1.2: Oriental x Trumpet (OT) group 4.1.2.1: In vitro propagation of Oriental x Trumpet cultivars Results derived after testing various concentrations of BAP, BAP + Kin + IAA and BAP + TDZ on initiation frequency (%), average number of shoots per explant and the average shoot length (cm) of V5 (Star fighter-O-red/white), V6 (Advantage La salmon), V7 (Golden tycon yellow) and V8 (Orange pixie) of Oriental X Trumpet cultivars are represented in Table 4.1.2.1.

For V5, BAP 3.0 (mg/L) gave the best results shown in Fig. 4.1.2.1.a. At this concentration (75%) frequency of shoot initiation with 2.5a±0.08 number of shoots per explant and 4.1b±0.07 cm average shoot length was observed. It was noticed that by increasing the concentration of BAP, positive effect was noted regarding shoot initiation but further increase from BAP 3.0 (mg/L) showed decrease in number of shoots per explant and frequency of shoot induction. Minimum number of shoots i.e. 1.3c±0.17 and shoot length 3.2d±0.06 cm was observed in BAP 1.0 (mg/L). In response to different concentrations of BAP + Kin + IAA, frequency of shoot induction in V5 ranged from 65-89% after one month of inoculation. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 89 % and minimum percentage was produced in MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 65%. Maximum numbers of shoots per explant i.e. 5.3a±0.06 were also obtained at the same concentration shown in Fig. 4.1.2.1.b. Lower concentrations of BAP and Kin and high concentration of IAA gave excellent results while increased concentrations of both BAP + Kin at constant IAA concentration suppressed shoot initiation i.e. 65-68% at MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L).

It is evident from (Table 4.1.2.1) that BAP combined with another cytokinin induced better effect as compared to BAP alone. Frequency of shoot induction ranged from 42-80%. Moderate concentrations of BAP and TDZ i.e. at BAP 2.0 (mg/L) + TDZ 2.0 (µM) caused highest shoot induction rate i.e. 80 % with maximum number of shoots 2.5a±0.08 (Fig. 4.1.2.1.c) as compared to increased concentrations of both hormones alone. Lowest number of shoots was recorded in MS with BAP 3.0 (mg/L) + TDZ 2.0 (µM) i.e. 1.5c±0.09.

In case of V6, BAP 4.0 (mg/L) showed the best results shown in Fig. 4.1.2.1.d. At this concentration (55%) frequency of shoot initiation with 1.9a±0.02 number of shoots per explant and 5.5a±0.07 cm average shoot length was observed. It was noticed that by increasing the concentration of BAP, stimulatory effect was achieved regarding shoot

initiation. At BAP 1.0 (mg/L) minimum number of shoots i.e. 1.3c±0.17 was observed (Fig.4.1.2.1e). Role of Kin + IAA along with BAP on regeneration percentage of V6 was also carried out as well. It was observed that frequency of shoot induction in V6 ranged from 70-81% in MS media with different concentrations of BAP + Kin + IAA. Increased concentrations of IAA respond very well with lower concentrations of BAP and Kin. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 81 % and minimum percentage was produced in MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 70%. Average number of shoots per explant and shoot length (cm) was also affected directly by different concentrations of BAP + Kin + IAA in MS media. Maximum numbers of shoots per explant i.e. 4.0a±0.07 were also obtained at the same concentration selected for shoot induction percentage (Fig.4.1.2.1f).

BAP combined with another cytokinin induced better effect as compared to BAP alone. Frequency of shoot induction ranged from 65-74%. The combination of BAP 3.0 (mg/L) + TDZ 2.0 (µM) produced 74 % highest rate of shoot induction with maximum shoot length i.e. 5.2b±0.06 cm (Fig.4.1.2.1g). V7 variety inoculated in MS medium fortified with different concentrations of BAP alone gave the best results at BAP 3.0 (mg/L) shown in Fig. 4.1.2.1h. At this concentration (73%) frequency of shoot initiation with 2.3a±0.09 number of shoots per explant and 4.0b±0.07 cm average shoot length was observed. At BAP 1.0 (mg/L) minimum number of shoots i.e. 1.0c±0.04 was observed (Fig.4.1.2.1i). The role of Kin + IAA along with BAP on regeneration percentage of V7 was also carried out as well. It was observed that frequency of shoot induction in V7 ranged from 63-87% in MS media with different concentrations of BAP + Kin + IAA. Increased concentrations of IAA respond very well with lower concentrations of BAP + Kin. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 87 % and minimum percentage was produced in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 63%.

Maximum numbers of shoots per explant i.e. 3.2a±0.06 were obtained at MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) shown in Fig.4.1.2.1j. To enhance the frequency of shoot induction, synergistic effect of two different cytokinins was also studied. It is clearly depicted from Table 4.1.2.1 that BAP combined with another cytokinin induced better effect as compared to BAP alone. Frequency of shoot induction ranged from 40-78%. The combination of BAP 2.0 (mg/L) + TDZ 2.0 (µM) produced 78 % highest rate of shoot induction. Maximum shoot length i.e. 4.8a±0.06 cm was produced in BAP 1.0 (mg/L) +

TDZ 4.0 (µM) while larger numbers of shoots 2.4a±0.10 were also obtained in the medium best for regeneration frequency shown in Fig. 4.1.2.1k. MS basal medium supplemented with different concentrations of BAP alone the gave best results at BAP 4.0 (mg/L) in case of V8 shown in Fig. 4.1.2.1l. At this concentration (75%) frequency of shoot initiation with 3.8a±0.10 cm average shoot length and 2.1a±0.03 number of shoots per explant was observed. It was noticed that by increasing the concentration of BAP, stimulatory effect was achieved regarding shoot initiation. At BAP 1.0 (mg/L) minimum number of shoots i.e. 1.3b±0.11 was observed (Fig.4.1.2.1m).

The role Kin + IAA along with BAP on regeneration percentage of V8 was also carried out as well. It was observed that frequency of shoot induction in V8 ranged from 71-83% in MS media with different concentrations of BAP + Kin + IAA. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 83 %. Average number of shoots per explant and shoot length (cm) was also affected directly by different concentrations of BAP + Kin + IAA in MS media. Maximum numbers of shoots per explant i.e. 4.0a±0.07 were also obtained at the same concentration best for shoot induction percentage (Fig.4.1.2.1n). Lower concentrations of BAP and Kin and high concentration of IAA gave excellent results while increased concentration of BAP decreased shoot initiation i.e. 71% at MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L). It is evident from Table 4.1.2.1 that BAP combined with another cytokinin induced better effect as compared to BAP alone. Frequency of shoot induction ranged from 39-85%. The combination of BAP 3.0 (mg/L) + TDZ 2.0 (µM) produced 85 % maximum rate of shoot induction with larger number of shoots 2.4a±0.10 with shoot length of 6.0a±0.04 cm also achieved in this medium (Fig.4.1.2.1o).

Table 4.1.2.1: Effect of various concentrations of BAP, Kin, IAA and TDZ on shoot initiation of Oriental x Trumpet cultivars

Conc. of different Frequency of shoot No. of shoots Shoot length (cm) Sr. hormones induction per explant No. (%) BAP Kin IAA TDZ V5 V6 V7 V8 V5 V6 V7 V8 V5 V6 V7 V8 (mg/L) (mg/L) (mg/L) (µM) 1 1.0 - - - 40 45 38 65 1.3c±0.17 1.3c±0.17 1.0c±0.04 1.3b±0.11 3.2d±0.06 3.4d±0.04 3.1d±0.06 4.1a±0.07 2 2.0 - - - 40 46 39 60 1.5c±0.09 1.5b±0.09 1.1c±0.05 1.0c±0.04 3.8c±0.10 3.8c±0.10 3.7c±0.09 3.5b±0.10 3 3.0 - - - 75 52 73 71 2.5a±0.08 1.1d±0.12 2.3a±0.09 1.5b±0.09 4.1b±0.07 5.0b±0.08 4.0b±0.07 3.2b±0.06 4 4.0 - - - 70 55 68 75 1.9b±0.02 1.9a±0.02 1.8b±0.04 2.1a±0.03 5.2a±0.06 5.5a±0.07 5.1a±0.06 3.8a±0.10 5 0.1 0.1 2.0 - 70 70 69 72 3.3b±0.04 3.1b±0.06 2.1b±0.03 2.3c±0.09 4.8b±0.06 5.3b±0.06 4.7b±0.05 4.8b±0.06 6 0.1 0.1 3.0 - 89 81 87 83 3.8a±0.10 4.0a±0.07 3.2a±0.06 4.0a±0.07 5.3a±0.06 5.5a±0.07 5.2a±0.06 5.3a±0.06 7 0.1 0.2 2.0 - 65 72 63 76 3.2b±0.06 3.3b±0.04 1.9c±0.02 3.2b±0.06 4.2c±0.05 4.9c±0.06 4.1c±0.07 5.0a±0.08 8 0.2 0.1 2.0 - 68 75 67 71 3.1b±0.06 3.8a±0.10 2.5b±0.08 2.5c±0.08 3.8d±0.10 5.1b±0.08 4.5b±0.03 5.1a±0.07 9 1.0 - - 2.0 42 65 40 48 2.1b±0.03 1.8c±0.04 1.7b±0.04 2.1a±0.03 4.6b±0.05 5.1b±0.08 3.6c±0.10 4.6c±0.05 10 1.0 - - 4.0 71 71 69 39 2.3b±0.09 2.5a±0.08 1.9b±0.02 1.9b±0.02 5.0a±0.08 5.5a±0.07 4.8a±0.06 4.2d±0.07 11 2.0 - - 2.0 80 71 78 74 2.5a±0.08 2.1b±0.03 2.4a±0.10 1.8b±0.04 4.8a±0.06 4.8c±0.06 4.5a±0.05 5.5b±0.07 12 3.0 - - 2.0 72 74 70 85 1.5c±0.09 2.3a±0.09 2.1a±0.03 2.4a±0.10 4.2c±0.05 5.2b±0.06 4.0b±0.07 6.0a±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

4.1.2.1a 4.1.2.1b 4.1.2.1c 4.1.2.1d

4.1.2.1e 4.1.2.1f 4.1.2.1g 4.1.2.1h 4.1.2.1i

Fig. 4.1.2.1a-4.1.2.1i: Micropropagation of Oriental x Trumpet cultivars in different concentrations of BAP, BAP + Kin + IAA and BAP + TDZ

a) Cultures of V5 showing shoot formation in MS + BAP 3.0 (mg/L) after 30 days of culturing (1X); b) Shoot formation of V5 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); c) Shoot formation of V5 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X); d) Shoot formation of V6 in MS + BAP 4.0 (mg/L) (1X); e) Cultures of V6 showing decreased shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing (1X); f) Shoot formation of V6 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); g) Shoot formation of V6 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X); h) Shoot formation of V7 in MS + BAP 3.0 (mg/L) (1X); i) Cultures of V7 showing decreased shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing (1X)

4.1.2.1j 4.1.2.1k 4.1.2.1l

4.1.2.1m 4.1.2.1n 4.1.2.71o

Fig. 4.1.2.1j-4.1.2.1o: Micropropagation of Oriental x Trumpet cultivars in different concentrations of BAP, BAP + Kin + IAA and BAP + TDZ j) Shoot formation of V7 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); k) Shoot formation of V7 in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X); l) Cultures of V8 showing growth in MS + BAP 4.0 (mg/L) (1X); m) Cultures of V8 showing shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing (1X); n) Shoot formation of V8 in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); o) Shoot formation of V8 in MS + BAP 3.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X)

4.1.3: Longiflorum x Oriental (LO) group 4.1.3.1: In vitro propagation of Longiflorum x Oriental cultivar Various concentrations of BAP, BAP + Kin + IAA and BAP + TDZ on initiation frequency (%), average number of shoots per explant and the average shoot length (cm) of V9 (Courier La white) of (LO) group are shown in Table 4.1.3.1.

By using different BAP concentrations data regarding frequency of shoot induction (%), average number of shoots per explant and maximum shoot length was recorded.

In case of V9 variety, the frequency of shoot induction ranged from 45-60 % in MS with different BAP concentrations. It was observed that increased concentration of BAP induced positive effect in the rate of initiation gradually with maximum frequency i.e. 65 % and highest shoot length 5.0a±0.08 and large number of shoots 2.3a±0.09 at BAP 3.0 (mg/L) shown in Fig. 4.1.3.1 a. Further increase in BAP concentration i.e. at 4.0 (mg/L) decreased the shoot induction percentage upto 60 %. But this percentage was higher as compared to those obtained in lower BAP concentrations with minimum frequency of shoot induction (45%) in MS with BAP 1.0 (mg/L) shown in Fig. 4.1.3.1 b.

Bulb scales of V9 inoculated in MS basal medium supplemented with different combinations of BAP, Kin and IAA gave best results at BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L). At this concentration (82 %) frequency of shoot initiation with 3.2a±0.06 number of shoots per explant and 5.1b±0.08 cm average shoot length (Fig. 4.1.3.1c) was observed. It was noticed that by increasing the concentration of Kin showed no positive effect regarding shoot initiation but increased BAP and IAA concentration produced simulative effect on number of shoots per explant and frequency of shoot induction. Minimum number of shoots i.e. 2.4b±0.10 with minimal shoot length 4.9c±0.06 cm was observed in BAP 0.1 + Kin 0.2 + IAA 2.0 (mg/L) (Fig. 4.1.3.1d).

In response to different concentrations of BAP + TDZ, frequency of shoot induction in V9 ranged from 45-68% after one month of inoculation. Highest rate (70%) was achieved in MS with BAP 2.0 (mg/L) + TDZ 2.0 (µM) (Fig. 4.1.3.1e). Average number of shoots per explant and shoot length (cm) was also affected directly by different concentrations of BAP + TDZ in MS media. Maximum numbers of shoots per explant i.e. 3.1a±0.06 were also obtained at the same concentration. Increased concentrations of TDZ minimize shoot initiation rate described in Table 4.1.3.1.

Table 4.1.3.1: Effect of various concentrations of BAP, Kin, IAA and TDZ on shoot initiation of Longiflorum x Oriental cultivar

Conc. of different Frequency of No. of shoots Shoot length (cm) Sr. hormones shoot per explant No. BAP Kin IAA TDZ induction (%) (mg/L) (mg/L) (mg/L) (µM)

1 1.0 - - - 45 1.9b±0.02 3.5d±0.04

2 2.0 - - - 47 1.5c±0.09 3.8c±0.10 a a 3 3.0 - - - 65 2.3 ±0.09 5.0 ±0.08 4 4.0 - - - 60 2.1a±0.03 4.2b±0.07 5 0.1 0.1 2.0 - 70 2.5b±0.08 5.4a±0.07 6 0.1 0.1 3.0 - 82 3.2a±0.06 5.1b±0.08

7 0.1 0.2 2.0 - 70 2.4b±0.10 4.9c±0.06 8 0.2 0.1 2.0 - 75 3.0a±0.11 5.4a±0.07 9 1.0 - - 2.0 45 1.8d±0.04 5.2b±0.06

10 1.0 - - 4.0 52 2.5b±0.08 5.5a±0.07

11 2.0 - - 2.0 70 3.1a±0.06 5.2b±0.06 12 3.0 - - 2.0 68 2.3c±0.09 4.9c±0.06

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

4.1.3.1a 4.1.3.1b

4.1.3.1c 4.1.3.1d 4.1.3.1e

Fig. 4.1.3.1a-4.1.3.1e: Micropropagation of Longiflorum x Oriental cultivar of Lilium in different concentrations of BAP, BAP + Kin + IAA and BAP + TDZ

a) Shoot formation in MS + BAP 3.0 (mg/L) (1X); b) Cultures of V9 showing decreased shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing (1X); c) Shoot formation in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) after 30 days of culturing (1X); d) Shoot formation in MS + BAP 0.1 + Kin 0.2 + IAA 2.0 (mg/L) after 30 days of culturing (1X); e) Shoot formation in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X)

4.1.4: Longiflorum (L) group 4.1.4.1: In vitro propagation of Longiflorum cultivar Data regarding initiation frequency (%), average number of shoots per explant and the average shoot length (cm) of V10 (Easter lily) is described in Table 4.1.4.1.

MS basal medium supplemented with different concentrations of BAP alone gave the best results at BAP 3.0 (mg/L) shown in Fig. 4.1.4.1.a. At this concentration (68%) frequency of shoot initiation with 2.5a±0.08 number of shoots per explant and 5.5a±0.07 cm average shoot length was observed. It was noticed that by increasing the concentration of BAP, stimulatory effect was achieved regarding shoot initiation. At BAP 1.0 mg/L minimum number of shoots i.e. 1.7c±0.04 was observed (Fig.4.1.4.1b).

The role of Kin + IAA along with BAP on regeneration percentage of V10 was also carried out as well. It was observed that frequency of shoot induction in V10 ranged from 80-88% in MS media with different concentrations of BAP + Kin + IAA. Increased concentrations of IAA respond very well with lower concentrations of BAP + Kin. Highest rate was achieved in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) i.e. 88 % and minimum percentage was produced in MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L) i.e. 80%. Average number of shoots per explant and shoot length (cm) was also affected directly by different concentrations of BAP + Kin + IAA in MS media. Maximum numbers of shoots per explant i.e. 3.2a±0.06 were also obtained at the same concentration best for shoot induction percentage (Fig.4.1.4.1c). Lower concentrations of BAP and Kin and high concentration of IAA gave excellent results while increased concentrations of both BAP + Kin at constant IAA concentration decreased shoot initiation i.e. 80% at MS + BAP 0.2 + Kin 0.1 + IAA 2.0 (mg/L). It is evident from Table 4.1.4.1 that BAP combined with another cytokinin induced better effect as compared to BAP alone.

Frequency of shoot induction ranged from 65-77%. The combination of BAP 3.0 mg/L + TDZ 2.0 µM produced 77 % maximum rate of shoot induction and larger number of shoots 3.0a±0.11 were obtained in BAP 2.0 (mg/L) + TDZ 2.0 (mg/L).

Table 4.1.4.1: Effect of various concentrations of BAP, Kin, IAA and TDZ on shoot initiation of Longiflorum cultivar of Lilium

Conc. of different Frequency of No. of shoots Shoot length (cm) Sr. hormones shoot per explant No. BAP Kin IAA TDZ induction (%) (mg/L) (mg/L) (mg/L) (µM)

1 1.0 - - - 56 1.7c±0.04 3.9c±0.10 2 2.0 - - - 59 1.8c±0.04 4.5b±0.05 3 3.0 - - - 68 2.5a±0.08 5.5a±0.07 b a 4 4.0 - - - 72 2.1 ±0.12 5.6 ±0.07 5 0.1 0.1 2.0 - 80 2.3c±0.09 5.8b±0.04

6 0.1 0.1 3.0 - 88 3.2a±0.06 6.3a±0.11 a c 7 0.1 0.2 2.0 - 82 3.0 ±0.11 5.5 ±0.07 8 0.2 0.1 2.0 - 80 2.5b±0.08 5.4c±0.07

9 1.0 - - 2.0 65 1.3d±0.17 4.5c±0.05 c a 10 1.0 - - 4.0 66 1.6 ±0.04 5.6 ±0.07 11 2.0 - - 2.0 75 3.0a±0.11 5.2b±0.06

b a 12 3.0 - - 2.0 77 2.1 ±0.03 5.5 ±0.07

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test.

4.1.4.1a 4.1.4.1b

4.1.4.1c

Fig. 4.1.4.1a-4.1.4.1c: Micropropagation of Longiflorum cultivar of Lilium in different concentrations of BAP, BAP + Kin + IAA and BAP + TDZ

a) Shoot formation in MS + BAP 3.0 (mg/L) (1X); b) Shoot formation in MS + BAP 1.0 (mg/L) after 30 days of culturing (1X); c) Shoot formation in MS + BAP 2.0 (mg/L) + TDZ 2.0 (µM) after 30 days of culturing (1X)

4.1.5: Root Initiation

Roots were formed simultaneously with shoots of different Lilium varieties. Although no auxins addition was required separately for the initiation of roots. However among all the combination of auxins and cytokinins tried, the best medium was noticed as BAP + Kin + IAA.

Data regarding average number of roots was observed (Fig. 4.1.5a & b). Rooting response was different at different concentrations in different varieties. V1 showed highest number of roots i.e. 10±0.24 in MS + BAP 0.2 + Kin 0.2 + IAA 4.0 (mg/L) (Fig. 4.1.5c). It was noticed that lower concentrations of both cytokinins and auxins decreased the number of shoots formed in this variety. V2 showed different response as compared to V1. Maximum number of shoots produced were 15±0.26 in MS +BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) and minimum number observed were 6±0.09 in MS + BAP 0.2 + Kin 0.2 + IAA 4.0 (mg/L) (Fig. 4.1.5d). It was noticed that higher concentrations suppressed the number of roots. In case of V3 higher concentration lead to increase in the number of roots formed. It is clearly evident that by increasing the BAP and IAA concentration, average number of roots also increased i.e. 19±0.4 in V3 (Fig. 4.1.5e). Same results were noted in V4 variety with maximum number of roots 20±0.9 (Fig 4.1.5f) at same concentration best for V3. V5 showed similar rooting response to V2 (Fig. 4.1.5g). Maximum number of roots formed was 17±0.13 in this.

It is depicted in Fig. 4.1.5 b that V6 produced larger number of roots 22±0.93 as compared to all other varieties of Lilium (Fig. 4.1.5h). Best rooting media noted was MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L). This medium was also excellent for shoot initiation frequency in this variety. V7 showed best results regarding root initiation 21±0.93 number of roots in MS + BAP 0.1 + Kin 0.1 + IAA 2.0 (mg/L) (Fig. 4.1.5i). Rooting response was observed in various concentrations of BAP + Kin + IAA in V8, V9 and V10 showing that higher BAP and IAA induced positive effect on root formation in V8 with 13± roots (Fig. 4.1.5j) in MS + BAP 0.2 + Kin 0.1 + IAA 3.0 (mg/L). In V9, number of roots 14±0.89 was noted in MS + BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) shown in Fig. 4.1.5k. V10 showed maximum number of roots at higher concentration of IAA i.e. 17±0.13 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) (Fig. 4.1.5l).

25 a

15 V1 V2 10 V3

Number Number rootsof V4 5 V5

0 1 2 3 4 5 Different Conc. of BAP + Kin + IAA (mg/L)

25 b

15 V6 V7 10 V8

Number Number rootsof V9 5 V10

0 1 2 3 4 5 Different Conc. of BAP + Kin + IAA (mg/L)

Fig. 4.1.5a & b: Effect of various concentrations of BAP + Kin + IAA on average number of roots during micropropagation of different Lilium cultivars.

1= 0.1+0.1+2.0 (mg/L)

2= 0.1+0.1+3.0 (mg/L)

3= 0.1+0.2+2.0 (mg/L)

4= 0.2+0.1+2.0 (mg/L)

5= 0.2+0.2+4.0 (mg/L)

c d e f g

h i j k l

Fig. 4.1.5c-4.1.5l: Rooting response in cultures of Lilium cultivars in different concentration of BAP + Kin + IAA (mg/L) after 30 days of 2nd subculturing (1X)

c) V1 showing maximum number of roots in MS + BAP 0.2 + Kin 0.2 + IAA 4.0 (mg/L) (1X); d) Root formation in V2 in MS + BAP 0.2 + Kin 0.2 + IAA 4.0 (mg/L) (1X); e) Root formation in V3 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) (1X); f) Root formation in V4 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) (1X); g) Root formation in V5 in MS + BAP 0.2 + Kin 0.2 + IAA 2.0 (mg/L) (1X); h) Root formation in V6 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) (1X); i) Root formation in V7 in MS + BAP 0.1 + Kin 0.1+ IAA 2.0 (mg/L) (1X); j) Root formation in V8 in MS + BAP 0.2 + Kin 0.1+ IAA 3.0 (mg/L) (1X); k) Root formation in V9 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) (1X); l) Root formation in V10 in MS + BAP 0.1 + Kin 0.1+ IAA 3.0 (mg/L) (1X)

4.1.6: Acclimatization of mericlones After in vitro propagation of different Lilium cultivars, acclimatization was done in green house and results are described in Table 4.1.5. First step in hardening of in vitro developed plantlets was their shifting in autoclaved sand for at least 25-30 days in the green house at proper conditions required. After that different mixture and proportion of sand, soil, vermicompost, leaf manure and cocopeat were used to check the best media for hardening of plants (Fig. 4.1.6a-4.1.6b). Data about survival percentage of shifted plants was recorded after fixed intervals of time.

The survival percentage ranged from 25-90 % in all combinations in different cultivars of Oriental group. Highest percentage was noticed to be 90.0 % in combination of sand + soil + cocopeat in ratio of 1:1:1 in V4. Minimum survival percentage (25 %) was recorded in mixture of soil + vermicompost in the ratio of 1:1 in V1.

In case of Oriental x Trumpet group, the best potting media observed was also sand + soil + cocopeat in ratio of 1:1:1. Highest survival percentage i.e. 88 % was noticed in V5 and lowest survival percentage of 23 % was also observed in same cultivar in mixture of soil + vermicompost in the ratio of 1:1.

V9 of Longiflorum x Oriental group showed maximum survival percentage of 85 % in the combination of sand + soil + cocopeat in ratio of 1:1:1 and minimum percentage was observed in soil + vermicompost mixture i.e. 29 %.

Plants of Longiflorum cultivar showed highest survival percentage among all Lilium cultivars i.e. 95 % in same medium best for others while lowest percentage was 33 % in soil + vermicompost medium.

Table 4.1.5: Effect of various combinations of soil, compost and leaf manure on acclimatization of microplants of Lilium cultivars

Sr. Treatments Mixture Survival Percentage (%) No. (O) (OT) (LO) (L) V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 1. Soil + Sand* 1:1 50.0 45.0 33.0 40 .0 35.0 45.0 37.0 41.0 31.0 48.0

2. Soil + Vermicompost 1:1 25.0 30.0 35.0 30.0 23.0 28.0 32.0 33.0 29.0 33.0

3. Soil + Cocopeat 1:1 35.0 40.0 42.0 30.0 45.0 53.0 48.0 38.0 43.0 45.0

4. Soil + Leaf manure 1:1 45.0 55.0 50.0 30.0 50.0 56.0 54.0 61.0 52.0 57.0

5. Sand + Soil + Vermicompost** 1:1:1 55.0 60.0 58.0 60.0 52.0 62.0 65.0 64.0 60.0 68.0

6. Sand + Soil + Cocopeat 1:1:1 85.0 80.0 83.0 90.0 88.0 84.0 86.0 83.0 85.0 95.0

7. Sand + Soil + Leaf manure 1:1:1 80.0 75.0 81.0 80.0 73.0 78.0 83.0 80.0 81.0 88.0

*1:1(50:50) **1:1:1(33:33:33)

a b

Fig. 4.1.6 a-b: Acclimatization of plants of Lilium cultivars in different potting media

a) Growth of plants shifted in mixture of Sand + Soil + Cocopeat after 10 days of shifting (1X); b) Hardening of plants shifted in mixture of Sand + Soil + Vermicompost after 10 days of shifting (1X); c) Growth of plants in open field (1X)

4.2: Induced mutagenesis

The present experiment was conducted to induce mutation in different Lilium cultivars to screen out the best mutants having better characteristics as compared to control ones. For this purpose in vivo mutagenesis, in vitro mutagenesis and molecular characterization of irradiated and non-irradiated plants was carried out. Bulbs were treated with different doses of gamma rays and were planted in pots of 14 inch to check the growth pattern of all treated bulbs with (2.0, 4.0, 6.0, 8.0 & 10.0) Gy doses of gamma radiation.

Four main cultivars were selected for the present study

4.2.1. Lilium Oriental (O)

4.2.2. Lilium Oriental x Trumpet (OT)

4.2.3. Lilium Longiflorum x Oriental (LO)

4.2.4. Lilium Longiflorum (L)

4.2.1: Oriental (O) group 4.2.1.1: In vivo mutagenesis Bulbs treated with different doses of gamma rays were planted in 14 inch pots and growth pattern of each treated bulb was studied. Morphological characters (Germination rate (%), average number of leaves, leaf length (cm), leaf width (cm) and plant height (cm) were observed for all cultivars of Lilium.

4.2.1.1.1: Morphological study of Oriental cultivars

Data regarding effect of different doses of gamma rays on germination responses, germination percentages and survival percentage of irradiated and non-irradiated plants produced from the treated bulbs of all varieties of Oriental cultivars of Lilium is presented in Table 4.2.1.1.1.

V1 showed different results regarding days to germination, germination rate and survival percentage of germinated plants. Increase in doses lead to increase the plant survival percentage as well germination percentage. Number of days for germination after sowing also decreased with increasing the dose. Control plants of V1 showed germination after 16 days while at 2.0 Gy response to days increased (24), but further increase in gamma rays dose gradually decreased the time taken up by the plants to start initiation (8) at 10.0 Gy. Similarly 85 % germination rate was observed in control plants (Fig. 4.2.1.1.1a) which increased upto 90 % at 10.0 Gy shown in Fig. 4.2.1.1.1b. 100 % survival percentage was observed at 00 Gy, 75 % at 8.0 Gy and 95 % at 10.0 Gy.

In control plants of V2, germination was started within 10 days after sowing. While radiated plants of this variety showed delay in germination response by increasing the doses of gamma rays. It was observed that plants at 2.0 Gy of gamma dose started germination after 13 days and plants at higher dose delayed their germination upto 29 days. In V2, the germination percentage ranged from 20 – 100 (%). Maximum rate was observed in control plants (Fig. 4.2.1.1.1c). Germination percentage was not much affected with the increase in dose of gamma rays upto 2.0 Gy. Minimum germination rate (20 %) was noted in V2 at 10 Gy shown in Fig. 4.2.1.1.1d. with 15 % of survival rate. V2 showed highest germination rate (75 %) at 2.0 Gy with 80 % survival rate at this dose.

In case of V3, germination was started within 18 days after sowing in control plants, while radiated plants of this variety showed delay in germination response by increasing the

doses of gamma rays. It was noticed that plants at 2.0 Gy of gamma dose started germination after 20 days and plants at higher dose delayed their germination upto 32 days at 10.0 Gy dose of gamma irradiation. Germination percentage varied between 55 – 100 (%) with highest rate of germination in control plants i.e. 100 % and 55 % at 10 Gy (Fig. 4.2.1.1.1e-4.2.1.1.1f). 100 % plants survived at 00 Gy dose (non-irradiated plants) and 30 % survival rate was observed in V3 at 10 Gy of gamma rays. In control plants of V4, germination was started within 14 days after sowing. While radiated plants of this variety showed delay in germination response by increasing the doses of gamma rays. It was observed that plants at 2.0 Gy of gamma dose started germination after 17 days and plants at higher dose delayed their germination upto 35 days. The germination percentage ranged from 41 – 90 (%) in V4 (Fig. 4.2.1.1.1g-4.2.1.1.1h). Germination percentage was not much affected with the increase in dose of gamma rays upto 6.0 Gy. Minimum germination rate (41 %) was noted 10 Gy with 38 % of survival rate. Highest germination rate (75 %) was observed at 2.0 Gy with 65 % survival rate at this dose.

Some other parameters including average number of leaves, leaf length and leaf width of Oriental cultivars of Lilium showed significant change at different doses of gamma rays as mentioned in Table 4.2.1.1.2. Non-irradiated plants of V1 showed 35d±0.26 leaves with 6.9d±0.08 cm leaf length and 1.0d±0.04 cm leaf width (Fig. 4.2.1.1.2a). Higher doses of gamma rays induced stimulatory effect on average number of leaves, leaf length as well leaf width as compared to control plants. By increasing the dose, positive results were observed. Number of leaves, leaf length and leaf width decreased at 2.0 and 4.0 Gy but further increase in gamma rays dose caused increase in number of leaves, leaf length and width. Maximum number of leaves was 80a±0.46 with highest leaf length and leaf width i.e. 9.5a±0.01 cm and 2.5a±0.08 cm at 10.0 Gy (Fig. 4.2.1.1.2b).

Average number of leaves gradually decreased with increasing doses of gamma rays in V2. Similar results were noted in response to leaf length but leaf width showed significant increased at higher dose. Larger number of leaves was produced in control plants 69a±0.77. At 2.0 Gy 42b±1.09 leaves were formed while at 10 Gy, average number of leaves decreased upto 12d±0.48. Similarly by increasing the dose of gamma rays, leaf length decreased. Leaf length of control plants observed was 9.4a±0.01 cm (Fig. 4.2.1.1.2c). At 10 Gy the length reduced upto 1.6f±0.04 cm. Leaf width of V2 showed different behavior in

response to higher dose of gamma rays. By increasing the dose, width of leaf increased i.e. from 0.7a±0.06 cm to 1.0b±0.04 cm (Fig. 4.2.1.1.2d).

Control plants of V3 showed 40a±1.16 leaves with 5.4c±0.01 cm leaf length and 1.1a±0.05 cm leaf width (Fig. 4.2.1.1.2e). Higher doses of gamma rays had inhibitory effect on average number of leaves, leaf length as well leaf width as compared to control plants. By increasing the dose, number of leaves reduced. Minimum number of leaves i.e. 14c±0.89 was produced at 10 Gy. Response of leaf length and leaf width at different doses of gamma irradiation was entirely different as compared to number of leaves. By increasing the doses, leaf length showed increased at some doses while decreased at others. At 2.0 Gy length increased from 5.4c±0.01 to 7.2a±0.02 but width at this dose decreased from 1.1a±0.05 cm to 0.9b±0.05 cm. At 6.0 Gy leaf length decreased while at 8.0 Gy, increase in length was again observed i.e. from 4.0d±0.07 cm to 7.3a±0.04 cm. Minimum leaf length and width was observed at 10 Gy i.e. 3.0e±0.11 cm and 0.7c±0.06 cm (Fig. 4.2.1.1.2f). Control plants showed leaf length of 5.4c±0.01 cm.

Average number of leaves gradually decreased with increasing doses of gamma rays in V4. Similar results were noted in response to leaf length but leaf width showed significant increased at some doses. Larger number of leaves was produced in control plants 42a±1.09. At 2.0 Gy 26b±0.93 leaves were formed while at 10 Gy, average number of leaves decreased upto 2.0e±0.4. Similarly by increasing the dose of gamma rays, leaf length and width decreased. Leaf length of control plants observed was 7.0a±0.06 cm with 4.1a±0.05 cm width (Fig. 4.2.1.1.2g). At 10 Gy the length reduced upto 1.0e±0.04 cm with 0.8d±0.05 cm width (Fig. 4.2.1.1.2h).

Effect of gamma rays on the height of treated plants of Oriental cultivars of Lilium is mentioned in Fig. 4.2.1.1.3. It is evident from Fig. 4.2.1.1.3 that height of plants germinated from irradiated bulbs was strongly affected by the doses of gamma rays. It was observed that V1 plants at 0 dose showed plant height of 46±0.89 cm (Fig. 4.2.1.1.4a) while maximum plant height of 96±0.57 cm was noticed at 10 Gy (Fig. 4.2.1.1.4b). The data indicated that plants of V1 respond well at higher dose. In V2, reduction in plant height occurred by increasing the gamma irradiation dose. Control plants showed highest plant height i.e. 71±0.63 cm (Fig. 4.2.1.1.4c). At dose of 10 Gy least plant height of 5.5±0.38 cm was observed (Fig. 4.2.1.1.4d).

Maximum height of 44±0.93 cm was observed in control plants of V3 (Fig. 4.2.1.1.4e). In case of radiated plants of V3 reduction in plant heights occurred with increased gamma irradiation dose i.e. 17±1.13 cm at 10.0 Gy (Fig. 4.2.1.1.4f). V4 showed maximum plant height of 45±1.01 cm at 0 dose and 3±0.11 cm at 10.0 Gy (Fig. 4.2.1.1.4g-4.2.1.1.4h).

Table 4.2.1.1.1: The effect of different doses of gamma irradiations on the germination response, germination percentage and survival percentage of Oriental cultivars

Sr. Variety name Code Dose Germination Germination rate Plant survival No. (Gy) Response (Days) (%) (%) 000 16.0 85.0 100 2.00 24.0 75.0 100 4.00 15.0 72.0 75.0 1 Samur La pink V1 6.00 19.0 69.0 72.0 8.00 12.0 75.0 80.0 10.0 8.00 90.0 95.0 000 10.0 100 100 2.00 13.0 75.0 80.0 4.00 15.0 55.0 65.0 2 Heaven white V2 6.00 16.0 40.0 50.0 8.00 19.0 25.0 32.0 10.0 29.0 20.0 15.0 000 18.0 100 100 2.00 20.0 80.0 65.0 4.00 22.0 75.0 65.0 3 Kabana lily V3 6.00 23.0 71.0 65.0 8.00 26.0 55.0 43.0 10.0 32.0 30.0

000 14.0 90.0 100 2.00 17.0 75.0 65.0 4.00 23.5. 62.0 50.0 4 Montezuma-O- V4 6.00 29.0 61.0 45.0 red 8.00 31.0 54.0 38.0 10.0 35.0 41.0 38.0

a b

c d

Fig. 4.2.1.1.1a-d: Germination response of Oriental cultivars of Lilium at different

doses of gamma rays a) Germination rate of control plants of V1 after 16 days (1X); b) Germination rate of V1 at dose of 10 Gy after 8 days (1X); c) Germination rate of control plant of V2 after 10 days (1X); d) Germination rate of V2 at 10.0 Gy after 29 days (1X)

e f

g h

Fig. 4.2.1.1.1e-h: Germination response of Oriental cultivars of Lilium at different

doses of gamma rays e) Germination rate of control plant of V3 after 18 days (1X); f) Germination rate at dose of 10 Gy of V3 after 32 days (1X); g) Germination rate of control plant of V4 after 14 days (1X); h) Germination rate of V4 at dose of 10 Gy after 35 days (1X)

Table 4.2.1.1.2: Effects of different doses of gamma rays on the length, number and width of leaves of Oriental cultivars of Lilium

Sr. Variety name Code Dose Average no. of leaves Leaf length (cm Leaf width (cm) No. (Gy) 000 35d±1.26 6.9d±0.08 1.0d±0.04 2.00 19e±0.40 3.8e±0.10 0.7d±0.06

4.00 18e±0.28 4.0e±0.07 0.9d±0.05 1 Samur La pink V1 6.00 43c±0.97 7.7c±0.05 1.3c±0.17 8.00 55b±0.48 8.9b±0.02 1.8b±0.04 10.0 80a±1.46 9.5a±0.01 2.5a±0.08

000 69a±0.77 9.4a±0.01 0.7b±0.06 2.00 42b±1.09 8.4b±0.10 1.0b±0.04 4.00 33c±0.80 5.5c±0.07 0.6b±0.06 2 Heaven white V2 6.00 28c±0.63 4.8d±0.06 0.7b±0.06 8.00 18d±0.28 3.2e±0.06 0.8b±0.04 10.0 12d±0.48 1.6f±0.04 1.0a±0.04

000 40a±1.16 5.4c±0.01 1.1a±0.05 2.00 26b±0.93 7.2a±0.02 0.9b±0.05 4.00 23b±1.42 6.5b±0.11 0.8bc±0.04 3 Kabana lily V3 6.00 25b±0.93 4.0d±0.07 0.9b±0.05 8.00 17c±1.13 7.3a±0.04 0.8bc±0.04 c e c 10.0 14 ±0.89 3.0 ±0.11 0.7 ±0.06

a a a 000 42 ±1.09 7.0 ±0.06 4.1 ±0.05 2.00 26b±0.63 4.0b±.074 0.9d±0.05 4.00 12d±0.48 3.1c±0.06 2.5b±0.08 4 Montezuma- V4 6.00 19c±0.63 2.5d±0.08 0.7d±0.06 O-red 8.00 12d±0.40 1.0e±0.04 1.0c±0.04 10.0 2.0e±0.40 1.0e±0.04 0.8d±0.05

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test

a b c d

e f g h

Fig. 4.2.1.1.2a-h: Leaf length and width at different gamma rays doses

a) Leaf length and width of control plant of V1 (1X); b) Leaf length and width at 10.0 Gy of V1 (1X); c) Leaf length and width of control plant of V2 (1X); d) Leaf length and width of V2 at 10 Gy (1X); e) Leaf length and width of V3 at 00 Gy (1X); f) Leaf length and width at 10.0 Gy of V3 (1X); g) Leaf length and width of non-irradiated plants of V4 (1X); h) Leaf length and width at 10.0 Gy of V4 (1X)

120 4.2.1.1.3

100

) 80 V1 60 V2

40 V3 Plant height (cm V4 20

0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.1.1.3: Effect of different doses of gamma rays on plant height of

Oriental cultivars of Lilium

V1= Samur La pink

V2= Heaven white

V3= Kabana lily

V4= Montezuma-O-red

a b c d

e f g h

Fig. 4.2.1.1.4a-g: Plant height of Oriental cultivars of Lilium at different

doses of gamma rays a) Plant height of control plants of V1 (1X); b) Plant height of V1 at dose of 10 Gy (1X); c) Plant height of control plant of V2 (1X); d) Plant height of V2 at 10.0 Gy (1X); e) Plant height of control plant of V3 (1X); f) Plant height at dose of 10 Gy of V3 (1X); g) Plant height of control plant of V4 (1X); h) Plant height of V4 at dose of 10 Gy (1X)

4.2.1.2: In vitro mutagenesis In vitro regenerated shoots from the Lilium scales of only one month age were treated with different doses of gamma rays same as in in vivo mutagenesis study and were used as explant for further study. These shoots were cultured in the same medium which was optimized as the best in the previous experiment under optimum conditions at 22±1ºC for in vitro shoot multiplications. Effect of stationary and shake cultures was observed by using the same medium. Experiment was repeated after shifting of the cultures periodically

3-4 weeks. The regeneration percentages and shoot multiplication in M1V1 generation of different Lilium cultivars were observed. All in vitro cultures of M1V1 were multiplied for two to three cycles in order to get M1V4 generation as in induced mutation, subsequent multiplication of in vitro cultures for two to three cycles is helpful in selecting mutants (Maluszynski et al., 1995). Then all morphological characteristic of in vitro derived mutants from M1V4 generation were also observed after hardening.

4.2.1.2.1: Shoot multiplication Observations regarding regeneration frequency, number of shoots per explant and shoot length of irradiated stationary in vitro cultures are presented in Table 4.2.1.2.1. For in vitro mutagenesis, in vitro regenerated shoots were inoculated in MS medium fortified with different concentrations and combinations of BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) as optimized media in first section of results. Mostly lower doses of gamma rays promoted multiplication while in some cultivars high dose also increased multiplication rate.

In V1 highest regeneration frequency was observed at higher dose of irradiation i.e. 88 % (Fig. 4.2.1.2.1a) and lowest at 6.0 Gy i.e. 65 %. V2 showed maximum regeneration rate in control plants 81 %. Beyond this dose, rate of formation was reduced upto 47 at 10 Gy. Lower doses were helpful in increasing the shoot formation percentage in V3. The value ranged between 46-75 (%) at different doses. 86 % regeneration rate was observed in control plants of V4 which showed reduction in the shoot formation upto 60 % at higher dose i.e. 10.0 Gy. When explants of V1 exposed to 10 Gy, maximum number of shoots were formed 3.8a±0.10 at this dose which decreased upto 2.3c±0.09 at lower dose of 6.0 Gy. While in all others Oriental cultivars maximum shoots of (3.8a±0.10, 3.1a±0.06 and 3.2a±0.06) were produced in control plant explants and when plants exposed to higher doses, reduction in number of shoot formation occurred i.e. (1.2e±0.04,1.0d±0.04 and 1.6c±0.04) shown in Fig. 4.2.1.2.1b at 10.0 Gy. Similarly shoot length also showed same

results with increase or decrease in gamma rays in all cultivars as in case of number of shoots. V1 gave highest shoot length of 6.9a±0.08 cm at 10.0 Gy and 5.5b±0.07 cm at 00 dose.

Shoot length of V2 varied between 2.5e±0.08 to 5.5a±0.07 (cm) at 0 dose and 10.0 Gy. Maximum shoot length of 5.3a±0.06 cm was observed in V3 control plants (Fig. 4.2.1.2.1c) and minimum shoot length of 3.3cd±0.04 cm was observed at 10.0 Gy. Shoot length of V4 ranged from 4.5c±0.05 to 5.7a±0.04 (cm) shown in Fig. 4.2.1.2.1d at 0 and 10.0 Gy gamma irradiation dose.

Effect of different doses of gamma rays on shaking cultures of in vitro Oriental Lilium cultivars is described in Table 4.2.1.2.2. It was noticed that gamma rays induced same effect as in stationary cultures but cultures phase i.e. shaking of cultures (120 rpm) enhanced regeneration potential of all cultivars. Regeneration frequency increased from 85- 88 percent in control plants of V1 and from 88-90 percent in irradiated plants at 10.0 Gy. In case of V2, rate increased from 81-83 percent in control plants and from 47 to 53 percent at dose of 10.0 Gy. Shaking of the cultures promoted shoot formation rate from 75 to 78 percent in control plants of V4 while at 10.0 Gy, this shaking effect increased the frequency of shoot initiation from 46-52 percent. Shake cultures of V4 showed maximum shoot formation rate in control plants i.e. 90 % and lowest value of 66 % was noticed in this cultivar at 10.0 Gy.

Maximum number of shoots 6.0a±0.04 (Fig. 4.2.1.2.2a) were observed at 10.0 Gy in shake cultures while 3.8b±0.10 number of shoots were shown in control plants with shoot length of 6.6bc±0.08 and 7.1b±0.05 cm. V2 showed larger number of shoots 4.2a±0.06 with shoot length of 6.5a±0.11 cm (Fig. 4.2.1.2.2b) at 0 dose of gamma irradiation and only 2.0d±0.03 shoots were appeared at 10.0 Gy with 3.3e±0.04 cm shoot length. In control plants of shake cultures of V3, 3.5a±0.06 shoots (Fig. 4.2.1.2.2c) were noticed having shoot length of 5.8a±0.08 cm which decreased upto 1.9c±0.24 in number and 4.5cd±0.05 cm in length. Number of shoots increased from 3.2a±0.06 to 4.0a±0.07 in control plants of shake cultures of V4 as compared to stationary plants and at 10.0 Gy, the number increased from 1.6e±0.04 to 2.5c±0.08 (Fig. 4.2.1.2.2d). Shoot length also increased from 5.7d±0.04 cm to 7.0b±0.06 cm in control plants and from 4.5c±0.05 cm to 5.3e±0.06 cm at higher dose of 10.0 Gy.

Data regarding effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants of Oriental Lilium cultivars is shown in Table. 4.2.1.2.3. It is clearly evident from the table that sucrose amount directly influenced the frequency of bulblet formation. By increasing the sucrose concentration from 30 to 60 %, bulblet formation rate also increased in all cultivars but further increase from 60-90 percent lead to decrease in frequency of bulblet formation. At 30 % sucrose amount, highest bulblets formation rate was observed in V1 at 10.0 Gy and lowest (52) % was noticed at same sucrose concentration in V3 at 10.0 Gy. Increased amount of sucrose upto 60 % enhanced formation of bulblets as in V1 from 89 to 90 percent in plants at 10.0 Gy (Fig. 4.2.1.2.3a) and from 52 to 73 in V3 at 10.0 Gy (Fig. 4.2.1.2.3b). Further increase of sucrose amount caused decrease in frequency of bulblet formation i.e. from 89 to 85 percent in plants of V1 and from 52 to 48 % in V3 plants at 10.0 Gy (Fig. 4.2.1.2.3c). Healthy plants were shifted to autoclaved sand in green house for acclimatization (Fig. 4.2.1.2.3d).

Table 4.2.1.2.1: Effect of different doses of gamma rays on regeneration potential of stationary in vitro cultures of Oriental cultivars of Lilium

Sr. Variety name Code Dose Regeneration No. of shoots/explant Shoot length No. (Gy) frequency (%) (cm) 00 85 3.2b±0.06 5.5b±0.07 2.0 80 3.1b±0.06 5.3b±0.06 4.0 79 2.5c±0.08 4.8c±0.06 1 Samur La pink V1 6.0 65 2.3c±0.09 4.5c±0.05 b a 8.0 86 3.0 ±0.11 6.6 ±0.08 10.0 88 3.8a±0.10 6.9a±0.08 00 81 3.8a±0.10 5.5a±0.07 2.0 79 3.0b±0.11 5.0b±0.08 4.0 62 2.4c±0.10 4.0c±0.07 2 Heaven white V2 6.0 60 1.9d±0.24 3.3d±0.04 8.0 54 1.6d±0.04 3.1d±0.06 e e 10.0 47 1.2 ±0.04 2.5 ±0.08 00 75 3.1a±0.06 5.3a±0.06 2.0 69 2.5b±0.08 4.8a±0.06

4.0 65 2.1b±0.12 4.5b±0.05 3 Kabana lily 6.0 58 1.8c±0.04 4.0c±0.07 V3 8.0 52 1.6c±0.04 3.8d±0.10 10.0 46 1.0d±0.04 3.3cd±0.04 00 86 3.2a±0.06 5.7a±0.04 2.0 84 3.0a±0.11 5.5b±0.07 b b 4.0 74 2.4 ±0.10 5.4 ±0.07 4 Montezuma-O- V4 6.0 70 2.3b±0.09 5.3b±0.06 red 8.0 63 1.8c±0.04 4.8c±0.06 10.0 60 1.6c±0.04 4.5c±0.05

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

c d

Fig. 4.2.1.2.1a-d: Effect of different doses of gamma irradiations on in vitro growth of stationary cultures Oriental cultivars

a) V1 showing highest regeneration frequency at 10.0 Gy (1X); b) Reduction in number of shoots of V2, V3 and V4 at 10.0 Gy (1X); c) V3 control plants showing highest shoot length (cm) (1X); d) V4 plants showing shoot length at 10.0 Gy (1X)

Table 4.2.1.2.2: Effect of different doses of gamma rays on regeneration potential of shaking cultures (rpm) of in vitro Oriental cultivars

Sr. Variety name Code Dose Regeneration No. of shoots/explant Shoot length No. (Gy) frequency (%) (cm)

00 88 3.8b±0.10 6.6bc±0.08 c c 2.0 85 3.4 ±0.04 5.7 ±0.07 4.0 81 3.2c±0.06 5.3cd±0.06 cd d 1 Samur La pink V1 6.0 68 2.9 ±0.11 5.0 ±0.08 8.0 89 3.3c±0.04 7.7a±0.05 a b 10.0 90 6.0 ±0.04 7.1 ±0.05 00 83 4.2a±0.06 6.5a±0.11 2.0 82 3.9ab±0.10 5.5b±0.07 4.0 65 3.5b±0.05 4.8c±0.06 2 Heaven white V2 6.0 64 3.0bc±0.11 3.8d±0.10 8.0 58 2.5c±0.08 3.4de±0.04 10.0 53 2.0d±0.03 3.3e±0.04 00 78 3.5a±0.06 5.8a±0.08 2.0 75 3.0ab±0.11 5.3b±0.06 4.0 69 2.6b±0.08 4.9c±0.05 3 Kabana lily V3 6.0 64 2.4b±0.10 4.8c±0.06 8.0 58 2.1bc±0.12 5.0b±0.08 10.0 52 1.9c±0.24 4.5cd±0.05 00 90 4.0a±0.07 7.0b±0.06 a d 2.0 86 3.8 ±0.10 6.0 ±0.04 4.0 79 3.3ab±0.04 7.7a±0.05

4 Montezuma- V4 6.0 75 3.1b±0.06 6.6bc±0.08 b c O-red 8.0 69 3.0 ±0.11 6.5 ±0.11 10.0 66 2.5c±0.08 5.3e±0.06

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

c d

Fig. 4.2.1.2.2a-d: Effect of different doses of gamma irradiations on in vitro growth of shaking cultures of Lilium Oriental cultivars

a) Maximum number of shoots at 10.0 Gy in V1 (1X); b) Maximum number of shoots in control plants of V2 (1X); c) V3 control plants showing maximum shoots in shaking cultures (1X); d) V4 plants showing larger number of shoots in shaking cultures (1X)

Table 4.2.1.2.3: Effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants of Oriental cultivars of Lilium

Plant Sucrose Gamma rays Frequency of bulblet formation (%) hormones amount dose BAP + Kin + (%) (Gy) V1 V2 V3 V4 IAA (mg/L) 00 85 76 80 81 2.0 80 73 75 77 4.0 77 70 70 73 6.0 68 66 63 65 30 8.0 87 63 56 60 10.0 89 60 52 58

00 86 80 89 88 2.0 85 76 87 85 4.0 82 71 85 83 0.1 + 0.1 + 3 60 6.0 76 68 81 78 8.0 88 66 79 74 10.0 90 64 73 71

00 83 72 75 79 2.0 76 69 72 74 90 4.0 72 65 66 70 6.0 65 61 59 62 8.0 84 58 52 59 10.0 85 53 48 56

a b

c d

Fig. 4.2.1.2.3a-d: Effect of different amount of sucrose g/L on bulblet formation of Oriental cultivars

a) Bulblet formation in V1 in 60g/L sucrose at 10.0 Gy (1X); b) V2 showing bulblet formation in 60g/L Sucrose at 10.0 Gy (1X); c) Reduction in bulblet formation in V1 at 10.0 Gy in 90g/L sucrose amount (1X); d) Hardening of plants of Oriental group (1X)

4.2.1.2.2: Studies on morphology of M1V4 and M1V5 generation of in vitro derived mutants

Effect of different doses of gamma irradiations on plant height and number, length and width of leaves of M1V4 generation of Oriental cultivars derived from in vitro mutagenesis is mentioned in Table 4.2.1.2.4. Plant height, number of leaves, leaf length was significantly influenced by irradiation dose and interaction effects were significant for all cultivars. All these parameters showed reduction by increasing the gamma irradiation dose except in case of V1 where increase in plant height, average number of leaves formed, increase in length and width of leaves observed at higher dose of 10.0 Gy. V1 showed significant increase from 18.5d±0.34 leaves to 35a±1.26 with highest plant height at 10.0 Gy i.e. 96a±0.05 cm (Fig. 4.2.1.2.4a) and lowest 46c±0.93 cm at 0 dose.

Similarly leaf length increased from 6.9bc±0.08 to 9.9a±0.04 cm (Fig. 4.2.1.2.4e) while width also increased at this dose i.e. from 1.0d±0.04 cm to 3.1a±0.06 cm. In all other cultivars opposite results were obtained by increasing the gamma rays doses. As in case of control plants of V2, V3 and V4, average number of leaves formed were 69a±0.77, 40a±1.16 and 42a±1.09 with plant height of 70a±0.74, 44a±0.93 and 25a±0.2 cm shown in Fig. 4.2.1.2.4b-4.2.1.2.4d which decreased at 10.0 Gy to 33cd±0.80, 15d±0.63 and 5.0d±0.08 leaves and 25d±0.20, 22d±0.93 and 5.5c±0.07 cm plant height. Leaf length also decreased with increasing the dose i.e. leaf length of 9.4a±0.14 cm was observed in control plants of V2 (Fig.4.2.1.2.4f) with 0.7d±0.06 cm width. V3 showed decrease in leaf length from 5.4bc±0.03 shown in Fig. 4.2.1.2.4g to 3.8d±0.10 cm and also in V4 (Fig. 4.2.1.2.4h) from 7.0a±0.06 to 1.5e±0.20 cm. Gamma rays showed no significant change in case of leaf width of all cultivars. In V2, increase in leaf width observed i.e. from 0.7d±0.06 to 2.9a±0.16 cm.

The number and average length of roots of in vitro irradiated and non-irradiated Lilium cultivars is presented in Fig. 4.2.1.2.5a-4.2.1.2.5b.

It was noticed that higher doses of gamma rays induced positive effect in response of number of roots which increased with increasing the dose. In all Lilium cultivars maximum roots shown in Fig. 4.2.1.2.5c-4.2.1.2.5d (11±0.04, 13±1.26, 8±0.10 and 4.5±0.05) were formed at 10.0 Gy with minimum number in control plants of these cultivars i.e. 5.0±0.08, 2.0±0.12, 3.0±0.12 and 2±0.12 (Fig. 4.2.1.2.5e-4.2.1.2.5f) at 0 dose.

The observed highest root length was 8.0±0.10 cm at 10.0 Gy in V1 and 5.3±0.07 cm at 8.0 Gy in V2. Maximum root length of V3 and V4 cultivars was also observed at 10.0 Gy i.e. 9.0±0.02 cm and 10.0±0.04 cm.

Superior mutants were selected on the basis of change in the flower morphology of M1V5 generation as compared to control ones. Data about average number of days to flowering and floral characteristics is presented in Table 4.2.1.2.5. Number of days taken up by the plant to flowering remained same in control and mutants at higher dose of 10.0 Gy and less time was taken by V1 at 8.0 Gy for flowering i.e. 38c±1.01 days but at this dose no change in colour was observed as compared to control one. Mutants at 10.0 Gy showed change in flower morphology in aspect of colour, size and shape. Larger flower of light pink having smooth petals were observed at this dose (Fig. 4.2.1.2.6a-b).

Time taken up by V2 to produced flowers showed very less difference. Control plants flowered in more days 58bc±0.63 as compared to mutant ones which showed flowering in 52c±0.63 days at 10.0 Gy. Flower morphology was same to control plants at all doses in this cultivar. Colour of plants noticed was white (Fig. 4.2.1.2.6c-4.2.1.2.6d).

Purple colour flowers of V3 cultivars were produced at all doses of gamma rays and control ones having same floral characteristics (Fig. 4.2.1.2.6e-4.2.1.2.6f). Number of days decreased with increasing the gamma irradiation dose i.e. from 49d±0.93 to 47d±0.93 days.

Number of days taken up by V4 plants was same in control and mutants at 10.0 Gy. Plants at dose of 10.0 Gy produced flowers which are darker in colour as compared to control ones (Fig.4.2.1.2.6g-4.2.1.2.6h).

Table 4.2.1.2.4: Effect of different doses of gamma irradiations on plant height and number, length and width of leaves of M1V4 generation of

Oriental derived from in vitro mutagenesis

Sr. Variety name Code Dose Average no. of leaves Plant height (cm) Leaf length Leaf width No. (Gy) (cm) (cm) 00 18.5d±0.34 46.0c±0.93 6.9bc±0.08 1.0d±0.04 2.0 25.0b±0.20 28.0d±0.63 4.5c±0.05 1.2c±0.04 4.0 23.0b±1.41 26.0d±0.93 4.8c±0.06 1.1d±0.05 1 Samur La pink V1 6.0 19.0cd±0.40 62.0bc±1.01 8.4b±0.10 1.5c±0.20 8.0 20.0c±0.69 71.0b±0.63 8.5b±0.06 2.1b±0.12 10.0 35.0a±1.26 96.0a±0.05 9.9a±0.04 3.1a±0.06 00 69.0a±0.77 70.0a±0.74 9.4a±0.14 0.7d±0.06 2.0 48.0b±0.93 49.0b±0.93 8.9ab±0.02 1.5b±0.20 4.0 45.0b±1.01 44.0bc±0.93 7.1b±0.05 1.2bc±0.04 2 Heaven white V2 6.0 42.0bc±1.09 40.0c±1.16 5.3c±0.06 1.0c±0.04 8.0 38.0c±0.50 38.0cd±0.50 4.0cd±0.87 1.3b±0.17 10.0 33.0cd±0.80 25.0d±0.20 2.5d±0.08 2.9a±0.16 00 40.0a±1.16 44.0a±0.93 5.4bc±0.07 1.1ab±0.05 2.0 30.0b±0.28 35.0b±1.26 7.7ab±0.05 1.2a±0.04 4.0 25.0c±0.12 33.0b±0.80 6.9b±0.08 1.1ab±0.05 3 Kabana lily V3 6.0 31.0b±0.63 31.0bc±0.63 4.8a±0.06 1.0bc±0.04 8.0 19.0d±0.40 28.0c±0.63 8.4a±0.10 1.3a±0.17 10.0 15.0d±0.63 22.0d±0.93 3.8d±0.10 1.1ab±0.05 00 42.0a±1.09 25.0a±0.20 7.0a±0.06 1.1bc±0.05 2.0 22.0b±0.93 20.0b±0.69 5.4b±0.07 1.3b±0.17 4.0 19.0bc±0.40 18.5b±0.34 4.0c±0.07 3.0a±0.11 4 Montezuma- V4 6.0 15.0c±1.26 5.00c±0.08 3.2d±0.06 1.0c±0.05 O-red 8.0 6.00d±0.04 6.00c±0.04 1.5e±0.20 1.2b±0.04 10.0 5.00d±0.08 5.50c±0.07 1.5e±0.20 0.5d±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b d c

e f g h

Fig. 4.2.1.2.4a-h: Effect of different doses of gamma irradiations on plant height, leaf length and

width (cm) of M1V4 generation of Oriental cultivars

a) Plant height of V1 at 10.0 Gy (1X); b) V2 control plants showing shoot height (1X); c) Plant height of control plants of V3 (1X); d) Maximum plant height of V4 plants at 0 dose of gamma rays (1X); e) Leaf length of V1 at 10.0 Gy (1X); f) Leaf length of V2 control plants (1X); g) Leaf length of V3 at 0 dose of gamma rays (1X); h) Control plants of V4 showing leaf length (1X)

14 a 12

8 V1

6 V2 V3 Numberofroots 4 V4 2

0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.1.2.5a: Effect of radiation on number of roots of M1V4 generation of in vitro derived mutants of Oriental cultivars

10 9 b 8 7 6 V1 5 V2 4 V3

Rootlength(cm) 3 2 V4 1 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.1.2.5b: Effect of radiation on root length of M1V4 generation of in vitro derived mutants of Oriental cultivars

c d

e f

Fig. 4.2.1.2.5c-f: Rooting of M1V4 generation of Oriental Lilium cultivars

c) Rooting ofV1 at 10.0 Gy (1X); d) V2 showing rooting at 10.0 Gy (1X); e) Control plants of V3 showing rooting (1X); f) V4 control plants showing roots

Table 4.2.1.2.5: Effect of radiation on flower formation of in vitro derived mutants of M1V5 generation of Oriental cultivars

Sr. Variety Dose Average No. of Floral characters No. name (Gy) days to flowering Colour Size shape

00 46a±0.89 Pink Normal Pigmented petals 2.0 47a±0.93 - - - 4.0 45ab±1.01 - - - 1 Samur La 6.0 43b±0.97 - - - pink 8.0 38c±1.01 - - - (V1) 10.0 46a±0.89 Light pink Larger Smooth

00 58bc±0.63 White Normal Normal 2.0 62b±1.01 - - - 4.0 68ab±0.80 - - - 2 Heaven white 6.0 69a±0.77 - - - (V2) 8.0 70a±0.74 - - - 10.0 52c±0.63 - - -

00 49d±0.93 Purple Normal Normal 2.0 51c±0.63 - - - 4.0 53bc±0.40 - - - 3 Kabana lily 6.0 55b±0.48 - - - (V3) 8.0 62a±1.01 - - - 10.0 47d±0.93 - - -

00 55b±0.48 Purplish red Normal Normal 2.0 50bc±0.63 - - - 4.0 62ab±1.01 - - - 4 Montezuma- 6.0 60ab±0.63 - - - O-red 8.0 69a±0.77 - - - (V4) 10.0 55b±0.48 Darker - -

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

(-) indicated same to control

a b

c d

Fig. 4.2.1.2.6a-d: Flowers of M1V5 generation of Oriental cultivars

a) Flower of V1 control plant (1X); b) V1 Flower morphology at 10.0 Gy (1X); c) Control plants of V2 showing flower formation (1X); d) V2 plants showing flower at 10.0 Gy (1X)

e f

g h

Fig. 4.2.1.2.6e-h: Flowers of M1V5 generation of Oriental cultivars

e) Flower of V3 control plant (1X); f) V3 Flower morphology at 10.0 Gy (1X); g) Control plants of V4 showing flower formation (1X); h) V4 plants showing flower at 10.0 Gy (1X)

4.2.2: Oriental x Trumpet (OT) group 4.2.2.1.: In vivo mutagenesis

4.2.2.1.1: Morphological study of Oriental x Trumpet cultivars

Data regarding effect of different doses of gamma rays on germination responses, germination percentages and survival percentage of irradiated and non-irradiated plants produced from the treated bulbs of (OT) group of Lilium cultivars is presented in Table 4.2.2.1.1.

In control plants of V5, germination was started within 16.0c±0.63 days after sowing. While radiated plants of this variety showed delay in germination response by increasing the doses of gamma rays. It was observed that plants at 2.0 Gy of gamma dose started germination after 21b±1.23 days and plants at higher dose delayed their germination upto 30a±0.28 days. In V5, the germination percentage ranged from 39 to 100 (%), 100.0 % in all control plants shown in Fig. 4.2.2.1.1a. Germination percentage was not much affected with the increase in dose of gamma rays upto 2.0 Gy. In response of radiated plants, maximum percentage (82 %) was observed in V5 at 2.0 Gy with 90 % survival of plants at this dose Minimum germinated rate was noted in V5 at 10 Gy (39 %) shown in Fig. 4.2.2.1.1b with 64 % of survival rate.

In control plants of V6, germination was started within 17c±1.10 days after sowing. While radiated plants of this variety showed delay in germination response by increasing the doses of gamma rays. It was observed that plants at 2.0 Gy of gamma dose started germination after 18c±0.28 days and plants at higher dose delayed their germination upto 32a±0.80 days at 8.0 Gy dose of gamma irradiation. V6 at 10 Gy show no germination at all. Germination percentage varied from 00 to 90 (%) with highest rate of germination in control plants i.e. 90 % and 52 % at 8.0 Gy (Fig. 4.2.2.1.1c-4.2.2.1.1d). 100 % plants survived at 00 Gy dose (control plants) and 70 % survival rate was observed in V6 at 8.0 Gy of gamma rays. In case of V7, number of days taken up by the plant to start germination increased by increasing the dose of gamma irradiation. Control plants germinated after 16c±0.63 days of sowing while at dose of 10 Gy, plants showed germination response after 26ab±0.93 days. In V7, the germination percentage ranged from 38 to 100, 100.0 % in all control plants and 38 % at 10.0 Gy (Fig. 4.2.2.1.1e-4.2.2.1.1f).

Germination percentage was not much affected with the increase in dose of gamma rays upto 2.0 Gy. Maximum percentage (82 %) was observed in V7 at 2.0 Gy with 90 % survival of plants at this dose. In control plants of V8, germination was started within 17.5c±1.13 days after sowing. While radiated plants of this variety showed delay in germination response by increasing the doses of gamma rays. It was observed that plants at 2.0 Gy of gamma dose started germination after 20bc±0.69 days and plants at higher dose delayed their germination upto 27a±0.63 days at 10.0 Gy dose of gamma irradiation. Germination percentage varied from 41 to 90 % with highest rate of germination in control plants i.e. 90% and 41 % at 10 Gy (Fig. 4.2.2.1.1g-4.2.2.1.1h). 100 % plants survived at 00 Gy dose (non-irradiated plants) and 38 % survival rate was observed in V8 at 10 Gy of gamma rays.

Gamma irradiation induced significant effect on all morphological characters including average number of leaves, leaf length and leaf width of (OT) cultivars of Lilium as mentioned in Table 4.2.2.1.2.

Average number of leaves gradually decreased with increasing doses of gamma rays in V5. Similar results were noted in response to leaf length. Larger number of leaves was produced in control plants 48a±0.93. At 2.0 Gy 30b±0.28 leaves were formed while at 10 Gy, average number of leaves decreased upto 8d±0.63. Similarly by increasing the dose of gamma rays, leaf length decreased. Leaf length of control plants observed was 8.5a±0.06 cm (Fig. 4.2.2.1.2a). At 10 Gy the length reduced upto 1.5f±0.20 cm. Leaf width of V5 showed different behavior in response to higher dose of gamma rays. By increasing the dose, width of leaf increased i.e. from 1.2ab±0.04 cm to 1.3a± cm (Fig. 4.2.2.1.2b). In case of V6, average number of leaves gradually decreased with increasing dose of gamma rays. Similar results were noted in response to leaf length and width. Larger number of leaves was produced in control plants 48a±0.93. At 2.0 Gy 29c±0.48 leaves were formed while at 10 Gy, average number of leaves decreased upto 0. Similarly by increasing the dose of gamma rays, leaf length decreased. Leaf length of control plants observed was 5.7a±0.04 cm (Fig. 4.2.2.1.2c). At 10 Gy no leaf was observed and length of leaves at 8.0 Gy was 2.4e±0.10 cm while width reduced from 1.1a±0.05 cm at no dose upto 0.7c±0.06 cm at 8.0 Gy.

Control plants of V7 showed 68a±0.80 leaves with 8.5a±0.06 cm leaf length and 1.1a±0.05 cm leaf width (Fig 4.2.2.1.2d). Higher doses of gamma rays had inhibitory effect on

average number of leaves, leaf length as well leaf width. At 2.0 Gy 55b±0.48 leaves with 6.6a±0.08 cm leaf length and 1.0a±0.04 cm leaf width were produced while at 10 Gy only 13d±0.28 leaves with highly decreased leaf length i.e. 1.0b±0.04 cm were observed. Leaf width at this dose increased i.e. 1.2a±0.04 cm (Fig. 4.2.2.1.2e).

Average number of leaves gradually decreased with increasing dose of gamma rays in V8. Similar results were noted in response to leaf length but leaf width showed increase at high dose. Larger number of leaves was produced in control plants 30a±0.28. At 2.0 Gy 26ab±0.93 leaves were formed while at 10 Gy, average number of leaves decreased upto 8d±0.63. Similarly by increasing the dose of gamma rays, leaf length decreased. Leaf length of control plants observed was 7.1a±0.05 cm (Fig. 4.2.2.1.2f). Length of leaves at 10.0 Gy was 2.2f±0.12 cm while width increased from 0.4d±0.05 cm to 0.7ab±0.06 cm at this dose (Fig. 4.2.2.1.2g).

Effect of gamma rays on the height of treated plants of Oriental cultivars of Lilium is mentioned in Fig. 4.2.2.1.3. It is evident from Fig. 4.2.2.1.3 that height of plants germinated from irradiated bulbs was strongly affected by the doses of gamma rays. It was observed that V5 plants showed maximum plant height 53±0.40 cm at 00 Gy (Fig. 4.2.2.1.4a). Control plants of V6 showed highest plant height i.e. 55.5±0.40 cm (Fig. 4.2.2.1.4b). Maximum height 71±0.63 cm and 35±1.26 cm was observed in control plants of V7 and V8 (Fig. 4.2.2.1.4c-4.2.2.1.4d). The data indicated that plants of V5 respond well at lower doses. In both V5 and V6, reduction in plant height occurred by increasing the gamma irradiation dose and higher dose of 10 Gy showed 10±0.63 cm least plant height in V5 (Fig. 4.2.2.1.4e). Radiated plants of both V7 and V8 cultivars also started reduction in their heights at higher doses of gamma rays. Minimum heights of 5.5±0.38 cm and 10 cm were observed at 10.0 Gy in both cultivars (Fig 4.2.2.1.4f-4.2.2.1.4g).

Table 4.2.2.1.1: The effect of different doses of gamma irradiations on the germination response, germination percentage and survival percentage of Oriental x Trumpet cultivars

Sr. Variety name Code Dose Germination Germination rate Plant survival No. (Gy) Response (Days) (%) (%) c 000 16.0 ±0.63 100 95.0 2.00 21.0b±1.23 82.0 90.0 Star fighter –O- 4.00 23.0b±1.41 63.0 75.0 1 red/white V5 6.00 25.0ab±0.93 58.0 70.0 8.00 29.0a±0.48 41.0 65.0 10.0 30.0a±0.28 39.0 64.0 000 17.0c±1.10 90.0 100 2.00 18.0c±0.28 87.0 80.0 Advantage La 4.00 23.0b±1.41 85.0 90.0 2 salmon V6 6.00 30.0a±0.28 55.0 60.0 8.00 32.0a±0.80 52.0 70.0 10.0 - - - 000 16.0c±0.63 100 100 2.00 18.5bc±0.34 82.0 90.0 b Golden tycon 4.00 22.0 ±0.93 71.0 75.0 3 yellow V7 6.00 27.0ab±0.89 64.0 60.0 a 8.00 32.0 ±0.80 51.0 44.0 10.0 26.0ab±0.93 38.0 21.0 c 000 17.5 ±1.13 90.0 100 2.00 20.0bc±0.69 75.0 65.0 4.00 23.5b±1.52 62.0 50.0 ab 4 Orange pixie V8 6.00 25.0 ±0.93 61.0 45.0 8.00 26.0a±0.93 54.0 38.0 a 10.0 27.0 ±0.63 41.0 38.0 Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

c d

Fig. 4.2.2.1.1a-d: Germination response of Oriental x Trumpet cultivars at different doses of gamma rays a) Germination rate of control plants of V5 after 16 days (1X); b) Germination rate of V5 at dose of 10 Gy after 30 days (1X); c) Germination rate of control plant of V6 after 17 days (1X); d) Germination rate of V6 at 10.0 Gy 32 days (1X)

e f

g h

Fig. 4.2.2.1.1e-h: Germination rate of Oriental x Trumpet cultivars at different doses of gamma rays

e) Germination rate of control plant of V7 (1X); f) Germination rate at dose of 10 Gy of V7 (1X); g) Germination rate of control plant of V8 (1X); h) Germination rate of V8 at dose of 10 Gy (1X)

Table 4.2.2.1.2: Effects of different doses of gamma rays on the length, number and width of leaves of Oriental x Trumpet cultivars

Sr. Variety name Code Dose Average no. of Leaf length Leaf width (cm) No. (Gy) leaves (cm

a a ab 00 48 ±0.93 8.5 ±0.06 1.2 ±0.04 b b abc 2.0 30 ±0.28 4.5 ±0.05 1.1 ±0.05 c c bc Star fighter -O-red/white 4.0 18 ±0.63 4.0 ±0.07 0.9 ±0.05 c d c 1 V5 6.0 16 ±0.63 3.3 ±0.04 0.8 ±0.04 d e bc 8.0 8.0 ±0.63 2.3 ±0.09 0.9 ±0.05 d f a 10.0 8.0 ±0.63 1.5 ±0.20 1.3 ±0.17

a a a 00 48 ±0.93 5.7 ±0.04 1.1 ±0.05 c b bc 2.0 29 ±0.48 5.3 ±0.06 0.8 ±0.04 Advantage La salmon V6 4.0 36b±0.93 4.5d±0.05 0.8bc±0.04 2 6.0 18d±0.28 5.0c±0.08 0.9b±0.05 8.0 16d±0.63 2.4e±0.10 0.7c±0.06 10.0 - - - 00 68a±0.80 8.5a±0.06 1.1a±0.05

2.0 55b±0.48 6.6a±0.08 1.0a±0.04

Golden tycon 4.0 43c±0.97 5.4a±0.07 0.6b±0.06 d b b 3 yellow V7 6.0 14 ±0.89 2.1 ±0.12 0.6 ±0.06 d b a 8.0 16 ±0.63 1.3 ±0.17 1.2 ±0.04 d b a 10.0 13 ±0.28 1.0 ±0.04 1.2 ±0.04 00 30a±0.28 7.1a±0.05 0.4d±0.05 2.0 26ab±0.93 6.0b±0.04 0.5cd±0.04 4 Orange pixie V8 4.0 22b±0.93 5.0c±0.08 0.6bc±0.06 6.0 17c±1.13 3.8d±0.10 0.8a±0.04 8.0 8.0d±0.63 3.3e±0.04 0.6bc±0.06 d f ab 10.0 8.0 ±0.63 2.2 ±0.12 0.7 ±0.06 Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05).

a b c

d e f g

Fig. 4.2.2.1.2a-g: Leaf length and width at different gamma rays doses

a) Leaf length and width of control plant of V5 (1X); b) Leaf length and width at 10.0 Gy of V5 (1X); c) Leaf length and width of control plant of V6 (1X); d) Leaf length and width of V7 at 00 Gy (1X); e) Leaf length and width at 10.0 Gy of V7 (1X); f) Leaf length and width of non- irradiated plants of V8 (1X); g) Leaf length and width at 10.0 Gy of V8 (1X)

80 4.2.2.3 70

60 50 V5 40 V6 30

V7 Plant height (cm) 20 V8 10 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.2.1.3: Effect of different doses of gamma rays on plant height of Oriental x Trumpet cultivars of Lilium

V5= Star fighter-O-red/white

V6= Advantage La salmon

V7= Golden tycon yellow

V8= Orange pixie

a b c d

e f g

Fig. 4.2.2.1.4a-g: Plant height of Oriental x Trumpet cultivars of Lilium at different doses of gamma rays a) Plant height of control plants of V5 (1X); b) Plant height of V5 at dose of 10 Gy (1X); c) Plant height of control plant of V6 (1X); d) Plant height of control plant of V7 (1X); e) Plant height at dose of 10 Gy of V7 (1X); f) Plant height of control plant of V8 (1X); g) Plant height of V8 at dose of 10 Gy (1X)

4.2.2.2: In vitro mutagenesis 4.2.2.2.1: Shoot multiplication

Effect of different doses of gamma rays on regeneration frequency, number of shoots per explant and shoot length of irradiated stationary in vitro cultures of Oriental x Trumpet cultivars is presented in Table 4.2.2.2.1.

In V5 highest regeneration frequency was observed at lower dose of irradiation i.e. 89 % (Fig. 4.2.2.2.1a) and lowest (42 %) at 10.0 Gy. It is evident from the data that higher doses suppressed shoot formation. V6 showed maximum regeneration rate in control plants (83) %. Beyond this dose, rate of formation was decreased upto 48 % at 10 Gy. Lower doses were helpful in increasing the shoot formation percentage in V7. The value ranged from 48-88 % at different doses. 87 % regeneration rate was observed in control plants of V8 which showed decrease in the shoot formation upto 50 % at higher dose i.e. 10.0 Gy. When explants of V5 exposed to 10 Gy, minimum number of shoots were formed 1.1c±0.04 which are very less as compared to the number of control plants 3.8a±0.10. Similarly control plants of all other cultivars produced highest number of shoots (4.0a±0.01, 4.0b±0.07 and 3.2a±0.06) which decreased upto 1.8cd±0.24 (Fig. 4.2.2.2.1b), 1.3d±0.17 and 1.7c±0.04 at 10.0 Gy. Shoot length also showed similar results with increase or decrease in gamma rays in all cultivars as in case of number of shoots. V5 gave highest shoot length of 5.3a±0.06 cm at 0 dose and lowest 3.8c±0.10 cm at 10.0 Gy.

Shoot length of V6 varied from 3.3c±0.04 to 5.3a±0.06 cm at 00 dose and 10.0 Gy. Maximum shoot length of 5.5a±0.07 cm was observed in V7 (Fig. 4.2.2.2.1c) control plants and minimum shoot length of 2.1c±0.12 cm was observed at 10.0 Gy. Shoot length ranged from 3.2d±0.06 to 5.2b±0.07 cm at 00 and 10.0 Gy gamma irradiation dose in V8 (Fig. 4.2.2.2.1d).

Effect of different doses of gamma rays on shaking cultures of in vitro Oriental X Trumpet Lilium cultivars is described in Table 4.2.2.2.2. It was noticed that gamma rays induced effect same as in stationary cultures but cultures phase i.e. shaking of cultures enhanced regeneration potential of all cultivars. Regeneration frequency increased upto 92 percent in control plants of V5 (Fig. 4.2.2.2.2a) and from 42-49 percent in irradiated plants at 10.0 Gy. In case of V6, rate increased from 83-86 percent in control plants and from 48 to 52 percent at dose of 10.0 Gy. Shaking of the cultures promoted shoot formation rate from 80

to 84 percent in control plants of V7 while at 10.0 Gy, this shaking effect increased that frequency of shoot initiation from 48-51 percent. Shake cultures of V8 showed maximum shoot formation rate in control plants i.e. 89 % and lowest value of 58 % was noticed in this cultivar at 10.0 Gy.

Maximum number of shoots 5.0a±0.08 were observed in control shake cultures of V5 while 2.1d±0.12 number of shoots were shown in radiated plants at 10.0 Gy with shoot length of 5.5a±0.07 and 4.0c±0.07 cm. V6 showed larger number of shoots 4.5a±0.05 with shoot length of 5.5a±0.07 cm (Fig. 4.2.2.2.2b) at 0 dose of gamma irradiation and only 2.6c±0.08 shoots were appeared at 10.0 Gy with 4.0c±0.07 cm shoot length. In control plants of shaking cultures of V7, 4.8a±0.06 shoots were noticed (Fig. 4.2.2.2.2c) having shoot length of 6.0ab±0.04 cm which decreased upto 1.9d±0.24 in number and 3.3d±0.05 cm in length. Number of shoots increased from 3.2a±0.06 to 5.5a±0.07 in control plants of shaking cultures of V8 (Fig. 4.2.2.2.2d) as compared to stationary plants and at 10.0 Gy, the number increased from 1.7c± 0.04to 2.5d±.0.08 Shoot length also increased from 5.2b±0.07 cm to 7.1b±0.05 cm in control plants and from 3.2d±0.06 to 3.8d±0.10 cm at higher dose of 10.0 Gy.

Data regarding effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants is shown in Table. 4.2.2.2.3. It is clearly evident from the table that sucrose amount directly influenced the frequency of bulblet formation. By increasing the sucrose concentration from 30 to 60 %, bulblet formation rate also increased in all cultivars but further increase from 60-90 percent lead to decrease in frequency of bulblet formation. At 30 % sucrose amount, highest bulblets formation rate was observed in control plants of V5 (85 %) shown in Fig. 4.2.2.2.3a while at 10.0 Gy lowest (40) % was noticed at same sucrose concentration in V6 at 10.0 Gy. Increased amount of sucrose upto 60 % enhanced formation of bulblets as in V5 from 85 to 96 percent in control plants (Fig. 4.2.2.2.3b) and from 40 to 66 in V6 at 10.0 Gy.

Further increase of sucrose amount caused decrease in frequency of bulblet formation i.e. from 96 to 80 percent in control plants of V5 (Fig. 4.2.2.2.3c) and from 66 to 39 in V6 plants at 10.0 Gy. Healthy plants were shifted to autoclaved sand in green house for acclimatization (Fig.4.2.2.2.3d).

Table 4.2.2.2.1: Effect of different doses of gamma rays on regeneration potential of stationary in vitro cultures of Oriental x Trumpet Lilium cultivars Sr. Treatment Code Dose Regeneration No. of shoots/explant Shoot length No. (Gy) frequency (%) (cm)

00 89 3.8a±0.10 5.3a±0.06 2.0 75 3.0ab±0.11 5.0a±0.08

Star fighter – V5 4.0 72 2.5b±0.08 4.8ab±0.06 1 O-red/white 6.0 56 2.3b±0.09 4.5b±0.05 8.0 45 2.1b±0.12 4.0bc±0.07 10.0 42 1.1c±0.04 3.8c±0.10 a a 00 83 4.0 ±0.01 5.3 ±0.06 2.0 77 3.8a±0.10 5.3a±0.06 Advantage La 4.0 62 3.3bc±0.04 5.0ab±0.08 2 salmon V6 6.0 59 2.4c±0.10 4.8b±0.06 8.0 53 2.1c±0.12 4.0bc±0.07 10.0 48 1.8cd±0.24 3.3c±0.04 00 80 4.0b±0.07 5.5a±0.07 a a 2.0 88 4.5 ±0.05 5.4 ±0.07 Golden tycon 4.0 59 2.1c±0.12 3.8b±0.10 3 yellow V7 6.0 52 1.9cd±0.24 3.2bc±0.06 8.0 50 1.7cd±0.04 2.5c±0.08 10.0 48 1.3d±0.17 2.1c±0.12 00 87 3.2a±0.06 5.2b±0.07 2.0 85 3.3a±0.04 6.0a±0.04 Orange pixie V8 4.0 74 3.0a±0.11 4.5bc±0.05

4 6.0 68 2.3b±0.09 4.0c±0.07 8.0 57 2.1b±0.12 3.8c±0.10 10.0 50 1.7c±0.04 3.2d±0.06

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

c d

Fig. 4.2.2.2.1a-d: Effect of different doses of gamma irradiations on in vitro growth of stationary cultures of Oriental x Trumpet cultivars a) V5 control plants showing highest regeneration frequency (1X); b) Reduction in number of shoots of V6 plants at 10.0 Gy (1X); c) V7 control plants showing highest shoot length (cm) (1X); d) V8 control plants showing shoot length (1X)

Table 4.2.2.2.2: Effect of different doses of gamma rays on regeneration potential of shaking (rpm) cultures of in vitro Oriental x Trumpet Lilium cultivars

Sr. Variety name Code Dose Regeneration No. of shoots/explant Shoot length No. (Gy) frequency (%) (cm) 00 92 5.0a±0.08 5.5a±0.07 2.0 80 4.0b±0.07 5.3a±0.06 bc ab Star fighter – 4.0 79 3.5 ±0.08 5.0 ±0.80 c b 1 O-red/white V5 6.0 62 3.0 ±0.06 4.9 ±0.06 8.0 53 2.5cd±0.08 4.5bc±0.05 10.0 49 2.1d±0.12 4.0c±0.07 a a 00 86 4.5 ±0.05 5.5 ±0.07 2.0 80 4.2ab±0.08 5.3a±0.06 Advantage La V6 4.0 66 4.0ab±0.07 5.0ab±0.08 2 salmon 6.0 63 3.5b±0.10 4.9b±0.06 bc bc 8.0 57 3.2 ±0.06 4.5 ±0.05 c c 10.0 52 2.6 ±0.08 4.0 ±0.07 00 84 4.8a±0.06 6.0ab±0.04 2.0 91 4.6b±0.05 6.6a±0.08 c b Golden tycon V7 4.0 64 2.8 ±0.09 4.5 ±0.05 cd c 3 yellow 6.0 56 2.5 ±0.08 3.8 ±0.10 8.0 54 2.1d±0.12 4.0bc±0.07 10.0 51 1.9d±0.24 3.3d±0.05 00 89 5.5a±0.07 7.1b±0.05 b a 2.0 88 4.8 ±0.06 7.7 ±0.05 Orange pixie V8 4.0 76 4.5b±0.05 5.0c±0.08 4 6.0 72 3.5c±0.10 4.5cd±0.05 8.0 61 3.0cd±0.06 4.8cd±0.06 d d 10.0 58 2.5 ±0.08 3.8 ±0.10 Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

100

a b

c d

Fig. 4.2.2.2.2a-d: Effect of different doses of gamma irradiations on in vitro growth of shaking cultures of Oriental x Trumpet cultivars a) Maximum number of shoots in shaking cultures of V5 (1X); b) Maximum number of shoots in control plants of V6 (1X); c) V7 control plants showing maximum shoots in shaking cultures (1X); d) V8 plants showing larger number of shoots in shaking cultures (1X)

101

Table 4.2.2.2.3: Effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants of Oriental x Trumpet Lilium cultivars Plant Sucrose Gamma Frequency of bulblet formation (%) hormones amount rays BAP + Kin dose V5 V6 V7 V8 + IAA (Gy) (mg/L) 00 85 84 82 84 2.0 70 70 85 80 4.0 68 61 73 78 6.0 55 48 70 72 30 8.0 53 45 68 69 10.0 43 40 57 65

00 96 85 87 88 2.0 85 83 84 83 4.0 82 81 81 80 0.1 + 0.1 + 3.0 60 6.0 78 78 79 78 8.0 62 70 75 74 10.0 59 66 72 70

00 80 82 78 81 2.0 66 68 82 75 90 4.0 62 57 70 72 6.0 54 44 67 69 8.0 48 40 63 63 10.0 40 39 54 60

102

a b

c d

Fig. 4.2.2.2.3a-d: Effect of different amount of sucrose g/L on bulblet formation of Oriental x Trumpet cultivars a) Bulblet formation in V5 control plants in 30g/L sucrose (1X); b) V5 showing bulblet formation in 60g/L Sucrose (1X); c) Reduction in bulblet formation in V5 in 90g/L sucrose amount (1X); d) Hardening of plants of Oriental x Trumpet group (1X)

103

4.2.2.2.2: Studies on morphology of M1V4 and M1V5 generation of in vitro derived mutants

Effect of different doses of gamma irradiations on plant height and number, length and width of leaves of M1V4 generation of Oriental x Trumpet cultivars derived from in vitro mutagenesis is mentioned in Table 4.2.2.2.4. Plant height, number of leaves, leaf length was significantly influenced by irradiation dose and interaction effects were significant for all cultivars. All these parameters showed reduction by increasing the gamma irradiation dose. V5 showed maximum number of leaves 48a±0.93 in control plants and minimum leaves 10e±0.63 were observed at 10.0 Gy with plant height of 53a±0.40 (Fig. 4.2.2.2.4a) and 15d±1.26 cm. Similarly leaf length decreased from 8.5a±0.06 to 4.0d±0.07 cm while width also decreased at this dose i.e. from 1.2a±0.04 cm to 0.8c±0.04 cm. In control plants of V6, V7 and V8, average number of leaves formed were 48a±0.93, 68a±0.80 and 30ab±0.28 with plant height of 55.5a±0.48 (Fig. 4.2.2.2.4b), 71a±0.77 (Fig. 4.2.2.2.4c) and 35ab±0.93 cm (Fig. 4.2.2.2.4d) which decreased at 10.0 Gy to 00, 5.0e±0.08 and 11c±0.63 leaves with 0, 7.7d±0.87 and 15cd±0.63 cm plant height. Leaf length also decreased with increasing the dose i.e. leaf length of 8.7a±0.04 cm was observed in control plants of V6 with 1.1ab± 0.05cm width which decrease with increased dose from 2.0 Gy to 10.0 GY similar to V5 plants (Fig. 4.2.2.2.4e-4.2.2.2.4f). V7 showed decrease in leaf length from 8.5a±0.06 (Fig. 4.2.2.2.4g) to 1.5d±0.20 cm and also in V8 from 7.1a±0.05 to 3.3d±0.04 cm(Fig. 4.2.2.2.4h) . Gamma rays showed no significant change in case of leaf width of all cultivars. In V7 and V8, increase in leaf width was observed i.e. from 1.1b±0.05 to 1.3a±0.04 cm and 0.4c±0.05 to 2.2a±0.12 cm.

The number and average length of roots of in vitro irradiated and non-irradiated Lilium cultivars is presented in Fig. 4.2.2.2.5a-4.2.2.2.5b.

In V5 and V7 number of roots increased at higher doses i.e. from 3±0.28 to 5±0.38 in V5 (Fig. 4.2.2.2.5c) and from 14±0.20 to 16±1.13 in V7 while control plants of V6 and V8 showed larger number of roots as compared to irradiated plants (Fig. 4.2.2.2.5d).

The observed highest root length was 3.6±0.10 cm at 8.0 Gy in V5 and 7.0±0.06 cm in control plants in V6. Maximum root length of V7 (Fig. 4.2.2.2.5e) and V8 cultivars was also observed at 8.0 Gy i.e. 7.2±0.02 cm and 6.0±0.04 cm at o dose (Fig. 4.2.2.2.5f).

104

Superior mutants were selected on the basis of change in the flower morphology of M1V5 generation as compared to control ones. Data about average number of days to flowering and floral characteristics is presented in Table 4.2.2.2.5. Number of days taken up by the plant to flowering decreased with increasing dose of gamma radiation. V5 produced same flowers in both control and radiated plants in 50cd±0.63 to 53c±0.40 days (Fig. 4.2.2.2.6a- 4.2.2.2.6b). Mutants of V6 at 10.0 Gy showed change in flower morphology in aspect of colour, and size. Larger flower of light colour petals were observed at this dose in 43bc±0.97 days (Fig. 4.2.2.2.6c-4.2.2.2.6d). V7 mutants produced variegated petals at 6.0 Gy (Fig. 4.2.2.2.6e-4.2.2.2.6f) in 55ab±0.48 days.

Orange colour flowers of V8 cultivars were produced at all doses of gamma rays and control ones having same floral characteristics. Number of days increased with increasing the gamma irradiation dose i.e. from 47bc±0.93 to 58a±0.63 days but at 10.0 Gy, flower formation occurred after 45c±1.01 days.

105

Table 4.2.2.2.4: Effect of different doses of gamma irradiations on plant height and number of leaves of M1V4 generation of Oriental x Trumpet cultivars derived from in vitro mutagenesis Sr. Variety name Dose Average no. of leaves Plant height (cm) Leaf length Leaf width No. (Gy) (cm) (cm) 00 48a±0.93 53.0a±0.40 8.5a±0.06 1.2a±0.04 2.0 33b±0.80 44.0b±0.93 5.5b±0.07 1.3a±0.04 Star fighter – 4.0 22c±0.93 28.0c±0.63 5.0bc±0.08 1.1ab±0.05 1 O-red/white 6.0 18d±0.28 25.0cd±0.93 4.8c±0.06 1.0b±0.90 (V5) 8.0 16de±0.63 18.5d±0.34 4.5cd±0.05 0.9c±0.05 10.0 10e±0.63 15.0d±1.26 4.0d±0.07 0.8c±0.04 00 48a±0.93 55.5a±0.48 8.7a±0.04 1.1ab±0.05 2.0 33bc±0.80 35.0b±1.41 6.9b±0.08 1.3a±0.04 Advantage La 4.0 38b±0.93 33.0bc±1.01 5.5c±0.07 1.1ab±0.05 2 salmon 6.0 40b±1.16 32.0bc±0.16 6.0bc±0.04 1.0b±0.05 (V6) 8.0 45ab±0.93 26.0c±0.93 3.1d±0.06 1.2a±0.04 10.0 - - - - 00 68a±0.80 71.0a±0.77 8.5a±0.06 1.1b±0.05 2.0 60b±0.63 62.0b±1.01 7.7ab±0.05 1.2ab±0.04 Golden tycon 4.0 45c±0.93 55.0bc±0.48 5.5b±0.07 1.0bc±0.05 3 yellow 6.0 18d±0.28 23.0c±0.93 3.1c±0.06 0.9c±0.05 (V7) 8.0 21d±0.93 20.0c±1.23 1.9d±0.24 1.5a±0.03 10.0 5.0e±0.08 7.7.0d±0.87 1.5d±0.20 1.3a±004

00 30ab±0.28 35.0ab±0.93 7.1a±0.05 0.4c±0.05 2.0 33a±1.01 38.0a±0.80 6.9a±0.08 0.9bc±0.05 4.0 31ab±0.63 35.0ab±0.93 5.5bc±0.07 1.0bc±0.05 4 Orange pixie 6.0 19b±0.40 33.0b±0.80 4.5c±0.05 1.3b±0.04 (V8) 8.0 10c±0.63 19.0c±0.40 4.0cd±0.07 1.1b±0.05 10.0 11c±0.63 15.0cd±0.63 3.3d±0.04 2.2a±0.12 Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

106

a b c d

e f g h

Fig. 4.2.2.2.4a-h: Effect of different doses of gamma irradiations on plant height, leaf length

and width (cm) of M1V4 generation of Oriental x Trumpet cultivars

a) Plant height of V5 at o0 Gy (1X); b) V6 control plants showing shoot height (1X); c) Plant height of control plants of V7 (1X); d) Maximum plant height of V8 plants at 0 dose of gamma rays (1X); e) Leaf length of V5 at 2.0 Gy (1X); f) Leaf length of V6 at 2.0 Gy (1X); g) Leaf length of V7 control plants (1X); h) V8 showing leaf length at 10.0 Gy (1X)

107

18 16 a 14

10 V5 8 V6 6 V7

4 V8 Numberofroots 2 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.2.2.5a: Effect of radiation on number of roots of M1V4 generation of in vitro derived mutants of Oriental x Trumpet cultivars

9 b 8

6 5 V5 4 V6

3 V7 Rootlength(cm) 2 V8 1 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.2.2.5b: Effect of radiation root length of M1V4 generation of in vitro derived mutants of Oriental x Trumpet cultivars

108

a b

c d

Fig. 4.2.2.2.5c-f: Rooting of M1V4 generation of Oriental x Trumpet cultivars

c) Rooting of V5 at 10.0 Gy (1X); d) V6 showing rooting at 00 Gy (1X); e) V7 showing rooting at 10.0 Gy (1X); f) V8 control plants showing roots (1X)

109

Table 4.2.2.2.5: Effect of radiation on flower formation of in vitro derived mutants of M1V5 generation of Oriental x Trumpet cultivar

Sr. Variety Dose Average No. Floral characters No. name (Gy) of days to Colour Size shape flowering

00 53c±0.40 Pink and white Normal Normal 2.0 55bc±0.48 - - - Star fighter – 4.0 58b±0.63 - - - 1 O-red/white 6.0 62ab±1.01 - - - (V5) 8.0 67a±0.80 - - - 10.0 50cd±0.63 - - -

00 45bc±1.01 Light orange Normal Normal 2.0 48b±0.93 - - - Advantage 4.0 47b±0.93 - - - 2 La salmon 6.0 57a±0.63 - - - (V6) 8.0 53ab±0.40 - - - 10.0 43bc±0.97 Lighter Larger - 00 47bc±0.93 Yellow Normal Normal 2.0 49bc±0.93 - - - Golden tycon 4.0 53b±0.40 - - - 3 yellow 6.0 55ab±0.48 - - Variegated (V7) 8.0 58a±063 - - petals 10.0 45c±1.01 - - - -

00 47bc±0.93 Orange Normal Normal 2.0 49b±0.93 - - - 4.0 53ab±0.40 - - - 4 Orange pixie 6.0 55ab±0.48 - - - (V8) 8.0 58a±0.62 - - - 10.0 45c±1.01 - - -

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

(-) indicated same to control

110

a b

c d

Fig. 4.2.2.2.6a-d: Flowers of M1V5 generation of Oriental x Trumpet cultivars a) Flower of V5 control plant (1X); b) V5 Flower morphology at 10.0 Gy (1X); c) Control plants of V6 showing flower formation (1X); d) V6 plants showing flower at 10.0 Gy (1X)

111

e f

g h

Fig. 4.2.2.2.6e-h: Flowers of M1V5 generation of Oriental x Trumpet cultivars

e) Flower of V7 control plant (1X); f) V7 Flower morphology at 6.0 Gy (1X); g) Control plants of V8 showing flower formation (1X); h) V8 plants showing flower at 10.0 Gy (1X)

112

4.2.3: Longiflorum x Oriental (LO) group 4.2.3.1: In vivo mutagenesis

4.2.3.1.1: Morphological study of Longiflorum x Oriental cultivar

Effect of different doses of gamma rays on germination responses, germination percentages and survival percentage of irradiated and non-irradiated plants produced from the treated bulbs of (LO) cultivar is presented in Table 4.2.3.1.1.

It is clearly evident from the Table 4.2.3.1.1 that number of days taken up by the plant to start germination increased by increasing the dose of gamma irradiation. Control plants germinated after 14c±0.89 days of sowing while at dose of 10 Gy, plants showed germination response after 36a±0.93 days.

The germination percentage ranged from 48 to 100 (%), 100.0 % in all control plants (Fig. 4.2.3.1.1a). Germination percentage was not much affected with the increase in dose of gamma rays upto 2.0 Gy. In case of radiated plants, highest germination rate was observed at 2.0 Gy and minimum (48 %) at 10 Gy (Fig. 4.2.3.1.1b) with 80 and 30 % survival rate at these doses.

It is clearly evident from the Table 4.2.3.1.2 that parameters including average number of leaves, leaf length and leaf width of Longiflorum x Oriental cultivar of Lilium showed significant change at different doses of gamma rays. Control plants showed 51a±0.63 leaves with 10a±0.24 cm leaf length and 0.7a±0.06 cm leaf width (Fig. 4.2.3.1.2a). Higher doses of gamma rays had inhibitory effect on average number of leaves, leaf length as well leaf width. At 2.0 Gy 29b±0.48 leaves with 5.3b±0.06 cm leaf length and 0.8a±0.04 cm leaf width were produced while at 10 Gy number of leaves increased i.e. 45ab±1.26 leaves with leaf length i.e. 8.9c±0.24 cm and 0.2c±0.04 cm leaf width were appeared (Fig. 4.2.3.1.2b).

Effect of gamma rays on the height of treated plants of Longiflorum x Oriental cultivar of Lilium is mentioned in Fig. 4.2.3.1.3. It is evident from Fig. 4.2.3.1.3 that height of plants germinated from irradiated bulbs was strongly affected by the doses of gamma rays. It was observed that V9 plants showed maximum plant height 54±0.48 cm at 00 Gy (Fig. 4.2.3.1.4a). The data indicated that plants of V9 respond well at lower doses Reduction in plant height occurred by increasing the gamma irradiation dose. Minimum height of 18.5±0.34 cm was observed at 10.0 Gy (Fig 4.2.2.1.4b).

113

Table 4.2.3.1.1: Effect of different doses of gamma irradiations on the germination response, germination percentage and survival percentage of Longiflorum x Oriental cultivar

Variety Code Dose Germination Germination Plant survival E name (Gy) Response (Days) rate Percentage (%) Percentage (%)

00 14c±0.89 100 100

2.0 27bc±0.93 75 80

b Courier La V9 4.0 29 ±0.63 64 55 white b 6.0 32 ±0.28 57 75

8.0 33ab±0.80 55 62

10.0 36a±0.93 48 30

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05).

a b

Fig. 4.2.3.1.1a-b: Germination rate of Longiflorum x Oriental cultivar at different doses of gamma rays

a) Germination rate of control plant after 14 days (1X); b) Germination rate at dose of 10 Gy after 36 days (1X)

114

Table 4.2.3.1.2: Effects of different doses of gamma rays on the length, number and width of leaves of Longiflorum x Oriental cultivar

Variety Dose Average no. of Leaf length (cm) Leaf width (cm) name leaves

00 51a±0.63 10a±0.241 0.7a±0.06

2.0 29b±0.48 5.3b±0.063 0.8a±0.04 Courier La white 4.0 25bc±0.93 4.8b±0.063 0.4b±0.05 (V9) 6.0 23bc±1.41 2.3c±0.093 0.3bc±0.02

8.0 19c±0.40 2.1c±0.129 0.3bc±0.02

10.0 45ab±1.26 8.9c±0.249 0.2c±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05).

a b

Fig. 4.2.3.1.2a-b: Leaf length and width at different gamma rays doses

a) Leaf length and width of control plant (1X); b) Leaf length and width at 10.0 Gy (1X)

115

60 4.2.3.1.3

30 V9

20 Plant height (cm)

0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.3.1.3: Effect of different doses of gamma rays on plant height of

Longiflorum x Oriental cultivar

a b

Fig. 4.2.3.1.4a-b: Plant height of Longiflorum x Oriental cultivar at different doses of gamma rays

a) Plant height of control plant (1X); b) Plant height at dose of 10 Gy (1X)

116

4.2.3.2: In vitro mutagenesis 4.2.3.2.1: Shoot multiplication Effect of different doses of gamma rays on regeneration frequency, number of shoots per explant and shoot length of irradiated stationary in vitro cultures of Longiflorum x Oriental cultivar is presented in Table 4.2.3.2.1.

Regeneration frequency ranged from 40 to 82 %. Higher doses of gamma rays inhibit shoot formation. Larger number of shoots 3.2a±0.06 shown in Fig. 4.2.3.2.1a was produced in control plants which decreased upto 1.3c±0.17 (Fig. 4.2.3.1b) at 10.0 Gy. Similarly shoot length also decreased from 5.1a±0.06 cm to 3.1bc±0.06 cm.

Effect of different doses of gamma rays on shaking cultures is described in Table 4.2.3.2.2. It was noticed that gamma rays induced same effect as in stationary cultures but cultures phase i.e. shaking of cultures enhanced regeneration potential of all cultivars. Regeneration frequency increased upto 85 percent in control plants of V9 and from 40-45 percent in irradiated plants at 10.0 Gy. Maximum number of shoots 8.0a±0.05 were observed in control shake cultures of V9 (Fig. 4.2.3.2.2a) while 4.0b±0.07 number of shoots were shown in radiated plants at 10.0 Gy (Fig. 4.2.3.2.2b) with shoot length of 5.7a±0.07 and 3.3c±0.04 cm.

Data regarding effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants is shown in Table. 4.2.3.2.3. It is clearly evident from the table that sucrose amount directly influenced the frequency of bulblet formation. By increasing the sucrose concentration from 30 to 60 %, bulblet formation rate also increased in all cultivars but further increase from 60-90 percent lead to decrease in frequency of bulblet formation. At 30 % sucrose amount, highest bulblets formation rate was observed in control plants (83 %) shown in Fig. 4.2.3.2.3a while at 10.0 Gy lowest (41) % was noticed at same sucrose concentration. Increased amount of sucrose upto 60 % enhanced formation of bulblets from (83-88) % in control plants (Fig. 4.2.3.2.3b) and from 41 to 65 at 10.0 Gy.

Further increase of sucrose amount caused decrease in frequency of bulblet formation i.e. from 88 to 81 percent (Fig. 4.2.3.2.3c) in control plants and from 65 to 39 at 10.0 Gy. Healthy plants were shifted to autoclaved sand in green house for acclimatization.

117

Table 4.2.3.2.1: Effect of different gamma rays doses on the regeneration potential of stationary in vitro cultures of Longiflorum x Oriental cultivar

Variety Dose Regeneration No. of Shoot length

name (Gy) frequency (%) shoots/explant (cm)

00 82 3.2a±0.06 5.1a±0.06

2.0 73 2.4ab±0.10 4.8ab±0.06

Courier La white b ab 4.0 68 2.1 ±0.12 4.5 ±0.05 (V9)

bc b 6.0 49 1.9 ±0.24 4.0 ±0.07

8.0 44 1.7c±0.20 3.3bc±0.04

10.0 40 1.3c±0.17 3.1bc±0.06

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

Fig. 4.2.3.2.1a-b: Regeneration frequency of stationary Longiflorum x Oriental cultivar at different doses of gamma rays

a) Regeneration frequency of control plant (1X); b) Regeneration frequency at dose of 10 Gy (1X)

118

Table 4.2.3.2.2: Effect of different gamma rays doses on the regeneration potential of shake cultures of in vitro cultures Longiflorum x Oriental cultivar

Variety Dose Regeneration No. of Shoot length name (Gy) frequency (%) shoots/explant (cm)

a a 00 85 8.0 ±0.05 5.7 ±0.07

ab 2.0 75 3.8b±0.10 5.4 ±0.07 Courier La white (V9) 4.0 69 3.3bc±0.04 4.9b±0.06

6.0 52 3.1c±0.06 4.5bc±0.05

8.0 48 2.8c±0.04 3.8c±0.10

10.0 45 4`.0b±0.07 3.3c±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

Fig. 4.2.3.2.2a-b: Regeneration frequency of shaking Longiflorum x Oriental cultivar of Lilium at different doses of gamma rays

a) Regeneration frequency of control plant (1X); b) Regeneration frequency at dose of 10 Gy (1X)

119

Table 4.2.3.2.3: Effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants of Longiflorum x Oriental cultivar

Plant hormones Doses Sucrose amount Frequency of

BAP + Kin + IAA (Gy) (mg/L) bulblet formation (%) (mg/L) 00 83

2.0 69

4.0 30 64

6.0 52 8.0 49

10.0 41

00 88

2.0 82 0.1 + 0.1+ 3.0 4.0 60 80

6.0 75

8.0 69 10.0 65

00 81

2.0 65 4.0 90 60

6.0 48

8.0 44 10.0 39

120

a b

c d

Fig. 4.2.3.2.3a-d: Effect of different amount of sucrose g/L on bulblet formation of Longiflorum x Oriental cultivar a) Bulblet formation in V9 control plants in 30g/L sucrose (1X); b) V9 showing bulblet formation in 60g/L Sucrose (1X); c) Reduction in bulblet formation in V9 in 90g/L sucrose amount (1X); d) Hardening of plants of V9 cultivar (1X)

121

4.2.3.2.2: Studies on morphology of M1V4 and M1V5 generation of in vitro derived mutants

Effect of different doses of gamma irradiations on plant height and number, length and width of leaves of M1V4 generation of Longiflorum x Oriental Lilium cultivar derived from in vitro mutagenesis is mentioned in Table 4.2.3.2.4. Plant height, number of leaves, leaf length was significantly influenced by irradiation dose and interaction effects were significant for all cultivars. All these parameters showed reduction by increasing the gamma irradiation dose. Control plants showed maximum number of leaves i.e. 51a± 0.40 and minimum leaves 19d±0.90 were observed at 10.0 Gy with plant height of 54a±0.48 (Fig. 4.2.3.2.4a) and 25d±0.93 cm. Similarly leaf length decreased from 7.7a±0.05 (Fig. 4.2.3.2.4b) to 3.4d±0.05 cm and width also decreased at this dose i.e. from 0.7b±0.06 cm to 0.5bc±0.04 cm.

The number and average length of roots of in vitro irradiated and non-irradiated Lilium cultivars is presented in Fig. 4.2.3.2.5a and Fig. 4.2.3.2.5c. It was noticed that by increasing the gamma rays dose average number of roots was also increased while root length decreased at higher concentrations. Maximum roots were produced at 10.0 Gy with 2.5 cm length (Fig. 4.2.3.2.5b and Fig. 4.2.3.2.5d).

Superior mutants were selected on the basis of change in the flower morphology of M1V5 generation as compared to control ones. Data about average number of days to flowering and floral characteristics is presented in Table 4.2.3.2.5. Number of days taken up by the plant to flowering increased with increasing dose of gamma radiation. Mutants of V9 at 8.0 Gy produced flowers in 71a±1.02days but further increase in dose caused decrease in time period for flowering i.e. 46c±0.93 days at 10.0 Gy. Off white flowers were produced at all doses of radiation which were similar in size, colour and shape to their control plants (Fig. 4.2.3.2.6a-4.2.3.2.6b).

122

Table 4.2.3.2.4: Effect of different doses of gamma irradiations on plant height and number of

leaves of M1V4 generation of Longiflorum x Oriental cultivar derived from in vitro mutagenesis

Variety Dose Average no. of Plant Leaf length Leaf width name (Gy) leaves height (cm) (cm) (cm) 00 51a±0.40 54a±0.48 7.7a±0.05 0.7b±0.06

2.0 33b±0.26 40b±1.16 7.3ab±0.04 1.0a±0.05 Courier La white 4.0 31bc±0.80 38bc±1.26 6.5b±0.11 0.8ab±0.04 (V9) 6.0 23c±0.93 33c±1.26 5.4c±0.07 0.6b±0.06

8.0 21cd±0.93 28d±0.28 3.9d±0.10 0.5bc±0.04

10.0 19d±0.90 25d±0.93 3.4d±0.05 0.5bc±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

Fig. 4.2.3.2.4a-b: Plant height and leaf length of V9 in vitro regenerated plant

a) Plant height of control plant (1X); b) Leaf length of control plant (1X)

123

25 a

10 V9 Numberofroots 5

0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.3.2.5a: Effect of radiation on number of roots of M1V4 generation of in vitro derived mutants of Longiflorum x Oriental cultivar

Fig. 4.2.3.2.5 b) Maximum number of roots of in vitro derived V9 at 10.0 Gy (1X)

124

4 b 3.5

2.5

1.5 V9 Rootlength(cm) 1

0.5 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.3.2.5c: Effect of radiation on root length of M1V4 generation of in vitro derived mutants of Longiflorum x Oriental cultivar

Fig. 4.2.3.2.5 d) Highest root length (cm) of in vitro derived V9 at 10.0 Gy (1X)

125

Table 4.2.3.2.5: Effect of radiation on flower formation of in vitro derived mutants of

M1V5 generation of Longiflorum x Oriental cultivar

Sr. Variety Dose Average No. of Floral characters No. name (Gy) days to flowering Colour Size shape

1 00 51bc±0.63 Off white Normal Normal 2 Courier 2.0 58b±0.48 - - - 3 La white 4.0 67ab±0.77 - - - 4 (V9) 6.0 68ab±0.80 - - - 5 8.0 71a±1.02 - - 6 10.0 46c±0.93 - -

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

(-) indicated same to control

a b

Fig. 4.2.3.2.6a-b: Flower morphology of V9 plants

a) Flowers of control plants (1X); b) Flower of plant irradiated at 10.0 Gy (1X)

126

4.2.4: Longiflorum (L) group

4.2.4.1: In vivo mutagenesis

4.2.4.1.1: Morphological study of Longiflorum cultivar

Data regarding effect of different doses of gamma rays on germination responses, germination percentages and survival percentage of irradiated and non-irradiated plants of Longiflorum cultivar is presented in Table 4.2.4.1.1.

Control plants germinated after 15c±0.63 days of sowing while at dose of 10 Gy, plants showed germination response after 30a±0.28 days. It was noted that number of days taken up by the plant to start germination increased by increasing the dose of gamma irradiation.

The germination percentage ranged from 54 to 94 percent. Germination percentage was not much affected with the increase in dose of gamma rays upto 6.0 Gy in both varieties. Maximum percentage (94 %) was observed in V10 at 00 Gy with 91 % survival of plants at this dose (Fig. 4.2.4.1.1a) while minimum percentage and survival rate was observed at 10.0 Gy i.e. 54 and 60 % (Fig. 4.2.4.1.1b).

Gamma irradiation induced significant effect on all morphological characters including average number of leaves, leaf length and leaf width of Longiflorum cultivar of Lilium as mentioned in Table 4.2.4.1.2.

Non-irradiated plants showed 36bc±0.93 leaves with 4.0cd±0.01 cm leaf length and 1.6d±0.63 cm leaf width (Fig. 4.2.4.1.2a). At some doses positive results were observed in case of average number of leaves and leaf length. At 4.0 Gy 55a±0.48 leaves with 6.5a±0.11 leaf length and 1.1ab±0.05 leaf width were produced while at 10 Gy 16d± 0.63leaves with leaf length i.e. 3.2d±0.63 cm were observed. Leaf width at this dose was 0.6bc±0.06 cm (Fig. 4.2.4.1.2b).±

Effect of gamma rays on the height of treated plants of Longiflorum cultivar of Lilium is mentioned in Fig. 4.2.4.1.3. It is evident from Fig. 4.2.4.1.3 that height of plants germinated from irradiated bulbs was strongly affected by the doses of gamma rays. It was observed that V10 plants showed maximum plant height 62±1.01 cm at 00 Gy (Fig. 4.2.4.1.4a). The data indicated that plants of V10 respond well at lower doses.

Reduction in plant height occurred by increasing the gamma irradiation dose. Minimum height of 44±0.93 cm was observed at 10.0 Gy (Fig 4.2.4.1.4b).

127

Table 4.2.4.1.1: Effect of different doses of gamma irradiations on the germination response, germination percentage and survival percentage of Longiflorum Cultivar of Lilium

Variety Code Dose (Gy) Germination Germination Plant survival name Response (Days) Percentage Percentage (%) (%)

00 15c±0.63 94 91

2.0 20bc±0.69 80 90 Easter lily V10 4.0 24b±1.40 85 92

6.0 26ab±0.93 65 75

8.0 27ab±0.89 60 72

0.0 30a±0.28 54 60

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05).

a b

Fig. 4.2.4.1.1a-b: Germination rate of Longiflorum cultivar of Lilium at different

doses of gamma rays

a) Germination rate of control plant after 15 days (1X); b) Germination rate at dose of 10 Gy after 30 days (1X)

128

Table 4.2.4.1.2: Effects of different doses of gamma rays on the length, number and width of leaves of Longiflorum cultivar

Variety Code Dose Average no. of Leaf length (cm) Leaf width (cm) name leaves 00 36bc±0.93 4.0cd±0.014 1.6a±0.04

b b ab 2.0 42 ±1.09 5.4 ±0.014 1.2 ±0.04

4.0 55a±0.48 6.5a±0.116 1.1ab±0.05 Easter lily V10 6.0 33c±0.80 5.0bc±0.08 0.8b±0.04

8.0 28cd±0.63 4.8c±0.63 0.6bc±0.06

10.0 16d±0.63 3.2d±0.63 0.6bc±0.06

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05).

a b

Fig. 4.2.4.1.2a-b: Leaf length and width at different gamma rays doses

a) Leaf length and width of control plant (1X); b) Leaf length and width at 10.0 Gy (1X)

129

70 4.2.4.1.3

) 50

30 V10

Plant height (cm 20

0 0 2 4 6 8 Different doses of gamma rays (Gy)

Fig. 4.2.4.1.3: Effect of different doses of gamma rays on plant height of Longiflorum cultivar of Lilium

a b

Fig. 4.2.4.1.4a-b: Plant height of Longiflorum cultivar of Lilium at different doses of gamma rays

a) Plant height of control plant (1X); b) Plant height at dose of 10 Gy (1X)

130

4.2.4.2: In vitro mutagenesis 4.2.4.2.1: Shoot multiplication Effect of different doses of gamma rays on regeneration frequency, number of shoots per explant and shoot length of irradiated stationary in vitro cultures of Longiflorum cultivar is presented in Table 4.2.4.2.1.

Regeneration frequency ranged from 43 to 88 % shown in Fig. 4.2.4.2.1a. Higher doses of gamma rays inhibit shoot formation. Maximum shoots 3.2a±0.06 were produced in control plants which decreased upto 1.1d±0.04 at 10.0 Gy (Fig. 4.2.4.2.1b). Similarly shoot length also decreased from 6.3a±0.10 cm to 4.0d±0.07 cm.

Effect of different doses of gamma rays on shaking cultures is described in Table 4.2.4.2.2. It was noticed that gamma rays induced same effect as in stationary cultures but cultures phase i.e. shaking of cultures enhanced regeneration potential of all cultivars. Regeneration frequency increased upto 91 percent in control plants (Fig. 4.2.4.2.2a) of V10 and from 43- 47 percent in irradiated plants at 10.0 Gy. Maximum shoots 5.0a±0.08 were observed in control shaking cultures of V10 while 2.4cd±0.10 shoots were shown in radiated plants at 10.0 Gy with shoot length of 6.9ab±0.08 and 4.5d±0.05 cm.

Data regarding effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants is shown in Table. 4.2.3.2.3. It is clearly evident from the table that sucrose amount directly influenced the frequency of bulblet formation. By increasing the sucrose concentration from 30 to 60 %, bulblet formation rate also increased in all cultivars but further increase from 60-90 percent lead to decrease in frequency of bulblet formation. At 30 % sucrose amount, highest bulblets formation rate was observed in control plants (83 %) shown in Fig. 4.2.3.2.3a while at 10.0 Gy lowest (63) % was noticed at same sucrose concentration. Increased amount of sucrose upto 60 % enhanced formation of bulblets from (83-86) % in control plants (Fig. 4.2.3.2.3b) and from 63 to 68 at 10.0 Gy.

Further increase of sucrose amount caused decrease in frequency of bulblet formation i.e. from 86 to 79 percent in control plants (Fig. 4.2.3.2.3c) and from 68 to 55 at 10.0 Gy. Healthy plants were shifted to autoclaved sand in green house for acclimatization (Fig. 4.2.3.2.3d).

131

Table 4.2.4.2.1: Effect of different gamma rays doses on the regeneration potential of stationary in vitro cultures of Longiflorum cultivar

Variety Dose Regeneration No. of shoots/explant Shoot length name (Gy) frequency (%) (cm)

a a 00 88 3.2 ±0.06 6.3 ±0.10

2.0 82 2.1b±0.12 6.0ab±0.04

bc b 4.0 80 1.8 ±0.24 5.3 ±0.06 Easter lily

(V10) 6.0 1.5c±0.20 4.8bc±0.06 69

cd c 8.0 54 1.3 ±0.17 4.5 ±0.05

10.0 43 1.1d±0.04 4.0d±0.07

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

Fig. 4.2.4.2.1a-b: Regeneration frequency of stationary cultures of Easter lily plants

a) Maximum regeneration frequency (1X); b) Shoot formation at 10.0 Gy (1X)

132

Table 4.2.4.2.2: Effect of different gamma rays doses on the regeneration potential of shaking (rpm) cultures of in vitro cultures of Longiflorum cultivar

Variety Dose Regeneration No. of shoots/explant Shoot length

name (Gy) frequency (%) (cm)

a ab 00 91 5.0 ±0.08 6.9 ±0.08

2.0 85 4.5ab±0.05 7.0a±0.06 Easter lily (V10) 4.0 83 4.2b±0.07 5.7b±0.07

6.0 70 3.0c±0.11 5.5bc±0.07

c c 8.0 56 2.6 ±0.10 5.0 ±0.08

10.0 47 2.4cd±0.10 4.5d±0.05

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

Fig. 4.2.4.2.2a) Regeneration frequency in control plants of shaking cultures of Easter lily (1X)

133

Table 4.2.4.2.3: Effect of different sucrose concentrations on bulblet formation of in vitro irradiated plants of Longiflorum cultivar

Plant hormones Doses Sucrose amount Frequency of BAP + Kin + IAA (Gy) (mg/L) bulblet (mg/L) formation (%) 83 00 80 2.0 30 76 4.0 72

6.0 69 8.0 63

10.0

00 86 0.1 + 0.1+ 3.0 2.0 82 4.0 60 79 6.0 75 8.0 70 10.0 68

00 79 2.0 75 4.0 90 70 6.0 68 8.0 64 10.0 55

134

a b

c d

Fig. 4.2.4.2.3a-d: Effect of different amount of sucrose g/L on bulblet formation of Longiflorum cultivar a) Bulblet formation in V10 control plants in 30g/L sucrose (1X); b) V10 showing bulblet formation in 60g/L Sucrose (1X); c) Reduction in bulblet formation in V10 in 90g/L sucrose amount (1X); d) Hardening of plants of V10 cultivar (1X)

135

4.2.4.2.2: Studies on morphology of M1V4 and M1V5 generation of in vitro derived mutants Effect of different doses of gamma irradiations on plant height and number, length and width of leaves of M1V4 generation of Longiflorum Lilium cultivar derived from in vitro mutagenesis is mentioned in Table 4.2.4.2.4. Plant height, number of leaves, leaf length was significantly influenced by irradiation dose and interaction effects were significant for all cultivars. All these parameters showed reduction by increasing the gamma irradiation dose. Control plants showed average number of leaves i.e. 36c±0.93 and minimum leaves 21cd±1.52 were observed at 10.0 Gy with plant height of 71a±0.77 (Fig. 4.2.4.2.4a) and 48c±0.93 cm. Leaf length increased from 4.0d±0.07 to 5.8bc±0.04 cm at 10.0 Gy (Fig. 4.2.4.2.4b) and width decreased at this dose i.e. from 1.6a±0.20 cm to 1.1b±0.04 cm.

The number and average length of roots of in vitro irradiated and non-irradiated Lilium cultivars is presented in Fig. 4.2.4.2.5a-4.2.4.2.5c. It was noticed that by increasing the gamma rays dose average number of roots and root length decreased at higher concentrations. Maximum roots were produced in control plants i.e. 4.0±0.09 with 2.0±0.06 cm length (Fig. 4.2.4.2.5b-4.2.4.2.5d).

136

Table 4.2.4.2.4: Effect of different doses of gamma irradiations on plant height and number of

leaves of M1V4 generation of Longiflorum cultivar derived from in vitro mutagenesis

Variety Dose Average no. of Plant Leaf length Leaf width name (Gy) leaves height (cm) (cm) (cm) 00 36c±0.93 71a±0.77 4.0d±0.07 1.6a±0.20

Easter 2.0 45b±1.01 69a±0.80 6.0b±0.04 1.5a±0.20 Lily (V10) 4.0 60a±0.63 62ab±0.48 7.7a±0.05 1.3ab±0.17

6.0 42bc±1.09 60b±0.93 5.5bc±0.07 1.2ab±0.17

8.0 36c±0.93 53bc±0.40 5.3c±0.06 1.0b±0.04

10.0 21cd±1.52 48c±0.93 5.8bc±0.04 1.1b±0.04

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

a b

Fig. 4.2.4.2.4a-b: Plant height and leaf length of in vitro regenerated plants of V10

a) Plant height of control plants (1X); b) Leaf length of irradiated plant at 10.0 Gy (1X)

137

4.5 4 a

3.5

3 2.5 2 V10

1.5 Numberofroots 1 0.5 0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.4.2.5a: Effect of radiation on number of roots of M1V4 generation of in vitro derived mutants of Longiflorum cultivar

Fig. 4.2.4.2.5b) V10 showing rooting in control plants (1X)

138

2.5

1.5

1 V10 Rootlength(cm) 0.5

0 0 2 4 6 8 10 Different doses of gamma rays (Gy)

Fig. 4.2.4.2.5c: Effect of radiation on root length of M1V4 generation of in vitro derived mutants of Longiflorum cultivar

Fig. 4.2.4.2.5d) Root length of V10 in control plant (1X)

139

Table 4.2.4.2.5: Effect of radiation on flower formation of in vitro derived mutants of M1V5 generation of Longiflorum cultivar

Sr. Variety Dose Average No. of Floral characters No. name (Gy) days to flowering Colour Size shape

1 00 53bc±0.40 White Normal Normal 2 2.0 55b±0.04 - - - 3 Easter plant 4.0 58ab±0.63 - - - 4 (V10) 6.0 62a±1.01 - Larger - 5 8.0 58ab±0.63 - - - 6 10.0 49bc±0.90 - - -

Each value is mean of five replicates with standard error (Mean ± S.E), Mean with same superscript are not significantly different by Duncan’s new multiple range test (p<0.05)

(-) indicated same to control

a b

Fig. 4.2.4.2.6: Flower morphology of control and mutant of V10

a) Flower of control plant of V10 (1X); b) Flower of mutant at 10.0 Gy (1X)

140

4.3: Molecular characterization by using Random amplified polymorphic DNA (RAPD) markers Effect of mutagenesis on the genetic variation of irradiated as well as control cultivars of all Lilium groups was evaluated by using RAPD markers. Phylogenetic trees/dendrograms were constructed by using DNAMAN software. Data about screened primers, total number of bands including both monomorphic and polymorphic bands was recorded. Four main groups of Lilium cultivars selected in the current study for RAPD analysis are as following: 4.3.1. Lilium Oriental (O) 4.3.2. Lilium Oriental x Trumpet (OT) 4.3.3. Lilium Longiflorum x Oriental (LO) 4.3.4. Lilium Longiflorum (L)

141

4.3.1: Oriental (O) group of Lilium 4.3.1.1: Molecular characterization of mutants by using RAPD markers

Total 25 RAPD decamer primers were used for evaluation of genetic polymorphism of 4 Oriental Lilium cultivars in the present study, out of which 11 were selected. Data about total number of primers along with their sequence, total number of bands of non-irradiated and irradiated genotypes, nature of bands, and molecular size along with polymorphism percentage of amplified products is described (Table 4.3.1.1-4.3.1.4). The amplification profiles generated by different primers across irradiated genotypes of Lilium cultivars were shown in Fig. 4.3.1.1 – 4.3.1.6.

After screening of 25 primers for the amplification of the DNA isolated from the 4 Lilium cultivars of Oriental group, 11 were selected for the production of amplicons. Total number of 57 bands in control and 83 bands in mutant plants of Samur La pink of Oriental group was recorded out of which 56 were monomorphic and 73 were polymorphic bands alongwith an average 50.65 percentage of polymorphism and size of bands ranged between 100-4000 bp (Table 4.3.1.1). In case of Heaven white, non-irradiated genotypes produced 54 bands with an average of 4.90 bands and 89 bands were observed in radiated plants of same cultivar. Out of total bands, 37 were monomorphic and 52 were polymorphic in nature alongwith 56.72 an average percentage of polymorphism as given in Table 4.3.1.2. The number of bands generated by each primer varied i.e. from 02 bands produced by LP- 01 to 10 bands produced by LP-09 in control genotypes while number of bands varied from 04 to 15 by LP-01 and LP-11 in irradiated genotypes. The molecular size of amplified fragments ranged from 100 bp to 3000 bp. An average of 5.63 bands was produced containing 3.36 monomorphic and 4.73 polymorphic bands.

Control plants of Kabana lily produced 57 bands while mutant genotypes showed 86 bands out of which 37 were monomorphic (Table 4.3.1.3). Polymorphism percentage ranged from 25.00 to 87.50. Maximum bands were produced by LP-04 i.e. 11 and LP-01 was responsible for the production of minimum number of bands (03). An average of 60.50 % polymorphism was observed and size of bands ranged from 100-3000 bp.

Data about DNA bands amplified and polymorphism generated in Montezuma-O-red cultivar of Oriental group is described in Table 4.3.1.4. Non-irradiated genotypes showed

142

an average of 5.18 bands whereas irradiated plants produced total 85 bands with an average rate of 7.72 bands containing 56 polymorphic bands.

The molecular size of amplified fragments ranged from 100 bp to 3000 bp.

143

Table 4.3.1.1: DNA bands amplified and polymorphism generated in Samur La pink (V1) included in Oriental group of Lilium

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 01 04 1 03 75.00 650-4000 2 LP2 GGAAACCCCT 08 08 6 02 25.00 100-1000 3 LP3 GTGCGCAATG 02 04 2 02 50.00 200-500 4 LP4 AAGTGCGACC 07 11 5 06 54.54 300-650 5 LP5 CCCGGATGGT 07 08 6 02 25.00 500-1500 6 LP6 CCGCATCTAC 07 08 4 04 50.00 100-800 7 LP7 TGTCTGGGTG 07 09 2 07 77.77 200-500 8 LP8 AAAGCTGCGG 02 04 2 02 50.00 650-1000 9 LP9 TGCGTGCTTG 05 09 2 07 77.77 100-650 10 LP10 CACACTCCAG 04 07 1 06 85.71 300-800 11 LP11 ACTTCGCCAC 07 11 07 04 36.36 300-2000

Total 57 83 56 73 50.65 100-4000 Mean 5.18±0.06 7.54±0.07 5.09±0.02 6.63±0.03

144

Table 4.3.1.2: DNA bands amplified and polymorphism generated in Heaven white (V2) Lilium cultivar included in Oriental group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 02 04 1 03 75.00 650-3000 2 LP2 GGAAACCCCT 05 10 2 08 80.00 200-800 3 LP3 GTGCGCAATG 03 04 3 01 25.00 200-650 4 LP4 AAGTGCGACC 04 06 4 02 50.00 300-650 5 LP5 CCCGGATGGT 06 11 2 09 81.81 500-1500 6 LP6 CCGCATCTAC 06 08 6 02 25.00 300-800 7 LP7 TGTCTGGGTG 04 09 4 05 55.55 200-800 8 LP8 AAAGCTGCGG 03 04 2 02 50.00 650-1500 9 LP9 TGCGTGCTTG 10 10 6 04 40.00 100-650 10 LP10 CACACTCCAG 04 08 2 06 75.00 200-650 11 LP11 ACTTCGCCAC 07 15 5 10 66.66 300-1500

Total 54 89 37 52 56.72 100-3000 Mean 4.90±0.03 8.09±0.07 3.36±0.05 4.73±0.04

145

Table 4.3.1.3: DNA bands amplified and polymorphism generated in Kabana lily (V3) Lilium cultivar included in Oriental group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 1 03 1 02 66.66 650-3000 2 LP2 GGAAACCCCT 8 10 7 03 30.00 200-800 3 LP3 GTGCGCAATG 2 05 2 03 60.00 200-650 4 LP4 AAGTGCGACC 7 11 5 06 54.54 300-650 5 LP5 CCCGGATGGT 7 08 6 02 25.00 500-1500 6 LP6 CCGCATCTAC 7 08 4 04 50.00 300-800 7 LP7 TGTCTGGGTG 7 09 2 07 77.77 200-800 8 LP8 AAAGCTGCGG 2 04 0 04 100.0 650-1500 9 LP9 TGCGTGCTTG 5 09 2 07 77.77 100-650 10 LP10 CACACTCCAG 4 08 1 07 87.50 1000-2000 11 LP11 ACTTCGCCAC 7 11 7 04 36.36 300-1500

Total 57 86 37 49 60.50 100-3000 Mean 5.18±0.06 7.82±0.04 3.36±0.01 4.45±0.05

146

Table 4.3.1.4: DNA bands amplified and polymorphism generated in Montezuma-O-red (V4) Lilium cultivar included in Oriental group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in base

No. code (5'……. 3') bands bands polymorphism pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 02 04 2 02 50.00 2000-10000 2 LP2 GGAAACCCCT 04 10 2 08 80.00 200-800 3 LP3 GTGCGCAATG 02 04 2 02 50.00 200-650 4 LP4 AAGTGCGACC 04 06 4 02 33.33 300-650 5 LP5 CCCGGATGGT 08 11 3 08 72.72 500-1500 6 LP6 CCGCATCTAC 08 09 3 06 66.66 300-1000 7 LP7 TGTCTGGGTG 07 07 3 04 57.14 200-800 8 LP8 AAAGCTGCGG 03 04 0 04 100.0 650-1500 9 LP9 TGCGTGCTTG 10 10 6 04 40.00 100-650 10 LP10 CACACTCCAG 03 08 2 06 75.00 1000-2000 11 LP11 ACTTCGCCAC 06 12 2 10 83.33 300-1500

Total 57 85 29 56 64.38 100-100000 Mean 5.18±0.04 7.72±0.02 2.63±0.08 5.09±0.01

147

650 bp

500 bp

300 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.1.1: Agarose gel showing RAPD amplification profile by Primer LP-04; L, 1 kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink

2000 bp

500 bp

200 bp

L C 2.0 4.0 6.0 8.0 10.0 Fig. 4.3.1.2: Agarose gel showing RAPD amplification profile by Primer LP-07; L, 1kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink

2000 bp

800 bp

300 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.1.3: Agarose gel showing RAPD amplification profile by Primer LP-10; L, 1kb (+) bp Standard Ladder; C) Samur La pink control; 2.0-10.0) corresponds to irradiated genotypes of Samur La pink

148

2000 bp

800 bp

200 bp L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.1.4: Agarose gel showing RAPD amplification profile by Primer LP-02; L, 1kb (+) bp Standard Ladder; C) Heaven white control; 2.0-10.0) corresponds to irradiated genotypes of Heaven white

10,000 bp

2000 bp

1000 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.1.5: Agarose gel showing RAPD amplification profile by Primer LP-10; L, 1kb (+) Standard Ladder; C) Kabana lily control; 2.0-10.0) corresponds to irradiated genotypes of Kabana lily

10,000 bp

3000 bp 2000 bp 1000 bp 1000 bp

300 bp

L C 2.0 4.0 6.0 8.0 10.0 L C 2.0 4.0 6.0 8.0 10.0

(a) (b)

Fig. 4.3.1.6a-b: Agarose gel showing RAPD amplification profile by Primer LP-06 & LP-01; L, 1kb (+) bp Standard Ladder; C) Montezuma-O-red control; 2.0-10.0) corresponds to irradiated genotypes of Montezuma-O-red

149

4.3.1.2: Phylogenetic relationship among mutants

DNAMAN software was used for generation of the phylogenetic tree on the basis of genetic distance coefficient matrix for phylogenetic studies among mutants of different cultivars of Lilium Oriental group. DNAMAN computing based software showed three important features including weight of each sequence, coefficient values at the top of branches that is the genetic distance of variety and branch length with reference standard value 0.05.

Data was analyzed on the basis of genetic distances of mutants from their respective controls shown in Fig. 4.3.1.7a - 4.3.1.7d. Mutants of Samur La pink were divided into two main clusters: first group included mutants irradiated with 10.0, 8.0, 6.0 and 4.0 Gy doses of gamma irradiation while control plants of Samur La pink and mutants at 2.0 irradiation dose were clustered in one group (Fig. 4.3.1.2a). Dendrogram of mutants and control plants of Heaven white were also clustered into two groups as well: first group included mutants treated with 10.0, 8.0 and 6.0 doses of gamma rays whereas second group had control and mutants irradiated at 2.0 and 4.0 Gy dose (Fig. 4.3.1.2b). It is clearly evident from the Fig. 4.3.1.2c and Fig. 4.3.1.2d that plants of Kabana lily and Montezuma-O-red were separated into two groups. Control plants and mutants of Kabana lily treated at 2.0 Gy dose clustered in one group while all other mutants were combined in another group. Similarly control and irradiated plants of Montezuma-O-red at 2.0 and 4.0 Gy dose were included in one major group while remaining mutants were separated in second group.

150

a b

c d

Fig. 4.3.1.7a-d: Phylogenetic relationship of 4 Lilium Oriental cultivars included the irradiated and non-irradiated genotypes of Samur La pink, Heaven white, Kabana lily and Montezuma-O-Red/white by using RAPD markers

SLP (Samur La pink), HW (Heaven white), KB (Kabana lily), MOR (Montezuma-O-red)

151

4.3.2: Oriental x Trumpet (OT) group of Lilium

4.3.2.1: Molecular characterization of mutants by using RAPD markers

Data about total number of primers along with their sequence, total number of bands, nature of bands, and molecular size along with polymorphism percentage of amplified products of Lilium cultivars included in Oriental x Trumpet group (Table 4.3.2) is described in Table 4.3.2.1-4.3.2.4. The amplification profiles generated by different primers across irradiated genotypes were shown in Fig. 4.3.2.1 – 4.3.2.4.

Total 25 RAPD decamer primers were used for evaluation of genetic polymorphism among control and radiated genotypes of 4 different cultivars of Oriental x Trumpet group. Star fighter-O-red/white showed clear variation in the number of bands.

Control genotypes produced total 77 bands with an average of 6.81 bands while irradiated genotypes produced more bands (103) as compared to non-irradiated (9.36) average bands (Table 4.3.2.1). The number of bands generated by each primer varied i.e. from 02 bands produced by LP-01 and LP-08 to 12 bands produced by LP-09 and LP-03 in control plants (Fig. 4.3.2.1a-4.3.2.1b) and from minimum 04 bands (LP-01) to 19 bands (LP-09).

The molecular size of amplified fragments ranged from 100 bp to 3000 bp. The highest number of polymorphic bands was produced by LP-11 (8). An average polymorphism percentage observed was 61.25 (%). Control and mutant genotypes of V6 showed dissimilarity in generation of number of bands as well as their size.

Total 54 bands were produced by control plants and 84 bands were showed in irradiated plants (Table 4.3.2.2).

Maximum number (7) was noticed in control genotypes by LP-02, LP-10 (Fig. 4.3.22) and LP-11. In treated genotypes, maximum 10 bands were recorded by LP-02, LP-09 and LP- 11. The molecular size of bands ranged from 200-3000 bp. The percentage polymorphism varied from 70 to 100 with an average of 48.17 %.

In case of Golden tycon yellow (V7) of Oriental x Trumpet group, an average of 5.18 bands were produced in control plants and 8.27 in irradiated plants, out of which 29 were monomorphic and 62 were polymorphic with an average polymorphism percentage of 64.87 (%). Minimum bands (02) in control plants were generated by LP-01 and LP-08 (Fig. 4.3.2.3a-4.3.2.3b0 and in treated plants (04) by Lp-01and LP-08. Size of generated bands

152

ranged from 100-2000 bp (Table 4.3.2.3). Orange pixie (V8) also showed effect of mutagenesis. The resulted bands profile is described in Table 4.3.2.4 which showed that 63 bands were generated by control plants and 94 by mutants. Maximum bands (12) were recorded in non-irradiated genotypes by LP-09 (Control plants) (Fig. 4.3.2.4) and (11) in treated plants by LP-11. An average of 65.78 polymorphism percentage was noticed.

The molecular size of the fragments ranged from 100-3000 bp.

153

Table 4.3.2.1: DNA bands amplified and polymorphism generated in Star fighter-O-red/white (V5) included in Oriental x Trumpet group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 02 04 01 3 75.00 500-3000 2 LP2 GGAAACCCCT 09 10 06 4 40.00 200-1000 3 LP3 GTGCGCAATG 12 12 05 7 58.33 400-1500 4 LP4 AAGTGCGACC 06 08 02 6 75.00 200-500 5 LP5 CCCGGATGGT 06 08 04 4 50.00 500-1500 6 LP6 CCGCATCTAC 07 08 03 5 62.50 200-800 7 LP7 TGTCTGGGTG 06 10 04 6 60.00 100-1500 8 LP8 AAAGCTGCGG 02 04 01 3 75.00 650-1000 9 LP9 TGCGTGCTTG 12 19 12 7 36.84 300-1500 10 LP10 CACACTCCAG 04 08 02 6 75.00 400-1000 11 LP11 ACTTCGCCAC 09 12 04 8 66.66 400-2000 Total 77 103 44 59 61.25 100-3000 Mean 6.81±0.05 9.36±0.02 04±0.03 5.36±0.01

154

Table 4.3.2.2: DNA bands amplified and polymorphism generated in Advantage La salmon (V6) Lilium cultivar included in Oriental group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 1 04 0 04 100.0 400-3000 2 LP2 GGAAACCCCT 7 10 3 07 70.00 200-1000 3 LP3 GTGCGCAATG 4 04 2 02 50.00 400-800 4 LP4 AAGTGCGACC 4 07 3 04 57.14 200-650 5 LP5 CCCGGATGGT 6 09 4 05 55.55 500-1500 6 LP6 CCGCATCTAC 6 08 6 02 25.00 200-1000 7 LP7 TGTCTGGGTG 4 09 4 05 55.55 200-1500 8 LP8 AAAGCTGCGG 3 04 3 01 25.00 500-1000 9 LP9 TGCGTGCTTG 7 10 5 05 50,00 300-1500 10 LP10 CACACTCCAG 7 09 7 02 22.22 1000-3000 11 LP11 ACTTCGCCAC 5 10 0 10 100.0 200-3000 Total 54 84 37 47 48.17 200-3000 Mean 4.90±0.02 7.63±0.04 3.36±0.06 4.27±0.03

155

Table 4.3.2.3: DNA bands amplified and polymorphism generated in Golden tycon yellow (V7) cultivar included in Oriental x Trumpet group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in

No. code (5'……. 3') bands bands polymorphism base pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 2 04 2 02 50.00 650-2000 2 LP2 GGAAACCCCT 9 10 3 07 70.00 200-1000 3 LP3 GTGCGCAATG 3 04 1 03 75.00 400-1500 4 LP4 AAGTGCGACC 3 07 2 05 71.42 200-500 5 LP5 CCCGGATGGT 5 09 2 07 77.77 500-1500 6 LP6 CCGCATCTAC 5 08 4 04 50.00 650-1500 7 LP7 TGTCTGGGTG 6 09 4 05 55.55 100-100 8 LP8 AAAGCTGCGG 2 04 2 02 50.00 650-800 9 LP9 TGCGTGCTTG 7 10 5 05 50.00 300-1500 10 LP10 CACACTCCAG 6 08 2 06 75.00 400-1000 11 LP11 ACTTCGCCAC 9 18 2 16 88.88 300-1500

Total 57 91 29 62 64.87 100-2000 Mean 5.18±0.01 8.27±0.03 2.63±0.04 5.63±0.05

156

Table 4.3.2.4: DNA bands amplified and polymorphism generated in Orange pixie (V8) Lilium cultivar included in Oriental x Trumpet group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in base

No. code (5'……. 3') bands bands polymorphism pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 02 05 01 4 80.00 400-2000 2 LP2 GGAAACCCCT 09 10 06 4 40.00 200-800 3 LP3 GTGCGCAATG 02 05 02 3 60.00 200-650 4 LP4 AAGTGCGACC 05 07 02 2 28.57 200-500 5 LP5 CCCGGATGGT 06 08 04 4 50.00 500-1500 6 LP6 CCGCATCTAC 07 08 02 6 75.00 100-1000 7 LP7 TGTCTGGGTG 05 09 04 5 55.55 100-2000 8 LP8 AAAGCTGCGG 03 04 01 3 75.00 650-1500 9 LP9 TGCGTGCTTG 12 19 12 7 36.84 500-2000 10 LP10 CACACTCCAG 04 08 02 6 75.00 500-1000 11 LP11 ACTTCGCCAC 08 11 03 8 72.72 400-3000

Total 63 94 39 52 65.78 100-3000 Mean 5.72±0.02 8.54±0.04 3.54±0.03 4.72±0.03

157

10,000 bp 1000 bp 1500 bp

400 bp 400 bp L C 2.0 4.0 6.0 8.0 10.0 L C 2.0 4.0 6.0 8.0 10.0

(a) (b) Fig. 4.3.2.1a-b: Agarose gel showing RAPD amplification profile by Primer LP-03 & LP-08; L, 1kb (+) bp Standard Ladder; C) Star fighter-O-red/white; 2.0-10.0) corresponds to irradiated genotypes of Star fighter-O-red/white

10,000 bp

2000 bp

1000 bp

500 bp L C 2.0 4.0 6.0 8.0 10.0 Fig. 4.3.2.2: Agarose gel showing RAPD amplification profile by Primer LP-10; L, 1kb (+) bp Standard Ladder; C) Advantage La salmon; 2.0-10.0) corresponds to irradiated genotypes of Advantage La salmon

158

4000 bp 10,000 bp

1500 bp 800 bp 650 bp 650 bp L C 2.0 4.0 6.0 8.0 10.0 L C 2.0 4.0 6.0 8.0 10.0 (a) (b) Fig. 4.3.2.3a-b: Agarose gel showing RAPD amplification profile by Primer LP-06 & LP-08; L, 100 bp Standard Ladder; C) Golden tycon yellow ; 2.0-10.0) corresponds to irradiated genotypes of Golden tycon yellow

1500 bp

650 bp

500 bp

Fig. 4.3.2.4: Agarose gel showing RAPD amplification profile by Primer LP-09; L, 100 bp Standard Ladder; C) Orange pixie; 2.0-10.0) corresponds to irradiated genotypes of Orange pixie

159

4.3.2.2: Phylogenetic relationship among mutants

Phylogenetic tree was constructed by using DNAMAN software on the basis of genetic distance coefficient matrix for phylogenetic studies among mutants of different cultivars of Lilium Oriental x Trumpet group. DNAMAN computing based software showed three important features including weight of each sequence, coefficient values at the top of branches that is the genetic distance of variety and branch length with reference standard value 0.05.

Data was analyzed on the basis of genetic distances of mutants from their respective controls shown in Fig. 4.3.2.5a - 4.3.2.5d. In case of Star fighter-O-red/white cultivars of (OT) group, control plants as well mutants irradiated at 2.0, 4.0 and 6.0 Gy dose of gamma radiation were clustered in one group while mutants treated with 8.0 to 10.0 Gy dose were separated in another major group. Control and irradiated plants of Advantage La salmon at 2.0 Gy dose were combined in one group whereas treated plants with 4.0 to 10.0 Gy of gamma rays were clustered in second group. Mutants of Golden tycon yellow irradiated at 4.0 to 10.0 Gy were combined in one group while control plants and treated plants at 2.0 Gy were separated in the second group. In case of Orange pixie, mutants irradiated at 2.0, 4.0, 6.0, 8.0 and 10.0 Gy gamma irradiation were grouped in one group while control plants were clustered in another group.

160

a b

c d

Fig. 4.3.2.5a-d: Phylogenetic relationship of 4 Lilium Oriental x Trumpet cultivars included the irradiated and non-irradiated genotypes of Star fighter-O-Red/white, Advantage La salmon, Golden tycon yellow and Orange pixie by using RAPD markers

SF (Star fighter-O-red/white), ALS (Advantage La salmon), GTY(Golden tycon yellow), OP (Orange pixie)

161

4.3.3: Longiflorum x Oriental (LO) group

4.3.3.1: Molecular characterization of mutants by using RAPD markers

The amplification profiles generated by different primers across irradiated genotypes of Lilium cultivars were shown in Fig. 4.3.3.1 – 4.3.3.2.

Total 25 RAPD decamer primers were used for evaluation of genetic polymorphism, out of which 11 were selected which produced total 96 bands in irradiated plants and 65 bands in control plants which were highly reproducible.

Out of total bands, 45were monomorphic and 51 were polymorphic in nature as given in Table 4.3.3.1. The number of bands generated by each primer varied i.e. from 04 bands produced by LP-03 and LP-04 to 09 bands produced by LP-11 in control genotypes and from (04) by LP-3 to (17) by LP11.

The molecular size of amplified fragments ranged from 100 to 3000 bp. An average of 8.72 bands was produced in mutants and 5.90 in control plants with polymorphism of 52.11 %.

162

Table 4.3.3.1: DNA bands amplified and polymorphism in Courier La white (V9) Lilium cultivar included in Longiflorum x Oriental group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in base

No. code (5'……. 3') bands bands polymorphism pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 7 07 3 04 57.14 400-800 2 LP2 GGAAACCCCT 9 10 5 05 50.00 200-1000 3 LP3 GTGCGCAATG 4 04 2 02 50.00 100-500 4 LP4 AAGTGCGACC 4 07 4 03 42.85 200-650 5 LP5 CCCGGATGGT 5 09 4 05 55.55 1500-3000 6 LP6 CCGCATCTAC 5 08 5 03 37.50 200-1000 7 LP7 TGTCTGGGTG 6 09 6 03 33.33 200-800 8 LP8 AAAGCTGCGG 2 04 1 03 75.00 650-1000 9 LP9 TGCGTGCTTG 7 10 5 05 50.00 200-800 10 LP10 CACACTCCAG 7 11 6 05 45.45 200-650 11 LP11 ACTTCGCCAC 9 17 4 13 76.47 200-3000

Total 65 96 45 51 52.11 100-3000 Mean 5.90±0.03 8.72±0.06 4.09±0.02 4.63±0.05

163

10, 000 bp

1000 bp

400 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.3.1: Agarose gel showing RAPD amplification profile by Primer LP-01; L, 1kb (+) Standard Ladder; C) Courier La white; 2.0-10.0) corresponds to irradiated genotypes of Courier La white

6000 bp

3000 bp

1500 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.3.2: Agarose gel showing RAPD amplification profile by Primer LP-05; L, 1kb (+) bp Standard Ladder; C) Courier La white; 2.0-10.0) corresponds to irradiated genotypes of Courier La white

164

4.3.3.2: Phylogenetic relationship among mutants

DNAMAN software was used for generation of the phylogenetic tree on the basis of genetic distance coefficient matrix for phylogenetic studies among mutants of cultivar of Longiflorum x Oriental group. DNAMAN computing based software showed three important features including weight of each sequence, coefficient values at the top of branches that is the genetic distance of variety and branch length with reference standard value 0.05.

Data was analyzed on the basis of genetic distances of mutants from their respective controls shown in Fig. 4.3.3.3. Mutants of Courier La white were divided into two main clusters: first group included mutants irradiated with 10.0, 8.0, 6.0 and 4.0 Gy doses of gamma irradiation while control plants and mutants at 2.0 irradiation dose were clustered in second group (Fig. 4.3.3.3).

Fig. 4.3.3.3: Phylogenetic relationship among control and mutants of Lilium Longiflorum X Oriental (LO) cultivar by using RAPD markers

CLW (Courier La white)

165

4.3.4: Lilium Longiflorum (L) group 4.3.4.1: Molecular characterization of mutants by using RAPD markers Total 25 RAPD decamer primers were used for evaluation of genetic polymorphism of cultivar included in Longiflorum group in the present study. Data about total number of primers along with their sequence, total number of bands, nature of bands, and molecular size along with polymorphism percentage of amplified products is described in Table 4.3.4.1. The amplification profiles generated by different primers were shown in Fig. 4.3.4.1 – 4.3.4.2.

After screening of 25 primers for the amplification of the DNA isolated from the one cultivar of Longiflorum group, 11 were selected for the production of total number of 102 bands in irradiated plants and 74 bands in control plants. Out of total bands, 5were monomorphic and 51 were polymorphic in nature as given in Table 4.3.4.1. The number of bands generated by each primer varied i.e. from 02 bands produced by LP-01 (Control plants) to 11 bands produced by LP-11 (Treated plants). The molecular size of amplified fragments ranged from 100 bp to 4000 bp. An average of 63.77 polymorphism percentage was noticed (Table 4.3.4.1).

166

Table 4.3.4.1: DNA bands amplified and polymorphism generated in Easter lily Lilium cultivar (V10) included in Longiflorum group

Sr. Primer Primer sequence Total bands Monomorphic Polymorphic %age Size in base

No. code (5'……. 3') bands bands polymorphism pair Control Irradiated genotypes genotypes 1 LP1 TCATCCGAGG 02 04 01 03 75.00 500-3000 2 LP2 GGAAACCCCT 09 10 06 04 40.00 200-800 3 LP3 GTGCGCAATG 02 05 02 03 60.00 100-500 4 LP4 AAGTGCGACC 13 15 02 13 86.66 300-1500 5 LP5 CCCGGATGGT 06 08 04 04 50.00 400-1500 6 LP6 CCGCATCTAC 07 08 02 06 75.00 200-650 7 LP7 TGTCTGGGTG 09 09 02 07 77.77 300-1000 8 LP8 AAAGCTGCGG 03 04 02 02 50.00 200-800 9 LP9 TGCGTGCTTG 11 20 12 08 40.00 100-1000 10 LP10 CACACTCCAG 04 08 02 06 75.00 300-800 11 LP11 ACTTCGCCAC 08 11 03 08 72.72 1000-4000 Total 74 102 38 64 63.77 100-4000 Mean 6.72 9.27 3.45 5.81

167

10,000 bp

1500 bp

300 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.4.1: Agarose gel showing RAPD amplification profile by Primer LP-04; L, 1kb (+) bp Standard Ladder; C) Easter lily; 2.0-10.0) corresponds to irradiated genotypes of Easter lily

10,000 bp

4000 bp

1000 bp

L C 2.0 4.0 6.0 8.0 10.0

Fig. 4.3.4.2: Agarose gel showing RAPD amplification profile by Primer LP-11; L, 1kb (+) bp Standard Ladder; C) Easter lily; 2.0-10.0) corresponds to irradiated genotypes of Easter lily

168

4.3.4.2: Phylogenetic relationship among mutants

DNAMAN software was used for generation of the phylogenetic tree on the basis of genetic distance coefficient matrix for phylogenetic studies among mutants of cultivar of Longiflorum group. DNAMAN computing based software showed three important features including weight of each sequence, coefficient values at the top of branches that is the genetic distance of variety and branch length with reference standard value 0.05.

Data was analyzed on the basis of genetic distances of mutants from their respective controls shown in Fig. 4.3.4.3. Mutants of Easter lily were divided into two main clusters: first group included mutants irradiated with 4.0, 6.0, 8.0 and 10.0 Gy doses of gamma irradiation while control plants and mutants at 2.0 irradiation dose were clustered in one group (Fig. 4.3.4.3).

Fig. 4.3.4.3: Phylogenetic relationship among control and irradiated cultivars of Easter lily of Lilium longiflorum group by using RAPD markers

ES (Easter lily)

169

4.4: Molecular characterization by using Simple sequence repeat (SSR) markers

Effect of radiation on the 10 Lilium cultivars was analyzed by molecular characterization through SSR markers as well. Data about total number of alleles and allele size of all irradiated and non-irradiated genotypes was recorded. The phylogenetic trees or dendrogram were constructed based on the genetic dissimilarity, estimated using the [-ln (ps)] transformation of the proportion of the shared alleles (ps). PIC values and observed heterozygosities were also measured to evaluate the informativeness and the genetic variation of control as well as mutants by each individual marker in the current section. Four major groups of Lilium were selected and analyzed by SSR markers in the present study are as follows:

4.4.1. Lilium Oriental (O)

4.4.2. Lilium Oriental x Trumpet (OT)

4.4.3. Lilium Longiflorum x Oriental (LO)

4.4.4. Lilium Longiflorum (L)

170

4.4.1: Oriental (O) group of Lilium

4.4.1.1: Molecular characterization of mutants by using SSR markers

Total 10 EST-SSRs markers were screened to analyze the 4 Lilium cultivars included in the Oriental group of Lilium. Among these, 5 EST-SSRs were selected to observe the allelic diversity between all control and irradiated plants of each cultivar included in the group.

Total 35 alleles were scored from 5 loci among the control and mutant plants of Samur La pink cultivar of Oriental group. Out of total alleles, 7 alleles were showed in control genotypes while 28 alleles were recorded in case of irradiated genotypes. Number of alleles per locus also varied from 1 (Ivflmre62, Ivflmre88 and Ivflmre117) to 2 (Ivflmre80 and Ivflmre 152) in non-irradiated genotypes along with allele size ranged from 113 (Ivflmre88) to 295 (Ivflmre62) and from 4 (Ivflmre117) to 7 (Ivflmre62) in irradiated genotypes along with allele size ranged from 118 (Ivflmre88) to 321 (Ivflmre62) as shown in Table 4.4.1.1. PIC values and observed heterozygosity were also calculated. It was noticed that PIC values of control plants ranged from minimum 0 (Ivflmre62, Ivflmre88 and Ivflmre117) to maximum 1 ((Ivflmre80 and Ivflmre 152) for each marker while mutants plants showed variation in the PIC values for all primers i.e. from minimum 0.000 to maximum 0.375. Similarly the percentage of heterozygotes per marker detected among the control and variants of Samur La pink also showed an observable difference ranged from 61% to 91% in the control plants and 49% to 79% in the mutant plants (Table 4.4.1.1).

It is clearly evident from the Table 4.4.1.2 that total number of 63 alleles was recorded from the 5 loci in Heaven white cultivar of Oriental group. An average of 1.8 alleles was scored in case of non-irradiated genotypes with allele size ranged from 114-294 bp by Ivflmre88 and Ivflmre62. While mutant plants showed an average of 3.8 alleles with different allele size ranged from 114 to 325 bp by Ivflmre88 to Ivflmre62. PIC values and observed heterozygosity were also measured for both control and mutant plants. Minimum PIC value was calculated i.e. 0.000 by Ivflmre88 and maximum value of 0.375 was recorded in non-irradiated genotypes (Ivflmre62, Ivflmre80, Ivflmre117 and Ivflmre152). PIC values of mutant genotypes ranged from 0.771 (Ivflmre152) to 1.000 (Ivflmre117). Observed heterozygosity also showed difference in both control and mutant plants i.e. 80%

171

of heterozygotes per marker were detected in control and 95% were observed in mutant plants of Heaven white cultivar.

Data about allelic diversity was also observed for irradiated and control genotypes of Kabana lily (Table 4.4.1.3). It was noticed that variation was observed among control and mutants. An average of 2.4 alleles was recorded in control genotypes by 5 different loci with the size ranged between 113-286 bp (Ivflmre88-Ivflmre62). Maximum alleles were produced by Ivflmre80 i.e. 3. In response to irradiated genotypes, an average of 4.8 alleles was observed with highest number of alleles (7) by Ivflmre88. The size of alleles also showed difference from the control cultivar (113-318) bp by Ivflmre88 and Ivflmre62. The PIC values and observed heterozygosity also showed difference in irradiated and non- irradiated plants i.e. an average of 0.375 PIC value was recorded for control and 0.833 was recorded for mutant ones. Similarly non-irradiated plants showed 100% of heterozygotes by each primer while radiated plants showed 94.6% of observed heterozygosity detected by each primer (Table 4.4.1.3). Control plants of Montezuma-O-red produced an average of 2.4 alleles with the size ranged from 114-286 (bp) by Ivflmre88 and Ivflmre62. In case of mutants of same cultivar, number of alleles increased (4.4) with size ranged from 131-315 (bp) showed by Ivflmre62 and Ivflmre152. An average of 0.375 PIC was recorded in non- irradiated plants and 0.824 was noticed for irradiated genotypes. The percentage of heterozygotes varied from 93.7% to 100% in control and mutants shown in Table.4.4.1.4.

172

Table 4.4.1.1: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in V1 (Samur La pink)

Sr. No. Sequence (5’-3’) Control genotypes Irradiated genotypes

No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp) 1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 1 295-295 0 0.888 7 302-321 0 0.771 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 2 159-161 1 0.733 5 159-163 0.375 0.595 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 1 113-113 0 0.888 6 118-123 0 0.771

4 Ivflmre117 CATCCCACACACCAACACCT 1 156-156 0 0.911 4 156-184 0 0.794 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2 132-133 1 0.622 6 126-124 0.375 0.499 GAAACTGATTCGTGAGCCAA

Mean 1.4 113-295 0.4 0.748 5.6 118-321 0.15 0.686

173

Table 4.4.1.2: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in V2 (Heaven white)

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp) 1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2 293-294 0.375 1 3 298-325 0.844 0.955 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 2 160-161 0.375 1 4 158-168 0.844 0.955 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 1 114-114 0.000 0 3 114-125 0.844 0.955

4 Ivflmre117 CATCCCACACACCAACACCT 2 152-153 0.375 1 5 152-183 0.891 1.000 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2 131-133 0.375 1 4 130-138 0.771 0.888 GAAACTGATTCGTGAGCCAA

Mean 1.8 114-294 0.3 0.8 3.8 114-325 0.840 0.950

174

Table 4.4.1.3: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in V3 (Kabana lily)

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2 285-286 0.375 1 4 285-318 0.868 0.977 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3 159-161 0.375 1 5 158-165 0.819 0.933 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 2 113-114 0.375 1 7 113-127 0.819 0.933

4 Ivflmre117 CATCCCACACACCAACACCT 3 151-153 0.375 1 4 151-181 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2 133-134 0.375 1 4 131-136 0.794 0.911 GAAACTGATTCGTGAGCCAA

Mean 2.4 113-286 0.375 1 4.8 113-318 0.833 0.946

175

Table 4.4.1.4: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in Montezuma-O-Red

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2 285-286 0.375 1 4 285-315 0.868 0.977 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3 157-161 0.375 1 4 159-165 0.771 0.888 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 2 114-116 0.375 1 5 114-128 0.844 0.955

4 Ivflmre117 CATCCCACACACCAACACCT 2 152-153 0.375 1 4 152-181 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 3 132-133 0.375 1 5 131-135 0.771 0.888 GAAACTGATTCGTGAGCCAA

Mean 2.4 114-286 0.375 1 4.4 131-315 0.824 0.937

176

4.4.1.2: Phylogenetic analysis of Lilium cultivars included in Oriental group using SSR markers

Dendrogram was constructed on the basis of similarity coefficient matrix to study relationship and variation among control and mutants genotypes (Fig. 4.4.1.2).

Estimation of the genetic dissimilarity was done by using the [-ln(ps)] transformation of the proportion of the shared alleles (ps). For the purpose, PHYLIP software, version 3.6 was used to construct the dendrogram using un-weighed pair-group method with arithmetic means (UPGMA) algorithms. The scale bar represents 0.1 nucleotide substitutions per site.

It was observed that Samur La pink cultivar clustered in to two major groups. Control plants and irradiated plants at 2.0, 4.0 and 6.0 doses of gamma rays (Gy) were combined in one group while mutants treated with 8.0and 10.0 Gy were branched in separate group. In case of Heaven white, two major groups were showed. Control and mutants treated with 2.0 and 4.0 Gy were grouped in similar group and irradiated plants at 8.0 and 10.0 (Gy) were clustered in another group. One major clade was noticed in Kabana lily which further bifurcated in to two groups. One clade contained only mutants treated with 10.0 (Gy) of gamma rays which separated it from the other plants while the second group clustered into control and plants irradiated at 2.0, 4.0, 6.0 and 8.0 (Gy) doses of gamma rays. It is clearly evident from the Fig. 4.4.1.2 that Montezuma-O-red bifurcated into two branches. One branch included control plants and mutants at 2.0, 4.0, 6.0 and 10.0 (Gy) of gamma rays while other branch consisted of irradiated plants at 8.0 and 10.0 (Gy) doses of gamma irradiation.

177

Fig. 4.4.1.2: Dendrograms showing relationships among irradiated and non-irradiated genotypes of cultivars included in Oriental group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps)

SLP (Samur La pink), HW (Heaven white), KB (Kabana lily), MOR (Montezuma-O-red)

178

4.4.2: Oriental x Trumpet (OT) group of Lilium 4.4.2.1: Molecular characterization of mutants by using SSR markers

To observe the allelic diversity between all control and irradiated plants of each cultivar included in the Oriental x Trumpet group, total 10 EST-SSRs markers were screened, out of which 5 EST-SSRs were selected to find out the total number of alleles, allele size, PIC value and H obs (Table. 4.4.2.1).

Total 41 alleles were scored from 5 loci among the control and mutant plants of Star fighter-O-red/white. Out of total alleles, 12 alleles were showed in control genotypes while 29 alleles were recorded in case of irradiated genotypes. Number of alleles per locus also varied from 1 (Ivflmre152) to 4 (Ivflmre80) in non-irradiated genotypes along with allele size ranged from 113 (Ivflmre88) to 305 (Ivflmre62) and from 4 (Ivflmre88) to 7 (Ivflmre62) in irradiated genotypes along with allele size ranged from 113 (Ivflmre88) to 315 (Ivflmre62) as shown in Table 4.4.2.1. PIC values and observed heterozygosity were also calculated. It was noticed that PIC values of control plants ranged from minimum 0 (Ivflmre152) to maximum 0.375 ((Ivflmre62, Ivflmre 80, Ivflmre88 and Ivflmre117) for each marker while mutants plants showed variation in the PIC values for all primers i.e. from minimum 0.748 to maximum 0.891. Similarly the percentage of heterozygotes per marker detected among the control and variants of Star fighter-O-red/white also showed an observable difference ranged from 0.00% to 100% in the control plants and 86% to 100% in the mutant plants (Table 4.4.2.1).

It is clearly evident from the Table 4.4.2.2 that total number of 43 alleles was recorded from the 5 loci in Advantage La salmon cultivar of Oriental x Trumpet group. An average of 2.4 alleles was scored in case of control genotypes with allele size ranged from 116-308 bp by Ivflmre88 and Ivflmre62. While mutant plants showed an average of 6.2 alleles with different allele size ranged from 114 to 315 bp by Ivflmre88 to Ivflmre62. PIC values and observed heterozygosity were also measured for both control and mutant plants. Minimum PIC value was calculated i.e. 0.000 by Ivflmre62 and Ivflmre152 to maximum value of 0.375 (Ivflmre80, Ivflmre88 and Ivflmre117) in non-irradiated genotypes. PIC values of mutant genotypes ranged from 0.844 (Ivflmre152) to 0.891 (Ivflmre88). Observed heterozygosity also showed difference in both control and mutant plants i.e. 22.5% of heterozygotes per marker were detected in control and 97.7% were observed in mutant plants of Star fighter cultivar.

179

Data about allelic diversity was also observed for irradiated and control genotypes of Golden tycon yellow (Table 4.4.2.3). It was noticed that variation was observed among control and mutants. An average of 2.0 alleles was recorded in control genotypes by 5 different loci with the size ranged between 114-302 bp (Ivflmre88-Ivflmre62). Maximum alleles were produced by Ivflmre80 i.e. 3. In response to irradiated genotypes, an average of 5.2 alleles was observed with highest number of alleles (7) by Ivflmre117. The size of alleles also showed difference from the control cultivar (114-318) bp by Ivflmre88 and Ivflmre62.

The PIC values and observed heterozygosity also showed difference in irradiated and non- irradiated plants i.e. an average of 0.300 PIC value was recorded for control and 0.853 was recorded for mutant ones. Similarly non-irradiated plants showed 80% of heterozygotes by each primer while radiated plants showed 76.4% of observed heterozygosity detected by each primer (Table 4.4.2.3). Control plants of Orange pixie produced an average of 2.2 alleles with the size ranged from 121-306 (bp) by Ivflmre88 and Ivflmre62. In case of mutants of same cultivar, number of alleles increased (5.8) with size ranged from 115-315 (bp) showed by Ivflmre88 and Ivflmre62. An average of 0.375 PIC was recorded in non- irradiated plants and 0.863 was noticed for irradiated genotypes. The percentage of heterozygotes varied from 100% to 86.3% in control and mutants shown in Table.4.4.2.4.

180

Table 4.4.2.1: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in V5 (Star fighter-O-red/white)

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 3.0 303-305 0.375 1.00 7 307-315 0.819 0.933 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 4.0 149-153 0.375 1.00 6 145-165 0.891 1.000 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 2.0 113-115 0.375 1.00 4 113-127 0.748 0.866

4 Ivflmre117 CATCCCACACACCAACACCT 2.0 158-159 0.375 1.00 6 159-181 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 1.0 125-125 0 0.00 6 125-136 0.844 0.955 GAAACTGATTCGTGAGCCAA

Mean 2.4 113-305 0.300 0.80 5.8 113-315 0.819 0.946

181

Table 4.4.2.2: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in (V6) Advantage La salmon

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 1.0 308-308 0.000 0.0 4.0 305-315 0.868 0.977 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3.0 146-148 0.375 1.0 4.0 142-166 0.868 0.977 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 3.0 116-118 0.375 1.0 8.0 114-131 0.891 1.000

4 Ivflmre117 CATCCCACACACCAACACCT 4.0 154-157 0.375 1.0 8.0 154-183 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 1.0 123-123 0.000 0.0 7.0 123-136 0.844 0.955 GAAACTGATTCGTGAGCCAA

Mean 2.4 116-308 0.225 0.6 6.2 114-315 0.867 0.977

182

Table 4.4.2.3: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in Golden tycon yellow (V7)

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2 301-302 0.375 1.0 4.0 305-318 0.819 0.933 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3 142-146 0.375 1.0 6.0 142-165 0.891 1 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 1 114-114 0 0.0 4.0 114-130 0.823 0.933

4 Ivflmre117 CATCCCACACACCAACACCT 2 148-150 0.375 1.0 7.0 148-185 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2 123-125 0.375 1.0 5.0 123-139 0.868 0.977 GAAACTGATTCGTGAGCCAA

Mean 2 114-302 0.300 0.8 5.2 114-318 0.853 0.764

183

Table 4.4.2.4: Primer sequences, number of alleles, allele size, PIC values and Observed heterozygosity detected by 05 microsatellites in (V8) Orange pixie

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2.0 305-306 0.375 1 6 294-315 0.891 1.000 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3.0 148-151 0.375 1 6 139-166 0.844 0.955 R:GTCATGGAACCGGCGTAG 3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 2.0 121-123 0.375 1 5 115-131 0.844 0.955

4 Ivflmre117 CATCCCACACACCAACACCT 2.0 170-171 0.375 1 8 165-200 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2.0 124-125 0.375 1 4 121-138 0.868 0.977 GAAACTGATTCGTGAGCCAA

Mean 2.2 121-306 0.375 1 5.8 115-315 0.863 0.972

184

4.4.2.2: Phylogenetic analysis of Lilium cultivars included in Oriental x Trumpet group using SSR markers

Dendrogram was constructed on the basis of similarity coefficient matrix to study relationship and variation among control and mutants genotypes (Fig. 4.4.2.2).

It was observed that Star fighter-O-red/white cultivar clustered in to two major groups. Control plants were separated in one clade and irradiated plants at 2.0, 4.0, 6.0, 8.0 and 10.0 doses of gamma rays (Gy) were combined in another group. In case of Advantage La salmon, two major groups were showed. Control and mutants treated with 2.0, 4.0, 6.0 and 8.0 Gy were grouped in similar group and irradiated plants at 10.0 (Gy) were clustered in another group. Two major groups were noticed in Golden tycon yellow, control and mutants irradiated at 2.0 and 4.0 (Gy) were clustered in one group while mutants treated with 6.0, 8.0 and 10.0 (Gy) were combined in second group. It is clearly evident from the Fig. 4.4.2.2 that a dendrogram showing relationship among control and mutants of Orange pixie placed them into two major clades. First clade separated mutant treated at 10.0 (Gy) from the remaining treatments. The second clade contains one group that separated mutants of 8.0 (Gy) from rest of the group members and further branched off to give mutants treated at 4.0 and 6.0 (Gy). The branch contained mutants treated at 4.0 (Gy) were further divided to give control plants and plants irradiated at 2.0 (Gy).

185

Fig. 4.4.2.2: Dendrograms showing relationships among irradiated and non-irradiated genotypes of cultivars included in Oriental x Trumpet group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps)

SF (Star fighter), ALS (Advantage La salmon), GTY (Golden tycon yellow), OP (Orange pixie)

186

4.4.3: Longiflorum x Oriental (LO) group of Lilium 4.4.3.1: Molecular characterization of mutants by using SSR markers

Out of Total 10 EST-SSRs markers, 5 EST-SSRs were selected to find out the total number of alleles, allele size, PIC value and H obs among control and mutants of courier La white of Longiflorum x Oriental group described in (Table. 4.4.3.1).

Total 35 alleles were scored from 5 loci among the control and mutant plants of Courier La white. Out of total alleles, 10 alleles were showed in control genotypes while 25 alleles were recorded in case of irradiated genotypes. Number of alleles per locus also varied from 1 (Ivflmre88) to 3 (Ivflmre80) in non-irradiated genotypes along with allele size ranged from 115 (Ivflmre88) to 301 (Ivflmre62) and from 4 (Ivflmre62 and Ivflmre152) to 7 (Ivflmre117) in irradiated genotypes along with allele size ranged from 115 (Ivflmre88) to 318 (Ivflmre62) as shown in Table 4.4.3.1. PIC values and observed heterozygosity were also calculated. It was noticed that PIC values of control plants varied from 0.000 to 0.375 while mutant plants showed variation in the PIC values i.e. from minimum 0.797 to maximum 0.891. Similarly the percentage of heterozygotes per marker detected among the control and variants of Courier La white also showed an observable difference ranged from 0% to 100% in the control plants and from 91.1%-100% in irradiated plants (Table 4.4.3.1).

187

4.4.3.1: Primer sequences, number of alleles, allele size, PIC values and H obs detected by 05 microsatellites in V9 Courier La white

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2 298-301 0.375 1.0 4 298-318 0.868 0.977 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3 141-144 0.375 1.0 6 141-169 0.891 1.000 R:GTCATGGAACCGGCGTAG

3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 1 115-115 0.000 0.0 4 115-131 0.797 0.911

4 Ivflmre117 CATCCCACACACCAACACCT 2 161-163 0.375 1.0 7 161-184 0.868 0.977 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2 124-125 0.375 1.0 4 124-138 0.819 0.933 GAAACTGATTCGTGAGCCAA

Mean 2 115-301 0.300 0.8 5 115-318 0.848 0.959

188

4.4.3.2: Phylogenetic analysis of Lilium cultivar included in Longiflorum x Oriental group using SSR markers

Dendrogram was constructed on the basis of similarity coefficient matrix to study relationship and variation among control and mutants genotypes (Fig. 4.4.3.2).

It was observed that Control plants and mutants treated at 2.0, 4.0 and 6.0 (Gy) of gamma rays were combined in one group (Fig. 4.4.3.2), while mutants irradiated at 8.0 and 10.0 (Gy) are separated in single group.

Fig. 4.4.3.2: Dendrogram showing relationships among irradiated and non-irradiated genotypes of Courier La white included in Longiflorum x Oriental group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps)

CLW (Courier La white)

189

4.4.4: Longiflorum (L) group of Lilium 4.4.4.1: Molecular characterization of mutants by using SSR markers

Out of Total 10 EST-SSRs markers, 5 EST-SSRs were selected to find out the total number of alleles, allele size, PIC value and H obs among control and mutants of Easter lily of Longiflorum group described in (Table. 4.4.4.1).

Total 38 alleles were scored from 5 loci among the control and mutant plants of Easter lily. Out of total alleles, 11 alleles were showed in control genotypes while 27 alleles were recorded in case of irradiated genotypes. Number of alleles per locus also varied from 2 (Ivflmre62, Ivflmre88, Ivflmre117 and Ivflmre152) to 3 (Ivflmre80) in non-irradiated genotypes along with allele size ranged from 114 (Ivflmre88) to 302 (Ivflmre62) and from 4 (Ivflmre62 and Ivflmre80) to 8 (Ivflmre117) in irradiated genotypes along with allele size ranged from 114 (Ivflmre88) to 318 (Ivflmre62) as shown in Table 4.4.4.1. PIC values and observed heterozygosity were also calculated. It was noticed that PIC values of control plants are same at all loci i.e. 0.375 while mutants plants showed variation in the PIC values for all primers i.e. from minimum 0.844 to maximum 0.891. Similarly the percentage of heterozygotes per marker detected among the control and variants of Easter lily also showed an observable difference ranged from 95.5% to 100% in the mutant plants and 100% in the all control plants (Table 4.4.4.1).

190

Table 4.4.4.1: Primer sequences, number of alleles, allele size, PIC values and H obs detected by 05 microsatellites in V10 Easter lily

Sr. Sequence (5’-3’) Control genotypes Irradiated genotypes No. No. of Allele PIC H obs No. of Allele size PIC H obs alleles size value alleles (bp) value (bp)

1 Ivflmre62 F:GGTAGGAGGTTCTTCGGT 2.0 301-302 0.375 1 4.0 302-318 0.891 1.000 R:GGCTGTTGTTGCCACTGT 2 Ivflmre80 F:CCCCTCTGAAAAGGCAAC 3.0 143-145 0.375 1 4.0 143-159 0.868 0.977 R:GTCATGGAACCGGCGTAG

3 Ivflmre88 CATCTCGCGGAGCCTAAGG GCTGTGGCGGCTGACTGTT 2.0 114-115 0.375 1 6.0 114-126 0.868 0.977

4 Ivflmre117 CATCCCACACACCAACACCT 2.0 169-170 0.375 1 8.0 169-184 0.844 0.955 TCCACGACCACCGACTAGC 5 Ivflmre152 CGTCTCCGGACACAGAATAT 2.0 124-125 0.375 1 5.0 124-138 0.868 0.977 GAAACTGATTCGTGAGCCAA

Mean 2.2 114-302 0.375 1 5.4 114-318 0.867 0.977

191

4.4.4.2: Phylogenetic analysis of Lilium cultivar included in Longiflorum group using SSR markers

Dendrogram was constructed on the basis of similarity coefficient matrix to study relationship and variation among control and mutants genotypes (Fig. 4.4.4.2).

It was observed that Control plants and mutants treated at 2.0, 4.0 and 6.0 (Gy) of gamma rays were combined in one group, while mutants irradiated at 8.0 and 10.0 (Gy) are separated in single group.

Fig. 4.4.4.2: Dendrogram showing relationships among irradiated and non-irradiated genotypes of Easter lily included in Longiflorum group of Lilium based on cluster analysis (UPGMA) of genetic dissimilarity estimated using the [-ln(ps)] transformation of the proportion of the shared alleles (ps)

ES (Easter lily)

192

DISCUSSION

Keeping in view the objectives of the present study; the following parameters are discussed in detail:

5.1: Micropropagation of different Lilium cultivars

5.2: Induced mutagenesis

5.3: Molecular characterization of Lilium cultivars by RAPD markers

5.4: Molecular characterization of Lilium cultivars by SSR markers

5.1: Micropropagation of different Lilium cultivars

Plant tissue culture technique is usually in vitro propagation of plants by inoculating plant part as explant on growth media containing a variety of essential nutrients required for proper growth of plants under sterilized conditions. This technique is generally used for development of large number of plants at commercial level. The different techniques used in plant tissue culture have many benefits as compared to conventional way of breeding. This technology has great applications related with other fields including genetic engineering at molecular level, productions of new verities with improved yield and quality which are further studied and examine by morphological and molecular markers (Razdan, 2003).

Due to several advantages of micropropagation usually in case of its multiplication property, this method has attained a great importance at commercial level (Debergh and Vanderschaeghe, 1987; Pierik, 1997). Basically micropropagation is used to get disease free material by using apical meristems, shoot tips for commercialization purpose (Ahloowalia and Prakash, 2004).

It is very essential to use optimized sterilization procedure for the entire explant to get successful results (Street, 1973). Sterilization is a process that leads to removal of all living microorganisms that are present in the environment during the work. To make the cultures free of pathogens, sterilization of explants before use is very necessary to eliminate surface contaminants (bacterial and fungal spores). But it should be carefully managed to do whole process without damaging the plant material so it was noticed by many scientists (Cornu and Michel, 1985; Duhem et al., 1987) that surface sterilization is the most efficient method to eradicate all contaminants with no damage to plants.

193

All excised scales were sterilized in the current study to make the material contamination free, because due to underground presence of the bulbs, their sterilization is difficult to make scales pathogen free. Surface sterilization was carried out by using 80% sodium hypochlorite (commercial bleach) and PPM i.e. 1.0 (mg/L) was poured in the inoculating medium. An average of 75% explants remained contamination free in order to get maximum plantlets of Lilium.

Plant preservative mixture commonly known as (PPM) is a biocide which cause blockage of main enzymes in the citric acid cycle that inhibits the growth of microorganisms. It was observed that use of PPM to 1.5 mL caused no delay in the growth of many plant species (Guri and Patel, 1998).

Gamborg et al. (1976) described that addition of plant hormones is very essential in the medium used for inoculation of plants to provide proper nutrients for healthy growth of plants. Culture medium comprise of macro and micronutrients, Fe-EDTA, vitamins and sugar as carbon source (Trigiano and Gray, 1999). The role of these nutrients is to enhance the growth of cultured plants.

In the present study, the effect of cytokinin and auxin was tested to optimize the best growth regulator for shoot formation of different varieties of Lilium. Different combinations and concentrations of cytokinins alone i.e. BAP (6-Benzyl amino purine), BAP + TDZ (Thidiazuron) and cytokinins along with auxins i.e. BAP + Kin (Kinetin) + IAA (Indole 3-acetic acid) were tested to obtain the best medium.

Phytohormones play an important role in describing the developmental pathway of plant cells. These hormones in various amounts are required to break dormancy and stimulate shoot formation because apical dormancy is usually controlled by these growth regulators (Madhulatha et al., 2004). Due to important role of both cytokinins and auxins in shoot and root formation, these are off great importance in plant tissue culture medium (Devoghalaere et al., 2012). Proper concentrations and combinations of these hormones are essential for the successful production of healthy plants (Dixon, 1994). Cytokinins including (BAP) benzyl aminopurine (BAP) and (Kin) kinetin are important due to their ability to break apical dormancy in the apical meristem and also due to their role in inducing the adventitious and axillary shoot formation in several plants (Jafari et al., 2013).

194

Hormones (Cytokinins) are usually described as specific plant chemical messengers which play importance role in the cell cycle regulation and major growth and developmental processes (Chaudhury et al., 1993). Root growth is inhibited by these growth regulators because they control the entry of actively dividing cells from the meristems. Higher amount of cytokinins in the medium enhance shoot formation while more quantity of auxins in the culture medium stimulate root formation. Due to their positive and effective action, these hormones are used in plant tissue culture medium (Kiba et al., 1999).

It was observed that mode of action of cytokinins is to enhance the cell division ratio due to manifestation of CycD3, which decodes a protein (D-type cyclin) lead to conversion of cell cycle from G1 to M (Tréhin et al., 1998).

In the present investigation BAP 4.0 (mg/L) verified to be most effective as compared to lower concentrations of BAP. Same data was also given by Gaspar et al. (1996) and Panda et al. (2007) that lower concentrations of BAP in the medium is less effective to produce shoots as compared to higher amounts of BAP which also resulted in the multiple shoots formation (George, 1993; Nasirujjaman et al., 2005). Highest frequency of shoot induction (78%) in Heaven white and maximum number of shoots/explant 2.5a±0.08 in Montezuma- O-Red with highest shoot length 5.2a±0.06 was recorded in Oriental group while in Star fighter-O-red/white included in Oriental x Trumpet cultivar, BAP 3.0 (mg/L) induced excellent effect showing 75% regeneration rate along with 2.5a±0.08 number of shoots and 5.0b±0.08 shoot length. Simulative effect of BAP 3.0 (mg/L) was also noticed in Longiflorum x Oriental cultivar. 65% frequency of shoot induction with 2.3a±0.09 shoots having shoot length of 5.0a±0.08 was observed. Easter lily plants included in Longiflorum group showed best results in BAP 3.0 & 4.0 (mg/L) i.e. 72% regeneration rate with 2.5a±0.08 shoots and 5.6a±0.07 cm shoot length.

Under natural conditions, these plant hormones are present endogenously in the plant tissues and organs of the plants which are used as explant for inoculation. When these explants are cultured under in vitro conditions, it becomes very difficult to synthesize the enough amount of these hormones required for proper growth and health of the plant (Buah et al., 2010). For proper growth in the tissue cultured conditions, it is very necessary to add these hormones to increase the plant cell division. Effect of amount of the cytokinin in the MS medium and plant variety along with type of explant showed variation in the growth of cultured plant material (Rahman, 2013). Data is present about the presence of aromatic

195

cytokinins which are cyclic in nature and consists of aromatic benzyl group at N6. These types are present very rarely and due to their large stability nature. Example of aromatic cytokinins is BAP.

BAP has noticeable effect in enhancing the axillary, adventitious growth and foliar development of shoot tips. Because BAP increases the multiplication rate by enhancing the cell division (Abeyaratne and Lathiff, 2002).

Effect of BAP on shoot regeneration of different varieties of Lilium was also described by many other researchers. Han et al. (2004) inoculated scales of Lilium bulbs on MS medium containing BAP to induce shoot formation. Results were achieved after six weeks showing highest frequency of plantlet formation that is 92.3 % in the MS medium containing 0.4– 8.9 μM BAP. MS medium containing BAP i.e. 2 µM was mainly successful in shoot formation from scales of Lilium. Takayama and Misawa (1982) observed the consequence of Naphthalene acetic acid, and Kin and other cytokinins on plant regeneration from scales of Lilium bulb and noticed that out of different hormones tested BAP showed stimulating effects on growth of plant including both shoot and root formation. The major role of BAP over other hormones in enhancing the multiplication rate was also described by many scientists on various plants (Farahani et al., 2008; Buah et al., 2010). Negative effect of BAP was also reported by El-Naggar et al. (2012) who noticed that BAP 2.0 (mg/L) increased the time period for shoot formation along with length of shoot. Contrary to above observation, successful results on in vitro propagation by using BAP were also observed by (Ali et al., 2010; NOOR-UN-NISA et al., 2013; Ilyas et al., 2014) in Stevia rebaudiana, Gladiolus and Peperomia obtusifolia.

Dhed’a et al. (1991) stated that combination of BAP with IAA or IBA was the most effective one for in vitro multiplication of different plants (Resmi and Nair, 2007).

Auxins including (IAA and IBA) are also added in the tissue culture medium are the most important and central part of the medium. Auxins control major processes of cell division and cell elongation at the cellular levels and are capable of starting cell division which lead to development of callus or defined organs like roots or may be shoot when combined with BAP (Aloni et al., 2006). IAA expresses itself in the culture medium by oxidizing which cause rapid metabolization with in plant tissues. When IAA is added in the medium with cytokinins, positive results were obtained because callus formation occurred which result in

196

the shoot formation as well (Baker, 2000). Major role of IAA has been described to induce the rooting of plantlets. Contrary to cytokinin, higher amounts of auxins produced larger number of roots as compared to shoots (Stickens and Verbelen, 1996). Auxin-binding proteins have been reported which are screened and analyzed by various techniques used in genetics (Napier et al., 2002; Zazimalova and Napier, 2003). Observations were also recorded which showed that less amounts of auxins caused root initiation while higher amounts lead to growth of the roots

In the present study, addition of Kin and IAA along with BAP induced pronounced effect in case of shoot formation in all Lilium cultivars. BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) gave 86% frequency of shoot induction with 3.8a±0.10 number of shoots and 5.5a±0.07 cm shoot length in Lilium cultivars included in Oriental group while 89% regeneration rate with 4.0a±0.07 shoots and 5.3a±0.06 cm shoot length was recorded in case of plants present in Oriental x Trumpet cultivars of Lilium. Courier La white of Longiflorum x Oriental cultivar showed maximum frequency (82%) and highest shoots 3.2a±0.06 in the same concentration. Similarly this medium at the same concentration proved to be the better one in inducing shoot formation in Easter lily plants of Longiflorum cultivar. Similar results were also observed by other scientists. Skoric et al. (2014) reported the most efficient medium for multiplication i.e. BAP (0.2 mg/L) and IAA (0.25 to 2 mg/L). Saifullah et al. (2010) described that best medium i.e. BAP 2.0 (mg/L) + IAA 1.0 (mg/L) for producing maximum shoots with larger shoot length.

Hutchinson et al. (2000) described the strength of Thidiazuron (TDZ) as a plant hormone as compared to both cytokinin and auxin. TDZ is recognized as synthetic hormone but its role in tissue culture proves it to be same as natural hormone (BAP) for shoot formation. It is very important and effective plant growth regulator used for in vitro plant regeneration and successful growth of plants (Murthy et al., 1998). Many biological and physiological processes in the cells are stimulated by TDZ induction but no report has been found about its mode of action. But the data about effect of TDZ on morphogenic growth has been reported and it was observed that TDZ may modify other plant hormones present endogenously in the cells and tissues which are important for its division (Guo et al., 2013).

In the current study, addition of TDZ was done to describe combine effect of both BAP and TDZ on shoot formation in different Lilium cultivars. BAP 3.0 (mg/L) and TDZ 2.0 (µM)

197

induced positive effect in the shoot initiation rate (78%) with larger number of shoots i.e. 3.1a±0.06 in Samur La pink of Oriental group. Plants included in Oriental x Trumpet cultivars showed 85% of shoot induction with 2.5a±0.08 shoots and 6.0a±0.04 cm shoot length at BAP 2.0-3.0 (mg/L) and TDZ 2.0 (µM). Courier La white of Longiflorum x Oriental cultivar gave 70% regeneration rate with maximum shoots 3.1a±0.06 at BAP 2.0 (mg/L) + TDZ 2.0 (µM) while Easter lily produced 3.0a±0.11 shoots with highest frequency of shoot induction in BAP 2.0-3.0 (mg/L) + TDZ 2.0 (µM).

Promotive effect of BAP was also described by Khosravi et al. (2007) which is similar to results of present study. They proved that BAP 0.25 (mg/L) with various concentrations of TDZ was the best for micropropagation of Lilium longiflorum. Lojic et al. (2015) studied the synergistic effect of both BAP and TDZ to check the regenerative potential of Oriental lily cultivars.

Similarly synergestic effect of both BAP + TDZ was also studied on many other plants by (Naz et al., 2011) in Turmeric, (Sajid and Aftab, 2014) in Solanum tuberosum and Stevia rebaudiana by (Ghauri et al., 2013).

Micropropagation practice has many benefits but also have certain disadvantages which have minimize the use of this technology in market mainly higher cost of this technology. Now the scientists are attentive to search for enhancing the production efficacy by decreasing the total cost (Anderson et al., 1977).

For obtaining the successful results, the use of shaking cultures was made. These cultures contain only liquid media or may be semi solid media (Weathers and Giles, 1988). The effective use of liquid medium in the shaking cultures was also described by other workers to minimize the cost of Lilium production at commercial level (Chu et al., 1993). Basically use of liquid medium has not been commonly used for micropropagation but due to advantage of using the liquid culture medium in reducing the cost production, this method has become very important to increase the efficiency of the system with less input. The principle of this method describes the close contact between the growing parts and the medium which ease the availability of important nutrients to plant and stimulate plant growth including shoot and root formation (Ziv, 1989; Sandal et al., 2001). Due to continuous motion of the medium and explant, activity of apical dominance reduces very much which stimulate growth of many axillary buds. In shaking cultures, sufficient amount

198

of oxygen is available to the tissues which increased the growth rate and lead to higher multiplication rate as well and one advantage of using this technique is due to its simple and easy handling.

To keep in view the objective of using shaking cultures, the current study also reveals the effect of stationary and shaking cultures on the regeneration potential of different Lilium cultivars. Regeneration ratio increased from stationary cultures (88, 81, 75 and 86) % to shaking cultures (88, 83, 78 and 90) % in Oriental group members. Similarly shaking cultures of Oriental x Trumpet cultivars also showed positive results as compared to stationary ones. Highest frequency of 92 % was recorded in plants of this group. In case of Courier La white of Longiflorum x Oriental cultivar, regeneration ratio increased from 82 to 85 % in the shake cultures. Frequency of shoot induction increased from 88 to 91 % in Easter lily plants.

Some scientists also published the promotive effect of shaking cultures over stationary cultures in different crops e.g. Sajid and Pervaiz (2008) compared the effect of both culture in sugar cane propagation. Results of their experiment described that shaking liquid media exhibited better culture growth as compared to stationary media. Mechanism of continuous shaking involves the regular supply of oxygen to the tissues which increased the growth rate rapidly as compared to stationary cultures (Mehrotra et al., 2007).

Sucrose is the main organic compound used in the tissue culture medium. It is commonly used as a source of carbon. Its function is to affect the secondary metabolism of the cultures described by (Fowler and Stepan-Sarkissian, 1985) which ultimately increase the function of persistent leaves (Merillon et al., 1984).

In the present investigation, the concentration of sucrose was optimized on in vitro bulblet formation. It was noticed that increase in the sucrose amount is directly proportional to the increase in bulblet formation. Concentration 60 (g/L) was shown to be the best one in the formation of maximum number of bulblets in all Lilium cultivars. 90 % frequency of bulblet formation was obtained in plants of Oriental group. Plants included in Oriental x Trumpet cultivars showed highest bulblet formation frequency of 96 % in MS medium with 60 % sucrose amount. In case of Courier La white and Easter lily, 88 and 86 % of bulblet formation was recorded.

199

Similar results were also noted by Jala (2012) in Turmeric, Kumar et al. (2005) in Lilium and Kumar et al. (2011) in Gladiolus. Results indicated that 45 (g/L) and 60 (g/L) glucose showed significant increase. Contrary to present study, some observations were also found by researchers who stated that sucrose lower concentration 20 (g/L) proved to be better as compared to higher concentrations (Nathiya et al., 2013). Nhut et al. (2002) also reported the results about the role of sucrose on bulblet and plant regeneration. However, there are no reports to date on the effect of sucrose in L. ledebourii. Azadi and Kosh Kui (2007) reported that 60 g/L sucrose produced maximum bulblets as compared to 30 and 90 g/L. It was described by Aslam et al. (2013) that 60 g/L sucrose amount gave 100% bulblet formation. Many reports have confirmed the stimulatory effect of sucrose on formation of storage organs like tubers (Abbott and Belcher, 1986), bulbs (Dantu and Bhojwani, 1987) and microtubers (Garner and Blake, 1989). In the genus Lilium, sucrose concentration is very essential in the formation of bulblets and this factor has become very crucial to the respective genus (Li et al., 2014). It is widely accepted that sucrose as endogenous or exogenous factor, influences the storage organ formation, both in vivo and in vitro, in different modes namely as signal molecules, as carbon source for storage carbohydrates biosynthesis, and as osmolarity factor. Among numerous ornamental genotypes reviewed, the elevated source level to 6%, and in some cases to 8% induced in vitro storage organ formation in the species from the following genera: Lilium, Gladiolus, Amaryllis (Sultana et al., 2011).

In the current investigation, it was noticed that roots in Lilium were initiated with shoot formation and there is no need to add separate rooting media and same observations were recorded in case of root length. Best media noted for the purpose was BAP + Kin + IAA. In the current investigation best rooting media noted was MS + BAP 0.1 + Kin 0.1 + IAA 0.3 (mg/L). This medium was also excellent for shoot initiation frequency.

Similar results were also observed by many other researchers (Nadgauda et al., 1978; Prathanturarug et al., 2005; Nayak and Naik, 2006; Goyal et al., 2010; Jala, 2012). Some findings are also present which are contrary to our results for rooting. NAA 1.0 (mg/L) was considered as best medium for root initiation by Saifullah et al. (2010). Ali et al. (2009) proved the best rooting medium i.e. IBA at 1.5 (mg/L) concentration in their study. Khawar et al. (2005) obtained rooting using various concentrations of BAP-IBA.

200

It was observed by many studies that successful output of using micropropagation techniques depends on the survival of plants under field conditions. Because during the shifting of plants from the tissue cultured conditions to field conditions, the delicate in vitro grown plantlets are unable to survive due to harsh environmental conditions and presence of microbes in the soil. Also, in vitro culture conditions produced the plantlets with change in their morphological, anatomical and physiological features. So to overcome all these factors, there is need to control all environmental changes to get successful hardening of plants by reducing the mortality in plantlets (Chandra et al., 2010; Deb and Imchen, 2010).

The hardening response in different media was also reported by many scientists for different plants (Salvi et al., 2002; Prathanturarug et al., 2005) they observed that Sand, soil, clay and vermicompost in different mixture and ratio were used to harden the in vitro regenerated plants.

In the present experiment different combinations of soil, compost and leaf manure (Soil + Sand, Soil + Vermicompost, Soil + Cocopeat, Soil + Leaf manure, Sand + Soil + Vermicompost, Sand + Soil + Cocopeat and Sand + Soil + Leaf manure) were used to optimize the best medium for hardening. Out of these, maximum survival percentage was noted in Sand + Soil + Cocopeat (1:1:1) ratio in all Lilium cultivars.

For proper growth of Lilium in the field conditions, it is very essential that soils contains medium should be proper aerated, having good water holding ability along with well drainage and physical characteristics (Treder, 2008). From the previous studies, it is clearly evident that cocopeat (Coir dust/mesocarp) has been used in horticulture as the best growing medium (Yau and Murphy, 1998). It has good physical characteristics including high water content and more pore space (Evans et al., 1996). Cocopeat used for hardening of gerbera (Van Labeke and Dambre, 1993) and many other ornamental plants (De Kreij and Van Leeuwen, 2001; Treder and Nowak, 2002). Cocopeat is used as a fertilizer due to high level of mineral ions.

5.2: Induced mutagenesis

Plant regeneration is essential and prerequisite for crop improvement. The use of in vitro mutagenesis technique has increased the availability of genetic variants to the plant breeders. In the present investigation, superior mutant selection was done on the basis of change in flower morphology of M1V5 generation.

201

The use of physical and chemical mutagens in mutation induction practice play an important role for production of novel variety which have great application in ornamental plant This technology can be easily applied to both ex vitro and in vitro systems for generating the mutants having improved characters such as in plant shape, leaf and flower morphology without causing lethal effect on human health (Krishna et al., 2016). Mutation induction is a vast alternative technique in different plant breeding programme for causing changes at DNA level and lead to production of variants with improved genetic traits. Novel screening ways combined with variation resulted due to mutagenesis in many populations and characteristics which are not easily identified by conventional breeding approaches are now being easily detect and characterized by using different molecular techniques (Sikora et al., 2012).

Induced mutagenesis has become an essential step in the improvement of different plant crops and is now very effective in practical use due to the development and combination of many other important selection systems like in vitro propagation including micropropagation and some other in vitro culture methods along with use of molecular markers and practices in enhancing the important crop breeding functions (Roychowdhury and Tah, 2011). Through induced mutation, a large number of plant varieties have been developed with improved traits such as high yield, early maturity, as well as high protein content, biotic and abiotic resistance. Also in ornamental plants improved characters include compact growth, attractive variegated leaves and novel flower colour and shapes (Ahmad et al., 2012).

Among these plants, Lilium is a vegetatively propagated bulbous plant and from sowing to flowering procedure take one year for the process to complete. Fewer studies have been

202

carried out to describe the important agronomic features at genetic level in the genus Lilium (Younis et al., 2014). It becomes very necessary to enhance the breeding efficiency by reducing the breeding cycle. Mutation breeding provides very accurate and cheap method to analyze the mutants. This practice will produce the desired genotypes which are difficult to obtain through natural variation (Joseph et al., 2004).

First of all, this method has been applied in Drosophila melanogaster and barley to induce mutation by introducing gamma irradiation (Müller, 1927; Stadler, 1928). Now, this technology has been vastly utilized to improve many cultivars of different crops (cereals, fruits and other crops). Gamma rays generally effect the growth of plants both in positive and negative way. It is described in some reports that exposure of the plants to higher dose of gamma rays will inhibit the growth of plants while exposure to lower dose will stimulate the growth of the plan (Thapa, 2004; Kumari et al., 2009). Gamma rays are types of electromagnetic radiation which are most energetic than others (Kovacs and Keresztes, 2002). These rays are ionizing and produce free radicals in cells when come in contact with different atoms and molecules. These generated radicals can affect the main components within plant cells in different aspects depends on the dose of irradiation at morphological, anatomical and physiological level. Mutations induced by treating with different rays of radiation and also through insertion of different chemical mutagens have been widely utilized to improve the yield and quality of many important crops as well ornamental plants (Mangaiyarkarasi et al., 2014).

In the present research work bulbs (in vivo mutagenesis) and in vitro regenerated shoots (in vitro mutagenesis) of the plant were treated with different doses of gamma irradiation (2.0, 4.0, 6.0, 8.0 and 10.0 Gy). (Xi et al., 2012) successfully induced the mutation in Lilium through gamma irradiation by using bulbs as explant.

It is concluded from different studies that growth and germination in different plants are not occurring constantly through time. Development of plant includes different processes which lead to formation and maturation as the growth proceeds. Any alternation in the growth will eventually affect the maturity and yield of the plant (Zaka et al., 2002).

In present study, different results regarding days to germination, germination rate and survival percentage of germinated plants were obtained in all Lilium cultivars. It was noticed that plants growth was strongly influenced by different doses of gamma rays. In

203

some plants increase in doses lead to increase the plant survival percentage as well germination rate while in others higher doses decreased the germination rate. Only Samur La pink of Oriental group showed increase in germination rate at higher dose (10.0 Gy) of gamma rays and 95 % plants survived at this dose while in all other cultivars of Lilium, decrease in germination rate was observed at 10.0 Gy. Similar to our results, reduction in germination rate and survival percentage of treated explants was also reviewed by (Ilyas and Naz, 2014).

It was observed that lower doses of gamma irradiation stimulate plant growth and development by enhancing cell division (Luckey, 1980). But the mode of action is generally unknown. Effect of dose of gamma irradiation on causing variation in morphological and functional features depend on duration and concentration of dose. Different doses which affect the plants showed increase or decrease in germination and other growth pattern. It is evident from the studies that low gamma irradiation dose will stimulate growth by increasing the antioxidant capacity of cells (Wi et al., 2005).

Effects of different doses of gamma rays on the length, number and width of leaves of different Lilium cultivars was also studied in the current experiment. Results clearly represents that except for the Samur La pink, all other cultivars showed decrease in the number of leaves, leaf length and width. Maximum number of leaves (80a±1.46) were obtained at 10.0 (Gy) in the latter one with the highest leaf length (9.5a±0.01) cm and leaf width of 2.5a±0.08 cm. To confirm the effect of gamma rays on plant growth, many experiments have been conducted by different researchers. It was noticed that gamma irradiation was very effective in stimulating the growth and yield depends on the concentration of dose. Usually lower doses promote while higher inhibit germination rate (Khan and Goyal, 2009).

Preuss and Britt (2003) described the mechanism of growth reduction by high gamma irradiation dose due to stop in the activity of the cell cycle at G2 phase of cell divison or may be due to changes in the DNA. Morphological changes resulted after treatment with gamma rays depends on the doses of gamma rays. Mostly auxin activity is inhibited by the radiation.

In the present study, plant height of irradiated plants was strongly influenced by different doses of gamma rays. Maximum heights were observed in control plants but treated plants

204

of Samur La pink showed highest plant height at 10.0 Gy dose. Inhibitory effect of gamma rays on the growth including seed maturity, height of plants and flower development was reported by Haruki et al. (1998). It was also noticed that different doses of gamma irradiation delayed the growth and lead to reduction in height of some crops. Contrary to above statement, stimulatory effects were also recorded which showed increase in number of fruits per plant as well as length of the fruit by (Cobos et al., 2009).

In the present research work, in vitro regenerated shoots were treated with different doses of gamma rays and were used as explant inoculated in MS medium fortified with different concentrations and combinations of BAP 0.1 + Kin 0.1 + IAA 3.0 (mg/L) as optimized. Mostly lower doses of gamma rays promoted multiplication while in some cultivars high dose also increased multiplication rate. Xi et al., (2012) established a regimented procedure of in vitro mutagenesis for Lilium longiflorum. Stanilova et al. (1994) described different ways for plant formation, and morphogenetic potential of the Lilium by using in vitro techniques. MS medium containing BAP 1mg/L and Kinetin 1mg/L and LS medium containing NAA 0.5 mg/L and Kinetin 0.1 mg/ were positive for organ formation directly by using these plant parts. A invigorating effect of a low dose of gamma rays i.e. 5 Grey growth strength and quantity of the bulblets produced by the different plant parts under controlled plant tissue culture conditions was observed.

In the current investigation, effect of gamma irradiation on various morphological traits such as plant height, number, length and width of leaves of M1V4 generation of Lilium

205

cultivars derived from in vitro mutagenesis was also observed. Maximum plant height of 96a±0.05 cm was observed in Samur La pink at 10.0 Gy with 9.9a±0.04 cm leaf length and 3.1a±0.06 cm leaf width while all other cultivars showed decrease in all parameters with increasing the dose of gamma rays. Contrary to above results, Heaven white produced larger number of roots (13±1.26) at 10.0 Gy while Montezuma-O-red gave root length of 10a±0.04 cm at 10.0 dose.

Datta (2009) used mutagenic agents, such as radiation and certain chemicals for the induction of mutation and creates variations at genetic level from which preferred variants having desired traits might be chosen.

Superior mutant selection was done on the basis of change in flower morphology of M1V5 generation; it was observed that mutants at 10.0 Gy showed change in flower morphology in aspect of colour, size and shape. Larger flower of light pink having smooth petals in Samur La pink cultivar and mutants with flowers darker in colour were produced in Montezuma-O-red at this dose as well . Mutants of Golden tycon yellow also showed change in aspect of petals pattern (variegated petals) at 6.0 dose as compared to non- variegated petals of control plants of this cultivar. Similarly Easter lily mutants also produced flowers larger in size as compared to control ones at 6.0 Gy.

5.3: Molecular characterization of Lilium cultivars by RAPD markers

The use of molecular markers becomes an effective method for the characterization and identification of different important plant species and cultivars (Pounders et al., 2007; Wang et al., 2009). Therefore, these markers are useful in the breeding programme which meant to produce new cultivar containing improved traits and characters (Heffner et al., 2009). Plant genetic diversity was also screened by using various molecular methods to

206

improve taxonomical features or also to establish improved cultivarss (Gismondi and Canini, 2013; Gismondi et al., 2014) by using various techniques.

Arzate-Fernandez et al., (2005) used different molecular markers such as (RFLP, cpDNA, RAPD, SSR and ISSR) which allowed the scientists to examine the plant diversity at genetic level among various species in the natural environment (Wolff and Morgan- Richards, 1998; Archak et al., 2003).

These molecular markers helps in the generation of phylogenetic and population genetic studies which have shown the accuracy and effectiveness of these practices. Cultivars traditional populations becomes helpful in providing the beneficial resource for plant breeding and genetic diversity preservation (Reddy et al., 2002). The investigation, assessment, and management of in situ and ex situ of plant diversity at genetic level in natural environment are imperious to promise the production of ecological system (Kölliker et al., 2003).

In the present study, RAPD markers proved their ability to detect the polymorphism among four different groups of Lilium including total ten cultivars. Polymorphism was calculated on the basis of difference among control and mutant plants of same cultivar. In Samur La pink, 64.38 polymorphism percentage was noted with an average of 5.18 bands in control and 7.72 bands in irradiated genotypes. Mutants of Heaven white, Kabana lily and Montezuma-O-red also showed larger number of bands as compared to control ones with 56.72, 60.50 and 64.38 percentage of polymorphism. Phylogenetic trees were also constructed to detect the relationship among control and mutants of same cultivar. Mutants and control plants of Samur La pink, Heaven white, Kabana lily and Montezuma-O-red were separated into two separate groups. Same work was also carried out by Wen and Hsiao (2001). They used RAPD marker system to characterize the genetic diversity of the genus Lilium. Estimation of genetic variation among the populations of the genus Lilium was also carried out by using the same technique (Ohsawa and Ide, 2008).

According to analysis, various DNA molecular markers have been widely used to detect the polymorphism in the DNA regions. For the purpose of evaluating clonal fidelity in in vitro regenerated plants, different DNA molecular markers commonly used by many researchers include (RFLPs), (RAPDS) and (AFLPs). From these, RAPD analysis is mostly well appropriate and best for plant breeding programme due to its properties

207

because it is very easy to perform, quick, consistent and cost effective (Williams et al., 1990). To detect the relationship between cultivars and species of same or different variety and also to examine the diversity at molecular level, RAPD markers are considered to be the best one and more suitable due to their reproducible properties and cost effectiveness properties (Lanying et al., 2008; Arya et al., 2010).

In the current study, genetic polymorphism among members of each cultivar included in Oriental x Trumpet group was also investigated. Highest polymorphism was observed among control and mutants of Orange pixie cultivar (65.78 %). The phylogenetic trees separated all the cultivars containing both irradiated and non-irradiated genotypes into two separate groups. Similar findings were also reported earlier (Hodgson, 1967; Saunt, 1990).

According to current study, 52.11 and 63.77 polymorphism ratio was found between the control and treated plants of Lilium cultivars. Dendrogram of both cultivars differentiated them into two major groups. Genetic analysis through the use of RAPD markers is very effective method in detecting the polymorphism percentage among irradiated and control genotypes of treated plants of gamma irradiation. Dhakshanamoorthy et al., (2011) described that the mutants produced by gamma radiation treatment are analyzed by different RAPD marker to detect the variants containing different morphological traits. RAPD are DNA markers which consist of fragments having 10 nucleotide bases. These Random DNA molecular markers are extensively used to select the clonal fidelity of produced bulblets of Asiatic group of Lilium which are regenerated by micropropagation (Varshney et al., 2001).

Genetic relationships were estimated by molecular characterization through RAPD analysis by 10 decamer random primers in Lilium Japonicum Thunb cultivars (Haruki et al., 1998). Varshney et al., (2001) used RAPD markers to screen the improved in vitro plantlets of (Asiatic hybrids) of Lilium which are produced through adventitious propagation way. Ikinci and Oberprieler (2010) analyzed distribution of genetic variation between populations of Lilium albanicum and Lilium chalcedonicum by means of (RAPD) amplified profiles. Analysis of plants collected from four different populations, containing 33 individuals was carried out. Eleven primers yielded 88 polymorphic bands. UPGMA clustering a indicated a clear separation between the populations of the two species and all the analyzed individuals clustered in three groups, one comprising L. chalcedonicum and the other two groups encompassing three populations of L. albanicum. The analysis of the

208

data carried out by using (AMOVA) represents that total variation of 33% is present between the species. The highest amount of genetic differentiation, 51% of the total variance, is found within the individual populations.

Data obtained from the amplified profiles and phylogenetic trees generated by RAPD markers in Lilium martugon described the variation within the same cultivar and also among different cultivars of same group (Persson et al., 1998).

Another study describing the role of (RAPD) markers was also carried out (Yamagishi et al., 2002). Two major cultivars of Asiatic lily were examined in the experiment (Montreux’ and ‘Connecticut King’). Results indicated the presence of 68 polymorphic bands from the total bands. It was observed that the efficacy of the experiment increased by increasing the length of the primer.

5.4: Molecular characterization of Lilium cultivars by SSR markers

Simple sequence repeats are often tandem repeat motifs of 1-6 bp in length which are frequently present in the genome of all prokaryotes and eukaryotes analyzed by Zane et al., (2002). These markers (ISSR) are actually DNA sequences comprised of same units of two inverted SSR whose amplification is accomplished by using single PCR primer. To avoid general hybridization and slippage in the microsatellite region, the primer is comprised by few SSR units with an affixed end (Weising et al., 2005). Molecular characterization through these markers provides allelic difference with multi locus profiles. Results obtained through SSR analysis are very effective, highly reproducible (Bornet and Branchard, 2004). The main usefulness of this practice is due to its universality easily

209

development and less cost issues as compared to other markers (Agostini et al., 2008; Jabbarzadeh et al; 2013; Weising et al., 2005).

To make the availability about the concept of variations and differentiations to the breeders, it is very much necessary to understand the diversity of whole population (Jabbarzadeh et al., 2013). Moreover, effective uses of methods which are very accurate in characterization of that diversity as well in identification are required. Some methods which are linked with important molecular techniques, allows the breeders to use the more efficient one in plant propagation practice (Jain et al., 1999; Cobos et al., 2009). ISSRs are used as important markers for genotype identification and also for analysis of genetic variability even in individuals which showed great relationship among them (González et al., 2005; Hundsdoerfer et al., 2005).

The method of utilizing the SSRs have been used for characterization of the assortment and structure of two Lilium species (L. philadelphicum and L. japonicum Thunb) (Horning et al., 2003) latter one is the extinct species of Japan which also have very beautiful cut flowers (Kawase et al., 2010).

In the current investigation, one of the PCR based system (SSR) has been used to study the genetic variation through molecular characterization between the control and mutants of ten different cultivars of Lilium included in four major groups. Fu et al. (2006) reported that SSR marker system is one of the best molecular marker methods due to higher consistency; high polymorphism level. Due to these features SSR markers becomes the markers of choice (Fu et al., 2006).

Results of current research work revealed that Samur La pink of Oriental group generated total 35 alleles out of which 7 alleles were recorded in control plants. PIC values and observed heterozygosities also showed variation among control and mutant ones. Similarly all other members of this group also showed clear differentiation in the total number of bands, PIC value and percentage of heterozygotes among control and radiated plants of same cultivar. Dendrogram were constructed which showed the separation of control and mutants into two groups indicating relationship among them in all cultivars of Oriental group.

ISSR markers have another advantage in lily: there are no strict requirements for the quality of extracted DNA, which is particularly important for lilies because of their high

210

polysaccharide content in all nutritive organs as compared with other plants. Therefore, ISSR genotyping is a suitable method for studying the genetic diversity of lilies and for the first time were used for the molecular identification of lily cultivars (Lee et al., 2011).

In the current investigation genetic polymorphism among control and mutants of Oriental x Trumpet group was also carried out through SSR markers. Results clearly described variation in the number of bands, PIC value and observed heterozygosities among non- irradiated and irradiated plants. Same observations were also noted in remaining two group; Longiflorum x Oriental (Courier La white) and Longiflorum group (Easter lily). Phylogenetic trees were also constructed to observe the relationship among control and mutant plants which showed bifurcation of mutants and control of each cultivar into two defined groups.

Sakazono et al., (2013) developed 10 SSR markers to identify the genetic changes in Longiflorum cultivar. After screening of total 61 loci, only ten were selected as the best to characterize the two populations of Longiflorum cultivar on the base of genetic variation. Number of alleles produced by each loci varied i.e. an average of 3.2 were produced out of total 10.3 alleles per locus with Hobs values ranged from 0.245 to 0.73.

Yamagishi et al., (2002) used ISSR markers to analyze the lily genome and found total 52 percent polymorphism between the two cultivars.

Genetic characterization through ISSR markers was also done on many plants by different researchers. Rocha et al. (2008) in potato, Grativol et al. (2011) in Jatropha curcas, Wang et al., (2009) in spring orchid, Taheri et al. (2014) in curcuma. To date, there have been very few reports using ISSRs to differentiate varieties of lily hybrid (Xi et al., 2012; Yuan et al., 2013). Conclusion

The present study was carried out in four different phases during the whole experiment; the first phase described the use of plant tissue culture techniques to get the better plantlets

211

which were further used as explants in the second phase of experiment (In vitro mutagenesis). Experiments have also shown that in vitro propagation of plants through micropropagation has become one of the best practice to produce plants at commercial level. For crop improvement, plant breeding requires variations of important traits at genetic level. Mutation induction has become a proven way of creating variation within a crop variety. In vitro mutagenesis is an important technique which improves the yield and quality of plants by changing one or more specific traits of cultivar. The third phase involved the molecular characterization of mutants through RAPD markers to detect the genetic polymorphism among the control and mutant genotypes. SSR analysis was also carried out during the fourth phase of the experiment to find out the allelic difference, PIC value and Hobs of control and irradiated genotypes among all the 10 cultivars from 4 different groups which clearly showed variation among variants and control plants. It is concluded from the present study that in vitro techniques along with induced mutagenesis, use of RAPD and SSR markers proved to be very useful in screening the best mutants having better characteristics which is a novel creation in plant breeding programme.

Mass propagation of the best mutant variety through plant tissue culture and commercialization of the variety in the market are future recommendations of work.

212

REFERENCES

Abbott, A. and Belcher, A. 1986. Potato tuber formation in vitro. In: (Ed.)^Eds.). Plant Tissue Culture and its Agricultural Applications. Butterworths London, City. pp. 113-122. Abeyaratne, W. and Lathiff, M. 2002. In vitro propagation of Rathambala (Musa AAA) and the occurrence of phenotypic variations in the pseudostem. Annals of the Sri Lanka Department of Agriculture (LKA), 4: 191-197. Agostini, G., Echeverrigaray, S. and Souza-Chies, T. 2008. Genetic relationships among South American species of Cunila D. Royen ex L. based on ISSR. Plant systematics and evolution, 274 (3): 135-141. Ahloowalia, B. and Prakash, J. 2004. Incorporation of low cost options. Low cost options for tissue culture technology in developing countries: 83.

Ahmad, Z., Abu Hassan, A., Salleh, S., Ariffin, S., Shamsudin, S. and Basiran, M. 2012. Improvement of Malaysian Ornamental Plants through Induced Mutation. Pertanika Journal of Tropical Agricultural Science, 35 (3) 4-8. Ali, A., Ahmad, T., Abbasi, N. A. and Hafiz, I. A. 2009. Effect of different concentrations of auxins on in vitro rooting of olive cultivar ‘Moraiolo’. Pak J Bot, 41: 1223-1231. Ali, A., Gull, I., Naz, S. and Afghan, S. 2010. Biochemical investigation during different stages of in vitro propagation of Stevia rebaudiana. Pakistan Journal of Botany, 42 (4): 2827-2837. Aloni, R., Aloni, E., Langhans, M. and Ullrich, C. 2006. Role of cytokinin and auxin in shaping root architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Annals of botany, 97 (5): 883-893. Anderson, N. O., Younis, A. and Sun, Y. 2010. Intersimple sequence repeats distinguish genetic differences in Easter lily ‘Nellie White’clonal ramets within and among bulb growers over years. Journal of the American Society for Horticultural Science, 135 (5): 445-455. Anderson, W., Meagher, G. and Nelson, A. 1977. Cost of propagating broccoli plants through tissue culture. Hort Science. Archak, S., Gaikwad, A., Gautam, D., Rao, E. V., Swamy, K. R. and Karihaloo, J. 2003. Comparative assessment of DNA fingerprinting techniques (RAPD, ISSR and AFLP) for genetic analysis of cashew (Anacardium occidentale L.) accessions of India. Genome, 46 (3): 362-369. Arya, L., Verma, M., Sandhia, G., Singh, S. and Lakhanpaul, S. 2010. The Pattern of Genetic Variation as Revealed by RAPD and AFLP Markers in Pearl Millet. Encyclopedia Of Agricultural Sciences, 5: 204-209. Arzate‐fernández, A. M., Miwa, M., Shimada, T., Yonekura, T. and Ogawa, K. 2005. Genetic diversity of Miyamasukashi‐yuri (Lilium maculatum Thunb. var. bukosanense), an endemic and endangered species at Mount Buko, Saitama, Japan. Plant Species Biology, 20 (1): 57-65.

213

Ashraf, M. 2009. Biotechnological approach of improving plant salt tolerance using antioxidants as markers. Biotechnology advances, 27 (1): 84-93. Ashraf, M. and Foolad, M. 2005. Pre‐sowing seed treatmen. A shotgun approach to improve germination, plant growth, and crop yield under saline and non‐saline conditions. Advances in Agronomy, 88: 223-271. Aslam, F., Naz, S., Tariq, A., Ilyas, S. and Shahzadi, K. 2013. Rapid multiplication of ornamental bulbous plants of Lilium orientalis and Lilium longiflorum. Pak. J. Bot, 45 (6): 2051-2055. Azadi, P. and Khosh-Khui, M. 2007. Micropropagation of Lilium ledebourii (Baker) Boiss as affected by plant growth regulator, sucrose concentration, harvesting season and cold treatments. Electronic Journal of Biotechnology, 10 (4): 582-591. Bacchetta, L., Remotti, P. C., Bernardini, C. and Saccardo, F. 2003. Adventitious shoot regeneration from leaf explants and stem nodes of Lilium. Plant Cell, Tissue and Organ Culture, 74 (1): 37-44. Bahr, L. R. and Compton, M. E. 2004. Competence for in vitro bulblet regeneration among eight Lilium genotypes. HortScience, 39 (1): 127-129. Baker, D. 2000. Vascular transport of auxins and cytokinins in Ricinus. Plant growth regulation, 32 (2-3): 157-160. Barba-Gonzalez, R., Ramanna, M., Visser, R. G. and Van Tuyl, J. 2005. Intergenomic recombination in F1 lily hybrids (Lilium) and its significance for genetic variation in the BC1 progenies as revealed by GISH and FISH. Genome, 48 (5): 884-894. Beattie, D. and White, J. 1993. Lilium-hybrids and species. The Physiology of Flower Bulbs. A. De Hertogh and M. Le Nard (eds) Elsevier Science Publishers, Amsterdam, The Netherlands: 423-454. Bornet, B. and Branchard, M. 2004. Use of ISSR fingerprints to detect microsatellites and genetic diversity in several related Brassica taxa and Arabidopsis thaliana. Hereditas, 140 (3): 245-247. Bowcock, A., Ruiz-Linares, A., Tomfohrde, J., Minch, E., Kidd, J. and Cavalli-Sforza, L. L. 1994. High resolution of human evolutionary trees with polymorphic microsatellites. nature, 368 (6470): 455-457. Buah, J., Danso, E., Taah, K., Abole, E., Bediako, E., Asiedu, J. and Baidoo, R. 2010. The effects of different concentrations cytokinins on the in vitro multiplication of plantain (Musa sp.). Biotechnology, 9 (3): 343-347. Chandler, S. and Tanaka, Y. 2007. Genetic modification in floriculture. Critical reviews in plant sciences, 26 (4): 169-197. Chandra, S., Bandopadhyay, R., Kumar, V. and Chandra, R. 2010. Acclimatization of tissue cultured plantlets: from laboratory to land. Biotechnology letters, 32 (9): 1199-1205. Chang, C., Chen, C. T., Tsai, Y. C. and Chang, W. C. 2000. A tissue culture protocol for propagation of a rare plant, Lilium speciosum Thunb. var. gloriosoides Baker. Botanical Bulletin of Academia Sinica, 41: 72-82. Chaudhury, A. M., Letham, S., Craig, S. and Dennis, E. S. 1993. amp1‐a mutant with high cytokinin levels and altered embryonic pattern, faster vegetative growth, constitutive photomorphogenesis and precocious flowering. The Plant Journal, 4 (6): 907-916.

214

Chen, W., Shui, Y. and Yu, Z. 2003. and its geographic implication of SE Yunnan Province. Bull. Bot. Res.(China), 23 (3): 267-268. Chow, A., Chau, A. and Heinz, K. M. 2008. Compatibility of Orius insidiosus (Hemiptera: Anthocoridae) with Amblyseius (Iphiseius) degenerans (Acari: Phytoseiidae) for control of Frankliniella occidentalis (Thysanoptera: Thripidae) on greenhouse roses. Biological Control, 44 (2): 259-270. Chu, C., Knight, S. and Smith, M. 1993. Effect of liquid culture on the growth and development of miniature rose (Rosa chinensis Jacq.‘Minima’). Plant cell, tissue and organ culture, 32 (3): 329-334. Cobos, M., Winter, P., Kharrat, M., Cubero, J., Gil, J., Millan, T. and Rubio, J. 2009. Genetic analysis of agronomic traits in a wide cross of chickpea. Field crops research, 111 (1): 130-136. Cornu, D. and Michel, M. 1985. Bacteria contaminants in shoot cultures of Prunus avium L. choice and phytotoxicity of antibiotics. In: (Ed.)^Eds.), Symposium on In Vitro Problems Related to Mass Propagation of Horticultural Plants 212. pp. 83-86. Dantu, P. K. and Bhojwani, S. S. 1987. In vitro Propagation and Corm Formation in Gladiolus/In vitro-Vermehrung und Knollenbildung bei Gladiolus. Gartenbauwissenschaft, 4: 90-93. Datta, S., Misra, P. and Mandal, A. 2005. In vitro mutagenesis a quick method for establishment of solid mutant in chrysanthemum. Curr Sci, 88 (1): 155-158. Datta, S. K. 2009. Role of classical mutagenesis for development of new ornamental varieties. Induced Plant Mutations in the Genomics Era. QY Shu (ed). Food and Agriculture Organization of the United Nations, Rome: 300-302. De Jong, P. 1974. Some notes on the evolution of lilies. Lily yearbook. De Kreij, C. and Van Leeuwen, G. 2001. Growth of pot plants in treated coir dust as compared to peat. Communications in soil science and plant analysis, 32 (13-14): 2255- 2265. Deb, C. and Imchen, T. 2010. An efficient in vitro hardening technique of tissue culture raised plants. Biotechnology, 9 (1): 79-83. Debergh, P. and Vanderschaeghe, A. 1987. Some symptoms indicating the presence of bacterial contaminants in plant tissue cultures. Bacterial and Bacteria-like Contaminants of Plant Tissue Cultures 225: 77-82. Devoghalaere, F., Doucen, T., Guitton, B., Keeling, J., Payne, W., Ling, T. J., Ross, J. J., Hallett, I. C., Gunaseelan, K. and Dayatilake, G. 2012. A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control. BMC plant biology, 12 (1): 7-10. Dhakshanamoorthy, D., Selvaraj, R. and Chidambaram, A. 2011. Induced mutagenesis in Jatropha curcas L. using gamma rays and detection of DNA polymorphism through RAPD marker. Comptes rendus biologies, 334 (1): 24-30. Dhed'a, D., Dumortier, F., Panis, B., Vuylsteke, D. and De Langhe, E. 1991. Plant regeneration in cell suspension cultures of the cooking banana cv. Bluggoe (Musa spp. ABB group). Fruits, 46 (2): 125-135. Dhyani, A. and Sims, D. 2007. Exploring Lilium polyphyllum in Uttarakhand, India. The Lily Yearbook of North American Lily Society, 60: 79-82.

215

Diaz, A., Fergany, M., Formisano, G., Ziarsolo, P., Blanca, J., Fei, Z., Staub, J. E., Zalapa, J. E., Cuevas, H. E. and Dace, G. 2011. A consensus linkage map for molecular markers and quantitative trait loci associated with economically important traits in melon (Cucumis melo L.). BMC plant biology, 11 (1): 1. Dixon, R. A.1994. Plant cell culture: a practical approach. In: (Ed.)Êds.). Oxford University Press, City. pp. Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull, 19: 11-15. Duhem, K., Le Mercier, N. and Boxus, P. 1987. Difficulties in the establishment of axenic in vitro cultures of field collected coffee and cacao germplasm. Bacterial and Bacteria-like Contaminants of Plant Tissue Cultures 225: 67-76. Eisenreichová, E., Haladová, M., Mučaji, P. and Grančai, D. 2004. The study of constituents of Lilium candidum L. Acta Facult Pharm Univ Comenianae, 51: 27-37. El-Naggar, H., Osman, A. and Sewedan, E. 2012. In vitro propagation and organogenesis of Lilium'Prato'. African Journal of Biotechnology, 11 (82): 14771. Evans, M. R., Konduru, S. and Stamps, R. H. 1996. Source variation in physical and chemical properties of coconut coir dust. HortScience, 31 (6): 965-967. Farahani, F., Aminpoor, H., Sheidai, M., Noormohammadi, Z. and Mazinani, M. 2008. An improved system for in vitro propagation of banana (Musa acuminate L.) cultivars. Asian Journal of Plant Sciences, 42: 890-912 Felsenstein, J. 2006. Phylogeny inference package. In: (Ed.)Êds.). Version 3.69. pp. Fowler, M. and Stepan-Sarkissian, G. 1985. Carbohydrate source, biomass productivity and natural product yield in cell suspension cultures. In: (Ed.)Êds.). Primary and Secondary Metabolism of Plant Cell Cultures. Springer, City. pp. 66-73. Francis, J. A., Rumbeiha, W. and Nair, M. G. 2004. Constituents in Easter lily flowers with medicinal activity. Life sciences, 76 (6): 671-683. Fu, Y. B., Peterson, G. W., Yu, J. K., Gao, L., Jia, J. and Richards, K. W. 2006. Impact of plant breeding on genetic diversity of the Canadian hard red spring wheat germplasm as revealed by EST-derived SSR markers. Theoretical and Applied Genetics, 112 (7): 1239- 1247. Gamborg, O., Murashige, T., Thorpe, T. and Vasil, I. 1976. Plant tissue culture media. In Vitro Cellular and Developmental Biology-Plant, 12 (7): 473-478. Garner, N. and Blake, J. 1989. The induction and development of potato microtubers in vitro on media free of growth regulating substances. Annals of Botany, 63 (6): 663-674. Gaspar, T., Kevers, C., Penel, C., Greppin, H., Reid, D. M. and Thorpe, T. A. 1996. Plant hormones and plant growth regulators in plant tissue culture. In Vitro Cellular & Developmental Biology-Plant, 32 (4): 272-289. George, E.1993. Plant propagation by tissue culture. Part 1: the technology. In: (Ed.)Êds.). Springer, City. pp. Ghauri, E., Afridi, M. S., Marwat, G., Rahman, I. and Akram, M. 2013. Micro-propagation of Stevia rebaudiana Bertoni through root explants. Pak J Bot, 45: 1411-1416.

216

Gismondi, A. and Canini, A. 2013. Microsatellite analysis of Latial Olea europaea L. cultivars. Plant Biosystems-An International Journal Dealing with all Aspects of Plant Biology, 147 (3): 686-691. Gismondi, A., Impei, S., Di Marco, G., Crespan, M., Leonardi, D., Canini, A. and Jenkins, G. 2014. Detection of new genetic profiles and allelic variants in improperly classified grapevine accessions. Genome, 57 (2): 111-118. González, A., Wong, A., Delgado-Salinas, A., Papa, R. and Gepts, P. 2005. Assessment of inter simple sequence repeat markers to differentiate sympatric wild and domesticated populations of common bean. Crop Science, 45 (2): 606-615. Goyal, A., Ganguly, K., Mishra, T. and Sen, A. 2010. In vitro multiplication of Curcuma longa Linn. an important medicinal zingiber. NBU Journal of Plant Science, 4: 21-24. Grassotti, A. and Gimelli, F. 2010. Bulb and cut flower production in the genus Lilium: current status and the future. In: (Ed.)Êds.), II International Symposium on the Genus Lilium 900. pp. 21-35. Grativol, C., da Fonseca Lira-Medeiros, C., Hemerly, A. S. and Ferreira, P. C. G. 2011. High efficiency and reliability of inter-simple sequence repeats (ISSR) markers for evaluation of genetic diversity in Brazilian cultivated Jatropha curcas L. accessions. Molecular biology reports, 38 (7): 4245-4256. Guo, B., Abbasi, B. H., Zeb, A., Xu, L. and Wei, Y. 2013. Thidiazuron: a multi- dimensional plant growth regulator. African Journal of Biotechnology, 10 (45): 8984-9000. Gupta, P., Varshney, R. K., Sharma, P. and Ramesh, B. 1999. Molecular markers and their applications in wheat breeding. Plant breeding, 118 (5): 369-390. Guri, A. Z. and Patel, K. N. 1998. Compositions and methods to prevent microbial contamination of plant tissue culture media. In: (Ed.)Êds.). Google Patents. pp. Han, B. H., Yae, B. W., Yu, H. J. and Peak, K. Y. 2005. Improvement of in vitro micropropagation of Lilium oriental hybrid ‘Casablanca’by the formation of shoots with abnormally swollen basal plates. Scientia horticulturae, 103 (3): 351-359. Han, B. H., Yu, H. J., Yae, B. W. and Peak, K. Y. 2004. In vitro micropropagation of Lilium longiflorum ‘Georgia’by shoot formation as influenced by addition of liquid medium. Scientia horticulturae, 103 (1): 39-49. Haruki, K., Hosoki, T. and Nako, Y. 1998. RAPD analysis of Lilium japonicum Thunb. native to Shimane and other prefectures [Japan]. Journal of the Japanese Society for Horticultural Science (Japan). Heffner, E. L., Sorrells, M. E. and Jannink, J. L. 2009. Genomic selection for crop improvement. Crop Science, 49 (1): 1-12. Hodgson, R. W.1967. Horticultural varieties of citrus. In: (Ed.)Êds.). Division of Agricultural Sciences, University of California, Press, City. pp. 591. Horning, M. E., Maloney, S. C. and Webster, M. S. 2003. Isolation and characterization of variable microsatellite loci in Lilium philadelphicum (Liliaceae). Molecular Ecology Notes, 3 (3): 412-413. Huang, Y. f., Yang, M. x., Zhang, H., Zhuang, X. y., Wu, X. h. and Xie, W. 2009. Genetic diversity and genetic structure analysis of the natural populations of Lilium brownii from Guangdong, China. Biochemical genetics, 47 (7): 503-510.

217

Hundsdoerfer, A. K., Kitching, I. J. and Wink, M. 2005. The phylogeny of the Hyles euphorbiae complex (Lepidoptera: Sphingidae): molecular evidence from sequence data and ISSR-PCR fingerprints. Organisms Diversity & Evolution, 5 (3): 173-198. Hutchinson, M., Senaratna, T., Sahi, S. and Saxena, P. 2000. Light mediates endogenous plant growth substances in thidiazuron-induced somatic embryogenesis in geranium hypocotyl cultures. Journal of Plant Biochemistry and Biotechnology, 9 (1): 1-6. Ikinci, N. and Oberprieler, C. 2010. Genetic relationships among NE Turkish Lilium L.(Liliaceae) species based on a random amplified polymorphic DNA analysis. Plant systematics and evolution, 284 (1-2): 41-48. Ilyas, S. and Naz, S. 2014. Effect of gamma irradiation on morphological characteristics and isolation of curcuminoids and oleoresins of Curcuma longa L. JAPS, Journal of Animal and Plant Sciences, 24 (5): 1396-1404. Jabbarzadeh, Z., Khosh-Khui, M., Salehi, H. and Saberivand, A. 2013. Inter simple sequence repeat (ISSR) markers as reproducible and specific tools for genetic diversity analysis of rose species. African Journal of Biotechnology, 9 (37): 6091-6095. Jafari, N., Othman, R. Y. and Khalid, N. 2013. Effect of benzylaminopurine (BAP) pulsing on in vitro shoot multiplication of Musa acuminata (banana) cv. Berangan. African Journal of Biotechnology, 10 (13): 2446-2450. Jain, A., Apparanda, C. and Bhalla, P. L. 1999. Evaluation of genetic diversity and genome fingerprinting of Pandorea (Bignoniaceae) by RAPD and inter-SSR PCR. Genome, 42 (4): 714-719. Jala, A. 2012. Effects of NAA, BA and sucrose on shoot induction and rapid micropropagation by trimming shoot of Curcuma longa L. International Transaction Journal of Engineering, Management, Applied Sciences and Technologies, 3 (2): 101-109. Joseph, R., Yeoh, H. H. and Loh, C. S. 2004. Induced mutations in cassava using somatic embryos and the identification of mutant plants with altered starch yield and composition. Plant cell reports, 23 (1-2): 91-98. Joshi, S. K. and Dhar, U. 2009. In vitro propagation from axenic explants of Lilium oxypetalum (D. Don) Baker, an endemic bulbous plant of high altitude Himalaya. Acta physiologiae plantarum, 31 (4): 833-838. Jovtchev, G., Gateva, S. and Stankov, A. 2014. Lilium compounds kaempferol and jatropham can modulate cytotoxic and genotoxic effects of radiomimetic zeocin in plants and human lymphocytes In vitro. Environmental toxicology, 12: 24-31. Kanchanapoom, K., Ponpiboon, T., Wirakiat, W. and Kanchanapoom, K. 2011. Regeneration of lily (Lilium longiflorum ‘Easter lily’) by callus derived from leaf explants cultured in vitro. Sci. Asia, 37: 373-376. Kawase, D., Hayashi, K., Takeuchi, Y. and Yumoto, T. 2010. Population genetic structure of Lilium japonicum and serpentine plant L. japonicum var. abeanum by using developed microsatellite markers. Plant Biosystems, 144 (1): 29-37. Khan, S. and Goyal, S. 2009. Improvement of mungbean varieties through induced mutations. African Journal of Plant Science, 3 (8): 174-180. Khawar, K. M., Cocu, S., Parmaksiz, I., Sarihan, E. O. and Ozcan, S. 2005. Massproliferation of Madonna lily (Lilium candidum L.) under in vitro conditions. Pakistan Journal of Botany, 37 (2): 243.

218

Khosravi, S., Azghandi, A., Mojtahedi, N. and Haddad, R. 2007. In vitro propagation of Lilium longiflorum var. ceb-dazzle through direct somatic embryogenesis. Pakistan journal of biological sciences, 10 (15): 2517-2521. Kiba, T., Taniguchi, M., Imamura, A., Ueguchi, C., Mizuno, T. and Sugiyama, T. 1999. Differential expression of genes for response regulators in response to cytokinins and nitrate in Arabidopsis thaliana. Plant and Cell Physiology, 40 (7): 767-771. Kim, J. H., Baek, M. H., Chung, B. Y., Wi, S. G. and Kim, J. S. 2004. Alterations in the photosynthetic pigments and antioxidant machineries of red pepper (Capsicum annuum L.) seedlings from gamma-irradiated seeds. Journal of Plant Biology, 47 (4): 314-321. Ko, C. W., Yang, C. Y. and Wang, C. S. 2002. A desiccation-induced transcript in lily (Lilium longiflorum) pollen. Journal of plant physiology, 159 (7): 765-772. Kölliker, R., Herrmann, D., Boller, B. and Widmer, F. 2003. Swiss Mattenklee landraces, a distinct and diverse genetic resource of red clover (Trifolium pratense L.). Theoretical and Applied Genetics, 107 (2): 306-315. Kovacs, E. and Keresztes, A. 2002. Effect of gamma and UV-B/C radiation on plant cells. Micron, 33 (2): 199-210. Krishna, H., Alizadeh, M., Singh, D., Singh, U., Chauhan, N., Eftekhari, M. and Sadh, R. K. 2016. Somaclonal variations and their applications in horticultural crops improvement. Biotech, 6 (1): 1-18. Kumar, A., Palni, L. and Sood, A. 2011. Factors affecting in vitro formation of cormlets in Gladiolus hybridus Hort. and their field performance. Acta physiologiae plantarum, 33 (2): 509-515. Kumar, S., Awasthi, V. and Kanwar, J. 2007. Influence of growth regulators and nitrogenous compounds on in vitro bulblet formation and growth in oriental lily. Hort. Sci.(Prague), 34 (7783): 11-17. Kumar, S., Kashyap, M. and Sharma, D. 2005. In vitro regeneration and bulblet growth from lily bulbscale explants as affected by retardants, sucrose and irradiance. Biologia plantarum, 49 (4): 629-632. Kumari, R., Singh, S. and Agrawal, S. 2009. Effects of supplemental ultraviolet-B radiation on growth and physiology of Acorus calamus L.(sweet flag). Acta Biol. Cracoviensia, Ser. Bot, 51: 19-27. Lanying, Z., Yongqing, W. and Li, Z. 2008. Genetic diversity and relationship of Rhododendron species based on RAPD analysis. American-Eurasian J. Agric. & Environ. Sci, 3 (4): 626-631. Lee, S. I., Park, K. C., Song, Y. S., Son, J. H., Kwon, S. J., Na, J. K., Kim, J. H. and Kim, N. S. 2011. Development of expressed sequence tag derived-simple sequence repeats in the genus Lilium. Genes & Genomics, 33 (6): 727-733. Li, X., Wang, C., Cheng, J., Zhang, J., da Silva, J. A. T., Liu, X., Duan, X., Li, T. and Sun, H. 2014. Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. BMC plant biology, 14 (1): 1-5. Lian, M., Chakrabarty, D. and Paek, K. 2002. Growth and uptake of sucrose and mineral ions by bulblets of Lilium Oriental Hybrid ‘Casablanca’during bioreactor culture. The Journal of Horticultural Science and Biotechnology, 77 (3): 253-257.

219

LingFei, X., FengWang, M. and Dong, L. 2009. Plant regeneration from in vitro cultured leaves of Lanzhou lily (Lilium davidii var. unicolor). Scientia horticulturae, 119 (4): 458- 461. Lojić, M., Vinterhalter, B., Subotić, A. and Vinterhalter, D. 2015. Differences in regenerative capacity of Oriental lily (Lilium sp.) cultivars. Botanica Serbica, 39 (2): 67- 75. Luckey, T. D.1980. Hormesis with ionizing radiation. In: (Ed.)^Eds.). CRC press Boca Raton, FL, City. pp. Madhulatha, P., Anbalagan, M., Jayachandran, S. and Sakthivel, N. 2004. Influence of liquid pulse treatment with growth regulators on in vitro propagation of banana (Musa spp. AAA). Plant Cell, Tissue and Organ Culture, 76 (2): 189-192. Mangaiyarkarasi, R., Girija, M. and Gnanamurthy, S. 2014. Mutagenic effectiveness and efficiency of gamma rays and ethyl methane sulphonate in Catharanthus roseus. Int. J. Curr. Microbiol. App. Sci, 3 (5): 881-889. Matsumura, A., Nomizu, T., Furutani, N., Hayashi, K., Minamiyama, Y. and Hase, Y. 2010. Ray florets color and shape mutants induced by 12 C 5+ ion beam irradiation in chrysanthemum. Scientia horticulturae, 123 (4): 558-561. Mehrotra, S., Goel, M. K., Kukreja, A. K. and Mishra, B. N. 2007. Efficiency of liquid culture systems over conventional micropropagation: A progress towards commercialization. African Journal of Biotechnology, 6 (13): 124-132. Merillon, J., Rideau, M. and Chenieux, J. 1984. Influence of Sucrose on Levels of Ajmalicine, Serpentine, and Tryptamine in Catharanthus roseus Cells in vitro. Planta medica, 50 (6): 497-501. Miller, W. B., Hammer, P. A. and Kirk, T. I. 1993. Reversed Greenhouse Temperatures Alter Carbohydrate Status in Lilium longiflorum Thunb.Nellie White'. Journal of the American Society for Horticultural Science, 118 (6): 736-740. Mimaki, Y., Satou, T., Kuroda, M., Sashida, Y. and Hatakeyama, Y. 1999. Steroidal saponins from the bulbs of Lilium candidum. Phytochemistry, 51 (4): 567-573. Minch, E. 1997. MICROSAT, version 1.5 b. In: (Ed.)^Eds.). pp. Minch, E., Ruiz Linares, A., Goldstein, D., Feldman, M. and Cavalli-Sforza, L. 1997. MICROSAT, Version 1.5 b. Stanford University Medical Center, Stanford. Misra, P., Datta, S. and Chakrabarty, D. 2003. Mutation in flower colour and shape of Chrysanthemum morifolium induced by γ-radiation. Biologia Plantarum, 47 (1): 153-156. Moose, S. P. and Mumm, R. H. 2008. Molecular plant breeding as the foundation for 21st century crop improvement. Plant physiology, 147 (3): 969-977. Müller, A. 1927. An X-ray investigation of certain long-chain compounds. Proceedings of the Royal Society of London. Series A, Containing Papers of a Mathematical and Physical Character, 114 (768): 542-561. Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia plantarum, 15 (3): 473-497. Murthy, B., Murch, S. and Saxena, P. K. 1998. Thidiazuron: A potent regulator ofin vitro plant morphogenesis. In Vitro Cellular & Developmental Biology Plant, 34 (4): 267-275.

220

Nadgauda, R., Mascarenhas, A., Hendre, R. and Jagannathan, V. 1978. Rapid multiplication of turmeric (Curcuma longa Linn.) plants by tissue culture. Indian Journal of Experimental Biology, 3: 120-122. Napier, R. M., David, K. M. and Perrot-Rechenmann, C. 2002. A short history of auxin- binding proteins. In: (Ed.)^Eds.). Auxin Molecular Biology. Springer, City. pp. 339-348. Nasirujjaman, K., Uddin, M. S., Zaman, S. and Reza, M. 2005. Micropropagation of turmeric (Curcuma longa Linn.) through in vitro rhizome bud culture. Journal of Biological Sciences, 5 (4): 490-492. Nathiya, S., Pradeepa, D., Devasena, T. and Senthil, K. 2013. Studies on the effect of sucrose, light and hormones on micropropagation and in vitro flowering of withania somnifera var. jawahar-20. The Journal of Animal & Plant Sciences, 23 (5): 1391-1397. Nayak, S. and Naik, P. K. 2006. Factors affecting in vitro microrhizome formation and growth in Curcuma longa L. and improved field performance of micropropagated plants. Science Asia, 32: 31-37. Naz, S., Ilyas, S., Jabeen, S. and Parveen, Z. 2011. Composition and antibacterial activity of the essential oil from the rhizome of turmeric (Curcuma longa L.). Asian Journal of Chemistry, 23 (4): 1639. Naz, S., Zafrullah, A., Shahzadhi, K. and Munir, N. 2013. Assessment of genetic diversity within germplasm accessions in tomato using morphological and molecular markers. J. Anim. Plant Sci, 23: 1099-1106. Nesi, B., Trinchello, D., Lazzereschi, S., Grassotti, A. and Ruffoni, B. 2009. Production of lily symptomless virus-free plants by shoot meristem tip culture and in vitro thermotherapy. HortScience, 44 (1): 217-219. Nhut, D. T., Van Le, B., Minh, N. T., de Silva, J. T., Fukai, S., Tanaka, M. and Van, K. T. T. 2002. Somatic embryogenesis through pseudo-bulblet transverse thin cell layer of Lilium longiflorum. Plant growth regulation, 37 (2): 193-198. Nishikawa, T., Okazaki, K., Arakawa, K. and Nagamine, T. 2001. Phylogenetic Analysis of Section Sinomartagon in Genus Lilium Using Sequences of the Internal Transcribed Spacer Region in Nuclear Ribosomal DNA. Breeding science, 51 (1): 39-46. Nitsch, J. and Nitsch, C. 1969. Haploid plants from pollen grains. Science, 163 (3862): 85- 87. NOOR-UN-NISA, M., Qasim, M., Jaskani, M. J., Khooharo, A. A., Hussain, Z. and Ahmad, I. 2013. Comparison of various explants on the basis of efficient shoot regeneration in Gladiolus. Pak. J. Bot, 45 (3): 877-885. Ohsawa, T. and Ide, Y. 2008. Global patterns of genetic variation in plant species along vertical and horizontal gradients on mountains. Global Ecology and Biogeography, 17 (2): 152-163. Page, R. D. 1996. An application to display phylogenetic trees on personal computer. Computer Application in Biosciences, 12: 357-358. Panda, M. K., Mohanty, S., Subudhi, E., Acharya, L. and Nayak, S. 2007. Assessment of genetic stability of micropropagated plants of Curcuma longa L. by cytophotometry and RAPD analysis. International Journal of Integrative Biology, 1 (3): 189-195.

221

Park, S. 2001a. Microsatellite toolkit. Department of Genetics, Trinity College, Dublin, Ireland. Park, S. D. E. 2001b. Trypanotolerance in West African cattle and the population genetic effects of selection. Ph. D. thesis, University of Dublin. Pelkonen, V. P. and Kauppi, A. 1999. The effect of light and auxins on the regeneration of lily (Lilium regale Wil.) cells by somatic embryogenesis and organogenesis. International journal of plant sciences, 160 (3): 483-490. Persson, H. A., Lundquist, K. and Nybom, H. 1998. RAPD Analysis of Genetic Variation Within and Among Populations of Turk's‐Cap Lily (Lilium Martagon L.). Hereditas, 128 (3): 213-220. Pierik, R. L. M.1997. In vitro culture of higher plants. In: (Ed.)Êds.). Springer Science & Business Media, City. pp. Pieroni, A. 2000. Medicinal plants and food medicines in the folk traditions of the upper Lucca Province, Italy. Journal of Ethnopharmacology, 70 (3): 235-273. Pizano, M. 2003. International market trends-tropical flowers. In: (Ed.)Êds.), V International Symposium on New Floricultural Crops 683. pp. 79-86. Plants, I. M. and Khare, B. C. 2007. An illustrated dictionary. In: (Ed.)Êds.). P. pp. Podgorsak, E. 2005. Radiation Oncology Physics: A Handbook for Teachers and Students, IAEA, 20: 42-45. Pounders, C., Rinehart, T. and Sakhanokho, H. 2007. Evaluation of interspecific hybrids between Lagerstroemia indica and L. speciosa. HortScience, 42 (6): 1317-1322. Prathanturarug, S., Soonthornchareonnon, N., Chuakul, W., Phaidee, Y. and Saralamp, P. 2005. Rapid micropropagation of Curcuma longa using bud explants pre-cultured in thidiazuron-supplemented liquid medium. Plant cell, tissue and organ culture, 80 (3): 347- 351. Preuss, S. and Britt, A. 2003. A DNA-damage-induced cell cycle checkpoint in Arabidopsis. Genetics, 164 (1): 323-334. Priyadarshi, S. and Sen, S. 1992. A revised scheme for mass propagation of Easter Lily. Plant Cell, Tissue and Organ Culture, 30 (3): 193-197. Rahman, A. 2013. Auxin: a regulator of cold stress response. Physiologia plantarum, 147 (1): 28-35. Razdan, M. K.2003. Introduction to plant tissue culture. In: (Ed.)Êds.). Science Publishers, City. pp. Reddy, M. P., Sarla, N. and Siddiq, E. 2002. Inter simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica, 128 (1): 9-17. Resmi, L. and Nair, A. S. 2007. Plantlet production from the male inflorescence tips of Musa acuminata cultivars from South India. Plant Cell, Tissue and Organ Culture, 88 (3): 333-338. Rocha, O. J., Zaldivar, M. E., Castro, L., Castro, E. and Barrantes, R. 2008. Microsatellite variation of cassava (Manihot esculenta Crantz) in home gardens of Chibchan Amerindians from Costa Rica. Conservation Genetics, 9 (1): 107-118.

222

Roychowdhury, R. and Tah, J. 2011. Mutation breeding in Dianthus caryophyllus for economic traits. Electronic Journal of Plant Breeding, 2 (2): 282-286. Rubin, N., Huleihel, M. and Zaccai, M. 2015. Stress conditions during plant growth increase the anti-herpetic properties of Lilium candidum leaf extracts and fractions. Journal of Medicinal Plants Research, 9 (37): 954-961. Saifullah, K., Sheeba, N., Mariam, R., Naheed, K., Asma, N. and Bushra, S. 2010. Cultivation of lilies (Lilium regale) for commercialization in Pakistan. Pak. J. Bot, 42 (2): 1103-1113. Sajid, G. M. and Pervaiz, S. 2008. Bioreactor mediated growth, culture ventilation, stationary and shake culture effects on in vitro growth of sugarcane. Pak. J. Bot, 40 (5): 1949-1956. Sajid, Z. A. and Aftab, F. 2014. Plant regeneration from in vitro-selected salt tolerant callus cultures of Solanum tuberosum. Pakistan Journal of Botany, 46 (4): 1507-1514. Sakazono, S., Hiramatsu, M., Watanabe, M. and Okubo, H. 2013. Development and characterization of microsatellite markers for Lilium longiflorum (Liliaceae). Applications in plant sciences, 1 (9): 56-64. Salvi, N. D., George, L. and Eapen, S. 2002. Micropropagation and field evaluation of micropropagated plants of turmeric. Plant cell, tissue and organ culture, 68 (2): 143-151. Sandal, I., Bhattacharya, A. and Ahuja, P. S. 2001. An efficient liquid culture system for tea shoot proliferation. Plant cell, tissue and organ culture, 65 (1): 75-80. Saunt, J.1990. Citrus varieties of the world. An illustrated guide. In: (Ed.)Êds.). Florida Science Source Inc, City. pp. 128. Schreiner, M., Korn, M., Stenger, M., Holzgreve, L. and Altmann, M. 2013. Current understanding and use of quality characteristics of horticulture products. Scientia horticulturae, 163: 63-69. Sikora, P., Chawade, A., Larsson, M., Olsson, J. and Olsson, O. 2012. Mutagenesis as a tool in plant genetics, functional genomics, and breeding. International journal of plant genomics, 20: 90-102. Skorić, M., Ţivković, S., Savić, J., Šiler, B., Sabovljević, A., Todorović, S. and Grubišić, D. 2014. Efficient one-step tissue culture protocol for propagation of endemic plant, Lilium martagon var. cattaniae Vis. African Journal of Biotechnology, 11 (8): 1862-1867. Sneath, P. H. and Sokal, R. R.1973. Numerical taxonomy. The principles and practice of numerical classification. In: (Ed.)Êds.). San Fran cisco: WH Freeman, City. pp. 114-182. Stadler, L. 1928. Mutations in barley induced by X-rays and radium. Science, 68 (1756): 186-187. Stanilova, M. I., Ilcheva, V. P. and Zagorska, N. A. 1994. Morphogenetic potential and in vitro micropropagation of endangered plant species Leucojum aestivum L. and Lilium rhodopaeum Delip. Plant cell reports, 13 (8): 451-453. Stickens, D. and Verbelen, J. P. 1996. Spatial structure of mitochondria and ER denotes changes in cell physiology of cultured tobacco protoplasts. The Plant Journal, 9 (1): 85-92. Street, H. E.1973. Plant tissue and cell culture. In: (Ed.)Êds.). Univ of California Press, City. pp.

223

Sultana, J., Sutlana, N., Siddique, M., Islam, A., Hossain, M. and Hossain, T. 2011. In vitro bulb production in Hippeastrum (Hippeastrum hybridum). Journal of Central European Agriculture, 11 (4): 56-67. Taheri, S., Abdullah, T. L., Ahmad, Z. and Abdullah, N. A. P. 2014. Effect of acute gamma irradiation on Curcuma alismatifolia varieties and detection of DNA polymorphism through SSR Marker. BioMed research international, 2014: 1-18. Takayama, S. and Misawa, M. 1982. Regulation of organ formation by cytokinin and auxin in Lilium bulbscales grown in vitro. Plant and Cell Physiology, 23 (1): 67-74. Tang, N., Mo, G., van Tuyl, J. M., Arens, P., Liu, J. and Tang, D. 2014. Genetic diversity and structure of Lilium pumilum DC. in southeast of Qinghai–Tibet plateau. Plant systematics and evolution, 300 (6): 1453-1464. Tanimoto, S. and Matsubara, Y. 1995. Stimulating effect of spermine on bulblet formation in bulb-scale segments of Lilium longiflorum. Plant cell reports, 15 (3-4): 297-300. Thapa, C. 2004. Effect of acute exposure of gamma rays on seed germination and seedling growth of Pinus kesiya Gord and P. wallichiana AB Jacks. Our Nature, 2 (1): 13-17. Tóth, G., Gáspári, Z. and Jurka, J. 2000. Microsatellites in different eukaryotic genomes: survey and analysis. Genome research, 10 (7): 967-981. Treder, J. 2008. The effects of cocopeat and fertilization on the growth and flowering of oriental lily ‘star gazer’. Journal of Fruit and Ornamental Plant Research, 16: 361-370. Treder, J. and Nowak, J. 2002. Zastosowanie podlozy kokosowych w uprawie roslin rabatowych. Zeszyty Problemowe Postępów Nauk Rolniczych, 485: 351-358. Tréhin, C., Planchais, S., Glab, N., Perennes, C., Tregear, J. and Bergounioux, C. 1998. Cell cycle regulation by plant growth regulators: involvement of auxin and cytokinin in the re-entry of Petunia protoplasts into the cell cycle. Planta, 206 (2): 215-224. Trigiano, R. N. and Gray, D. J.1999. Plant tissue culture concepts and laboratory exercises. In: (Ed.)Êds.). CRC press, City. pp. Troja, E., King, A. R., O'Brien, P. T., Lyons, N. and Cusumano, G. 2008. Different progenitors of short hard gamma-ray bursts. Monthly Notices of the Royal Astronomical Society: Letters, 385 (1): 10-14. Van Labeke, M.-C. and Dambre, P. 1993. Gerbera cultivation on coir with recirculation of the nutrient solution: a comparison with rockwool culture. In: (Ed.)Êds.), International Symposium on Water Quality & Quantity-Greenhouse 458. pp. 357-362. Van Tuyl, J. M. and Lim, K. B. 2003. Interspecific hybridisation and polyploidisation as tools in ornamental plant breeding. In: (Ed.)Êds.), XXI International Eucarpia Symposium on Classical versus Molecular Breeding of Ornamentals-Part I 612. pp. 13-22. Varshney, A., Dhawan, V. and Srivastava, P. 2000. A protocol for in vitro mass propagation of Asiatic hybrids of lily through liquid stationary culture. In Vitro Cellular & Developmental Biology Plant, 36 (5): 383-391. Varshney, A., Lakshmikumaran, M., Srivastava, P. and Dhawan, V. 2001. Establishment of genetic fidelity of in vitro-raised Lilium bulblets through RAPD markers. In Vitro Cellular & Developmental Biology-Plant, 37 (2): 227-231.

224

Velmurugan, M., Rajamani, K., Paramaguru, P., Gnanam, R., Bapu, J., Kannan, H. C. and Hemalatha, P. 2010. In vitro mutation in horticultural crops, a review. Agric Rev, 31: 63- 67. plants: principles, methods, and applications. In: (Ed.)^Eds.). CRC press, City. pp. Wang, X., Rinehart, T. A., Wadl, P. A., Spiers, J. M., Hadziabdic, D., Windham, M. T. and Trigiano, R. N. 2009. A new electrophoresis technique to separate microsatellite alleles*. African Journal of Biotechnology, 8 (11) 1-4. Wawrosch, C., Malla, P. and Kopp, B. 2001. Clonal propagation of Lilium nepalense D. Don, a threatened medicinal plant of Nepal. Plant Cell Reports, 20 (4): 285-288. Weathers, P. J. and Giles, K. L. 1988. Regeneration of plants using nutrient mist culture. In vitro cellular & developmental biology, 24 (7): 727-732. Weising, K., Nybom, H., Pfenninger, M., Wolff, K. and Kahl, G. 2005. DNA fingerprinting in Wen, C. and Hsiao, J. 2001. Altitudinal genetic differentiation and diversity of Taiwan lily (Lilium longiflorum var. formosanum; Liliaceae) using RAPD markers and morphological characters. International journal of plant sciences, 162 (2): 287-295. Wi, S. G., Chung, B. Y., Kim, J. H., Baek, M. H., Yang, D. H., Lee, J. W. and Kim, J. S. 2005. Ultrastructural changes of cell organelles inArabidopsis stems after gamma irradation. Journal of Plant Biology, 48 (2): 195-200. Wi, S. G., Chung, B. Y., Kim, J. S., Kim, J. H., Baek, M. H., Lee, J. W. and Kim, Y. S. 2007. Effects of gamma irradiation on morphological changes and biological responses in plants. Micron, 38 (6): 553-564. Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A. and Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic acids research, 18 (22): 6531-6535. Wolff, K. and Morgan-Richards, M. 1998. PCR markers distinguish Plantago major subspecies. Theoretical and Applied Genetics, 96 (2): 282-286. Xi, M., Sun, L., Qiu, S., Liu, J., Xu, J. and Shi, J. 2012. In vitro mutagenesis and identification of mutants via ISSR in lily (Lilium longiflorum). Plant cell reports, 31 (6): 1043-1051. Xia, Z., Wan, J., Chen, Y., He, Y. and Yu, J. 2013. Experimental Oriental Hybrid Lilies (Lilium Hybrids) Poisoning in Cats. Journal of Clinical Toxicology, 3: 1-4. Yamagishi, M., Abe, H., Nakano, M. and Nakatsuka, A. 2002. PCR-based molecular markers in Asiatic hybrid lily. Scientia horticulturae, 96 (1): 225-234. Yau, P. and Murphy, R. 1998. Biodegraded cocopeat as a horticultural substrate. In: (Ed.)^Eds.), XXV International Horticultural Congress, Part 7: Quality of Horticultural Products 517. pp. 275-278. Yuan, S., Ge, L., Liu, C. and Ming, J. 2013. The development of EST-SSR markers in Lilium regale and their cross-amplification in related species. Euphytica, 189 (3): 393-419. Zaka, R., Vandecasteele, C. and Misset, M. 2002. Effects of low chronic doses of ionizing radiation on antioxidant enzymes and G6PDH activities in Stipa capillata (Poaceae). Journal of Experimental Botany, 53 (376): 1979-1987.

225

Zane, L., Bargelloni, L. and Patarnello, T. 2002. Strategies for microsatellite isolation: a review. Molecular ecology, 11 (1): 1-16. Zazimalova, E. and Napier, R. 2003. Points of regulation for auxin action. Plant cell reports, 21 (7): 625-634. Ziv, M. 1989. Enhanced shoot and cormlet proliferation in liquid cultured gladiolus buds by growth retardants. Plant cell, tissue and organ culture, 17 (2-3): 101-110. Zukauskiene, J., Paulauskas, A., Varkuleviciene, J., Marseliene, R. and Gliaudelyte, V. 2014. Genetic Diversity of Five Different Lily (Lilium L.) Species in Lithuania Revealed by ISSR Markers. American Journal of Plant Sciences, 5 (18): 2741.

xix

APPENDICES

Appendix I Formulation of MS medium (Stock Solutions)

Sr. No. Nutrients Constituents MS medium Stock (Actual) Concentration g/L g/L (20X) 1. Macronutrients

NH4NO3 16.50 33

KNO3 19.00 38

CaCl2. 2H2O 4.40 8.8

MgSO4. 7H2O 3.70 7.4

KH2PO4 1.70 3.4 2. Micronutrients g/L (100X)

MnSO4. 4H2O 0.0223 2.23

ZnSO4. 7H2O 0.0086 0.86

H3BO3 0.0062 0.62 KI 0.00083 0.083

Na2MoO4. 2H2O 0.00025 0.025

CuSO4. 5H2O 0.000025 0.0025

CoCl2. 6H2O 0.000025 0.0025 3. Iron EDTA g/L (200X)

Na2 EDTA 0.0278 5.56

FeSO4. 7H2O 0.0373 7.46 4. Vitamins g/L (100X) Nicotinic Acid 0.002 0.2 Pyridoxine HCl 0.0005 0.05 Thiamine HCl 0.0005 0.05 Glycine 0.0001 0.01

Appendix II Preparation of one liter MS medium from stock solutions

Sr. No. Nutrient Quantity

1. Macronutrient Stock solution 50 ml/L

2. Micronutrient Stock solution 10 ml/L

3. Vitamin Stock solution 10 ml/L

4. Fe-EDTA stock solution 5 ml/L

5. Sucrose 30 g/L

6. Myo-inositol 0.1 g/L

7. Phytagel 1.5 g/L if required

8. Plant hormone As per requirement

9. pH of medium 5.5-5.8

Appendix III Preparation of stock solutions of plant hormones

Plant Amount Solvent type Solvent volume Storage hormones (mg) (ml) auxins 10 Few drops of 10 4ºC 0.1N NaOH and then volume raised with distilled water Cytokinins 10 Few drops of 10 4ºC 0.1N HCl or NaOH and then volume raised with distilled water

xxi

Appendix IV 2X CTAB solution for DNA extraction

Sr. No. Chemicals Concentrations (Final) 1 Tris–HCl (pH 8.0) 100 mM

2 Na2-EDTA 20 mM 3 NaCl, 1.4 M 4 CTAB, 2 % (wv-1) 5 β-mercapto ethanol 2 % pH adjusted with HCl.

Appendix V 1X T.E buffer for DNA extraction

Sr. No. Chemicals Concentrations (Final) 1 Tris-HCl 10 mM

2 Na2-EDTA 0.5 mM pH adjusted to 8.0 with HCl.

Appendix VI 50X TAE buffer for DNA extraction

Sr. No. Chemicals Concentrations (Final) 1 Tris-HCl 1M 2 Acetic acid 57ml

3 Na2-EDTA 0.5M pH adjusted to 8.0 with HCl.

Appendix VII 6X Bromophenol Blue dye (Loading dye)

Sr. No. Chemicals Concentrations (Final) 1 Bromophenol Blue 0.25 % 2 Glycerine 30 %

xxii

xxiii

xxiv

List of Research Publications

1. Farah Aslam, Shagufta Naz, Amina Tariq, Saiqa Ilyas and Kiran Shehzadi. (2013). Rapid multiplication of ornamental bulbous plants of Lilium orientalis and Lilium longiflorum. Pak. J. Bot., 45(6): 2051-2055, 2013.

Submitted Publications

1. Farah Aslam and Shagufta Naz. (2015). Effect of Radiation on Morphological Characters of Different Cultivars of Lilium and Genetic Analysis of Mutants through Molecular Markers. JAPS 2. Farah Aslam and Shagufta Naz. (2016). A review article on in vitro propagation of Lilium by using plant tissue culture techniques submitted to Biotechnology advances.

xxv

Other publications

1. Shagufta Naz, Safia Jabeen, Saiqa Ilyas, Farkhanda Manzoor, Farah Aslam and Aamir Ali. (2010). Antibacterial activity of curcuma longa varieties against

different strains of bacteria. Pakistan Journal of Botany. 42(1): 455-462.

2. Shagufta Naz1, Fozia Tabassum, Sumera Javad, Saiqa Ilyas, Farah Aslam, Neelma munir and Aamir Ali. (2011). Micropropagation and callogenesis of a recalcitrant species ricinus communis pak. j. bot., 43(5): 2419-2422

3. Sana Rashid, Saiqa Ilyas, Shagufta Naz, Farah Aslam And Amir Ali. (2012). In vitro propagation of gypsophila paniculata l. through plant tissue culture techniques Pakistan Journal of Science. 64(1).

4. Shagufta Naz, Fozia Naz, Amina Tariq, Farah Aslam, Aamir Ali, and Mohammad Athar. (2012). Effect of different explants on in vitro propagation of gerbera (Gerbera jamesonii). African Journal of Biotechnology, 1 1(37): 9048-9053.

5. Sumera Javad, Shagufta Naz, Saiqa Ilyas, Aamir Ali, Farah Aslam and Neelma Munir. (2012).Study of the effect of physical state of medium and different concentrations of sucrose, ferric ethylenediamine- tetraacetic acid (FeEDTA) and CuSO4 in enhancing the micropropagation system of Stevia rebaudiana. Journal of medicinal plants research. 6(9) 1800-1805.

6. Shagufta Naz, Farah Aslam and Safia jabeen (2012). In vitro Propagation of Polianthes tuberosa, Journal of medicinal plants research

7. Farah Aslam, Sana Habib and Shagufta Naz. (2012). Effect of different phytohormones on plant regeneration of Amaryllis hippeastrum. Pakistan Journal of Science. 46(1)

8. Rukhama Haq, Shagufta Naz, Farah Aslam and Farkhanda Manzoor. (2013). comparison of in vitro response of micropropagation and callogenesis of medicinal plant, Vinca rosea . J. Agric. Res., 51(1)

9. Farah Aslam, Shagufta Naz, Amina Tariq, Saiqa ilyas and Kiran Shahzadi. (2013) Rapid multiplication of ornamental bulbous plants of Lilium orientalis and Lilium longiflorum Pak. J. Bot., 45(6): 2051-2055.

xxvi

10. Saiqa ilyas, Shagufta naz, Farah aslam, Zahida parveen and Aamir ali. (2014) chemical composition of essential oil from in vitro grown Peperomia obtusifolia through Gc-ms. Pak. J. Bot., 46(2): 667-672, 2014.

11. Sumera Javed, Shagufta Naz, Saiqa Ilyas, Amina Tariq and Farah Aslam.(2014). Optimization of the Microwave Assisted Extraction and Its Comparison with Different Conventional Extraction Methods for Isolation of Stevioside from Stevia rebaudiana. Asian Journal of Chemistry, 26(23): 8043-8048

12. Shagufta Naz, Rukhama Haq, Farah Aslam and Saiqa Ilyas .(2015). Evaluation of antimicrobial activity of extracts of in vivo and in vitro grown Vinca rosea L. (Catharanthus roseus) against pathogens. Pak. J. Pharm. Sci., 28(3): 849-853

xxvii

xxviii

xxix

xxx

xxxi

xxxii

xxxiii

xxxiv

xxxv

xxxvi