Lactobacillus Fermentum CECT5716 Ameliorates High Fat Diet-Induced

Home , Lactobacillus fermentum

Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. odto sdvlpda osqec fa nryiblnedet necsieeeg naeand intake energy excessive an to due This imbalance 2018). energy Calder, an & 2010). of (Rogero Zimmet, syndrome consequence worldwide & metabolic a the of Grundy hypertension, as of axis obesity, Alberti, central developed 25% resistance, the (Eckel, is affects considered insulin dyslipidemia condition It is including and obesity dysfunctions them, time. hyperglycemia Among metabolic our tolerance, several characterized of glucose is of syndrome problems impaired Metabolic concurrence health 2018). (Saklayen, the public increasing constantly by the is prevalence of its and one population, is syndrome Metabolic tolerated. well ameliorate and INTRODUCTION safe to role relatively probiotic of key be this use to a potential demonstrated of play have a to ability treatments suggests reported the probiotic this been that time, Therefore, account have first into that obesity. taking the bacteria of for different pathogenesis affecting describe, the modulation, findings in microbiome Our through obesity approach. experimental interesting very a represents restores probiotic The and dysbiosis. gut and dysfunction endothelial Garcia Molina-Tijeras Alberto Jose gut of dysbiosis. modulation microbiota through mice in fat obesity high diet-induced ameliorates CECT5716 fermentum Lactobacillus niiflmaoyeet n aaiyt ouaemcoit opsto ndffrn xeietlmodels. experimental different this mice. in management. on composition obesity effects microbiota for beneficial modulate treatments. strategies demonstrated Approach: to probiotic have and safer capacity of probiotics effectiveness and and development Different implies limited effective effects the therapy. disease more anti-inflammatory present in promising interest such for a them the as demand of of increasing emerging urgent management most condition, are an Unfortunately, probiotics its is sense, Nowadays, there this drugs. Therefore In anti-obesity dysfunctions. effects. different metabolic side and related important lifestyle the in of changes development drastic the to contribute Purpose: and Background Abstract 2020 23, July Granada of University 4 3 2 Granada of University 1 Rodriguez-Cabezas Elena Maria Iñaki Robles-Vera IE-H,Dprmn fPamclg,Cne o imdclRsac (CIBM), Research Biomedical for Center Pharmacology, of Department CIBER-EHD, 1 Life (ibs.GRANADA) Biosearch Granada de Investigación Biosanitaria de (CIBM), Instituto Research Biomedical for Center Pharmacology, of Department CIBER-EHD, lsrdu spp Clostridium e results: Key 1 noi Jesús Ruiz-Malagón Antonio , .fermentum L. .fermentum L. rsnea ela increased as well as presence 2 eeioGarcia Federico , ET76(5x10 CECT5716 bst sacmlxcniinweealwgaecrnciflmainadgtdysbiosis gut and inflammation chronic low-grade a where condition complex a is Obesity xrsat-bst ffcs soitdwt t niiflmaoypoete n amelioration and properties anti-inflammatory its with associated effects, anti-obesity exerts 1 arcaDiez-Echave Patricia , 1 laRodr´ıguez-Nogales Alba , 8 F/iedy a vlae namdlo ihftde-nue bst in obesity diet-induced fat high of model a in evaluated was CFU/mice/day) 2 ui Plaza-Diaz Julio , Bacteroides 1 ai Jesús Rodr´ıguez-Sojo Maria , 1 proportion. Akkermansia 1 eeaVezza Teresa , .fermentum L. 2 Mónica Olivares , ocuinadImplications: and Conclusion atbclu fermentum Lactobacillus p bnac n reduced and abundance sp. 4 n ui Galvez Julio and , ET76i lnclpatc,also practice, clinical in CECT5716 1 ar Hidalgo Laura , 1 iulRomero Miguel , 3 unDuarte Juan , ET76hsshown has CECT5716 Erysipelotrichi 1 Experimental hsprobiotic This 2 , 2 class , Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. 09.Frhroe hs tde ihih h blt fti rboi oaeirt u irboadysbio- microbiota gut ameliorate to al., probiotic et Toral this 2018; of al., ability et (Rodriguez- the (Robles-Vera colitis highlight & hypertension of studies and models Morris these experimental 2015) Furthermore, (Bond, in al., 2019). Rodr´ıguez-Nogales mothers obtained et 2017; effects and al., beneficial infants the et in in interest-Nogales involved tolerance be an and can safety be that interest. proven properties of can with be syndrome could 2003) 2017), metabolic al., Nassar, et for characterization (Martin tested the context, milk Meanwhile, previously breast this 2017). not In Wiele, strains, approach. development de their probiotic ing Van hinder conventional & can Hernandez-Sanabria other limitations Hage, regulatory of (El and technological therapy However, human generation 2019). for next including al., emerging et conditions, for (Chang the these treatments others these, against probiotic-based Among new studied of be safety. search minuta to and the started in efficacy interest have combine just great probiotics that syndrome a the syndrome is and metabolic there Gomez- metabolic profile with & reason, human metabolic Gil this patients the For Martinez-Ramirez, clinical (Tenorio-Jimenez, on to 2020). randomized condition impact Llorente, probiotics this of their with of considering review associated com- when administration biomarkers systematic especially inflammatory microbiota recent date, improvement, gut discrete a to a of However, up produces modulation 2020). that, through Abdollahi, concluded probably & trials and most metabolism Nikfar beneficial acid endotoxemia, (Daniali, bile their metabolic (Tenorio-Jimenez, of position in regulation resistance from involved production, insulin (SCFA) be protection acid may decreasing host fatty mechanisms short-chain as Different increased well weight including 2020). as modulating effects, Gomez-Llorente, by metabolism, & humans, lipid Gil and and Martinez-Ramirez, rodents in glycemic both improving administered effects, gain, when anti-obesity considerable host probiotics, demonstrating the Among drome, to benefit 2004). health (mainly al., a et confer (LAB13) (Backhed that rota amounts microorganisms adequate live re- as in and defined disorders Gomez-Llorente, are & metabolic Probiotics Gil obesity-associated Martinez-Ramirez, (Tenorio-Jimenez, of paid explored treatment recently be and function in should been prevention barrier attention has 2020). involved the special it intestinal mechanisms for context, as the this diseases, pathogenic probiotics of In lated of the enhancement 2016). use Terra, of and the & Considering amelioration response to Blay Ardevol, in inflammatory 2012). Pinent, result the al., Gines, the (Gil-Cardoso, of can et to Teixeira modulation microbiota contributes 2007; like gut translo- clearly obesity, al., of endotoxins which also et bacterial modulation circulation, composition, (Cani promotes systemic microbiota this, inflammation that intestinal the systemic permeability altered into low-grade Marasco, an gut (LPS), obesity-associated Eusebi, to increased lipopolysaccharide Schiumerini, linked with including its (Festi, been important together cation, for disorders an has dysbiosis, play strategies Obesity obesity-associated as to and safer seems known 2014). microbiota obesity and Colecchia, gut of effective & that development Taddia revealed more have the studies for in different demand decades, role prevalence last clear two the side a the considering During significant is and and there Therefore, the effectiveness co-morbidities, Nowadays, 2018). limited its Aronne, orlistat, present management. 2010). and phentermine, & them are Choue, obesity Kumar of used & Igel, of most frequently Umashanker, Shin but most (Saunders, Lee, The liraglutide, effects 2019; available. exercise. and and are Kim, bupropion restrictions drugs dietary & lorcaserin, including anti-obesity lifestyle, Jang different in the addition, changes Oh, drastic diseases in In Kim, implies obesity-related usually results and Han, obesity dysfunctions This of metabolic (Jang, management the patients to 2014). contributes these (TNF)- pro-inflammatory Paquot, and factor in of tissues & necrosis secretion adipose tumor Scheen to the and macrophages tissue with Piette, of (IL)-6 adipose associated interleukin Legrand-Poels, mainly state, as inflammatory tissues, Esser, such systemic mediators, metabolic 2010; low-grade in a al., lipids of et of development accumulation (Ding abnormal liver an and to leading expenditure, low , .infantis B. aaatrie goldsteinii Parabacteroides , .gasseri L. , .longum B. , .rhamnosus L. .fermentum L. and , .fermentum L. .beeB3 breve B. , kemni muciniphila Akkermansia and , ET76 rboi tanoiial sltdfo human from isolated originally strain probiotic a CECT5716, ET76hsbe hw odslyimmunomodulatory display to shown been has CECT5716 r h otrlvn nteteteto eaoi syn- metabolic of treatment the in relevant most the are ) .plantarum L. 2 mn tes and others) among , or atbclu spp. Lactobacillus atrie thetaiotaomicron Bacteroides α. hs tpooe h recruitment the promotes it Thus, rvtlacopri Prevotella ( idbceimspp. Bifidobacterium .csisri Shi- strain casei L. , Christensenella among , Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. is(pnec,SA,Grn,San.Pam nui ocnrtoswr unie sn os insulin (HOMA- mouse resistance a insulin of using assessment quantified model were Homeostatic USA). concentrations NH, insulin col- Salem, Spinreact Plasma Diagnosis, were using (Alpco Spain). samples 4 methods kit ELISA lipoprotein colorimetric Girona, at Blood high-density by S.A., g (LDL)-cholesterol, measured (Spinreact, 5000 anesthesia. were lipoprotein kits concentrations low-density at isoflurane triglycerides glucose, centrifuged under and Plasma and (HDL)-cholesterol sacrificed -80degC. heparin were at containing frozen mice measured tubes was was treatment, ice-cold glucose the in Blood of lected injection. end blood after the and min Spain). injection, At 120 Barcelona, intraperitoneal S.L., and by Care, weight determinations 60 received Diabetes Plasma They body 30, Ascensia of 15, 2.4.2. h. XT, g/kg 8 0, (Contour 2 for at glucometer of fasted vein handheld dose mice a tail on a using the performed at from was water collected test in was tolerance solution glucose glucose a 50% sacrifice, a the before intake. week water One and food weight, test tolerance body Glucose animal regularly 2.4.1. 230 controlling HFD- diet weeks, HFD. 11 (Purified for the fat followed fed was from were derived groups groups was different obese probiotic content to while assigned chow caloric randomly standard its were the Mice from of France). Laboratories, calories Augy, 60% Harlan (13% Engineering, 2014; which diet & ( diet chow in Food (Global standard Animal HFD carbohydrate) a Scientific from either a HF; calories with or 67% fed temperature Spain) were and a Mice protein Barcelona, water. in from tap calories housed to 20% were of access fat, Spain) free Committee (Barcelona, as a Ethic mice with Animals’ Laboratories the C57BL/6J provided River Laboratory Male by (22 Charles of 28/03/2016/030). facility approved Use from humidity-controlled No. protocols and (Ref. and obtained (Spain) the Care old) Granada the and weeks of for University Health, (5 the ‘Guide of of the Institute Animals with Laboratory National accordance the in by out promulgated carried was study a 5 The using design of experimental suspended concentration and was a diets it obtain 37 Animals, treatment, at to 2.3. probiotic h diluted For 24 was of UK). and period Basingstoke, solution a PBS (Oxoid, for sterile system media (MRS) Anaerogen Sharpe the and using Rogosa Man, De in grown probiotic fermentum The L. stated. of otherwise administration unless and Spain), Preparation (Madrid, 2.2 Sigma-Aldrich from purchased were dysfunction. chemicals endothelial All and status inflammatory probiotic dysbiosis, the Reagents gut of 2.1. effects on the impact evaluate its to Tan, and was (Zhu, effect, aim anti-obesity the metabolism Therefore, lipid 2019). fermentum of al., L. improvement et (Cavalcante an rats with while HFD-treated 2019); in associated Zhao, effect & Zhou an Yi, Mu, mice, in obesity Similarly, 2014). (HFD)-induced al., of et strains (Tomaro-Duchesneau difficult metabolism other lipid Furthermore, being administration. synbiotic, probiotic of a from tration as derived fructooligosaccharides were fermentum effects with L. which administered establish was effects clearly probiotic anti-obesity to (Fasano, the the syndrome Noteworthy, although 2014). metabolic 2017), Colecchia, of & features Taddia common Marasco, function, of Eusebi, barrier Schiumerini, intestinal Festi, impaired 2017; the improve and sis n .fermentum L. 1) oto cnrlde) bs HD n bs rae ( treated obese and (HFD) obese diet), (control control =10): .fermentum L. .fermentum L. ET76i oe fde-nue bst nmc,adt sals ikbtenthe between link a establish to and mice, in obesity diet-induced of model a in CECT5716 atbclu fermentum Lactobacillus aesonbnfiileet ndffrn xeietlmdl foeiy hs h adminis- the Thus, obesity. of models experimental different in effects beneficial shown have ET76hv enpeiul eotdi xeietloeiy(ieoGterze al., et (Rivero-Gutierrez obesity experimental in reported previously been have CECT5716 t5x10 at CM52 oZce ibtcfty(D)rt mrvdislnrssac and resistance insulin improved rats (ZDF) fatty diabetic Zucker to NCIMB5221 8 Fsi 100 in CFUs .fermentum L. ± 1 ° ET76wspoie yBoerh ..(rnd,San and Spain) (Granada, S.A. Biosearch, by provided was CECT5716 ,55 C, ± μ /os/a n oto iercie B.Tetreatment The PBS. received mice control and l/mouse/day 0 eaiehmdt)wt 2hu ih/akcceand cycle light/dark 12-hour a with humidity) relative 10% 9 hwdpoetv ffcso adoaclrdysfunction cardiovascular on effects protective showed 296 3 CECT5716 .fermentum L. .fermentum L. .fermentum L. × 10 9 Fsi ml. 1 in CFUs ° QC5ihbtdhg-a diet high-fat inhibited CQPC05 o 0mn n h plasma the and min, 20 for C ° ne neoi conditions anaerobic under C iewr diitrdthe administered were mice .Cnrlgopreceived group Control ). Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. A S)adseicSgapeeindpiesa hi neln eprtr Tbe1.Teexpression The 1). (Table temperature CA, annealing Diego, their San at (Illumina, primers SYBR System predesigned KAPA Sigma PCR the specific time and cDNA, Real detection USA) of (Qiagen, EcoTM and MA, in ng Kit amplification plates 20 Mini PCR well with RNeasy quantitative 48 USA) time using optical-grade using Real on extracted transcribed UK). performed was reverse was Southampton, was samples and (Promega, colon recommendations, primers and manufacturer’s oligo(dT) the fat following liver, USA), rings, MD, Germantown, aortic from aortic was RT-qPCR RNA weight dry by Total dry expression (RLU)/min/mg their gene units and of luminescence dried, Analysis relative then 2.4.7. as were Vessels shown NADPH. is of activity subtracting presence by ring. oxidase a the measured NADPH was in in and was s those intervals determined. 200 lucigenin 5-s from over in values and luminescence Germany) basal measuring Berthold, NADPH, the by 9507, without 5 LB determined (Lumat was or of counter activity with scintillation concentration oxidase NADPH solution, final concentrations. salt a higher physiological at containing automatically O tubes injected of in production placed Aortic then 5.5. glucose and sa,a rvosydsrbd(azeoe l,21) rey otcrnsfo l xeietlgroups experimental all MgSO 4.6, from KCl rings 20, aortic HEPES Briefly, 119, 2011). NaCl 37 al., at mM): chemiluminescence minutes (in et lucigenin-enhanced 30 the (Zarzuelo for by incubated described performed were was previously rings as aortic intact assay, in activity oxidase NADPH activity oxidase NADPH 2.4.6. VAS2870 inhibitor oxidase pre-contraction. acetylcholine (NADPH) of to phosphate dinucleotide curves adenine concentration-response nicotinamide (10 cumulative tension selective a the Thus, of to min. presence set 90 were during aortae the equilibrated (10 and and Denmark) 5mN Myotechnologies, Danish of 2.01, (Myodaq software myograph O 95% by with described gassed 610M, subsequently previously (model as myograph measurement MgSO wire tension 25, a in isometric suspended for and Denmark) Toral mice Aarhus, Technology, from removed Myo were Danish rings Fiji aortic thoracic using Descending analyzed and measured studies reactivity was 5 Vascular size and plugin. 2.4.5. paraffin Adipocyte v1.16 in Adiposoft eosin. embedded the and PFA, with hematoxylin 4% software with in imaging stained fixed and were taken tissue were adipose stored epididymal then of and by Samples nitrogen calculated liquid were in frozen studies indices were Histological Weight samples 2.4.4. tissue weighed. All and length. tibia -80 cleaned, the at removed, by weights were their fat dividing epididymal always was and material Abdominal pyrogen-free and variables Sterile Morphological integrity. respectively. 2.4.3. test fat, and and sample guarantee extraction to blood MgCl used mM during 10 a used with heparin pre-treated were Pyrosperse samples plasma and The solution instructions. ( manufacturer’s insulin following USA) (mM)xfasting Pierce MA, glucose a fasting using measured formula: were the LPS using calculated was IR) -5 -9 M-10 ) hc a de 0mnbfr.Rlxn epne oaeycoiewr xrse sapercentage a as expressed were acetylcholine to responses Relaxant before. min 30 added was which M), ° tal. et C. -5 4 .,CaCl 1.2, )wr eoddfritc ig r-otatdb 469(10 U46619 by pre-contracted rings intact for recorded were M) Trle l,21) rb ouin(opsto nm:NC 1,Kl47,NaHCO 4.75, KCl 118, NaCl mM: in (composition solution Krebs 2014). al., et (Toral 2 ,KH 2, TM iprigAet(oz,Wlesil,M,UA nodrt eoeresidual remove to order in USA) MD, Walkersville, (Lonza, Agent Dispersing 2 PO 2 4 n %CO 5% and TM . n lcs 1 t37 at 11) glucose and 1.2 ° nHPScnann hsooia atslto p .)containing 7.4) (pH solution salt physiological HEPES-containing in C hooei nooi un i Tem cetfi,Ic,Waltham, Inc., Scientific, (Thermo Kit Quant Endotoxin Chromogenic 2- a tmltdb diino AP (100 NADPH of addition by stimulated was 2 ® p .) eghtnincaatrsiswr curdvathe via acquired were characteristics Length-tension 7.4). (pH ATqC atrMx(aaBoytm,Wilmington, Biosystems, (Kapa Mix Master qPCR FAST 4 ,Na 1, 4 μ o/ owtda nw reat hnue at used when artefacts known withdraw to mol/L 2 HPO ° a sdt l h ra hme n was and chamber organ the fill to used was C 4 .5 KH 0.15, 2 PO μ -8 /L/25 lsalvl of levels Plasma U/mL)/22.5. 4 )i h bec ri the in or absence the in M) .,NaHCO 0.4, μ μ -hc sections m-thick ) ig were Rings M). 3 ,CC21.2 CaCl2 1, 3 2 Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. vrin092 tp:/eh.r) n h olwn ouaiyaaye n esoend identification node keystone and analyses modularity Gephi. following within the conducted were and diffe- cut between https://gephi.org), correlation functions Spearman’s 0.9.2; predicted a (version at their p-value analyzed and and were taxa networks 0.7 different co-occurrence off Modularity-based of associations mice. proportion software differential of the functions find groups statistical in rent to and (https://gephi.org/) alterations “R” Gephi taxa similar the software by between open-source caused in the networks using calculated by Co-occurrence were calculated with https://www.r-project.org/). were functions taxa 3.6.0; bacterial metagenomic of (version KEGG correlations package Spearman’s and packages. parameters https://www.r-project.org/) “ggplots” 3.6.0; va- and metabolic (version log “heatmap.2” package two-way and software ”pheatmap”, abundance statistical or the of “R” one-way using patterns the parameters, by within metabolic constructed USA) the were depicting CA, lues maps Jolla, heat and La clustering Inc., P Hierarchical Software, with Data al., (GraphPad Rodr´ıguez-Nogales correlation. et 8 Pearson 2017; mean Prism or Xia, ANOVA GraphPad the & in as Agellon analyzed expressed algorithm King, re are web-based were Habib, data the beta-diversity The Chong, using in (PERMANOVA) (Dhariwal, 2015). Differences variance Analyst Principal mice. of Microbiome of analysis tool groups multivariate groups. different permutational phenotype from visualize by different via and bacteriomes tested pathways coordinates among of principal functional data score identify and multidimensional to (LDA) plex analysis performed analysis was taxonomic (PCoA) discriminant species (Version analysis linear both size) coordinate effect the for (LDA) biomarkers of analysis identify discriminatory calculation to (linear of employed LEfSE was Analysis Mothur. 1.0) using p-values evaluated Resulting method. were were comparison. which groups Bonferroni data, U different by Mann–Whitney the pairwise of corrected by data were followed abundance test bacterial Kruskal–Wallis and using indices compared diversity alpha with evaluation, significance out microbiota statistical For sig- carried with Differences USA), were statistical CA, analyses for Jolla, tests. statistical La P tested significance All Inc., at Software, were least set test. (GraphPad package means post-hoc chi-squared software between 8 the and GraphPad (ANOVA) with Differences the variance analyzed SEM. of were +- proportions analysis mean between one-way the a as using expressed nificance were are and results manner All bacterial comparable non-16S a any in and Statistics samples DNA 2.5. were mitochondrial DNA Sequences plasmids, the USA). chimeras, sequences of CA, and primers, diversity Diego, reads barcodes, San bacterial remove Lab, total 2007) to (Knight Cole, the trimmed 1.9.1) & estimate (Version Tiedje Garrity, package to (Wang, software basis Project) selected QIIME the Database the on (Ribosomal RDP assigned using the taxonomically fluorometrically by against and quantified level clustered, be similarity quality-filtered, 97% to completed, of library were one sequences make resulting to The pooled Sequal- Invitrogen then high-throughput same were the the samples using sequencing. from The normalized before reactions and kit. were PCR cleaned products Plate The then PCR 96-well plate, E-gel. in Prep primers. one 96-well- sequence in barcoded Invitrogen 600-bp using tar- pooled purified, high-throughput were a performed gel primers a was samples of (V4-5), gene running using amplification gene rRNA by The rRNA amplified 16S visually 16S the machine. verified PCR of bacterial MiSeq Rodriguez-Nogales V4-V5 was the Illumina region by of the samples variable 5 on the described stool through multiplexing 4 using from procedure regions analyzed DNA variable and the Total the following flanking regions 2017). isolated geting al., was et contents (Rodriguez-Nogales fecal from sequencing MiSeq DNA Illumina and extraction ( DNA dehydrogenase 3-phosphate 2.4.8. ([?][?]Ct) glyceraldehydes Ct that comparative to the normalized by were genes measured target the of levels < 0.05. < < .1 h eetdcreaindt eeipre noteitrciepafr,Gephi platform, interactive the into imported were data correlation selected the 0.01; 5 bp. 150 . ± < tnaderro h en(E) xeietldt we- data Experimental (SEM). mean the of error standard .5wr osdrdsaitclysignificant. statistically considered were 0.05 5 α- iest a efre nteotu normalized output the on performed was diversity β- iest ncom- in diversity Gapdh tal et and ) . Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. fteaioie etnadaioetni a ise ncmiainwt eue xrsino leptin of expression expression reduced the a restored significantly with treatment combination probiotic The in expression imbalance 4). tissue, (Figure an fat tissues in fat in resulted and intake adiponectin liver HFD both and in mice, leptin receptor diet-fed adipokines control with the comparison, of in and addition, In 3B). (Figure treatment the by with decreased treated a mice with HFD-fed of associated in was ameliorated mice were obese which in transporter metabolism glucose lipid the of and expression glucose in impairment the Furthermore, proliferator-activated peroxisome of expression expression altered its 3B). reduced an treatment manifested probiotic also whereas mice receptor group, obese diet the Likewise, control Likewise, 3A). the 3A). (Figure with (Figure comparison mice in diet-fed mice kinase control HFD-fed N-terminal to expression c-jun mRNA of similar expression cases most in showing increased markers, by including ( evidenced 3A). cytokines, protein-1 pro-inflammatory as (Figure chemotactic of status, monocyte tissues inflammatory chemokine fat systemic and the liver a in with expression mRNA associated was obesity HFD-diet-induced mice diet control fermentum to compared L. mice HFD-fed control in increased 2B). also (Figure were significantly which lipoprotein was levels, high-density ratio triglycerides This and mice plasma ratio. (LDL)-cholesterol LDL/HDL HFD-fed increased lipoprotein by control in low-density resulted reduced to both which shown), of compared not diet- levels (data value control (HDL)-cholesterol higher with index comparison with in after HOMA-IR hypercholesterolemia mice, showed displayed fed reduced mice was HFD-fed sensitivity control the Similarly, insulin when 2A). by on (Figure groups evidenced improvement among observed an as were analyzed, differences administration, non- were no to levels although lipid compared and insulin Furthermore, by levels and plasma 2A). glucose reduced (Figure glycemic fasted group significantly of in diet were increase control alterations significant which a obesity-induced mice, showed mice the obese HFD-fed evidenced control Thus, determinations profiles. biochemical when hypertrophy plasma showed with The mice treatment after HFD-fed ameliorated Moreover, untreated significantly 1B). min was from 1C). (Figure which 60 tissue (Figure (AUC) mice, curve from diet-fed fat the control group however, epididymal under with control area of compared diet; HFD the sections control in fed with reduction histological fed Mice comparison significant the those a performed. in in was levels a than resulted test glucose the had which peaks onwards, plasma tolerance also Thus, level reduced glucose probiotic glucose 1A). significantly when The higher treatment (Figure evidenced 1A). mice, significantly as (Figure HFD-fed period showed homeostasis deposits untreated experimental HFD glucose with fat control the comparison on abdominal untreated in impact and throughout efficiency positive the epididymal groups energy both in two administration decrease reducing gain significantly daily the consequently to The weight in able 1A). body was similar (Figure treatment mouse diet was period. higher standard intake treatment the a 11-weeks food receiving in the group during resulted control week of HFD to a compared of twice when intake groups group experimental the all expected, in As recorded was weight profile Body biochemical plasma and test tolerance fermentum L. RESULTS Tlr4 .fermentum L. nlvradaioetsuswsas lee ncnrlHDfdmc,wihwssgicnl restored significantly was which mice, HFD-fed control in altered also was tissues adipose and liver in α ( .fermentum L. Ππαρα .fermentum L. ET76rdcdwih anadfttsu cuuainadipoe glucose improved and accumulation tissue fat and gain weight reduced CECT5716 ET76amnsrto eue h namtr ttsi eaoi tissues metabolic in status inflammatory the reduced administration CECT5716 oHDfdmc infiatyrdcdwih anfo a 3owrs vnthough even onwards, 53 day from gain weight reduced significantly mice HFD-fed to nft hc a infiatyaeirtdatrtetetwith treatment after ameliorated significantly was which fat, in ) diitaint bs ie nadto,poitctetdmc hwdreduced showed mice probiotic-treated addition, In mice. obese to administration diitaint bs iesgicnl mloae l hs inflammatory these all ameliorated significantly mice obese to administration Glut-4 (Jnk)-1 n M-ciae rti iae( kinase protein AMP-activated and rti nbt ise a infiatyicesdi control in increased significantly was tissues both in protein Mcp-1 .fermentum L. 6 .fermentum L. ,we oprdwt hs iefdcnrldiet control fed mice those with compared when ), bann iia aust hs fthe of those to values similar obtaining , Fgr B.Mroe,teexpression the Moreover, 3B). (Figure Ampk Τνφ-α nlvradfttissue, fat and liver in ) .fermentum L. and Il-6, .fermentum L. .fermentum L. .fermentum L. swl as well as (Figure Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. hsstainaeirtdatrpoitctetet(iue7C). (Figure treatment probiotic after ameliorated situation this of with increased significantly Similarly, 7). increasing (Figure phyla by significantly restored abundant significantly mice, most was non-obese which the to reducing that at compared and revealed when composition analysis 78.68%) phyla this bacteria rDNA both investigate the 16S in further treatment, shift The To probiotic 7C). 7B). after (Figure (Figure environment were examined mice microbial was obese gut level non-treated gut the phylum with different in comparison extremely shift two in remarkable indicating appreciated thus be when groups, note, could HFD-fed Of showed did and 7B). (PCoA) it analysis (Figure diet- values, coordinates environments control normal principal and the HFD reached between Furthermore, richness it 7A). differences the (Figure Although (a evident group in control index. diversity the decreased Shannon from Shannon excepting differ significantly values, not and were normal whereas sample) to diversity group, across each parameters diet and diversity ecological control in evenness the estimate OTUs to richness, to compared unique Microbial group phylogeny of the (count estimator). communities (diversity (consider OTUs evenness richness bacterial tree Observed Chao1 gut including whole tree), the parameters (PD) a of different diversity by features groups Phylogenetic ecological experimental Several estimation), three the obesity. in including evaluated were disorders, metabolic in role of effects on The probiotic the by including fermentum exerted markers, L. pro-inflammatory impact of beneficial expression HFD-fed the reduced from Moreover, with rings 6B). aortic associated , rings the also (Figure in aortic was reduced probiotic the function was the vascular activity in this with increased and treated mice, significantly control among mice was to observed compared were activity mice response oxidase HFD-fed relaxant from NADPH maximal Accordingly, the in groups. differences experimental significant no VAS2870, inhibitor oxidase (72.2 E mice similar obtaining diet-fed acetylcholine, by induced relaxation endothelium-dependent probiotic the comparison of in response administration 59.5 relaxant were maximal the values P in spectively; (Emax reduction experimen- a mice different showed of control mice from HFD-fed with mice impact of analyzed. aortae were groups the from acetylcholine tal to evaluate responses vasodilator to endothelium-dependent order In control to fermentum concentrations of similar L. levels reaching plasmatic ones, lower non-treated with 5B). with control associated compared (Figure non-obese was when in mice function those mice barrier to treated-obese colonic expressions in in similar improvement LPS obtaining The even tissue proteins, 5A). these colon (Figure all mice in of expression reduced colonic present was with the the observed integrity of in effects observed epithelial beneficial been in has The ( involved it mucins 5A). proteins including as obesity, mice, different in HFD-fed of control altered from be expression 4). to the (Figure reported since liver been study, has in function receptor barrier leptin colonic of The expression the increased and fermentum tissue L. fat in genes these all of Τνφ-α Erysipelotrichi Bacteriodetes and < Tlr4 .5 hntecnetainrsos uvst ctlhln eeaaye Fgr A.The 6A). (Figure analyzed were acetylcholine to curves concentration-response the when 0.05) ET76tetetaeirtdtegtdysbiosis gut the ameliorated treatment CECT5716 function endothelial enhanced supplementation CECT5716 dysfunction barrier intestinal ameliorated treatment CECT5716 .fermentum L. nara isei oprsnwt oto bs ie(iue6B). (Figure mice obese control with comparison in tissue aortae in , cas a nihdi nrae bs iei oprsnwt o-bs ie being mice, non-obese with comparison in mice obese untreated in enriched was (class) ± B and (B) .% Fgr A.We h otcrnswr rvosyicbtdwt h NADPH the with incubated previously were rings aortic the When 6A). (Figure 3.8%) Verrumicrobia Bacteroidetes .fermentum L. Firmicutes nteitsia irboawr xlrdsnegtdsisspasakey a plays dysbiosis gut since explored were microbiota intestinal the on .fermentum L. .fermentum L. hlmas hwdardcdpooto nHDfdmc,wihwas which mice, HFD-fed in proportion reduced a showed also phylum fo 37%t 30%.Ti eutdi nicesdFBratio, F/B increased an in resulted This 13.02%). to 23.72% (from F naleprmna rus lhuhHDidcdadramatic a induced HFD although groups, experimental all in (F) .fermentum L. .fermentum L. .fermentum L. diitain(iue7) neetnl,terltv abundance relative the Interestingly, 7C). (Figure administration ± .%ad71.7 and 4.7% Muc-1 ET76t bs iesgicnl mrvdtealtered the improved significantly mice obese to CECT5716 ramn,rahn iia aust oto itfdmice diet-fed control to values similar reaching treatment, .fermentum L. , 7 Muc-2 noeemc eeascae ihteamelioration the with associated were mice obese in a diitrdt bs ie akddifferences marked mice, obese to administered was noeiyascae adoaclrdysfunction, cardiovascular obesity-associated in ± and .%i h F n oto-itgop,re- groups, control-diet and HFD the in 2.0% diitainwsal orsoealthese all restore to able was administration Muc-3 ), Zo-1 max Firmicutes , Occludin aust hs ncontrol in those to values and fo 76%to 57.66% (from Tff-3 (Figure Ιλ-1β Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. xrsini eue hnislnrssac per Sehr an 99,smlryt htobserved that to similarly 1999), Kahn, of & whose (Shepherd expression 2020), Sepulveda, appears study. Carrillo present resistance the & insulin in Podder that when (Vargas, uptake reduced GLUT-4 glucose is receptor intracellular insulin-dependent expression of the impairment by by characterized mediated also is is resistance reported insulin previously Obesity-associated been the has of which contents, 2020). impact fat of al., the strains in et different expression by like adiponectin shown probiotics, restored other as as for probably well resistance, most as insulin Moreover, metabolism, tissue obesity-associated lipid values. adipose and HOMA-IR the on glucose of PPAR treatment in improvement amelioration probiotic as an such the with adiponectin from associated control derived was that this showed obesity, factors human transcription it of in key models but of experimental expression effect, Indeed, different the 2015). treat- anorexigenic al., in The Rodr´ıguez-Nogales any et 2017; before discarding metabolism. al., tum seen lipid et thus as (Rodriguez-Nogales and intake, inflammation glucose properties, intestinal energy of immunomodulatory modify amelioration and an significantly anti-inflammatory with not associated did was ment which gain, weight body with treatment The non-treated between observed results. were subsets DISCUSSION previous arrays correlation confirming networks significant mice, co-occurrence obese the different treated extracted Moreover, and we 8C). clusters, (Figure metagenomic these and group heat taxa simplify hierarchical bacterial further rho of between To form using (Spearman’s associations the negative 8B). group in and each (Figure depicted positive as in functions of Results, enrichments clusters correlation. functional distinct showed rank and map, Spearman’s taxonomic of between test non-parametric relationship the the estimated we Finally, secondary or metabolism (p nucleotide the (p represented evaluated molecules, overrepresented we structural were When biosynthesis intracellular membrane 8A). metabolism and acids, (Figure membrane fatty sugar metabolism, and nucleotide (p proline and lipopolysaccharides higher glycan sugar of a other amino biosynthesis fermentum and of harbored antigens, metabolism processes mice a cellular and repair by HFD the transporters and characterized with contrast, replication was associated In vitamins, group taxa and 8A). mice cofactors (Figure non-obese of the degradation that among metabolism indicated clusters catabolism, different graph and showed bar also (p LEfSe signatures higher bacterial 8A). significantly these (Figure with groups analysis associated States) three orthologs Unobserved of KEGG Reconstruction the by Communities of of Investigation (Phylogenetic PICRUSt The of abundance increased Thus, of S1). of from (Figure derived genus found test were as, expression well non-parametric markers as the expression, between markers correlation using barrier positive intestinal a markers and in fact, obesity-related observed In effects main modulation. microbiota beneficial and that genera suggested bacteria Spearman major of Correlation genera, two 7C). in (Figure sequences the in proportion ium reduced a revealed mice and obese control level, genus At Erysipelotrichi Akkermansia ncmaio ihcnrlmc,wihwssgicnl mloae after ameliorated significantly was which mice, control with comparison in , oneuae h xrsino r-namtr eitr nHDfdmc swl supregulated as well as mice HFD-fed in mediators pro-inflammatory of expression the downregulated ramn noeemc atrarltdwt lcnboytei n eaoim riieand arginine metabolism, and biosynthesis glycan with related bacteria mice obese in treatment Glut-4 < > .1 nteohrtoeprmna ruso ie(iue8A). (Figure mice of groups experimental two other the in 0.01) cas bevdafter observed (class) eogn to belonging , . n p-value and 0.7 .fermentum L. .fermentum L. mloaiggyei eesadguoeuiiainb agttsus spreviously as tissues, target by utilization glucose and levels glycemic ameliorating , < .1 rprino atra aaascae ihteeeg eaoim transport metabolism, energy the with associated taxa bacterial of proportion 0.01) Bacteriodetes loipoe nui eitne hc a soitdwt nincreased an with associated was which resistance, insulin improved also ET76t F-e ieipoe F-nue bst,reducing obesity, HFD-induced improved mice HFD-fed to CECT5716 < .1 n ul eaaecreainntok o ahexperimental each for networks correlation separate built and 0.01) .fermentum L. .plantarum L. and < Verrumicrobia .1,wihmasta l fteeptwy eeless were pathways these of all that means which 0.01), .fermentum L. 8 ramn ol eivle nisbnfiileffects. beneficial its in involved be could treatment .fermentum L. Co,Dn,Jog ug i i,21;Kwon 2019; Kim, & Kim Jung, Jeong, Dong, (Choi, Akkermansia epciey n nices in increase an and respectively, , mloae etnrssac nlvrand liver in resistance leptin ameliorated Erysipelotrichaceae tetdmc ol edrvdfrom derived be could mice -treated Akkermansia < eu bnac n adipokines and abundance genus .1 rprino bacterial of proportion 0.01) .fermentum L. α Kme l,21) As 2015). al., et (Kim n eue presence reduced and n inflammatory and Bacteroides .fermen- L. treatment Clostrid- L. Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. ffcsosre.Adtoal,i bs ainsdffrn hl aebe eotdt eicesd in- increased, be to reported beneficial been the have to phyla contribute different potentially patients and assimilation obese dysbiosis shift energy in obesity-associated a of of Additionally, cluding indicating amelioration reduction clusters, This the in the observed. probiotic. observed between with effects the values separation associated by normal clear induced be the a composition could showed to bacterial an analysis phyla showed gut PCA bacteria the mice However, The in main HFD-fed than non-digestible since the mice. food of mice. observations restoring diet-fed from hydrolysis these non-obese control composition, fat with efficient with microbiota and agrees more compared gut study calories when a modulate Our more ratio with extract 2004). F/B associated individuals al., (Ley, increased obese been et obesity (Backhed so has in ones lumen, ratio altered lean intestinal F/B in is the enrichment Increased in composition an polysaccharides microbiota 2017). on in et gut consisting al., (Marchesi reduction that 2005), et a before development established Gordon, as mentioned dramatic well the well & as a promote is Knight as in inflammation, and it Lozupone, low-grade result host addition, Turnbaugh, a can the In Backhed, facilitating factors, and by external bacteria 2016). maybe by gut al., caused diseases, between by mainly relationship metabolic exerted to symbiotic composition, of mice related the microbial obese Closely of in gut mice. alteration microbiota in in gut Changes obesity of in role. inflammation modulation ameliorate the and above, integrity the intestinal improve to reported 2016)(and Kadooka, preventing & and downregulated Sakai function and Ogawa, levels barrier plasma like intestinal LPS the probiotics, reduced restoring Other it thus of since mice, translocation, expression obese components in up-regulated bacterial integrity and epithe- gut levels of in involved markers plasma markers colonic LPS the Importantly, increased of study as expression present aorta. well reduced The displayed as 2016). activation mice integrity Hulver, the obese & lial promotes Frisard since McMillan, This observations, (Boutagy, these homeostasis muscle. confirms lipid skeletal and recep- and glucose main tissue altering its NF adipose thus to factor liver, et binding transcription cells, (Cani upon the immune endotoxemia inflammation of in systemic metabolic provoke obesity-associated located to and TLR-4, barrier contribute components circulation tor intestinal may bacterial systemic the facilitates LPS in reach that 2007). defect 2012) could a al., al., that et is (Teixeira LPS, 2019). there permeability obesity, like al., gut of et translocation, increased pathogenesis (Toral to the leads erythematosus in This lupus gut function. systemic the promote of of could involvement model the which reported experimental bioavailability, Regarding that an NO to in similarly higher acetylcholine, probiotic a to this and relaxation for endothelium-dependent production previously impaired ROS the of of reduction restoration the a (O suggests This anion 2015). tissue. superoxide al., and et TNF- (Walther NO oxidase cytokines most of NADPH Interestingly, the humans, production and of 2017). in eNOS the inflammation (Didion, vasodilation of to modifies activity of leads and it impairment that expression Thus, lesions, system the pre-atheromatous altering renin-angiotensin through of the probably development of activation and the walls in vascular results This TNF- muscle molecules. including smooth and cytokines, TNF- endothelial adipokines pro-inflammatory vascular pro-inflammatory Additionally, of the of 2015). targeting Randeva, and also & endothelium-derived endothelial are enzyme Tan acetylcholine-induced cells (Adya, effective (eNOS) and aorta most synthase hypertension the in oxide (NO), factor arterial nitric oxide relaxing endothelial nitric with of of inversely production phosphorylation 2016). subsequent cardiovascular correlate the Chantemele, the de facilitates of to Belin it development shown & since Otvos the (Huby, been dysfunction, leptin to has by related mediated adiponectin part, closely Conversely, in is dysfunction, endothelial state and inflammatory disease obesity-associated 2018). the al., Besides, et (Chen probiotics other for reported Fusobacteria α n IL-1 and .fermentum L. and .sake L. Proteobacteri Bacteroidetes β noeemc,a ela niie h nrae AP ciiyi h aortic the in activity NADPH increased the inhibited as well as mice, obese in .fermentum L. κ K7(i,Jog o,Hn&Km 2016), Kim, & Han Woo, Jeong, (Lim, OK67 n usqetpouto n ees fctkns dpknsadROS, and adipokines cytokines, of release and production subsequent and B ramn infiatyicesdteclncepeso ftedifferent the of expression colonic the increased significantly treatment idbceimadolescentis Bifidobacterium ,whereas a, B,bt nhmn D iip ta. 00 n ie(Bagarolli mice and 2010) al., et Filippo (De humans in both (B), ramn eue aclrepeso ftepro-inflammatory the of expression vascular reduced treatment α Verrucobacteria n IL-1 and 9 β, sosre ntepeetsuy n adhesion and study, present the in observed as α n L6 hc,a el nraeexpression increase well, as which, IL-6, and srdcd(rvs,Msesn&Rosado, & Masterson (Crovesy, reduced is M8(i i,21)hv lobeen also have 2017) Kim, & (Lim IM38 2 - aiiaigvsua xdtv stress oxidative vascular facilitating ) .fermentum L. .fermentum L. .gasseri L. ramn a beto able was treatment Tlr-4 em opa key a play to seems Kwn,Miyoshi, (Kawano, Tlr-4 nlvr a and fat liver, in Firmicutes expression. (F) Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. aaol A oa ,Oier G ruoT,Crah M oh GZ Rocha BM, Carvalho TG, the Araujo of AG, Sciences of Oliveira Academy N, National Tobar the A RA, of Nagy Bagarolli Proceedings GY, 101 Koh America storage. LV, of fat States Hooper regulates United angio- T, that endothelial Wang in factor H, adiponectin environmental and Ding leptin F, of Backhed 2015 effects research Differential diabetes (2015). of HS Journal Randeva & genesis. BK, Tan R, Adya syndrome. metabolic and References obesity with the patients and treat in imbalance and changes homeostasis prevent by glucose reversed per- resistance, were intestinal by of insulin features increase induced obesity-related to profile may these lead microbiota that However, gut as microbiota well inflammation. gut as low-grade in systemic translocation, alterations LPS promotes and consumption meability HFD microbiota. summary, gut In of on assim- modulation enrichment sugars after the showed and decreased on motility mice were probiotic secretion, HFD-fed & and this bacterial where Turnbaugh transporter), others, study, (Greenblum, ABC among our mainly more (including sugars in ilation, metabolism, be transport of confirmed phosphorus to for were assimilation for found responsible results and genes genes also These as uptake are mice. well the sugars 2012). HFD-fed as of Borenstein, in in and mice, involved seen assimilation peptides HFD-fed as and systems sugars, intake, from intake phosphotransferase energy lipids, samples in favor as microbiome involved could such in genes transporters nutrients abundant 2009). of these of al., of collection variety et number a a (Hildebrandt the Furthermore, of decreased in were transport increase while an metabolisms the abundance, metals, energy control in and increased transporters carbohydrate were ABC pathways for Since motility genes on cell more activation increased. and less with were gene transcription found those repair modify transports), and been to ABC replication have described and (mostly metabolism, also transport port membrane nucleotide mech- been for within and has the genes HFD into Therefore, translation, those Similarly, insights while metabolism, obesity. mice, some acid and HFD provided in amino gain has abundant weight in mice, involved affect HFD genes to and in microbiome reduced diet the a control of manifested both anism in mice analysis, HFD-fed whereas metagenomic untreated mice Gut study, diet-fed control our of with in strains comparison Accordingly, some in Thus, proportion 2017). 2018). al., al., et et (Castaner (Yang ones as obese in such Our than , individuals lean 2015). in higher (Chakraborti, being mice and Regarding 2013) al., et (Karlsson while mice humans since in this confirmed obesity to results and 2017). tool that Wiele, valid syndrome reported de a Van metabolic been & become has Hernandez-Sanabria could it Hage, Furthermore, probiotic El 2019; This al., et production. (Chang mucins before of colonic proportion proper the in a study, increment acquire present an the Thorngren-Jerneck, In through & diabetes 2019). maybe Ahrne 2 al., et Molin, type (Vezza genus Xu, and disorders the Onnerfalt, weight that metabolic (Karlsson, HFD-induced reported body reverse humans been to could and has bacteria related it 2013) the inversely Actually, al., includes is 2012). et which abundance (Everard latter, whose mice the bacterium in to mucin-degrading paid a been has , attention Special 2020). .fermentum L. .acidifaciens B. Akkermansia Bacteroidetes .fermentum L. Akkermansia nciia rcie ncnlso,tepoitctetetcnb nipratto to tool important an be can treatment probiotic the conclusion, In practice. clinical in a eue nutetdoeemc,wieicesdafter increased while mice, obese untreated in reduced was eu,asgicn soito ewe F and HFD between association significant a genus, ramn eue infiatyterpeec noeemice. obese in presence their significantly reduced treatment aebe eotdt rvn bst n mrv nui estvt nmice in sensitivity insulin improve and obesity prevent to reported been have , Erysipelotrichi : bnac htcudhv hrpui ffc noeiy sdemonstrated as obesity, in effect therapeutic a have could that abundance 15718-15723. .fermentum L. Erysipelotrichi : .muciniphila A. ls and class 648239. ET76amnsrto,wihsget oeta use potential a suggests which administration, CECT5716 .fermentum L. 10 lsrdu spp Clostridium specifically, , ramn,o hs htpooeisabundance, its promote that those or treatment, .fermentum L. tal. et , diitain ofimn h oeta of potential the confirming administration, Firmicutes bnac eeicesdi HFD-fed in increased were abundance lsrdu spp Clostridium 20) h u irboaa an as microbiota gut The (2004). Bacteroides infiatyicesdit. increased significantly tal. et , Bacteriodetes hlm ebaetrans- Membrane phylum. kemni muciniphila Akkermansia .fermentum L. bnac a found, was abundance sascae with associated is , 21) Probiotics (2017). iegsrich lineages , Bacteroides Bacteroides treatment, Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. lHg ,HradzSnbi ,&Vnd il 21) mrigTed n”mr Probiotics”: in ”Smart Frontiers in Trends Applications. Emerging Industrial and (2017). Health T Novel Wiele of de Development 8 Van the microbiology 375 & lancet for The E, Consideration syndrome. Hernandez-Sanabria Functional metabolic R, The Hage (2010). PZ El Zimmet & SM, Grundy KG, Alberti RH, Eckel S 5 resistance Magness insulin one and NM, PloS obesity Schwerbrock with mouse. correlates R, and in precedes Rigby which Hypertension BP, inflammation intestinal Scull promote Hypertension. interactions MM, in Chi Inflammation S, of Ding Complexities web-based and a Role 45 MicrobiomeAnalyst: the research Unraveling 70 acids (2017). Nucleic (2017). J SP data. Xia Didion microbiome & of LB, meta-analysis Agellon and Africa. IL, visual 107 rural King W180-W188. statistical, America and S, comprehensive of Europe Habib for States from tool United J, S children the Chong Massart in of A, JB, study Sciences Dhariwal comparative Poullet of overweight a Academy M, treat National by Ramazzotti to the revealed M, probiotics of microbiota Paola of Proceedings gut Di use shaping the D, in 15 Cavalieri on diet metabolism overview C, & brief Filippo endocrinology A of De review (2020). Expert M Diet-Induced patients. Abdollahi obese of & Lactobacillus and Intestine S, of Effects Nikfar the Antiobesity 22 M, in (2019). food Daniali cloacae TH medicinal Enterobacter Kim of & of Journal YH, high- Inhibition Mice. Kim in by Obese HH, tissue Accompanied Jung HU, LMT1-48 adipose Jeong SP plantarum white HJ, Tsao Dong of 54 WJ, biochemistry CH, remodeling Choi nutritional Chan metabolism of Journal energy TY, The with Chien rats. associated KC, energy-diet-fed 263 Cheng reuteri YH, Lactobacillus Chen 27 CC LH, analysis Lu drug Chen WF, and Lai food TR, a Wu of YL, Journal obesity: Tsai amelioration. gastrointestinal with TL, of Lin adults journal CJ, World of Chang obesity. microbiota and gut microbiota between the link 6 of pathophysiology New-found Profile (2015). CK nutrition. (2020). clinical Chakraborti EL of LA, 29 journal Rosado NMCD Santos European & : review. Dos D, diseases systematic cardiovascular Carneiro Masterson and GAH, L, metabolism, Ferreira Crovesy Nutrition, MO, rats. diet-treated Freire fat Luna high in de TMR, M 2018 Albuquerque Magnani endocrinology de of journal RGS, STE International Cavalcante Shiow Review. F, Systematic Magkos SH, A D Lee Obesity: YM, Bastelica in Park C, A, Goday Knauf 56 O, M, Castaner Diabetes it Poggi resistance. Is MA, insulin and obesity: Iglesias obesity with J, initiates endotoxemia Amar Metabolic PD, 124 (2016). Cani Biochimie MW relevant? Hulver it trial. & Fer- is controlled MI, and Lactobacillus Frisard randomised real probiotic RP, a McMillan the women: NE, of breastfeeding evaluation Boutagy in 17 protocol: mastitis childbirth Study of and prevention pregnancy (2017). BMC the N for Nassar CECT5716 & mentum JM, Morris DM, biochemistry nutritional Bond of Journal The mice. DIO in sensitivity 50 insulin improve and microbiota gut modulate : : 700-702. 16-25. tal. et , : 1889. : 21) h rboi atbclu emnu 9 teutscrimtblcdisorders cardiometabolic attenuates 296 fermentum Lactobacillus probiotic The (2019). 110-119. : e12191. : 148. : 11-20. : 560-566. : : 1761-1772. 11 615-622. tal. et , 21) etgnrto rboisi disease in probiotics generation Next (2019). tal. et , : 87-94. tal. et , tal. et , tal. et , : 1-4. 21) h u irboeProfile Microbiome Gut The (2018). 20) eaoi endotoxemia Metabolic (2007). 21) ihftde:bacteria diet: High-fat (2010). 21) nibst ffc of effect Antiobesity (2018). : 4095789. tal. et , : 14691-14696. 21) matof Impact (2010). : 1408-1417. : 181-183. : Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. i M en J o H a J i H(06.LcoailsskiO6 mloae high-fat ameliorates 36 lipopolysaccharide research OK67 microbiota Nutrition sakei gut Lactobacillus expression. inhibiting protein (2016). by junction DH tight mice colon Kim in inducing obesity & gut 102 and and MJ, alters America production intolerance Han Obesity of glucose KH, States blood Woo (2005). United diet-induced JJ, JI the of Jeong of Gordon levels SM, Sciences improved & Lim of carbohydrate RD, Academy high Knight National to CA, the fat of Lozupone 11070-11075. 57 high P, Proceedings journal from Turnbaugh Endocrine ecology. diet F, diet. microbial in high-fat Backhed Shifts a RE, fed Ley mice (2010). in R cytokines Choue pro-inflammatory & and G, adipokines Shin IS, treatment Lee probiotics 15 IS by one pathway Choi PGC-1alpha PloS BK, the mice. Kim of in activation H, through Joung dysfunctions C, 6 metabolic Lee communications diet-induced B, Nature AF Kim resistance. J, Bassas insulin Kwon SH, mediates Kwak nutritional gene KC, of adiponectin Shin Journal the inhibits X, of SBT2055 Pan diet. thylation YJ, gasseri high-fat Park Lactobacillus a AY, fed Kim (2016). mice Y in Kadooka permeability & intestinal 5 F, science and Sakai inflammation 498 A, Nature tissue Ogawa control. adipose M, glucose Miyoshi diabetic M, and Kawano the impaired B of normal, Fagerberg CJ, microbiota with Behre 20 women The G, Obesity European Bergstrom (2012). in weight. I, K Nookaew body Thorngren-Jerneck V, Tremaroli excessive & FH, and S, Karlsson normal Ahrne with G, In- children Molin preschool and High-Fat- J, in Expression Alleviates Xu gut SIRT1 sakei J, 63 Lactobacillus and research Onnerfalt Activation food CL, (2019). & AMPK Karlsson DH nutrition Inducing Molecular Kim by & Activation. NF-kappaB HB, Mice Microbiota-Mediated Endothelial Jang in Gut and SJ, hibiting Anxiety Oh Hypertension and JK, Induces Obesity Kim Leptin 67 Diet-Induced SK, Hypertension (2016). Han Mice. HM, EJ Female Jang Chantemele Obese de in Belin Mechanisms Aldosterone-Dependent & via Jr., Gastroenterology Dysfunction L, obesity. Otvos of AC, independently Huby microbiome gut murine the YY of gut Chen 137 composition M, 109 human Hamady the America SA, the determines Keilbaugh of SA, of diet States Sherrill-Mix Proceedings United C, biology the Hoffmann disease. systems MA, of bowel Hildebrandt Sciences inflammatory Metagenomic of and Academy obesity (2012). National with the E associated of shifts Borenstein topological & reveals intestinal PJ, microbiome on Turnbaugh flavonoids of S, Effects and research Greenblum Nutrition (2016). microbiota obesity. X diet-induced Terra Gut during & microbiota M, 29 gut (2014). Blay reviews in changes A, A and Ardevol integrity Colecchia M, barrier & Pinent inflammation, I, M, the Gines Taddia K, is 20 G, Gil-Cardoso gastroenterology who of Marasco and journal chicken LH, World the Eusebi syndrome. is R, metabolic who Schiumerini 105 D, disorders: nutrition Festi clinical metabolic of and journal obesity, American permeability, The Gut egg? 110 America (2017). of A States LB Fasano United Bindels National the the C, of of Druart Sciences Proceedings JP, of obesity. diet-induced Ouwerkerk Academy controls obesity, epithelium 105 L, between intestinal practice Geurts and link muciniphila clinical a Akkermansia C, and as Belzer research Inflammation A, Diabetes (2014). Everard N diabetes. Paquot 2 & type AJ, and Scheen syndrome J, Piette metabolic S, Legrand-Poels N, Esser : 7612 e1711-1712. 1716-1724 : : e23. 234-248. : e0228932. : tal. et , 12 3-4. : : tal. et , 9066-9071. 22) opeesv mloaino high-fat of amelioration Comprehensive (2020). 16079-16094. 21) bst-nue N hyperme- DNA Obesity-induced (2015). tal. et , : 594-599. tal. et , : 2257-2261. 21) rs-akbetween Cross-talk (2013). 21) u metagenome Gut (2013). tal. et , : : 99-103. 141-150. : : 337-348. 7585. 20) High-fat (2009). : : 39-50. 1020-1028. : e1800978. : Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. emnu ET76 oe lentv o h rvnino aclrdsresi os oe of model mouse Societies a American of in Federation disorders the vascular of publication of 33 F official Biology prevention O’Valle : Experimental M, the journal for Sanchez FASEB for N, erythematosus. alternative Visitacion lupus novel la systemic a de M, CECT5716: Romero fermentum I, Robles-Vera M, Toral obese in 127 status pro-inflammatory Science and Clinical pro-oxidant vascular mice. the MP reduces ZDF Utrilla CECT5711 Sánchez coryniformis using M, Lactobacillus M, analysis vivo Romero Gómez-Guzmán in Jiménez R, M, an M, L Toral syndrome: 98 Rodes biotechnology metabolic A, and of markers microbiology on Labbe on Applied ML, Probiotics 5221 rats. Jones NCIMB of fermentum M, Effects L. 12. Malhotra administered (2020). Nutrients S, Trials. C Saha Clinical C, Gomez-Llorente Randomized Tomaro-Duchesneau of Clinical & Review factors. A, Systematic A risk Gil Syndrome: syndrome MJ, Metabolic Martinez-Ramirez metabolic C, with CL Tenorio-Jimenez Ferreira correlated J, are Bressan patients SC, 31 obese Franceschini nutrition in PG, parameters Chiarello NC, 341 permeability medicine Souza resistance of TF, insulin journal for Teixeira England The action–implications New insulin Pharmacotherapy. The and Obesity transporters mellitus. Glucose (2018). diabetes (1999). LJ and BB Kahn Aronne & & PR, Shepherd RB, 102 America Kumar North LI, 20 of Igel reports clinics hypertension D, Medical Current Umashanker Syndrome. KH, Metabolic Saunders the of Epidemic Nutrients Global Acids. 12. The Fatty (2018). and MG 4 Saklayen Receptor Toll-Like Inflammation, Obesity, (2018). PC 10. Calder & MM, properties. Rogero anti-inflammatory intestinal exert 6 to Function essential not & M is Food Comalada CECT5716 M, fermentum Olivares Lactobacillus N, of research Garrido-Mesa bility food T, Vezza & F, nutrition Algieri Rodr´ıguez-Nogales Molecular mouse A, DSS composition. microbiota in and salivarius expression Lactobacillus 61. microRNAs and N on fermentum Chueca impact MP, Lactobacillus Utrilla colitis: of T, effects Vezza 62 research J, anti-inflammatory Garrido-Mesa intestinal food Hypertension F, & with Algieri nutrition Rats A, M Molecular Olivares in Rodriguez-Nogales Blockade. Stress M, Oxide Oxidative Romero Nitric Vascular M, Chronic and Sanchez by Dysbiosis N, Induced Prevents microbiota. Visitacion fermentum the la Lactobacillus in de changes otic M, with Toral fatty associated diet I, of Robles-Vera fructose development 61. high research the a prevents food M fed FOS & rats Olivares nutrition in and AM, Molecular alterations CECT5716 Aransay glycemic fermentum and JL, Lactobacillus liver Lavin acid of MD, 143 composed Suarez pediatrics synbiotic of R, A J Journal Gamez-Belmonte Xaus The B, ML, gut. Rivero-Gutierrez Marin infant E, the Jiminez for bacteria C, acid Reviriego lactic S, 65 Langa Gut G R, frontier. Hold Martin clinical GM, new Hirschfield a GD, Hermes health: host F, Fava Nutrition and DH, microbiota. Adams in gut JR, colitis by Marchesi diet-induced production high-fat lipopolysaccharide ameliorates and IM38 41 activation adolescentis research NF-kappaB Bifidobacterium inhibiting (2017). by DH mice Kim & SM, Lim : : 735-740. 86-96. : 1176-1184. : 33-45. : 10005-10018. : 135-148. : : 330-339. 115-126. 13 tal. et , : 248-257. : 754-758. tal. et , 20) ua iki oreof source a is milk Human (2003). tal. et , tal. et , tal. et , 21) h u microbiota gut The (2016). tal. et , tal. et , tal. et , : e1800298. tal. et , 21) ffc forally of Effect (2014). 21) h probiotic The (2014). 21) Lactobacillus (2019). 21) h Probi- The (2018). 21) Differential (2017). 21) Intestinal (2012). 21) h via- The (2015). tal. et , (2017). : Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. n- os W GATTTTG- FW: TAGTCCTTCC- FW: Mouse GAGAATACAGC- FW: Mouse GACTTC- FW: Jnk-1 Mouse GATGGCAGA- T FW: Annealing Il-6 CCATCAC- FW: Mouse Il-1 3’ 5’- Sequence Glut4 Mouse Mouse Ampk Organism Adiponectin Gapdh fermentum Lactobacillus Gene of Effects Anti-Obesity (2019). X Signaling 1. PPAR-alpha Zhao Table through & Mice X, Obese Diet-Induced Zhou 7. High-Fat R, Microorganisms in Pathway. Pickle Yi Sichuan J, from Isolated Mu CQPC05 F, Tan K, Zhu 58 M receptor- Romero proliferator-activated A, peroxisome 10 Nieto Sánchezof immunology M, P, Mucosal Galindo Jiménez R, mice. S MJ, Fukuda in Zarzuelo S, sensitivity Ryu insulin SH, improves Lee and rRNA Y, obesity of 73 Kim assignment prevents microbiology rapid YS, environmental for Lee and classifier JY, Bayesian Applied Yang taxonomy. Naive (2007). bacterial JR new Cole the & into JM, sequences Tiedje GM, Garrity G Q, 35 Naughton Wang biology cross-sectional B, vascular dysfunction: vascular Lesourd and generalized present thrombosis, R, mellitus Arteriosclerosis, diabetes Chapier in study. 2 properties. type F, obesity immunomodulatory without and Dutheil its diet-induced with P, individuals to in and Obert extract dysbiosis G, leaf microbiota Walther L.) gut europaea of amelioration 150 (Olea M research the olive Sanchez Pharmacological to of M, related Romero effects are J, protective mice Garrido-Mesa vascular F, (GLUT4). and Algieri 4 tabolic A, Type Transporter Rodriguez-Nogales Glucose T, Physiology, Vezza (2020). (FL). MA Island Sepulveda Treasure Carrillo StatPearls. & In V, Podder E, Vargas : β 733-743. rmrsqecsue nR-PRassays RT-qPCR in used sequences Primer os W TGATGAGAAT- FW: Mouse : 104487. β ciaini pnaeul yetniert.Hypertension rats. hypertensive spontaneously in activation tal. et , 14 TAGCCCATGCCGAGAATGA RV: GACTGGCGAGGACT TTGGTCCTTAGCCACTCCTTCC RV: TACCCCAATTTCC CTTCTTCAAAGATGAAGGAAA RV: GACCTCTTCT TCTTATTGCAGCAGCGCCTGAG RV: TAGGACCAGTG CGCGCGACTATCAAAGACATACG RV: CTTCACAGCCTCATC CTTGCCAGTGCTGCCGTCAT RV: GATGGCACTCC CCTGCTTCACCACCTTCTTG RV: CATCTTCCAGGAG : 21) u omna atrie acidifaciens Bacteroides commensal Gut (2017). 1022-1029. tal. et , tal. et , 21) niyetnieeffects Antihypertensive (2011). 21) eaoi syndrome Metabolic (2015). : tal. et , 104-116. 60 60 60 62 60 52 60 : 5261-5267. 21) h me- The (2019). ° C Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. o1MueF:GGGGCCTA- FW: fat); FW: and epididymal (AUC) and curve abdominal the efficiency, under Mouse area energy intake, energy evolution, 1. Figure CCTG- FW: LEGENDS FIGURE Mouse Zo-1 Mouse ACGGACCCT- FW: Tnf- CGTGGTCAACT- FW: Tlr4 GCAGTC- FW: Mouse Tff3 GCAGTC- FW: Mouse Ppar- AGCCAACTCT- FW: Mouse Occludin FW: Mouse Muc-3 T Annealing TTCACA- Mouse FW: Muc-2 3’ 5’- Sequence Mouse Muc-1 Mouse Mcp-1 Organism R Leptin Leptin Gene α α ffcsof Effects .fermentum L. os W AACTAGTGGT- FW: Mouse AGGCTG- FW: Mouse c) pddmlaioetsu,aaye yhmtxlnadesnstaining eosin and hematoxylin by analysed tissue, adipose Epididymal ET76amnsrto on administration CECT5716 15 TGGAGATGAGGCTTCTGCTT RV: CACTGATCAAGA CTTCACAGAGCAATGACTCC RV: GCCAGCCGAT AGATCAACCGATGGACGTGTAA RV: TAAGCTCC GCCTTTCAGGGAAT- GCCACGGTTGTTACACTGCTC RV: CTCTG GTTGCTGGGTC- GGCATTTGTTCCGGTTCTTC RV: TAAGGGCTTCTTTCG TCAGCAGCAGCCATGTACTC RV:GACCACTATGA CGGCTCTATCTCTACGCTCTCC RV: GCGAGAATGG CACCGTGGGGCTACTGGAGAG RV: CTCAGTGGCACCTC CACCGTGGGCTACTGGAGAG RV: CTCAGTGGCACCTC TCTCCAGCCTACTCATTG RV: CACTGAAG TGCCTGGGCCTCTATCTC RV: GATGT GCTATTTTGGGAA- GCTGGTGAGGACCTGTTGAT RV: CACGCAGTCGGTAT a) opooia hne bd weight (body changes morphological b) lcs oeac etand test tolerance Glucose 56 60 60 60 62 56 60 60 60 55 60 60 ° C Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. of-gut-microbiota-dysbiosis fermentum-cect5716-ameliorates-high-fat-diet-induced-obesity-in-mice-through-modulation- 1.pdf Figure ( mice obese file treatment Hosted the in and differences HFD-group drove and mice, and HFD-group control abundant mice), differentially (control were b) that mice States) non-obese Unobserved in of Reconstruction by munities a) 8. Spearman. Figure of test non-parametric using Correlation markers. S1. (P Figure differ statistically letter different with Groups index); c) Shannon and OTUs Observed tree, 7. Figure VAS2870; Tnf- inhibitor means oxidase Tlr4, as NADPH of expressed presence expression the gene or and absence activity the in relaxation dependent 6. Figure means as qPCR; expressed time real by analysed markers integrity 5. Figure means as expressed are (P Data differ qPCR. time real by and means 4. as expressed Figure are Data (P qPCR. differ time statistically real by means analysed as expressed are , Data mice. 3. (HFD)-fed (P Figure differ diet statistically fat letter high different and with Groups control in levels plasma a) 2. Figure (P differ statistically letter different bar=50 (scale Τνφ-α orlto ewe atra aaadfntoa etrsi ahgop and group; each in features functional and taxa bacterial between Correlation atra omnt pya ls n eu)adteFBrto aaaeepesda means as expressed are Data ratio. F/B the and genus) and class (phyla, community bacterial Adinopectin < , Mcp-1 matof Impact 0.05). ffcsof Effects ffcsof Effects ffcsof Effects etmpo ao htwr otsgicnl ieeti bnac n anobesity-related main and abundance in different significantly most were that taxon of Heat-map ffcsof Effects aa lcs,islnlvl n OAI ne,and; index, HOMA-IR and levels insulin Glucose, Basal eaeoi ucinlfaue rdce yPCUt(hlgntcIvsiaino Com- of Investigation (Phylogenetic PICRUSt by predicted features functional Metagenomic μ vial at available n nftadlvrgn xrsinof expression gene liver and fat on and , )ado dpct ra aaaeepesda means as expressed are Data area. adipocyte on and m) and Muc-1 ± ± < .fermentum L. .fermentum L. .fermentum L. Jnk-1 E n1) ruswt ieetlte ttsial ie (P differ statistically letter different with Groups (n=10). SEM (P differ statistically letter different with Groups (n=10). SEM .fermentum L. 0.05). .fermentum L. , Muc-2 and; , b) .fermentum L. https://authorea.com/users/345589/articles/471772-lactobacillus- lsaedtxncnetain E/L nooi nt/L.Dt are Data units/mL). endotoxin (EU/mL, concentrations endotoxin plasma b) ET76amnsrto on administration CECT5716 , < ET76amnsrto nlvrado a eeepeso of expression gene fat and/or liver on administration CECT5716 ET76amnsrto on administration CECT5716 Muc-3 Ppar[?] 0.05). ET76amnsrto nedteilfunction: endothelial on administration CECT5716 α ET76amnsrto nftgn xrsinof expression gene fat on administration CECT5716 b) n Il-1 and , rae mice. treated eadvriyb rnia oriaeaayi cr lt and plot, score analysis coordinate principal by Beta-diversity Zo-1 , Glut4 < < ± 0.05). β 0.05). , 16 Occludin E n1) ruswt ieetlte statistically letter different with Groups (n=10). SEM ncnrladhg a it(F)fdmc.Dt are Data mice. (HFD)-fed diet fat high and control in , etnR Leptin AmpK ± and and E n1) ruswt ieetletter different with Groups (n=10). SEM a) nhg a it(F)fdmc,analysed mice, (HFD)-fed diet fat high in Tff-3 a) irboedvriy(ho,P whole PD (Chao1, diversity microbiome Tlr4 b) eeepeso fitsia barrier intestinal of expression gene D/D ai n Triglycerides and ratio LDL/HDL nhg a it(F)fdmice, (HFD)-fed diet fat high in nhg a it(F)fdmice, (HFD)-fed diet fat high in ± E n1) ruswith Groups (n=10). SEM c) orlto ewrsfor networks Correlation .fermentum L. < < 0.05). 0.05). b) ± a) otcNADPH aortic E (n=10). SEM endothelium- ± group); Leptin a) SEM. Il-6 Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure 2

mg/dL a) b) Control Control Control Control a a diet diet LDL/HDL Glucose HFD HFD b b L. L. fermentum fermentum a c

mg/dL pmol/L Control Control Control Control a diet diet Triglycerides 17 Insulin HFD HFD b L. L. fermentum fermentum c Control Control a diet HOMA HFD b - IR L. fermentum a Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary.

Fold increase Fold increase Fold increase Fold increase Figure 3 b) a) Control Control Control Control Control Control Control Control a a a Mcp a diet diet diet Ppar diet Il Tlr4 - HFD HFD - 6 HFD b 1 HFD b b ⍺ b ( ( liver ( liver ( liver L. L. L. fat L. fermentum fermentum fermentum fermentum a ) a a ) a ) ) Control Control Control Control Control Control Control Control a a a a diet diet diet Glut4 Mcp diet Tlr4 Il - HFD HFD HFD 6 b b HFD b - b 1 ( ( ( fat fat fat ( L. L. L. fat L. fermentum fermentum fermentum ) fermentum ) ) a c c ) a 18 Control Control Control Control Control Control a a a Ampk Tnf diet diet Jnk diet - HFD HFD HFD - ⍺ b b b 1 ( ( liver ( liver liver L. L. L. fermentum fermentum fermentum a a ) a ) ) Control Control Control Control Control Control a a a diet diet diet Ampk Tnf Jnk HFD HFD HFD - - b b b ⍺ 1 ( ( ( fat fat L. L. L. fat fermentum fermentum fermentum ) ) a ) a a Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure 4

Fold increase Fold increase Control Control diet diet a a Leptin Leptin HFD HFD b b - R ( fat ( fat L. L. L. L. fermentum ) fermentum ) a a 19 Control Control diet diet a a Adiponectin Leptin HFD HFD b b - R ( L. L. L. L. liver ( fermentum fermentum fat a c ) ) Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure

b) Fold increase Fold increase a) Control 5 Control diet diet a a Muc Zo - - 1 1 HFD HFD (colon) (colon) b b L. L. L. L. fermentum EU/ml fermentum a a

1.0

0.8

0.6

0.4

0.2

0.0 Control diet a Control Control diet diet a a Occludin Muc LPS HFD 20 b - 2 HFD HFD b b (colon) (colon) L. L. L. fermentum L. L. fermentum fermentum a a a Control Control diet diet a a Muc Tff - - HFD 3 HFD 3 b b (colon) (colon) L. L. fermentum L. L. fermentum a a Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure 6 a) b)

TNFa mRNA % Relaxation -1 -1 100

50 RLU min mg protein 75

(Foldfold cincreasehange) 0

-9 Control Control NADPH oxidase NADPH

ST DIO DIO + LC40 L. High Control

ANDARD DIET fermentum a

r a

-8 *

l fat

diet diet

d Log[

i diet diet

e Tnf *

t Ach

-7 * - HFD ⍺ HFD b

H ] (M) b

F (aorta) *

-6 L. L. * activity L. L.

L fermentum

fermentum

f *

e a

m a

-5 *

m 21

TLR4 mRNA IL-1b mRNA % Relaxation

(fold change) (Foldfold increasechange) 100 75 50 25 10

10 0 0 2 4 6 8

0 -9 Control Control C

C o

o n

n t

t r

r a a L. High Control o

o l

fermentum

d d diet diet -8

i i

e e Tlr4 Il fat

t t Log[ - diet diet 1β HFD HFD

H H Ach (aorta) b b

F -7 (aorta) F

D D + VAS2870 (10 ] (M) L. L. L. L.

L L

. fermentum

-6 fermentum

e f e

r r

m a m a

e e

n n

u t u

m m -5 μM ) Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure 7 a) c) Proportion of Sequences (%) Proportion of Sequences (%) b)

1000

100

800

600

400

200

0 Control Control

Ve Control diet

h a

i diet diet

Chao1 Chao1

HFD HFD b

Phyla

Class HFD HFD L. fermentum

L.F a L. L. fermentum fermentum

(

1 Control

PD_whole_tree

. diet

h PD a

)

Ve Pr

Actinobacteria

Others

Cyanobacteria

Bacter Firmicutes

Actinobacteria

Others Ve Gammapr Alphapr Flavobacteria

Bacilli Bacter Clostridia Erysipelotrichi whole

HFD

oteobacteria

r HFD

u b

oidetes

oidia

oteobacteria

r L.

(

5 fermentum

L.F tree

P a

(

)

600

400

200

0 Proportion of Sequences (%) %

100

Observed_species

)

Ve Control Control Observed Control diet

h a

c a

e diet

HFD L. High Control diet HFD b fermentum F/B ratio F/B L. fat

Genus OTUs HFD fermentum diet

L.F HFD diet b a L. L. fermentum

6.0

5.5

5.0

4.5

4.0

3.5

3.0 fermentum a

Ve Control diet

h a

Shannon

l Shannon

HFD HFD b

Derived form

Sisymbrium

Other Pr Derived form Enter Coptotermes Alistipes Eubacterium Odoribacter Lactobacillus Clostridium Bacter

Parabacter

Akkermansia Derived form

evotella L.

oides

habdus fermentum a,b

L.F

oides

Ruminococcaceae

Lachnospiraceae

Erysipelotrichaceae Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure S1 23 Posted on Authorea 23 Jul 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159551303.38968103 — This a preprint and has not been peer reviewed. Data may be preliminary. Figure 8 c) a) HFD Control L. fermentum diet b) 24