Quick viewing(Text Mode)

Insecta: Odonata)

Insecta: Odonata)

Molecular phylogenetics and taxonomic issues in dragonfly systematics (Insecta: )

Rasmus Hovm¨oller

Department of Zoology Stockholm University 2006 Molecular phylogenetics and taxonomic issues in dragonfly systematics (Insecta: Odonata) Doctoral dissertation 2006

Rasmus Hovm¨oller Department of Swedish Museum of Natural History PO Box 500 07 SE 104 05 Stockholm [email protected]

ISBN 91-7155-282-0 c 2006 Rasmus Hovm¨oller Typeset in Computer Modern with LATEX 2ε. Cover illustration by Andrea Klintbjer sanguineum (M¨uller, 1764)

Printed by US-AB, Stockholm List of papers

I: Hovm¨oller,, R., K¨allersj¨o,M. and Pape, T., 2004. The problem: basal pterygote phylogeny inferred from 18S and 28S rDNA sequences. Cladistics 18, 313–323. II: Hovm¨oller, R. and Johansson, F., 2004. A phylogenetic perspec- tive on larval spine evolution in (Odonata: ) based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phyloge- netics and Evolution 30, 653–662. III: Hovm¨oller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera, ) established from COII and 16S sequences. Manuscript. IV: Hovm¨oller, R. A catalog of group names in the Kirby, 1890 (Odonata: Coenagrionidae). Manuscript. V: Hovm¨oller, R. A proposal to conserve the name Leach, 1815 over Agrion Fabricius, 1775. Manuscript.

i ii Contents

1 and classification of the Odonata 1 1.1 Origin and monophyly of Odonata ...... 1 1.2 Classification and - a historical review ...... 1 1.2.1 Pioneers of dragonfly systematics ...... 2 1.2.2 Cladistic morphological studies ...... 3 1.2.3 Molecular studies ...... 4

2 Life history 7 2.1 Larval stage ...... 7 2.2 Emergence ...... 8 2.3 Imago ...... 8 2.4 system ...... 8 2.5 Mating rituals and species recognition ...... 9 2.6 Ovipositing ...... 10 2.7 Life on the ...... 11

3 Extant clades of Odonata 13 3.1 Zygoptera - damselflies ...... 13 3.1.1 ...... 13 3.1.2 “Lestinoidea” ...... 13 3.1.3 ...... 14 3.1.4 Hemiphleboidea ...... 14 3.2 : + “Anisozygoptera” ...... 14 3.2.1 The paraphyletic Anisozygoptera ...... 15 3.3 Anisoptera ...... 15 3.3.1 “” ...... 16 3.3.2 Cordulegastroidea ...... 16 3.3.3 ...... 17

4 Odonata – a key group in evolution 19 4.1 History of insect flight ...... 19 4.2 Paranota – a terrestrial origin? ...... 20 4.3 An aquatic origin? ...... 20 4.4 Palaeopterous and neopterous ...... 21 4.5 Folding wings – a key event in insect evolution ...... 21 4.6 Palaeoptera – monophyletic or not? ...... 21 4.6.1 The hypothesis ...... 21 4.6.2 The Opistoptera hypothesis ...... 22 4.6.3 A monophyletic Palaeoptera? ...... 22

5 Ribosomal sequences in phylogenetic systematics 25 5.1 Structure and function of the ribosome ...... 25 5.2 Establishing in molecular data ...... 26 5.3 Approaches to multiple sequence alignment ...... 26 5.3.1 Finding an optimal path ...... 26 5.4 Multiple sequence alignment ...... 27 5.4.1 Heuristic multiple alignment ...... 27 5.5 Optimization methods ...... 28

iii 5.5.1 Parsimony direct optimization – an example ...... 28 5.6 Secondary structure alignment ...... 29

6 A presentation of the articles 31

7 Sammanfattning p˚asvenska 37 7.1 Inledning ...... 37 7.2 Trollsl¨andors liv och naturhistoria ...... 37 7.2.1 Klassificering av trollsl¨andor – en historisk ¨oversikt . . . . 37 7.3 En trollsl¨andas livscykel ...... 39 7.3.1 Larvstadiet ...... 39 7.3.2 F¨orvandlingen ...... 39 7.3.3 Imagon – den fullbildade sl¨andan ...... 39 7.3.4 Parningssystemet ...... 40 7.3.5 Parningsspel och artigenk¨anning ...... 40 7.3.6 Aggl¨ ¨aggning ...... 40 7.3.7 Flyg- och jaktbeteende ...... 40 7.4 De nu levande trollsl¨andornas diversitet ...... 41 7.4.1 Zygoptera ...... 41 7.4.2 Epiprocta ...... 41 7.4.3 Anisoptera - ¨akta trollsl¨andor ...... 42 7.5 En nyckelgrupp i insekternas evolution ...... 42 7.5.1 Vingutveckling p˚aland – paranotalhypotesen ...... 43 7.5.2 Vingutveckling i vatten – omformade g¨alar? ...... 43 7.6 Palaeoptera och ...... 44 7.6.1 Ar¨ Palaeoptera en monofyletisk grupp? ...... 44 7.7 Ribosomala DNA-sekvenser i fylogenetisk systematik ...... 45 7.7.1 Ribosomers struktur och funktion ...... 45 7.8 Presentation av artiklarna ...... 47

8 Acknowledgments 51

iv Preface

Dragonflies (Odonata) are one of the instantly recognizable groups of . The aerial acrobatics of the true dragonflies, the shimmering wings of the demoi- selles and perhaps even the tiny damselflies are a familiar sight to anyone who has spent an afternoon at a lakeside. Dragonflies are an ancient group of insects, and a key group in understanding the and insect flight. I have studied dragonflies from different phylogenetic perspectives – from the wide view of the systematic placement of dragonflies in the insects, to higher- level phylogeny in Coenagrionid damselflies and a close look at a small group of libellulids in the genus Leucorrhinia. For these papers, I have used molecular methods to obtain phylogenetic hypotheses. In addition to phylogentic stud- ies, I have examined the nomenclature of two groups of damselflies, first in a synonymic catalog of the genus Coenagrion and next in an examination of the history and taxonomic availabilty of the genus name Agrion. The first and second chapters of the introduction are about the natural his- tory of dragonflies and how their phylogeny and life-history evolution has been interpreted. This is followed by a presentation of the extant groups of dragon- flies on a super-familial level. The final historical chapter is a history of insect flight. Next, there is a section on ribosomal and different strategies for homologizing DNA data in phylogenetic systematics, and finally a presentation of the five articles included in this thesis.

v vi Chapter 1

Clades and classification of the Odonata

1.1 Origin and monophyly of Odonata

Dragonflies are one of the most ancient groups of insects alive today. The first known fossils of dragonfly-like insects are from the Upper and belong to the group Protodonata, the extinct of modern Odonata. Included in Protodonata is the largest insect known to have existed: Mega- neuropsis permiana Carpenter, 1939. This species had a wingspan of over 70 cm. Most Protodonata are only known from wings, but a composite picture can be assembled from fragmented evidence (Grimaldi and Engel, 2005): an insect with some striking similarities to modern dragonflies bearing toothed mandibles, large compound and legs angled forward. They were most cer- tainly predators. Although the larvae are unknown, the close relationship to extant dragonflies suggests that they could have been aquatic. True Odonata appeared in the early era, represented by the extinct suborders Protanisoptera, Protozygoptera as well as the species Permagrion falklandicum Tillyard, 1928, which has been interpreted either as a modern zy- gopteran or a representative of the extinct suborder Archizygoptera (Trueman in Silsby, 2001). Modern dragonflies (Odonata sensu stricto) are a well-supported monophyletic group (e.g. Rehn, 2003; Trueman, 1996; Kristensen, 1975; Wheeler et al., 2001). They share several unique characters, most notably the secondary male genitalia and the prehensile labial mask of the larvae.

1.2 Classification and taxonomy - a historical re- view

Figure 1.1: Scandinavian besman scale. Illustration from “Nordisk Familjebok” (1905).

Dragonflies were originally classified in the genus within the (Linnaeus, 1758). Libellula means “small weighing scale”, referring to a type of counterbalanced hanging scales. The linnaean Neuroptera contained all the insect orders with multiple crossveins in the wings: Odonata in Libel- lula; Ephemeroptera in Ephemera; Trichoptera in Phryganea; , Neu-

1 roptera sensu stricto, and in Hemerobius, in and Rhaphidioptera in Rhaphidia. Fabricius (1775) divided the genus Libel- lula intro three: Libellula, and Agrion. An even finer division of the European genera was suggested by Leach (1815), where such familiar taxa as , Calopteryx (as Calepteryx), and were described. Leach’s taxonomy was accepted and expanded upon by the francophone odona- tologists Rambur (1842) and de S´elys-Longchamps (e.g. 1850, 1872, 1876).The Belgian entomologist Baron Michel Edmond de S´elys-Longchamps, can be con- sidered the founder of modern odonatology. From 1840 to his death in 1900, he published monographs on every major group of Odonata except the Libel- lulidae. He described over 1000 species as well as erecting, as subfamilies, most of the groups now treated as families. Well into the 20th century Odonata were still usually treated as part of the Neuroptera sensu Linnaeus, although this was often considered an unnatural grouping. In contemporary literature, Odonata were sometimes referred to as Paraneuroptera, and grouped with the other hemimetabolous “Neuroptera” i.e. Ephemeroptera, Psocoptera and Ple- coptera in the Pseudoneuroptera. The classification changed when Martynov (e.g. 1925) reconsidered the group Subulicornes, proposed by Latreille (1807) for Neuroptera with tiny bristle-like antennae and aquatic larvae, under the name Palaeoptera. This was to be a controversial group, as will be explained below.

1.2.1 Pioneers of dragonfly systematics

Coenagrionoidea

Lestoidea

Calopterygoidea

Epiophlebia

Figure 1.2: Munz (1919) phylogeny for Zygoptera

The most notable pre-cladistic phylogenetic studies of the Odonata were performed by Needham (1903) on the entire group, and Zygoptera by Munz (1919). These were mostly based on patterns in the wing venation and the theory that “ontogeny recapitulates phylogeny” (Haeckel, 1866). In Odonata larvae, the growth of tracheae in the wing pads can be followed throughout the . The pattern of the growing tracheae follow the pattern of the main veins in the imago, but there are indications that the trachaetion as well as the venation rather follows lacunae in the epidermis that form well before either tracheae or veins migrate in (see Carpenter (1966), for a review). Needham’s (1903) paper used comparative examinations of the wing-vein patterns to extract “trends” in odonate evolution. All character states were divided into an ancestral- (e.g. fore and hind wings alike), and a derived state (e.g. fore and hind wings differentiated). Needham stated that there is a di- chotomy between Anisoptera and Zygoptera. Anisoptera are further divided into Libellulidae (modern Libelluloidea) and (the remainder of the Anisoptera), with Aeshnidae considered representing a primitive branch. Zy- goptera are in turn divided into (Calopterygoidea) and other Zygoptera lumped into Agrionidae. Needham (1903) also discusses the peculiari- ties of the extant Anisozygopteran superstes (de S´elys-Longchamps, 1889) (as Palaeophlebia), including its affinity to certain fossil groups, but he

2 leaves it unplaced in the genealogy. Munz (1919) also argued for a dichotomy between Zygoptera and Anisoptera, where the Agrionidae (Calopterygoidea in modern taxonomic terms) are a grade including a monophyletic Coenagrionidae (the remainder of the Zygoptera). Zygoptera are seen as being derived from Anisozygoptera. Fraser’s (1957) reclassification of Odonata was based on the unpublished work of Tillyard, who left an unfinished manuscript behind at his passing away in 1937. In this landmark paper, the first phylogenetic hypothesis of the entire Odonata was published. In Fraser’s interpretation (contrary to Tillyard’s as in his unpublished manuscript), Zygoptera are a paraphyletic group. To a modern phylogenetic systematist, it looks not quite like a cladogram, and one should be careful in interpreting groups as mono- or paraphyletic. Fraser based named groups on “persistent archaic characters”, or in cladistic terms: plesiomorphies. Several of the families are presented as less and less primitive grades towards fi- nal families where the ancestral line reaches its highest degree of advancement. For example, Coenagrionidae are presented as the apex of a grade consisting of (in turn) Platystichtidae, and . In the fig- ure below, I have attempted to re-interpret Fraser’s phylogeny from a cladistic perspective.

Coenagrionoidea

Lestoidea

Calopterygoidea

Anisozygoptera

Aeshnoidea

Cordulegastroidea

Libelluliodea

Figure 1.3: Interpretation of Fraser’s (1957).

1.2.2 Cladistic morphological studies As late as in 1996 was the first formal cladistic study on Odonata published in John Trueman’s modestly titled “A preliminary cladistic analysis of odonate wing venation”. Here 14 fossil and 32 extant Odonata were scored for 96 wing characters; along with as outgroup. Trueman used an “ex- emplar approach”, and used only single species as terminal taxa. On the super- familial level, Trueman’s tree holds a surprise: the rare Australian damselfly de S´elys-Longchamps, 1877, placed in its own super- familiy Hemiphlebioidea, appear as the sister taxon of all extant Odonata. All other superfamilies except Libelluloidea are found to be paraphyletic. Zygoptera are a paraphyletic grade, leading to a monophyletic Epiprocta, including a pa-

3 raphyletic Anisozygoptera and a monophyletic Anisoptera. Epiophlebia is basal to all of Anisozygoptera and are hence the sister taxon to the entire Anisoptera.

Zygoptera

Epiophlebia

Anisozygoptera

Aeshnoidea + Cordulegastroidea

Libelluliodea

Hemiphlebia

Figure 1.4: Trueman’s tree (1996).

To date, the most ambitious study on Odonata phylogeny was performed by Rehn (2003). In this morphological cladistic study, the focus is on resolving higher-level relationships in the Zygoptera. 85 terminals, representing all ex- tant and fossil families and most subfamilies were included and coded for 122 characters. Terminal taxa were composites from several species coded to the generic level, and the 85 terminals were the synthesis of 161 examined species. Rehn found strong support for monophyly of extant Zygoptera as the sister group of Epiprocta. A grade of fossil Anisozygoptera leads to a monophyletic group of extant Anisoptera. In the Zygoptera, none of the superfamilies, as proposed by Fraser (1957), came out as monophyletic. In Calopterygoidea, there is a monophyletic core group of Calopterygidae, excluding a monophyletic Aphipterygidae, nested in a paraphyletic Lestinoidea. and , sometimes both included in Amphipterygidae, sometimes in , are found outside the core Calopterygoidea: Philoganga as sister taxon to the rest of Zygoptera, and Diphlebia as the sister taxon to Lestinoidea + Amphipterygidae + Coenagrionoidea. Lestinoidea are not monophyletic in any analysis presented. Coenagrionoidea is monophyletic, if are included. This taxon was placed in Agrioidea (=Calopterygoidea) by Fraser (1957). Hemiphlebia mirabilis is found within the lestoid grade. The basal placement on this taxon by Trueman (1996) was based on the absence of the arculus in the hind wings, a character state only seen in fossil Archizygoptera. But as found by Trueman (1999), this is a derived character state, as an arculus is occasionally found in Hemiphlebia specimens. Rehn (2003) concludes that this phylogeny has low statistical support, and that he is “reluctant to suggest formal changes to the current family group classification” and “The overall topology of Zygoptera suggests its division into three subfamilies, one each for Philoganga, Calopterygoidea and the [Diphlebia, Amphipterygidae, Hemiphlebia, Lestinoidea and Coenagrionoidea] [. . . ]”

1.2.3 Molecular studies No comprehensive molecular study on Odonata phylogeny has been published to date. Recent studies include the 12S rDNA phylogeny by Saux et al. (2003),

4 using 12S rDNA from 25 taxa, as well as Hasegawa and Kasuya (2006) who an- alyzed 16S and 28S rDNA data. Both studies found a paraphyletic Zygoptera with a single species of Lestes as the immediate sister taxon to a monophyletic Anisoptera. However, both studies suffer from poor taxon sampling and a nar- row systematic scope. Where Saux et al. (2003) sampled 25 North American taxa, the 32 species Hasegawa and Kasuya included were all from . Cur- rently, there are several research groups working on large scale molecular phy- logenies, both in Europe and in the USA.

Coenagrionoidea

Lestoidea

Calopterygoidea

Philoganga

Libelluliodea

Cordulegastroidea

Aeshnoidea

Anisozygoptera

Epiophlebia

Figure 1.5: Phylogeny of Odonata according to Rehn (2003).

5 6 Chapter 2

Life history

A common myth is that dragonflies only live for a single day, something that probably stems from confusing them with mayflies. The life cycle for a dragonfly can be anything from six months in coenagrionid damselflies, up to nine years in the rare Epiophlebia laidlawii Tillyard, 1921 (Silsby, 2001). Most of their life is spent in the aquatic larval stage, with a final season as a winged imago. Although the imago only spends few days to a few months on the wing, during this time they will hunt, feed, defend a territory, mate and reproduce.

2.1 Larval stage

Immature stages of Odonata and Ephemeroptera are here referred to as larvae, following the terminology of Westfall and May (1996) for “immature feeding stage[s] of an insect that undergoes a major reorganization of body form when transforming to the adult stage.” Dragonfly larvae are entirely aquatic and in- habit all kinds of freshwater habitats, from streams (e.g. , Caloptery- gidae) to lakes and (e.g. Libellulidae, Coenagrionidae, ) and even water accumulated in epiphytic plants (). Damselfly larvae can be recognized by their slender build and the presence of three caudal blades. These are highly tracheaeted and are used for extracting oxygen, as well as for swimming. The shape and patterns of the gills are important features in identifying damselfly larvae at the species level. The larvae of true dragonflies are more robustly built and are never equipped with external gills. Instead, the surface area of the rectum is folded, up to 60–80 times, to create internal gills. This specialized area of the gut can be closed with a valve, and muscles pump water in and out of the rectum for respiration. The pump also works as an escape mechanism, and water can be pushed out as a jet stream that propels the dragonfly away from predators. The ecology of dragonfly larvae can usually be deduced from their shape: ambush predators are squat and spiny to blend in with underwater vegetation, and active hunters are slender and streamlined. Many Anisoptera carry sharp spines on a ridge on top of the abdomen, as well as on the sides. These spines serve as a protection against , and Johansson and Samuelsson (1994), showed that the length of defensive spines is directly affected by the presence of fish predators in the habitat. The labium (the bottom mouth part, or lower lip) is transformed into an ejectable mask. At rest, it is folded underneath the head with the labial palps closed. When catching prey, the mask is ejected up to a third of the length of the body, the palps open up like a bear trap, and in an instant the prey is caught. The prey can be anything from small worms, larvae, other aquatic insects, and even small fish. This adaptation is unique in the whole insect world, and one of the defining characteristics of the Odonata. The larval stage lasts through several molts, usually between 8–15, a low number compared to the Ephemeroptera, which pass through up to 50 larval stages (Peters and Campbell, 1991), but high compared to louse flies (Diptera,

7 Hippoboscidae), where larvae immediately form puparia as soon as they are deposited (Foote, 1991). The very first is known as a prolarva, and is immotile with its legs fixed against the sides of the body. This stage is very short-lasting, and the second instar hatches from the prolarva within a few hours. After each molt, when the cuticle is still soft, the larvae grow by inflating themselves with water. When the cuticle hardens, no growth is possible until the next molt. Wing pads begin to show in the third or fourth instar and get proportionally larger for every succeeding molt.

2.2 Emergence

A few days before emergence, the larva stop feeding, and the final molt takes place within the larval skin, analogous to the pharate pupae found among holometabolous insects. Damselfly larvae, and those of stream-dwelling gom- phid dragonflies, emerge on flat rock surfaces near the water. Most Anisoptera larvae climb reeds or plant stems and use their claws to attach themselves in a vertical position before emerging. The dragonfly emerges by breaking the dorsal surface of the head and thorax of the larval skin. It then proceeds to crawl partially out of the shell, and waits until the legs are hardened before emerging entirely. By first filling the body with air, and then using hydrostatic pressure to push haemolymph into the wing veins and abdomen, the dragonfly hatchling inflates itself to full size. The newly hatched, or teneral, dragonfly can be recognized by the soap bubble-shimmering wings and pale coloration. Teneral dragonflies sometimes migrate away from the source of water, to return when they have fully matured.

2.3 Imago

The mature dragonfly’s appearance is different from the from the teneral. The wings are no longer shimmering, and body color is deeper and darker. Some species develop pruinescense. This is a waxy body coating, usually blue in color, but ranging from white to purple and even red. This is most notable in males, especially libellulids (i.e. Linnaeus, 1758), where the tenerals are very similar in color to the female, but the mature male has an abdomen entirely covered with blue pruinescense. The mature dragonfly will return to a source of water, usually the one it was hatched from, but longer migrations also occur. An extreme example of a migrating species is the aeshnid Hemianax ephippiger (Burmeister, 1839). Its usual habitats are desert areas from the Sahara over the Middle East to India, but migrating individuals have been found as far away as (Olafsson,´ 1975). Territoriality is common in dragonflies, and a male that takes up a territory will defend it from intruders, especially conspecific males. Territorial behavior is the norm in Anisoptera, but rare outside Calopterygoidea in Zygoptera. A good territory contains a perch, for the male to rest and observe, and suitable sites for depositing eggs. This can be a part of a riverbend, a clump of reeds or an area of open water.

2.4 Mating system

A unique feature of Odonata is the peculiar mating system. Male dragonflies have, aside from the primary genitalia distally on the abdomen, secondary geni- talia ventrally on the second and third abdominal segments. This structure has no homologous counterpart in any other extant group of insects. The primar- ily apterygote hexapods ( – silverfish, Collembola – etc.) have external fertilization: the males deposit spermatophores on the ground, which are subsequently picked up by the females. Other pterygote insects (in- cluding Ephemeroptera) have a direct gonopore-to-gonopore mating system. In

8 Odonata, the male has to transfer sperm from the tip of the abdomen to a reser- voir in the secondary genitalia. A side effect of the odonate mating system is that every mating is dependent on female choice (Fincke, 1997). Before mating, the male clasps the female using the anal appendages, but for a successful mat- ing to ensue, the female has to flex her abdomen to connect with the secondary genitalia of the male. In Zygoptera the females are grasped behind the pro- thorax, and in Anisoptera (and Anisozygoptera) around the back of the head. This is known as the tandem position. The mating position, when females are grasped by the males and the female genitalia are connected to the secondary genitalia of the male, is called the wheel position. The structures involved in

Figure 2.1: Tandem and wheel. Redrawn from Robertson & Paterson (1981). mating are useful in identifying species: males of closely related species can be identified by the shape and size of anal appendages, and in Anisoptera also the structures around the secondary genitalia. Zygopteran females can be identified on the shape of the prothorax, and the mesostigmal plates on the metathorax. Species of anisopteran females can be separated on structures around the genital opening on abdominal segment 8.

2.5 Mating rituals and species recognition

Dragonflies recognize conspecifics by visual and tactile information. Pheromo- nes are apparently not involved, as the antennae of dragonflies are underdevel- oped structures compared to insects where air-borne chemicals are important signals, such as and mosquitoes. In a few groups, most notably in certain Calopterygoidea, mating is preceded by a courtship ritual, where the predomi- nantly dark-metallic male raises his abdomen to expose the light underside and flutters his wings. A brief courtship is also performed in some Anisoptera, but most species tend to rely on visual clues for identifying prospective mates and competitors. Pajunen (1964) studied the - and species recognition of two closely related and sympatric Leucorrhinia species: L. dubia (Vanderlinden, 1825) and L. rubicunda (Linnaeus, 1758). Pajunen found that males rely on the flight pattern to recognize conspecific males, and would attempt tandem coupling with anything not exhibiting the typical male behavior. This included erratically flying exhausted males, experimentally weighted down males and fe- males painted in bright unnatural colors. Males of L. rubicunda were inspected closely, more often than unmanipulated conspecifics, by males of L. dubia. In smaller Zygoptera, visual clues are less useful, and recognition tends to rely more on tactile information. Males will attempt tandem coupling with any dam- selflies fitting the size and color of females of their own species. Loibl (1958), and Krieger and Krieger-Loibl (1958) studied sympatric species of Lestes and (both Zygoptera), and found that males would often attempt mating with heterospecific females, but females would refuse mating by not assuming the wheel position. It was also found that females would refuse mating with conspecific males who had had their anal appendages experimentally altered. Paulson (1974), performed an experiment where captive females of and species (Coenagrionidae), were presented to con- and heterogeneric males. Males did not distinguish females of their own species visually, but showed less response towards heterospecific females. Extraspecfic were prohibited by the males’ inability to grasp heterogeneric females around the

9 prothorax, and the refusal to mate by congeneric, but heterospecific females. Paulson concluded that mechanical isolation is very important in clear winged Zygoptera, where the coloration of females are simliar between closely related species but the shape of male genitalia differ substantially. Robertson and Paterson (1982), repeated the methods of Loibl (1958) and experimentally altered the anal appendages of males of Enallgma glaucum (Bur- meister, 1839) (now ), and found that females readily mated with males who had altered paraprocts (inferior anal appendages), but refused mat- ings with those with altered cerci (superior anal appendages). This corrobo- rates the theory that the site for tactile discrimination in Zygoptera are the inner grooves of the female mesostigmal plates. As revealed by scanning elec- tron microscopy (Robertson and Paterson, 1982), the mesostigmal plates are equipped with tactile sensilla at the sites where only the cerci of a conspecific male will make sufficient contact. In these coenagrionid damselflies the shape of the genitalia and mesostigmal plates vary distinctly, even between closely related species, and females are very discriminating against males whose cerci does not hit the right spots on the mesostigmal plates. This is in contrast to those dragonflies that rely on visual information, such as the Leucorrhinia stud- ied by Pajunen (1964), where altered cerci did not affect the females’ willingness to mate. Or sympatric Calopteryx species (i.e. North American C. maculata (Palisot de Beauvois, 1805) and C. aequabilis Say, 1839) where identification of conspecifics is dependent on visual cues, and there are only minor differences in the shapes of the genitalia and mesostigmal plates between species (Waage, 1975). The Odonata mating system superficially appears to be a perfect example of the lock-and-key hypothesis of Durfour (1844), explaining the shapes of genitalia as matched to prevent heterospecific matings. However, observations are also in concordance with Eberhard’s theory (1985) that on genitalia is driven by female choice. Eberhard’s theory is that evolution of odd shapes in animal genitalia is driven by sexual selection, a red-queen race of male behavioral and mechanical manipulation and female counter-adaptations to resist the manipulations. If the same mechanisms for female choice are used to discriminate between males of the same species, and to separate out males from other species, then only these systems will be subjected to sexual selection. This prediction fits the female choice system of the visually oriented Leucorrhinia, the courting calopterygids (Waage, 1975) and the tactile Coenagrionidae (Loibl, 1958; Robertson and Paterson, 1982).

2.6 Ovipositing

Very soon after mating, ovipositing takes place. In some species, the couple is still attached in the tandem position, in others, the male hovers around the female to chase off other males attempting to elope with the ovipositing female, or the female oviposits unattended. The ancestral state in Odonata is to deposit eggs endophytically, i.e. inside plant matter, using a serrated ovipositor. This behavior is found in all Zygoptera, in Epiophlebia, and in the plesiomorphic anisopteran groups Aeshnidae and . An ovipositing damselfly can stay underwater for several minutes while boring eggs into the stems of sub- merged plants. Not only underwater plants are used for endophytic oviposition: Lestes viridis attaches eggs to branches of and bushes hanging over open water. The eggs winter in this stage, and the larvae hatch in the spring. The ovipositor has been lost independently in Gomphoidea and Cordulegastroidea + Libelluloidea. In Cordulegastroidea a secondary unserrated ovipositor is formed from the vulvar scales, and is used for depositing eggs in mud along the bot- tom of brooks and streams. In other Anisoptera, there are several methods of ovipositing: Eggs can be dropped straight into the water from a perched or fly- ing position, or a low-flying female can extrude eggs in small batches and release them by dipping her abdomen in the water. The corduliid bimaculata

10 (de Charpentier, 1825) deposits eggs in long gelatinous strands, similar to ’ eggs.

2.7 Life on the wing

Dragonflies are active visual predators, and show a number of adaptations for hunting and capturing live prey. Legs are spiny and pointed forward at an angle from the slanted pterothorax, forming a basket for catching and handling prey. The compound eyes are adapted for sensing movement, and dragonflies can be seen to investigate anything passing by in the air to decide if it is a competitor, mate or food. Adaptation to counter the acute sight of competitors have been investigated in the Aeshnid Hemianax papuensis (Burmeister, 1839) by Mizutani et al. (2003), who showed that interacting territorial males use motion camouflage to remain undetected even if they are circling around each other at high speed. This is accomplished by the attacker matching the flight movements of the occupant of the territory, as an objects stationary in the visual field are percieved as immobile. By employing motion camoflage, the attacker can get close to his opponent without being detected.

Figure 2.2: Pseudostigmatidae: Megaloprepus caeruleatus (Drury, 1782).

When it comes to feeding, dragonflies are generalists. Anything alive and flying is seen as food. and mosquitoes are the staple diet of most Odonata, but some species have become specialist on certain type of prey. The aeshnid junius (Drury, 1770) prefers (Warren, 1915), especially hon- eybees, but will also eat moths, and dipterans. The real specialists are the helicopter damselflies (Psedostigmatidae) of Central- and South America, who prey exclusively on . These long (up to 21 cm in ), hover in front of webs in trees, and will carefully pluck any inhabitant. After grabbing a spider with its front legs, the pseudostigmatid will fly back- wards to a perch, and then bite the legs off the spider before consuming the body (Corbet, 1999).

11 12 Chapter 3

Extant clades of Odonata

The extant Odonata are traditionally divided into three suborders: Zygoptera, Anisoptera and Anisozygoptera (Fraser, 1957). Worldwide, about 6000 species of Odonata have been formally named (Silsby, 2001), and a speculative estimate (Tennessen, 1997), indicates that there are less than 10000 extant species of Odonata. The number of described species is about evenly divided between Zygoptera and Anisoptera. The names of higher taxa in this section is from Fraser’s re-classification, but all reference to phylogeny is based on Rehn (2003), and names of paraphyletic groups are set within quotes. All specimens are pictured approximately lifesize.

3.1 Zygoptera - damselflies

The Zygoptera, damselflies, are characterized by their slender abdomen, the an- terolaterally flattened head with widely separated compound eyes, similar shape of fore and hind wings and a functional serrated ovipositor in females. Eggs are deposited endophytically. Damselflies are generally weak fliers, compared to the true dragonflies, with a few notable exceptions in the Pseudostigmatidae.

3.1.1 Calopterygoidea The type family of this group is Calopterygidae, known as demoiselles in the UK and jewelwings in North America. They are mostly found in habitats with flowing water. Blue or green metallic body color is common, and many species have tinted wings with several antenodal crossveins.

Figure 3.1: : rutilans (Rambur, 1842).

3.1.2 “Lestinoidea” This group is sometimes called Lestoidea (Silsby, 2001). However, Lestoidea is also the name of a genus within the group. Typically, the wings are peti- olate, and are kept in a spread position at rest. The type family is Lestidae, spreadwings (North America), or emeralds (UK). The Lestinoidea are not a

13 monophyletic group, but rather a paraphyletic grade between Calopterygoidea and Coenagrionoidea. Some taxa traditionally placed in this group include the family Lestoideidae with the three genera: Diphlebia, Philoganga and Lestoidea. The former two are sometimes places in their own family Diphlebiidae (Davies and Tobin, 1984). In Rehn’s analyses (2003) Philoganga is the sister taxon of the entire Zygoptera, while Diphlebia is associated with the paraphyletic Lestinoid grade. Lestoidea itself is found within Coenagrionoidea.

Figure 3.2: Lestidae: (Hansemann, 1828).

3.1.3 Coenagrionoidea The Coenagrionoidea are a monophyletic group, when Lestoidea is included. This group contains some of the smallest as well as the longest Odonata with the coenagrionid pygmaea (Rambur, 1842) no longer than 16–18 mm, and pseudostigmatids which can reach over 21 cm in length. Wings are typically petiolate and hyaline with two antenodal crossveins. Ecologically they are a diverse group, with Coenagrionidae breeding in still waters, such as ponds and bogs, and Platycnemididae which inhabit brooks and streams. The unsual Pseudostigmatidae live in rainforests, and breed in water filled tree holes and leaf bases of epiphytic plants.

Figure 3.3: Coenagrionidae: Coenagrion puella (Linnaeus, 1758).

3.1.4 Hemiphleboidea This groups consists of a single species Hemiphlebia mirabilis de S´elys-Long- champs, 1877, in the monotypic family , endemic to Australia and . It was feared to be extinct in the 1980s, but several healthy colonies have been discovered in mainland Australia as well as Tasmania. As discussed above, the Hemiphleboidea, are not basal within Odonata, or even Zygoptera.

3.2 Epiprocta: Anisoptera + “Anisozygoptera”

In the light of recent cladistic analyses (Trueman, 1996; Rehn, 2003), Anisozy- goptera have been found to be paraphyletic. Lohmann (1996), suggested the taxon Epiprocta (referring to the structure formed by fusion of the male’s lower

14 Figure 3.4: Forewing of Hemiphlebia mirabilis (de S´elys-Longchamps, 1877). Note the conspicuous lack of an arculus. Redrawn from Munz (1919).

anal appendages) for Anisozygoptera + Anisoptera, and I will use that termi- nology here.

3.2.1 The paraphyletic Anisozygoptera

Figure 3.5: Epiophlebiidae: (de S´elys-Longchamps, 1889). One of two extant anisozygopterans.

Historically, the Anisozygoptera were a diverse group (Fraser, 1957; True- man, 1996), but today only two species are extant, both in the genus Epio- phlebia. As the name implies, this group blends features of Zygoptera with Anisoptera. Epiophlebia has the robust synthorax of an anisopteran, with wings that are zygopteran in shape but intermediate in venation. The head has widely separated eyes, resembling those found in Gomphidae more than a typical zy- gopteran. The coloration of the body is of the black and yellow scheme common in basal Anisoptera. The larvae are cylindrical, and have rectal gills, but are unable to use them for jet propulsion. In mating, the female is grasped behind the head, rather than the prothorax. They have a functional ovipositor and lay eggs endophytically. Epiophlebia superstes (de S´elys-Longchamps, 1889) is common in Japan. The other species, E. laidlawii Tillyard, 1921 inhabit Hi- malayan mountain streams, and has never been found below an altitude of 1800 m. Epiophlebia spp. are adapted to cold water and a cold climate. The larvae of E. laidlawii have the longest development time found in Odonata, estimated to 5–9 years.

3.3 Anisoptera

Although the term dragonfly is also used for the entire order, it is commonly used as a vernacular for Anisoptera. The name refers to the dissimilar shape of the wing pairs: the bases of the hind wings are broader then those of the fore wings. At rest, the wings are held outwards to the sides. Anisopterans are strong fliers and are able to hover and fly in any direction, including backwards. The larvae are robust and use rectal gills for respiration and jet propulsion.

15 3.3.1 “Aeshnoidea”

Figure 3.6: Gomphidae: (Linnaeus, 1758).

This name covers the basal anisopteran groups Aeshnidae, Gomphidae and Petaluridae. Gomphidae and Petaluridae retain the widely separated eyes, while the Aeshnids have the more typical dragonfly eyes covering most of the head. Members of this group share the ancestral color scheme, with a dark base and brighter stripes on the synthorax and abdomen, never metallic. With Gomphidae as an exception, the ovipositor is fully functional and eggs are de- posited endophytically. The Petaluridae are considered the most ancestral of the Anisoptera, based on wing venation characters. This group includes ingentissima, the world’s largest dragonfly. It is not as long as some pseudostig- matids, but has a wingspan up to 16 cm.

3.3.2 Cordulegastroidea

This is a Holarctic group classified into a single family (gold- enrings in the UK, spiketails in North America). They exhibit the ancestral color scheme of the Aeshnoidea: a black body with yellow stripes. Oviposition takes place in mud and sand in flowing water, the females using their elongated ovipositor to stab eggs into the substrate.

Figure 3.7: Cordulegastridae: Cordulegaster boltoni (Donovan, 1807).

16 3.3.3 Libelluloidea This is one of the largest and morphologically diverse groups in Odonata. Li- belluloid are found in most types of habitats around the world. They range in size from the gigantic chlorogomphids, with wingspans only rivaled by the Aus- tralian petalurids, to the world smallest dragonflies in Libellulidae (subfamily Brachydiplactinae).

Figure 3.8: Libellulidae: Nannaphya pygmaea Rambur, 1842. One of the small- est anisopterans.

All types of coloration are found in Libelluloidea, from the ancestral black- and-yellow in and to bright metallic greens in and all possible colors within Libellulidae. Spectacular patterned wings are also common within this group. Although Libelluloidea is a diverse group, morphologically and ecologically, it is a well-established monophyletic taxon. Synapomorphies include the entirely reduced ovipositor, and the shapes

Figure 3.9: Libellulidae: Libellula quadrimaculata Linnaeus, 1758. of the triangles being different in fore and hind wings. The nominate group, Libellulidae, contains the genus Libellula, which was the original Linnaean genus for the entire Odonata. Pictured is Libellula quadrimaculata Linnaeus, 1758, the nominate species in the nominate genus of the nominate family.

17 18 Chapter 4

Odonata – a key group in insect evolution

Dragonflies are some of the most agile fliers among the insects. Their manouver- ability and speed are only rivaled by large robberflies (Diptera: ), who actually hunt dragonflies. The flight mechanism is also very specialized. Other insects mainly use their indirect wing muscles to power flight. These attach to the body wall and work by deforming the shape of the thorax. In dragonflies, the wings are powered by direct wing musculature which attach to the fulcrums formed by the basal wing sclerites. As Odonata are one of the most basal groups of winged insects, they hold vital clues to the origin of insect flight. Are the direct wing muscles and uniqe venation pattern an ancestral trait or a highly developed specilisation?

4.1 History of insect flight

Powered flight has originated four times in the history of life on earth: In the insects, in pterosaurs, birds and bats. In the , the multiple origin of wing is evident from how the forelimbs have been modified. In pterosaurs, the arm is short, and the elongated fourth finger is used to stretch out the wing membrane. In bats, the wing is formed by the webbing between the fingers. In birds, the bones of the arm form the leading edge of the wing and feathers, rather than the wing membrane, form the airfoil. In other , there are no obvious homologous structures to the insect wings. The oldest known insect wings are found in Namurian (Upper Carbonif- erous, 326–315 myo) fossil beds (Carpenter and Burnham, 1985). These are fully formed structures and several can even be placed within extant groups, including mayflies (Ephemeroptera) and (). However, Engel and Grimaldi (2004), re-examined hirsti Tillyard, 1928, from the of Scotland ( Old Red Sandstone, formed 400 mya). Only fragments of mouth-parts are preserved, but by using compound microscopy, the authors were able to show that the mandibles are clearly di- condylious and articulated in a manner only found among Odonata and Neoptera, backdating pterygote insects by 75 million years. No intermediary stage in evolution has ever been found, as noted by Carpenter and Burnham (1985) “The fossil record, as presently known, contributes nothing to our understanding of the actual origin of the insects.” Phylogeny offers no simple leads, as the firmly established sister-group of the pterygotes are the entirely wingless Zygentoma (Hennig, 1981; Kristensen, 1975, etc.). Clues to the origin of insect wings have been sought in ontogeny Snod- grass (1935), palaeecology (Wigglesworth, 1963a,b), and ethology (Alexander and Brown, 1963). These theories should be taken as they are: speculative, untestable, more or less plausible, but usually thought provoking and an inter- esting read.

19 4.2 Paranota – a terrestrial origin?

Snodgrass (1935), launched the theory that wings have an origin in expanded paranotal lobes – structures expanding from the folds of the soft body wall below the sides of the dorsum. The evolution of wings is interpreted as a three-staged process: 1. Three pairs of lateral flaps develop on the thorax. 2. The flaps are utilized in gliding, enabling insects to “depart from a strictly terrestrial or arboreal life”. 3. The flaps of the meso- and metathorax acquire motility, and the flaps on the prothorax are lost. Alexander and Brown (1963) suggested the original function of the thorax flaps were mating display. Sexual selection would have driven the evolution towards larger and more prominent structures. An- other proposed original function of the paranota is thermoregulation (Douglas, 1981). Extant dragonflies, as well as butterflies and other large-winged insects, actively use their wings to adjust body temperature. Many insects bask in sun- light to increase body temperature, or position themselves to minimize the area directly facing the sun. This can be observed in libellulid dragonflies perching in the “obelisk position” with the body nearly vertical and the wings pointed downward. As demonstrated by Kingsolver and Koehl (1985, 1994) selection for higher body temperature would favor having wing pads over not having them, and larger wing pads over smaller.

4.3 An aquatic origin?

Other scenarios imagine wings originating in an aquatic environment, and adap- tation to flight through a function shift. Handlirsch (1937), argued that the winged insects were derived from trilobites, rather than silverfish-like hexapods, and that the ancestral wings were intersegmental gills. Kukalov´a-Peck has in several publications (e.g. 1983; 1987; 1991) argued that wings evolved from an leg-associated structure known as the epicoxa. This structure is the hy- pothetical junction between the pleuron (side) and dorsum (top) of the leg bearing segments. Larvae in Ephemeroptera, perhaps the sister group to all extant pterygotes (Kristensen, 1975; Wheeler et al., 2001; Ogden and Whiting, 2003), bear paired abdominal gills with a tracheaetion mimicking the pattern on the developing winglets. These structures are seen by Kukalov´a-Peck as se- rially homologous to the wing pads of the meso- and metathorax. Marden and Kramer (1994) described a scenario for evolution of flight through a function shift: Stoneflies (Plecoptera) have aquatic nymphs, and are commonly associ- ated with streaming water. In certain groups, a behavior called “skimming” occurs, where imagos remain on the water surface and use their wings for lo- comotion without becoming airborne. This could be interpreted as a possible intermediary stage in wing evolution, as it eliminates any useless transitional stages. Gill pads could initially have been used as immobile sails, and with se- lective pressure pushing mobility, gliding and eventually powered flight. Hennig (1981) placed Plecoptera as the sister group of all other neopterous insects, with Palaeoptera as the monophyletic sister group of Neoptera. A possible interpre- tation is that having aquatic larvae and surface skimming adults is an ancestral state in winged insects. However, as Will (1995) commented on Marden and Kramer (1994), Plecoptera are neither phylogenetically basal in pterygote in- sects, nor is surface skimming an ancestral trait in Plecoptera. Will notes in conclusion: “Surface skimming can be added to the list of feasible scenarios put forward, but without the support of phylogeny it remains speculative.” There are other difficulties with the aquatic origin theory (see Grimaldi and Engel 2005, p.159 for a review): the earliest fossil freshwater insects are from the era (Zherikhin, 2002), 100 million years younger than the first winged insect fossils. Most insect fossils are formed in water by becoming embedded in silts under anaerobic conditions (Carpenter and Burnham, 1985). It is unlikely that the fossil record would be biased towards terrestrial insects accidentally falling into water, against early protopterygotes in their natural aquatic habi- tat. Also the structures forming gills in extant insects are clearly not homolo-

20 gous ontogenically: the abdominal gills of Ephemeroptera are different from the caudal gills and modified gut in Odonata, and the gill tufts of Plecoptera.

4.4 Palaeopterous and neopterous wings

Although the wings of palaeopterous and neopterous insects are undoubtedly homologous, they are different in structure and function. Martynov (1925) first divided the insects into two groups based on wing function. Most insects are able to fold their wings flat over the abdomen at rest. This is achieved by a muscle pulling on one of the sclerites articulating the wing against the body, and a wing vein branching that allows for folding. All extant pterygote insects fall into this category except Ephemeroptera and Odonata. These two groups are unable to fold their wings back in any way, and keep them either upright above the abdomen (Ephemeroptera and Zygoptera), or folded flat to the sides (Epiprocta). Martynov assumed the latter to the ancestral condition and called the group consisting of Ephemeroptera and Odonata Palaeoptera, or old wings. This in contrast to the wing folding insects in Neoptera – new wings.

4.5 Folding wings – a key event in insect evolu- tion

Wing folding has evolved twice in insects: once in the extinct group Palaeo- (Kukalov´a-Peck, 1991), and once in Neoptera. Wing folding has also been lost in certain neopterous groups (e.g. papillionid butterflies). How- ever, Neoptera is a firmly established monophyletic taxon, as established both by morphology and molecular evidence (Hennig, 1981; Kristensen, 1975, 1991; Boudreaux, 1979; Wheeler et al., 2001). The ability to fold the wings flat over the abdomen is considered one of the most important reasons for the success and diversity of insects. Folded wings allow for a more compact shape of the insect, and has enabled the invasion of narrow habitats inaccessible to an insect with large inflexible wings. The neopterous wing has also opened up pathways for the forewings to evolve into protective covers for the flight wings. Protective elytra have evolved many times independently in Neoptera (e.g. in Blattodea, , and Coleoptera). If number of species is in any way a measure of evolutionary success, then neopterous wing folding, not wings in themselves, is the true key innovation for the diversity of insects.

4.6 Palaeoptera – monophyletic or not?

The monophyly of Neoptera has rarely been questioned, but Palaeoptera has been a controversial group since it was first proposed by Martynov (1925). Even if the palaeopterous condition is ancestral, is Palaeoptera a monophyletic group or a grade towards Neoptera? There are three extant basal groups, and hence three possible trees, and all possible solutions have been more or less convinc- ingly argued from a morphological perspective. Interpreting the morphology on this level has to rely on characters not involved with wings or flight, as these characters can not be used to polarize the character states using apterygote outgroups. The closest relatives of the pterygotes are Zygentoma, or silverfish. Together with the , they form the monophyletic group , based among other characters on a unique adaptation in the articulation of the mandibles. Other mandibulate arthropods have a mandible connecting to the head capsule by a single socket, allowing a rotational movement of the mandible, whereas the dicondylian mandible is articulated by two joints, limiting the move- ment to that of a hinged door. This adaptation has allowed the dicondylious insects to exploit new sources of nutrition, as the more restricted mobility of the mandibles also allows for greater leverage, enabling the crushing or grinding of harder foodstuffs.

21 4.6.1 The Metapterygota hypothesis

B¨orner (1904), considered the Odonata to be more closely related to Neopte- ra than Ephemeroptera and united them in the group Metapterygota. This group has received support from total-evidence (Kluge, 1998) studies (Whiting et al., 1997; Wheeler et al., 2001), and from the thorough work of Kristensen (1975, 1981, 1991), it is the grouping scheme that has the strongest support from morphology. The characters connecting Ephemeroptera to the apterygote hexapods involve characters in the mouthparts, the molting, musculature in the tracheal system and the caudal filament. The dicondylious mandibles of the Zygentoma and Ephemeroptera larvae (adult Ephemeroptera does not have any functional mouthparts) are elongate and articulated parallel to the teeth of the mandible, whereas Odonata and Neoptera have stouter, more triangular, mandibles with the articulation perpendicular to the teeth. Ephemeroptera are the only extant insects to molt after acquiring functional wings. The larvae hatch to an immature winged stage called a subimago. This stage only lasts for a very short time (minutes to a few hours), and the subimago molts to the winged, sexually mature imago. This has been interpreted as an ancestral trait, as many apterygote hexapods (and other arthropods) never reach an imaginal stage, but continue to molt at irregular intervals throughout their life (Snodgrass, 1935). However, the ancestral status of the subimago of Ephemeroptera is open to interpretation as they do molt into a final imago, one of the uniting characters of the Pterygota. No winged sexually mature insect molt, and the apterygotes do not have a final instar. Therefore, the subimago of Ephemeroptera can only also be considered an autapomorphy. There are in- dications from the fossil record that several other insect groups had one or more subimaginal instars (Kukalov´a-Peck, 1978, 1991). In Kukalov´a-Peck’s interpre- tation, juveniles with articulated winglets occurred not only in Ephemeroptera, but Odonata, Plecoptera, and even Hemiptera. From a cladistic perspective, it seems unlikely that flying subimagos have been lost independently so many times, and the allegedly flying nymphs of the are due for a thorough independent review. In most Odonata and many Neoptera groups, the muscles that close the abdominal spiracles are attached directly to the abdominal spiracular sternites, whereas they are missing in Ephemeroptera and apterygote hexapods. The exact distribution of this character is not elaborated on by Kristensen (1981), but it was coded as present in all Neoptera and Odonata in the morphological matrices of Whiting et al. (1997) and Wheeler et al. (2001). The terminal filament is an annulated process extending from the last ab- dominal segment. According to Hennig (1981), it is undecided if it is a synapo- morphy of the true Insecta (or ectognathous hexapods), or if it is part of the hexapod groundplan. It is present in Zygentoma, , and Ephemeroptera. It is missing in ectognathous hexapods and in Odonata. In a few Plecoptera, a similar structure, the posteromedian gill filament occupies the same position (Zwick, 1980), but its homology to the long terminal filament of Ephemeroptera and apterygote ectognaths is uncertain.

4.6.2 The Opistoptera hypothesis

Boudreaux (1979) strongly argued for a sister-group relationship between Ephe- meroptera and Neoptera, a grouping first proposed by Lemche (1940) as Opist- optera (and sometimes as Ophistoptera in the same publication). The strongest similarity linking Odonata to the apterygote insects is the mating system. Apterygote males deposit spermatophores which are picked up by the female, whereas Ephemeroptera and neopterous insects always mate in copula, gono- pore to gonopore. The mating system of Odonata, is considered a variant of the ancestral method of indirect mating, with the secondary genitalia and active sperm transfer as adaptations to a life away from flat ground. According to fossil evidence interpreted by Bechly et al. (2001), Namurotypus (Protodonata),

22 did not have secondary genitalia and had a mating system with spermatophores much like the extant apterygote insects.

4.6.3 A monophyletic Palaeoptera? Martynov (1925) proposed a phylogenetic tree of the insects where several higher taxa of insects were described. These included , a group consist- ing of Hemiptera + Psocoptera + Phthiraptera, and the groupings Mecopterida and in the Holometabola, groups later confirmed as mono- phyletic by phylogenetic studies (Whiting et al., 1997; Wheeler et al., 2001; Kristensen, 1975). Martynov’s group Neoptera, the wing-folding insects, would become almost universally accepted, but the Palaeoptera have remained con- troversial to this day. Hennig (1981), supported monophyly of the extant Palaeoptera, listing 4 “relatively trivial” characters: the short antennae, the intercalary veins in the wings, the fusion of the galea and lacinia in the larval maxillae, and the aquatic larvae. As any character involving wings or flight cannot be used to root the ptery- gotes using primarily wingless insects as an outgroup, they can’t tell us any- thing about the basal pterygote phylogeny. Wings with intercalary veins can equally parsimoniously be interpreted as a symplesiomorphy. The short bristle- like antennae are ubiquitous in extant Ephemeroptera and Odonata, but as shown by Grimaldi (2001), the antennae of Odonata are divided into distinct antennomeres ending with a annulated flagellum, whereas they are simple, un- segmented structures with a simple flagellum in Ephemeroptera. There is also fossil evidence (Bechly, unpublished) that stem-group Ephemeroptera, as well as the protodonatan Namurotypus, had long flagellar antennae. This shows that the short antennae of extant Palaeoptera is a derived condition that has arisen in parallel. Kukalov´a-Peck (1991, and others), list several characters that either involve the wings or flight (see above), or are extrapolations (from fossil evidence) to an unobserved ancestral condition involving endites and exites of the thorax and abdominal segments. In Whiting et al. (1997), and Wheeler et al. (2001), the phylogeny of holo- metabolous insects, and later, the entire , were examined using formal cladistic methods. Morphological and ribosomal (18S and 28S) molecular mark- ers were used to find a phylogeny of insects. In the lower Pterygota, they relied heavily on the characters described by Kristensen (1975, 1981, 1991). The mor- phological, as well as total-evidence trees showed support for the Metapterygota, while the 18S tree found a monophyletic Palaeoptera.

23 24 Chapter 5

Ribosomal sequences in phylogenetic systematics

Three papers in this thesis use information from ribosomal sequences. Nuclear 18S and 28S rDNA was used in “The Palaeoptera problem”, nuclear 5.8S and the surrounding non-coding spacers ITS1 and ITS2 was used for the paper on Leucorrhinia phylogeny, and mitochondrial 16S sequences provide most of the support in the phylogenetic study on Ischnurinae.

5.1 Structure and function of the ribosome

Ribosomes are the organelles that translate protein coding mRNA sequences into chains of amino acids that fold up to functional proteins. The ribosomes consists of an RNA scaffolding encrusted with proteins. The active site in ribosomes, where tRNAs connect to the extending amino acid chain is largely free of protein, indicating that the RNA itself is responsible for forming the catalytic site. This has been taken as evidence that the ribosomes are a remnant from the “RNA world” (Gilbert, 1986), before enzymatic proteins evolved and RNA both stored the inheritable information and carried out catalytic reactions. In metazoans there are two distinct varieties of ribosomes: the nuclear ri- bosome found in the cytoplasm, the endoplasmatic reticulum and the nuclear membrane and the mitochondrial ribosome, restricted to the insides of the mi- tochondrion. The nuclear ribosomes are assembled from two major parts: the large- (LSU, or 28S) and the small (SSU, or 18S) subunit. Their mitochondrial counterparts are the 16S and 12S subunits. In contrast to the 16S and 12S, which are encoded from adjacent single copy regions in the mitochondrial DNA, Nuclear Ribosomal RNA is transcribed from repeated regions found in many copies on one or more chromosomes in the nuclear DNA. The ribosomal repeats are transcribed as a unit of single stranded RNA. Aside from 18S and 28S subunits, the ribosomal repeats encode other regions of rRNA. These are the Internal Transcibed Spacers (ITS1 and ITS2) and the 5.8S subunit. Before the ribosome is fully formed the spacers are enzymatically removed. The 5.8S subunit is associated with the large subunit in the mature ribosome. The DNA regions encoding ribosomal repeats are very homogenous within a single genome, and a mechanism known as concerted evolution (Zimmer et al., 1980) is thought to keep the copies identical. The self-complementary nature of nucleic acids not only enables DNA to form the double stranded helix, but allows the rRNA to fold up on itself to a highly ordered 3-dimensional structure. The self-complementary regions are known as “stem”, and the intermittent single-stranded as “loop”-regions. Stem- regions are highly conserved compared to loop-regions, as single mutations in a stem-region causes changes in the secondary- and tertiary structure of the ribosome, which can have severe effects on its ability to function. In molecular systematics, the nuclear rDNA genes have been extensively

25 rRNA Sequence (=primary structure) Secondary structure GAGUAAAGUUAAUACCUUUGCUC GAGUAAAG CUCGUUUC stem loop

Figure 5.1: A self-complementary structure of ribosomal RNA

used, especially small subunit (18S, or SSU) sequences e.g. for metazoa, Lip- scomb et al. (1998); arthropods, Giribet and Rivera (2000); fungi, Tehler et al. (2000); hexapods, Wheeler et al. (2001); plants, Soltis et al. (2000), but also the 28S and the internal transcribed spacer (ITS) regions with the 5.8S . The variability in selective pressure on stems and loops have proven very useful for systematics. The highly conserved stem regions are suitable general primer sites, to the extent that the same set of 18S PCR primers can be used for every- thing from fungi (Tehler et al., 2000), flatworms (Nor´enand Jondelius, 1999), polychaetes (Rousset et al., 2004) as well as insects. Thus variable regions that contain phylogenetic information on several taxonomic levels can be amplified by general primers. The ITS regions are highly variable, but are easy to amplify by PCR using general primers in the 3’ end of the 18S rDNA and the 5’ of 28S.

5.2 Establishing homology in molecular data

Comparing character states in homologous structures is the very basis of phy- logenetic systematics (Hennig, 1966). For morphological characters, primary homology can be established from several criteria: positional homology, on- togeny, structural similarity, etc. In molecular data, ontogeny and structural similarity are not applicable. An adenine “A” in one position is indistinguish- able from any other A. Thus positional information is the only clue for finding homology in DNA data, a procedure referred to as alignment. For protein coding genes, positional homology can easily be established as the sequences have to conform to the amino acid triplet code. A single insertion or deletion in a protein coding sequence shifts the reading frame, and often results in a non-functioning protein, which can be lethal to the organism. Ribosomal are less affected by insertion and deletion events, especially in the loop regions. As a result rDNA sequences from different organisms differ in length to the degree that positional homology is difficult to establish.

5.3 Approaches to multiple sequence alignment

Homologous regions in two DNA sequences can be visualized as a dot-plot ma- trix, where one sequence is represented by the X-axis and the other by the Y-axis. Similarities between any position in one sequence to the other are marked, showing longer stretches of matching sequence as downward diagonal bands going left-to-right on the plot. All possible alignments between two sequences are contained in a dot-plot, as any path that begins in the upper right corner and ends in the lower right represents a possible alignment.

5.3.1 Finding an optimal path To find an optimal alignment, explicit costs for substitutions and gaps have to be set. The costs used must follow the triangle inequality law i.e., the sum of any two kinds of costs must be equal to or greater than any other. If substitutions cost 1, and gaps 0, the optimal result would be an alignment without parsimony informative characters from substitutions.

26 0 1000 0

1000

2000

Figure 5.2: A dot plot of 18S rDNA from the dragonfly Sympetrum sanguineum (Libellulidae) and the stonefly Isoperla obscura (Perlodidae). The break in the diagonal corresponds to a large insert in the stonefly sequence.

Needleman and Wunsch (1970), developed an algorithm to find optimal alignments between protein amino-acid sequences. The algorithm is very gen- eral, and can be applied to any pairwise alignment problem, and is guaranteed to find every optimal path through a pairwise alignment. The N-W algorithm is the basis of all algorithmic multiple alignment.

5.4 Multiple sequence alignment

Although the N-W algorithm was described for solving pairwise sequence align- ment, it can be expanded to finding optimal alignments for more than two sequences. However, this rapidly becomes very computationally demanding, as the number of possible alignments increase geometrically with the number of sequences to align. Computationally hard problems, such finding an optimal multiple alignment, can sometimes be broken down into several smaller prob- lems: a multiple alignment can be re-phrased into a series of pairwise alignments. However, this creates a new problem: you can no longer be sure to have found an optimal alignment, as the result is dependent on the order in which the se- quences are added to the multiple alignment. One method for determining the sequence addition order is to create a guide tree.

5.4.1 Heuristic multiple alignment A common method for creating multiple sequence alignments is the Clustal algorithm (Higgins and Sharp, 1988), as implemented in computer programs ClustalW (Thompson et al., 1994) and ClustalX (Thompson et al., 1997). The Clustal algorithm is a two-stage process: pairwise and multiple alignment. In the pairwise step, phenetic distances between all sequences are calculated. These are used to create a guide tree for the multiple alignment stage. The first versions of Clustal, up to ClustalV, used a simple UPGMA (Sneath and Sokal, 1973) algorithm to create the guide tree, but later versions use a Neighbor-joining (Saitou and Nei, 1987) method. The limitation in Clustal is that it only examines a single guide tree, and outputs a single multiple alignment. The only options for finding better align- ments under one set of multiple alignment costs is to either examine the effects of changing the cost settings in the pairwise alignment stage, or to use guide trees obtained from other methods. MALIGN (Wheeler and Gladstein, 1994), is a computer implementation of a heuristic multiple alignment algorithm. The tenet of the MALIGN philosophy is to use an explicit optimality criterion throughout the process of creating the guide trees and the multiple alignment. The MALIGN algorithm is different

27 from Clustal in that it evaluates several guide trees, and keeps a tally of costs during the multiple alignment stage. The total cost of the alignment will be identical to the tree length if the resulting multiple alignment is analyzed under the same cost parameters that was used in creating the alignment. MALIGN can perform the basic parsimony heuristic searches, such as SPR, TBR and branch- and-bound. The trees found during searches are used as guide trees, with MA- LIGN keeping track of the implied tree-length in finding the most parsimonious multiple alignments. However, MALIGN is magnitudes more computationally demanding than Clustal.

5.5 Optimization methods

From the tree based static alignment method implemented in MALIGN, direct optimization methods is just a step away. These methods were introduced by Wheeler (1996) under the bold title (although with a humble question mark) “Optimization alignment: the end of multiple sequence alignment in phylogenet- ics?” Direct optimization (DO) is derived from the standard cladistic character optimization of Farris (1970) and Fitch (1971). An explicit cost regimen is re- quired for DO, where every allowed kind of transformation must be given a cost. The simplest models only set costs for substitutions (DNA base to another DNA base), and gaps (insertions and deletions). More complicated methods where different types of substitutions have different costs, and there is a lower cost for extending a gap than opening one etc., can also be utilized. In the Wheele- rian philosophy, a cladogram can be interpreted as a computer program that transforms one sequence to another. The events that transformed the ancestral sequence at the node to the sequences observed in the terminal taxa can be deduced from the topology of the tree and the explicit costs used to calculate the tree length. DO finds the lowest total transformation costs needed for a tree (the tree length), and standard heuristics (TBR, SPR, Ratchet) can be used to find the tree that has the lowest total transformation costs. There is no need ever to create a static alignment in this process.

TTT TTG TA TAG

TA(G) +1 gap

TWG +1 substitution

TTK +1 substitution

Figure 5.3: The down-pass of direct optimization. The cost of the optimization is calculated and preliminary ancestral states are reconstructed at the nodes

5.5.1 Parsimony direct optimization – an example

Here I will only present how the simplest parsimony model for DO works, but several optimization methods have been presented e.g. fixed states (Wheeler, 1999), iterative pass optimization (Wheeler, 2003b) and Maximum Likelihood (Wheeler, 2006). These methods are implemented in the computer program POY (Gladstein and Wheeler, 2003). In the example, the optimization is a standard ACCTRAN optimization (Farris, 1970) under Fitch parsimony (un- ordered character states), with equal costs (1) for substitutions and gaps. There is a down-pass, where putative ancestral sequences are created at the nodes, and an up-pass, where the ancestral nodes are reconstructed.

28 The down-pass Starting at the upper right corner, the ancestral state for the sequences TA and TAG has to be re-created. This necessitates either an insertion or deletion of a

G, so the preliminary sequenceTTT atTT theG nodeTA is TA(G).TAG The parenthesis indicating that the third base is either a G, or nothing, so the ancestral sequence was either TAG or TA. Moving down one node, the sequence on the next branch TA(G) +1 gap is TTG. The simplest way of transforming TTG to TA(G) is a substitution in the second position. In the putative ancestralTWG + sequence,1 substitution this is represented by a W, the IUPAC code for either T or A. The third position if fixes as a G, as this state is found possible for both sequences.TTK +1 su Thebstituti putativeon ancestral sequence for this node becomes TWG. Moving further down, the final (root) node is to be reconstructed. Transforming TTT to TWG requires one substitution in the third position, and once again a IUPAC code (K = T or G) is used to represent the ambiguity. In the second position, T is fixed, as it is a possibility for both sequences, and the reconstructed root becomes TTK. The total transformation needed for this tree has been 1 indel and 2 substitutions, for a total cost (or tree length) of 3.

TTT TTG TA TAG

TAG

TTG

TTK

Figure 5.4: The up-pass of direct optimization. Final ancestral states are re- constructed at the nodes.

The up-pass The final cost cannot change by going through the up-pass, but this step will finalize the reconstruction of the ancestral states at each node. This begins at the node above the root, as the root has no ancestors. Each position in the ancestral state will be that of the node below, if they have a possible common character state. Comparing TTK to TWG, W is T or A, and K is T or G. Thus the final reconstructed sequence of that node is TTG. Moving up, TA(G) is compared to TTG. Now, the most parsimonious possible sequence has to be assigned to the node. TA(G) could be either TAG – this would require one substitution, or TA – this would require one substitution and an indel, so the optimized ancestral state of this node has to be TAG, and the deletion has to be an autapomorphy of the terminal taxon with TA.

5.6 Secondary structure alignment

It is known from proteins, as well as ribosomal RNA, that the sequence (or primary structure) is less conserved than the secondary- (2-dimensional) or ter- tiary structure (the 3-dimensional shape). While the 3-dimensional structure cannot yet be inferred from the nucleotide (or amino-acid) sequence, there are numerous models to predict the secondary structure: the loops and stems of ribosomal RNA, and the helices and sheets of proteins. The European riboso- mal database (Wuyts et al., 1994) is an online repository of RNA sequences, aligned after a secondary structure model. The derivation of the model is not strictly mathematical, but an amalgam of manual comparison, theoretical mod- els, and incremental adjustments as more ribosomal sequences become known

29 (Van de Peer et al., 1997). Methods for aligning new sequences after a sec- ondary structure model include using the profile alignment option implemented in Clustal (Nor´enand Jondelius, 1999), manual alignment with visual reference to pre-aligned sequences (Kjer, 2004), and model-based alignment using Hidden Markov Models (Wallberg et al., 2004). Clustal profile alignment uses an aligned matrix to create a consensus sequence. The unaligned sequences are then aligned to this consensus sequence following the standard Clustal algorithm, with all its implicit problems.Wallberg et al. (2004) used a probabilistic model for sequence alignment as implemented in the program HMMer (Eddy, 2003). This program uses pre-aligned sequences to create a statistical model of gaps and nucleotides (or amino-acids). The probability for each kind of nucleotide (or gap), is cal- culated for each position in the model. The custom model can then be applied to unaligned sequences to create a multiple alignment. Although HMMers have some limitations: “HMMs make poor models of RNAs [. . . ] because an HMM cannot describe base pairs ( HMMer manual. p.7)”, this method of creating an alignment with reference to secondary structure is repeatable, and will get bet- ter the more pre-aligned sequences are used in creating the model. However, the “repeatable” methods for secondary structure alignment (Clustal profile align- ment, HMMer), as well as the manual method, all rely on the vaguely defined model of the European Ribosomal database. Unlike an alignment created by MALIGN, or an implied alignment from POY, they do not use an optimality criterion and deciding on the “best” alignment becomes a matter of aesthetics. Phillips et al. (2000) summed up their review on multiple sequence alignment with this cautionary message: “In many ways, alignment is where phylogenetic analysis was 20 years ago. [. . . ] Computer programs for performing align- ments are in their infancy and users are often unfamiliar with the numerical and methodological assumptions made.” Alignment methodology is often a ne- glected step in systematics, compared to recreating the phylogeny. One should never forget that this is the crucial step in which homology assessments are made.

30 Chapter 6

A presentation of the articles

I: Hovm¨oller,, R., K¨allersj¨o,M. and Pape, T., 2004. The Palaeoptera problem: basal pterygote phylogeny inferred from 18S and 28S rDNA sequences. Cladistics 18, 313–323.

This article originates from my undergraduate thesis ”Basal pterygote phylogeny – a molecular study” from Stockholm University (1999). For this study, com- plete 18S sequences, along with a 600 bp fragment of 28S, were obtained from 18 Odonata, 8 Ephemeroptera and the archaeognathan Petrobius brevistylus Car- penter, 1913. This publication spurred a reply by Ogden and Whiting (2003). In their rebuttal, they focused on the omission of a POY sensitivity analysis (Wheeler, 1995), as well as not incorporating the morphological characters of Whiting et al. (1997). In the sensitivity analysis paradigm, the best parame- ters for analyzing molecular data (including creating alignments) are those that minimize incongruence among datasets (Mickevich and Farris, 1981). The most “robust” phylogeny is the one recovered under many different parameter sets. The reanalysis of the data from paper I, found that a monophyletic Palaeoptera is found “only under a small (23%) subset of alignment parameters” The figure 23% was calculated by creating Clustal alignments from 18S, 28S and combined datasets under 11 sets of gap opening weights (1,2 and 5 -100 in 5 step increments), with gap extension either set to 1 or equal to the gap opening cost, and then analyzing the multiple alignments with gaps either as a 5th base or missing data. It should be noted that one of the conclusions of paper I is that 28S rDNA is not useful for finding the basal pterygote phylogeny, yet 28S only datasets accounts for 33% of these analyses. In the 18S only datasets, either a monophyletic Palaeoptera was found (81%), or the basal phylogeny was unresolved (19 %) with gaps treated as missing data. In combination with 28S, and gaps as missing data, Palaeoptera remains at 81%, while exactly one set of parameters each found an unresolved basal polytomy or Opistoptera. If gaps were treated as a 5th state all 18S only analyses found the basal phylogeny unresolved. A monophyletic Metapterygota or Opistoptera was never recovered from 18S or combined 18S + 28S data, only from 28S only analyses accounting for a total of 7%. Ogden and Whiting (2003) also performed a combined analysis with 18S, 28S, morphology and new data from the histone 3 (H3) gene. These analyses always found a well supported monophyletic Metapterygota. Using only molec- ular data, the basal phylogeny varied according to the settings, and all four (Palaeoptera, Metapterygota, Opistoptera, and unresolved) possible outcomes appeared. However, in all analyses including the morphological data, Metapterygota was always recovered. There are no natural boundaries for “reasonable” pa- rameter sets to examine, and by carefully selecting which data to present, the reliability of a group can be given any requested percentage. There is clearly

31 phylogenetic conflict in between the 18S data and morphology. The evidence from 18S can only be considered inconclusive, and the other genetic markers tested (H3, 28S) do not provide information at this taxonomic level. The case of the Palaeoptera problem remains open.

II: Hovm¨oller, R. and Johansson, F., 2004. A phylogenetic perspec- tive on larval spine evolution in Leucorrhinia (Odonata: Libellulidae) based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phyloge- netics and Evolution 30, 653–662. Leucorrhinia Brittinger, 1856 are a group of Anisopterans, consisting of 14 (Tsuda, 2000) to 16 (Paulson et al., 2006) recognized species. The scientific name is derived from the white frons, a plate located above the mouthparts, as leukos is white and ris is nose in classic Greek. The common name is white- face dragonflies in North America and white-face darters in the UK. These dragonflies have a circumboreal distribution, i.e. they are only found on the northern hemisphere. They prefer acidic water, and several species only breed in Sphagnum bogs. In Libellulidae, and many other anisopteran groups, the larvae are equipped with spines on the dorsal and lateral sides of the abdomen. In Leucorrhinia larvae, there are species with strong spines (e.g. L. caudalis (de Charpentier, 1840)), and those completely lacking spines (e.g. L. borealis Hagen, 1890). Johansson and Samuelsson (1994) and Johansson (2002), showed that the spines are effective in defense against predation from fish, and that the length of the spines is affected by the presence or absence of fish in the larval environment. This is an example of predator-induced phenotypic plasticity (re- viewed by Benard (2004)), where the production of spines is affected by not just genetic, but also environmental factors. One of the purposes of this study was to obtain a reliable phylogeny of Leucorrhinia, to find the relations among the species lacking spines. We were able to show that the spines had been reduced at least twice: once in the Paleaarctic L. rubicunda (Linnaeus, 1758), and once in a clade of Nearctic species. The genetic markers used in this study are the internal transcribed spacer (ITS) regions and 5.8S rDNA. We found evidence that concerted evolution, the mechanism which keeps the many copies of ribosomal DNA identical throughout the genome, has less effect over the ITSs than the rDNAs (18S, 28S and 5.8S). This was found when the PCR products proved difficult to sequence, and no amount of tweaking the protocols resulted in clear readings. A solution was to clone the sequences into bacterial plasmids. Cloning is performed by ligating the PCR product into a bacterial plasmid. The plasmids are then mixed with E. coli bacteria with chemically disrupted cell walls, allowing the plasmids into the cytoplasm. The bacteria are grown on a selective medium, which only allows those cells that have taken in a plasmid to multiply. The bacteria are spread on agar plates, where colonies stemming from a single bacterium grow. Each colony is genetically identical, and the insert in the plasmid stems from a single molecule in the PCR product. The result is that individual molecules can be sequenced, even from a mixed PCR product. In every examined case, intraindividual variation was found in the non ITSs, but rarely in the 5.8S rDNA. A modified sensitivity analysis (Wheeler, 1995) was used to evaluate the topological stability in the phylogenetic trees. We tested a variety of settings in the pairwise- and multiple alignment stages, effectually testing various guide trees (from the pairwise step). In retrospect, this was a crude way of circum- venting the limitations of the single guide tree of the Clustal algorithm.

III: Hovm¨oller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera, Coenagrionidae) established from COII and 16S sequences. Manuscript. These are the first results from an ongoing project about the phylogenetic re- lationships within the family Coenagrionidae. The monophyly of the family has been doubted by recent cladistic morphological studies (O’Grady and May,

32 2003; Rehn, 2003), and the subfamilial divisions have been demonstrated to be highly artificial. Coenagrionidae are divided into 5 subfamilies, following pre-cladistic work by Fraser (1957). The characters involved in separating the subgroups are mostly quantitative characters, such as the degree of petiolation: the relative length of the narrow proximal part of the wings. In a preliminary study involving a wider sample of coenagrionids, the only subfamily that was resolved as monophyletic were the Ischnurinae, and I decided to focus on this group. This is also the only group that is diagnosed by clearly defined mor- phological characters: the presence of a vulvar spine in females, and a raised structure of the 10th abdominal segment in males. The placement of the groups outside Ischnurinae proved to be unsupported by parsimony jackknifing, and a forthcoming project is to sequence additional molecular markers to improve stability in these parts of the tree. Two molecular markers were sequenced for this study, both from the mitochondrial genome: 16S ribosomal DNA and cy- tochrome oxidase II (COII), a protein-coding gene. For the alignment of the 16S gene, I used a new method for finding better alignments than those found by Clustal. This method uses the standard cladistic optimality criterion, where shorter trees are preferred. Since there are frequent indels in the 16S gene, gaps are treated as a 5th character state. Following Grant and Kluge (2003), no type of transformational events are given higher weight than another, so all costs (substitutions and gaps) were set to 1 in all steps. An initial alignment was pro- duced by Clustal from the Neighbor-joining distance tree. This alignment was entered into TNT (Goloboff et al., 2005) to find the most parsimonious trees. Of of the most parsimonious trees was then used as a guide tree in Clustal, to produce a new alignment, which in turn was entered into TNT etc. This itera- tive process resulted in trees significantly shorter than the initial tree produced by analysis of the Clustal alignment. At the fourth iteration, the resulting trees were longer, and the tree from the third iteration was submitted to POY to create an implied alignment. The use of POY to create the final alignment was indented to minimize artifacts introduced by the Clustal algorithm. Given a tree and explicit trans- formation costs, POY can in a very short time (seconds in this case) generate an implied alignment (Wheeler, 2003a; Giribet, 2005). The implied alignment is based on the homology statements implicit from the tree. The tree length as calculated from POY is identical to the one of the shortest trees from the static implied alignment. This shows that almost any tree produced by a parsimony method is an improvement over the distance based guide trees produced by Clustal. This simple iterative process eventually yielded trees more than 10% shorter than the initial tree. Ideally, POY could have been used to find the shortest trees too, but the computer resources needed were not available at this time. The 16S and COII sequences were combined and analyzed separately, as well as in a combined analysis. Parsimony jackknifing and Bayesian inference (Ronquist and Huelsenbeck, 2003) were used to estimate stability of the groups in the tree. In Ischnurinae, the two genera Ischnura and Enallagma together make up al- most 50% of the 291 species recognized in the subfamily. 24 out of 29 ischnurine genera have less than 5 species, with 13 being monotypic. One of the purposes of this study was to find the boundaries of Ischnura and Enallagma, as several smaller genera are likely to be ingroups within these. Ischnura was found to be monophyletic if the monotypic genus Rhodischnura was allowed as an ingroup, while Enallagma was never found to be monophyletic. Also, Ischnura hastata (Say, 1893), unusual in having a pterostigma behind the wing margin, was found to be a true Ischnura. It had previously sometimes been placed in the mono- typic genus Anomalagrion. Historically, Enallagma has been used for species in two geographically disjunct areas: the Northern hemisphere and Africa. As was suggested by May (2002), the African Enallagma are not closely related to the Holarctic monophyletic group. A puzzling find was that samples from two (Brauer, 1865), a species with a wide geographical distribution from Tahiti to the Middle East, did not group together. An investigation into

33 this using the ITS regions hints that I. aurora may be a species complex, and could possibly be divided into several species (Dumont, pers. comm.).

IV: Hovm¨oller, R. A catalog of species group names in the genus Coenagrion Kirby, 1890 (Odonata: Coenagrionidae). Manuscript. This is a purely taxonomical study, as it does not contain any analytical findings. However, taxonomic information is a necessity in systematics for providing the correct names of species and locating type material and descriptions. Sources for taxonomic information are scattered all over historical literature, and there is no central repository for species names, descriptions and information of type material. One of my findings was that the species Coenagrion exornatum (de S´elys- Longchamps, 1872) as listed in several catalogs, simply did not exist! The bibliographical reference for C. exornatum is found in the catalog published by Kirby (1890), pointing to a description by de S´elys-Longchamps, 1872. Only by checking the original 1872 description, it could be deduced that Kirby must have accidentally changed C. ecornutum into C. C. exornatum. On the page specified, only the description of Agrion ecornutum can be found. Errors introduced by one catalog author are propagated by later compilers, and once in a while a return to the sources is useful for clearing up inconsistencies and finding accurate bibliographical data. This takes many trips to the library and emails to curators all over the world.

V: Hovm¨oller, R. A proposal to conserve the name Calopteryx Leach, 1815 over Agrion Fabricius, 1775. Manuscript. The rule of priority is one of the central tenets in nomenclature. This is the rule that the first name imposed on a taxon (species-level or higher) should be used for that group and cannot be replaced by a younger synonym. However, some- times older names are forgotten, or fall into disuse even if they formally have priority. For this reason, the International Commission of Zoological Nomen- clature (ICZN), is an instance of appeal for when zoologists notice that there is a need to suppress a formally senior name when a junior name is in such prevailing usage that a reversal would threaten taxonomic stability. In the case of Agrion and Calopteryx, this was an old disagreement that was never formally settled. In this case, Kirby (1890) is once again one of the culprits! When Kirby wrote his catalog of Odonata, there were no formal published rules on zoological nomenclature. Kirby was a strong enthusiast of the rules of priority, and devised new names for taxa whenever he thought the senior name could be threatened. Thus the usage of the name Calopteryx Leach, 1815 and Agrion Fabricius, 1775 were radically changed. Latreille (1810), had indicated Agrion virgo Linnaeus, 1758, as type species for the genus Agrion Fabricius, 1775. At this point in time, only the genus Agrion was recognized in the entire Zygoptera. Leach (1815) described the new genus Calepteryx for “Agrionida with coloured wings”, as well as the genus Lestes. The naming scheme with using Agrion for Coenagrionoidea, Lestes for Lestidae and Calopteryx for, well, Calopterygids was used by most of the important odonatologists of the 19th century. Kirby decided to apply the rules of priority strictly, and reverted the Calopterygids to Agrion and devised the new taxon Coenagrion for the species at that time usually called Agrion. The result was confusion about which group should really be called Agrion. In the debated that followed, the usage of Agrion was clearly an emotional issue. Erich Schmidt (1948) raised the question if the name changes introduced by Kirby added to, or reduced, nomenclatural confusion: “ [. . . ]why should I use Agrion, when the arguments offered for the change are in no way indis- putable? If I continue to use Calopteryx, as hitherto in all my published papers, I am sure to be understood correctly at once, and this is the principal mat- ter.” A (harsh) reply from Cynthia Longfellow came the following year: “How exceedingly tiresome of Dr. Erich Schmidt to have again raised the question

34 of ‘Calopteryx versus Agrion’, and on insufficient knowledge.” Citing the rules of priority, Longfellow concluded “The case for Agrion versus Calopteryx is clearly proved and all Dr. Schmidt’s arguments are useless.” In Schmidt’s re- buttal (ibid.), he resorts to hoping for a decision against Latreille’s genus types by the “God-like International Commission of Zoological Nomenclature”, but “[. . . ]this is only a dream of the future. However, the present generation has a duty to establish an accord in nomenclature as soon as possible [. . . ] especially for the younger generation, in order to prevent, in the end, football versus en- tomology.” In 1954, everyone seemed to have settled down when Montgomery wrote a very thorough paper on “Nomenclatural confusion in the Odonata; The Agrion-Calopteryx problems.” This article delves deeply into the etymology of the Greek behind the names Calopteryx and Agrion, and the correct form for the family named after the latter genus (it should be Agrionidae, rather than Agri- idae or Agrioidae). This is followed by a careful examination of the literature and the finding that Agrion does have priority over Calopteryx. This conclusion has been accepted, but not applied by later authors. In recent faunistic litera- ture (Westfall and May, 1996; Askew, 1988), the issue is recapitulated with the conclusion that using Agrion would be formally correct, but using Calopteryx is actually less confusing. I found that the issue had never been formally settled, although a manuscript written by Montgomery (1955) to conserve Agrion was widely circulated but never published (Garrison, pers. comm.). I drafted this manuscript as an ap- peal to the ICZN, formulated according to their specifications. It is currently circulated among odonatologists, as to avoid stirring up a hornet’s nest like Erich Schmidt!

Figure 6.1: Calopterygidae: Calopteryx virgo (Linnaeus, 1758).

35 36 Kapitel 7

Sammanfattning p˚asvenska

Trollsl¨andor tillh¨or de insekter som ¨ar l¨attast att k¨anna igen. Deras skickliga man¨ovrar i luften, de skimrande vingarna hos jungfrusl¨andor och kanske ¨aven de sm˚aflicksl¨andorna ¨ar en bekant syn f¨or den som tillbringat en sommaref- termiddag vid en sj¨o. Trollsl¨andor ¨ar en av de ¨aldsta grupperna av nu levande insekter, och en nyckelgrupp i insekternas naturhistoria och utvecklingen av insektsvingar.

7.1 Inledning

Avhandlingen sammanfattar den forskning jag har utf¨ort vid Naturhistoriska riksmuseet 2001–2006. Den inkluderar fylogenetiska studier ¨over trollsl¨andornas sl¨aktskap ur olika perspektiv, samt rent taxonomiska avsnitt d¨ar jag av nomen- klaturorsaker har gjort djupdykningar i arkiven f¨or att reda ut vilka namn som ¨ar giltiga inom flicksl¨andesl¨aktet Coenagrion och vilket vetenskapligt namn som ¨ar det r¨atta f¨or jungfrusl¨andorna: Agrion eller Calopteryx.

7.2 Trollsl¨andors liv och naturhistoria

Trollsl¨andor anv¨ands som namn f¨or hela ordningen Odonata, men ibland ocks˚a specifikt f¨or gruppen Anisoptera. H¨ar anv¨ander jag “trollsl¨andor” f¨or hela Odo- nata, “¨akta trollsl¨andor” f¨or Anisoptera samt “flick- och jungfrusl¨andor” f¨or Zygoptera. De ¨aldsta fossilen av trollsl¨andelika insekter ¨ar fr˚an ¨ovre karbon och h¨or till ordningen Protodonata, en utd¨od grupp som ¨ar trollsl¨andornas historiskt n¨armaste sl¨aktingar. Till denna grupp h¨or permiana som med ett vingspann p˚a ¨over 70 cm ¨ar den st¨orsta insekt som funnits. De ¨aldsta fossilen ¨ar mestadels avtryck av vingar, men fr˚andessa ¨ar det k¨ant att Protodonata var mycket trollsl¨andelika insekter. Inga larver har hittats, men det ¨ar fullt m¨ojligt att de var akvatiska. Akta¨ trollsl¨andor har hittats bland fossil fr˚anperm, huvudsakligen representerade av utd¨oda grupper men ¨aven ett vingfragment som kan ha kommit fr˚anen flicksl¨anda av nutida typ har p˚atr¨affats.

7.2.1 Klassificering av trollsl¨andor – en historisk ¨oversikt Trollsl¨andorna placerades av Linn´ei ett enda sl¨akte, Libellula, inom ordningen Neuroptera. Namnet Libellula betyder “liten v˚ag”och syftar p˚aen gammaldags besmanv˚ag.Linn´eplacerade alla insekter med tv¨arribbor i vingarna i denna ord- ning, som inneh¨oll alla de insektsgrupper med efterleden –sl¨andor: dagsl¨andor, trollsl¨andor, b¨acksl¨andor, st¨ovsl¨andor, nattsl¨andor och skorpionsl¨andor samt de n¨atvingeartade (Neuropteroida) insektsordningarna (¨akta n¨atvingar, ormhals- sl¨andor och s¨avsl¨andor). Eftersom den linn´eanska ordningen Neuroptera visade sig vara en onaturlig grupp av insekter som inte var n¨armare sl¨akt med varand-

37 ra, och de ¨ovriga “sl¨andorna” har placerats i egna ordningar, omfattar numera ordningen Neuroptera bara gruppen ¨akta n¨atvingar.

Den f¨orste att dela upp trollsl¨andorna i mindre grupper var Fabricius, som 1775 br¨ot upp Linn´es Libellula i tre sl¨akten: Aeshna f¨or mosaik-, flod- och kungstrollsl¨andor, Agrion f¨or flick- och jungfrusl¨andor, samt Libellula f¨or segel- och guldtrollsl¨andor.

Trollsl¨andor fortsattes att betraktas som en del av Neuroptera l˚angt in p˚a 1900-talet, trots att man var medveten om att det var en onaturlig gruppering. Ibland f¨ordes de ihop med de ¨ovriga “sl¨andor” som har ofullst¨andig f¨orvandling, dvs. dagsl¨andor, b¨acksl¨andor och st¨ovsl¨andor, i gruppen Pseudoneuroptera, eller som en sj¨alvst¨andig ordning i Paraneuroptera.

Betydande f¨orkladistiska studier ¨over trollsl¨andornas fylogeni utf¨ordes un- der det tidiga 1900-talet av Needham och Munz, samt senare ¨aven Fraser. Un- der denna tidsperiod utgick man mycket fr˚anHaeckels teori om att ontogenin upprepar fylogenin – en organism upprepar stadier dess f¨orf¨ader genomg˚attun- der evolutionshistorien i sin embryonalutveckling. Ett popul¨art exempel var de g¨alb˚agaroch simhud som finns under en kort tid under fosterutvecklingen hos d¨aggdjur. Hos trollsl¨andelarver kan man se hur vingribbn¨atet anl¨aggs genom ˚adror som v¨axer in i vinganlagen fr˚ankroppssidan. Man utgick ifr˚anatt de ribbor som anlades f¨orst var de mest ursprungliga, och genom att studera ut- vecklingen av vingribbsn¨atet genom larvstadierna sl¨ot man sig till vilka drag som var primitiva respektive avancerade. Senare har det visat sig att utvecklingen av vingribbor, s˚av¨al som de ˚adror med kroppsv¨atska som finns i vingarna, snarare f¨oljer de h˚alrum, lakuner, som bildas i vinganlagen l˚angtinnan vingribbor eller kroppsv¨atske˚adror v¨axer in.

Needham j¨amf¨orde trollsl¨andor sl¨aktesvis f¨or att uppt¨acka m¨onster i grup- pens evolution. Karakt¨arstillst˚and klassificerades som antingen primitiva (fram- och bakvingar likformade), eller avancerade (fram- och bakvingar olikforma- de). Needham, liksom Munz, tycke sig kunna se en tv˚adelning i utvecklingen av trollsl¨andorna mellan Zygoptera och Anisoptera.

Fraser gjorde ett banbrytande arbete i sin reklassificering av hela Odo- nata. Han gick noggrant igenom vingkarakt¨arer, men utgick fortfarande fr˚an t¨ankandet i utvecklingslinjer n¨ar han ritade ett sl¨akttr¨ad ¨over ordningen Odo- nata. I detta tr¨ad ligger familjegrupper som stationer p˚aen tunnelbanekar- ta, med den mest avancerade familjen som slutstation. Till exempel m˚aste flicksl¨andet˚aget passera Platystichtidae, Protoneuridae och Platycnemididae in- nan det kan n˚afram till full¨anding i Coenagrionidae. Fraser ans˚agatt Zygoptera inte var en enhetlig grupp, utan inneh¨oll arter som via en gradvis utveckling n˚adde de ¨akta trollsl¨andorna.

Den f¨orsta st¨orre kladistiska ¨oversikten av trollsl¨andesystematiken kom s˚a sent som 1996. D˚apublicerade australiensaren John Trueman sin morfologiska studie baserad p˚avingkarakt¨arer fr˚an32 nutida och 14 fossila arter. Han fann ocks˚aatt flick- och jungfrusl¨andorna utgjorde en parafyletisk (icke-naturlig) grupp. En ¨overraskning var att den den s¨allsynta flicksl¨andan Hemiphlebia mi- rabilis, endemisk f¨or Australien och Tasmanien, visade sig vara systertaxon till hela ¨ovriga Odonata!

Rehn (2003) publicerade en mycket ambiti¨os studie ¨over ordningen Odona- ta. Denna studie fokuserade p˚asl¨aktskapsf¨orh˚allandena mellan st¨orre grupper inom flick- och jungfrusl¨andor och baserades p˚amorfologi, men inte bara fr˚an vingkarakt¨arer. Rehn fann, att flick- och jungfrusl¨andor utgjorde en naturlig systergrupp till Epiprocta som inneh˚allerde ¨akta trollsl¨andorna samt de som placerats i den parafyletiska gruppen Anisozygoptera. Ett viktigt resultat var att klassificeringen i ¨overfamiljer bland flick- och jungfrusl¨andor visade sig vara baserad p˚aicke-naturliga grupper.

38 7.3 En trollsl¨andas livscykel

En vanlig missuppfatting ¨ar att trollsl¨andor bara lever en enda dag, n˚agonting som f¨ormodligen kommer ifr˚anen sammanblandning med de mycket kortliva- de dagsl¨andorna. Livscykeln hos en trollsl¨anda varierar mellan ett halv˚arf¨or vissa sm˚aflicksl¨andor upp till de nio ˚arutvecklingen kan ta hos den s¨allsynta trollsl¨andan Hemiphlebia laidlawii. Den l¨angsta delen av livscykeln utg¨ors av larvstadier, med en sista s¨asong som fullbildad flygande insekt. Trots att den flygande trollsl¨andan endast lever n˚agra dar till n˚agram˚anader s˚ahinner de jaga byten, f¨orsvara ett revir och para sig under denna period.

7.3.1 Larvstadiet Yngelstadier hos de insekter som inte har fullst¨andig f¨orvandling (med larv, puppa och imago) brukar kallas nymfer, men trollsl¨andors yngelstadier brukar ¨aven de kallas larver, och jag f¨oljer den terminologin h¨ar. Ett ¨aldre namn som aldrig slog igenom f¨or vattenlevande insektsnymfer ¨ar najader. Vackert, men lika bortgl¨omt som Linn´es yrf¨an som svenskt ord f¨or insekter. Trollsl¨andelarv- er lever i alla slags s¨otvatten, fr˚anstr¨ommande vatten till sura mossar, sj¨oar och sm˚adammar. Flick- och jungfrusl¨andelarver k¨anns igen p˚aden sm¨ackra kroppsbyggnaden och de tre bladg¨alarna i bakkroppsspetsen. Larverna hos ¨akta trollsl¨andor ¨ar mer kraftigt byggda och saknar helt yttre g¨alar. De f¨orlitar sig p˚aen veckad g¨altarm f¨or syreupptagning. Vatten kan pumpas ut och in genom anus, och genom att snabbt pressa ut allt vatten ur tarmen kan trollsl¨andelarver f¨orflytta sig korta str¨ackor genom jetdrift! Detta har f¨ormodligen utvecklats som ett s¨att att undfly rovdjur som andra st¨orre vatteninsekter och fiskar. Trollsl¨andelarvers ekologi ˚aterspeglas i kroppsformen. Lurpassare ¨ar satta och taggiga, medan aktiva j¨agare ¨ar avl˚anga och str¨omlinjeformade. En unik anpassning hos trollsl¨andelarver ¨ar f˚angstmasken. Denna best˚arav ett omfor- mat labium, den understa mundelen hos insekter, med en g˚angj¨arnsled och tv˚a r¨orliga palper. I hopf¨allt tillst˚and ligger den vikt under huvudet, med de tanda- de palperna t¨ackande st¨orre delen av ansiktet. N¨ar ett byte skall f˚angaskastas f˚angstmasken ut, och palperna sl˚arigen som en r¨avsax. Byten utg¨ors av sm˚a vattendjur som maskar, mygglarver och grodyngel. Trollsl¨andor genomg˚arto- talt 8-15 larvstadier. De kan bara v¨axa i storlek mellan skal¨omsningar, n˚agot de g¨or genom att pumpa upp sig sj¨alva med vatten innan den nya huden ¨annu inte hunnit h˚ardna till ett skal. Vinganlag b¨orjar anas som sm˚aflikar i omkring tredje eller fj¨arde larvstadiet. De blir proportionerligt st¨orre f¨or varje ¨omsning. I det sista larvstadiet kan vingribbm¨onstren hos den fullbildade sl¨andan anas i de halvgenomskinliga vinganlagen.

7.3.2 F¨orvandlingen Ett par dagar innan den akvatiska delen av livscykeln avslutas slutar larven att ¨ata, och den sista ¨omsningen sker inuti larvskalet. Larven kryper sedan upp p˚a land f¨or att fullborda f¨orvandlingen, p˚aett vasstr˚aeller en klippa. Omsningen¨ sker genom att skalet spricker upp ¨over ryggen och huvudet, och trollsl¨andan kryper ut med huvud och mellankropp f¨orst. N¨ar benen har h¨ardat i luften drar den ut bakkroppen ur skalet. Den ny¨omsade trollsl¨andan bl˚aser upp sig sj¨alv till full storlek genom att fylla kroppen med luft och sedan pressa ut kroppsv¨atska i vingribborna och bakkroppen. En ny¨omsad trollsl¨anda k¨anns igen p˚ade bleka f¨argerna och p˚aatt vingarna skimrar som s˚apbubblor.

7.3.3 Imagon – den fullbildade sl¨andan Ny¨omsade trollsl¨andor ger sig ibland av fr˚anvattnet tills de blivit k¨onsmogna. De ˚aterv¨ander f¨or det mesta till det vattendrag d¨ar de kl¨acktes, men kan ¨aven g¨ora l¨angre f¨orflyttningar. Ett extremt exempel ¨ar mosaiktrollsl¨andan Hemianax ephippiger som normalt lever i ¨okenomr˚aden i Nordafrika och Mellan¨ostern, men

39 har hittats s˚al˚angt bort som p˚aIsland, d¨ar det inte f¨orekommer n˚agra inhemska trollsl¨andearter.

7.3.4 Parningssystemet Bland insekterna har trollsl¨andor ett helt unikt parningssystem. Hanar har f¨orutom de prim¨ara k¨onsorganen i bakkroppsspetsen sekund¨ara k¨onsorgan p˚a undersidan av de andra och tredje bakkroppssegmenten. Denna struktur har ingen motsvarighet hos n˚agonannan insektsgrupp, och ¨ar sv˚artolkad ur ett evo- lution¨art perspektiv. De vingl¨osa insekterna (som silverfiskar och hoppstj¨artar) har extern befruktning – hanar deponerar en spermatofor direkt p˚amarken och denna plockas upp av honan utan att n˚agonegentlig parning sker. Ovriga¨ vingade insekter har intern befruktning d¨ar parningen sker k¨ons¨oppning mot k¨ons¨oppning. Hos trollsl¨andor f¨orflyttar hanen sperma fr˚anbakkroppsspetsen till en reservoar i de sekund¨ara k¨onsorganen. Vid parningen anv¨ander hanen sina cerci (bakkroppsspr¨ot) f¨or att greppa honan, antingen bakom huvudet (hos ¨akta trollsl¨andor), eller runt mellankroppens f¨orsta segment (flick- och jung- frusl¨andor). Honan m˚astesedan b¨oja sin bakkropp upp mot hanens sekund¨ara k¨onsorgan f¨or att parningen skall slutf¨oras. B˚adede prim¨ara och sekund¨ara k¨onsorganen hos trollsl¨andor ¨ar viktiga karakt¨arer f¨or artbest¨amning: ¨aven hos arter som ¨ar ytligt sett mycket lika finns det sm˚amen distinkta skillnader i dessa strukturer.

7.3.5 Parningsspel och artigenk¨anning Trollsl¨andor f¨orlitar sig p˚asynen och k¨anseln f¨or att k¨anna igen artfr¨ander. I ett f˚atal grupper, som jungfrusl¨andor, f¨oreg˚asparningen av ett parningsspel d¨ar hanen fladdrar med vingarna och visar upp den ljusa undersidan av bak- kroppsspetsen. Hos ¨akta trollsl¨andor sker artigenk¨anningen helt genom visuella signaler. Hanar av k¨arrtrollsl¨andor, Leucorrhinia, tolkar flygstilen hos andra trollsl¨andor, och uppvaktar allting som inte flyger som en hane av samma art. Bland flicksl¨andor ¨ar k¨anselsignaler viktiga f¨or artigenk¨anningen. Hanar f¨ors¨oker ofta para sig med individer av annan art, men lyckas d˚ainte f˚agrepp runt det f¨orsta mellankroppssegmentet. I de fall d¨ar hanen lyckas gripa en hona av annan art sker ofta ingen parning. P˚aundersidan av det andra mellankropps- segmentet finns en mesostigmalplatta som ¨ar f¨orsedd med strategiskt placerade k¨anselborst. Endast hanar av artfr¨ander har bakkroppsspr¨ot som passar och tr¨affar r¨att k¨anselborst. Om inte r¨att borst ber¨ors av hanen v¨agrar honan att b¨oja upp bakkroppen mot hanens sekund¨ara k¨onsorgan och genomf¨ora parning- en.

7.3.6 Aggl¨ ¨aggning Mycket kort tid efter parningen l¨agger honan sina ¨agg. Detta sker ibland medan paret ¨ar hopkopplade i tandem. Det ursprungliga tillst˚andet hos trollsl¨andor ¨ar att l¨agga ¨aggen inuti v¨axtmaterial, s˚akallad endofytisk ¨aggl¨aggning. Hos alla flick- och jungfrusl¨andor, samt de ursprungligaste grupperna bland ¨akta trollsl¨andor har honan en s˚agtandad ¨aggl¨aggare som snittar sm˚ah˚ali v¨axter d¨ar ¨aggen l¨aggs ett och ett. I de grupper d¨ar ¨aggl¨aggaren har f¨orlorats l¨aggs ¨aggen i ¨oppet vatten, eller borras ner i dy eller sand. En udda metod finns hos guldtrollsl¨andan Epitheca bimaculata d¨ar ¨aggen l¨aggs i gel´eartade str¨angar, liknande grodrom.

7.3.7 Flyg- och jaktbeteende Kroppen hos en trollsl¨anda har m˚angaanpassningar f¨or ett liv som aktivt ja- gande rovdjur. De stora fasett¨ogonen ¨ar anpassade f¨or att uppt¨acka r¨orelse mer ¨an f¨or att k¨anna igen m˚albilder av byten. Mellankroppen ¨ar vinklad fram˚ats˚a att de taggiga benen bildar en f˚angstbur f¨or att gripa och h˚allafast bytet. Mun- delarna best˚arav ett par kraftiga mandibler som river bytet i mindre delar, och

40 ett par syllika maxiller som h˚allerdet i ett stadigt grepp. N¨ar det g¨aller dieten ¨ar trollsl¨andor generalister, men flugor och mygg utg¨or stapelf¨odan. Ett f˚atal grupper has specialiserat sig, som helikopterflicksl¨andorna (Pseudostigmatidae) i Syd- och Mellanamerika som ¨ar specialister p˚aatt ¨ata spindlar. De sv¨avar fram mot spindeln¨at i tr¨ad och plockar skickligt innehavaren. Sedan flyger de bakl¨anges bort fr˚ann¨atet. N¨ar de landat, knipsar de f¨orst av benen p˚aspindeln innan de ¨ater upp kroppen.

7.4 De nu levande trollsl¨andornas diversitet

Traditionellt delas trollsl¨andor in i Zygoptera (flick- och jungfrusl¨andor), An- isoptera (¨akta trollsl¨andor) samt Anisozygoptera (saknar svenskt namn). Det finns ca 6000 beskrivna arter av trollsl¨andor, och en gissning ¨ar att det finns f¨arre ¨an 10000 totalt.

7.4.1 Zygoptera Flick- och jungfrusl¨andor k¨anns igen p˚aden smala kroppen, det framifr˚antill- plattade huvudet med utst˚aende brett skilda fasett¨ogon och n¨astan likformade fram- och bakvingar. De ¨ar f¨or det mesta svaga flygare och f¨orflyttar sig s¨allan l¨angre str¨ackor.

Calopterygoidea Typfamiljen i denna grupp ¨ar Calopterygidae, jungfrusl¨andor. De lever vanligen i str¨omvatten och hanarna uppvaktar honor med parningsspel. Kroppen ¨ar ofta bl˚a-eller gr¨onmetallisk, och vingarna ¨ar m¨orkf¨argade.

“Lestinoidea” Detta ¨ar en parafyletisk grupp som inte ¨ar baserad p˚an˚agra enkla karakt¨arer. Vingarna ¨ar vanligen avsmalnande mot kroppen och h˚alls n˚agotutslagna n¨ar sl¨andan sitter stilla. Smaragdflicksl¨andorna, Lestes och vinterflicksl¨andan Sym- pecma fusca h¨or hit.

Coenagrionoidea Inom denna grupp finns s˚aval de minsta flicksl¨andorna som de allra l¨angsta helikopterflicksl¨andorna (Pseudostigmatidae), vilka kan ha en bakkroppsl¨angd ¨over 21 cm. Ekologiskt ¨ar det en divers grupp. Vanligast ¨ar larvutveckling i stil- last˚aendevatten, men ¨aven str¨ommande vatten utnyttjas av flodflicksl¨andorna (Platycnemididae). De udda helikopterflicksl¨andornas larver lever i vattenfyll- da tr¨adh˚aloch epifytiska ananasv¨axter. Vingarna h˚allsvid vila ihopslagna ¨over bakkroppen.

Hemiphleboidea Denna grupp innefattar en enda art, den lilla s¨allsynta Hemiphlebia mirabilis, endemisk f¨or Australien och Tasmanien. Den har betraktats som mycket primi- tiv, eftersom den saknar den innersta tv¨arsl˚ani vingen, arculus, n˚agotsom finns hos alla andra trollsl¨andor men saknas hos utd¨oda grupper. Det har senare visat sig att detta ¨ar en sekund¨ar f¨orlust hos Hemiphlebia, eftersom ett par procent av alla individer trots allt har en utveckad arculus.

7.4.2 Epiprocta Detta ¨ar en sammanslagning av den parafyletiska gruppen Anisozygoptera och den monofyletiska gruppen Anisoptera. Karakt¨aren som f¨orenar gruppen ¨ar att de undre bakkroppsspr¨oten, paraprocterna, har sm¨alt samman.

41 Den parafyletiska gruppen Anisozygoptera Historiskt var Anisozygoptera en artrik grupp, men nu finns endast tv˚alevande representanter, b˚ada i sl¨aktet Epiophlebia. Dessa ser ut som en felande l¨ank mel- lan Zygoptera och Anisoptera. De har ¨ogon som sitter brett ˚atskilda, men till formen ¨ar Anisoptera-artade. Mellankroppen ¨ar kraftigt byggd, som hos Aniso- ptera, men vingarna ¨ar likformiga som hos Zygoptera. En fungerande ¨aggl¨aggare finns. Larverna ¨ar byggda som Anisopter-larver, men saknar f¨orm˚agantill jet- drift. Av de tv˚aarterna ¨ar Epiophlebia superstes vanlig p˚ade Japanska ¨oarna, men Epiophlebia laidlawii f¨orekommer endast p˚a ¨over 1800 m h¨ojd i Himalaya.

7.4.3 Anisoptera - ¨akta trollsl¨andor Namnet syftar p˚ade olikformade fram- och bakvingarna. De senare ¨ar bredare och har ofta en skarp vinkel vid basen. De ¨akta trollsl¨andorna ¨ar skickliga flygare och kan sv¨ava i luften och flyga i alla riktningar, ¨aven bakl¨anges. Larverna ¨ar kraftiga och kan f¨orflytta sig korta str¨ackor med jetdrift. Vid vila h˚allsvingarna brett utslagna ˚atsidorna.

“Aeshnoidea” Detta namn t¨acker de ursprungligare trollsl¨andefamiljerna Aeshnidae, Gomphi- dae och Petaluridae. Gomphidae (flodtrollsl¨andor) och Petaluridae har beh˚allit de ursprungliga separerade fasett¨ogonen medan Aeshnidae (mosaiktrollsl¨andor) har mer typiska trollsl¨ande¨ogon som t¨acker n¨astan hela huvudet. De har alla den ursprungliga f¨argskalan, med svart bottenf¨arg och ljusare r¨ander p˚amellan- och bakkroppen. Aggen¨ l¨aggs endofytiskt f¨orutom i Gomphidae.

Cordulegastroidea Kungstrollsl¨andorna, Cordulegastridae, ¨ar den enda familjen i denna holarkt- iska grupp. De har den ursprungliga svart-gula f¨argskalan som aeshnoiderna. Honorna har en sekund¨ar ¨aggl¨aggare som anv¨ands f¨or att borra in ¨agg i dy och sand i str¨ommande vatten.

Libelluloidea Denna monofyletiska grupp uppvisar en stor del av den morfologiska variationen inom de ¨akta trollsl¨andorna. Libelluloider finns i alla typer av vatten ¨over hela jorden. Storleksm¨assigt varierar de mellan j¨attarna i familjen Chlorogomphidae (med vingspann upp till 15 cm) och den knappt tumsl˚anga Nannophyopsis clara i Libellulidae. Alla typer av f¨arger f¨orekommer, och m¨onstrade vingar ¨ar vanligt. Inom denna grupp finns sl¨aktet Libellula, som var Linn´esursprungliga sl¨akte f¨or alla arter som nu ing˚ari ordningen Odonata.

7.5 En nyckelgrupp i insekternas evolution

Vingar och aktiv flygning har uppst˚att fyra g˚anger under evolutionen: hos insek- ter, flyg¨odlor, f˚aglaroch fladderm¨oss. Bland ryggradsdjuren ¨ar det uppenbart att vingarna har uppst˚attflera g˚anger oberoende av varandra eftersom de har bildats fr˚anolika strukturer. Hos flyg¨odlorna h¨olls vingmembranet uppe av ett f¨orl¨angt finger, hos fladderm¨oss av huden mellan fingrarna och hos f˚aglarbildas vingframkanten av benen i armen och vingytan av fj¨adrar. Hos ryggradsdjuren ¨ar det ocks˚al¨att att f¨orst˚avarifr˚anvingarna utvecklades, eftersom de alla ¨ar mo- difierade framben. Bland ¨ovriga leddjur finns det ingen sj¨alvklar motsvarighet till insekternas vingar. De ¨aldsta insektsfossilen har hittats i 400 miljoner ˚argammal r¨od sandsten i Rhynie, Skottland. Ett av dessa fossil, Rhyniognatha hirsti best˚arendast av fragment fr˚anmundelar. Fossilet hittades 1925, men en ny unders¨okning har visat att mundelarna liknar de som endast finns hos trollsl¨andor och h¨ogre

42 vingade insekter. Detta tyder p˚aatt vingarna utvecklades tidigt i insekternas historia. Det har inte hittats n˚agotmellansteg i utvecklingen av vingar i fos- sil, d¨ar de antingen saknas helt eller ¨ar fullt utvecklade flygdugliga vingar av modern typ. Det finns inte heller n˚agraledtr˚adar att h¨amta fr˚anfylogenin, ef- tersom systergruppen till de vingf¨orsedda insekterna ¨ar de fullst¨andigt vingl¨osa fj¨allborstsvansarna. Mer eller mindre trov¨ardiga teorier om vingarnas uppkomst har framlagts inom utvecklingsbiologi, etologi, morfologi och palaeoekologi. De skall tas f¨or vad de ¨ar – intressanta hypoteser, mer eller mindre trov¨ardiga och tankev¨ackande, men trots allt spekulationer.

7.5.1 Vingutveckling p˚aland – paranotalhypotesen

Snodgrass lanserade i sitt standardverk om insektsmorfologi teorin om att ving- flikar uppst˚attsom genom en utvidgning av den mjuka kroppsv¨aggen mellan sidopl˚atarna och ovansidan av mellankroppssegmenten. Ovansidan av ett mel- lankroppssegment hos insekter kallas notum, och paranota betyder “vid sidan av notum”. Den ursprungliga funktionen skall ha varit glidflygning, och r¨orlighet och muskulatur n˚agotsom utvecklats senare. Ett annat f¨orslag p˚aden ursprung- liga funktionen ¨ar att vingflikarna anv¨andes f¨or parningsspel. Sexuell selektion skall sedan ha drivit dem mot st¨orre och st¨orre strukturer. Aven¨ v¨armereglering har f¨oreslagits som en ursprunglig funktion f¨or vingflikar, och det har bevisats experimentellt att ¨aven sm˚avingflikar skulle ge ett betydligt v¨armetillskott som kunde ¨oka r¨orligheten hos en liten insekt.

7.5.2 Vingutveckling i vatten – omformade g¨alar?

Andra hypotes om vingarnas uppkomst ¨ar att de har utvecklats i s¨otvatten och ursprungligen haft en annan funktion ¨an flygning. Ett f¨orslag som lagts fram ¨ar att vingar har sitt ursprung i en ben-associerad struktur kallad epicoxa. Detta ¨ar ett helt hypotetiskt segment, som ¨ar resultatet av en extrapolering fr˚an fossil och nutida leddjur hur det ursprungliga leddjursbenet s˚agut, och vilka segment som ingick. I denna modell ¨ar de g¨alar som finns l¨angs bakkroppen hos dagsl¨andenymfer en motsvarighet till vingar, vad g¨aller position i segmentet och ursprunglig funktion. Insektsvingar blir ocks˚agenom den hypotetiska epicoxan j¨amf¨orbara med de beng¨alar som finns hos vissa kr¨aftdjur. Hos vissa b¨acksl¨andor f¨orekommer ett beteende som kallas “skimming”, n˚agotsom jag i brist p˚ab¨attre motsvarande begrepp kallar surfning. B¨acksl¨andenymfer ¨ar vattenlevande, och de fullbildade sl¨andorna h˚alleralltid till n¨ara vattendrag. Surfningen inneb¨ar att den nykl¨ackta b¨acksl¨andan anv¨ander vingarna som segel, utan att n˚agonsin l¨amna vattenytan. G¨alblad skulle ursprungligen varit icke-r¨orliga strukturer som anv¨ants som segel, och selektionen skulle gynnat st¨orre, r¨orligare och till slut flygdugliga strukturer. Hypotesen of surfning som ett f¨orstadium till flygning har dock inget som helst st¨od i fylogenin. B¨acksl¨andor ¨ar inte en basal grupp bland h¨ogre vingade insekter (Neoptera), och de arter som surfar ¨ar inte basala inom ordningen b¨acksl¨andor. Det r¨or sig snarare om en anpassning till ett liv i en mycket kall milj¨o, d¨ar vingmusklerna inte blir tillr¨ackligt varma f¨or att lyfta insekten. Det finns andra sk¨al att tveka om trov¨ardigheten i att vingar utvecklats i vat- ten. De ¨aldsta fossila s¨otvattensinsekterna ¨ar 100 miljoner ˚aryngre ¨an de ¨aldsta vingade insektsfossilen. De flesta av de ¨aldsta insektsfossilen ¨ar fr˚anlandlevande insekter, men fossiliseringen har skett i vatten genom att insekterna b¨addats in i lera under syrefattiga f¨orh˚allanden. Varje landlevande insekt som fossiliserats i vatten m˚aste ha hamnat d¨ar genom olycksh¨andelser. Om flygande insekter ut- vecklats i en akvatisk milj¨o verkar det osannolikt att fossillagren i sj¨osediment domineras av landlevande insekter. Aven¨ morfologiskt ¨ar det tydligt att g¨alar hos vattenlevande insekter har utvecklats ur olika strukturer. Trollsl¨andornas bladg¨alar och g¨altarm motsvaras inte av dagsl¨andornas bakkroppsg¨alar eller b¨acksl¨andornas g¨altofs i bakkroppsspetsen.

43 7.6 Palaeoptera och Neoptera

Vingarna hos insekter ¨ar homologa strukturer, och de vingf¨orsedda insekterna (Pterygota) utg¨or en naturlig grupp. Om vingar finns, upptr¨ader de i samma position: mellankroppens andra och tredje segment. De flesta insekter kan vika vingarna platt ¨over bakkroppen n¨ar de inte flyger; de enda insektsgrupper som helt saknar denna f¨orm˚aga ¨ar trollsl¨andorna och dagsl¨andorna. Ovikbara ving- ar s˚agssom n˚agonting primitivt, och gruppen som utg¨ors av dagsl¨andor och trollsl¨andor fick namnet Palaeoptera – gamla vingar. De vingvikande insekterna s˚agssom mer avancerade och placerades i Neoptera – nya vingar. F¨orm˚aganatt vika vingarna ¨over bakkroppen ¨ar en av de viktigaste anpassningarna i insekter- nas evolution. Vikbara vingar har m¨ojliggjort f¨or insekter att invadera tr˚anga mikrohabitat som skulle trasa s¨onder stora stela palaeoptervingar. Vingvikning har ¨aven b¨addat f¨or omformning av framvingar till t¨ackvingar, som skyddar de ¨omt˚aligaflygvingarna. Skyddande t¨ackvingar har uppst˚attparallellt hos exem- pelvis kackerlackor, tvestj¨artar och skalbaggar. Om antalet arter ¨ar ett m˚att p˚aevolution¨ar framg˚ang s˚a ¨ar det vikbara vingar, och inte vingar i sig, som ¨ar nyckeln till diversiteten inom insekterna.

7.6.1 Ar¨ Palaeoptera en monofyletisk grupp? Eftersom det finns tre basala grupper (Odonata, Ephemeroptera och Neoptera), s˚afinns det tre m¨ojliga fylogenier, varav alla tre har haft sina v¨alformulerade f¨orespr˚akare. Ett bekymmer ¨ar att karakt¨arer i vingarna, eller strukturer asso- cierade med flygning inte kan anv¨andas f¨or l¨osa Palaeoptera-problemet. Anled- ningen ¨ar, att det ¨ar om¨ojligt att uppt¨acka vilket karakt¨arstillst˚and som ¨ar det ursprungliga, eftersom vingar helt saknas hos de n¨armaste sl¨aktingarna. Det g˚ar inte att avg¨ora om ovikbara vingar ¨ar en anpassning som f¨orenar trollsl¨andor och dagsl¨andor i en monofyletisk grupp, eller om det ¨ar det ursprungliga tillst˚andet f¨or en flygande insekt.

Metapterygota: Odonata + Neoptera En av de karakt¨arer som h˚allerihop gruppen ¨ar formen p˚amandiblerna. Hos fj¨allborstsvansar och dagsl¨andenymfer (fullbildade dagsl¨andor saknar helt fun- gerande mundelar) ¨ar mandibeln l˚angstr¨ackt och mest r¨orlig parallellt med mandibelns t¨ander. Hos Odonata och Neoptera ¨ar mandibeln kraftig och tri- angul¨ar och r¨orlig mer som ett g˚angj¨arn. En mer tveksam karakt¨ar ¨ar f¨orlusten av subimagostadiet. Prim¨art insekter n˚araldrig ett sista utveck- lingsstadium, de blir k¨onsmogna n¨ar de n˚atten viss storlek och forts¨atter se- dan att ¨omsa skal med oj¨amna mellanrum hela livet. Dagsl¨andenymfer kl¨acks till ett kortlivat sub-imagostadium, som efter ett par timmar ¨omsar skal till det slutgiltiga k¨onsmogna imagostadiet. Inga andra insekter ¨omsar skal ef- ter det att de har utvecklat flygdugliga vingar. De som f¨orespr˚akar Metap- terygota ser dagsl¨andornas sub-imagostadium som en rest av det ametabola ¨omsningssystemet hos de vingl¨osa insekterna. Men eftersom de vingl¨osa insek- terna aldrig n˚arett imagostadium kan sub-imagostadiet lika g¨arna ses som en unik anpassning hos dagsl¨andorna. Andra karakt¨arer som f¨oreslagits ¨ar de musk- ler som st¨anger andnings¨oppningarna p˚abakkroppen och f¨orlusten av ett l˚angt ringlat spr¨ot p˚asista bakkroppssegmentet.

Opistoptera: Ephemeroptera + Neoptera Den starkaste karakt¨aren som f¨orenar de tv˚agrupperna Ephemeroptera och Ne- optera ¨ar parningssystemet d¨ar spermie¨overf¨oringen alltid sker k¨ons¨oppning mot k¨ons¨oppning. H¨ar ses trollsl¨andornas unika parningssystem som en sekund¨ar an- passning till ett liv som inte levs som hos de apterygota insekterna, p˚amarken. Ett fossil av Namurotypus fr˚anden utd¨oda gruppen Protodonata tyder p˚aatt de f¨orsta trollsl¨andeartade insekterna inte hade sekund¨ara k¨onsorgan utan hade ett parningssystem med spermatoforer liknande det hos de apterygota insekterna.

44 Ett monofyletiskt Palaeoptera? Karakt¨arer som anf¨ors f¨or ett monofyletiskt Paleoptera ¨ar de korta antennerna, sekund¨ara l¨angsribbor i vingarna, sammansm¨altningen av tv˚amundelar och de akvatiska larverna. Vid en n¨armare gransking ¨ar de korta borstlika antennerna hos trollsl¨andor och dagsl¨andor inte s¨arskilt lika varandra. Trollsl¨andeantenner ¨ar uppdelade i segment, medan de hos dagsl¨andorna har en enkel struktur utan tydliga segmentgr¨anser. Det finns dessutom fossil som antyder att ursprungliga dagsl¨andor, s˚aval som den trollsl¨andelika Namurotypus hade l˚anga tr˚adlika an- tenner. Detta visar att de korta antennerna hos nutida Palaeoptera har uppst˚att parallellt. I nyare studier har morfologiska karakt¨arer och DNA-sekvenser analyserats f¨or att hitta en stabil insektsfylogeni. F¨or de ursprungligare flygande insek- terna har fanns ett starkt morfologiskt st¨od f¨or Metapterygota, medan mole- kyl¨arinformationen gav ett svagare st¨od f¨or Palaeoptera. N¨ar alla data analy- serades tillsammans, en s˚akallad “total-evidence”-analys, hade de morfologiska karakt¨arerna en starkare genomslagskraft ¨an den molekyl¨ara informationen.

7.7 Ribosomala DNA-sekvenser i fylogenetisk sys- tematik

De tre fylogenetiska studierna i denna avhandling bygger alla p˚ainformation fr˚anribosomala DNA-sekvenser. 18S och 28S anv¨andes i “The Palaeoptera Problem”, ITS-sekvenser i artikeln om Leucorrhinia och mitokondriella 16S- sekvenser bidrar med det mesta av uppl¨osningen till fylogenin ¨over Ischnurinae.

7.7.1 Ribosomers struktur och funktion Ribosomer ¨ar de organeller i cellen som bygger upp proteiner genom att ¨overs¨atta den genetiska koden i mRNA (messenger-RNA) till en kedja av aminosyror. Hos djur finns det tv˚atyper av ribosomer, de som ¨ar associerade med k¨arnan och cellplasman, och de som endast finns inuti mitokondrier. K¨arnribosomen byggs upp av tv˚asubenheter: 18S och 28S. De mostsvaras i de mitokondriella riboso- merna av 12S och 16S. Varje subenhet best˚arav ett RNA-skelett inspr¨angt med proteiner. Den del av ribosomen som sammanfogar aminosyror saknar n¨astan helt proteinkomponenter, och kan vara en rest av livet f¨ore DNA, n¨ar RNA b˚ade lagrade den genetiska informationen och sk¨otte katalys av biokemiska reaktioner. K¨arnribosomernas RNA-skelett byggs upp utifr˚anm¨onster i DNA-sekvenser i “ribosomala paket”. Paketen inneh˚aller den komplement¨ara DNA-koden f¨or de ribomala subenheternas RNA-skelett, men ¨aven regioner som inte bygger upp ribosomen. Ribosomalt RNA i de ribosomala paketen transkriberas (¨overs¨atts) fr˚anDNA i ett stycke. D¨arefter klipps de mellanregioner som inte ing˚ari suben- heterna bort fr˚anRNA-kedjan innan subenheterna sammankopplas till en ribo- som. Ribosomala paket finns i m˚angakopior p˚aflera av k¨arnans kromosomer, och en biofysisk mekanism antas h˚allaalla kopiorna identiska genom hela ge- nomet.

Komplement¨ara strukturer Liksom DNA bildar en dubbelspiral kan RNA bilda strukturer genom sj¨alvkom- plementaritet. Genom sj¨alvkomplementaritet byggs ribosomens tredimensionel- la struktur upp av de f¨orbindelser som bildas mellan olika regioner i ett och samma RNA-kedja. De segment som ¨ar komplement¨ara till ett annat ¨ar ocks˚a mycket k¨ansligare f¨or mutationer, eftersom en f¨or¨andring as sekvensen riskerar att orsaka en icke-fungerande ribosom. Detta medf¨or att ribosomalt DNA best˚ar av omv¨axlande variabla- (icke-komplement¨ara) och konserverade regioner. I molekyl¨arsystematisk forskning har ribosomala DNA-sekvenser anv¨ants f¨or att utreda fylogenin inom s˚avitt skilda grupper som gr¨ona v¨axter, svampar, leddjur och ¨aven f¨or stora analyser av hela djurriket.

45 Homologi i molekyl¨ara data

Att j¨amf¨ora karakt¨arstillst˚and ¨ar sj¨alva grunden f¨or fylogenetisk systematik. F¨or morfologiska karakt¨arer ¨ar det i regel inte sv˚art att avg¨ora om karakt¨arerna i sig ¨ar homologa i de organismer som unders¨oks. F¨or DNA finns det inga mot- svarande ledtr˚adar. Ett adenin-A ser exakt likadant ut som vilket annat A. Nukleotider i DNA ¨ar endast j¨amf¨orbara om de har samma relativa position i DNA-sekvensen. F¨or proteinkodande gener ¨ar DNA-sekvensen uppbyggd av tripletter som motsvaras av aminosyror i proteinet. Om en DNA-bas skulle l¨aggas till el- ler f¨orsvinna s˚afasf¨orskjuts ¨overs¨attningen till protein vilket resulterar i ett oanv¨andbart enzym. D¨arf¨or varierar proteinkodande sekvenser mycket lite i l¨angd mellan organismer, vilket g¨or det l¨att att hitta den positionala homologin. Ribosomala gener regleras inte av tripletter. Det medf¨or att DNA-baser l¨attare kan plockas bort eller l¨aggas till genom mutationer, och ¨ar mycket sv˚arare att homologisera.

J¨amkning av DNA-sekvenser

N¨ar DNA-sekvenser fr˚anolika arter varierar i l¨angd ¨ar den positionella homo- login f¨or varje enskild DNA-bas os¨aker. En metod f¨or att hitta homologin ¨ar j¨amkning av sekvenserna, vilket inneb¨ar att “gap”, representerade av ett “-” s¨atts in f¨or att fylla ut de positioner d¨ar baser f¨orlorats eller motsvaras av en insertion. Den metod som ¨ar grunden f¨or alla typer av ber¨aknad j¨amkning ¨ar Needleman-Wunsch (N-W) algoritmen. Med den kan man enkelt hitta en opti- mal j¨amkning mellan tv˚asekvenser, s˚akallad parvis j¨amkning. N-W algoritmen kan ut¨okas f¨or att hitta en optimal j¨amkning av fler sekvenser ¨an tv˚a.Antalet antalet ber¨akningar som kr¨avs ¨okar geometriskt med antalet sekvenser, och en expanderad N-W ¨ar d¨arf¨or praktiskt oanv¨andbar f¨or mer ¨an ett f˚atalsekvenser samtidigt. Ett matematiskt sv˚art problem som j¨amkning av m˚anga sekvenser kan delas upp i en serie av parvisa j¨amkningar, men d˚akan man inte l¨angre vara s¨aker p˚aatt man har hittat den optimala l¨osningen. De tv˚amest anv¨anda datorpro- grammen f¨or multipel j¨amkning ¨ar Clustal, som ¨ar baserad p˚adistans-metoder och MALIGN, som ¨ar parsimonibaserad. Clustal har f¨ordelen att det ¨ar snabbt, men ¨ar d˚aligtp˚aatt hitta bra l¨osningar. MALIGN kr¨aver mycket datorkraft, och ¨ar n¨astan oanv¨andbart med en enkel persondator. Ett nytt s¨att att homologisera DNA, utan att g¨ora en multipel j¨amkning, ¨ar direktoptimering (DO). H¨ar anv¨ands en metod som liknar MALIGN, men som betraktar j¨amkningen av DNA som optimering av karakt¨arer i ett parsimoni- tr¨ad. I likhet med en heuristisk s¨okning efter de kortaste tr¨aden i en parsimo- nianalys j¨amf¨or DO fylogenetiska tr¨ad, och den m¨angd insertioner, deletioner och substitutioner som kr¨avs f¨or att f¨orklara variationen mellan sekvenserna. Det tr¨ad som kr¨aver minst f¨or¨andring ¨ar det mest parsimoniska, och m¨angden f¨or¨andringar ¨ar direkt j¨amf¨orbar med tr¨adl¨angden i standardparsimoni. Ytterligare en metod f¨or multipel j¨amkning av rDNA-sekvenser ¨ar sekund- ¨arstrukturj¨amkning. Aven¨ om sekvenser varierar mellan arter, s˚a ¨ar m¨onstret av stabila komplement¨ara och variabla regioner likartat. European Ribosomal Database tillhandah˚aller f¨ardigj¨amkade rDNA-sekvenser fr˚analla typer av or- ganismer fritt tillg¨angliga p˚ainternet. Dessa ¨ar j¨amkade med referens till se- kund¨arstrukturen, och forskare kan anv¨anda dem som mall f¨or j¨amkning av nyframtagna sekvenser. Nackdelen med sekund¨arstrukturj¨amkning ¨ar densamma som f¨or helt manu- ell j¨amkning, att det inte finns n˚agotoptimalitetsbegrepp. Det finns inget s¨att att s¨aga om en multipel j¨amkning ¨ar en b¨attre l¨osning ¨an en annan. Det har sagts att metoderna f¨or multipel j¨amkning av sekvenser befinner sig i samma position som kladisisk analys gjorde f¨or 20 ˚arsedan. Man skall inte gl¨omma att detta ¨ar ett lika viktigt steg som den fylogenetisk analysen i och med att homologibed¨omningarna ¨ar helt beroende av hur j¨amkningen gjordes.

46 7.8 Presentation av artiklarna

I: Hovm¨oller,, R., K¨allersj¨o, M. and Pape, T., 2004. The Palaeoptera problem: basal pterygote phylogeny inferred from 18S and 28S rDNA sequences. Cladistics 18, 313–323.

Artikeln b¨orjade som mitt examensarbete “Basal pterygote phylogeny - a mo- lecular study” fr˚an Stockholms Universitet, 1999. F¨or denna studie sekvenserade vi 18S och 28S rDNA fr˚an18 trollsl¨andor, 8 dagsl¨andor och den vingl¨osa klipp- smygen Petrobius brevistylus. Resultatet blev ett starkt statistiskt st¨od f¨or ett monofyletiskt Palaeoptera. Aret˚ efter kom en replik d¨ar v˚arartikel kritiserades f¨or att ha anv¨and en ol¨amplig j¨amkningsmetod (Clustal), och att vi inte tagit med de morfologiska karakt¨arer som publicerats tidigare. De analyserade om v˚ara data med direktoptimeringsmetoder, s˚av¨al som Clustal, och drog slutsat- sen att ett monofyletiskt Palaeoptera endast hittas inom ett “sn¨avt omr˚ade” av j¨amkningsparametrar. Ett “sn¨avt omr˚ade” ¨ar f¨orst˚asen ren definitionsfr˚aga.Ett intressant resultat ¨ar att i de allra flesta analyser baserade p˚a18S finner st¨od f¨or ett monofyletiskt Paleoptera, om gap (-) inte r¨aknas med. Opistopera eller Metapterygota hittas n¨astan aldrig p˚adetta s¨att, hur parametrarna ¨an s¨atts. R¨aknas gap med, s˚ablir resultatet ett ouppl¨ost tr¨ad. Men s˚afort de morfologiska karakt¨arerna l¨aggs in, s˚ablir resultatet alltid ett monofyletiskt Metapterygota! Det ¨ar tydligt att det finns en konflikt i informationen mellan 18S och de morfologiska karakt¨arerna. Resultaten fr˚an18S kan fortfarande r¨aknas som tvek- samma, och kontroversen kring Palaeoptera ¨ar l˚angt ifr˚anavslutad.

II: Hovm¨oller, R and Johansson, F., 2004. A phylogenetic perspecti- ve on larval spine evolution in Leucorrhinia (Odonata: Libellulidae) based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phyloge- netics and Evolution 30, 653–662.

Det h¨ar arbetet utf¨ordes i samarbete med ekologen Frank Johansson vid Ume˚a Universitet. Hans forskargrupp studerar ekologin hos trollsl¨andelarver, och hur de p˚averkas av fiskpredation. Leucorrhinia ¨ar ett litet sl¨akte (14–16 arter be- roende p˚ahur man r¨aknar) inom segeltrollsl¨andorna. Sl¨aktet har f˚attsitt ve- tenskapliga namn fr˚anden frons, en pl˚atovanf¨or mundelarna, som lyser vitt i ett ¨ovrigt m¨orkt ansikte. P˚aklassisk grekiska betyder “leukos” vit och “rhis” nos. P˚asvenska kallas de k¨arrtrollsl¨andor, eftersom flera av arterna f¨oredrar surt vatten i vitmossek¨arr. Sl¨aktet har en utbredning ¨over norra halvklotets nordligare delar, fr˚anEuropa, ¨over Ryssland, Kina och Japan, till USA och Ka- nada. M˚anga trollsl¨andelarver ¨ar bev¨apnade med taggar p˚abakkroppens rygg och sidor. Hos k¨arrtrollsl¨andorna varierar taggigheten mellan arterna. S˚ahar till exempel den breda k¨arrtrollsl¨andan L. caudalis mycket taggiga larver, medan den nordiska k¨arrtrollsl¨andan L. rubicunda n¨astan helt saknar taggar. Frank Johansson m.fl. har visat att taggarna ¨ar effektiva som ett skydd mot rovfisk, och att f¨orekomsten av arter ¨ar beroende av om det finns fisk i vattnet eller inte. Ett syfte med den h¨ar unders¨okningen var att hitta en stabil fylogeni ¨over k¨arrtrollsl¨andorna, s˚aatt det g˚aratt avg¨ora f¨or varje art om avsaknaden av taggar ¨ar en anpassning eller ett ned¨arvt tillst˚and. Vi lyckades visa att taggarna har f¨orlorats ˚atminstone tv˚ag˚anger:dels hos den europiska arten L. rubicunda, och i en grupp med nordamerikanska arter. Fylogenin baserades p˚asekvenser fr˚ande mycket variabla spacer-region- erna (ITS) i de ribosomala paketen. Vi gjorde en egen version av parame- terk¨anslighetsanalys, d¨ar Clustal k¨ordes under m˚angaolika parameterinst¨all- ningar och resultatet sammanst¨alldes grafiskt. Vi uppt¨ackte ocks˚aatt den me- kanism som skall h˚allakopior av ribosomala sekvenser identiska i genomet inte hade lika stor inverkan ¨over ITS som ¨over 18S och 28S.

47 III: Hovm¨oller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera, Coenagrionidae) established from COII and 16S sequences. Opubli- cerat manuskript. Det h¨ar ¨ar de f¨orsta resultaten fr˚anett p˚ag˚aendeprojekt om fylogeni inom flicksl¨andefamiljen Coenagrionidae. Indelningen i underfamiljer ¨ar baserad p˚a sv˚artolkade kvantitativa karakt¨arer, mest i vingribbm¨onstret. I mycket preli- min¨ara analyser ¨over hela familjen Coenagrionidae fick jag endast fram denna underfamilj som monofyletisk, och jag best¨amde mig f¨or att koncentrera mig p˚aden. Det ¨ar ocks˚aden enda underfamiljen som ¨ar definierad p˚aotveksamma karakt¨arer, som att honorna har en tagg i anslutning till ¨aggl¨aggaren och att hanarna har ett upph¨ojt utskott p˚abakkroppssegment 10. Tv˚amitokondriella gener anv¨andes: den proteinkodande COII och den ribo- somala 16S. H¨ar anv¨ande jag en annan strategi f¨or j¨amkningen av de ribosomala sekvenserna, en kombination av Clustal och parsimonij¨amkning med ett direk- toptimiseringsprogram. Resultatet blev betydligt b¨attre tr¨ad ¨an de jag skulle funnit om jag helt f¨orlitat mig p˚aClustal f¨or j¨amkningen. Ischnurinae domineras av tv˚astora sl¨akten med ca 70 arter vardera: Enal- lagma, representerat av arten E. cyathigerum i Sverige, och Ischnura med med tv˚asvenska arter I. elegans och I. pumilio. Ut¨over dessa finns en m¨angd mind- re sl¨akten, varav de flesta bara inneh˚alleren eller ett f˚atal arter. Jag fann att Ischnura ¨ar monofyletiskt, men Enallagma var som tidigare f¨orslagits en icke- naturlig grupp. Historisk sett har Enallagma anv¨ants f¨or den holarktiska grupp dit E. cyathigerum h¨or, men ocks˚af¨or vissa afrikanska arter. Den holarktiska gruppen ¨ar monofyletisk, men de afrikanska arterna b¨or placeras i egna sl¨akten.

IV: Hovm¨oller, R. A catalog of species group names in the genus Co- enagrion Kirby, 1890 (Odonata: Coenagrionidae). Opublicerat manu- skript. En katalog ¨ar ett rent taxonomiskt arbete och inneh˚allerinte n˚agonanalytisk del. And˚a¨ ¨ar kataloger helt n¨odv¨andiga f¨or de som forskar inom systematik. Det finns ingen samlande databas f¨or information om artbeskrivningar, typ- material eller vilka namn som ¨ar giltiga. All den informationen finns spridd i originallitteraturen och i bibliografisk litteratur som Zoological Record. Kata- loger sammanst¨aller den spridda informationen f¨or en mindre grupp, och g¨or i b¨asta fall arbetet lite l¨attare f¨or den som skall arbeta med gruppen systematiskt. Ett ov¨antat resultat av denna sammanst¨allning var att arten Coenagrion exor- natum, som finns upptagen i flera artlistor, helt enkelt aldrig har funnits! Det namnet ¨ar fr˚anb¨orjan en felskrivning i W. F. Kirbys katalog ¨over trollsl¨andor fr˚an1890. Senare sammanst¨allare har tagit med alla arter som Kirby tog upp, och felet har kvarst˚att.

V: Hovm¨oller, R. A proposal to conserve the name Calopteryx Leach, 1815 over Agrion Fabricius, 1775. Opublicerat manuskript. Det h¨ar ¨ar en gammal fr˚agasom aldrig har f˚att en slutgiltig l¨osning: vilket ¨ar det giltiga vetenskapliga namnet p˚ajungfrusl¨andorna i sl¨aktet Calopteryx? Aterigen˚ figurerar W. F. Kirby. Inom taxonomi ¨ar namnprioritet en av grundstenarna. Det f¨orsta namn som publicerats f¨or en art, sl¨akte eller familj ¨ar ocks˚adet som skall anv¨andas. F¨or att skydda v¨aletablerade namn som ho- tas av ett bortgl¨omt, men ¨aldre namn, finns det en nomenklaturkommission som beslutar om ett v¨aletablerat namn skall vara giltigt trots att det inte har prioritet. Jungfrusl¨andorna placerades tillsammans med alla andra Zygoptera i sl¨aktet Agrion av Fabricius (1775). Leach (1815) uppr¨attade sl¨aktet Calepteryx (senare omstavat till Calopteryx) f¨or “Agrionider med f¨argade vingar”, och detta namn slog igenom hos de tongivande odonatologerna under 1800-talet. Agrion fort- satte att anv¨andas f¨or andra grupper inom flicksl¨andorna. Kirby var en stark anh¨angare av namnprioritet, n˚agotsom ¨annu inte var helt accepterat ˚ar1890.

48 Han uppt¨ackte att Latreille redan 1802 hade utsett Agrion virgo som typart f¨or sl¨aktet, och inf¨orde ett nytt namnskick inom Zygoptera. De som kallats Calop- teryx hette nu Agrion, och de som hetat Agrion placerades i det nyuppr¨attade sl¨aktet Coenagrion. Namnet Agrion anv¨andes f¨or b˚adagrupperna, och resultatet blev en del f¨orvirring och en h¨atsk debatt. Erich Schmidt (1948), ifr˚agasatte l¨ampligheten i att ¨over huvud taget anv¨anda Agrion. “Om jag skriver Calopteryx [. . . ] f¨orst˚ar alla omedelbart vad jag syftar p˚a”,menade han. Ett skarpt svar kom ˚aret d¨arp˚a och en hetsig debatt utbr¨ot i tidskriften Entomological News. 1954 hade debat- ten lugnat ner sig, och Montgomery publicerade en mycket noggrann genomg˚ang av nomenklaturfr˚agan.Han fann att formellt sett s˚ahar Agrion prioritet ¨over Calopteryx. Detta har inte f¨oljts av senare ˚arsodonatologer, och Agrion har knappast anv¨ants alls de senaste 20 ˚aren. Trots det ¨ar Calopteryx formellt sett ett ogiltigt namn, n˚agotsom ofta p˚apekas i faunistisk litteratur. Detta manu- skript ¨ar en formell ans¨okan till kommissionen f¨or zoologisk nomenklatur om att ge Calopteryx status som giltigt namn, och placera Agrion p˚alistan ¨over namn som inte kan anv¨andas. Jag har cirkulerat manuskriptet bland odonatologer i flera v¨arldsdelar f¨or att undvika att trampa i ett getingbo som Erich Schmidt!

49 50 Chapter 8

Acknowledgments

I owe my thesis advisors Thomas Pape, Mari K¨allersj¨oand Kjell Arne Johanson thanks for their patience and support. Thomas, thank you for your indefatiga- ble encouragement and insights on insects. Mari, I have never received a single piece of bad advice from you, and because of you, my writing has really become more better. Kjell Arne, thank you for always taking time, for advice, reading and commenting on my texts and for dealing with all the bureaucracy.

The faunistics team: Erland Dannelid, Magne Friberg, Johan Lind, Johan Lil- jeblad, Fredrik Stjernholm, Helena Str¨omberg and Lisa Weingartner. We have had fun, accidents and even fun accidents teaching field courses on Oland¨ and elsewhere 2001-2005.

I wish to thank everyone at the Molecular Systematics Laboratory. Residents and transients: Pia Elden¨asand Bodil Cronholm for technical assistance and good advice. Former and current PhD students – I have learned a lot from our discussions. Invertebrate enthusiasts: Ida Envall, Micke Nor´en,and Erica Sj¨olin. Fans of fins, feathers and fangs: Rei Dehghani, Bo Delling, Martin Irest- edt, Jan Ohlson and Ulf Johansson. Experts on things green: Petra Korall, Catarina Rydin, Jenny Smedmark, Ida Trift and Livia Wanntorp.

Odonatologists around the world: thank you for sharing your knowledge and material. In approximately west-eastern order: Frank Johansson and G¨oran Sahl´enin Sweden, Matti H¨am¨al¨ainen in Finland, KD Dijkstra in the Nether- lands, Henri Dumont in Belgium, Viola Clausnitzer in Germany, Oleg Kos- terin in Russia, Tohru Yokoyama in Japan, Kim Pullen in Australia, Frederico Lencioni in Brazil, Dennis Paulson, Rosser Garrison, Seth Bybee and Heath Og- den in the USA and Jeff Skevington, Reg Webster and Paul Brunelle in Canada.

Thanks for fantastic phylogenetic software: James Farris, Pablo Goloboff, Fredrik Ronquist and Ward Wheeler.

For science and cinnamon rolls: Jonathan Habib-Enqvist, Cinna Lindqvist, Gu- nilla R¨o¨orand Sofie Sweger. Artists know when they are creating art.

51 Everyone at the department of entomology: My office mates – James Bonet, dipterologist, hi-fi enthusiast and coffee-connaisseur. Tobias Malm, trichopterol- ogist, disco bandit and TNT-hacker. Ellen Rehnberg, prospective arachnologist, feeder and socialite. Office neighbors – Marianne Espeland, the new kid. Mattias Forshage, Canadian field trip companion and a true polyhistor. Niklas J¨onsson, fan and pet farmer. Andrea Klintbjer, unrivaled illustrator. Bert Gustafsson, Kevin Holston, Torbj¨ornKronestedt, Gunnel Sellerholm and Bert Viklund who actually know the collections – I still get lost. Marie Svens- son, not afraid to stare bureaucracy in the face.

Bertil Borg is thanked for comments that really improved the text in this thesis.

S¨oren Nylin and Hans-Erik Wanntorp: thank you for the undergraduate class on evolutionary back in 1997. That’s when this thesis started.

52 Bibliography

Alexander, R. D., Brown, W. L., 1963. Mating behaviour and the origin of insect wings. Occasional papers of the Museum of Zoology, University of Michigan 628, 1–19.

Askew, R. R., 1988. The Dragonflies of Europe. Harley Books, Colchester, UK.

Bechly, G., Brauckmann, C., Zessin, W., Gr¨oning, E., 2001. New re- sults concerning the morphology of the most ancient dragonflies (Insecta: ) from the Namurian of Hagen-Vorhalle (Germany). Journal of Zoological Systematic & Evolutionary Research 39, 209–226.

Benard, M. F., 2004. Predator-induced phenotypic plasticity in organisms with complex life histories. Annual Review of Ecology, Evolution and Systematics 35, 651–673.

Boudreaux, H. B., 1979. phylogeny with special reference to insects. Wiley, New York, USA.

Carpenter, F. M., 1966. The lower Permian insects of Kansas. Part II. The orders and Orthoptera. Psyche 73, 46–88.

Carpenter, F. M., Burnham, L., 1985. The geological record of insects. Annual Review of Earth and Planetary Sciences 13, 297–314.

Davies, D., Tobin, P., 1984. The dragonflies of the world: A systematic list of the extant species of Odonata. Vol.1 Zygoptera, Anisozygoptera. No. 3 in Rapid Communications (Supplements). Societas Internationalis Odonatolog- ica, Utrecht, Germany. de S´elys-Longchamps, E., 1850. Revue des Odonates ou Libellules d’Europe. Muquart, Brussels, Belgium. de S´elys-Longchamps, E., 1872. Mat´eriaux pour une faune n´evropt´erologique. Annales de la Soci´et´eEntomologique de Belgique 15. de S´elys-Longchamps, E., 1876. Synopsis des Agrionines. Bulletin de l’Acad´emie Royale des Sciences de Belgique 41.

Douglas, M. M., 1981. Thermoregulatory significance of thoracic lobes in the evolution of insect wings. Science 211, 84–86.

Eberhard, W. G., 1985. Sexual Selection and Animal Genitalia. Harvard Uni- versity Press, Cambridge, MA, USA.

Eddy, S., 2003. HMMer 2.3.2: Software and manual. Available from http://hmmer.wustl.edu.

Engel, M. S., Grimaldi, D. A., 2004. New light shed on the oldest insect. Nature 427, 627–630.

Fabricius, J. C., 1775. Systema Entomologiae, sistens insectorum classes, ordines genera, species, adiectus synonymus, locis, descriptionibus, observationibus. Korte, Flensburgi et Lipsiae [Flensburg and Leipzig, Germany].

53 Farris, J. S., 1970. A method for computing Wagner trees. Systemaic Zoology 19, 83–92.

Fincke, O. M., 1997. Conflict resolution in the Odonata: implications for un- derstanding female mating patterns and female choice. Biological Journal of the Linnaean Society 60, 201–220.

Fitch, W. M., 1971. Toward defining the course of evolution: minimum change for a specific tree topology. Systematic Zoology 20, 406–416.

Foote, B. A., 1991. Hippoboscidae. In: Stehr, F. W. (Ed.), Immature insects. Vol. 2. Kendall / Hunt, Ch. 37, pp. 878–879.

Fraser, F., 1957. A Reclassification of the order Odonata. Royal Zoological So- ciety of New South Wales.

Gilbert, W., 1986. Origin of life: The RNA world. Nature 319, 618.

Giribet, G., 2005. Generating implied alignments under direct optimization us- ing POY. Cladistics 21, 396–402.

Giribet, G., Rivera, C., 2000. A review of arthropod phylogeny: new data based on ribosomal DNA sequences and direct character optimization. Cladistics 16, 204–231.

Gladstein, D. L., Wheeler, W. C., 2003. POY. Program and documentation. American Museum of Natural History. Current version 3.0.11 (2003) available from ftp://ftp.amnh.org/people/wheeler/poy.

Goloboff, P., Nixon, K., Farris, J. S., 2005. TNT 1.0 Software and manual., published by the Authors.

Grant, T., Kluge, A. G., 2003. Data exploration in phylogenetic inference: sci- entific, heuristic, or neither. Cladistics 19, 379–418.

Grimaldi, D., Engel, M. S., 2005. Evolution of the Insects. Cambridge University Press, New York, USA.

Haeckel, E., 1866. Generelle Morphologie der Organismen. Gerog Reimer, Berlin, Germany.

Handlirsch, 1937. Neue Untersuchungen ¨uber die fossilen Insekten I. Annalen den Naturhistorischen Museums in Wien 48, 1–140.

Hasegawa, E., Kasuya, E., 2006. Phylogenetic analysis of the insect order Odonata using 28S and 16S rDNA sequences: a comparison between data sets with different evolutionary rates. Entomological Science 9, 55–66.

Hennig, W., 1966. Phylogenetic systematics. University of Illinois Press.

Hennig, W., 1981. Insect Phylogeny. John Wiley & Sons, Bath, UK.

Higgins, D. G., Sharp, P. M., 1988. CLUSTAL: a package for performing mul- tiple sequence alignment on a microcomputer. Gene 73, 237–244.

Johansson, F., 2002. Reaction norms and production costs of predator-induced morphological defences in a larval dragonfly (Leucorrhinia dubia: Odonata). Canadian Journal of Zoology 80, 944–950.

Johansson, F., Samuelsson, L., 1994. -induced variation in abdominal spine length of Leucorrhinia dubia (Odonata) larvae? Oecologia 100, 74–79.

Kingsolver, J. G., Koehl, M. A. R., 1985. Aerodynamics, thermoregulation, and the evolution of insect wings: differential scaling and evolutionary change. Evolution 39, 488–504.

54 Kingsolver, J. G., Koehl, M. A. R., 1994. Selective factors in the evolution of insect wings. Annual Review of Entomology 39, 425–51. Kirby, W. F., 1890. A synonymic catalogue of Neuroptera Odonata, or dragon- flies. Gurney & Jackson, London, UK. Kjer, K. M., 2004. Aligned 18S and insect phylogeny. Systematic Biology 53, 506–514. Kluge, A. G., 1998. Total evidence or taxonomic congruence: cladistics or con- sensus classification. Cladistics 14, 151–158. Krieger, F., Krieger-Loibl, E., 1958. Bietr¨agezum Verhalten von Ischnura el- egans und Ischnura pumilio (Odonata). Zeitschrift f¨ur Tierpsychologie 15, 83–93. Kristensen, N. P., 1975. The phylogeny of hexapod “orders”. A critical review of recent accounts. Zeitschrift f¨urzoologische Systematik und Evolutions- forschung 13, 1–44. Kristensen, N. P., 1981. Phylogeny of insect orders. Annual Review of Entomol- ogy 26, 135–57. Kristensen, N. P., 1991. The phylogeny of extant hexapods. In: Naumann, I. D., Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry, J. P., Taylor, R. W., Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of Australia: A textbook for students and research workers, 2nd Edition. Vol. 1. CSIRO, Melbourne University Press, Melbourne, Australia, Ch. 5, pp. 125–140. Kukalov´a-Peck, J., 1978. Origin and evolution of insect wings and their relation to , as documented by the fossil record. Journal of Morphology 156, 53–126. Kukalov´a-Peck, J., 1983. Origin of the insect wing and wing articulation from the arthropodan leg. Canadian Journal of Zoology 61, 1618–1669. Kukalov´a-Peck, J., 1987. New Carboniferous Diplura, and Thysanura, the hexapod ground plan, and the role of thoracic side lobes in the origin of wings (Insecta). Canadian Journal of Zoology 65, 2327–2345. Kukalov´a-Peck, J., 1991. Fossil history and the evolution of hexapod structures. In: Naumann, I. D., Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry, J. P., Taylor, R. W., Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of Australia: A textbook for students and research workers, 2nd Edition. Vol. 1. CSIRO, Melbourne University Press, Melbourne, Australia, Ch. 6, pp. 141– 179. Latreille, P. A., 1810. Consid´erations g´en´eralessur l’ordre naturel des animaux composant les classes des Crustac´es,des Arachnides et des Insects avec un tableu m´ethodique de leurs genres dispos´esen familles. Schoell, Paris, France. Latreille, P. L., 1807. Genera Crustaceorum et Insectorum secundum ordinem naturalem in familias doisposita, iconibus exemplurisque plurimis explicata. Amand Koenig, Paris. Leach, W. E., 1815. Edinburgh Encyclopediae. Vol. 9. Brewster, Edinburgh, UK, Ch. Entomology, pp. 57–172. Lemche, H., 1940. The origin of winged insects. Videnskablige Meddelelser fra Dansk Naturhistorisk Forening i København 104, 127–168. Linnaeus, C., 1758. Systema Naturae, 10th Edition. Vol. 1. Laurentii Salvii, Holmiae [=Stockholm], Sweden. Lipscomb, D. L., Farris, J. S., K¨allersj¨o,N., Tehler, A., 1998. Support, ribosomal sequences and the phylogeny of eukaryotes. Cladistics 14, 303–338.

55 Lohmann, H., 1996. Das phylogenetische System der Anisoptera (Odonata). Entomologische Zeitschrift 106, 209–252. Loibl, E., 1958. Zur Ethologie und Biologie der deutschen Lestiden (Odonata). Zeitschrift f¨urTierpsychologie 15, 54–82. Longfellow, C., 1949. Agrion versus Calopteryx. Entomological News 60, 145– 146. Marden, J. H., Kramer, M. G., 1994. Surface-skimming stoneflies: A possible intermediate stage in insect flight evolution. Science 266, 427–430. Martynov, A. V., 1925. Uber¨ zwei Grundtypen der Fl¨ugel bei den Insekten und ihre Evolution. Zeitchrift f¨urMorphologie und Okologie¨ der Tiere 4, 465–501. May, M. L., 2002. Phylogeny and taxonomy of the damselfly genus Enallagma and related taxa (Odonata: Zygoptera: Coenagrionidae). Systematic Ento- mology 27, 387–408. Mickevich, M. F., Farris, J. S., 1981. The implications of congruence in Menidia. Systematic Zoology 30, 351–370. Mizutani, A., Chahl, J. S., Srinivasan, M. V., 2003. Motion camouflage in drag- onflies. Nature 423, 604. Montgomery, B. E., 1954. Nomenclatural confusion in the Odonata: The Agrion- Calopteryx problems. Annals of the Entomological Society of America 47, 471–483. Munz, P. A., 1919. A venational study of the suborder Zygoptera. Memoirs of the American Entomological Society 3, 1–78. Needham, J. G., 1903. A genealogic study of dragon-fly wing venation. Proceed- ings of the United States Natural Museum 26, 703–764. Needleman, S. B., Wunsch, C. D., 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 48, 443–453. Nor´en, M., Jondelius, U., 1999. Phylogeny of the Prolecithophora (Platy- helminthes) inferred from 18S rDNA Sequences. Cladistics 15, 103–112. Ogden, T., Whiting, M. F., 2003. The problem with ”the Paleoptera problem:” and sensitivity. Cladistics 19, 432–442. O’Grady, E. W., May, M. L., December 2003. A phylogenetic reassessment of the subfamilies of Coenagrionidae (Odonata, Zygoptera). Journal of Natural History 37, 2807–2834. Olafsson,´ E., 1975. Drekaflugan Hemianax ephippiger (Burm.) (Odonata) ´ovæntur gestur ´a´ıslandi. N´att´urufræ ingurinn 45, 209–212, [In Icelandic]. Pajunen, V. I., 1964. Mechanism of sexk recognition in Leucorrhinia dubia v. d. Lind., with notes on the reproductive isolation between L. dubia and L. rubicunda L. (Odon., Libellulidae). Annales Zoologici Fennici 1, 55–71. Paulson, D., Schorr, M., Lindeboom, M., 2006. World Odonata List. Webiste. http://www.ups.edu/x6140.xml. Paulson, D. R., 1974. Reproductive isolation in damselflies. Systematic Zoology 23, 40–49. Peters, W. L., Campbell, I. C., 1991. Ephemeroptera. In: Naumann, I. D., Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry, J. P., Taylor, R. W., Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of Autralia, 2nd Edition. Vol. 1. CSIRO, Melbourne University Press, Melbourne, Australia, Ch. 16, pp. 279–293.

56 Phillips, A., Janies, D., Wheeler, W., 2000. Multiple sequence alignment in phylogenetic analysis. Molecular Phylogenetics and Evolution 16, 317–330.

Rambur, M. P., 1842. Histoire Naturelles des insectes N´europt`eres. Librairie encyclop´edique de Roret, Paris, France.

Rehn, A. C., 2003. Phylogenetic analysis of higher-level relationships of Odonata. Systematic Entomology 28, 181–239.

Robertson, H. M., Paterson, H. E. H., 1982. Mate recognition and mechanical isolation in Enallagma damselflies (Odonata: Coenagrionidae). Evolution 36, 243–250.

Ronquist, F., Huelsenbeck, J. P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 572–1574.

Rousset, V., Rouse, G. W., Siddall, M. E., Tillier, A., Pleijel, F., 2004. The phylogenetic position of Siboglinidae (Annelida) inferred from 18S rRNA, 28S rRNA and morphological data. Cladistics 20, 518–533.

Saitou, N., Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 6, 514– 525.

Saux, C., Simon, C., Spicer, G. S., 2003. Phylogeny of the dragonfly and dam- selfly order Odonata as Inferred by mitochondrial 12S ribosomal RNA Se- quences. Annals of the Entomological Society of America 96, 693–699.

Schmidt, E., 1948. Calopteryx versus Agrion: Again? (Odonata). Entomological News 59, 197–201.

Silsby, J., 2001. Dragonflies of the World. Smithsonian Institution Press, Wash- ington, D.C., USA.

Sneath, P., Sokal, R. R., 1973. Numerical Taxonomy: The principles and prac- ticeof numerical classification. Freeman, San Fransisco, CA, USA.

Snodgrass, R. E., 1935. Principles of . McGraw-Hill Book Company, New York, USA.

Soltis, D. E., Soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Za- nis, M., Savolainen, V., Hahn, W. H., Hoot, S. B., Fay, M. F., Axtell, M., Swensen, S. M., Prince, L. M., Kress, J. W., Nixon, K. C., Farris, J. S., 2000. Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Botanical Journal of the Linnaean Society 133, 381–461.

Tehler, A., Farris, J. S., Lipscomb, D. L., K¨allersj¨o,M., 2000. Phylogenetic analyses of the fungi based on large rDNA data sets. Mycologia 92, 459–474.

Tennessen, K. J., 1997. The rate of species descriptions in Odonata. Entomo- logical News 108, 122–126.

Thompson, J., Higgins, D., Gibson, T., 1994. CLUSTAL W: improving the sen- sitivity of progressive multiple sequence alignment through sequence weight- ing, positions-specific gap penalties and weight matrix choice. Nucleic acids research 22, 4673–4680.

Thompson, J. D., Higgins, D. G., Gibson, T. J., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment through sequence weighting, positions specific gap penalties and weight matrix choice. Nucleic Acids Research 25, 4876–4882.

Trueman, J. W. H., 1996. A preliminary cladistic analysis of odonate wing venation. Odonatologica 25, 59–72.

57 Trueman, J. W. H., 1999. The enigmatic Australian endemic species Hemiphlebia mirabilis Selys (Zygoptera: Hemiphlebioidea): four short obser- vations and a new record. International Journal of Odonatology 2, 115–121. Tsuda, S., 2000. A Distributional List of World Odonata. Published by author, Osaka, Japan. Van de Peer, Y., Jansen, J., De Rijk, P., De Wachter, R., 1997. Database on the structure of small ribosomal subunit RNA. Nucleic Acids Research 25, 111–116. Waage, J. K., 1975. Reproductive isolation and the potential for charac- ter displacement in the damselflies, Calopteryx maculata and C. aequabilis (Odonata: Calopterygidae). Systematic Zoology 24, 24–36. Wallberg, A., Thollesson, M., Farris, J. S., Jondelius, U., 2004. The phylogenetic position of the comb jellies (Ctenophora) and the importance of taxonomic sampling. Cladistics 20, 558–578. Warren, A., 1915. Dragonflies and their food. Proceedings of the Hawaiian En- tomological Society 3, 72–82. Westfall, Jr., M. J., May, M. L., 1996. Damseflies of North America. Scientific Publishers, Gainsville, USA. Wheeler, W., 1995. Sequence alignment, parameter sensitivity, and the phylo- genetic analysis of molecular data. Systematic Biology 44, 321–331. Wheeler, W., 1996. Optimization alignment: The end of multiple sequence align- ment in phylogenetics? Cladistics 12, 1–9. Wheeler, W., 1999. Fixed character states and the optimization of molecular sequence data. Cladistics 15, 379–385. Wheeler, W. C., 2003a. Implied alignment: a synapomorphy-based multiple- sequence alignment method and its use in cladogram search. Cladistics 19, 261–268. Wheeler, W. C., 2003b. Iterative pass optimization of sequence data. Cladistics 19, 254–260. Wheeler, W. C., 2006. Dynamic homology and the likelihood criterion. Cladistics 22, 157–170. Wheeler, W. C., Gladstein, D. L., 1994. MALIGN. Program and documentation. American Museum of Natural History, current version 2.7 (2002) available from ftp://ftp.amnh.org/people/wheeler/. Wheeler, W. C., Whiting, M., Wheeler, Q. D., Carpenter, J. M., 2001. The phylogeny of the extant hexapod orders. Cladistics 17, 113–169. Whiting, M. F., Carpenter, J. C., Wheeler, Q. D., Wheeler, W. C., 1997. The problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribsosomal DNA sequences and morphology. Systematic Biology 46, 1–68. Wigglesworth, V. B., 1963a. Origin of wings flight in insects. Proceedings of the Royal Entomological Society of London 28, 23–32. Wigglesworth, V. B., 1963b. Origin of wings in insects. Nature 197, 97–98. Will, K. W., 1995. Plecopteran surface-skimming and insect flight evolution. Science 270, 1684. Wuyts, J., Perri`ere, G., Van de Peer, Y., 1994. The European ribosomal database. Nucleic Acids Research 32, 101–103.

58 Zherikhin, V. V., 2002. Pattern of insect burial and conservation. In: History of Insects. Kluwer Academic Publishers, Dordrecht, Netherlands, Ch. 1.4, pp. 17–62. Zimmer, E. A., Martin, S. L., Beverly, S. M., Kan, Y. W., Wilson, A. C., 1980. Rapid dupliactions and loss of genes coding for chains of hemoglobin. Proceedings of the National Academy of Sciences, USA 77, 2158–2162. Zwick, P., 1980. Handbuch der Zoologie : eine Naturgeschichte der St¨amme des Tierreiches. Vol. 4. Walter de Gruyter, Berlin, Germany.

59

Top View