A Systematic Revision of Gomphandra (Stemonuraceae)

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

Melanie Schori

June 2010

© 2010 Melanie Schori. All Rights Reserved.

2

This dissertation titled

A Systematic Revision of Gomphandra (Stemonuraceae)

by

MELANIE SCHORI

has been approved for

the Department of Environmental and Plant Biology

and the College of Arts and Sciences by

Philip D. Cantino

Professor of Environmental and Plant Biology

Harvey E. Ballard, Jr.

Associate Professor of Environmental and Plant Biology

Benjamin M. Ogles

Dean, College of Arts and Sciences 3

ABSTRACT

SCHORI, MELANIE, Ph.D., June 2010, Plant Biology

A Systematic Revision of Gomphandra (Stemonuraceae) (480 pp.)

Directors of Dissertation: Philip D. Cantino and Harvey E. Ballard, Jr.

The genus Gomphandra Wall. ex Lindl. was studied and revised to more accurately reflect the diversity of the group. Floral morphology and fruit anatomy were

compared to other genera of Stemonuraceae to assess reproductive diversity within the

family and identify potential synapomorphies. Seven genera of Stemonuraceae possess

what appears to be a unique fruit type: a laterally compressed drupe with fleshy

appendage that aids in dispersal. Fruit of nine genera were sectioned, and all exhibit

sclerified longitudinal bundles in the inner mesocarp; one bundle, which appears bright in cross-section under polarized light, may be a synapomorphy for the family. Seed coats are vascularized with a chalazal/post-chalazal bundle (7 genera) or a pachychalazal

bundle (2 genera). Molecular data were sampled from four gene regions (rbcL, trnL

intron, trnL-F spacer, matK) in 10 species of three genera (Gomphandra, Grisollea,

Stemonurus), for a total of 24 new sequences. Preliminary evidence suggests Grisollea

and Codiocarpus (both with a laterally compressed fruit) are more closely related to each other than to Stemonurus or Gomphandra, which have uncompressed fruits. Members of

Stemonuraceae may have a molecular synapomorphy in a 100 base pair region of TA repeats in the trnL-F spacer that is apparently not shared with any genera outside the family. Gomphandra has two moderately supported clades, one with the synapomorphy of terminal (vs. axillary) inflorescences. The revision of the genus recognizes 62 taxa: 56 4 species, three subspecies, and three varieties. Diversity is highest in the Philippines (17 taxa), followed by Borneo and Papua New Guinea (10 taxa each), and Sumatra (9 taxa).

Twenty-nine new taxa are described, three species are resurrected, one species is reduced in status, and five taxa are synonymized. Problems with typification and nomenclature are corrected for 24 species of Gomphandra and six species in four other genera of

Stemonuraceae.

Approved: ______

Philip D. Cantino

Professor of Environmental and Plant Biology

Approved: ______

Harvey E. Ballard, Jr.

Associate Professor of Environmental and Plant Biology

5

ACKNOWLEDGMENTS This dissertation would not have been possible without the help of many individuals and organizations. I apologize to anyone I may have inadvertently omitted. The librarians at Harvard University Herbaria, especially Judy Warnement, provided invaluable help, as did Peter Fraissinet at Cornell University’s Bailey Hortorium. Curators and staff at 29 herbaria sent loans, checked specimens, hosted me as a visitor, and photographed specimens (A/GH, BH, BISH, BM, BRI, C, CAHUP, CAL, CANB, E, F, G, K, L, LBC, MEL, MICH, MO, MU, NY, P, PNH, PUH, TAIF, TNM, U, UC, US, WRSL). I would especially like to thank Linda Hollenberg (US), Emily Wood and Walter Kittredge (A/GH), Laura Pearce and Timothy Utteridge (K), Gerard Thijsse (L), Jim Solomon (MO), and Peter Lowry (P). Alice Schori databased hundreds of specimens at Harvard for me, showing true maternal devotion. Several people provided translations - Maria Teresa Bonsatti (Italian), Tineke Blokzijl (Dutch), David Tees (French and Japanese), Angelika Stammler (German), and Yunjing Wang, Leonardo Co, and Yi-Ting Wang (Chinese). Neil Bernstein provided assistance with Latin translations and patiently proof-read my Latin descriptions and diagnoses. I received research funding from a variety of sources. Ohio University’s Graduate Student Senate awarded me two original work grants and one travel grant. The American Society of Plant Taxonomists provided support for a research trip to Kew, Leiden, and Paris, and paid for conference attendance at its 2009 meeting in Snowbird, Utah. Ohio University’s Student Enhancement Award provided funds for travel, equipment, and lab expenses. The Ohio Center for Ecology and Evolutionary Studies (OCEES) paid for two quarters of tuition and stipend in support of my research. Ohio University’s Clippinger Fellowship allowed me to concentrate on research without teaching responsibilities for one academic year. A Fulbright grant permitted me to travel to the Philippines for nine months to conduct field research. I would like to thank Elizabeth Clodfelter and the staff at the Philippine-American Educational Foundation for their unwavering support during the Fulbright. I cannot possibly individually thank all the people in the Philippines who helped me, but I can acknowledge those who contributed the most to my success. Mary Ann 6

Cajano was my travel companion during field work, and one could not find a better person with whom to visit remote leech-infested mountains. Julie Barcelona took me under her wing at PNH and helped me connect with other Filipino botanists. Leonardo Co provided amazing botanical assistance. Dr. Edwino Fernando mentored me during my time at the College of Forestry, University of the Philippines – Los Baños. The Quimado family, especially Grace and Marilyn, opened their home to me, as did Rhodora and Nestor Aldemita. Aurora and Gene Hettel and the IT staff at the International Rice Research Institute provided cultural, travel, and technical assistance. The following people and organizations were also invaluably helpful: Dr. Domingo Madulid, Luisto Evangelista (PNH); Dr. Antonio Manila, Anson Tagtag (Department of Environment and Natural Resources); DENR Regional Executive Directors, PENR and CENR officers, and mayors who gave permission to collect and provided collection permits; Rey Luna and Bert Almonte (National Commission on Indigenous Peoples); Andy Pascual, Artaban (Buboy) Famenia, Pompeo Sanchez, and all the other DENR foresters; Nonito Antoque and the other men and women who acted as local guides. Maraming salamat po! Drs. David Tank, Kobinah Abdul-Salim, Vicki Funk, and Félix Forest provided assistance with molecular systematics research. Dr. Wolfgang Stuppy mailed a tungsten carbide microtome blade from the United Kingdom so I could section fruit and then helped me interpret my results. Dr. Timothy Utteridge and Dr. Peter Lowry have served as collaborators on manuscripts and worked with me to make sense of difficult specimens. Drs. James Reveal, Richard Brummitt, and Kanchi Gandhi provided nomenclatural assistance. I need to thank the people at Ohio University who helped me with my dissertation. Dr. Philip Cantino served as my primary advisor, meticulously edited everything I wrote, and supported my efforts tirelessly for six years. Dr. Harvey Ballard coadvised me, provided encouragement when I needed it most, and told me he had no doubt I would finish my dissertation on time. I could not have asked for a better pair of advisors. My other committee members, Drs. Gar Rothwell, Morgan Vis, and Kelly Johnson, have supervised my tenure as a graduate student and read most, if not all, of my dissertation, which is a lot to ask from anyone. Vijay Nadella and Tara Killen at the Ohio 7

University Genomics Facility helped me finally get useable sequence data. Martha Bishop helped me find obscure but essential equipment for my fruit study. Dr. Robert Hikida taught me how to use several kinds of microtomes and allowed me to use his lab. Noorliza Warner produced several hundred annotation slips for me. Dr. Brian McCarthy provided advice on statistical analyses. Connie Pollard found an answer to every administrative question I had, gave me two cats (who provided fur therapy), and was always willing to listen to my frustrations and triumphs, no matter how busy she was (and she’s always busy). Finally, I need to thank Dr. David Tees, who started out translating French for me and ended up as my husband. He called every night while I was in the Philippines, never complained when I worked late, and provided the cheerful loving support every woman should be lucky enough to have from her partner.

8

TABLE OF CONTENTS

Page

Abstract 3

Acknowledgments 5

List of Tables 10

List of Figures 11

Chapter 1: Introduction 14 Systematics of Gomphandra 14 Stemonuraceae 16 Biogeography 17 Objectives 18 Herbarium and Field Work 18 Taxonomic Concepts 19 Overview of Results 19 Dissemination 20

Chapter 2: Stemonuraceae 21 Introduction 21 Morphology and Anatomy 22 Ecology and Reproductive Biology 30 Economic Importance 32 Relationships among the Genera 32 Family Description 36 Key to the Genera 37 Generic Descriptions 38

Chapter 3: Systematics and Phylogeny of Stemonuraceae 44 Introduction 44 Previous Studies 44 Materials and Methods 46 Results 49 Parsimony Analyses 52 Preliminary Conclusions 55

Chapter 4: Characters, Species Concepts, and Morphometrics 57 Characteristics of Gomphandra 57 Species, Subspecies, and Varieties 64 Hybrids, Microspecies, and Agamospermy 67 9

Phenetic Analyses 70 Difficult Groups within Gomphandra 78 Clades and Phenetic Groups 83

Chapter 5: New Species Publications and Nomenclature 87 Summary 87 Article 1 – Three New Gomphandra 88 Article 2 – Nine New Gomphandra 107 Article 3 – Twelve New Gomphandra 150 Article 4 – Nomenclature and Typification 206

Chapter 6: Taxonomic Revision 229 Continental Asia 233 Philippines and Taiwan 277 Borneo 325 Indonesia (excluding Kalimantan) 348 Papua New Guinea 394 Solomon Islands and Fiji 420 Australia 426

References 430

Appendices 1. Sequences from GenBank 442 2. Alignments 443 3. Extraction Log 471 4. Amplification Log 476 5. Sequencing Log 479 10

LIST OF TABLES

Page

Table 1.1 Genera of Stemonuraceae 17

Table 2.1 Reproductive Characters of Stemonuraceae 35

Table 3.1. GenBank Sequences of Stemonuraceae 45

Table 3.2. Primers 46

Table 3.3. Sequences of Stemonuraceae for trnL, trnL-F, and matK 50

Table 4.1. Variable-Variate Correlations for Gomphandra luzoniensis 72

Table 4.2. Variable-Variate Correlations for Gomphandra cumingiana and G. borneensis 75

Table 4.3. Variable-Variate Correlations for Gomphandra mollis and G. cambodiana 77 11

LIST OF FIGURES

Page

Figure 2.1. Fruit of Stemonuraceae 29

Figure 3.1. Single Most Parsimonious Tree for trnL 52

Figure 3.2. Majority Rule Tree for trnL-F 53

Figure 3.3. Single Most Parsimonious Tree for matK 54

Figure 3.4. Three-Gene Majority Rule Tree 55

Figure 4.1. Canonical Variance Plot for Gomphandra luzoniensis 71

Figure 4.2. Canonical Variance Plot for Gomphandra cumingiana and G. borneensis 74

Figure 4.3. Canonical Variance Plot for Gomphandra mollis 76

Figure 5.1. Sulcus Complex 90

Figure 5.2. Gomphandra palustris 93

Figure 5.3. Map of Gomphandra palustris Distribution 93

Figure 5.4. Gomphandra halconensis 96

Figure 5.5. Map of Gomphandra halconensis and G. conklinii Distributions 96

Figure 5.6. Gomphandra conklinii 99

Figure 5.7. Gomphandra rarinervis 104

Figure 5.8. Map of Gomphandra rarinervis Distribution 105

Figure 5.9. Gomphandra engganensis 110

Figure 5.10. Map of Gomphandra engganensis Distribution 111

Figure 5.11. Gomphandra bracteata 113

Figure 5.12. Map of Gomphandra bracteata Distribution 114

12

Figure 5.13. Gomphandra fernandoi 116

Figure 5.14. Map of Gomphandra fernandoi Distribution 118

Figure 5.15. Gomphandra luzoniensis subsp. septentrionalis 120

Figure 5.16. Map of Gomphandra luzoniensis subsp. septentrionalis Distribution 123

Figure 5.17. Gomphandra longipedunculata 125

Figure 5.18. Map of Gomphandra longipedunculata and G. macrosperma Distributions 127

Figure 5.19. Gomphandra macrosperma 129

Figure 5.20. Gomphandra angustata 131

Figure 5.21. Map of Gomphandra angustata, G. muscosa, and G. subcordata Distributions 133

Figure 5.22. Gomphandra muscosa 136

Figure 5.23. Gomphandra subcordata 138

Figure 5.24. Gomphandra melanesiensis 141

Figure 5.25. Map of Gomphandra melanesiensis subsp. melanesiensis Distribution 142

Figure 5.26. Gomphandra melanesiensis subsp. macrocarpa 146

Figure 5.27. Map of Gomphandra melanesiensis subsp. macrocarpa Distribution 148

Figure 5.28. Gomphandra microcarpa 153

Figure 5.29. Map of Gomphandra microcarpa Distribution 154

Figure 5.30. Gomphandra tenuis 156

Figure 5.31. Map of Gomphandra tenuis Distribution 157

Figure 5.32. Gomphandra coi 160

Figure 5.33. Map of Gomphandra coi and G. psilandra Distributions 162

13

Figure 5.34. Gomphandra psilandra 164

Figure 5.35. Gomphandra dinagatensis 168

Figure 5.36. Gomphandra ultramafiterrestris 171

Figure 5.37. Map of Gomphandra ultramafiterrestris Distribution 172

Figure 5.38. Gomphandra borneensis 175

Figure 5.39. Map of Gomphandra borneensis Distribution 176

Figure 5.40. Gomphandra kinabaluensis var. kinabaluensis 180

Figure 5.41. Map of Gomphandra kinabaluensis Distribution 181

Figure 5.42. Gomphandra kinabaluensis var. clemensiorum 185

Figure 5.43. Gomphandra lamanii 188

Figure 5.44. Map of Gomphandra lamanii Distribution 189

Figure 5.45. Gomphandra chimaera 192

Figure 5.46. Map of Gomphandra chimaera, G. jacobsii, G. parviflora var. magnifolia, G. parviflora var. paucibarbata, and G. simulans Distributions 193

Figure 5.47. Gomphandra jacobsii 195

Figure 5.48. Gomphandra parviflora var. magnifolia 198

Figure 5.49. Gomphandra parviflora var. paucibarbata 201

Figure 5.50. Gomphandra simulans 203

14

CHAPTER 1: INTRODUCTION Gomphandra Wall. ex Lindl. is a genus of trees that grows throughout most of Southeast Asia. It is the largest genus of the family Stemonuraceae, a recent segregate from Icacinaceae s.l. (Kårehed 2001). Gomphandra was last revised by Sleumer in 1969, in preparation for the inclusion of Icacinaceae in volume 7 of Flora Malesiana. Apart from a revision of the genus Medusanthera recently submitted to Kew Bulletin (Utteridge pers. comm.), no one had revised Gomphandra or any of its related genera in the intervening years, so the need for a modern revision remained. Sleumer’s revision included 33 species and four varieties. More than 70% of the species were considered endemic to an island or other restricted geographic area. Endemism was highest in the Philippines (7 species), followed by Sumatra (6 species) and Papua (5 species). In contrast, the present revision recognizes 56 species, three subspecies, and three varieties. Endemism stands at 65%, with 13 endemic taxa in the Philippines, 10 in Papua, and 8 each in Borneo and Sumatra. Species of Gomphandra are shrubs or small to medium understory trees that grow in primary or secondary forests in a variety soils, forest communities, and elevational zones. The genus is characterized by small, white, four- or five-petaled flowers with long trichomes on the filaments. The flowers are functionally dioecious, and pistillate and/or staminate flowers are unknown for 16 species. Flowers are presumably pollinated by small generalist insects, though no pollinator visits have been documented. Gomphandra fruits are one-seeded drupes that are distinguished by a persistent, sessile, disk-like stigma at the fruit apex, and by longitudinal ribs that are visible on dried fruits. Fruits range from 1 cm to more than 4 cm long, depending on the species. Mature fruit color may vary from white to orange or red, though most herbarium collections are of unripe green fruits. No important economic or ethnobotanical uses have been reported for the genus. Systematics of Gomphandra Wallich (1831-1832) first applied the name Gomphandra to two species he listed in his ‘Catalogue’ of plants collected by the East India Company. Lindley (1836) provided descriptions of Wallich’s species and retained the name Gomphandra, but 15

subsequent authors have placed species in Stemonurus Bl., Lasianthera P.-Beauv., Tylecarpus Engl., Urandra Thw., and Medusanthera Seem. Consequently, the literature is filled with conflicting interpretations of generic and specific limits as well as many incorrect names. Miers (1861) published the first major treatment of new species in 1861 (under Stemonurus), followed by Beccari (1877) and Sleumer (Sleumer et al. 1942). The last significant study of Gomphandra was published by Sleumer in 1969, in preparation for the seventh volume of Flora Malesiana, a flora for the Indo-Malaysian region of Southeast Asia. In Flora Malesiana, Sleumer (1971) included 26 species of Gomphandra but stated that “specific distinction is in the present state far from satisfactory.” Gomphandra is dioecious, and in some cases a species was described solely on the basis of pistillate or staminate flowers (Sleumer 1969). In other species, mature fruits had not been collected and studied. Incomplete specimens prevented Sleumer from thoroughly comparing species and writing a comprehensive key for their identification. Almost no research has been conducted on Gomphandra since Sleumer’s publication despite advances in systematic techniques and the increased availability of herbarium specimens. Recently, Kårehed (2001) published the first molecular phylogeny to include Gomphandra. Gomphandra was traditionally placed in Icacinaceae s.l., but Kårehed divided the family and placed Gomphandra in Stemonuraceae on the basis of its floral morphology. Kårehed (2001) used 72 morphological characters and molecular data to split Icacinaceae s.l. into four families in three orders, but he only examined one or two specimens each of eight genera of Stemonuraceae, and his molecular data were sparse. He used one sequence each of ndhF from Discophora Miers, Grisollea Baill., Irvingbaileya R. A. Howard, and Lasianthera; rbcL from Gomphandra and Irvingbaileya; and 18S rRNA and atpB from Irvingbaileya. Gomphandra is the largest genus in this new family, and both its relationship to other genera and the relationship of Stemonuraceae to other families remain unclear. Representatives of Gomphandra and some of its relatives have been examined as part of larger studies of Icacinaceae s.l. Pollen (Dahl 1952), vessels (Bailey and Howard 1941b), tracheary elements (Bailey and Howard 1941c), crystals and hairs (Heintzelman Jr. and Howard 1948), and vascular bundle arrangement (Teo and Haron 1999) have been 16

surveyed and provided evidence that Icacinaceae s. l. was not a monophyletic group. These studies consistently grouped the genera that Kårehed placed in Stemonuraceae, which is not surprising because these works provided the majority of his morphological data. One publication reported a chromosome number of 2n = 44 for Stemonurus (Oginuma et al. 1998). No other studies of chromosome numbers have been done, perhaps because of the difficulty of obtaining root tips or flower buds at the correct stage of development. Stemonuraceae As delimited by Kårehed (2001), Stemonuraceae is a family of 12 genera, with Gomphandra the largest (~60 spp.), followed by Stemonurus (14 spp.) and Medusanthera (10 spp.); the remaining genera have only a few species (see Table 1.1). The family is predominantly Malesian in distribution, though some genera are found in mainland Asia, northern Australia, and Micronesia. Three genera are extra-Malesian: Grisollea (~4 spp.) occurs in Madagascar, the Comoros, and the Seychelles; Lasianthera (1 sp.) grows in western equatorial Africa; and Discophora (2–3 spp.) ranges from Panama to Brazil. In Kårehed’s strict consensus tree, Gomphandra was grouped in a polytomy with Discophora, Irvingbaileya, and Grisollea. The only tree in Kårehed’s paper that was based on morphological data (one of 24 most parsimonious trees, not a consensus tree) showed Gomphandra near the base of Stemonuraceae, between Irvingbaileya and Medusanthera. However, no support values were provided for the tree, and only 32 out of 71 morphological characters used were informative, so the support for the placement of Gomphandra in the tree was questionable. Additional molecular data have not yet resolved the relationships among genera of Stemonuraceae. 17

Table 1.1. Genera and distribution of Stemonuraceae. Genus # of species Distribution Gomphandra Wall. ex Lindl. ~60 SE Asia Stemonurus Bl. 14 SE Asia Medusanthera Seem. 10 SE Asia, Micronesia Grisollea Baill. 4-5 Madagascar, Seychelles, Comoros Discophora Miers 2-3 northern S. America Codiocarpus R. A. Howard 1-2 Andaman, Philippines Cantleya Ridl. 1 Malesia Gastrolepis Tiegh. 2 New Caledonia Hartleya Sleumer 1 New Guinea Irvingbaileya R. A. Howard 1 Australia Lasianthera P.-Beauv. 1 equatorial west Africa Whitmorea Sleumer 1 Solomon Islands

Biogeography The biogeography of Gomphandra and Stemonuraceae was not investigated as part of this study, but like many plant groups that are predominantly Southeast Asian in distribution, the dispersal and radiation of the genus and family are undoubtedly complex. Gomphandra is almost entirely restricted to the region known as Malesia (Sleumer 1971). Malesia is defined as a region that extends from just north of the Malaysian-peninsular Thailand border to the Philippines, south to the strait between Indonesia and Australia, and east to the Bismarck islands (Aiken and Leigh 1992). The Bismarck Islands, a group of small islands that lacks the diverse habitats and climatic variations found in Malesia, are considered part of Melanesia (Mayr and Diamond 2001). Malesia is distinguished floristically by having many species that are common to its region but not to the adjacent continents and islands, and vice versa. The islands of Malesia have varied origins. Western Malesia was carried on the Sunda Shelf, which collided with the Sahal Shelf, bearing Australia and New Guinea, 15 mya (Aiken and Leigh 1992). After this Tertiary collision, chains of volcanic islands formed along plate boundaries, and uplift created limestone islands (Mayr and Diamond 2001). Some large islands like New Guinea are believed to be composed of terranes (Heads 2003), which are fragments of disparate crusts that accreted after being carried great distances along plates. During the Quaternary, sea levels dropped up to 180 m, 18

connecting Australia to New Guinea, the Malay Peninsula to Sumatra and Borneo, and Taiwan to the Philippines (Aiken and Leigh 1992). Plant dispersal and radiation were probably aided by shifts in climate and the regular disturbances provided by volcanic eruptions that would have provided new habitat. Fossils are scarce from this region, and pollen records and present-day distributions form the basis for many interpretations of plant biogeography in Malesia (Morley and Flenley 1987). The flora of Malesia is thought to be primarily Asian in origin (Aiken and Leigh 1992), but generic diversity in Stemonuraceae is highest on the Australian side of Wallace’s line, so an Australian origin of the family cannot be discounted at this time. Future biogeographic studies will be greatly aided by a molecular phylogeny for Stemonuraceae. Objectives The systematic revision of Gomphandra included the following objectives: 1. Morphological studies of Gomphandra and other representatives of Stemonuraceae to assess species boundaries 2. Molecular studies to determine phylogenetic relationships among species of Gomphandra and among genera in Stemonuraceae 3. A taxonomic monograph of Gomphandra Herbarium and Field Work Approximately 4500 herbarium specimens from the following 29 herbaria were examined for the revision of Gomphandra: A/GH, BH, BISH, BM, BRI, C, CAHUP, CAL, CANB, E, F, G, K, L, LBC, MEL, MICH, MO, MU, NY, P, PNH, PUH, TAIF, TNM, U, UC, US, WRSL. Herbarium acronyms follow the standard format (Holmgren et al. 1990). Additional specimens of the other genera in Stemonuraceae were also examined and databased. All specimens of Gomphandra received on loan were annotated. Seven species of Gomphandra were observed in the field and collected in the Philippines during 2007 and 2008. Field data and photographs from other researchers in Southeast Asia were consulted in order to include features of living plants in the genus and species descriptions presented in Chapters 2, 4, 5, and 6. 19

Taxonomic Concepts Taxa were recognized on three different taxonomic levels in the revision of Gomphandra: species, subspecies, and varieties. These designations represent differences in the data available to distinguish taxa and in the case of subspecies, the inferred completeness of speciation. Species are conceptualized as separate evolutionary lineages (see Mayden 1999) that were recognized (delimited, see de Queiroz 2007) by a unique combination of three or more morphological characters, at least one of which was reproductive. Geographic distribution and molecular data provided additional support for the recognition of certain species, but were not used as criteria in the revision. See Chapter 4 for a discussion of informative morphological characters that were used to distinguish taxa. Subspecies are conceptualized as populations that are in the process of speciation but are not yet fully differentiated morphologically. In general, subspecies were recognized when one or two characters could be used to distinguish abundantly collected, geographically proximal taxa, but intermediate specimens could be found at the boundary between the taxa. However, in the case of Gomphandra javanica, the two subspecies are geographically isolated with no intermediates, but currently only two characters, both of which vary within other species, can be used to separate them. Varieties are recognized in cases where taxa are so incompletely known that the normal variation within a species cannot be accurately assessed. Although taxa described as varieties may represent separate species, more collections are needed to identify which characters can be used to separate the taxa and determine whether they intergrade. See Chapter 4 for examples of species, subspecies, and varieties. Overview of Results The dissertation is organized into six chapters, five of which are formatted as stand alone papers. Chapter 2 is a treatment of Stemonuraceae that summarizes previous research on the family and includes a key to the family and descriptions of all the genera. Gomphandra is introduced in the context of its family, although relationships among the genera are not yet resolved. Chapter 3 concerns the systematics of Stemonuraceae, with an emphasis on Gomphandra. Results and conclusions are preliminary, but they indicate that Stemonuraceae is supported by a molecular synapomorphy and suggest that 20

Gomphandra may have two main clades that differ in inflorescence position. Chapter 4 includes a discussion of morphological characters that are useful for distinguishing species of Gomphandra, results of phenetic analyses of certain species complexes, and a discussion of difficult groups of species. Chapter 5 consists of four separate articles. The first three describe new species of Gomphandra, and the fourth deals with nomenclature and typification in Stemonuraceae. Chapter 6 is the taxonomic revision, which begins with a detailed description of the genus and presents 62 taxa according to their geographic distributions. Dissemination Preliminary findings were presented at the 2008 Botanical Society of America (BSA) meeting in Vancouver, British Columbia, and the 2009 BSA meeting in Snowbird, Utah. Three new species publications for Gomphandra have been or will shortly be submitted to Blumea or Kew Bulletin. A treatment of Stemonuraceae coauthored with Dr. Martin Potgieter and Dr. Timothy Utteridge was prepared for the series The Families and Genera of Vascular Plants. A paper on the phylogeny of Gomphandra and Stemonuraceae will be submitted to Systematic Botany or the American Journal of Botany when sufficient data are available. The Gomphandra monograph will be submitted to Kew Bulletin, which has a focus on Southeast Asian botany. The key and descriptions from the monograph will be sent to the review board of Flora Malesiana for inclusion as an appendix in the next published volume. Typifications and nomenclatural corrections will be submitted to Taxon, and DNA sequences will be submitted to GenBank. An electronic, non-dichotomous (multiple entry) key for Gomphandra and Stemonuraceae will be made available for public use at the Diversity of Life website (www.plantsystematics.org). 21

CHAPTER 2: STEMONURACEAE Summary. Chapter 2 is an introduction to Stemonuraceae. The family’s placement within the angiosperms and information on morphology, anatomy, and ecology are included, a synopsis of each genus is provided, and relationships among the genera are discussed. Most of the information below comes from a manuscript coauthored with Dr. Martin Potgieter (University of Limpopo, South Africa) and Dr. Timothy Utteridge (Royal Botanic Gardens, Kew, UK). A treatment of Stemonuraceae, slightly different from the version presented here, has been submitted to the series The Families and Genera of Vascular Plants. Although Dr. Potgieter is the first author of that treatment, at least 90% of the text of this chapter is my own. Introduction The family Stemonuraceae was circumscribed in 2001, after a combined morphological and molecular analysis found Icacinaceae to be a polyphyletic assemblage of distantly related groups (Kårehed 2001). Subsequent studies (Tank & Donoghue 2010, in press) have confirmed the separation of Stemonuraceae from Icacinaceae s.str. Prior to 2001, Icacinaceae (s.l.) included approximately 54 genera of shrubs, trees, and lianas (Kårehed 2001), although several disparate groups within the family had been recognized on the basis of anatomical differences among the genera (Bailey & Howard 1941b, Dahl 1952). What they called Group II Icacinoideae included Cantleya, Discophora, Gastrolepis, Grisollea, Gomphandra, Lasianthera, Medusanthera, and Stemonurus (all of which are now considered part of Stemonuraceae), as well as Gonocaryum and Leptaulus (now in Cardiopteridaceae, sister family to Stemonuraceae). Kårehed (2001) stated that the family Stemonuraceae is well supported by an array of morphological features, but the only characters he listed that are found in all the genera occur in other families of Aquifoliales: plants woody, leaves simple, alternate, entire, exstipulate, flowers articulated with the pedicel, sepals fused, stamens isomerous and alternipetalous, ovules two, anatropous, pendulous, fruit drupaceous. He also wrote that Stemonuraceae as a family exhibit easily recognized characters but he never specified what they were. He presented a table of morphological characters useful for recognizing taxa within Icacinaceae s.l., but only one character listed for Stemonuraceae 22

is unique to the family (cylindrical hairs on the filaments), and this character varies within the family. Terminal bud form, growth architecture, and fruit anatomy may provide synapomorphies for the family, but they have not been adequately investigated. The vascularized testa appears to be a synapomorphy for the family. Molecular data (primarily rbcL and ndhF) to date do support Stemonuraceae as currently circumscribed, and the family diverged from its closest relative, Cardiopteridaceae, approximately 66.8 Myr (95% highest posterior density [HPD] 41.18 Myr - 96.20 Myr, Tank pers. comm.). Stemonuraceae belong to the order Aquifoliales. The Aquifoliales are members of the euasterid II clade (Winkworth et al. 2008), also known as Campanulidae (Cantino et al. 2007). As proposed by Kårehed (2001) and adopted by APG III (2009), the order includes five families. Aquifoliaceae is the largest family, with ca. 500 species in the genus Ilex, followed by Stemonuraceae (12 genera, ca. 90 spp.) and Cardiopteridaceae (5–7 genera, ca. 45 spp.); Helwingiaceae and Phyllonomaceae are both monogeneric with only a few species (Stevens 2008, Loizeau et al. in press). Recent studies based on coding and non-coding chloroplast gene regions show that the Aquifoliales are sister to the rest of the Campanulidae, which includes Asterales, Dipsacales, and Apiales (Winkworth et al. 2008, Tank & Donoghue 2010 in press). Stemonuraceae have a very limited fossil record, which makes it difficult to establish the age of the family or its genera. Fossil pollen of Stemonurus was reported from a Holocene peat (~4270 years ago) and a Miocene coal deposit (7.5–3.5 mya) in Borneo (Anderson & Muller 1975). Fossil wood from the Deccan Intertrappean beds was described as Gomphandroxylon samnapurensis (Bande & Khatri 1980). The silicified wood can be dated to the Maestrichtian of the Upper Cretaceous, 70–65 mya (Guleria & Srivastava 2001). Two species of Gomphandra currently grow in the wet tropics of southwestern India, and similarities between their wood and the fossil led to the description of Gomphandroxylon. Morphology and Anatomy Branches & Growth Architecture Branches of mature trees are often perpendicular to the trunk, though they ascend or descend somewhat. Twigs are usually green when young and are initially pubescent in 23

most taxa. The terminal buds of Stemonurus and Whitmorea are sticky-resinous and may appear vernicose. Terminal buds are usually represented by a single folded leaf, though several dormant leaves (preformation, Hallé et al. 1978) may be visible in Codiocarpus and certain species of Gomphandra. Lateral buds are present, and accessory buds may also be present (and are often the source of inflorescences). As far as known, taxa do not experience continuous growth of leaves and twigs, but rather experience dormant periods followed by flushes of growth or flowering. Branching may be monopodial or sympodial, or a mix of both on the same individual. Hallé et al. (1978) presented Lasianthera africana as an example of Prévost’s model of architecture, Gomphandra cf. quadrifida as an example of Petit’s model, and Medusanthera laxiflora as an example of Roux’s model. The latter two models both have a monopodial orthotropic trunk with continuous growth, plagiotropic branches, and leaves that are spiral to distichous. Prévost’s model, with separate trunk (proleptic) and branch (sylleptic) modules, spiral leaves, and plagiotropic branches, may be found in Gomphandra as well, which has distinctive branching patterns (see Chapters 4 and 6). Wood The wood of Gomphandra is conspicuously striate with alternating light and dark bands in transverse section. The striations are visible on cleanly cut ends of twigs on herbarium specimens. Faint striations may be visible on larger twigs of other genera. The light bands are multiseriate rays, and the darker bands are composed of fibers, fiber- tracheids, vessels, and parenchyma. Young twigs of all genera tend to have a large pith. Bailey & Howard studied the anatomy of Icacinaceae s.l. and published a series of articles with their findings. Their first article (1941a) divided Icacinoideae into groups using nodal anatomy, with all genera of Stemonuraceae included in the study placed in the trilacunar group. Their second article (1941b) examined vessels and found scalariform to simple porous perforations in the included genera of Stemonuraceae. Vessels were arranged singly (Cantleya, Gomphandra, Lasianthera) or in groups (Discophora, Gastrolepis, Grisollea, Medusanthera, Stemonurus). Continuing their investigation, Bailey & Howard (1941c) reported that the tracheary elements of Stemonuraceae tended to have very thick secondary walls and approached fiber- 24

tracheids. The imperforate tracheary elements of Gomphandra and Cantleya had relatively large inter-tracheid bordered pits. In the wood, the distribution of parenchyma ranged from scattered (apotracheal) to associated with the vessels (paratracheal). Discophora, Gomphandra, and Medusanthera had apotracheal parenchyma, while Cantleya, Gastrolepis, and Stemonurus had paratracheal parenchyma. Bailey & Howard (1941d) found enlarged multiseriate rays in tangential sections of the secondary xylem of Discophora, Gastrolepis, Gomphandra, Lasianthera, Medusanthera, and Stemonurus, although uniseriate rays were still present. Cantleya, Codiocarpus, and Grisollea had narrow multiseriate as well as uniseriate rays in the secondary xylem. Pubescence & Crystals Heintzelman & Howard (1948) surveyed the pubescence and crystals of Icacinaceae s.l. and found four different types of hairs and three types of crystals. Cylindrical hairs were found on the stamens of Cantleya, Discophora, Gastrolepis, Gomphandra, Irvingbaileya, Lasianthera, Medusanthera, and Stemonurus. They were found in other genera of Icacinaceae s.l. as well, but not on the stamens of those taxa. Icacinaceous hairs, which bend 90° just above the base (visible only under a microscope) and sometimes have a short second arm, were seen on Cantleya (contradicted by van Staveren & Baas 1973), Codiocarpus, Gastrolepis, Grisollea, Lasianthera, and Medusanthera. Normal hairs, with an elongate or tapering body, only occurred in Codiocarpus and Discophora. Thin-base hairs, with a thick body wall and a thin base wall, were found in Cantleya, Codiocarpus, Irvingbaileya, and Medusanthera, as well as in Citronella and Gonocaryum (now in Cardiopteridaceae). All the other hair types noted by Heintzelman & Howard (1948) were found in genera that are no longer considered close relatives of Stemonuraceae. Van Staveren & Baas (1973) reexamined pubescence in Icacinaceae s.l. and reclassified the categories “normal” and “thin-base” as 1) normal hairs with a thick body/thin base and 2) normal hairs without this combination (presumably with equally thick or thin walls throughout the hairs). They also found a transition from normal hairs to malpighiaceous hairs and treated Heintzelman & Howard’s “icacinaceous” hairs as normal hairs with a second arm stub. They reported all hair types from various species of Gomphandra and malpighiaceous hairs from 25

Stemonurus. Heintzelman & Howard (1948) also reported druses (aggregate crystals) from the leaves of all genera of Stemonuraceae except Gomphandra, Irvingbaileya, and Lasianthera. However, Teo & Haron (1999) found druses in the leaves of Malaysian Gomphandra. Druses were absent from the flowers of Discophora, Gomphandra, Grisollea, Irvingbaileya, and Lasianthera (Heintzelman & Howard 1948). Rhombics (single large crystals) were found in the leaves and flowers of Gomphandra and Medusanthera, and in the leaves of Discophora. Crystal sand (tiny crystalline particles) occurred in Cantleya, Discophora (flowers), Gomphandra, Lasianthera, and Medusanthera. The composition of the crystals was not determined. Leaves Teo & Haron (1999) studied leaf anatomy in Malaysian Icacinaceae s.l., including Cantleya, Gomphandra, and Stemonurus. They reported funnel-shaped cells in the mesophyll palisade layer of the lamina and three vascular bundles in the petiole. Foliar sclereids and tannin crystals occurred in Cantleya and Stemonurus. Leaf thickness varies within some genera of Stemonuraceae, but Gastrolepis and Stemonurus are characterized by coriaceous leaves. In Gomphandra, protoxylem in the midrib and secondary veins is pulled out in webby strands when a leaf is torn perpendicular to the midrib (Schori, pers. obs.). Stemonurus does not share this trait, and other genera have not been checked for this feature. The strands are more easily observed with fresh material, although herbarium specimens will also display protoxylem strands if torn. In 1973, van Staveren & Baas surveyed stomatal types in Icacinaceae s.l. Gomphandra and Medusanthera had anisocytic stomata, Cantleya, Gastrolepis, and Hartleya were cyclocytic, and Codiocarpus, Stemonurus, and Whitmorea had stomata intermediate between anisocytic and cyclocytic. Heliocytic stomata were occasionally observed in Gomphandra. Cork warts were seen in abundance on Gomphandra quadrifida, G. subrostrata, Stemonurus malaccensis, and S. umbellatus. Baas (1974) reported anisocytic stomata in Discophora guianensis, Irvingbaileya, and Lasianthera, and anisocytic to cyclocytic stomata in Grisollea thomassetii.

26

Inflorescence Structure Inflorescences of Stemonuraceae are basically cymose but may appear capitate, umbelliform, thyrsoid, or flowers may be solitary. Scorpioid cymes are present in Stemonurus and Gomphandra. The typical structure is of several branched cymes borne on a common peduncle, each cyme with 1–3 orders of branching. Inflorescences may be axillary, leaf-opposed, terminal, or ramiflorous. Bracts are present but are often deciduous shortly after anthesis, though in some species (Stemonurus) they persist. Occasionally a small leaf will be present in the inflorescence (Gomphandra). Flowers may be (sub)sessile or on short pedicels, and in inflorescences that are reduced to a single flower, the peduncle serves as a pedicel. In dioecious taxa, the staminate inflorescences tend to bear many more flowers and be more highly branched than pistillate inflorescences. Flower Structure Flowers are small but often massed together. The calyx is usually cupular, entire to 4–5-lobed, and radially symmetrical, though it may split irregularly. The corolla is radially symmetrical, with 4–5 free to coherent or connate petals. In most genera, the petals have a thickened midrib and an inflexed tip. Stamen number is equal to petal number, although extra stamens of irregular length have rarely been observed (Gomphandra). The stamens are usually exserted and bear clavate pubescence; they are often showier than the petals. The filaments tend to be flattened and dilated towards the apex. The anthers are basifixed, longitudinally dehiscent, and introrse (extrorse in Grisollea). Fresh pollen is usually white. Staminodes (absent in Grisollea) in female flowers resemble the stamens but are often shorter and less pubescent, as well as having anther cells that are brownish and devoid of pollen. Some genera have a disk at the base of the ovary or ovary rudiment. The disk may be annular, squamiform, or hippocrepiform. The ovary is superior, approximately equal in length to the stamens or petals, evidently 1-carpellate and unilocular, with two pendulous apical ovules, only one of which develops. The stigma is sessile or on a very short style and may be capitate, lobed, or punctiform. In several genera, it is as broad as the ovary (accrescent in Gomphandra). In male flowers, the ovary rudiment is minute and much shorter than the 27

stamens or petals, conical to cylindrical or globose, often evidently embedded in a disk, with a very reduced or absent stigma. Ovules have been reported from ovary rudiments, but there is no evidence that they mature. Pollen Morphology The pollen of Stemonuraceae is generally small, 7.6 × 14 µm to 24 × 27 µm, triporate, oblate, and minutely foveolate-papillate to papillate-echinate (Dahl 1952). Dahl included Cantleya, Codiocarpus, Gastrolepis, Gomphandra, Irvingbaileya, Lasianthera, Medusanthera, and Stemonurus in his study. According to Lobreau-Callen (1973), Gomphandra mappioides and G. quadrifida have small (10–20 µm), oblate, triporate pollen with different exine ornamentation, suggesting that species might be distinguishable by their exine. Grisollea pollen is pororate, suboblate, triporate (to hexaporate), with an echinulate exine (Rasoarimalala et al. 1982). Erdtman (1986) indicated that pollen is relatively similar within Stemonuraceae despite the differences that distinguish genera. Fruit and Seed The fruits of Stemonuraceae are indehiscent drupes with a thin, fleshy to leathery mesocarp with an inner part consisting of one to several layers of sclerotic bundles. (The inner mesocarp has been widely referred to as the endocarp.) The true endocarp is formed of sclerified cells that encircle the seed and are perpendicular to the bundles of the mesocarp. Crystals are present in the mesocarp of Gomphandra and Whitmorea. Stemonurus (Utteridge & Schori 2009) and Whitmorea have relatively large, bicolored fruits. Parthenocarpy is present in Gomphandra papuana, which often produces fruit that have no sclerified inner mesocarp, endocarp, or seed. The drupe of Cantleya has an invaginated fruit wall. Gomphandra has a prominent terminal stigma and a feature that has been referred to as a sulcus complex (Schori & Utteridge in press) – a pair of longitudinal ridges and grooves flanking a central ridge. In cross-section, the bundle that forms the central ridge appears bright under polarized light. All genera have this bundle in the same position on the fruit, even if a sulcus complex is not evident. All genera except Stemonurus, Whitmorea, Cantleya, and Gomphandra have a laterally compressed drupe (Fig. 2.1), and of these, only Grisollea lacks a fleshy appendage. The fleshy 28

appendage appears to develop from the ovary wall, in a position that correlates with the placement of the sulcus complex in Gomphandra (the bundle is found adjacent to the center of the appendage). The appendage can grow quite large and in some species, completely surrounds the rest of the fruit body. Appendage color ranges from white to pink and generally contrasts with the main fruit body. Seeds have a soft, vascularized testa. Most genera appear to have a prominent chalazal and post-chalazal bundle that can be adnate to the endocarp. At least two genera (Codiocarpus and Medusanthera) are evidently pachychalazal. 29

Figure 2.1. Fruits of Stemonuraceae in cross-section. The outer mesocarp and appendage (if present) were removed during the embedding process. 1. Whitmorea; 2. Stemonurus (with seed); 3. Cantleya; 4. Gomphandra; 5. Grisollea; 6. Discophora; 7. Hartleya; 8. Medusanthera; 9. Codiocarpus. All sections are 5 µm thick, except for Whitmorea and Stemonurus (10 µm thick). All sections were stained with Safranin. 30

Embryology Embryology has been investigated in Stemonurus (Mauritzon 1936) and Gomphandra (Fagerlind 1945, Padmanabhan 1961). The tapetum is secretory, and cells of the inner layer are multinucleate. Cytokinesis is simultaneous after meiosis, and the pollen grains are 2-celled when shed. The ovules are anatropous, unitegmic, and crassinucellate. The vascular bundle in the chalaza extends up to the top of the single integument. In the linear tetrad of megaspores, the chalazal megaspore develops into a Polygonum-type embryo sack while the other megaspores disintegrate. The synergids are pyriform and hooked, with the filiform apparatus. The polar nuclei fuse at the time of fertilisation and the 3 antipodal cells are ephemeral. Endosperm development is nuclear. Embryogeny is unknown. Karyology A chromosome number of n = 22 was reported for Stemonurus cf. ammui (Oginuma et al. 1998). Ecology and Reproductive Biology Distribution and Habitats The family occurs in all major wet tropical forest regions. Lasianthera (1 sp.) occurs in Guineo-Congolan Africa, Grisollea (4 spp.) in Madagascar, the Seychelles and the Comores, Irvingbaileya (1 sp.) in Queensland, and Discophora (2–3 spp.) from Panama to Brazil, while the other 8 genera are found within a region from eastern tropical and subtropical Asia to Melanesia. Gomphandra (55 spp.) grows from India to China and the Solomons; Stemonurus (14 spp.) from the Andamans and Sri Lanka to the Solomons; Medusanthera (10 spp.) from Malaya to Samoa; and Cantleya, Codiocarpus, Gastrolepis, Hartleya and Whitmorea each have 1–2 spp. with narrower distributions. Evergreen tropical rainforest is the typical habitat, though certain species occur in coastal forests or in mangrove swamps. Pollination and Reproductive Systems The flowers of Stemonuraceae are generally small to minute (Whitmorea excepted) and white, green, yellow, or sometimes red (Stemonurus). Herbarium labels variously report certain species as having fragrant flowers (Codiocarpus, Gomphandra, 31

Grisollea, Medusanthera, and Stemonurus). Photographs of Stemonuraceae indicate that flowers are diurnal, though not all species and genera have been observed in flower. Individual flower duration is not known, but most herbarium specimens indicate a flowering time of one to several weeks for inflorescences or individual trees. Specimens of widely collected taxa provide evidence for blooming periods that range from one to several months, and certain species may flower at any time of year. Pollen is abundant in Gomphandra, and it is possible that the clavate hairs that characterize Stemonuraceae aid in pollen transfer and/or pollinator attraction. Although a disk is present in some genera, it is not known whether it has a role in pollination. Pollinators are not documented for any species. Stemonuraceae exhibit two breeding systems. Several genera have bisexual flowers (Cantleya, Gastrolepis, Lasianthera, Stemonurus, and Whitmorea), while the other genera are functionally dioecious. Dioecy may not be complete. Ovules have been reported from ovary rudiments, but there is no evidence that ovary rudiments ever develop into fruit. Pistillate flowers produce staminodes that are often quite similar to stamens, except the anther cells contain no pollen. An isolated pair of pistillate trees of Gomphandra luzoniensis planted at the National Tropical Botanical Garden in Kaua’i, Hawaii produces fruit (documented by herbarium specimens), though the method (“leaky” dioecy, apomixis) is not known. Dispersal & Animal Use Dispersal may occur by several routes. Fruits may drop off the parent tree and germinate in place. The fruits of mangrove species (some Stemonurus) may disperse via water. The most common mode of dispersal is by mammals or birds. Civet cats (anecdotal from Filipino forester), cassowaries (David Mack, pers. comm.), fruit doves (Frith et al. 1976), pigeons (Ganesh & Davidar 2001), and birds of paradise (LeCroy et al. 1980) have all been reported as dispersers. Gall-midges may cause galls on the leaves of Gomphandra javanica (Docters van Leeuwen-Reijnvaan & Docters van Leeuwen 1926). Galls on the leaves of Stemonurus secundiflorus are probably caused by a psyllid (Docters van Leeuwen-Reijnvaan & Docters van Leeuwen 1941). Twig galls and leaf galls may be seen on herbarium 32

specimens of several other species of Gomphandra (e.g. comosa, halconensis, mappioides), and Stemonurus. Gomphandra coriacea leaves may provide 20% or more of the diet of Nilgiri langur monkeys (Trachypithecus johnii) in the Western Ghats of India (Oates et al. 1980, Davies & Oates 1994). Leaves of Gomphandra quadrifida are one of the preferred food plants for Malayan tapirs at Taman Negara, Malaysia (Williams & Petrides 1980). Red leaf monkeys (Presbytis rubicunda) eat fruits of Cantleya corniculata (Supriatna et al. 1986), although Davies (1991) reported that they are seed predators and unlikely to be effective dispersers. In New Guinea, pigs were once reported (in 1887) to prefer the fruits of Gomphandra (Hide 2003), though the report may have actually referred to Stemonurus or Medusanthera. Economic Importance The Malesian Cantleya corniculata produces highly prized timber, which is often used in house- or ship-building or as a substitute for sandalwood. Codiocarpus, Gomphandra, Stemonurus and Whitmorea have minor local uses in construction as house posts. The wood of Lasianthera africana is used for large pestles, and the leaves are eaten as a vegetable. The root of Gomphandra mollis is used in traditional medicine in Vietnam (Dan & Nhu 1989, Nhu 1990), and leaves or roots of G. quadrifida are used in Peninsular Malaysia (Kalima 2003). Gomphandra quadrifida was burned to make a teeth-blackening substance in Malaysia (Burkill 1935, Zumbroich 2009). Relationships Relatively little is known about intergeneric relationships in Stemonuraceae. Kårehed (2001) presented two phylogenies in a paper that focused on the broader relationships of Icacinaceae s.l., but neither resolved relationships among genera of Stemonuraceae. The first phylogeny was based mainly on ndhF sequences and included five of the twelve genera of Stemonuraceae, although the placement of Gomphandra was based on the similarity of rbcL sequences between it and Irvingbaileya (99% similar). Lasianthera was sister to an unresolved clade comprising Gomphandra, Discophora, Grisollea, and Irvingbaileya on the basis of 11 ndhF base pair positions (0.5%) in which the derived state was shared by Discophora, Grisollea, and Irvingbaileya. The position of Lasianthera was well-supported (jackknife value = 100%), but the other genera formed a 33

polytomy because ndhF is not especially variable within Stemonuraceae. Kårehed’s second phylogeny presented one of 24 most parsimonious trees from an analysis of morphological data. This phylogeny ostensibly resolves relationships among all 12 genera of Stemonuraceae but is flawed because the study group for this analysis (Icacinaceae s.l.) is clearly polyphyletic, based on the molecular analysis in the same paper and subsequent work (Lens et al. 2008, Winkworth et al. 2008, Tank & Donoghue 2010 in press). The polarities of characters that resolved clades within Stemonuraceae may not be correct, because the closest outgroups to the family (Apodytes [near Garryales] and Pennantia [Apiales]) are in fact distantly related to Stemonuraceae and each other. Furthermore, several characters relating to the gynoecium and fruit do not include character states that accurately reflect morphological variation within Stemonuraceae. Finally, the morphological phylogeny has no support values. A more complete molecular phylogeny is clearly needed, and more informative morphological data need to be collected from all genera of Aquifoliales so that character polarities within Stemonuraceae can be established. Currently, no resolved phylogeny is available. My own molecular data suggest that morphologically distinct genera may have very similar sequences at certain gene regions (see Chapter 3). Even without a resolved phylogeny, it is possible to hypothesize particular clades based on shared character states that are likely to be apomorphic. Morphological and anatomical features that suggest phylogenetic relationships among genera of Stemonuraceae are discussed below. These features either do not occur in the rest of Aquifoliales (i.e., the outgroups to Stemonuraceae) or their character states are not yet known for those genera. Autapomorphies are not mentioned here, nor are characters that are probably homoplasious (e.g., perfect vs. imperfect flowers). Several possible synapomorphies suggest that Stemonurus and Whitmorea are sister taxa. They share resinous terminal buds and several fruit features. The fruits are large and bicolored, with a thin endocarp, an inner mesocarp composed of T-shaped sclerotic bundles, and red cells interspersed among the sclerotic bundles. Alternatively, Stemonurus may be sister to Cantleya, which also has red cells in its fruit. Teo & Haron (1999) found that Stemonurus and Cantleya both had tannin crystals and foliar sclereids 34

in their leaves, although they only studied Malaysian species of Stemonuraceae and so did not include Whitmorea. Whitmorea and at least one species of Gomphandra both have crystals in the outer mesocarp of their fruit, a feature not observed in other genera, but it is not known whether this is a characteristic of all Gomphandra species, and the two taxa are otherwise dissimilar. All genera except Stemonurus, Whitmorea, Cantleya, Gomphandra, and Grisollea share a fruit type that is a probable synapomorphy. The fruits are laterally compressed with an exterior fleshy appendage that aids in dispersal. This appendage is evidently unique to Stemonuraceae, so it seems unlikely that it would have had two independent origins within the family. Grisollea may have a transitional fruit morphology (its fruits are compressed but they lack the appendage), or it may represent a reversal (loss of the appendage). Within the group of genera with a compressed fruit and a fleshy appendage, Medusanthera and Codiocarpus may be sister genera as they share a testa with pachychalazal bundles. This vascularization pattern has not been found in any other genus of Stemonuraceae, although Gastrolepis, Irvingbaileya, and Lasianthera have not yet been studied. Hartleya and Gastrolepis may be sister genera because they are the only two genera that share a squamiform disk and a papillose stigma. Further assessments of synapomorphies and relationships will have to wait until additional molecular and morphological/anatomical data are available. Each genus of Stemonuraceae has a unique combination of reproductive characters (see Table 2.1 and genus descriptions), and molecular data to date (see Chapter 3) indicate that despite its morphological diversity, the family is a natural group. 35

Table 2.1. Flowering and fruiting characters of Stemonuraceae. In the Seed Testa column, post indicates the presence of a post-chalazal bundle, while pachy indicates pachychalazal bundles.

Genus Flowers Fruit Fleshy Fruit Papillose Red Seed Disk Unisexual Compressed Appendage Bicolored Stigma Cells Testa (female/bi) Cantleya - - - - - + post - Codiocarpus + + + - - - pachy - Discophora + + + - - - post + Gastrolepis - + + - + - ? + Gomphandra + - - - - - post - Grisollea + + - - - - post - Hartleya + + + - + - post + Irvingbaileya + + + - ? - ? ? Lasianthera - + + - - - ? + Medusanthera + + + - - - pachy - Stemonurus + - - + - + post + Whitmorea + - - + - + post - 36

Stemonuraceae Evergreen trees or shrubs. Bole often straight, lower branches self-pruning and leaving conspicuous scars in some genera. Buttresses absent (except Cantleya), or stilt- roots and pneumatophores sometimes present (Stemonurus). Branches often perpendicular to trunk. Leaves simple, alternate (sometimes appearing distichous), entire, penninerved (rarely triplinerved), exstipulate. Inflorescences axillary, terminal, or leaf- opposed, occasionally ramiflorous, cymose, rarely reduced to 1 or a few flowers. Flowers bisexual or functionally unisexual, actinomorphic, usually 5-merous, usually small (3–6 mm), but Whitmorea up to 1.5 cm. Calyx persistent, articulated with the pedicel, small, generally cupular, sepals 4–5, connate, calyx rim entire, apiculate, or shortly lobed. Petals 4–5(–7), minute to conspicuous, free (coherent), sometimes united in Gomphandra, often inflexed at the apex, lobes valvate, midrib usually thickened within. Stamens isomerous, alternipetalous, filaments filiform (rarely) or broad and flattened, glabrous or bearing papillose to clavate hairs ventrally, dorsally, and/or at the connective apex; anthers 2- celled, basifixed, introrse or extrorse (Grisollea), longitudinally dehiscent. Staminodes in female flowers present or absent (Grisollea), resembling stamens or much smaller (Codiocarpus) but anther cells empty. Disk absent or present, cupular, hippocrepiform, or squamiform and unilateral, lobed or entire, persistent in fruit. Carpel evidently 1, ovary superior, unilocular, often bearing an exterior lateral appendage above the disk, ovules 2, apical, pendulous, anatropous, unitegmic. Stigma on a short style or more often sessile, peltate, subcapitate, or punctiform (only in bisexual flowers), entire to lobed, crenate, or ridged, often eccentric, persistent in fruit. Ovary rudiment in male flowers usually smaller than ovary, occasionally with 2 ovules that do not develop, lateral gibbosity or basal disk sometimes present, stigma absent or much reduced. Drupe shape various, in most genera laterally compressed, when compressed bearing a conspicuous lateral appendage that develops from the ovary wall (except Grisollea). Outer mesocarp fleshy or fibrous, thin, variously colored. Inner mesocarp thin to thick, sclerified and forming prominent ridges visible in dried fruit. Endocarp sclerified. Seed 1, testa vascularized. Twelve genera with about 90 species, distributed mainly in the tropics of the Old World, rapidly decreasing in number towards the subtropics. 37

Key to the Genera

1. Flowers bisexual 2 - Flowers unisexual by abortion 6 2. Leaves membranaceous to thinly coriaceous 3 - Leaves thickly coriaceous to stiff 4 3. Stigma capitate, disk absent, fruit without appendage, Malesia 1. Cantleya - Stigma punctiform, disk present, fruit with appendage, wet tropical Africa 9. Lasianthera 4. Fruit with appendage, twig tips not resinous, New Caledonia 4. Gastrolepis - Fruit without appendage, twig tips usually resinous, Malesia and Melanesia 5 5. Stamens exserted, calyx less than 5 mm wide, stigma punctiform, Southeast Asia to Malesia and Melanesia 11. Stemonurus - Stamens included, calyx at least 5 mm wide, stigma invaginated, Solomon Islands 12. Whitmorea 6. Flowers minute, petals usually less than 2 mm long and wide 7 - Flowers small but petals at least 3 mm long 8 7. Secondary veins very prominent beneath, tertiary veins scalariform, ripe fruit black with white appendage, Central and South America 3. Discophora - Secondary veins well-defined to obscure but not very prominent beneath, tertiaries not scalariform, fruit without appendage, Madagascar, Seychelles, Comoros 6. Grisollea 8. Petals free to base, strongly recurved, filaments filiform, Andamans & Nicobars, Philippines 2. Codiocarpus - Petals free or not but never recurved, filaments flattened and dilated 9 9. Disk absent in pistillate flowers, stigma accrescent and prominent on fruit, fruit without appendage, uncompressed, India to Melanesia 5. Gomphandra - Disk present or absent in pistillate flowers, stigma small, fruit with appendage, laterally compressed 10 10. Disk squamiform, dried fruit with more than 12 closely spaced, equally prominent ridges on side without appendage, Papua New Guinea 7. Hartleya - Disk absent or not squamiform, dried fruit with fewer than 12 ridges or ridges unequally prominent 11 11. Appendage much larger than main fruit body, fruit body flattened and winged, Queensland 8. Irvingbaileya - Appendage small to twice the size of main fruit body, fruit body not especially flattened and winged, Malesia and Melanesia 10. Medusanthera 38

Cantleya Ridl., Fl. Malay. Penins. 1: 436 (1922)

Tree. Leaves ovate-elliptic, thinly coriaceous. Inflorescences cymose, axillary and solitary, peduncle with minute imbricate bracts. Flowers bisexual, (4–)5-merous. Sepals cupular, lobed. Petals free, probably coherent. Stamens free, filaments with clavate- penicillate hairs. Ovary elongate-conical, stigma capitate, slightly lobed. Drupe fusiform, inner mesocarp thickly sclerified, fruit wall invaginated on one side, cavity visible in cross-section. 1 sp. (C. corniculata (Becc.) Howard), Peninsular Malaysia, Sumatra, and Borneo.

Codiocarpus R. A. Howard, Brittonia 5: 53, f. 2 & 3 e–f (1943)

Trees. Leaves oblong-elliptic, chartaceous to thinly coriaceous, venation prominent. lnflorescences cymose, multiply branched, axillary, often ramiflorous. Flowers unisexual, 5–(6-)merous. Calyx cupular. Petals free, recurved. Male flowers: stamens free, conspicuous, filaments filiform, ovary rudiment small, globose with a short style. Female flowers: sepals and petals shorter than in male flower, staminodes weakly developed, shorter than ovary, ovary subcylindric, stigma capitate. Drupe oblongoid, compressed, slightly curved, with several prominent longitudinal ridges on the convex surface, and a longitudinal, median furrow covered by the fleshy appendage on the concave surface. 1–3 spp., Philippines, India (Andaman and Nicobar Is.), 1 collection from Aru Islands.

Discophora Miers, Ann. Mag. Nat. Hist. ser. II, 10: 118 (1852)

Kummeria Mart. ex Engler (1872)

Shrubs or trees. Leaves oblong-elliptic, coriaceous, venation prominent below. Inflorescences thyrsoid, axillary, supra-axillary or cauliflorous. Flowers minute, 39

unisexual, 5-merous. Calyx cupular, apiculate. Petals free. Male flowers: stamens free, filaments with an inconspicuous adaxial swelling bearing tangled clavate hairs below the anthers. Ovary rudiment minute, depressed, evidently embedding in an encircling disk, style apiculate. Female flowers: staminodes similar to stamens, ovary cylindrical, disk reniform, subtending lateral appendage, stigma sessile, capitate. Drupe compressed, slightly curved, black, with 3–7 longitudinal ridges on the convex side, and a white fleshy appendage on the concave side. 2 spp., Central America, northern South America to Ecuador, Peru, Brazil, and Bolivia.

Gastrolepis Van Tieghem Bull. Soc. Bot. France 44: 115 (1897)

Shrubs or trees. Twigs stout. Leaves ovate-elliptic to obovate, coriaceous. Inflorescences of clustered flowers in cymose panicles, axillary or terminal. Flowers bisexual, 5-merous. Calyx cupular, lobed. Petals free at apex, coherent below. Stamens free, filaments flattened, bearing clavate hairs on both sides below the anthers. Disk squamiform, unilateral, subtending the lateral appendage. Ovary asymmetrically curved, stigma sessile, papillose. Drupe compressed, slightly curved, with multiple low longitudinal ridges on the convex side, and a fleshy appendage on the concave side. 2 spp., New Caledonia.

Gomphandra Wall. ex Lindl. Nat. Syst. ed. 2: 439 (1836)

Stemonurus Bl. (1825–1826), Platea Miers (1852), non Bl., Lasianthera Miq. (1856), non P. Beauv.

Shrubs to medium sized trees. Wood with prominent rays. Lower branches self-pruning, leaving scars, branching 90° perpendicular to subtending leaf. Young twigs green, more or less horizontal. Terminal buds falcate, pubescent. Leaves various, chartaceous to 40

coriaceous, showing webby strands of protoxylem from veins when torn. Inflorescences axillary, leaf-opposed, or terminal. Flowers unisexual. Calyx cupular, entire to minutely apiculate or lobed. Petals 4–5, free to connate. Male flowers: stamens 4–5, generally exserted, filament glabrous or more often pubescent ventrally, dorsally, and/or at the connective, ovary rudiment small, cylindrical to ovoid-conical, possibly embedded in a disk. Female flowers: staminodes resembling stamens, sometimes with less pubescence, ovary cylindrical, glabrous to densely pubescent, sometimes gibbous at the base but without a lateral appendage, stigma sessile, capitate, often lobed or ridged, accrescent. Fruit uncompressed, drupe shape various, flesh thin, inner mesocarp usually with 8–13 longitudinal ridges, prominent sulcus complex on one side (stigma often displaced toward sulcus). About 55 spp., Tropical Asia to NE Australia.

Grisollea Baill. Adansonia 4: 217, t. 3 & 4 (1864)

Small trees. Leaves oblong-elliptic to obovate, thinly to thickly coriaceous, shape and texture diagnostic. Inflorescences axillary or terminal cymose panicles. Flowers unisexual, 5-merous, minute. Calyx deeply lobed. Disk absent. Male flower: petals minute, not inflexed at tip, adherent to calyx at base; filaments opposite the sepals; anthers extrorse, ovary rudiment subconical or globular. Female flower: petals minute, not inflexed at tip, adherent to calyx at base, staminodes absent, ovary cylindrical, curved, pubescent, unilocular, with minute projections at the center and around the edges of the stigma. Drupe elliptic, compressed, with several longitudinal ridges on the convex side and a sulcus on the concave side. 4–5 spp., Madagascar, Seychelles and Comores.

Hartleya Sleumer Blumea 17: 218 (1969)

Tree. Leaves ovate-elliptic to obovate, coriaceous. Inflorescences cymose, axillary. Flowers unisexual, 4–5-merous. Male flowers unknown. Female flowers: calyx cupular, 41 lobed. Petals free. Staminodes pubescent dorsally and ventrally below the anther cells. Disk squamiform, subtly trilobed, subtending ovary appendage. Ovary with a lateral appendage, scarcely differentiated in flower. Stigma sessile, subcapitate, papillose, displaced towards ovary appendage. Drupe curved, somewhat compressed, ovate- acuminate, with numerous prominent nerves on the convex side, and a short rib from the apex to the appendage on the concave side, the appendage attached to a thickened pad, disk evident below the appendage. 1 sp. (H. inopinata Sleumer), New Guinea.

Irvingbaileya R. A. Howard Brittonia 5: 50 (1943)

Tree. Leaves elliptic, firmly chartaceous. Inflorescences axillary, cymose. Flowers unisexual, 5-merous. Calyx cupular, shallowly lobed. Petals free. Male flowers: stamens free; filaments flattened, villous above middle. Ovary rudiment conical, evidently immersed in a disk. Female flowers: staminodes present. Ovary asymmetric, with a basal gibbosity (presumably a disk) at base on concave side. Drupe asymmetric, calyx displaced toward concave side, ellipsoid or ovoid, flattened and winged, with multiple longitudinal ridges on the concave side, bearing a much larger white fleshy lateral appendage on the convex side. 1 sp. (I. australis (C.T. White) R.A. Howard), Queensland, Australia.

Lasianthera P. Beauv. Fl. Oware and Benin 1: 85, t. 51 (1806)

Tree or shrub. Leaves lanceolate to ovate, elliptic, or obovate, often caudate, chartaceous. Inflorescences umbelliform, opposite the leaves. Flowers bisexual, 5-merous. Calyx cupular, lobed. Petals connate, apices free. Filaments free, short straight hairs borne on an adaxial flap below the anthers, long tangled hairs abaxially at the connective. Disk unilateral, fleshy, covering half of the ovary in flower, overlapping the lateral appendage. Ovary and fruit with a lateral appendage. Drupe laterally compressed, oblong-elliptic, 42

flattened, longitudinally ribbed. 1 sp. (L. africana P. Beauv.), with two var., tropical Africa.

Medusanthera Seem. J. Bot. 2: 74 (1864)

Tylecarpus Engl. (1893 [1896])

Trees. Leaves various, chartaceous to coriaceous. Inflorescences axillary, paniculate. Flowers unisexual, 5-merous. Calyx cupular, minutely toothed or lobed. Petals free. Male flowers: stamens free; filaments flattened and fleshy, persistently clavate-hairy to barbate in the upper part; ovary rudimentary. Female flowers: staminodes present; ovary subcylindrical, base gibbous. Drupe oblongoid to ellipsoid, or subovoid, laterally compressed, the concave side with a fleshy appendage, and 1–3(–5) prominent longitudinal ridges on the convex side. 10 spp., Malesia, Fiji, and Samoa.

Stemonurus Bl. Bijdr. Fl. Ned. Ind. 648 (1826)

Urandra Thw. (1855), Lasianthera Miq. (1856), non P. Beauv.

Trees. Some species with buttresses or pneumatophores. Bark smooth, hooped, or with lenticels. Twigs generally stout, glabrous or initially pubescent, green when young, terminal buds abruptly contracted, resinous. Leaves lanceolate to elliptic, ovate, or obovate, often stiffly coriaceous. Inflorescences axillary, either compound scorpioid cymes or apparently umbelliform. Flowers bisexual, sessile, (4–)5-merous. Calyx cupular, almost entire to shallowly lobed, persistent in fruit. Petals connate at base, coherent into a tube with the sutures evident. Stamens 5, connate with the petals at base only; filaments pubescent below the anther and long-penicillate at the connective abaxially. Disk cupular, often lobed. Ovary conical, unilocular, with 2 pendulous ovules. Style very short, stigma punctiform. Drupe ovoid, ellipsoid or oblongoid-fusiform, 43

mesocarp bicolored (except S. corrugatus). 14 spp., Andamans, Vietnam, Sri Lanka, Malesia, Palau.

Whitmorea Sleumer Blumea 17: 263 (1969)

Trees. Terminal buds resinous. Leaves elliptic, coriaceous. Flowers bisexual, (4–)5- merous. Inflorescence axillary, of 3–4 umbelliform scorpioid cymes in a cross-like arrangement on top of a common peduncle. Calyx cupular, entire. Petals generally connate at base. Stamens fused to the petals; filaments trapezoidal in cross-section, fleshy, with subclavate hairs dorsally below the anthers. Ovary ovoid-cylindrical, apex truncate, invaginated, stigma within invagination. Drupe oblong-ellipsoid, bicolored. 1 sp. (W. grandiflora Sleumer), Solomon Is. 44

CHAPTER 3: SYSTEMATICS AND PHYLOGENY OF STEMONURACEAE Summary. Chapter 3 presents methodology, results, and discussion of molecular data collection and analyses. Preliminary results suggest that the genera within Stemonuraceae have undergone morphological divergence without corresponding molecular divergence at the studied gene regions. A few clades may be recognized within Gomphandra on the basis of molecular data and morphological characters. Data for alignments, sequencing, amplification, and extractions are presented in Appendices 1 – 4. Introduction A molecular phylogeny of Gomphandra was an important part of the original dissertation proposal. This phylogeny was to have established a framework of species relationships, allowing a better understanding of important morphological characters and identification of hybrids or cryptic taxa. Representatives of other genera of Stemonuraceae would have established the position of Gomphandra in the family and provided synapomorphies for related groups of genera. However, once extraction and amplification efforts were started, it quickly became apparent that obtaining sequence data would be much more difficult than anticipated. At the time of writing, results are still preliminary, and sequencing will continue after this dissertation is submitted. Previous Phylogenetic Studies Molecular data from Stemonuraceae were first used by Savolainen et al. (2000), followed by Kårehed (2001), Albach et al. (2001), and Soltis et al. (2003) (Table 3.1). These studies focused on relationships at the order or family level and used gene regions that scarcely vary within Stemonuraceae. Kårehed (2001) relied on ndhF to separate the polyphyletic Icacinaceae s.l. into four families in three different orders. The most recent study that included data from Stemonuraceae (Tank & Donoghue 2010 in press) also focused at the order and family level, confirming the placement of Stemonuraceae as sister to Cardiopteridaceae in the Aquifoliales, and providing strong support for Kårehed’s recognition of Stemonuraceae as a separate family from Cardiopteridaceae. 45

Table 3.1. Sequences of Stemonuraceae in GenBank (as of 15 March 2010). Species Gene Region Citation(s) Discophora guianensis ndhF Kårehed 2001 Gomphandra javanica rbcL Savolainen et al. 2000 Grisollea myriantha ndhF Kårehed 2001 Irvingbaileya australis 18S, 26S, atpB, ndhF, rbcL Kårehed 2001, Albach et al. 2001, Soltis et al. 2000, Soltis et al. 2003 Lasianthera africana ndhF Kårehed 2001

Several target gene regions were selected to begin to understand relationships at the genus or species level within Stemonuraceae. The chloroplast trnL intron and the adjacent trnL-F spacer, along with the matK region, have been successfully used to assess species-level relationships in other families (Shaw et al. 2005, Lahaye et al. 2008). In Gomphandra, the trnL + trnL-F region varies from 1,100 to 1,300 base pairs (bp) in length, with most of the variation in the spacer region. The matK region (1,300 bp sequenced for this study) is somewhat more conserved and is better suited to assessing relationships among the genera of Stemonuraceae. The rbcL region tends to be conserved at the family level and was not expected to provide species-level resolution, but a few species were sequenced to compare to the rbcL sequences for Gomphandra and Irvingbaileya in GenBank. Primer sequences used in this study are presented in Table 3.2. Sequences from GenBank are presented in Appendix 1. 46

Table 3.2. Primers used for PCR and Sequencing. Gene Region Primer Sequence Citation trnL-F Tab E 5’ GGT TCA AGT CCC TCT ATC CC Taberlet et al. 1991 Tab F 5’ ATT TGA ACT GGT GAC ACG AG Taberlet et al. 1991 rbcL 1F 5’ ATG TCA CCA CAA ACA GAA AC Lledό et al. 1998 636F 5’ GCG TTG GAG AGA TCG TTT C(T/G) Lledό et al. 1998, modified by Schori 724R 5’ TC(G/A) CAT GTA CCT GCA GTA GCA Lledό et al. 1998, TTC AAG T modified by Schori 1327R 5’ CAT TAC CCT CAC GAG CAA GAT C Schori, this study 1460R 5’ TCC TTT TAG TAA AAG ATT GGG CCG Savolainen et al. AG 2000 matK 1F 5’ ACT GTA TCG CAC TAT GTA TCA Sang et al. 1997 38F 5’ CTC AAC AAC AMK ACT TYY TAT ATC Schori, this study 640F 5’ GGT MYG GAR TCA AAT GCT AG Schori, this study 1273R 5’ GTA CTT TTG TGT TTA CGA GCC A Schori, this study 1326R 5’ TCT AGC ACA CGA AAG TCG AAG T Cuénod et al. 2002 1475R 5’ CAA ATA CCA AAT YCG CCT TCT A Schori, this study

Material and Methods Leaf material for DNA extractions came primarily from herbarium specimens because field collection was not possible for most taxa. Fresh material was collected from several species of Gomphandra and from Codiocarpus merrittii in the Philippines and dried in silica gel. Several extraction procedures were attempted for Stemonuraceae but most did not yield abundant or clean genomic DNA. The Ballard lab’s modified SDS (sodium dodecyl sulfate) protocol (Ballard et al. 1999) did not work initially and eventually produced poor-quality DNA for a few taxa. DNeasy® kits (Qiagen, Valencia, CA) produced elutions that had very low levels of DNA that did not amplify or sequence cleanly. A review of the literature indicated that secondary compounds might be causing problems, so two pre-treatments were added: a wash with HEPES ((4-(2-hydroxyethyl)- 1-piperazineethanesulfonic acid) buffer and a wash with PVP (polyvinylpyrrolidone) solution. These pre-treatments dramatically improved results for extractions of one species, and although they did not alter results for other species, they were adopted as a standard part of the extraction protocol in hopes that they might reduce secondary compounds. The washes were eventually combined into a single event. Attempts were 47

made to improve PCR results for the target gene regions by amplifying genomic DNA beforehand with Qiagen’s REPLI-g® kit, but these efforts failed to produce useable DNA. After consultation with the Jodrell Laboratory at Royal Botanic Gardens, Kew, and with researchers in Vicki Funk’s lab at the Smithsonian Institution, a modified CTAB (cetyl trimethylammonium bromide) extraction, with a β-mercaptoethanol addition and chloroform-isoamyl alcohol precipitation, was adopted. Extractions were cleaned with an UltraClean™ kit (MO BIO Laboratories, Inc., Carlsbad, CA), which substantially improved sequence results for Gomphandra ultramafiterrestris. Extractions Leaf material was ground in liquid nitrogen, 1000 µl HEPES buffer (50 mM) and 200 µl of 1% PVP buffer were added, and the mixture was transferred to a centrifuge tube and spun at 10,000 rpm for 5 minutes. The supernatant was poured off, 400 µl 2x CTAB, 30 µl β-mercaptoethanol, and 30 µl Proteinase K (20 mg/ml) were added, and the extraction was incubated overnight at 65°C. After incubation, 460 µl 24:1 chloroform:isoamyl alcohol was added, the tubes were spun at 13,000 rpm for 5 minutes, and the aqueous phase was transferred to a new centrifuge tube. A 2x volume of ice-cold isopropanol was added, and DNA was allowed to precipitate for 30 minutes to overnight, or until a pellet was visible after centrifugation. Longer precipitation times increased the amount of an unknown precipitate for most samples. Visible co-precipitation ceased after a new formulation of Proteinase K was used (New England Biolabs, 20 mg/ml Proteinase

K in a solution of 20 mM Tris-HCl, 1 mM CaCl2, and 50% glycerol; pH 7.4 @ 25°C). After precipitation, tubes were spun at 13,000 rpm for 5 minutes, the liquid was drained off, and 500 µl 70% ethanol was added and left for 1 hour. If the pellets were brown, the tubes were drained, another 500 µl 70% ethanol was added, and the tubes were drained after 10 minutes. The DNA pellets were allowed to dry overnight to remove any traces of ethanol, and then the pellets were suspended in 100 µl TE buffer. The extractions were then cleaned with MO BIO’s UltraClean™ 15 DNA purification kit, following the manufacturer’s instructions. See Appendix 2 for a log of extractions. 48

Amplifications and Sequencing Genomic DNA was amplified with appropriate primers for the targeted gene region (Table 3.2 above). Each 100 µl amplification reaction contained 80 µl distilled ™ water, 10 µl 10x PCR buffer (Applied Biosystems , Foster City, CA), 6 µl MgCl2 solution (25 mM, Applied Biosystems™), 2 µl dNTPs (Promega, Madison, WI), 1 µl bovine serum albumin (4 mg/ml), 2.5 µl each of forward and reverse primers (Invitrogen, Carlsbad, CA, or Eurofins MWG Operon, Huntsville, AL), and 0.5 µl AmpliTaq® DNA polymerase (5U/µl, Applied Biosystems™). The following program was used for trnL, trnL-F, and matK: 94°C for 2 min, 40 cycles of 94º for 30 sec, 52° for 1 min, and 72° for 30 sec, with a final extension of 72° for 7 min. The rbcL program ran 94°C for 2 min, 35 cycles of 94° for 1 min, 50° for 1 min, and 72° for 2 min, with a final extension of 72° for 7 min. To check for successful amplification, 10 µl of PCR product was run on a 1.3% agarose gel for 30 minutes, stained for 20 minutes in a dilute ethidium bromide solution, destained in distilled water for 20 minutes, then exposed for 0.05 seconds on a gel imager. See Appendix 3 for PCR results. PCR products were cleaned with the Promega Wizard® SV Gel and PCR cleanup kit, according to the manufacturer’s instructions. Cleaned PCR products were submitted to the Ohio University Genomics Facility for cycle sequencing. Special pre-treatment was required for trnL-F samples to maintain a read through the 100 bp TA repeat region. The cycle sequencing master mix included 2 µl BigDye® Terminator 5x sequencing buffer (Applied Biosystems™), 0.5 µl dimethyl sulfoxide, 0.5 µl BigDye® Terminator dyes, 0.1 µl ThermoFidelase (Fidelity Systems, Gaithersburg, MD), and 4.9 µl micropure water. The following thermocycler program was used: 96°C for 1 min, 16 cycles of (96°C for 10 sec, 50°C for 5 sec, 60°C for 1 min 1 sec), 6 cycles of (96°C for 10 sec, 50°C for 5 sec, 60°C for 1 min 30 sec), 6 cycles of (96°C for 10 sec, 50°C for 5 sec, 60°C for 2 min). After cycle sequencing, the samples were cleaned with a BigDye XTerminator® Purification Kit with the addition of 10 µl SAM™ Solution (Applied Biosystems™) before they were analyzed with a 3130xl Genetic Analyzer (Applied Biosystems™). See Appendix 4 for a summary of amplification results. 49

Alignments and Analyses Sequences were edited in Sequence Scanner (v. 1.0, Applied Biosystems™), aligned with the Clustal W module of BioEdit, corrected by hand to fix alignment problem with indels in the 100 bp TA repeat in the trnL-F spacer, and assembled into contiguous files for trnL to trnL-F. See Appendix 2 for alignments. Gaps were indicated with hyphens and were not coded separately. Alignments were analyzed with the NONA program (Goloboff 1993) in WinClada (Nixon 2002). Sequences from Ilex aquifolium were used to root the trees. The following analyses were run: Ratchet (200 iterations/rep, 2 trees held, 10% of characters used), bootstrap and jackknife (100 replications, 10 search reps, 1 tree held, no max*, 100 max trees). In addition, ndhF sequences (used in Kårehed 2001) and rbcL sequences were downloaded and aligned with the Clustal W module of BioEdit to assess the variability of these gene regions within Stemonuraceae. Results The rbcL region was sequenced from two species of Gomphandra and from Codiocarpus merrittii (Jodrell Laboratory, Royal Botanic Gardens, Kew) for comparison to the rbcL sequences for Gomphandra and Irvingbaileya in GenBank. The trnL intron was sequenced from 13 taxa, trnL-F spacer was sequenced from 12 taxa, and matK was sequenced from 9 taxa (Table 3.3). 50

Table 3.3. Sequences of Stemonuraceae for trnL, trnL-F, and matK. Species Gene Region(s) Distribution Codiocarpus merrittii trnL1, trnL-F1 Philippines Gomphandra australiana trnL, trnL-F, matK Australia G. fernandoi trnL, trnL-F, matK Philippines G. flavicarpa trnL, trnL-F, matK Philippines G. javanica trnL2, matK2 Indonesia G. luzoniensis trnL1, trnL-F1, matK Philippines, Taiwan G. mappioides trnL, trnL-F, matK, rbcL Philippines G. oligantha trnL, trnL-F, matK Philippines G. psilandra trnL-F, matK, rbcL Philippines G. ultramafiterrestris trnL-F Philippines Grisollea madagascariensis trnL Madagascar Stemonurus ammui trnL, trnL-F, matK Papua New Guinea 1 Sequences from the Jodrell Laboratory, Kew, Royal Botanic Gardens, UK. 2 Sequences from David Tank (University of Idaho). rbcL – An alignment of Codiocarpus merrittii and Gomphandra luzoniensis sequences from the Jodrell Laboratory, Royal Botanic Gardens, Kew, a G. javanica and an Irvingbaileya australis sequence from GenBank, and two new partial sequences (G. mappioides and G. psilandra) showed that the taxa of Stemonuraceae were unique at 30 bp (out of 1370 bp) when compared to Ilex and Cardiopteris (Appendix 2A). The three species of Gomphandra were unique at a single bp when compared to Codiocarpus and Irvingbaileya. The rbcL gene is only useful for distinguishing Stemonuraceae from other families. ndhF – An alignment of Kårehed’s (2001) 31 ndhF sequences (from GenBank) of Icacinaceae s.l. plus Helwingia, Phyllonoma, and Ilex (3 spp.) showed that Discophora, Grisollea, Irvingbaileya, and Lasianthera shared 25 unique bp values (out of 1650 bp, Appendix 2B [Aquifoliales only]). Within these genera, apomorphies (including autapomorphies) occurred at 73 bp. Kårehed’s (2001) placement of Lasianthera as basal to a polytomy of Discophora, Grisollea, and Irvingbaileya was based on 31 positions shared with other Icacinaceae s.l. and not with Discophora, Grisollea, and Irvingbaileya. An alignment of just Stemonuraceae taxa + Cardiopteris showed only 3 bp that varied for 51

more than one taxon within the family, indicating that ndhF may be used to distinguish Stemonuraceae from other families, but it is not useful below the family level. matK – An alignment of 10 matK sequences (Ilex aquifolium, Stemonurus ammui, 8 spp. of Gomphandra) showed that 26 bp (out of 1270 bp) were informative for more than one taxon. Stemonurus was different from both Ilex and Gomphandra at 4 bp. Gomphandra and Stemonurus shared two 6 bp insertions that were not present in Ilex. More sequences are needed, but matK may be useful for reconstructing a phylogeny of the genera within Stemonuraceae. trnL intron – An alignment of Codiocarpus merrittii, Stemonurus ammui, Grisollea madagascariensis, and 7 spp. of Gomphandra showed 28 bp (out of 630) that were parsimony informative. Gomphandra luzoniensis and G. fernandoi had identical sequences, and G. oligantha shared 13 apomorphies with them. Codiocarpus had a 5 bp deletion not found in Gomphandra, Grisollea, or Stemonurus. Gomphandra australiana, G. flavicarpa, G. javanica, and G. mappioides shared a unique 6 bp deletion. trnL-F spacer – An alignment of Stemonurus ammui, Codiocarpus merrittii, Ilex aquifolium, and 10 spp. of Gomphandra showed a high level of variation, with 52 bp (out of ~630 bp) that were informative for more than one taxon and apomorphies (including autapomorphies) at 225 loci. Ilex lacks the 190 bp region of TA repeats that is present in all Stemonuraceae included in the study. The typical trnL-F region is ~550 bp long in Gomphandra. Codiocarpus had a 9 bp T insertion near the beginning of the spacer. At one position, all taxa of Gomphandra shared a G, while Stemonurus and Codiocarpus shared a T. Gomphandra mappioides had a 6 bp insertion. The Gomphandra luzoniensis group, which includes the two subspecies of G. luzoniensis as well as G. fernandoi and G. ultramafiterrestris, shared one unique position, while the G. mappioides group (G. flavicarpa, G. mappioides, G. psilandra), shared five other insertions (26 bp total). Stemonurus shared a 7 bp insertion with Gomphandra mappioides. Codiocarpus had several unique deletions (25 bp total). Gomphandra mappioides and G. psilandra had a 52

series of insertions absent in the other taxa. The sequences of the two subspecies of Gomphandra luzoniensis, G. fernandoi, and G. ultramafiterrestris only differed by a single bp, indicating a close relationship among the taxa. This relationship is further supported by similarities in leaf morphology, inflorescence structure and fruit shape among the taxa. Gomphandra australiana had a 25 bp insertion not shared with other taxa, but it shared 3 insertions (15 bp total) with the G. mappioides group. Parsimony Analyses Single-gene analyses returned trees with strong to moderate support for certain clades. An analysis of trnL (11 taxa) resulted in one most parsimonious tree of 72 steps (Fig. 3.1).

Fig. 3.1. Single most parsimonious tree for trnL. Bootstrap values >50% are shown above supported branches, and equivalent jackknife values are shown below. Gomphandra luzoniensis (N) is a sequence from a specimen found in Nabas, Panay, Philippines. 53

An analysis of trnL-F (12 taxa) returned one most parsimonious tree of 140 steps, but Stemonurus and Codiocarpus were nested within Gomphandra but that placement was not supported. Bootstrap values supported Stemonuraceae, Gomphandra luzoniensis, Stemonurus + Codiocarpus, as shown in the majority rule tree presented in Fig. 3.2.

Fig. 3.2. Majority rule tree for trnL-F. Bootstrap values >50% are shown above supported branches. Gomphandra luzoniensis (N) is a sequence from a plant in Nabas, Panay, Philippines; G. luzoniensis (luz.) is subsp. luzoniensis, and G. luzoniensis (sept.) is subsp. septentrionalis from Lanyu Island, Taiwan.

54

An analysis of matK resulted in one most parsimonious tree of 168 steps (Fig. 3.3).

Fig. 3.3. Single most parsimonious tree for matK. Bootstrap values >50% are shown above supported branches, with equivalent jackknife values shown below. Gomphandra luzoniensis (N) is a sequence from a specimen found in Nabas, Panay, Philippines.

Data were combined for a three-gene analysis. The Ratchet analysis returned two most parsimonious trees of 388 steps that differed in the position of Stemonurus relative to Codiocarpus + Grisollea and Gomphandra. The strict consensus tree returned by the Ratchet showed that Ilex was the clear outgroup, Stemonurus, Codiocarpus + Grisollea, and Gomphandra formed an unresolved polytomy, and Gomphandra was represented by two clades. A majority rule tree with bootstrap and jackknife values and all unsupported nodes collapsed is shown in Figure 3.4. Gomphandra oligantha was sister to the unresolved G. luzoniensis clade, which includes G. luzoniensis, G. fernandoi, and G. ultramafiterrestris. Gomphandra australiana, G. flavicarpa, and G. psilandra formed an unresolved polytomy with G. mappioides + G. javanica. 55

Figure 3.4. Majority rule tree that reflects the strict consensus of two most parsimonious trees produced with the Ratchet, using the trnL intron, trnL-F spacer, and matK; nodes with <50% bootstrap support are collapsed, bootstrap values >50% appear above supported branches, and equivalent jackknife values appear below. In Gomphandra, the upper clade is characterized by axillary inflorescences, while the lower clade has terminal inflorescences. Gomphandra luzoniensis (N) is a sequence from a plant in Nabas, Panay, Philippines; G. luzoniensis (luz.) is subsp. luzoniensis, and G. luzoniensis (sept.) is subsp. septentrionalis from Lanyu Island, Taiwan.

Preliminary Conclusions Single-gene analyses provided resolution at different taxonomic levels but were not fundamentally incongruent. Despite pronounced morphological differences, Codiocarpus, Stemonurus, Grisollea, and Gomphandra do not differ more than 2% for matK and trnL. Both trnL and matK provided reasonably strong support for the terminal inflorescence clade within Gomphandra, but only matK provided support for Gomphandra as a single clade. With the limited number of taxa included, the trnL-F 56 spacer was too variable to provide much support for any clade other than the Gomphandra luzoniensis group, based on the nearly identical sequences of its taxa. The three-gene analysis showed that sufficient data are not yet available to resolve the position of Gomphandra within Stemonuraceae with strong bootstrap support. Codiocarpus and Grisollea appear to be more closely related to each other than to Stemonurus or Gomphandra, but sequences have not yet been obtained for the other eight genera in the family. If fruit morphology is a reliable indicator, Codiocarpus and Grisollea should group with the other genera that share a compressed fruit. Within Gomphandra, several clades are evident. Gomphandra luzoniensis and several closely related species are morphologically distinct but do not show sequence variation at the selected gene regions. Together with Gomphandra oligantha, they form a clade of species with terminal inflorescences. The other main clade within Gomphandra includes species with axillary inflorescences. In this group, Gomphandra mappioides is sister to G. javanica. These two species have similar flowers and fruit and are geographically adjacent, though their distributions do not overlap. Gomphandra psilandra, which is similar to G. mappioides in fruit color and flower number, is in an unresolved polytomy with G. flavicarpa, G. australiana, and the G. mappioides clade. Additional sequence data from other species are needed to provide better resolution. Most species of Gomphandra have axillary inflorescences, so it will be interesting to see whether they form one clade within the genus. It should be noted that TA repeat region may prove to be a molecular synapomorphy for Stemonuraceae. The only portion of the trnL-F spacer that aligns with any taxa outside of Stemonuraceae is the relatively conserved 3’ end. Clustal W cannot produce a reliable alignment of Stemonuraceae taxa and Cardiopteris, a representative from its sister family, and the alignment of Stemonuraceae taxa and Ilex aquifolium had to be altered by hand, using the trnL intron and the conserved 3’ trnL-F end as anchors so an approximately 200 bp gap could be inserted in the Ilex sequence. 57

CHAPTER 4: CHARACTERS, SPECIES CONCEPTS, AND MORPHOMETRICS Summary. Chapter 4 begins with a discussion of the characters that are used to distinguish species of Gomphandra. An explanation of the species, subspecies, and variety concepts used in the revision in Chapter 6 follows. Results of morphometric analyses of problematic species or species groups are presented along with a discussion of difficult groups within the genus. Characteristics of Gomphandra The majority of Gomphandra species can be relatively easily and reliably distinguished by a combination of morphological features. To one unacquainted with the genus, individual trees or specimens will appear rather nondescript, with simple alternate leaves and no obvious vegetative characters to distinguish them from other plants. Even flowers and fruit have been misidentified by collectors, with stamens mistaken for petals and fruit identified as buds. Morphological and anatomical features of the leaves, flowers, and fruit allow the genus to be accurately identified, and these features are discussed in Chapters 2 and 6. At the species level, a different set of characters must be used, and with a few rare exceptions, a single feature is not sufficient to effect an accurate identification. The characters that do work for the majority of species are presented and discussed below, followed later by a discussion of difficult groups and insufficiently known taxa. For identification of species, one of the most useful parts of a Gomphandra specimen is its leaves. Leaves can vary greatly within an individual tree, not to mention within a single species, yet they contain a wealth of information and are usually consistent in certain aspects. ƒ Leaf Size. Size varies within a species, but some species are characterized by large leaves (Gomphandra comosa, donnaiensis, engganensis, papuana, rarinervis, simalurensis, subrostrata), while others tend to have quite small leaves (G. coriacea, halconensis, lysipetala, oligantha). ƒ Leaf Shape. Shape refers to the overall outline of a leaf (orbiculate, ovate, obovate, lanceolate) as well as the shape of the apex and base. There are no unique leaf shapes within Gomphandra, and within some taxa, leaf shape is quite variable, but a number of shapes are only found in a few species. Several species 58

(Gomphandra angustata, lanceolata, oblongifolia) are named for their overall leaf shape, while G. subcordata is named for the shape of its leaf base. Other taxa (Gomphandra luzoniensis subsp. septentrionalis, G. parviflora vars.) have a distinctive shape that is not alluded to in the specific epithet. Gomphandra oligantha is one of several species that has leaves with a long caudate tip. ƒ Leaf Texture. This feature is difficult to quantify and differs between fresh and dried specimens, but it tends to be consistent within a taxon. Coriaceous leaves are found in Gomphandra bracteata, coriacea, halconensis, kinabaluensis, luzoniensis subsp. septentrionalis, palustris, and ultramafiterrestris. These taxa can be easily distinguished from species with chartaceous leaves, like Gomphandra australiana, javanica, mappioides, oligantha, quadrifida, and tetrandra. Species with intermediate leaf textures are more difficult to separate using this character. ƒ Leaf Pubescence. All Gomphandra leaves are pubescent in bud. The shoots do not exhibit continuous growth and the buds are naked, so trichomes provide protection when the buds are dormant. All Gomphandra leaves are also pubescent when they begin to expand, and most are glabrescent – glabrous adaxially at maturity, and glabrous to sparsely pubescent along the veins abaxially. Therefore, leaf pubescence is only important in the 12 species that remain moderately to densely pubescent abaxially at maturity – Gomphandra chimaera, cumingiana, donnaiensis, fernandoi, fuliginea, macrosperma, mollis, papuana, rarinervis, subcordata, tomentella, and velutina. ƒ Secondary Vein Number. The number of secondary veins per leaf varies within each species, and most species have 4 – 6 pairs of veins, but some species are distinctive. Gomphandra halconensis does not have visible secondary veins, while G. oligantha, fuliginea, and luzoniensis subsp. septentrionalis tend to have only 2 – 4 pairs, and G. parviflora commonly has more than 9 pairs. ƒ Secondary Vein Course. The vein course, or pathway that the secondary veins describe as they travel from midrib to margin, can be diagnostic (Ash et al. 1999). Certain species with large leaves, like Gomphandra papuana, rarinervis, and 59

subcordata, have widely spaced veins that are more or less parallel. Gomphandra flavicarpa has veins that consistently loop and join each other near the margin (brochidodromy), a feature that is commonly seen but usually only in the upper few pairs of leaves. The veins of Gomphandra longipedunculata form a very acute angle to the midrib and converge toward the margin – that is, the distance between two pairs of veins is much greater at the midrib than it is near the margin. A few taxa are quite variable in their secondary vein course (i.e. Gomphandra quadrifida), but most species are consistent. ƒ Twig Pubescence. All twigs are initially pubescent, but the persistence of the pubescence is important, as is the length and the arrangement. Most trichomes found on Gomphandra twigs are less than 1 mm long, so longer pubescence is diagnostic. Two species in Papua New Guinea, Gomphandra papuana and G. rarinervis, have quite similar leaves but can easily be distinguished by their twig pubescence, which is short and appressed in G. papuana, and longer and spreading in G. rarinervis. Another similar species, Gomphandra subcordata, also has short appressed pubescence, but its trichomes are densely packed and reddish. Although pubescence color is included in the species descriptions, Gomphandra subcordata is one of the few species for which it is diagnostic, as pubescence color can vary within a taxon. ƒ Twig Diameter. Twig diameter has not been used previously to help identify species, but it is quite useful. Twig diameter of course increases from the terminal bud to the main trunk, but within a species the thickness in the terminal 10 cm only varies by one or two mm, so it can be diagnostic for certain species. Some species have very slender twigs (Gomphandra borneensis, lamanii, oligantha, tenuis) while others have relatively stout twigs (G. engganensis, luzoniensis subsp. septentrionalis, rarinervis). ƒ Inflorescence Structure. The basic inflorescence structure in Gomphandra is a compound, scorpioid cyme. In species that have an inflorescence with about 8 – 20 flowers, inflorescence structure is rarely a useful feature. However, for taxa that have very few or very many flowers, inflorescence structure is usually 60

distinctive and useful for identifying species. Gomphandra bracteata, lamanii, oligantha, and tenuis have long slender peduncles with relatively few flowers, while G. longipedunculata has a long robust peduncle and many flowers. Gomphandra papuana, rarinervis, and subcordata have only a few flowers on short peduncles and long pedicels, while G. muscosa and G. pseudoprasina have few flowers arranged in an umbel with long peduncles and short pedicels. Gomphandra capitulata is one of three species that have a capitate inflorescence. Gomphandra luzoniensis has a relatively long inflorescence with many flowers and 3 – 5 degrees of branching, an inflorescence type shared by several other species (G. fernandoi, palustris, simalurensis, ultramafiterrestris). More discussion of phylogenetic relationships suggested by inflorescence structure is presented in this chapter. The staminate inflorescences of Gomphandra quadrifida are unique in that they elongate and bloom multiple times via tiny “reserve buds” that remain dormant near the apices of the inflorescence branches. It should be noted here that staminate and pistillate inflorescences differ in flower number and, to a lesser extent, in inflorescence structure. ƒ Inflorescence Position. Inflorescence position can be diagnostic, and it may also provide information on phylogenetic relationships. The most frequent inflorescence position is axillary, in the axil of a leaf, though in a strict sense these inflorescences terminate a short axillary branch. It is not uncommon to see a small bud at the base of an axillary inflorescence, though these buds never develop. Terminal inflorescences are less common, but are encountered in the Gomphandra luzoniensis group and the G. quadrifida group. After branch elongation, terminal inflorescences may appear leaf-opposed, though leaf- opposed inflorescences fall into two categories. The first is a single terminal inflorescence that did not mature until the most distal axillary bud developed into a new branch. The second is a series of terminal inflorescences on successive sympodial branches that experienced synchronous growth, so that the branch appears to have multiple leaf-opposed inflorescences blooming simultaneously. This second form is relatively uncommon and can be observed in Gomphandra 61

cambodiana and G. mollis. Another aspect of inflorescence position is the age of the twig where the inflorescences appear. Some species only flower from a twig segment that is at least one season old. Others form buds on newly expanding growth at the tip of the twig. A few species form small buds on active growth, but the flowers do not mature until the following season. ƒ Flower Size. Gomphandra has relatively small flowers, usually only a millimeter or two wide and less than a centimeter long. However, flower size does not appear to vary appreciably within species. Species with small flowers, like Gomphandra australiana, quadrifida, and tetrandra, have petals that are 3 to 4 mm long. Most species have medium sized flowers, with petals 4 to 5 mm long, and a few species, like Gomphandra papuana, have large flowers with petals 8 mm long. While this may not seem like much of a difference, large-flowered taxa have petals that are twice as long as those of small-flowered taxa, and such differences are easily noticed. ƒ Petal Pubescence. Most species of Gomphandra have glabrous petals, so petal pubescence is only diagnostic for a few taxa. Gomphandra melanesiensis, montana, muscosa, and pseudoprasina have sparse external apical pubescence in bud, while G. papuana, rarinervis, and velutina remain densely pubescent in the upper 1/3 or 2/3 of their petals. ƒ Stamen Pubescence. One of the features that is supposed to characterize Stemonuraceae is cylindrical hairs on the stamens, so it is important to note that not all species have this kind of trichome or even any pubescence on their stamens. The stamens of Gomphandra mappioides can be glabrous or may have very short, papillate trichomes on the inside face of the filaments. Stamen pubescence ranges from these short papillate hairs to longer clavate hairs, which may be present ventrally or dorsally below the anthers, or in a tuft dorsally at the connective. If the connective tuft is present, the stamens are also pubescent ventrally. Stamen pubescence is only used descriptively because the trichomes tend to tangle, making it difficult to measure lengths or count individual 62

trichomes. Staminodes tend to have pubescence that is similar to but sparser than that of stamens. ƒ Ovary Pubescence. Ovary pubescence is not always a reliable character for distinguishing species of Gomphandra. Gomphandra cumingiana, fuliginea, javanica, lysipetala, longipedunculata, rarinervis, and velutina all have pubescent ovaries, but the pubescence does not necessarily persist as the ovaries develop into fruits. Consequently, although ovary pubescence is a good character when it is present, as only a handful of species have it, lack of ovary pubescence on an individual specimen does not necessarily mean that the specimen belongs to a species that always has a glabrous ovary. Interestingly, pubescent ovaries do not occur in species with terminal inflorescences. ƒ Fruit Size. Fruit size is a somewhat difficult character to use with Gomphandra because many of the fruiting collections have immature fruit. Generally, if the inner mesocarp and endocarp are developed, the fruit is probably close to its mature length. The width of dried fruit is never the same as the width of fresh fruit because the outer mesocarp shrinks. However, when fresh, the mesocarp probably only adds 1 – 2 mm thickness on each side of the fruit. Species with large fruit are usually easily identified even if their fruit is immature. Gomphandra conklinii, macrocarpa, melanesiensis var. macrocarpa, montana, papuana, parviflora var. dolichocarpa, and rarinervis all have fruit that are commonly 3 cm long or longer. Fruit size is usually consistent within a species. ƒ Fruit Shape. Most Gomphandra fruits can be described as ovoid or ellipsoid, although a few species have globose (G. halconensis), noticeably obovoid (G. lanceolata, schoepfiifolia), or fusiform fruits (G. dolichocarpa, fusiformis). Apex and base shape are more diagnostic, though they can vary within some taxa. Gomphandra rarinervis has a long beak on its fruit, while G. subrostrata has a short beak. Gomphandra ramuensis and G. quadrifida frequently have a gibbous base below the sulcus, though basal swellings do not seem to be consistently found in the species that exhibit them. 63

ƒ Fruit Pubescence. Species that have a pubescent ovary may also have a pubescent fruit. Gomphandra chimaera, cumingiana, fusiformis, javanica, and lysipetala usually have pubescent fruit, though pubescence can be lost during fruit development. ƒ Fruit Color. Fruit color may be extremely useful for identifying species of Gomphandra and assessing their relationships, but it is also one of the most difficult characters to use. Fruit color is not preserved in herbarium specimens, and most collections of fruit were not made at maturity. Gomphandra flavicarpa, which was named after its yellow fruit, actually has salmon pink fruit when ripe. On herbarium labels, fruit color has been reported as green, brown, black, purple, gray, yellow, white, clear, pink, or orange. Reliable field observations indicate that yellow, white, pink, and orange are colors of mature fruit. Preliminary molecular data suggest that fruit color may be an informative character for recognizing groups of species (white in Gomphandra javanica and mappioides; pink or orange in G. fernandoi, luzoniensis, and ultramafiterrestris), although as more species are sequenced, fruit color may prove to not be informative. If it is informative, its utility may be limited because mature fruit color is still unknown for most species of Gomphandra. ƒ Fruit Ridges. The “endocarp” of Gomphandra (actually the inner mesocarp but referred to as the endocarp in Sleumer’s species descriptions) consists of multiple sclerotic bundles that anastomose to a minor extent. When the outer mesocarp is dried, these bundles form ridges that are quite evident on the fruit and are distinctive in different species. The number of ridges varies from approximately 8 to 15, although the anastomosing nature makes an exact count difficult. Ridge numbers are therefore given as a range or an approximation – e.g., ca. 15. Ridge prominence varies as well, from scarcely evident in Gomphandra quadrifida and G. papuana to strongly raised in G. montana and G. rarinervis. Each species of Gomphandra also has a feature that is described as a sulcus or sulcus complex. On one side of the fruit, there is a pair of ridges that flank a central bundle. The central bundle is less prominent than the ridges, so it appears to be within a 64

groove – the sulcus. The sulcus complex, composed of these ridges and the bundle, is apparently homologous to the site of attachment for the fleshy appendage found in other genera of Stemonuraceae. The ridges in the sulcus complex are included in the ridge number count, though the central bundle is not. The stigma is often displaced toward the sulcus. ƒ Stigma Diameter. In flower, the stigma is usually only 1 to 2 mm across, but in most species it is accrescent during the course of fruit development. Although stigma diameter does not exceed 4 or 5 mm in mature fruit, the difference between a 2 mm stigma and a 4 mm stigma is quite evident. Stigma shape and lobing or ridging are less useful, though when used in combination with diameter, they can be used to separate mixed collections of fruit. Stigma differences were sufficient to sort out Gomphandra mappioides (broad, flattened stigma) and G. oblongifolia (smaller, high and capitate stigma) fruits that were in a packet with fruit of G. dinagatensis, which has a small, flat stigma. Species, Subspecies, and Varieties Most species of Gomphandra can be readily identified by using a combination of the above characters – pubescence, leaf shape and venation, fruit size and ridging pattern, or inflorescence structure if fruit are not available. Variation exists within each species, but if it is continuous and collections are from a geographically contiguous region, the species’ description encompasses the range of variation. If discrete morphological differences exist, and there is a geographical separation of collections, separate species or subspecies have been recognized. The following examples illustrate the factors I took into consideration in deciding whether to recognize a taxon as a species or subspecies. In the Philippines, Gomphandra luzoniensis is a widespread, much-collected species whose range of variation is well documented. It is restricted to the western part of the country. Gomphandra fernandoi shares many characteristics with G. luzoniensis, and molecular data have shown little to no difference between the taxa at certain gene regions. However, Gomphandra fernandoi has leaves that differ in shape, texture, and pubescence, and it is restricted to four islands in the southeastern part of the country, where G. luzoniensis has never been found, so it is treated as a distinct species. 65

Gomphandra ultramafiterrestris is similar to both G. luzoniensis and G. fernandoi in its inflorescences and is indistinguishable at certain gene regions, but its leaves differ in size, texture, and venation, its fruits are much smaller than either species, and although the western edge of its range overlaps with the eastern range of G. fernandoi, it is restricted to a certain soil type. Given these differences, it too is treated as a separate species from Gomphandra luzoniensis. In the far northern part of the Philippines and on an island off the coast of Taiwan, there is a taxon that had been identified as Gomphandra luzoniensis. It is identical genetically to Gomphandra luzoniensis and G. fernandoi at the gene regions examined, and its fruits and inflorescences do not differ from G. luzoniensis. It has thicker leaves with fewer veins than typical Gomphandra luzoniensis, and its leaf shape is rounder. Although it is geographically isolated and a discriminant analysis has shown a separation between the taxon and typical Gomphandra luzoniensis, it is treated as G. luzoniensis subsp. septentrionalis rather than as a different species. Some of the differences in leaf morphology may be due to phenotypic plasticity, as the islands where Gomphandra luzoniensis subsp. septentrionalis grows are heavily influenced by strong ocean winds that stunt plant growth. On the northern coast of Luzon, specimens with transitional leaf types have been collected, suggesting that there is not yet a clean separation of morphology. Given how isolated the populations on the Batanes and Lanyu Island are, it is likely that Gomphandra luzoniensis subsp. septentrionalis will become a distinct species in time, but it is not distinct enough yet to be recognized as a separate species. Only three subspecies of Gomphandra are recognized in the revision presented in Chapter 6. Gomphandra luzoniensis subsp. septentrionalis is discussed above. Gomphandra melanesiensis subsp. macrocarpa occurs in Rotuma and the Santa Cruz Islands. Gomphandra melanesiensis subsp. macrocarpa has larger fruits and leaves that are a different shape than typical G. melanesiensis. Its distribution overlaps slightly with that of Gomphandra melanesiensis, and as with G. luzoniensis, a few specimens with transitional morphologies have been found at the geographical boundary between the subspecies. In the revision, geographically adjacent taxa with a few consistent differences but evidence of incomplete morphological separation are treated as subspecies. The third 66

subspecies in the revision presents a different case. Gomphandra javanica subsp. pseudojavanica, from Simeulue Island, was described (Sleumer 1969) as a separate species from G. javanica, which is found on Java, Bali, and Lombok. These two taxa are separated by approximately 7,500 km, although both Simeulue and Java are less than 125 km from Sumatra. However, only two features can be used to distinguish specimens: leaf pubescence (sparsely pubescent in pseudojavanica vs. usually glabrous in javanica) and stigma diameter on the fruit (2 mm in pseudojavanica vs. 2.5 – 3.5 mm in javanica). These characters can vary more within other species of Gomphandra than they do between these two taxa, so G. pseudojavanica is treated as a subspecies of G. javanica in the revision despite complete geographical separation and discontinuities in two characters. Additional collections from Simeulue may provide more characters that distinguish the taxa, in which case it might be appropriate to recognize Gomphandra pseudojavanica as a separate species rather than a subspecies. Varieties are recognized in the revision as well, but they are not conceptualized the same way as subspecies. Varieties of a species are found in a geographically contiguous area, though they may represent a few scattered collections from a large area. Specimens that belong to one variety are morphological different from all the other varieties of the same species, but because of insufficient numbers of collections and/or incomplete reproductive material, it cannot be determined whether the differences are discrete or merely points along a continuous spectrum of variation. Taxa that are treated as varieties of a single species may represent extremes of a highly variable species, or they might be different species altogether, but too much information is missing to decide which is the case. In Borneo, I have described two new taxa from Mt. Kinabalu. Both are known from limited material and have not been recently collected. Gomphandra kinabaluensis var. kinabaluensis has coriaceous leaves that are variable in shape, and all reproductive parts are known from the eight collections that were gathered from elevations of 1350 to 2150 m. Gomphandra kinabaluensis var. clemensiorum is only known from one collection at 2700 m. It has narrow, coriaceous leaves that match one extreme of the typical variety, but its fruit are much larger. Mt. Kinabalu has tremendous species diversity, but without more collections, it is not possible to determine whether 67 these taxa represent different species, or if instead there is a transition in morphology that follows an elevational gradient. The other varieties newly recognized in the revision are from the Padang Highland area in Sumatra, along the Barisan Range. Most collections of material identified as Gomphandra parviflora have little or no locality data, so determining the species’ distribution is difficult. Two specimens of Gomphandra parviflora purportedly from the type locality are distinct from all the others, with larger leaves and more veins, and one of the specimens has fruits that are larger than those of other G. parviflora (the other specimen is sterile); these two specimens are treated here as G. parviflora var. magnifolia. Sumatra has a number of similar but endemic species with very narrow distributions, and this taxon may represent a species, but with only two collections, both from the same area, it is difficult to determine whether Gomphandra parviflora var. magnifolia represents large-leaved individuals of G. parviflora or a distinct species. Another variety, Gomphandra parviflora var. paucibarbata, is represented by a single collection less than 200 km southeast of the type locality of G. parviflora. The specimens are similar to Gomphandra parviflora but have narrow leaves, larger flowers, and only a few hairs on the stamens. Because there is only one collection, and mature male flowers of Gomphandra parviflora are not well known, it is treated as a variety. Additional collections with mature reproductive material would help determine whether G. parviflora represents more than one species, but so much habitat has been destroyed in Sumatra that it may never be possible to collect more specimens from the type localities of the taxa or from other parts of the Barisan Range. Hybrids, Microspecies, and Agamospermy Although there is no direct evidence that hybridization occurs in Gomphandra, the morphologies of certain taxa indicate that hybridization might occur within the genus. In Papua New Guinea, the species Gomphandra papuana is easily identified. It has large leaves, appressed pubescence, and few-flowered inflorescences with pubescent petals. The fruit are quite large, but they appear to be parthenocarpic, as the lignified inner mesocarp, endocarp, and the seed rarely develop. The fruit itself is quite distinctive, with a granular outer surface not found in any other species, and a very large, unridged stigma. 68

A few specimens, including the type, do have a seed inside a very thick inner fruit wall, but most collections show no evidence of normal fruit development. This regular failure to produce seeds suggests that Gomphandra papuana might be a mostly sterile hybrid. Gomphandra rarinervis is similar to G. papuana, with similar leaves and flowers, but it has spreading pubescence and large, prominently ridged fruit with a smaller stigma and a smooth surface. If Gomphandra papuana is of hybrid origin, G. rarinervis is almost certainly one of its parents. The two taxa do not overlap in distribution, but they are found in adjacent provinces. One collection from Northern Province is intermediate, with the appressed pubescence of Gomphandra papuana but the strongly ridged fruit of G. rarinervis. In Peninsular Malaysia, specimens intermediate in morphology between Gomphandra quadrifida and G. tenuis suggest that hybridization might be occurring. Gomphandra quadrifida is a widespread but variable species that can be recognized by its terminal inflorescences and reblooming male inflorescences. Some of the material Sleumer identified as Gomphandra quadrifida var. ovalifolia is now treated as G. tenuis. Gomphandra tenuis is quite similar to G. quadrifida in most respects, except its leaves dry dark brown, its twigs and peduncles are extremely slender, its peduncles are very long, and its inflorescences have fewer flowers and do not rebloom. Geographically, Gomphandra tenuis is restricted to the central part of Peninsular Malaysia, while G. quadrifida is more widespread. Where the taxa meet, specimens that are morphologically intermediate have been collected. Their leaves are larger and the twigs are more robust than those of Gomphandra tenuis, the inflorescences are slender and do not rebloom, but they have as many flowers as those of G. quadrifida, and the fruits are larger than those of either species. These intermediates, which could be the result of hybridization between the two species, are found at high elevations in the central Malaysian highlands, while Gomphandra tenuis tends to occur at low elevations. Another possibility is that Gomphandra quadrifida and G. tenuis represent extremes in variation of a single taxon, though such differences in inflorescence structure do not occur within any species or infraspecific taxon of Gomphandra. 69

Field botanists in Malaysia have reported for various genera that distinct morphologies of single species may be found throughout a landscape – that is, one valley will have plants of one morphology, the next valley will have another, but each morphology will be found in multiple valleys throughout the species’ range. In agamospermous species, especially ones that can hybridize, a population with a distinct morphology may reproduce asexually, creating what is known as a microspecies (Jauhar & Joshi 1970, Grant 1981). At this time, neither hybridization nor agamospermy can be confirmed, but the case of Gomphandra papuana suggests that hybridization does occur within the genus. Agamospermy has been reported in dioecious woody plants, though it is not considered common. Dupont (2002) found that Lindera glauca Bl. (Lauraceae) is only represented by pistillate plants in Japan, and the plants produce viable seeds even though related species of Lindera in Japan are dependent on cross-pollination for seed production. According to Dupont (2002), pollination by generalist insects and low population densities or low male-to-female ratios are thought to increase the likelihood of apomixis. Gomphandra has small white or greenish flowers that are presumably pollinated by generalist insects, and sex ratios within the genus may be unequal. No scientific study of sex ratios has been conducted, but my search for both sexes of flowering Gomphandra psilandra found approximately 20 pistillate trees and only one staminate tree. Male inflorescences are often much showier than female inflorescences, so during flowering, male inflorescences may be preferentially collected. However, in nearly all species of Gomphandra, the male inflorescences abscise after anthesis, so even if male trees are abundant, specimens from female trees with immature fruit will be collected instead of the apparently sterile male trees. Sex ratios determined from herbarium specimens are therefore not necessarily a good reflection of actual sex ratios within a population. Additionally, many collectors cannot identify Gomphandra in the field and are not aware that it is dioecious, so they do not search for trees of the other sex. An organized field study would be required to determine sex ratios for different species of Gomphandra. 70

Phenetic Analyses Gomphandra luzoniensis Gomphandra luzoniensis is a fairly widespread species in the western Philippines. Its leaves and inflorescences are easily recognizable, but collections from northern Luzon and Lanyu Island are distinctive. They have small coriaceous leaves that are obovate to rounded, with a round apex and 2 – 4 pairs of secondary veins. The trees tend to be short and have thick twigs. To test whether a clear separation in morphology existed between typical Gomphandra luzoniensis and these northern collections, leaves of 43 collections (121 leaves) from all parts of the species’ range were measured with a Ballard radiometer. Only mature, unobstructed leaves with an intact apex, base, and margin were measured. The distance (cm) from the midpoint to the margin at the widest part of the leaf was measured (0° reading). Distance was also measured from the center point to the margin along 30°, 60°, 90°, 270°, 300°, and 330° radii to record the basic outline of leaf shape. It should be noted that Gomphandra leaves are not perfectly symmetrical, and only one side of each leaf was measured. The right side of the leaf was measured unless the left side was more intact. Leaf base and apex angle were also measured with a protractor and a ruler. Vein number was recorded from whichever side of the leaf had the most secondary veins. Leaves were assigned to two groups based on overall leaf morphology. Seventy-three leaves belonged to Group 1, with smaller, coriaceous leaves that were obovate to rotund, with few vein pairs (northern collections). Forty-eight leaves belonged to Group 2, with larger, mostly chartaceous leaves that were obovate and had more vein pairs (typical collections). A discriminant analysis run in the program NCSS (Kaysville, UT) showed that the groups are morphologically distinct (Fig. 4.1). This distinction corresponds to the geographic distribution of Gomphandra luzoniensis, with Group 1 found in Batan and Lanyu Islands, and Group 2 found in Luzon and Palawan. Plants with intermediate or both morphologies are found in Northern Luzon and on the Babuyan Islands between Luzon and the Batanes Islands. No leaves were misclassified, but one collection from Camiguin Island had some leaves that were classified in Group 1 and others that were classified in Group 2. Leaf morphology can vary within a species between sun and shade 71 leaves, and while it is a possibility the more open habitat of forests on Batan and Lanyu Islands influences texture and size, it cannot account for the other differences between the two groups. Nursery-grown plants of Gomphandra luzoniensis (Mt. Makiling) and G. mappioides (Bohol) do not appear any different from plants under the nearby forest canopy. Twig diameter, vein number, and apex and base shape may vary within an individual tree depending on age (e.g. Gomphandra oligantha), but reproductively mature material tends to be consistent for these features.

Figure 4.1. Plot of canonical-variates scores for Gomphandra luzoniensis. Group 1 corresponds to Gomphandra luzoniensis subsp. septentrionalis, and Group 2 corresponds to G. luzoniensis subsp. luzoniensis.

Variable-variate correlations (canonical variates) are presented in Table 4.1. Vein number, twig diameter, leaf length, and apex and base shape contributed significantly (≥ |0.24|, r correlation coefficient value with n – 2 degrees of freedom, α = 0.05). The first variate accounted for 100% of the variation, with an eigenvalue of 5.9. 72

Table 4.1. Variable-Variate Correlations for Gomphandra luzoniensis. Significant canonical variates are shown in bold. Variable Canonical Variate 1 Vein number 0.31 Avg. twig diam. -0.32 0º length 0.00 30º length 0.01 60º length 0.07 90º length 0.33 270º length 0.43 300º length 0.15 330º length 0.05 Apex angle 0.65 Base angle 0.62

As a result of the morphological and geographic separation of the northern collections, a new subspecies of Gomphandra luzoniensis was described. The new taxon was not treated as a separate species because there were no differences in reproductive morphology and a few specimens with intermediate morphology were found on the geographic boundary between typical Gomphandra luzoniensis and the northern populations. Gomphandra luzoniensis subsp. luzoniensis is found in Luzon, Palawan, Mindoro, and Panay, while G. luzoniensis subsp. septentrionalis is restricted to the Batanes Islands and Lanyu Island. Gomphandra cumingiana & G. borneensis Many specimens from Borneo were left without identification in Sleumer’s 1969 revision. Much of the material resembled Gomphandra cumingiana, which has been collected throughout Borneo, except the leaves tended to be smaller and their shape was quite variable. Moreover, their ovaries and fruits were glabrous, whereas Gomphandra cumingiana has pubescent ovaries. Although ovary pubescence is not known to vary in other species of Gomphandra, a difference in pubescence alone would not be sufficient to recognize a separate species or subspecies if there were no clear separations in the ranges of variation in other characters. A discriminant analysis was performed to determine whether any other character correlated with ovary pubescence in this complex. 73

Leaves of 53 collections (96 leaves) were measured according to the protocol outlined above. Petiole length was measured to the nearest mm. Twig diameter was measured to the nearest 0.1 mm between two mature leaves along the youngest portion of the twig with Mitutoyo digital calipers. Secondary vein number was recorded, as was ovary pubescence in specimens that had female flowers or fruit. Twenty-eight samples with smaller leaves, slender twigs, and glabrous ovaries were assigned to Group 1, while 21 samples with larger leaves, thicker twigs, and pubescent ovaries were assigned to Group 2. Ovary pubescence was only used in assigning samples to groups. Forty-seven leaves were left unassigned because reproductive material was not present; all leaves were classified into a group by the discriminant analysis. The analysis clearly separated the two groups (Fig. 4.2), though three leaves were incorrectly classified. Two of the leaves belonged to specimens for which other leaves were correctly classified, and one specimen with 8 vein pairs and a pubescent fruit was classified as Group 1 (99% chance). When this specimen was assigned to Group 2 prior to another analysis, it was still classified as Group 1 (78% chance). The discriminant analysis provided support for the conclusion that two similar but distinct species occur in Borneo. Gomphandra cumingiana, with larger leaves and pubescent ovaries, corresponds to Group 2, while the taxon with smaller leaves and glabrous ovaries, which corresponds to Group 1, has been described as G. borneensis.

74

Figure 4.2. Plot of canonical-variates scores for Gomphandra borneensis (Group 1) and G. cumingiana (Group 2).

Variable-variate correlations (canonical variates) are presented in Table 4.2. All variables except 90° length, apex and base angles, petiole length, and twig diameter contributed significantly (≥ |0.37|, r correlation coefficient value with n – 2 degrees of freedom, α = 0.05). The first variate accounted for 100% of the variation, with an eigenvalue of 8.1. 75

Table 4.2. Variable-Variate Correlations for Gomphandra cumingiana & G. borneensis. Significant canonical variates are shown in bold. Variable Canonical Variate 1 0º length -0.56 30º length -0.60 60º length -0.63 90º length -0.30 270º length -0.42 300º length -0.54 330º length -0.56 Apex angle 0.33 Base angle 0.07 Vein number -0.52 Petiole length -0.16 Twig diameter -0.36

Without reproductive material, it is difficult to distinguish certain specimens of Gomphandra cumingiana and G. borneensis, as their leaf morphology can overlap between large-leaved individuals of G. borneensis and small-leaved G. cumingiana. In general, the leaves of Gomphandra borneensis have a long caudate tip, are oblong to obovate, and dry a light brown, whereas the leaves of G. cumingiana are merely acuminate, are ovate, and dry a dark brown. These shape features are reflected in the discriminant analysis, though dried leaf color and the following feature are not because they could not be readily quantified. Specimens of Gomphandra borneensis tend to have many short twigs somewhat irregularly arranged on a larger branch, giving them a scraggly appearance, while specimens of G. cumingiana tend to have a single unbranched twig or a few robust twigs attached to the main twigs. In the field, it may be relatively easy to distinguish the species based on their growth habit. Gomphandra cambodiana and G. mollis Gomphandra cambodiana is a widespread, variable species from Continental Asia. In 1942, Merrill described a new species from material that closely resembled Gomphandra cambodiana. Gomphandra mollis, which has not been widely collected, was distinguished by its large pubescent leaves. To determine whether Gomphandra mollis was in fact a separate species, rather than a persistently pubescent variety of G. 76 cambodiana, data on leaf dimensions, vein number, petiole length, twig diameter, and leaf pubescence (sparse and appressed vs. dense and spreading) were collected from 14 collections (15 leaves) of G. cambodiana and 12 collections (12 leaves) of G. mollis. Gomphandra mollis has been collected from six provinces in Vietnam, while G. cambodiana has been collected from 13, but their distributions appear to overlap in only three provinces (as well as in Yunnan, China). Specimens of Gomphandra mollis examined for the morphometric study came from five provinces, while those of G. cambodiana came from six provinces; both taxa were represented by specimens from two of the shared provinces (Lào Cai and Hà Nội). Smaller leaves that were glabrous or sparsely pubescent below were assigned to Group 1, and larger leaves that were densely pubescent below were assigned to Group 2. A discriminant analysis showed that Gomphandra mollis is morphologically distinct from G. cambodiana (Fig. 4.3). All samples were classified correctly with 99 – 100% accuracy.

Figure 4.3. Canonical-variates scores for Gomphandra cambodiana (Group 1) and G. mollis (Group 2).

77

Variable-variate correlations (canonical variates) are presented in Table 6. Measurements of leaf width and vein number contributed significantly (≥ |0.50|, r correlation coefficient value with n – 2 degrees of freedom, α = 0.05). The first variate accounted for 100% of the variation, with an eigenvalue of 8.8.

Table 4.3. Variable-Variate Correlations for Gomphandra mollis & G. cambodiana. Significant values are shown in bold. Variable Canonical Variate 1 0º length 0.61 30º length 0.64 60º length 0.64 90º length 0.27 270º length 0.41 300º length 0.70 330º length 0.63 Apex angle -0.39 Base angle -0.27 Vein number 0.55 Petiole length 0.24 Twig diameter 0.33

Some specimens of Gomphandra cambodiana have rather large leaves, and the morphology of a few approaches that of G. mollis. However, almost all specimens of Gomphandra mollis can be readily identified by the combination of large leaves, 7 – 10 pairs of secondary veins, and densely pubescent leaves and twigs According to reports of medicinal plant use in Vietnam (Dan & Nhu 1989, Nhu 1990), the tuberous taproot of Gomphandra mollis is used as a digestive remedy while G. cambodiana (whose root structure is undocumented) is not, which indicates the two species might have different chemistries. However, no photographs or vouchers are available to confirm that the specimens identified as Gomphandra mollis in books actually match the type of the species. Regardless, leaf pubescence seems to be a key character for selecting the appropriate plants in Vietnam, and pubescence persistence is a discrete difference between Gomphandra mollis and G. cambodiana. 78

Difficult Groups within Gomphandra Several groups of taxa were initially considered for phenetic analyses, though distinguishing characteristics were found prior to or during data collection, obviating the need for a discriminant analysis or a principal components analysis. Other groups had too few specimens to be analyzed (Gomphandra parviflora varieties, G. montana, G. schoepfiifolia; refer to the Notes section for those species in Chapter 6) or too few specimens with informative characters. Gomphandra cambodiana, for example, has been widely collected, but most specimens do not have mature flowers or fruit, which are likely to be more informative than the highly variable leaves. In Papua, Gomphandra ramuensis may represent more than one taxon, but almost all the specimens from Irian Jaya have immature male inflorescences, so reproductive differences cannot be used to compare them to specimens from Papua New Guinea. In time, increased collections, more field observations, and studies of population genetics may provide evidence for more species of Gomphandra than are currently recognized in the taxa discussed below. Gomphandra quadrifida Material that was previously identified as Gomphandra quadrifida (Sleumer 1969) is now recognized as belonging to four different species, two of which are newly described. Gomphandra quadrifida is characterized by terminal inflorescences, though mature twigs often have very reduced axillary branches that produce terminal inflorescences, so the inflorescences appear axillary. However, scars from previous terminal inflorescences can be found opposite the leaves along the main portions of the twigs. Leaf shape and fruit shape are quite variable within Gomphandra quadrifida, but the male inflorescences are diagnostic, with axes that elongate and bloom multiple times. Gomphandra microcarpa (formerly identified as G. quadrifida var. angustifolia) is superficially similar to narrow-leaved specimens of G. quadrifida, but it is a rheophyte restricted to three states of Peninsular Malaysia. Gomphandra microcarpa is distinguished by its ridged twigs, few-flowered axillary inflorescences, and small fruit. The inflorescence position clearly indicates that it does not belong to Gomphandra quadrifida or to G. tenuis, the other species newly recognized as a separate taxon from G. quadrifida. The geographic distribution of Gomphandra tenuis, combined with 79

differences in twig and peduncle diameter, flower number, and inflorescence structure, provided support for its treatment as a species. Gomphandra tenuis is very likely closely related to G. quadrifida, as they have very similar inflorescence positions, flowers, and fruits, and the two species may hybridize. Specimens with intermediate morphologies are cited as such under Gomphandra quadrifida in Chapter 6. Another species that seems closely related to Gomphandra quadrifida is G. tomentella, which was known from a single collection from Myanmar. Several recent collections from Peninsular Malaysia are now treated as Gomphandra tomentella, on the basis of their pubescent leaves and twigs and their sessile flowers (flowers of G. quadrifida are pedicelled). Female flowers and fruit are unknown for Gomphandra tomentella, so at the moment, pubescence and a lack of pedicels are the features that distinguish the species from G. quadrifida. Gomphandra tetrandra Gomphandra tetrandra was described from the Assam region of northwest India. It also occurs in southern India and Sri Lanka. Sleumer (1969) treated it as a widespread species, ranging from India to southern China, south to the Thai peninsula. In doing so, he failed to recognize that true Gomphandra tetrandra has axillary inflorescences, while most of the specimens he examined have terminal or leaf-opposed inflorescences. Gomphandra tetrandra is a straight-forward species in its current concept. Gomphandra cambodiana complex (including G. pauciflora) Gomphandra cambodiana is in many respects quite similar to G. quadrifida. The inflorescences are leaf-opposed or terminal and similar in structure and flower number. Both species have twigs that are initially pubescent, and their leaf morphologies are quite variable. The leaves tend to dry a darker brown in most specimens of Gomphandra cambodiana, but leaf morphology alone is not always sufficient so distinguish the taxa. Fruit morphology may differ, though mature fruits of Gomphandra cambodiana are lacking in the herbarium record, and photographs indicate that both species have white fruit. The male inflorescences differ, however, as Gomphandra cambodiana does not rebloom the way G. quadrifida does. The geographical distributions of the two taxa meet in Thailand. 80

Certain specimens from Thailand are characterized by very long, slender, many- flowered inflorescences. They are not Gomphandra quadrifida because they do not rebloom, their overall aspect does not fit well into G. cambodiana, and they differ from Thai material that was described as Gomphandra pauciflora. Most specimens originally identified as Gomphandra pauciflora have axillary inflorescences, although they are on twigs that have already bloomed once and a few specimens do have terminal inflorescences. While these “Gomphandra pauciflora” specimens, including some collections from Yunnan, do seem distinctive, the only character that does not overlap with at least some specimens of G. cambodiana is the stamen pubescence. However, the stamen pubescence is shared with the Thai specimens that have slender inflorescences. Neither of these morphologies can be satisfactorily distinguished from Gomphandra cambodiana even though each may represent a different species. Gomphandra cambodiana seems incredibly polymorphic, even in a relatively small geographic area like Hainan. It might represent a taxon that exhibits incomplete speciation, forming a morphological complex. Another possibility is that Gomphandra cambodiana represents a hybrid swarm between G. quadrifida to the south and G. mollis, which is found sympatrically in part of Vietnam. Gomphandra cambodiana shares many characters with both species, and individual specimens can approach the morphology of either species. The specimens from Thailand and Yunnan that have been treated as Gomphandra pauciflora may reflect introgression with G. quadrifida. A number of specimens with odd morphologies have been collected in Thailand, which is the region where Gomphandra quadrifida and G. cambodiana meet. For now, Gomphandra cambodiana is treated as a complex that includes a G. pauciflora morphotype. Field observations and population studies may be the only way to determine relationships within this group. Other taxa A number of other taxa have had their species descriptions emended (Chapter 6) to encompass a wider range of variation within the species. It is difficult to know the true range of variation in a plastic feature like leaf morphology from herbarium specimens alone. Given the age of a plant, or the light conditions, the morphology of newly 81

produced leaves may differ substantially from one season to the next. Juvenile leaves of Gomphandra oligantha scarcely resemble mature leaves from the same tree. Field observations and photographs are invaluable for assessing whether leaf variation represents true differences between taxa. Most species are distinguishable by their flowers and fruit, but reproductive characters are not always available or well- documented. In the Philippines, Gomphandra mappioides was originally described as G. apoensis, but the types of the two names do not represent different species. Philippine Gomphandra mappioides varies only slightly morphologically, though it may be difficult to distinguish vegetative specimens from those of the related species G. psilandra and G. coi. In Indonesia, Gomphandra mappioides is much more variable in leaf size, shape, and texture, with collections from western Flores exhibiting peculiar morphologies. The species may be slowly differentiating on the eastern Indonesian islands were it occurs, even though the Philippine populations are much more morphologically consistent. In Papua New Guinea, Gomphandra papuana occurs in the southern part of the island, in Gulf and Central Provinces. As discussed above, Gomphandra papuana may have had a hybrid origin (once or more than once). The species can be recognized by its appressed pubescence, large leaves, few-flowered inflorescences with pubescent petals, and fruit that do not usually develop a sclerified inner mesocarp and endocarp. Gomphandra sawiensis, which Sleumer described from the northern coast of the island, near the border between Papua New Guinea and Irian Jaya, matches G. papuana in terms of pubescence, inflorescence structure, and fruit. Even though Gomphandra sawiensis and G. papuana are separated by the central highlands, their morphologies are so similar that G. sawiensis is treated as a synonym of G. papuana. The northern material described as Gomphandra sawiensis may represent an independent hybrid origin of the species, or it might be a hybrid between different parent taxa. A few specimens from a limited area in Northern Province could be a different hybrid. The leaves and pubescence are very similar to those of Gomphandra papuana, but the fruits are indistinguishable from those of G. rarinervis. Gomphandra rarinervis has dense, spreading pubescence on its twigs and leaves. Neither Gomphandra rarinervis nor G. papuana has been collected where the 82 intermediate specimens were found. It is not clear whether the specimens represent a hybrid of these two species. It could be a separate species, but population studies, chromosome counts, or molecular data might be needed to understand the relationships among Gomphandra papuana, G. rarinervis, and the intermediate taxon to determine which, if any, is a hybrid. Gomphandra ramuensis is a more widespread species also found in Papua New Guinea and Papua. It is similar to Gomphandra australiana but has different leaf venation and fruits. Most collections identified as Gomphandra ramuensis are not reproductively mature, which can hamper identification. Leaf morphology in the species varies greatly, although most specimens have a prominent reticulation of fine-order veins on the lower leaf surface. No other species of Gomphandra has similar venation, but not all leaves on a single specimen of G. ramuensis necessarily show the venation clearly. Fruit morphology can vary dramatically between specimens that share the venation pattern, so either Gomphandra ramuensis is extremely variable in both its leaf and fruit morphology, or the species includes cryptic taxa which may be described when adequate reproductive material is available. Some specimens treated as Gomphandra ramuensis approach the leaf morphology of G. pseudoprasina, which has thinly coriaceous leaves and widely-spaced veins. If flowers or mature fruits are present, Gomphandra pseudoprasina can readily be distinguished by its pubescent petals and different fruit shape, but in the absence of mature reproductive material, the two species can be difficult to distinguish. Gomphandra melanesiensis is a newly described species that is well-characterized and found throughout the Solomon Islands. Specimens that belong to the species have been collected in the Bismarck Archipelago, although the collections from New Britain, the largest island, are not clearly Gomphandra melanesiensis. Most New Britain collections have damaged or immature leaves and immature fruit, but the collection with mature fruits has fewer inner mesocarp ridges than Gomphandra melanesiensis, suggesting that the collections may be a different taxon. If they do represent a different species, it would have to be newly described. New Britain collections are somewhat similar to Gomphandra australiana, G. ramuensis, and G. pseudoprasina, but they are 83

not any of those species. They are treated as Gomphandra aff. melanesiensis in the revision, and further studies will require more collections with mature flowers and fruits. Unassigned Specimens Ideally, every collection should be assignable to a species. However, incomplete, sterile, or immature collections, and incomplete species descriptions prevent this end from being achieved. I have been unable to assign some specimens of Gomphandra to a species. They may represent new species, or they may be odd or sterile individuals of known species. Rates of endemism are so high in Gomphandra that distribution is often quite useful for correctly identifying a collection, though high endemism also means it is likely that more species are awaiting description. Clades and Phenetic Groupings within Gomphandra For the most part, clades within Gomphandra can only be recognized with molecular data at this time. Few synapomorphies based on morphology are available because of inadequate information about the distribution of these characters in the outgroups. Characters that are informative for Gomphandra may not be present in other families of Aquifoliales, and because generic relationships within Stemonuraceae are unresolved, outgroups within the family cannot be used to establish character polarities in Gomphandra. Even within Gomphandra, the basal species or clade has not been identified, and relationships among the species are not known. Several taxa have been sequenced, and they suggest that inflorescence position may provide a synapomorphy for one clade of Gomphandra (see Chapter 3). Two clades are supported by molecular data. One clade has axillary inflorescences while the other has terminal inflorescences. Outgroup taxa from other genera in Stemonuraceae have axillary inflorescences, so terminal inflorescences can be inferred to be derived. Within the “terminal” clade, three different species have identical trnL-F sequences, and while they are morphological distinct, they share characteristic reproductive features. The inflorescence structure, flower number and size, and fruit shape and color are the same in all the species, and this combination is not seen in other species. Other morphological groups of similar taxa may later be supported as clades by molecular data. The following two groups are supported 84

by molecular and morphological evidence, though their delimitations might change as more species are sequenced. The Gomphandra luzoniensis group is centered in the Philippines. All species share certain leaf shape and venation features; large, many-flowered inflorescences; medium-sized flowers with glabrous petals and ovaries and strongly exserted stamens; and large fruits of the same shape and inner mesocarp ridging pattern. The species can be distinguished morphologically even though their DNA sequences are identical at the examined gene regions (see Chapter 3). Gomphandra luzoniensis is a widespread, abundantly collected species that is known from the islands of Luzon, Palawan, Mindoro, and Panay. A subspecies, Gomphandra luzoniensis subsp. septentrionalis, is found on Batan and Lanyu Islands. Batan is one of the Philippine Batanes Islands, which range from 20°14” N to 21°08” N. Lanyu is off the southeast coast of Taiwan at 22° N. Batan is approximately 200 km north of Luzon and 180 km south of Lanyu. Gomphandra luzoniensis is characterized by terminal inflorescences with three to four degrees of branching, 50 to 100 flowers on male inflorescences, about 20 flowers on female inflorescences, and pink to orangish fruits with about 15 longitudinal ridges. Gomphandra fernandoi occurs in the Visayas in the central part of the country. Its flowers and fruits are very similar to those of Gomphandra luzoniensis, though the fruits have about 12 ridges. The leaves and twigs, however, are persistently pubescent with spreading hairs, and the leaf shape, texture, and venation also differ. Gomphandra ultramafiterrestris is found on Dinagat Island and on the Davao Peninsula of Mindanao. Its leaves are smaller and thicker than those of Gomphandra luzoniensis, its flowers are noticeably dimorphic (males larger and showier than females), and its fruits are approximately half the length of those in both G. luzoniensis and G. fernandoi. Gomphandra oligantha, which is sister to a polytomy of the above taxa, is easily distinguished from all these species by its glabrous, chartaceous leaves, slender, few- flowered inflorescences, and yellow fruits, but it shares the terminal inflorescence position of the other species, and molecular data suggest it is closely related to the Gomphandra luzoniensis group. Gomphandra palustris, which has been found in peat 85

swamps of Sarawak, has a similar inflorescence structure and is likely to belong to this group as well. The Gomphandra mappioides group also has members in the Philippines, though its center might be in Indonesia. The species in this group have very similar leaf morphologies (often indistinguishable among sterile specimens), short axillary inflorescences with relatively few female flowers, and white fruit. Gomphandra mappioides and G. javanica currently appear to be sister species (see Chapter 3). Gomphandra mappioides, which is found throughout the eastern Philippines and eastern Indonesia, has female inflorescences with 4 – 8 flowers on long pedicels. Its stamens range from glabrous to pubescent with papillose hairs. Gomphandra javanica, restricted to Java and Simeulue Island, has somewhat more flowers, pubescent ovaries, and longer hairs on the stamens, but its inflorescence structure is similar to that of G. mappioides. The Gomphandra mappioides – G. javanica clade forms an unresolved polytomy with G. psilandra, G. flavicarpa, and G. australiana, all of which have axillary inflorescences. Gomphandra psilandra, found on the island of Luzon in the Philippines, has very short peduncles and pedicels and glabrous stamens. Gomphandra coi, also from Luzon, is very similar to G. psilandra and only differs in flower number and fruit size, so it is expected to be closely related to G. psilandra. Gomphandra flavicarpa, from Mindanao in the Philippines, has orange fruits. Gomphandra australiana, from Australia and southern Papua, also has orange fruits, but it does not closely resemble G. flavicarpa in other respects. Other species with short axillary inflorescences, like Gomphandra cumingiana and G. borneensis, may belong to the G. mappioides group, though as molecular data become available for more species, concepts of morphological groups are likely to change. The following groups do not yet have any molecular support, but their members share morphological features that may provide evidence for close relationships if some of the features are shown to be derived; for the time being they should be regarded as phenetic groupings. Gomphandra quadrifida, like G. luzoniensis, has terminal inflorescences, but its fruits are a different shape, with fewer, less-prominent ridges, and they are white when ripe. Gomphandra cambodiana has white fruit as well, and is 86 probably closely related to G. quadrifida. Specimens from the area where the two species meet can be difficult to identify unless male inflorescences or mature fruits are present. Gomphandra lamanii, G. tenuis, and G. tomentella are not known as well, but they all share leaf, inflorescence, and/or fruit features with G. quadrifida and are more likely to be close to it than to G. luzoniensis. Molecular studies to date suggest that Gomphandra consists of two clades, one with terminal inflorescences and the other with axillary inflorescences. In Sumatra, Gomphandra quadrifida is the only species with terminal inflorescences. Most of the other species on the island share short axillary inflorescences and leaves with brochidodromous secondary veins that can form an intramarginal vein. Gomphandra fusiformis, G. chimaera, G. dolichocarpa, G. parviflora, and G. jacobsii can be difficult to distinguish without careful examination and fertile material, though the species do not overlap in their distributions. The venation pattern, which is relatively unusual in Gomphandra, suggests that may all be closely related to each other, but this hypothesis has not been tested with molecular data.

87

CHAPTER 5: NEW SPECIES PUBLICATIONS AND NOMENCLATURE Summary Chapter 5 includes four articles that have been submitted or will be submitted to specific journals. The articles are presented in chronological order. The first three describe new species of Gomphandra, and the final article deals with nomenclature and typification in several genera of Stemonuraceae. Article 1 has already been reviewed by the dissertation committee. One additional article is not included in the dissertation: Utteridge, T. M. A. and M. Schori (2009), Stemonurus corrugatus (Stemonuraceae, Icacinaceae s.l.) a new species from Sarawak, Kew Bulletin 64: 327-331. The first author, Dr. Timothy Utteridge, works at Royal Botanic Gardens, Kew. He prepared the article, except for the Latin description, the illustration, and the map, which were done by other people at Kew. I brought the new species to Tim’s attention (at which point he asked me to be his coauthor), suggested the specific epithet, and reworded some portions of the text before it was submitted for review. Latin diagnoses have not been included here because electronic publication is not valid publication according to the current International Code of Botanical Nomenclature. A Latin diagnosis or description is required for valid publication, so the Latin has been omitted here to ensure that this dissertation is not erroneously cited as the place of publication for any new species names. 88

Article 1 – Three new species and a new name in Southeast Asian Gomphandra (Stemonuraceae/Icacinaceae s.l.). Submitted to Blumea and accepted for publication on April 16, 2009. I invited Dr. Timothy Utteridge to be my coauthor in exchange for producing the maps and IUCN statuses for the species. He also had a few comments on the manuscript before it was submitted. Figure numbering for the dissertation has been added in brackets.

Three new species and a new name in Southeast Asian Gomphandra (Stemonuraceae/Icacinaceae s.l.)

Melanie Schori1 & Timothy M. A. Utteridge2

SUMMARY

Three new species of Gomphandra (Stemonuraceae/Icacinaceae s.l.) are described from Malesia, and a new name is proposed for a misidentified species. Gomphandra palustris is known from peat swamp forests in Borneo, Sarawak, G. halconensis is known from the Philippines, Mindoro, Mt. Halcon, and G. conklinii from the Philippines, Ifugao Province, Banaue. Gomphandra rarinervis is offered as a new name for Stemonurus puberulus, which was incorrectly synonymised with G. papuana by Sleumer. This commonly collected taxon is known from Madang and Morobe Provinces in Papua New Guinea and does not overlap in distribution with G. papuana.

Key words: Gomphandra, Icacinaceae s.l., new species, Southeast Asia, Stemonuraceae, Stemonurus.

1) Department of Environmental & Plant Biology, Ohio University, Athens, OH 45701 USA; e-mail: [email protected]. 2) Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, UK. 89

INTRODUCTION

Gomphandra Wall. ex Lindl. is a genus of approximately 50 species of small trees and shrubs distributed from Sri Lanka and India to China, Indo-China, and throughout Southeast Asia to the Solomon Islands. The genus was revised by Sleumer in 1969 prior to its inclusion in Flora Malesiana (Sleumer 1971). Although it was traditionally placed in Icacinaceae, Kårehed (2001) provided evidence that the family is polyphyletic and placed Gomphandra in the segregate family Stemonuraceae. Gomphandra is the largest genus in the family, with 33 species previously recognized (Sleumer 1969) and approximately 20 yet to be described. The genus is characterized by functionally dioecious flowers, a large sessile stigma, and fruit with longitudinal inner mesocarp ridges. Other genera in the family that share these characteristics also have laterally compressed fruit, usually with a fleshy lateral appendage, both of which are absent in Gomphandra. The site of appendage attachment may correspond to a distinctive pair of ridges and grooves flanking a central ridge on one side of the inner mesocarp in Gomphandra, a feature we refer to as a sulcus because the immediate impression is of a groove on the inner mesocarp (Fig. 1 [Fig. 5.1]). The term “pseudohilum” was considered for this feature, but it has already been used to refer to a feature of the seeds of Sapindaceae (Weckerle and Rutishauser 2005). The sulcus is not visible in fresh fruit but can be pronounced on dried mature inner mesocarps, though the ridges vary in prominence depending upon the species. Sleumer (1971) and others referred to the endocarp being ridged, but the ridges represent sclerified bundles of the inner mesocarp.

90

Fig. 1 [Fig. 5.1]. Sulcus. a. The stigma is displaced toward a pair of parallel grooves (emphasized here as thick black lines) divided by a ridge, all of which is here referred to as a sulcus. The longitudinal ribs of the inner mesocarp are visible to either side; b. sulcus in profile. The thick black bars correspond to the thick lines shown in the lateral view. The ridges and grooves of the sulcus are not more prominent than those of the longitudinal ridges in this species (Scale bar = 1 cm; G. luzoniensis, Reynoso et al. PPI 17155).

Many species of Gomphandra have a poor collection record, and a few are known only from the type collection. Ideally, a new species publication would include descriptions of female flowers, male flowers, and mature fruit. However, for the poorly known species of Gomphandra, complete reproductive material is usually lacking. Nonetheless, new species can be described if their morphologies are distinctive enough to preclude confusion with previously described taxa. Two of the species described below were recognized as new by Sleumer (1969), but he did not choose to describe them at the time. Very few additional specimens have been collected since, and it is unlikely that more material will be collected in the future, as all three species described below are probably either extinct or critically endangered by habitat loss.

1. Gomphandra palustris Schori – Fig. 2 [Fig. 5.2]; Map 1 [Fig. 5.3]

Small tree to 25 m high and 40 cm dbh; trunk fluted (to 2 m) or not. Twigs pubescent with minute, somewhat appressed hairs when young, eventually becoming glabrescent, 91

1.5–3.0 mm diam, terminal buds falcate, densely covered with light brown pubescence. Leaves coriaceous, ovate-elliptic to obovate or almost orbicular, frequently conduplicate, apex acute to shortly and abruptly acuminate, base acute, lamina shortly decurrent onto the petiole, margin flat to slightly revolute, glabrous above when mature, sparsely pubescent along the veins below, shining above when dried, matte below, 5.6–13 by 2.6– 6.7 cm; midrib sunken above, raised below, secondary veins 4–6 pairs, impressed above, weakly brochidodromous with the upper pairs joining 1–2 mm from the margin, concolorous above, darker than the leaf surface below and raised, tertiary veins generally not visible above, ± raised below, percurrent and perpendicular to the midrib; petioles grooved, initially tomentellous but glabrescent with age, 1.0–2.5 cm by 1.0–1.6 mm. Inflorescences and flowers not known. Infructescences with up to 5 fruits developing (out of perhaps 12 or more flowers), either terminal on sympodial branches, or axillary, when axillary, most often on the older, naked portion of the twigs, cymose with 2–3 degrees of branching, up to 4 branches borne on a common peduncle to 1.5(–2.0) cm long, branches to 1.2 cm long, fruit sessile or on short pedicels when more than one fruit develops per branch, all axes and calyx with minutely appressed pubescence. Fruit obovate-ellipsoid, widest in upper half, apex and base rounded, 1.9–2.1 by 0.9 cm, glabrous; subtended by persistent calyx 3 mm diam; inner mesocarp with c. 7 strong longitudinal ridges, stigma distinctly eccentric in dried fruit, 3 mm diam, facing away from sulcus. Distribution – Only from Borneo, Sarawak. Habitat & Ecology – Only collected from (peat) swamp forests at low elevations up to 3 m. Field notes – Bark smooth to narrowly longitudinally fissured with a somewhat scabrous surface, gray or pale yellowish gray, inner bark orange. Fruit pinkish white, orangey-pink, or yellowish gray. Notes – Gomphandra palustris is distinguished by its rounded, coriaceous leaves with impressed brochidodromous veins, and its strongly ridged, asymmetrical fruit. It is not similar to any other species in Borneo and is probably most closely related to the Philippine Gomphandra luzoniensis (Merr.) Merr. group, whose members have a similar infructescence structure, fruit size and color. All collections, to date, are female and in 92

fruit from June through October. On specimens with immature fruit, the young ovaries are strongly cylindrical, with no evident asymmetry. This species was mentioned by Anderson (1963) as Gomphandra aff. comosa King, and he cited three additional specimens, which are presumably at SAR: Anderson 3116 and 14502 (2nd Division, Triso P. F.), and Anderson 4189 (4th Division, Sg. Dua); unfortunately, we have been unable to see and verify these collections. Using specimens we have seen to map the distribution, the species is known from peat swamp forests along the northern coast of Sarawak. Following IUCN (2001) guidelines to estimate threat, these collections have a small extent of occurrence (11, 779 km2) suggesting a conservation rating of Vulnerable (VU). However, using satellite imagery, most of the collections (apart from Burley & Lee 353) are now areas of plantation (probably oil palm), and, even with the additional collections we have not seen, a conservation of Endangered (EN B1ab(i, iii, iv)) is more appropriate for this species. Label notes report the vernacular name as Kerak nasi but do not specify in which language.

Specimens examined:

MALAYSIA. Sarawak: 5 km S of Lundu, near Batang Kayan (River), 18 Oct. 1987, Burley & Lee 353 (A, F, K, L, US); Pulau Bruit in centre of island, 16 (or 10) Jun. 1957, Anderson 7914 (K, L); Betong District, Saribas F. R., 12 Aug. 1957, Anderson 8517 (K, L); 3rd Division, Rejang Delta, Lassa Protected Forest, 26 Aug. 1971, Hamdi S.27828 (A, E, K, L, SING n.v.); 3rd Division, Batang Igan, Sungai Tutus Logging Camp, 6 Sept. 1970, Haji Bujang S.30259 (A, K, L).

93

Fig. 2 [Fig. 5.2]. Gomphandra palustris Schori. a. Habit of twig with fruit; b. fruit, sulcus not visible (Scale bar = 1 cm; Haji Bujang S.30259).

Map 1 [Fig. 5.3]. Distribution of G. palustris in Sarawak, Malaysia, Borneo. 94

2. Gomphandra halconensis Schori – Fig. 3 [Fig. 5.4]; Map 2 [Fig. 5.4]

Small tree to 8 m tall and 20 cm dbh. Twigs slender, slightly zigzag, 2.0–2.5 mm diam. Leaves and twigs initially covered with very short, rusty pubescence, quickly glabrescent and apparently glabrous but usually retaining some pubescence on the twigs, petioles, and leaf midribs below (visible under magnification). Leaves coriaceous, lanceolate-elliptic to ovate, mostly oblanceolate-elliptic, apex acuminate to caudate with an acumen c. 7 mm long, sometimes with a short mucro formed by the tip of the midrib, base acute, margins revolute, apparently glabrous, pale yellowish brown when dried, 5.5–9.0 by 2.0–3.5 cm; midrib slightly impressed above, raised below, secondary veins 4–8 pairs, flat or not evident above, scarcely evident below, brochidodromous, intersecondaries common, tertiary veins not evident on mature leaves; petiole grooved, 9–15 by 1.1–1.5 mm. Inflorescences unknown, probably borne on new flushes of growth. Infructescences with 2–5 fruits in a very reduced cyme, axillary, on previous season’s growth, peduncle 1–2 cm long, pedicels 1.5–5.0 mm long, glabrescent. Fruit globose, slightly asymmetrical, glabrous, 1.0–1.3 by 0.8–0.9 cm; subtended by the persistent cupular calyx 2.0–2.5 mm diam; inner mesocarp with c. 12 faint ribs, stigma discoid, c. 2 mm diam, eccentric. Distribution – Endemic to the Philippines, restricted to Mt. Halcon on Mindoro. Habitat & Ecology – On a ridge at 1200 m, in a forest dominated by gymnosperms and Tristania, on gravel/sand, possibly from a quartz base, and from cloud forest at 1350 m. Leaf galls are present on the A and K specimens. According to the Mangyan man who collected the specimen for Ridsdale et al., “bees” pollinated the flowers and birds ate the fruit. Fruit doves or hornbills might be able to swallow the fruit whole, but other birds would be limited to consuming the thin mesocarp. Field notes – Outer bark smooth, brown and greenish, sometimes with short vertical lines of lenticels, inner layer of outer bark green, inner bark cream. Leaves dark green. Fruit yellow-cream to yellowish-orange. 95

Notes – This species is most similar to Gomphandra oligantha Sleumer, but it differs in its coriaceous leaves with a revolute margin, obscure venation, longer petioles, and shorter acumen, and in its thick, shorter peduncle and globose fruit. The herbarium label for Ridsdale et al. 1702 indicates that a duplicate collection was deposited at PNH. The specimen was not found and presumably has not been accessioned yet, so it cannot be designated as the holotype. If it is accessioned in the future, it should be regarded as an isotype. The LBC specimen was not chosen as a holotype because of concerns about the specimen’s long-term conservation. Gomphandra halconensis is known from two fruiting collections from Mt. Halcon. Mt. Halcon is currently closed to all visitors and is now under ancestral lands jurisdiction. According to the Mangyan man who collected Ridsdale et al.’s specimens, only one tree was present in Ramayan village, and the tree has since been cut. Apparently much of the forest on Mt. Halcon has been cut for charcoal production and slash-and-burn agriculture (kaingin), but perhaps this species can still be found on the mountain’s slopes. Following IUCN (2001) guidelines, the limited number of localities and the small area of occupancy (extent of occurrence cannot be calculated for two points), together with known problems of habitat destruction on Mt. Halcon, give a conservation rating of Critically Endangered (CR2ab(iii)). The Mangyan have no common name for Gomphandra halconensis.

Specimens examined:

PHILIPPINES. Oriental Mindoro: Mt. Halcon area near Paitan, Dulangan River, Ramayan village, c. 13° 12’ N, 121° 12’ E, 8 May 1986, Ridsdale, Coode & Reynoso 1702 (A, K, L, LBC, PNH non inveni); Ramayan to Mustning, Mt. Halcon complex above Paitan on Dulangan River, 10 May 1986, Coode & Ridsdale 5757 (K, L). 96

Fig. 3 [Fig. 5.4]. Gomphandra halconensis Schori. a. Habit of twig with fruit; b. leaf, adaxial surface; c. leaf, abaxial surface; d. fruit in lateral view, sulcus at center; e. fruit in apical view, sulcus at bottom (Scale bar = 1 cm; a-b, d-e: Ridsdale, Coode & Reynoso 1702; c: Coode & Ridsdale 5757).

Map 2 [Fig. 5.5]. Distributions of Gomphandra halconensis (■) in Mindoro and G. conklinii (▲) in Luzon, Philippines. 97

3. Gomphandra conklinii Schori – Fig. 4 [Fig. 5.6]; Map 2 [Fig. 5.5]

Shrub or small, slender tree to 8 m tall and 20 cm dbh. Twigs slender, almost straight, with minute appressed hairs near the apex, glabrescent, 1–2 mm diam, terminal buds small, falcate, rusty pubescent. Leaves coriaceous, ovate to elliptic, often conduplicate, apex acuminate, base rounded to tapered, often slightly asymmetrical, glabrous or with sparse pubescence below on the veins, drying brown on both sides, 4.4–13.0 by 2.2–4.0 cm; midrib sunken above, raised below, extending to tip, secondary venation highly variable, 1–5 pairs, somewhat obscure above, raised below, acrodromous to weakly brochidodromous with lowest pairs converging toward margin and upper pairs joining 1– 2 mm from margin, tertiary veins not visible above, raised and distinctly percurrent below; petioles c. 0.5 cm long by 1.0-1.5 mm wide, grooved, glabrescent. Male inflorescences unknown. Female inflorescences 6- or 7-flowered in an axillary reduced cyme on previous season’s growth, to 2 cm long when mature, peduncle 0.5–0.7 cm long, with up to 5 branches, branches either serving as pedicels or bearing 2 or 3 flowers on pedicels 2 mm long, peduncle and pedicels pubescent. Female flowers: calyx cupular, articulated at base, margin with minute teeth or ciliate, very sparsely pubescent to glabrous, 2–3 mm across, 1–2 mm high; petals 4(or 5?), with very fine white hairs appressed along midveins or at petal apex on outside of buds, buds 3–4 mm long; staminodes glabrous (not seen at maturity); ovary cylindrical, glabrous, 4 by 2 mm, stigma apical, 2 mm wide, 5-lobed, edges undulate, capping ovary & slightly wider than it. Fruit oblong to obovoid, apex rounded, base swollen, 2.2–3.1 by 0.9 cm; inner mesocarp with c. 10–11 low ridges, stigma 2.5 mm diam, displaced toward sulcus. Distribution – Ifugao Province, Luzon, Philippines. Habitat & Ecology – On ridge at 1705 m, on clay loam in secondary disturbed forest and slightly disturbed gully forest. Field Notes – Leaves glossy above and dull and paler below, midrib yellowish. Fruit yellowish or slightly pink (both specimens with submature fruit). 98

Notes – Gomphandra conklinii is distinguished by its relatively small, coriaceous leaves with irregular venation and by its fruits, which are the largest of any Gomphandra in the Philippines. PPI collectors (12920) did not see ripe fruit but reported that the fruit are purple when ripe. This anecdote is somewhat doubtful, given the fruit colours that are reported for other collections of this species, and considering that all observations of ripe fruit in other species of Gomphandra list the colour as white, ivory, yellow, pink, salmon, or red. Based on herbarium records, this species blooms in September and fruits from March to July. Gomphandra conklinii was first collected in 1961 and has been found as recently as 1994. While Ifugao Province has retained its forested areas and in fact has more forest now than it did when Conklin collected this species, much of the forest is highly degraded. The 1990s collection sites have been extensively cut or converted to agriculture and then abandoned to grassland. The local forester in Banaue did not recognize photos of herbarium specimens of this species. There are also reports that previously common species have become very scarce or even extirpated in the past generation, presumably as a result of overharvesting. Applying IUCN (2001) standards, especially the geographic range which is extremely small (e.g., area of occupancy is only 4 km2), and taking into account forest degradation, this species is Critically Endangered (CRB2ab(iii)). Conklin’s collector, Ballogan (Banlugan is a spelling variation), reported the Ifugao common name “halipan” for this species and said that the branches were used as a supplement to betel nuts. However, in 2007, when the first author visited Banaue, “hali- pon” referred exclusively to Ficus spp., and no one could recall using twigs of any plant along with betel nuts. Mr. Ballogan said that while collecting for Conklin, he would ask locally about common names, and a common name was reported on the herbarium label if three people gave the same identification. On his own collection, Conklin reported “lungi” as a common name and said that the timber was used for house construction. This use is much more in line with other reports of economic uses of Gomphandra, but we have not had an opportunity to search for this species under this other common name. 99

Etymology – The specific epithet honors Harold C. Conklin, an anthropologist at Yale University’s Peabody Museum, who first collected this species as part of his research for what became the Ethnographic Atlas of Ifugao. Specimens examined:

PHILIPPINES. Ifugao: Banaue, Barangay Dalikan, Mt. Bukung, 30 July 1992, Reynoso, Sagcal & Garcia PPI 6987 (CAHUP, L, PNH, US, 2 other duplicates, n.v.); Barangay Batad, Mt. Borbor, 1705 m (16° 56.0’ N, 121° 09.8’ E), 6 Apr. 1994, Barbon et al. PPI 12920 (L, PNH, 3 other duplicates, n.v.); Banaue, Amganad, 11 Sept. 1961, Banlugan et al. PNH 72486 (A, L, PNH); Banaue, Bayninan, steep slope, 1525 m [5000 ft.], 6 Mar. 1963, Conklin & Buwaya 79571 (K, L).

Fig. 4 [Fig. 5.6]. Gomphandra conklinii Schori. a. Habit of twig with buds and female flowers (petals and staminodes caducous); b. larger leaf, abaxial surface; c. dissected bud showing ovary and staminodes; d. outline of outer mesocarp of a fresh fruit surrounding the inner mesocarp; e. fruit in lateral view, sulcus at center (a: Banlugan et al. PNH 72486; b: Conklin & Buwaya PNH 79571; c, d: Reynoso et al. PPI 6987). 100

4. Gomphandra rarinervis Schori – Fig. 5 [Fig. 5.7]; Map 3 [Fig. 5.8] Stemonurus puberulus K. Schum. & Lauterb., Fl. Schutzgeb.: 414 (1900), haud Gomphandra puberula Ridl. 142 (1915). – Type: Lauterbach 2204 (B†; lectotype WRSL! photo, isolectotype L!), Papua New Guinea, Madang Province, Astrolabe Plain near Erima Village.

Small tree to 15 m high and 32 cm dbh. Twigs usually zigzag, with spreading tawny to light brown pubescence, 2.5–3.0 mm diam, terminal buds falcate, densely pubescent. Leaves chartaceous to thinly coriaceous, ovate, often somewhat asymmetrical, widest at or just below the middle, apex abruptly and shortly acuminate, base tapered, velutinous below, glabrescent above, (12–)18–26 by (6–)10–13.5 cm; midrib sunken above, raised below, secondary veins 6–8 pairs, flat to slightly raised above, raised below, widely spaced (upper veins 1-3 cm apart), converging towards margin and upper few pairs ± brochidodromous, tertiary veins obscure above, flat to slightly raised below, percurrent and perpendicular to the midrib; petiole 0.8–1.1 cm by 2.0–2.6 mm. Inflorescences axillary, 1 or 2 per axil, from older leafy or leafless portion of twigs. Male inflorescences with up to c. 12 flowers, to 2 cm long, peduncle to 0.5 cm long, usually bearing 2 branches, flowers crowded, sessile or on pedicels 1–3 mm long. Male flowers: calyx pubescent, entire to slightly toothed, cupular, 4–5 mm diam; petals 5, upper half of corolla pubescent abaxially, 5–6 mm long; stamens white, exserted, 8 mm long, filaments pubescent with short clavate hairs on both sides; ovary rudiment ovoid, apex acute, with a few hairs. Female inflorescences 1- or 2-(or -3)- flowered, to 1.6 cm long, peduncle short, to 0.6 cm long, pedicels 0.4–0.6 cm long, axes densely pubescent with spreading hairs. Female flowers incompletely known, calyx pubescent, evidently entire, cupular, 4– 5 mm diam; ovary 4–5 mm long, sparsely pubescent, glabrescent, stigma lobed and ridged, 3.0-3.5 mm diam. Fruit ovoid to obovoid, somewhat asymmetrical, apex curved and prominently beaked, 3-4 by 1.5-1.7 cm; stigma displaced toward sulcus, inner mesocarp with c. 8 sharp, prominent ridges. 101

Distribution – East Sepik, Madang, and Morobe Provinces, Papua New Guinea. Habitat & Ecology – Primary and secondary rain forest, lower montane Castanopsis forest zone, lowland rain forest dominated by Anisoptera, tall alluvial forest and flood plain forest, on steep to moderate slopes, along streams, in riverine swamp forest, at forest edges, in a limestone area and on ultrabasic alluvial soil, and in disturbed forest on flat, well-drained land, 5–500 m elevation. Field Notes – Bark gray, gray-green, greenish brown, smooth or with pustular lenticels. Leaves dark to medium green and matte or shiny above, paler or yellow green and matte below. Calyx (male flowers) green, petals light green. Fruit reportedly yellow or orange when ripe (no collections of ripe fruit). Notes – Gomphandra rarinervis is one of the most easily recognized Gomphandra species in New Guinea, with large leaves, widely spaced veins, a long, prominently ribbed drupe, and spreading pubescence on both the twigs and leaves. This species has most often been identified as Gomphandra papuana (Becc.) Sleumer, or less frequently as G. montana (Schellenb.) Sleumer. Gomphandra rarinervis has been collected from the northern part of Papua New Guinea, and it does not appear to overlap in distribution with G. papuana, which occurs in Irian Jaya, Western, Gulf, Chimbu, Central, and Northern Provinces, with a disjunct population in West Sepik Province near Vanimo. Gomphandra papuana has similar leaves, but the pubescence on the leaves and twigs is very tightly appressed, and while the fruits are a similar size, the inner mesocarp seldom develops, so no ribs are evident, the stigma is much smoother, and the epicarp has a granular texture. Gomphandra montana was described from East Sepik Province, and unfortunately all the fruiting syntypes appear to have been destroyed at B, but the male specimens have much smaller leaves with close parallel veins, and a long-peduncled inflorescence that is multiply branched. Material from Central Province, originally described as Gomphandra carrii Sleumer, probably belongs to G. montana. The fruits are up to 3 cm long (matching Schellenberg’s description), but they lack the beak of Gomphandra rarinervis, have more numerous and less prominent ridges, and are borne on a long-peduncled, multiply branched infructescence. 102

Gomphandra rarinervis matches type material of Stemonurus puberulus, but the epithet “puberula” was used in Gomphandra by Ridley (1915), so a replacement name is needed. The epithet “rarinervis” has been chosen in reference to the widely spaced veins on the leaves. The syntypes of Stemonurus puberulus were at B, and Sleumer inappropriately designated Lauterbach 2204 as a lectotype in 1969, after the specimen had been destroyed. The other specimen cited in the protologue of Stemonurus puberulus, Lauterbach 2483, evidently did not have any duplicates. WRSL has a duplicate of the Lauterbach 2204 specimen, which is here designated as the lectotype. A fragment at Leiden (ex WRSL) has the status of an isolectotype. To date, Gomphandra rarinervis has been collected from 22 localities in Morobe and Madang Provinces and is given a conservation rating of Least Concern (LC) using IUCN (2001) guidelines. However, the extent of occurrence (39241 km2) is large, and above any of the IUCN threat thresholds, because of a couple of ‘outlier’ collections (especially Robbins 2033b, but also Kiapranis et al. LAE 87104). If either of these localities no longer held viable habitat for Gomphandra rarinervis then a rating of Near Threatened (NT) is more appropriate.

Specimens examined:

PAPUA NEW GUINEA. East Sepik: Robbins 2033b (CANB). Madang: Regalado & Katik 1116 (BISH, F, L, MO); Simaga 1813 (A n.v., CANB (3 sheets), K, L ([2 sheets), LAE n.v.); Lauterbach 2204 (L, WRSL n.v.); Hoogland 5076 (A, BRI, L); Schlechter 17021 (A, B†, L, P, UC); Henty NGF 28033 (A, BO n.v., BRI n.v., CANB, K, L, PNH, SING n.v., SYD n.v., UH n.v.); Kiapranis et al. LAE 87104 (K, L, US). Morobe: Lovave 129 (A n.v., BRIT n.v., CANB, K non inveni, L); Rau 542 (K, L (2 sheets)); Womersley NGF 3203 (A, BRI, CANB); Okada & Katik 4324 (BRI, KYO n.v., LAE n.v., U n.v.); Takeuchi & David 5935 (A, BISH, CANB, K (2 sheets), L); Takeuchi & David 6963 (A, BISH, CANB, L); Hartley 10282 (A, BRI, CANB, K, L); Hartley 10282 A (BRI, CANB); Hartley 11037 (CANB, K, L); Millar NGF 12225 (A, K, L); Henty NGF 12407 (CANB, K, L, PNH, SING); Takeuchi & Ama 16229 (A, CANB (2 sheets), K, L); Takeuchi & Ama 17110 (A, L); Gillison NGF 22260 (A n.v., BO n.v., BRI n.v., CANB, 103

K, L, PNH n.v., SING n.v., SYD n.v., UH n.v.); Streimann NGF 24342 (A n.v., BO n.v., BRI n.v., CANB, K, L); Ridsdale NGF 31689 (A, BO n.v., BRI n.v., CANB n.v., K non inveni, L); Womersley NGF 37107 (CANB, K (2 sheets), L (2 sheets)); Katik NGF 46772 (A, BISH n.v., BO n.v., BRI, CANB, K, L, PNH n.v., SING n.v., SYD n.v., US); Katik & Larivita LAE 62056 (A, BISH, BRI (2 sheets), CANB, E, K, L, PNH n.v., SYD n.v., US); Kerenga et al. LAE 73883 (A, BISH, BRI, CANB, E, K, L, MO, NSW n.v., UPNG n.v., US); Lovave LAE 82339 (A, K, L); Bau LAE 82612 (A n.v., CANB, E, K, L (2 sheets), NSW n.v., PNH n.v., UPNG n.v., US); Bau LAE 82682 (K n.v., L (2 sheets)). 104

Fig. 5 [Fig. 5.7]. Gomphandra rarinervis Schori. a. Habit of twig with fruit; b. spreading pubescence on twig; c. male inflorescence; d. male flower, showing pubescence on calyx, petals, and stamens; e. rudiment of ovary with few apical hairs (scars at base from detached stamens); f. stamen with clavate hairs (a-b: Kerenga et al. LAE 73883 (leaves and twig), Bau LAE 82612 (terminal bud), Katik NGF 46772 (fruit); c-f: Hoogland 5076). 105

Map 3 [Fig. 5.8]. Distribution of Gomphandra rarinervis in Papua New Guinea.

ACKNOWLEDGEMENTS

Thanks to the curators of the following herbaria for loans of specimens and assistance during visits: A, BISH, BRI, CAHUP, CANB, E, F, K, L, LBC, PNH, US. Thanks to Dr. Neil Bernstein (Ohio University) for his help with the Latin diagnoses, Dr. Stefan Gleissberg (Ohio University) for a German translation, Dr. Wolfgang Stuppy (Kew) for fruit morphology advice, and to Jaap J. Vermeulen (Leiden) and Melissa Haviland (Ohio University) for advice on illustrations. The National Commission on Indigenous Peoples office in Calapan, Mindoro, and the Mangyan assisted with inquiries about Mt. Halcon. Drs. Philip D. Cantino and Harvey E. Ballard, Jr. provided valuable feedback on the manuscript, and an anonymous reviewer suggested changes that have improved the manuscript. This research was funded in part by a J. William Fulbright grant to the first author for field work in the Philippines. 106

REFERENCES

Anderson JAR. 1963. A catalog of the flora of the peat swamp forests of Sarawak and Brunei including all recorded species of flowering plants, ferns and fern allies. The Gardens’ Bulletin, Singapore 20: 166. IUCN. 2001. IUCN red list categories and criteria. Ver. 3.1. Gland, Switzerland and Cambridge, UK: IUCN. Kårehed J. 2001. Multiple origin of the tropical forest tree family Icacinaceae. American Journal of Botany 88: 2259-2274. Ridley HN. 1915. XIII. The botany of Gunong Tahan, Panang. Journal of the Federated Malay States Museums 6: 142. Schumann K. 1900. Die Flora der Deutschen Schutzgebiete in der Südsee. Gebruder Borntraeger, Leipzig. Sleumer HO. 1969. Materials towards the knowledge of the Icacinaceae of Asia, Malesia, and adjacent areas. Blumea 17: 181-264. Sleumer HO. 1971. Icacinaceae. Flora Malesiana Series 1. 7 (1): 1-63. Noordhoff-Kolff, Djakarta. Weckerle CS, Rutishauser R. 2005. Gynoecium, fruit and seed structure of Paullinieae (Sapindaceae). Botanical Journal of the Linnean Society 147: 159-189.

107

Article 2 – Nine new species and two new subspecies of Gomphandra (Stemonuraceae) from Malesia and Melanesia. Formatted for Kew Bulletin (2010 submission). Dr. Timothy Utteridge is again a coauthor and is contributing the maps and IUCN statuses. He was also included as an author of Gomphandra fernandoi and G. luzoniensis subsp. septentrionalis, as he had started to describe them as new species before he learned I was working on a revision of the genus.

Nine new species and two new subspecies of Gomphandra (Stemonuraceae) from Malesia and Melanesia

Melanie Schori1 and Timothy M. A. Utteridge2

Summary. Nine new species of Gomphandra are described. Gomphandra fernandoi occurs in the eastern Visayan region of the Philippines, G. bracteata is restricted to southern Palawan, G. engganensis is endemic to Enggano Island off the coast of Sumatra, and G. longipedunculata and G. macrosperma are known from Sarawak and Sabah, respectively, in Borneo. Three new species, Gomphandra angustata, G. muscosa and G. subcordata, are from Papua New Guinea, and G. melanesiensis is found throughout the eastern islands of Papua New Guinea and the Solomon Islands. Two subspecies, Gomphandra luzoniensis subsp. septentrionalis from the northern Philippines and Taiwan, and G. melanesiensis subsp. macrocarpa from the Solomon Islands and Rotuma, are distinguished.

Key words. Gomphandra, Icacinaceae s.l., Malesia, Melanesia, Stemonuraceae

1 Department of Environmental & Plant Biology, 411 Porter Hall, Ohio University, Athens, OH 45701, USA; email: [email protected]; 2 Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, UK. 108

Introduction

Gomphandra Wall. ex Lindl. is a genus of understory trees and shrubs in the Stemonuraceae (Icacinaceae s.l.). The genus is restricted to the Old World tropics and is found from Sri Lanka to Taiwan, south to Australia and the Fijian island of Rotuma. Recent research by the first author has shown diversity in Gomphandra to be much higher than the previously recognised 33 species, most of which were included in Flora Malesiana (Sleumer 1971). A few of the species described here were acknowledged as unnamed species by Sleumer (1969).

Gomphandra engganensis Schori

Small tree. Twigs slightly zigzag, younger portions 2 – 3 mm in diam., older portions to 5 mm, glabrescent. Terminal buds small, pubescence tightly appressed. Leaves large, chartaceous, pale green when fresh, initially pubescent but quickly glabrescent, ovate, base acute, apex shortly acute to acuminate, (14 – ) 18 – 22 ( – 26) × (6.5 – ) 8 – 11 ( – 13) cm, midrib sunken above, raised below, secondary veins 5 – 9 pairs, ± parallel, upper ones joining near the margin, tertiary veins distinctly and delicately percurrent; petiole 1.5 – 2 cm long, narrowly grooved above, with a few sparse hairs. Male inflorescences unknown. Female inflorescences axillary on older growth, presumably short and bearing 1 – 2 flowers. Female flowers not seen. Infructescence with peduncle short, 2 – 4 mm long, pedicels to 6 mm long. Fruit not seen in mature state, immature fruit evidently glabrous, at least 1.4 × 0.7 cm, base tapered, stigma 5-lobed, 1.7 – 2.2 mm across, displaced to one side. Fig. 1 [Fig. 5.9].

DISTRIBUTION. Indonesia: Sumatra, Enggano Island. Endemic. Map 1 [Fig. 5.10]. SPECIMENS EXAMINED. INDONESIA. Enggano Island sw of Sumatra, [Bengkulu Province], Boea boea [Bua-Bua], ± 100 m, imm. fr., 2 June 1936, Lutjeharms 4108 (L! holotype; A!, BO, K! [2 sheets], P! isotypes); Malakoni, small tree in forest, 21 June 109

1936, Lutjeharms 4933 (A!, BO, K!, L!, P!); Lutjeharms 4931 (cited by Sleumer (1969), BO?, n.v.). HABITAT. Presumably from lowland rainforest near 100 m elevation. Bua-bua, the highest part of Enggano, reaches 250 m. VERNACULAR NAMES. The common name in Bua-bua was medang poentoen in Malay Palembang, while it was tjemetek in Malakoni. CONSERVATION STATUS. Endangered: EN B2ab(iii), based on IUCN (2001) guidelines. Gomphandra engganensis is only known from two localities in on Enggano Island, which has an area of approximately 500 km2. Any individuals still present on the island would be seriously threatened by forest degradation. If the species is not extinct, a conservation status of Critically Endangered may be more appropriate, but a survey of the island would be required to determine the current population extent of the species. NOTES. Gomphandra engganensis is superficially similar to G. simalurensis Sleumer, which is found on Simeulue Island in the Mentawi group. Both species have large leaves, but they are quite different in inflorescence structure and fruit. Gomphandra simalurensis has much longer peduncles, many more flowers, and a pubescent fruit with a somewhat flattened, unlobed stigma that is creased down the middle. Gomphandra engganensis may be more closely related to G. javanica subsp. pseudojavanica (Sleumer) Schori, also of Simeulue Island, which has much smaller, narrower leaves, but which also has relatively small, few-flowered female inflorescences and a raised, lobed stigma. However, Gomphandra javanica subsp. pseudojavanica has persistently pubescent leaves, a longer peduncle, more flowers, and pubescent ovaries. Sleumer (1969) reported three collections from Enggano: Lutjeharms 4108, 4931, and 4933. No specimen with the number 4931 was found at L, K, or P, though a specimen may be deposited at BO. Evidently this species has not been collected since 1936 and may be extinct. 110

Fig. 1 [Fig. 5.9]. Gomphandra engganensis (Lutjeharms 4108; scale bar = 1 cm). 111

Map 1 [Fig. 5.10] Distribution of Gomphandra engganensis (▲) on Enggano Island.

Gomphandra bracteata Schori

Small tree 3 – 6 m high, 5 – 11 cm in diam. Twigs (1.5 – ) 2 – 3 mm in diam., straight to slightly zigzag, initially sparsely pubescent with minute appressed hairs, quickly glabrescent. Leaves lanceolate-ovate, ovate, or obovate, shining above, coriaceous, glabrous at maturity, apex abruptly acuminate or caudate, base acute to rounded, (8.5 – ) 10 – 18 × 3 – 6 ( – 7.5) cm, margin revolute; midrib sunken above, raised below, secondary veins 4 – 6 pairs, flat, sunken, or obscure above, raised below, veins parallel, upper pairs joining near margin, tertiary veins not visible above, flat to slightly raised or obscure below, weakly percurrent; petiole glabrescent, narrowly grooved, (0.6 – ) 1 – 2.2 cm long. Male inflorescences evidently axillary on recent growth, also pseudoterminal (from axillary buds), often from accessory buds, 1 – 2 per axil, peduncle slender, 1 – 2 cm long, bearing 1 – 2 branches, one branch evidently in the axil of a bract or small, caducous leaf, branches up to 1 cm long, flowers sessile or borne on short pedicels, flowers up to 10 per inflorescence. Male flowers only known from buds, calyx sparsely ciliate, cupular, 2 – 2.5 mm across, with 4 small teeth, petals 4, white, glabrous, 4 mm long in bud, stamens 4, glabrous, mature length not known, ovary rudiment cylindrical, glabrous. Female inflorescences axillary, solitary, peduncle 0.5 – 1.2 cm long, bearing a single terminal flower. Female flower: calyx 2 mm across, margin with minute teeth, sparsely ciliate; petals and staminodes not seen; ovary 3 mm long, glabrous or with a few 112 caducous hairs, stigma 1 mm in diam. Infructescences axillary, bearing 1 fruit on a peduncle 1.3 – 2 cm long, with 1 or 2 minute persistent bracts. Fruit submature, ovoid, slightly asymmetrical, 1.5 × 0.6 – 0.7 cm, faintly ridged, glabrous, punctate, stigma grooved, 2 mm across. Fig. 2 [Fig. 5.11].

DISTRIBUTION. Philippines: Palawan, Mt Gantung area. Endemic. Map 2 [Fig. 5.12]. SPECIMENS EXAMINED. PHILIPPINES. Palawan. Palawan Province. Tindogan District, Mantalingajan Mountain Range, Mt Gantung, headwaters of Tagwaya River, 8°59.0’ N, 117°49.0’ E, 700 m, ♂ buds, 17 Aug. 1996, Pipoly et al. PPI 37833 (MO!, 9 other duplicates n.v.); Mt Gantung, imm. fr., 18 Aug. 1996, Pipoly & Romero PPI 37925 (PNH! holotype; A!, BRI!, BRIT!, K!, L!, MO!, US! isotypes); Quezon municipality, Barangay Bundog, Sumindap River, tributary of Kinlugan River, 9°02.0’ N, 117°48.0’ E, 250 m, ♂ inflo., 22 Aug 1996, Pipoly et al. PPI 38256 (GH!, PNH! [2 sheets], 9 other duplicates, n.v.). HABITAT. Collected in lowland primary forest on steep ultramafic soils and in swamp forest on lateritic soil; 250 – 700 m. CONSERVATION STATUS. Critically Endangered: CR B2b(iii,v), based on IUCN (2001) guidelines. Gomphandra bracteata is only known from Mt. Gantung, and the estimated area of occurrence is approximately 6 km2. The species is known from three individuals, and although the population is likely to be larger, satellite images show extensive deforestation on the lower slopes of Mt. Gantung. Gomphandra is often cut because its straight bole makes it useful for poles and beams, and as deforestation continues, reproductive individuals will be cut even though they are not used for timber. PHENOLOGY. Flowers in August and September. ETYMOLOGY. The specific epithet refers to the small, caducous leaf that is present in male inflorescences. Although the inflorescences are borne in leaf axils and appear axillary, they represent a branch (the “peduncle” in the above description) which bears one leaf, a terminal inflorescence, and an axillary inflorescence in the leaf axil. The leaf at the apex of the “peduncle” resembles a bract. 113

NOTES. Gomphandra bracteata was first collected in 1996 and is only known from three collections. The species is distinguished by its coriaceous leaves with few veins and an acuminate to caudate apex, its solitary female flowers and fruits, and by the few- flowered male inflorescences that sometimes bear a small leaf. In inflorescence structure, Gomphandra bracteata is most similar to G. oligantha Sleumer, which also has few- flowered inflorescences on relatively long, slender peduncles. However, the size and texture of the leaves is more like that of Gomphandra luzoniensis (Merr.) Merr., which also occurs in Palawan, or G. palustris Schori (Schori & Utteridge, in press), which is found to the south in western Sarawak.

Fig. 2 [Fig. 5.11]. Gomphandra bracteata. A. Twig showing male inflorescences (Pipoly et al. PPI 37833; scale bar = 1 cm); B. Leaf variation (Pipoly & Romero PPI 37925; scale bar = 1 cm); C. Male flower, petals and calyx, stamens and ovary rudiment (Pipoly et al. PPI 38256; scale bar = 3 mm). 114

Map 2 [Fig. 5.12]. Distribution of Gomphandra bracteata (▲) in Palawan.

Gomphandra fernandoi Schori & Utteridge

Small tree to 20 m and 15 cm in diam. Bark smooth, light brown to grey, with prominent branch scars from self-pruning of lower limbs. Branches held horizontally, young twigs green to dark brown or black (from fungal smut) when fresh, 2 – 3 mm in diam., pubescence tawny, spreading. Leaves variable with age of plant, on saplings lance-elliptic to ovate-elliptic and only thinly coriaceous, on mature trees ovate-elliptic to obovate or rounded-ovate, coriaceous, medium glossy green and glabrous above when fresh, usually drying somewhat shiny, paler green and dull below when fresh, persistently pubescent with tawny spreading hairs, eventually somewhat glabrescent on some leaves, apex acuminate, base rounded-acute, 11 – 20.5 × (4 – ) 5 – 7 ( – 9.5) cm; midrib sunken above, raised below, secondary veins flat or impressed above, raised below, 4 – 6 pairs, parallel or somewhat converging, often joining (brochidodromous) near the margins, tertiary veins flat above, delicately but distinctly percurrent below; petiole grooved above, pubescent, 1.0 – 2.4 cm × 1.3 – 1.7 mm. Inflorescences terminal on sympodial branches, on newest flush of growth, leaving prominent scars opposite leaves on older portions of twigs. Male inflorescences with 3 – 4 ( – 5) orders of branching, common peduncle 0.4 – 115

3.5 cm long, 3 – 4 primary branches, 0.9 – 1.9 cm long, each bearing up to 3 secondary branches which are branched (sometimes multiply) or not, bearing sessile or subsessile flowers in a scorpioid cyme, often with 100 or more flowers; all axes pubescent. Male flowers white and sweetly scented (fide Sulit PNH 21575), calyx cupular, 1.5 mm high, minutely 5-lobed, sparsely pubescent, petals 5, glabrous at anthesis, 4 – 5 mm long, stamens exserted, 5 – 6 mm long, bearing a tuft of clavate hairs dorsally at the anthers, and usually with at least a few scattered clavate hairs ventrally below the anthers, ovary rudiment glabrous. Female inflorescences an open cyme with 3 – 4 orders of branching and up to ca. 30 flowers, common peduncle 1.4 – 2.0 cm, bearing 3 – 5 branches 0.6 – 1.6 cm long, these unbranched or with 2 – 3 branches which may branch again, each terminal branch (often resembling pedicels) with one to several sessile to very shortly pedicelled flowers. Female flowers: calyx cupular, sparsely pubescent to glabrescent, with 5 minute teeth but tearing irregularly as ovary enlarges, 3 mm across, petals 5, glabrous, 5 mm long, staminodes equaling the petals or perhaps exserted, bearing a tuft of penicillate hairs at the connective, and with a few scattered clavate hairs ventrally below the anther cells, ovary glabrous, 4 mm long and capped by a ridged stigma 1 mm high, maturing ovary (one to several months after anthesis) light green and punctate, obovoid, with a yellowish-brown stigma. Fruit ellipsoid, 1.8 – 2.2 × 0.8 – 1.1 cm, stigma slightly displaced toward sulcus, 3 – 4 mm in diam., inner mesocarp with ca. 12 low, anastomosing longitudinal ribs. Fig. 3 [Fig. 5.13].

DISTRIBUTION. Philippines: Leyte, Samar, Biliran, Dinagat. Endemic to the eastern Visayas of the Philippines. Map 3 [Fig. 5.14]. 116

Fig. 3 [Fig. 5.13]. Gomphandra fernandoi. A. Twig with young female fruits (Sulit PNH 14592 & Sulit PNH 14345; scale bar = 1 cm); B. Mature fruit (Sulit PNH 14592; scale bar = 1 cm); C. Male flower (Sulit PNH 21575; scale bar = 5 mm); D. Juvenile leaf (Fernando & Schori 1893; scale bar = 1 cm).

SPECIMENS EXAMINED. PHILIPPINES. Samar. Northern Samar Province. Catarman, Lope de Vega, Mt Cansayao, 200 m, buds, fr., 3 April 1951, Sulit PNH 14345 (A!, K!, L! [2 sheets], PNH!, US!); ibid, fr., 7 May 1951, Sulit PNH 14592 (A!, K!, L!, US!). Western Samar Province. Paranas, Campo Uno [11°58.2’ N, 124°43.0’E], 400 m, ♂ fl., 1 May 1996, Reynoso & Majaducon PPI 21977 (PNH! [2 sheets] holotype; A!, K!, L!, MO! isotypes). Eastern Samar Province. Balangiga, Barangay [Poblacion] 1, Sitio Cantinoc, east of Forestry Station, [11°07’ N, 125°23.30’E], 150 m, imm. fr., 21 Aug. 1996, Gaerlan & Chavez PPI 26379 (K!, PNH!); Balangiga, Barangay [Poblacion] 1, Busong-busong, [11°07’N, 125°23.30’E], 300 m, imm. fr., 23 Aug. 1996, Gaerlan & Chavez PPI 26482 (K! [2 sheets], L! [2 sheets]); Balangiga, Barangay Guinmaayohan, imm. fr., May 1971, Madulid et al. PNH 118383 (L!). Biliran. Biliran Province. Mt Suiro, 530 m, ♂ fl., 30 April 1954, Sulit PNH 21575 (K!, L! [2 sheets], PNH!, US!). 117

Leyte. Leyte Province. Abuyog-Silago inland road, 4 Nov. 2006, Fernando & Schori 1892 (BHO!); ibid, Fernando & Schori 1893 (A!); ibid, Fernando & Schori 1894 (PNH!); ibid, Fernando & Schori 1895 (A!, BHO!, BRI!, CAHUP!, LBC!, US!); ibid, imm. fr., Fernando & Schori 1896 (A!, BHO!, CAHUP!, K!, L!, MO!, PNH!); ibid, 26 Feb. 2008, Schori 2008-14 (BHO!, CAHUP!). Dinagat. Dinagat Province. Tubajon, Paragua Forest Reserve, 21 Feb. 2008, Schori 2008-8 (A!, BHO!, CAHUP!, PNH!). HABITAT. Lowland dipterocarp hill forest over limestone and ultramafic soils, up to 530 m elevation. CONSERVATION STATUS. Vulnerable: VU B1ab(iii,iv,v), following IUCN (2001) guidelines. Gomphandra fernandoi has been collected from eight different localities, at least three of which no longer have suitable habitat. Northern Samar and Biliran have been almost completely deforested, and the rate of deforestation in other localities is very rapid. A population that included reproductively mature individuals in southern Leyte could not be relocated the following year because the forest had been converted to agricultural land. The population on Dinagat is likely to be the only secure population, and as deforestation continues in the Visayas, a conservation status of Critically Endangered (CR 3c) will become appropriate. PHENOLOGY. Flowers in April and May. ETYMOLOGY. The specific epithet honors Dr. Edwino S. Fernando, a palm taxonomist and one of the Philippines’ leading botanists. NOTES. Gomphandra fernandoi is closely related to G. luzoniensis (Merr.) Merr., based on similarities in leaf venation, inflorescence structure, flowers, fruit, and molecular data. However, the two species are easily distinguished by the velvety pubescence on the twigs and lower leaves of Gomphandra fernandoi (glabrescent to glabrous in G. luzoniensis), differences in leaf shape and texture (narrower and acuminate in young leaves of G. fernandoi, broader and more coriaceous in mature leaves of G. fernandoi when compared to G. luzoniensis), and by distribution. Gomphandra luzoniensis has never been collected from the eastern Visayas, whereas G. fernandoi seems to be restricted to the four easternmost Visayan islands. Gomphandra fernandoi may be locally common in the appropriate habitat, but this habitat is severely threatened in the Philippines and is no 118

longer available in Biliran and the areas of Samar where the species was previously collected. A population in the southern Leyte municipality of Abuyog was found in 2006; by 2008, the area was unrecognizable due to settlement and agriculture, though a few saplings were still found in degraded forest fragments. The population on Dinagat may be secure.

Map 3 [Fig. 5.14]. Distribution of Gomphandra fernandoi (■) in the Philippines.

Gomphandra luzoniensis (Merr.) Merr. subsp. septentrionalis Schori & Utteridge

Small tree, 6 – 10 ( – 15) m tall (Lanyu Island). Bark light grey. Twigs green, initially covered with minute appressed grey pubescence, glabrescent with age, 2 – 3.5 mm thick, older twigs thicker than those of Gomphandra luzoniensis subsp. luzoniensis. Leaves coriaceous, often erect and laxly involute in living specimens, orbicular to broadly ovate- 119

elliptic, apex rounded to very shortly and abruptly acute, base rounded to obtuse, glabrous or with a few sparse hairs along the veins below, (4.5 – ) 6 – 9.5 × (3 – ) 5.5 – 7 cm, margin revolute; midrib flat to sunken above, raised below, midrib and secondary veins often lighter than the lamina and yellowish-green, secondary veins (1 – ) 3 – 4 pairs, flat to impressed above, raised below, lower pairs often somewhat crowded at leaf base, tertiary veins scarcely evident, weakly percurrent; petiole grooved, sparsely pubescent to glabrescent, 0.5 – 1 cm long. Inflorescences terminal on sympodial branches, with very short, appressed greyish pubescence. Male inflorescences with peduncle to 4 cm long, bearing 3 – 5 branches, these to 1.5 cm long, often bearing up to 3 branches of somewhat scorpioid cymes, or the branches dividing again (4, rarely 5 degrees of branching within the inflorescence), flowers sessile to on pedicels 3 mm long, inflorescence as a whole to 8 cm long, often with 70 or more flowers. Male flowers: calyx cupular, minutely apiculate, essentially glabrous, 1 – 2 mm across, petals 4 – 5, yellowish, 3 – 4 mm long, lobes free but corolla not splitting, stamens 4 – 5, white, strongly exserted, 4 – 5 mm long, somewhat reflexed, pubescent dorsally and ventrally with spreading hairs, ovary rudiment minute, glabrous. Female inflorescences with peduncle 1 – 2 cm long, bearing 3 – 4 branches, each branch somewhat irregularly rebranched into a cyme or bearing flowers on long pedicels, flowers subsessile or on pedicels to 6 mm long; inflorescence as a whole to 4 cm long with up to ca. 20 flowers. Female flowers: calyx cupular, minutely apiculate, green, essentially glabrous, 2 – 2.5 mm across, petals 4 – 5, yellowish, glabrous, 4 mm long, corolla sometimes split to base on one side, staminodes 4 – 5, white, exserted or 1 – 2 strongly reflexed, 5 mm long, bearing a tuft of clavate hairs at the connective and with scattered clavate hairs dorsally below the anther cells, ovary cylindrical, glabrous, bright green, 3 mm long, stigma yellowish, 4-5-lobed, 1 – 1.5 mm across. Fruit ellipsoid, glabrous, orangish to pinkish- beige, 1.5 – 2.1 × 0.9 cm, inner mesocarp with ca. 10 strong longitudinal ridges, stigma 4 mm across, ridged or with a slit on the side facing the sulcus. Fig. 4 [Fig. 5.15]. 120

Fig. 4 [Fig. 5.15]. Gomphandra luzoniensis subsp. septentrionalis. A. Habit of flowering and fruiting branches (Yang et al. 8250; scale bar = 1 cm); B – E Leaf variation (B & C Huang et al. 10514; D Ramos B. S. 80423; E Ramos B. S. 79973; scale bar = 1 cm); F. ♂ fl. (Ramos B. S. 79973; scale bar = 1 mm); G. ♀ fl. with petal and staminode removed (Yang et al. 8250; scale bar = 1 mm); H. Inflorescence (Ramos B. S. 79973; scale bar = 1 cm). 121

DISTRIBUTION. Taiwan: Lanyu Island, Philippines: Batan Island. Also reported from Lu Tao Island (Chang 4084, Flora of Taiwan (1993)), but specimen not seen. SPECIMENS EXAMINED. TAIWAN. Taitung County, Lanyu Is.: Irunomirukusya [Tungching], 3 June 1947, Yamamoto s.n. (TAI! photo); no specified locality, ♀ buds, fr., 6 April 1977, Chang 803 [13156] (L!); along the round-island road from the RadWaste Administration’s nuclear waste depository to Helmet Rock, on exposed road bank, 22° 01’ N, 121° 35’ 10” E, 5-30 m elev., ♂ buds, 28 Feb. 1993, Ho et al. 1115 (A!, HAST n.v.); no specified locality, 1 April 1974, Ou et al. 2415 (TAI! photo); no specified locality, 200 m, 5 April 2002, Lu 3932 (TAIF! photo); Hsiaotienchih, 180 m, fl., 28 April 1997, Chiu & Chen 4093 (TAIF! photo); no specified locality, 150 – 350 m, fl., 20 July 2003, Lu 6279 (TAIF! photo); Lanyu Township, Yehyo Village, on the way to Hsiaotienchi Pond, 150 m, 27 April 1997, Yang, Cheng, Hsu, & Yen 8246 (TNM! photo); ibid, 120 m alt., ♀ fl., fr., 27 April 1997, Yang, Cheng, Hsu, & Yen 8250 (TNM! photo [herb. no. S42996] holotype; IBSC, MO!, PE, TAIF! photo, TNM! photo [herb. no. S42995], TNS, Department of Education, Ryukyu University isotypes); Tungching Village, Lungmen Bridge, forest margin, 20 m, ♀ buds, fr., 20 Jan. 1998, Yang, Hsu, & Wang 10016 (TAIF! photo, TNM); in forests, 180 m, 25 March 1998, Yang & Wang 10141, 10142 (TNM); Tentsu [Tienchih], on the coast, fr., 17 Feb. 1986, Huang et al. 10514 (A!, L! [2 sheets], MO! [2 sheets], TAI! photo [2 sheets]); no specified locality, fr., 30 Jan. 1978, Chang 11636 [13161] (L!); no specified locality, buds, 1 May 1963, Chang 13158 (L!); Yehyo Village, on the way to Hsiaotienchi Pond, trailside, forest margin, 160 m, 24 May 2000, Yang, Chiang & Hsiao13178 (TNM! photo); Langtao, Pond Hsiaotienchih, 22°04’39” N, 121°30’37” E, 167 m, fr., 11 Sept. 2002, Yang et al. 15194 (MO!); Wangnanchiau, Tengchi, 20 – 350 m, fr., 12 Nov. 1982, Tateishi et al. 15231 (A!); Langtao, Pond Hsiaotienchih, 22°04’36” N, 121°30’33” E, 172 m, fr., 4 May 2003, Yang & Huang 15753 (MO!); no specified locality, 22°03’ N, 121°31’ E, imm. fr., 22 Oct. 1985, Lu 17547 (TAIF! photo); no specified locality, fr., 21 Feb. 1986, Lu 18409 (CANB!, TAIF! photo [5 sheets]). PHILIPPINES. Batanes Province, Batan Is.: Valugan, SE slope of Iraya near forestry nursery, 20° 28.1’ N, 122° 00.6’ E, 20 m, ♂ buds, 8 May 1996, Madulid et al. PPI 26038 (11 duplicates); Mt Iraya, in forest slopes, 122

425 m [1400 ft.], ♂ fl., 29 April 1930, Ramos B. S. 79973 (BH!, MICH!, NY!); Mt Matarim, in forest slopes, 305 m [1000 ft.], (imm.) fr., 19 June 1930, Ramos B. S. 80423 (MICH!, NY!); Mt Matarim, in forest slopes, 335 m [1100 ft.], imm. fr., July 22, 1930, Ramos B. S. 80643 (MICH!, NY!). HABITAT. This subspecies is found in short forests, in coastal forests, at forest margins and in exposed locations. On Lanyu it occurs at elevations up to 180 m, while on Batan it can grow at an elevation of 425 m. CONSERVATION STATUS. Based on geographic area, a conservation status of Endangered might be appropriate, as Lanyu Island is 45km2 and Batan is 35km2. However, the other criteria for a status of Endangered cannot be met (IUCN 2001). The population from Lu Tao (15 km2) has been extirpated, and satellite images show that the mountain forest on Batan is highly degraded, but Gomphandra luzoniensis subsp. septentrionalis appears to be relatively secure on Lanyu. A conservation status of Vulnerable (VU A2c) is considered appropriate at this time. PHENOLOGY. Flowers in April and May. On Lanyu Is., flowering may begin in March and extend through June (Aleck Yang, pers. comm.). ETYMOLOGY. The epithet septentrionalis refers to this subspecies’ northern distribution within the species’ range. Septentrionalis was chosen in preference to borealis, which could imply a geographical distribution north of the Tropic of Cancer. VERNACULAR NAME. Gala in Yami (Tao), lu song mao rei mu (Chinese, meaning Luzon furry-flowered bush). USES. The Yami use the wood for house and boat construction. NOTES. Gomphandra luzoniensis subsp. septentrionalis differs from subsp. luzoniensis by its thicker twigs, rounded coriaceous leaves, and fewer veins. Discriminant analysis (unpubl. data [see Chapter 4 of dissertation]) of leaf dimensions, average twig thickness, vein number, and leaf apex and base angles showed a clear separation of the two subspecies, with the exception of a few specimens from northern Luzon (Cagayan and Ilocos Norte Provinces). Those specimens had individual leaves from each morphotype on the same plant, a condition that is not unusual at the geographic boundary between subspecies. On Lanyu Island, this subspecies is very common and can be found scattered 123

in the forests and at forest edges. Trees bloom on a regular basis, and flowers and fruit can be found in the spring and summer. No living individuals have been found on Lu Tao Island in recent years, and much of the forest on the island has been destroyed (Aleck Yang, pers. comm.). The original record from Lu Tao has not been confirmed, but if Gomphandra luzoniensis subsp. septentrionalis grew on the island at one time, it has since been extirpated. The first collection from Lanyu Island was made in 1947, but the specimen was identified as Gonocaryum diospyrosifolia Hayata, so Gomphandra was not included in the first edition of Flora of Taiwan.

Map 4 [Fig. 5.16]. Distribution of Gomphandra luzoniensis subsp. septentrionalis (■) on Lanyu and Batan Islands. 124

Gomphandra longipedunculata Schori

Tree 12 m tall, 25 cm girth. Twigs straight, quickly glabrous, 2.0 – 3.5 mm in diam. Terminal bud falcate, pubescent with minute appressed hairs. Leaves thinly coriaceous, lanceolate-elliptic, smooth and shiny above when fresh, slightly shining on both surfaces when dry, glabrous or glabrescent above and below, base attenuate and decurrent onto petiole, apex acuminate, margin slightly revolute, 14 – 19 × 4 – 6 cm; petiole narrowly grooved above, glabrescent, 1.5 – 2 cm × 1.5 – 2.0 mm; midrib sunken above, strongly raised below and usually paler than the lower leaf surface, secondary veins 4 – 6 pairs, flat to slightly sunken above, strongly raised below, lowest pair steeply ascending, upper pairs converging and joining near the margin, tertiary veins flat above, raised below, weakly percurrent. Inflorescences axillary, on previous seasons’ growth. Male inflorescences unknown. Female inflorescences axillary but apparently located below or next to a supra-axillary bud that develops into a branch, axes with appressed reddish pubescence; peduncle 2 – 2.5 cm long, bearing 3 – 4 branches, each branch then rebranching 1 – 2 times, flowers sessile or on pedicels up to 3 mm long, up to ca. 30 flowers per inflorescence. Female flowers: calyx cupular, minutely apiculate, ciliate or sparsely pubescent, 2 mm wide, petals 4, glabrous, united except for the tips, 4 – 5 mm long, staminodes 4, not or scarcely exserted, bearing a tuft of clavate hairs ventrally below the anther cells and dorsally at the connective, ovary ridged when dry, 3 – 4 mm long, densely pubescent with reddish hairs except for a zone at the base and the apex, capped by a broader, ridged stigma ca. 3 mm across. Fruit unknown. Fig. 5 [Fig. 5.17]. 125

Fig. 5 [Fig. 5.17]. Gomphandra longipedunculata. A. Twig with inflorescence (scale bar = 1 cm); B. ♀ fl., petal and staminode removed; C. Staminode (Mohtar et al. S. 49257; scale bar = 5 mm). 126

DISTRIBUTION. Malaysia: Borneo, Sarawak, 1st Division, Bukit Merubang, Tebedu. Only known from the type collection, endemic. SPECIMENS EXAMINED. MALAYSIA. Borneo, Sarawak, 1st Division, Bukit Merubang, Tebedu, logged-over mixed dipterocarp forest, 9 Feb. 1985, Mohtar et al. S. 49257 (K! [2 sheets] holotype; L!, KEP isotypes). HABITAT. Logged-over mixed dipterocarp forest. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii), based on IUCN (2001) guidelines. Gomphandra longipedunculata is known from only a single locality, so the original extent of the species is unknown. However, no appropriate habitat remains at the type locality, and satellite images indicate that lowland forest in southwestern Sarawak and adjacent Kalimantan has been almost completely decimated. PHENOLOGY. Flowers in February. ETYMOLOGY. The specific epithet refers to the long peduncle, which distinguishes this species from all other Gomphandra species with a pubescent ovary. NOTES. Gomphandra longipedunculata is a striking species that does not closely resemble any other Gomphandra in Borneo. The leaves are attenuate at the base and apex, the inflorescence is located above a leaf scar but below an axillary branch (i.e. from an accessory bud), the peduncle is quite long, and the flowers are larger than those of most other Gomphandra species. The pubescent ovary is shared with other species, including Gomphandra cumingiana (Miers) Fern.-Vill. and G. lysipetala Stapf in Borneo, and G. javanica (Bl.) Valeton in Java, but none of those species has a similar inflorescence structure or position or a similar leaf shape. The species should be considered endemic and may be extinct. 127

Map 5 [Fig. 5.18]. Distribution of Gomphandra longipedunculata (■) and G. macrosperma (▲) in Borneo.

Gomphandra macrosperma Schori

Tree, to 12 m high, 8 cm diam., bole cylindrical, smooth, bark pale. Twigs slightly zigzag, 2 – 3 mm in diam., densely pubescent with short appressed hairs, eventually glabrescent on older portions. Leaves ovate-elliptic, apex abruptly acuminate, base acute to rounded, margin flat to slightly revolute, chartaceous to thinly coriaceous, glabrous above, initially sparsely pubescent below and retaining pubescence along the veins, lower surface finely papillose, (7 – ) 12 – 19 × (3 – ) 5 – 7 cm; petiole pubescent, grooved above, 1 – 1.5 cm long; midrib sunken above, raised below, secondary veins 3 – 4 ( – 5) pairs, flat to sunken above, raised below, converging, upper pairs sometimes joining near margin, tertiary veins not evident above, flat below, delicately percurrent and perpendicular to the midrib. Inflorescences and flowers unknown. Infructescences axillary, evidently bearing 1 – 3 fruit, peduncle 0.3 – 1 cm long, with 0 – 3 pedicels 1 – 3 mm long, axes densely pubescent. Submature fruit ellipsoid, base rounded, 2.5 – 3.5 × 0.8 – 0.9 cm, epicarp with fine pale punctations, stigma 4 mm across, terminal or slightly 128 inclined toward sulcus, deeply grooved in the middle, inner mesocarp with ca. 10 low ridges. Fig. 6 [Fig. 5.19].

DISTRIBUTION. Malaysia: Borneo, Sabah, Telupid and Beluran Districts. Endemic. SPECIMENS EXAMINED. MALAYSIA. Borneo, Sabah, Beluran District, Kiabau, near Labuk Bay, 6 July 1981, Amin et al. SAN 93819 (K! [K000271873], L non inveni, SAR); Telupid District, Ruku-ruku, along stream, 26 Aug. 1992, Madani SAN 133979 (K! holotype; L! isotype). HABITAT. Ridge of hill and along stream. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra macrosperma has a conservation status of Endangered (EN B2ab(iii)). The species is known from two localities, and satellite images indicate that lowland forest is no longer present in much of the area where collections were made in the 1990s. A conservation status of Critically Endangered may be more appropriate, but the extent of occurrence for the species is unknown. ETYMOLOGY. The specific epithet alludes to the large fruits (with a large seed inside), which are unique among the Gomphandra species in Borneo. NOTES. Gomphandra macrosperma is only known from these two collections in Sabah. It does not closely resemble any other species of Gomphandra, and it can be distinguished by its very long fruit, its velvety terminal buds and young twigs, and the thinly coriaceous leaves with only a few veins. Madani SAN 133979 was chosen as the type based on its mature leaves and intact peduncle. Amin et al. SAN 93819 has much smaller, younger leaves that were not fully developed at the time of collection. Label data indicate that a duplicate of Amin et al. SAN 93819 was sent to L, but the specimen was not found in the herbarium’s mounted or unmounted collections. 129

Fig. 6 [Fig 5.19]. Gomphandra macrosperma. A. Twig with infructescences; B. Fruit, sulcus at center; C. Fruit, sulcus at left (Madani SAN 133979; scale bars = 1 cm). 130

Gomphandra angustata Schori

Tree to 10 m, 25 cm diam. Bark orange brown. Twigs slender, glabrescent, 1 – 2 mm in diam. Terminal bud falcate, covered with tightly appressed reddish pubescence. Leaves chartaceous, lanceolate to oblanceolate, glabrescent, dark green and somewhat glossy above when fresh, mid green below, drying dull and dark above, paler below, base acute to attenuate, apex acuminate, 7 – 14 × 2 – 4 cm, margin flat to slightly revolute; midrib slightly impressed above, raised below, secondary veins 3 – 5 pairs, flat above, raised below, steeply ascending and converging toward margin, occasionally joining, tertiary veins generally not visible, delicately percurrent; petiole narrowly grooved above, eventually glabrescent, 0.5 – 0.8 ( – 1.0) cm × 1 – 1.5 mm. Male inflorescences and flowers unknown. Female inflorescences axillary, on older growth, bearing 1 – 3 flowers, axes with appressed reddish pubescence, common peduncle 0.4 – 1 cm long, bearing up to 3 peduncles 0.4 – 0.8 cm long. Female flowers: calyx deeply cupular, entire to irregularly splitting, covered with appressed reddish pubescence, 3.5 mm in diam., 2 mm high, petals not seen, staminodes not seen, ovary cylindrical, evidently glabrous, 4 – 5 mm long, stigma ridged, 2 mm in diam. Fruit submature, glabrous, obovoid, apex acute, base tapering to a very narrow short stalk, 2 – 2.2 × 0.9 – 1.1 cm, pale orange when ripe (fide Croft et al. LAE 71080), stigma slightly displaced toward sulcus, 2.5 mm in diam., inner mesocarp with ca. 13 – 15 low anastomosing ridges. Fig. 7 [Fig. 5.20]. 131

Fig. 7 [Fig. 5.20]. Gomphandra angustata (Croft et al. LAE 71080; scale bar = 1 cm). 132

DISTRIBUTION. Papua New Guinea: Fergusson Island. Endemic. Map 6 [Fig. 5.21]. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Milne Bay District, Esa’ala Subdistrict, Fergusson Island, Mt Kilkerran (Woiatabu), (9° 25’ S, 150° 48’E), 700 m, fr., 8 Dec. 1976, Croft et al. LAE 71080 (holotype L!; isotypes BRI!, CANB!); ibid, 700 m, imm. fr., 8 Dec. 1976, Croft et al. LAE 71084 (A!, BISH!, BRI!, CANB!, E!, K!, L!, M n.v., NSW n.v., QRS n.v., US!). HABITAT. Montane forest; 700 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra angustata has a conservation status of Endangered (EN B2ab(iii)). The species has been collected from Mt. Kilkerran on Fergusson Island. The island has an area of 1437 km2, but portions of the lowlands have been affected by logging, agriculture, and mining activities. The forest on Mt. Kilkerran appears to be relatively intact, but deforestation will be a threat to the species. ETYMOLOGY. This species is named for its narrowly lanceolate leaves. The epithet “angustifolia” has been used for a variety of Gomphandra quadrifida from Malaysia, and the epithet “lanceolata” has also been used. NOTES. Gomphandra angustata is known from only two collections on Mt Kilkerran. Based on the material available, the species is easily identified by its narrowly lanceolate leaves. The immature fruits are somewhat similar to fruits of Gomphandra pseudoprasina Sleumer from the Aseki region of Morobe Province, and it is possible that G. pseudoprasina is the closest relative. Both species have a few-flowered female inflorescence with a peduncle 0.5 – 1 cm long, a similar number of secondary veins, and occur in similar habitats. However, Gomphandra pseudoprasina has coriaceous leaves that are never lanceolate, its leaves are usually much larger than those of G. angustata, and the peduncle elongates in fruit, which has not been observed in G. angustata. 133

Map 6 [Fig. 5.21]. Distribution of Gomphandra angustata (●), G. muscosa (■), and G. subcordata (▲) in Papua New Guinea.

Gomphandra muscosa Schori

Mid canopy tree, 20 m tall, to 30 cm in diam. Bark dark brown to grey brown or greenish brown. Twigs slightly zigzag, younger portions 1.5 – 2.5 mm in diam., pubescent with minute appressed hairs, glabrescent. Leaves coriaceous, lanceolate-elliptic to ovate- elliptic, base rounded to tapered, apex acute to acuminate, dark green above, light green above, initially pubescent but glabrous at maturity, margin slightly revolute, (5 – ) 10 – 12 × (2.0 –) 3.5 – 5.0 cm; midrib sunken above, raised below, secondary veins flat above, raised below, 5 – 7 pairs, upper pairs joining near margin, tertiary veins obscure above, slightly raised below, delicately percurrent; petiole (0.7 –) 1.0 – 1.5 cm long, grooved above, glabrescent. Inflorescences axillary, on previous year’s growth or on older portions of twigs, axes densely pubescent with minute appressed hairs. Male 134

inflorescences to 3.5 cm long, with up to ca. 20 flowers, peduncle 1.0 – 1.8 cm long, bearing 3 – 4 branches, branches up to 1 cm long, often branched again and bearing 2 short (2 – 3 mm) branches, each with several sessile or very shortly pedicelled flowers. Male flowers with calyx cupular, sparsely pubescent, 2 mm across, petals 4, sparsely pubescent externally, 4 – 5 mm long in bud, stamens pubescent ventrally below the anthers, ovary rudiment conical, glabrous. Female inflorescences shorter, each with 1 – 4 flowers, peduncle 2 – 5 mm long before branching, branches serving as pedicels, up to 4 mm long, peduncle and pedicels elongating in fruit. Female flowers with calyx cupular, entire, sparsely pubescent, 2 mm across, petals 4, sparsely pubescent externally, 4 mm long in bud, staminodes pubescent below the empty anther cells, ovary cylindrical, glabrous, capped by the broader stigma. Fruit slightly obovoid, apex scarcely tapered, base tapered, very base swollen, 2.2 – 2.6 × 1.2 – 1.3 cm, inner mesocarp with ca. 11 – 14 ridges, sulcus distinctly sunken, stigma terminal, 4 mm in diam., ripe fruit colour unknown. Fig. 8 [Fig. 5.22].

DISTRIBUTION. Papua New Guinea: Rossel and Misima Islands. Endemic. Map 6 [Fig. 5.21]. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Milne Bay Province, Misima Subprovince. Rossel Island, Mt Rossel, (11°20’ S, 154°10’ E), 19 March 1979, Katik et al. LAE 70949 (A!, BISH!, BM! photo, BRI!, CANB!, E!, K!, L!, M, NSW, QRS, UPNG, US!); ibid., 19 March 1979, Katik et al. LAE 70952 (A!, BISH!, BM! photo, BO, BRI!, CANB!, E!, K!, L!, MO!, NSW, PNH, QRS, UPNG, US!); Misima Island, Mt Oeatau (Foot), 720 m, 27 March 1979, Damas et al. LAE 74602 (A!, BISH!, BM! photo, BRI, CANB!, E!, K!, L!, NSW, QRS, US!); Mt Oia tau (10°39’ S, 152°42’ E), 600 m, 28 March 1979, Gideon LAE 76053 (A! holotype; BISH! photo, CANB!, E! photo, K non inveni, L!, QRS, US! isotypes). HABITAT. Mountain cloud forest, hill forest, and low montane mossy forest; 600 – 720 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra muscosa has a conservation status of Endangered (EN B2ab(iii)). The combined 135

geographic area of Misima and Rossel Islands is 464 km2, and the species is only known from three localities. Satellite images indicate that the forest on both islands is still relatively intact, but habitat threats include logging and mining activities. PHENOLOGY. Flowers March to April. ETYMOLOGY. Muscosa comes from the Latin “muscosus”, meaning mossy, referring to both the mossy forest where this species grows and its tendency to have moss-covered branches. NOTES. Gomphandra muscosa probably belongs to the G. australiana F. Muell. group, given its large ridged fruit with a large terminal stigma. It differs from Gomphandra australiana in its smaller leaves, pubescent petals, fewer and larger flowers, and fruits which are slightly tapered at the base and apex. Gomphandra muscosa is distinctive and not likely to be confused with any other species, and it is only known from Rossel and Misima Islands, where it grows in mossy forests. Label data indicate that a duplicate of LAE 76053 was sent to K, but the specimen has not been found in the herbarium’s collections. 136

Fig. 8 [Fig. 5.22]. Gomphandra muscosa. A. Twig with female inflorescence (Damas et al. LAE 74602); B. Leaf (Katik et al. LAE 70949); C. Stamen, ventral view (Katik et al. LAE 70949); D. Male flower showing stamen, ovary rudiment, and petal (Katik et al. LAE 70949); E. Female flower showing pubescent petals, ovary, and staminode (Damas et al. LAE 74602; scale bar = 5 mm); F. Fruit, dorsal view; G. Fruit, ventral view (Damas et al. LAE 74602); H. Male inflorescence (Katik et al. LAE 70949). All scale bars = 1 cm (except C – E). 137

Gomphandra subcordata Schori

Small tree 10 m tall. Bark grey-green. Twigs 2.0 – 3.5 mm in diam., persistently pubescent, pubescence reddish, short, appressed. Leaves dark to medium green and fleshy when fresh, glabrescent above, persistently pubescent below, ovate-elliptic to slightly obovate, base rounded to subcordate or occasionally tapering, apex abruptly and shortly acuminate, 16 – 21 ( – 23) × 8 – 12 cm, petiole short, 0.5 – 0.7 ( – 1.0) cm long; midrib sunken above, raised below, secondary veins 5 – 7 pairs, widely spaced, flat to slightly impressed above, raised below, upper pairs joining near the margin, tertiary veins obscure below, flat to slightly raised above, percurrent, perpendicular to the midrib. Male inflorescences unknown. Female inflorescences axillary, from previous year’s growth, bearing 2 – 3 flowers, peduncle 6 mm long before flowering, elongating in fruit, to 1.5 cm long before branching, branches 2 – 3, serving as pedicels, 0.4 – 0.7 ( – 1.0) cm long, axes densely pubescent. Female flowers: only seen in bud, calyx entire to minutely apiculate, sparsely pubescent, 2 mm wide; petals pubescent externally, 3 mm long. Fruit pale pink when ripe (fide Womersley & Millar NGF 8465), glabrous, punctate with small white spots, slightly obovoid, apex rounded, base a bit tapered, 2 – 2.6 × 1.1 – 1.3 cm, stigma terminal or slightly eccentric, inner mesocarp with ca. 15 anastomosing ridges. Fig. 9 [Fig. 5.23]. 138

Fig. 9 [Fig. 5.23]. Gomphandra subcordata (Womersley & Millar NGF 8465). A. Twig with female inflorescence; B. Fruit, ventral (sulcus) view; C. fruit, dorsal view. Scale bars = 1 cm.

DISTRIBUTION. Papua New Guinea: Morobe Province, Kupper Range. Endemic. Map 6 [Fig. 5.21]. 139

SPECIMENS EXAMINED. PAPUA NEW GUINEA. Morobe Province, Wagau – Labu Track, Mumeng, (6° 51’ S, 146° 48’ E), 800 m, 8 March 2000, Lovave 23 (L!); Wau-Salamaua Road, near Skindewai, (7°10’ S, 147° E, 1645 m [5400 ft.]), fl. & fr., 7 Jan. 1956, Womersley & Millar NGF 8465 (K! holotype, A!, BRI! [2 sheets] isotypes); Gully due north of Wagau airstrip, (6°10’ S, 146° 50’ E, 1220 m [4000 ft.]), imm. fr., 3 Nov. 1963, Womersley NGF 17882 (K! [2 sheets]). HABITAT. Understory in mid mountain forest; 800 – 1645 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra subcordata has a conservation status of Endangered (EN B2ab(iii)). The species is known from three localities in an area approximately 50 km2. A status of Critically Endangered may be more appropriate because satellite images indicate that large areas of lowland forest in the region have been degraded. ETYMOLOGY. The specific epithet refers to the shape of the leaf base. NOTES. Gomphandra subcordata is restricted to the Kupper Range, the ridge of mountains between Wau and Lae. It seems closely related to Gomphandra rarinervis Schori (Schori & Utteridge in press), with its large leaves and widely spaced veins. However, it differs in its reddish appressed pubescence, smaller fruits, and longer peduncles. Gomphandra subcordata also grows at a higher elevation than G. rarinervis. Staminate material has not been collected, and pistillate flowers remain incompletely known. Neither of the two flower buds on the holotype was dissected, in order to preserve the inflorescence structure.

Gomphandra melanesiensis Schori subsp. melanesiensis

Tree to 30 m high, 40 cm diam., buttresses absent or up to 0.6 m high, bole straight, bark smooth with pustules to rough, grey or light grey-brown to brown. Twigs straight to slightly zigzag, 2 – 3.5 mm in diam., cinereous with short appressed pubescence, eventually glabrescent. Leaves firmly chartaceous to thinly coriaceous, glossy green above when fresh, paler and shiny to dull below, initially pubescent, glabrous above and sparsely pubescent on the veins below at maturity, elliptic to obovate, base acute to 140

attenuate, apex abruptly acute or acuminate, 14 – 20 ( – 23) × (4 – ) 5 – 7 ( – 8.5) cm, margin flat to slightly revolute; midrib sunken above, raised below, secondary veins 4 – 6 ( – 8) pairs, flat to slightly raised above, raised below, somewhat steeply ascending and usually converging towards the margin, usually not joining, tertiary veins flat above, flat to slightly raised below, distinctly percurrent; petiole grooved, (0.3 – ) 0.7 – 1.5 ( – 1.8) cm × 1.5 – 2 mm, sparsely pubescent. Inflorescences axillary, on mature twigs, 1 – 2 per axil, axes pubescent with appressed hairs. Male inflorescences 3 – 5 cm long overall, with 3 – 5 orders of somewhat irregular branching, peduncle 0.3 – 1.5 cm long before branching, second order branches to 1 cm long, usually bearing 3 – 4 branches, these third order branches again to 1 cm long, then often dichotomously branched into several few-flowered, somewhat scorpioid cymes, flowers subsessile or pedicels to 4 mm long, robust examples with up to ca. 100 flowers per inflorescence, more commonly 30 – 40. Male flowers: calyx cupular, entire to slightly lobed, pubescent with tawny hairs, 2 – 2.5 mm across, petals 5, cream to yellowish-green, pubescent at apex, 3 – 4 mm long, stamens scarcely to slightly exserted, 3 – 4 mm long, filaments glabrous or with a few clavate hairs ventrally below the anthers; ovary rudiment globose to ovoid, glabrous. Female inflorescences with peduncle (0.3 – ) 0.7 – 1 cm long, bearing up to 4 branches 3 – 5 mm long, each branch cymose with 1 – 3 flowers on pedicels 3 – 5 mm long, 5 – 10 ( – 20) flowers per inflorescence. Female flowers: calyx cupular, entire to slightly lobed, 2.5 – 3 mm across, pubescent with tawny hairs, petals pubescent at apex, 3 – 4 mm long, staminodes 3 – 4 mm long, glabrous or with a few hairs, ovary cylindrical, glabrous, 2 – 3 mm long. Fruit cream (fide BSIP 12174) to creamy-yellow (fide Regalado & Sirikolo 717) when ripe, ovoid-ellipsoid, apex and base obtuse, 1.7 – 1.8 – 2.2 × 1.0 – 1.1 cm, inner mesocarp bearing ca. 20 close longitudinal ridges, stigma terminal, slightly angled toward sulcus complex, 2.5 mm wide, ridged with a central depression. Fig. 10 [Fig. 5.24].

141

Fig. 10 [Fig. 5.24]. Gomphandra melanesiensis subsp. melanesiensis. A. Twig (Craven & Schodde 270, scale bar = 1 cm); B. Female inflorescence (Sayers 19699, scale bar = 1 cm); C. Infructescence (Schodde & Craven 4038, scale bar = 1 cm); D. Schematic of male inflorescence (Craven & Schodde 366, scale bar = 1 cm); E. Male flower (Craven & Schodde 366, scale bar = 4 mm). 142

DISTRIBUTION. Papua New Guinea: Manus, Morobe, New Ireland, and North Solomons Provinces (Bougainville); Solomon Islands. Map 7 [Fig. 5.25].

Map 7 [Fig. 5.25]. Distribution of Gomphandra melanesiensis subsp. melanesiensis in the Bismarck Archipelago and the Solomon Islands.

PAPUA NEW GUINEA. Manus Province: Horno Islands, Rambutyo Island, Kerenga & Croft LAE 77393 (A!, BRI! [2 sheets], E!, K!); Morobe Province: Umboi Island, Conn & Katik LAE 66107 (A!, BRI!, E!, K!); New Ireland Province: New Ireland, Coode et al. NGF 29646 (A!, BRI!, K!); Feni Islands, Ambitle Island, Takeuchi 16787 (K!, US!); Takeuchi 16805 (K!); Bougainville: Craven & Schodde 233 (A!, BRI!, K!, L!, LAE); Craven & Schodde 270 (A!, BH!, BISH!, BO, BRI!, CANB!, G, K!, L!, LAE, MEL, NSW, PNH!, US); Craven & Schodde 366 (A!, B, BH!, BISH!, BO, BRI!, CANB!, G, K!, L!, LAE, MEL, NSW, US); Kajewski 1801 (A!, BISH!, BRI! [2 sheets], L!, US!); Schodde & Craven 4038 (A! holotype; CANB! [2 sheets], K! [2 sheets], L! isotypes); Sayers NGF 19699 (A!, BISH!, BO, BRI!, CANB!, K!, L!, PNH! [2 sheets], SING, SYD, US). SOLOMON ISLANDS. No specific locality, Griffith s.n. (BRI!); Choiseul Province, Choiseul Island: Whitmore BSIP 5241 (K!, L!); Whitmore’s Collectors BSIP 5654 (K!, L!); Gafui et al. BSIP 17429, 17555, 18468, 18617, 18643, 18816 (K!, L!); Wagina [Vaghena] Island: Whitmore’s Collectors BSIP 5426 (K!, L!); Western Province, Treasury Island: Mauriasi et al. BSIP 14070, 14076, 14249, 14263 (K!, L!); Mauriasi et al. BSIP 14144 (K!, L!); Shortland Island: Whitmore’s Collectors BSIP 5921 (K!, L!); 143

Runikera et al. BSIP 12924, 13074, 13195 (K!, L!); Mauriasi et al. BSIP 13232 (K!, L!); Ovau Island: Mauriasi et al. BSIP 13758 (K!, L!); Fauro Island: Mauriasi et al. BSIP 13984 (L!); Vella Lavella Island: Kotali et al. BSIP 9540 (K!, L!); Baga [Mbava] Island: Whitmore BSIP 1308, 1329 (K!, L!); Whitmore’s Collectors BSIP 3023, 3077 (K!, L!); Ranongga Island: Mauriasi et al. BSIP 14362, 14482, 15565, 15682, 15720 (K!, L!); Gizo Island: Mauriasi et al. BSIP 11695, 15805 (K!, L!); Kolombangara Island: Regalado & Sirikolo 717 (MO!, K!, L!); Evans BSIP 1389 (K!, L!); Whitmore BSIP 1482 (K!, L!); Arifanata R.S.S. 2573 (A!, CANB!, K!, L!); Dennis et al. BSIP 8159 (A!, K!, L!, SING!); Mauriasi et al. BSIP 8492 (K!, L!); Gafui et al. BSIP 8660, 8928 (K!, L!); Mauriasi et al. BSIP 9562, 11378, 11569 (K!, L!); New Georgia Island: Waterhouse 232 (K!); Cowmeadow BSIP 3134 (K!, L!); Cowmeadow’s Collectors BSIP 3236 (A!, K!. L!, SING!); Cowmeadow’s Collectors BSIP 3257, 3775, 4824 (K!, L!); Maenu’u BSIP 5161, 6407 (K!, L!, US!); Burn-Murdoch’s Collectors BSIP 6865 (K!, L!, US!); Burn- Murdoch’s Collectors BSIP 6878 (K!, L!, SING!, US!); Burn-Murdoch’s Collectors BSIP 7161 (L!); Rendova Island (New Georgia group): Whitmore BSIP 1904 (K!, L!); Tetepare Island (New Georgia group): Mauriasi et al. BSIP 15865, 15914, 15975, 16145 (K!, L!); Vanganu Island (New Georgia group): Walker & White BSIP 160 (BRI!, CANB!, K!, L!); Isabel Province, Barora Fa Island: Mauriasi et al. BSIP 16236 (K!, L!); Barora Ite Island: Mauriasi et al. BSIP 16014, 16155 (K!, L!); Santa Isabel Island: Whitmore BSIP 2361, 2406, 2597 (K!, L!); Susui R.S.S. 2902 (A!, BRI!, CANB!, K!, L!); Beer’s Collectors BSIP 5122 (K!, L!, US!); Beer’s Collectors BSIP 6407 (K!, L!, SING!); Beer’s Collectors BSIP 6761 (K!, L!, SING!, US!); Beer’s Collectors BSIP 7366 (K!, L!, SING!); Mauriasi et al. BSIP 16530 (K!, L!); Malaita Province, Malaita Island: Lipaqeto BSIP 3423 (K!, L!); Gafui et al. BSIP 10208, 10289 (K!, L!); Runikera et al. BSIP 10350 (K!, L!); Runikera et al. BSIP 10401 (K!, L!); Runikera et al. BSIP 10540, 10712, 10734 (K!, L!); Mauriasi et al. BSIP 13438, 13516 (K!, L!); Small Malaita Island: Gafui et al. BSIP 16234, 16366, 16922, 17285 (K!, L!); Ulawa Island: Teona BSIP 6232 (K!, L!, US!); Central Province, Nggela Sule Island: Gafui et al. BSIP 15041 (A!, K!, L!); Gafui et al. BSIP 15205, 16801, 16882 (K!, L!); Mauriasi et al. BSIP 18211, 18245 (K!, L!); Nggela Pile Island: Gafui BSIP 15305 (A!, K!, L!); Gafui BSIP 144

15393 (K!, L!); Guadalcanal Province, Guadalcanal Island: Griffith SJG 13/02 (BRI!); Whitmore BSIP 660, 785, 1833 (K!, L!); Kajewski 2564 (A!, BRI!); Whitmore BSIP 2788 (K!, L!); Whitmore’s Collectors BSIP 3555 (K!, L!); Kere BSIP 5035 (K!, L!); Whitmore R.S.S. 6075 (A!, CANB!, K!, L!); Gafui et al. BSIP 9064, 9242, 9353 (K!, L!); Sirute’e et al. BSIP 9998 (K!, L!); Gafui et al. BSIP 10108 (K!, L!); Mauriasi et al. BSIP 11217 (K!, L!); Farodo et al. BSIP 12027 (K!, L!); Fa’arodo et al. BSIP 12174 (K!, L!); Mauriasi et al. BSIP 12457 (K!, L!); Makira-Ulawa Province, San Cristobal Island: Whitmore BSIP 4232 (K!, L!); Kere’s Collectors BSIP 5591 (K!, L!, SING!); Gafui et al. BSIP 11008 (K!, L!); Runikera et al. BSIP 11097 (K!, L!); Gafui et al. BSIP 12793, 12692 (K!, L!); Santa Ana Island: Mauriasi et al. BSIP 17862 (K!, L!); Santa Catalina Island: Mauriasi et al. BSIP 17813 (K!, L!). HABITAT. Primary (disturbed) rainforest, ridges, valley bottoms, riversides, or swampy flat land; 10 – 700 m. CONSERVATION STATUS. This species is widely distributed and, given its historic distribution and based on IUCN (2001) guidelines, has a status of Least Concern (LC). However, deforestation across its range poses a threat, and the species’ current abundance is not known. PHENOLOGY. Flowering does not seem to be restricted to any particular time of year, though flowers may be more common from September through March. ETYMOLOGY. The specific epithet comes from the region of Melanesia, where the species occurs. VERNACULAR NAMES. Yamul (Bougainville); aialo (Kwara’ae, Solomon Isl.); tutuamauvo (Manukiki, Guadalcanal). The Kwara’ae name of aialo is applied to other species of trees as well. USES. The trees are used as house supporting beams. NOTES. Gomphandra melanesiensis is probably closely related to G. australiana F. Muell. but differs in its generally obovate leaves, pubescent petals, twig pubescence, and fruits with more numerous, less prominent ridges. The abrupt increase in twig diameter from the terminal bud toward the base of the twig is marked in specimens from the Solomon Islands, but less evident in specimens from New Britain and New Ireland 145

Provinces. The inflorescences are somewhat irregular in their branching and can have few to many flowers. This species was common in the Solomon Islands in the 1960s and may still be common today, but there are few recent collections at A, K, or L. The US herbarium probably has many of the BSIP duplicates in its unmounted backlog. It is somewhat surprising that such a widespread, abundantly collected species would remain undescribed for such a long time, but Sleumer (1969) treated the specimens of this species as belonging to Gomphandra montana (G. Schellenb.) Sleumer. While there is very little material of Gomphandra montana available, it does not appear to represent the same taxon as G. melanesiensis. The pubescence of the petals in Gomphandra montana is restricted to minute hairs at the edges of the petals, the leaves are not obovate, the twigs do not show the same increase in diameter, the stamens are longer, and the inflorescences have fewer flowers. Fruits of material initially described as Gomphandra carrii Sleumer, but later synonymised with G. montana by Sleumer (1969), have a different shape and ridge pattern than fruits of G. melanesiensis. Three collections from New Britain (Hart NGF 7029, Stevens & Lelean LAE 58717, Croft et al. NGF 41408) may belong to a closely related taxon. The material is inadequate to make a determination, but the leaves, twigs, and immature fruit seem different from those of Gomphandra melanesiensis. A certain amount of variation in leaf morphology is expected in a taxon as widespread as Gomphandra melanesiensis, but differences in twigs and fruit suggest that these New Britain specimens represent a different (undescribed) species. More collections from New Britain are needed to determine the specimens’ identities. 146

Gomphandra melanesiensis subsp. macrocarpa Schori

Tree to 15 m high and 14.5 cm in diam. Similar to Gomphandra melanesiensis subsp. melanesiensis, but twigs 2 – 3 mm thick, not increasing in diameter as quickly, leaves ovate-elliptic, not obovate and generally more rounded in outline, base acute, apex acute to shortly acuminate, 11 – 18.5 × 5 – 8 cm, fruit white (fide St. John 19243), ivory (fide St. John 19462), or creamy yellow (fide Kajewski 514) when ripe, ellipsoid to obovoid, curved or straight, apex asymmetrical, base swollen, 2.4 – 4.5 × 1.5 – 2.2 cm, stigma 3.5 – 5 mm wide. Fig. 11 [Fig. 5.26].

Fig. 11 [Fig. 5.26]. Gomphandra melanesiensis subsp. macrocarpa. A. Twig with leaf and infructescence (St. John 19462); B. Associated fruit; C. Leaf (Kajewski 514); D. Associated fruit. All scale bars = 1 cm. 147

DISTRIBUTION. Santa Cruz Is., Rotuma. Map 8 [Fig. 5.27]. SANTA CRUZ ISLANDS. Tomotu Noi: Ngambwani area, 10° 47’ S, 166° 04’ E, buds, 14 April 1972, Powell BSIP 19862 (BISH!, CANB!, L!); Temotu Province, Santa Cruz [Nendo] Island: SW part, Baenga area, 50 m [100 ft.], imm. fr., 6 Oct. 1969, Mauriasi et al. BSIP 16619 (K!, L!); SE part, Bwenja River area, 50 m [175 ft.], imm. fr., 11 Oct. 1969, Mauriasi et al. BSIP 16713 (K!, L!); SW part, Masoko area, 0 m [25 ft.], 11 Oct. 1969, Mauriasi et al. BSIP 16733 (K, L!); NE part, Charlisle Bay area, imm. fr., 22 Oct. 1969, Mauriasi et al. BSIP 17001 (K!, L!); NE part, Lausaleba area, 100 m [250 ft.], imm. fr., 27 Oct. 1969, Mauriasi et al. BSIP 17090 (K!, L!); NW part, Mbo area, 50 m [225 ft.], imm. fr., 30 Oct. 1969, Mauriasi et al. BSIP 17165 (K!, L!); Mbania area, 0 m [25 ft.], imm. fr., 9 Oct. 1969, Mauriasi et al. BSIP 17620 (K!, L!); SE part, Utongo area, imm. fr., 16 Oct. 1969, Mauriasi et al. BSIP 17675 (K!, L!); East Santa Cruz, 0 m [75 ft.], imm. fr., 18 Oct. 1969, Mauriasi et al. BSIP 17684 (K!, L!); NW Graciosa Bay, Kauri area, 100 m [400 ft.], imm. fr., 11 Nov. 1969, Mauriasi et al. BSIP 17800 (K!, L!); Vanikoro [Vanikolo] Island: no specific locality, 50 m, fr., 20 Sept. 1928, Kajewski 514 (A!, MO!, US!); Near Peou, buds, 20 March 1963, Whitmore BSIP 1568 (K!, L!); Sundi Valley, Middle Ridge, 300 m [c. 1000 ft.], buds, 29 March 1963, Whitmore BSIP 1633 (K!, L!); South coast at Emwa, 450 m [c. 1500 ft.], fr., 8 April 1963, Whitmore BSIP 1693 (K!, L!); East side of Saboe Bay, 300 m [c. 1000 ft.], fl., 17 April 1963, Whitmore BSIP 1740 (K!, L!); no specific locality, fl., March 1965, Pia(i)to BSIP 7022 (K!, L!). FIJI. Rotuma Island, Itutiu District: Jarua, 0 m [50 ft.], fr., 22 July 1938, St. John 19243 (A! holotype; A!, BISH! photo, BRI!, K!, L!, NY!, US! isotypes); Paho, 200 m [650 ft.], fr., 8 Aug. 1938, St. John 19462 (A! [2 sheets], BISH! photo, NY!, US!). HABITAT. Rainforest, second growth forest, on ridges, well-drained loam soil over coral, 0 – 450 m, common. CONSERVATION STATUS. Endangered: EN B2ab(iii,iv), based on IUCN (2001) guidelines. The total land area available on Nendo, Tomotu Noi, Rotuma, and the Vanikoro Island group is 777 km2, although the area of occupancy for Gomphandra melanesiensis subsp. macrocarpa is estimated to be less than 500 km2. These islands, especially Rotuma, are remote and represent a severely fragmented area of occupancy, 148

with little to no chance of dispersal between populations. This taxon was reportedly common in Santa Cruz when it was collected in the 1960s, but satellite images indicate areas of deforestation and plantations on Nendo and Tomotu Noi, with almost no intact forest remaining on Rotuma. PHENOLOGY. Flowers March to April. ETYMOLOGY. The epithet macrocarpa refers to this subspecies’ large fruit. VERNACULAR NAMES. Aialo (Kwara’ae), ngamume (Nangu), hahu’a (Rotuman). USES. Used for roofing cross-beams in Rotuma. NOTES. Gomphandra melanesiensis subsp. macrocarpa is similar to subsp. melanesiensis in most respects. However, its twigs tend to be more slender and do not increase in diameter as close to the apex, its leaves are usually ovate-elliptic rather than obovate and appear more rounded in outline, and its fruits are substantially larger than those of subsp. melanesiensis. Specimens from the Santa Cruz Islands have smaller fruits than specimens from Rotuma.

Map 8 [Fig. 5.27]. Distribution of Gomphandra melanesiensis subsp. macrocarpa (□) east of the Solomon Islands, in Santa Cruz and Rotuma.

149

Acknowledgements

Thanks to Dr. Neil Bernstein (Ohio University) for assistance with the Latin diagnoses and descriptions, and to Yi-Ting Wang for Chinese translation. Thanks to Dr. Luisto “Tito” Evangelista, Dr. Corazon Alvina, and Dr. Domingo Madulid for data on PPI specimens. Many thanks to Aleck Yang at TNM for images of and notes about Gomphandra luzoniensis subsp. septentrionalis on Lanyu Is., and to curators at A, BH, BISH, BM, BRI, CANB, E, K, L, MICH, MO, NY, P, PNH, and US for specimen loans and photographs. Dr. Philip D. Cantino (Ohio University) provided valuable comments on the manuscript.

References

Editorial Committee of the Flora of Taiwan. (1993). Flora of Taiwan. Republic of China, Taipei, Taiwan.

IUCN. (2001). IUCN red list categories and criteria. Ver. 3.1. Gland, Switzerland and Cambridge, UK: IUCN.

Schori, M. & Utteridge, T. M. A. (In press). Three new species and a new name in Southeast Asian Gomphandra (Stemonuraceae/Icacinaceae s.l.). Blumea.

Sleumer, H. O. (1969). Materials towards the knowledge of the Icacinaceae of Asia, Malesia, and adjacent areas. Blumea 17: 181-264.

Sleumer, H. O. (1971). Icacinaceae. Flora Malesiana Series 1. 7 (1): 1-63. Noordhoff- Kolff, Djakarta.

150

Article 3 – Twelve new species of Gomphandra. Formatted for Kew Bulletin (2010 submission). This is the last article that describes new species of Gomphandra. In addition, three new varieties are recognized and a species is reduced to a subspecies.

Twelve new species, three varieties, and a subspecies of Gomphandra (Stemonuraceae) from Malesia

Melanie Schori1

Summary. Twelve new species of Gomphandra from Malesia are described. Gomphandra microcarpa and G. tenuis are found in Peninsular Malaysia. Gomphandra coi, G. dinagatensis, G. psilandra, and G. ultramafiterrestris are endemic to the Philippines. Gomphandra borneensis is widespread in Borneo while G. lamanii has a more restricted distribution. Gomphandra kinabaluensis is endemic to Sabah, as is its variety clemensiorum. Gomphandra chimaera, G. jacobsii, and G. simulans are described from Sumatra, as are two new varieties of G. parviflora. Gomphandra pseudojavanica from Simeulue Island is reduced to a subspecies of G. javanica.

Key words. Gomphandra, Icacinaceae s.l., Malesia, Stemonuraceae

Introduction

This is the last of three articles describing new species of Gomphandra Wall. ex Lindl. in preparation for a revision. Gomphandra is a genus of small trees and shrubs in Stemonuraceae (Icacinaceae s.l.) and is found throughout much of the Old World tropics. The centre of diversity is in the Philippines (17 spp.), followed by Papua New Guinea (13 spp.). Overall diversity of the genus is currently estimated at 62 taxa, nearly double the

1 Department of Environmental & Plant Biology, 411 Porter Hall, Ohio University, Athens, OH 45701, USA; email: [email protected]. 151

37 taxa recognised by Sleumer (1969). The taxa described here are mostly species first collected since Sleumer’s revision, although most of the material he left as undetermined has now been identified or described. Gomphandra tenuis, G. microcarpa, G. chimaera, G. jacobsii, and G. simulans are somewhat cryptic taxa that were identified as other species before they were examined for the forthcoming revision. Gomphandra pseudojavanica, which Sleumer described as a new species in 1969, does not substantially differ from G. javanica, so it is now treated as a subspecies.

Gomphandra microcarpa Schori

Bush, or occasionally small tree to 18 m high and 29 cm diam. Twigs with a decurrent ridge below the petiole insertion, initially pubescent with minute reddish-brown hairs but soon glabrescent, 1 – 2 mm in diam. Leaves narrowly lanceolate, base acute, apex acuminate to caudate, firmly chartaceous to thinly coriaceous, glabrous or finely pubescent with appressed hairs on the midrib below, (3.5 – ) 5 – 9 ( – 11.5) × 0.7 – 1.2 ( – 1.8) cm, margins revolute and decurrent onto petiole; midrib impressed above, raised below, secondary veins 5 – 8 pairs, flat above, slightly raised below, lowest pair often steeply ascending, other pairs slightly converging and tending to join near margin, intersecondaries difficult to distinguish from secondary veins, tertiary veins flat to not visible above, slightly raised below, scarcely percurrent; petiole narrowly grooved above, often sparsely pubescent, 1 – 3 ( – 5) mm long, subtly transversely ridged. Inflorescences axillary, usually solitary but flowering repeatedly from short shoots, axes pubescent with minute appressed hairs. Male inflorescences to 1.5 cm long overall, with peduncle 0.5 – 0.8 cm long, bearing 3 branches, these branches usually unbranched with flowers arranged in a scorpioid cyme, occasionally branches to 2 mm long, then bearing scorpioid cymes, flowers subsessile or on pedicels to 4 mm long, up to 15 flowers per inflorescence. Male flowers: calyx glabrous, minutely apiculate, 1 mm wide; petals 5, yellow-green (fide Whitmore FRI 8946) or white (fide Shah & Noor MS 2041), glabrous, 2 – 2.5 mm long, stamens 5, slightly exserted, 2.5 – 3 mm long, filaments pubescent ventrally below the anthers with short clavate hairs; ovary rudiment minute, globose, 152 apiculate, glabrous. Female inflorescences with peduncle 1 – 2 mm long, bearing 1 – 3 flowers on pedicels 1 – 3 ( – 4) mm long, pedicels elongating to 5 mm in fruit. Female flowers: calyx glabrous, minutely apiculate, 1 mm wide; petals 5, glabrous, 2 – 2.5 mm long; staminodes only seen in bud, 5, as long as the ovary, filaments with a dense fringe of clavate hairs on each edge dorsally, forming an inverted v up to the connective; ovary glabrous, cylindrical, 1.5 mm long, stigma ~ 1 mm wide. Fruit white (fide Wong & Khairuddin FRI 32624) or yellowish (fide Whitmore FRI 8592) when ripe, slightly obovoid, base and apex somewhat acute, glabrous, 0.8 – 1 × 0.4 – 0.5 cm, stigma lobed, 1.5 mm in diam., slightly displaced towards sulcus, inner mesocarp with ca. 8 scarcely evident ridges. Fig. 1 [Fig. 5.28]. DISTRIBUTION. Malaysia. Map 1 [Fig. 5.29].

SPECIMENS EXAMINED. MALAYSIA. Terengganu, Sungai Loh near Kuala Datok, rocky granite banks, 30 m [100 ft.], ♂ buds, ♀ fr., 5 July 1968, Whitmore FRI 8946 (A!, K!, L!); Ulu S. [Sungai] Trengan, between K. Biwa and K. Taat, Ulu Trengganu, riverside forest, 90 m [300 ft.], ♂ buds & fl., 13 June 1968, Cockburn FRI 10627 (K!, L!); Trengganu mountains, Sg. Kerbat at Jeram Keteh 1.5 miles below K. Trengan, sandstone, boulder stream flood channel, ♀ fl., 27 June 1971, Whitmore FRI 20260 (K!, L!); Sg. Trengganu near K. Panchor, ♀ fl., fr., 14 Feb. 1972, Whitmore FRI 20494 (K!, L!); Pahang, Jeram Panjang, ♂ buds, 22 July 1970, Shah & Noor MS.2041 (A!, CANB!, L!); Taman Negara, Sungei Tembeling at Kuala Belau, high forested sandbank, fr., 7 March 1968, Whitmore FRI 8592 (holotype L!; isotypes A!, K!); Taman Negara, beside river, ♀ fl., fr., 18 Aug. 1982, Wong & Khairudden FRI 32624 (A!, K!, L!); Kelantan, Kuala Rek, ♂ buds, 27 Jan. 1923, Haniff SFN 10174 (BRI! [2 sheets], UC!); Sungai Lebir, on shale rocks over river, ♀ or ♂ fl., fr., 7 July 1935, Henderson SFN 29609 (A!, K!, L!). HABITAT. Rheophyte, on sandstone, shale, or sand along rivers, 30 – 90 m. Flowers recorded from February to August. 153

Fig. 1 [Fig. 5.28]. Gomphandra microcarpa. A. Habit (Whitmore FRI 8592); B. Male inflorescence, note decurrent ridges on twig (Shah & Noor MS.2041); C. Female inflorescence (Henderson SFN 29609). All scale bars = 1 cm.

154

Map 1 [Fig. 5.29]. Distribution of Gomphandra microcarpa (Δ) in Peninsular Malaysia.

CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra microcarpa has a conservation status of Vulnerable (VU B2ab(iii)). Specimens have been collected from an area of approximately 500 km2, at nine different localities. A status of Endangered (EN B2ab(iii)) might be more appropriate as it is likely that several populations were destroyed by logging and the creation of Tasik Kenyir in Terengganu. Gomphandra microcarpa is also a rheophyte, which means its potential area of occupancy might be substantially smaller than 500 km2. PHENOLOGY. Flowers have been recorded from February to August. NOTES. Specimens of Gomphandra microcarpa were previously identified as G. quadrifida (Bl.) Sleumer var. angustifolia (King) Sleumer. However, material of Gomphandra microcarpa does not match the type material of G. quadrifida var. angustifolia. Both taxa have narrow leaves, but Gomphandra quadrifida has terminal inflorescences, whereas G. microcarpa only has axillary inflorescences. The decurrent 155 ridges on the twigs below each petiole and the transverse ridges on the petiole, as well as the small fruit size, distinguish Gomphandra microcarpa. The 1968 population from the Trengan River was probably destroyed during the creating of Tasik Kenyir. The species may be restricted to the Banjaran Timur Mountains and is found in Taman Negara National Park.

Gomphandra tenuis Schori

Small tree (or shrub) to 12 m tall and 19 cm diam. Bark greyish white to brown, smooth, often covered with crustose lichens. Twigs slender, only slightly zigzag, youngest twigs < 1 mm in diam., initially pubescent with minute appressed hairs, glabrescent with age. Leaves chartaceous, ovate, ovate-elliptic, or somewhat obovate, rarely lanceolate, (4 – ) 5 – 11.5 × 1.5 – 3.5 cm, apex acute to acuminate, base rounded to acute, often inequilateral, glabrous at maturity, margin flat to very slightly revolute; midrib sunken above, raised below, secondary veins 2 – 4 pairs, flat above, raised below, converging towards margin, lowest pair steeply ascending, at least the upper pairs brochidodromous, tertiary veins obscure above, flat to slightly raised below, weakly percurrent; petiole slender, grooved, glabrescent, 0.4 – 0.9 cm × 0.6 – 1 mm. Inflorescences terminal or leaf-opposed, very slender, axes moderately pubescent with short appressed hairs. Male inflorescences with peduncle 0.5 – 1 cm long, then usually with 2 ( – 3) branches 1 – 1.5 cm long, each ending in a few-flowered cyme, rebranched or not, of 4 – 10 flowers on pedicels 1 – 4 mm long, 4 – 10 ( – 20) flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, glabrous, 1 mm across, < 1 mm high, petals 4 – 5, glabrous, white to yellowish-green, 3 mm long, stamens 4 – 5, exserted, 4 mm long, with a tuft of clavate hairs dorsally at the connective and scattered hairs ventrally below the anthers, ovary rudiment minute. Female inflorescences variable, with peduncle 0.5 – 1 cm long, bearing a solitary flower or up to 4 branches, branches 0.3 – 0.9 mm long, each with 1 – 3 flowers on pedicels 0.1 – 0.5 cm long, flowers 1 – 10 per inflorescence. Female flowers: calyx cupular, minutely apiculate, 1 mm across, < 1 mm high, petals 4 – 5, glabrous, 3 – 4 mm long, white to yellowish, staminodes 4 – 5, ovary cylindrical, glabrous, 2.5 – 3 mm long, 156

capped by a prominent stigma 1 – 2 mm in diam. Fruit obovoid-ellipsoid, base abruptly contracted, apex slightly beaked, 1.4 – 1.5 × 0.6 cm, inner mesocarp ridges scarcely evident, c. 8 anastomosing veins, stigma with a short groove, 2 mm in diam. Fig. 2 [Fig. 5.30].

Fig. 2 [Fig. 5.30]. Gomphandra tenuis. A. Twig with male inflorescence (Anuar KEP 115691; scale bar = 1 cm); B. Leaf and infructescence with flattened immature fruit (Chan FRI 17693; scale bar = 1 cm); C. Leaf and mature fruit (Stone 14505; scale bar = 1 cm); D. Male flower Anuar KEP 115691; scale bar = 4 mm). 157

DISTRIBUTION. Central Peninsular Malaysia. Map 2 [Fig. 5.31].

Map 2 [Fig. 5.31]. Distribution of Gomphandra tenuis (■) in Peninsular Malaysia.

SPECIMENS EXAMINED. MALAYSIA. Perak, Trolak Forest Reserve, ♀ fl., 18 March 1967, Chelliah KEP 104608 (A!, K!, L!); Tapah Hills, Sungai Woh, 1050 m [3500 ft.], fr., 13 July 1966, Ng FRI 1357 (K!, L!); Kelantan, Ulu Sungei Ketil [near Gua Musang], 150 m [500 ft.], imm. fr., 15 March 1972, Shah MS.2556 (BRI!, UC!); Terengganu, Kemaman District, Kajang, Ulu Bendong, 150 m [500 ft.], ♀ buds, 2 Nov. 1935, Corner SFN 30157 (A, K!, L!, LAE, SING); Bukit Kajang, 150 m [500 ft.], ♂ buds, 15 Nov. 1935, Corner SFN 30472 (A!, K!, L!, LAE, SING); Selangor, Gombak, Forest Research Institute Malaysia, keruing trail, 50 m, ♀ fl., imm. fr., 22 Sept 2005, Phoon et al. FRI 51551 (KEP, L!, SAN, SING); Bukit Lagong, 200 m [660 ft.], imm. fr., 12 April 1974, Ng FRI 22095 (K!, L!); Kepong, Forest Research Institute Plantations, imm. fr., 8 Oct. 1960, Yong KEP 94275 (L!); Bukit Lagong Forest Reserve, 150 m [500 158

ft.], ♂ fl., 6 Jan. 1967, Anuar KEP 115691 (A!, K!, L!); ibid, 150 m [500 ft.], imm. fr., 9 Jan. 1967, Gerus KEP 99453 (K!, L!); ibid, imm. fr., 18 Jan. 1979, Suppiah FRI 28323 (K!, L!); Genting Sempah, 450 m [1500 ft.], ♀ buds, fr., 15 May 1980, Stone 14505 (A!); Pahang, Taman Negara, path leading to Gunung Tahan, 150 m [500 ft.], ♂ buds, 21 April 1975, Chan FRI 21796 (A!, K!, L!); Ulu Sungai Sat near Kuala Kelepah [Kelapah], 30 m [100 ft.], imm. fr., 9 July 1970, Shah & Noor MS.1740 (L!, SING); Taman Negara, 90 m [300 ft.], ♂ buds, 19 April 1975, Ang Khoon Cheng FRI 23314 (K!, L!); Gunung Tapis, 550 m [1800 ft.], imm. fr., 27 Sept. 1971, Chan FRI 17693 (A!, K!, L!); Jerantut, Ulu Tekam, 150 m [500 ft.], imm. fr., 26 June 1972, Ng & Beltran FRI 6415 (A!, K!, L!); Taman Negara near Kuala Tahan, path to Bukit Tersek, ♂ buds, 10 June 1971, Whitmore FRI 20128 (A!). HABITAT. Ridge top, lowland forest, secondary forest on alluvium, 30 – 150 m, collected once at 1050 m. Galls on Suppiah FRI 28323 (L). CONSERVATION STATUS. Based on its extent of occurrence (IUCN 2001), Gomphandra tenuis has a conservation status of Near Threatened. However, a status of Vulnerable may be more appropriate. Populations that are in protected areas like forest reserves or national parks are probably secure, but populations from unprotected areas are likely to be threatened by logging and development activities. PHENOLOGY. Flowers occur throughout the year. ETYMOLOGY. The specific epithet refers to the slender twigs and peduncles. VERNACULAR NAME. Minyak berok (now applied to species of Xanthophyllum, Polygalaceae), kayu melada. NOTES. Gomphandra tenuis is a somewhat cryptic species that has commonly been identified as G. quadrifida (Bl.) Sleumer var. ovalifolia (Ridl.) Sleumer. It differs from Gomphandra quadrifida in its very slender twigs, petioles, and pedicels, its few-flowered inflorescences, and its habit (tree rather than shrub). The male inflorescences do not show any evidence of reblooming the way inflorescences of Gomphandra quadrifida do. Geographically, specimens of Gomphandra tenuis form a band across central Malaysia. At the edges of the species’ range, specimens morphologically intermediate with Gomphandra quadrifida may be found where the two species overlap. These 159

intermediates, which may represent hybrids, are found at high elevations, while specimens of Gomphandra tenuis are mostly from below 150 m. Gomphandra tenuis is also similar to G. lamanii Schori, which occurs in Borneo, and G. oligantha Sleumer, found in the Philippines. Gomphandra lamanii has prominent brochidodromous secondary venation, appressed reddish pubescence, and distinct ridges on the fruit. Gomphandra oligantha has wider, caudate leaves with more veins, longer pedicels, fewer female flowers, and more prominently ridged fruit.

Gomphandra coi Schori

Shrub or small tree to 4 m tall and 2 cm in diam. Twigs green when fresh, apparently glabrous, 1.5 – 2.5 mm in diam., older portions of twigs stout. Leaves variable, shining above and bullate when fresh, ovate-oblong to elliptic or occasionally lance-ovate, tapered at base, acuminate at apex, chartaceous, apparently glabrous, 12 – 17 ( – 21) × (3 – ) 3.5 – 7 cm, midrib sunken above, raised below, secondary veins (3 – ) 6 – 8 pairs, sunken above when fresh, flat to slightly raised when dry, raised below, lowest pair often steeply ascending, converging, upper pairs often joining toward margin, intersecondary veins common, tertiary veins flat above, slightly raised below, percurrent; petiole possibly a bit decurrent on twig, grooved, (0.5 – ) 1 – 2 cm long, glabrescent. Inflorescences axillary on mature portions of the twigs, 1 ( – 2) per axil. Male inflorescences only known from photographs, with peduncle as long as petioles, bearing several short branches, each with up to 6 subsessile flowers, ca. 15 – 30 flowers per inflorescence. Male flowers: calyx short, green, lobed; petals greenish-white, probably glabrous; stamens white, well exserted, possibly glabrous. Female inflorescences and flowers not known. Infructescences axillary, peduncle 2 – 3 mm long, with 1 or 2 branches 1 – 2 mm long, fruit crowded in a reduced cyme, pedicels 1 – 2 mm long, up to 9 fruit per infructescence. Fruit ovoid, white at maturity, base slightly to prominently swollen, apex slightly tapered, 1.6 – 1.8 ( – 2) × 0.7 – 0.8 cm, stigma 2 – 2.5 mm across, brown when fresh, inner mesocarp with 10 – 13 low anastomosing ridges. Fig. 3 [Fig. 5.32]. 160

Fig. 3 [Fig. 5.32]. Gomphandra coi. A. Twig with infructescences (Co 3591); B. Leaf (Ridsdale et al. ISU 472). Scale bars = 1 cm.

DISTRIBUTION. Philippines. Endemic. Map 3 [Fig. 5.33]. SPECIMENS EXAMINED. PHILIPPINES. Isabela Province, Palanan. Dipaguidin, [17°07’ N, 122°32’ E], 100 [m?], imm. fr., 18 April 1991, Ridsdale et al. ISU 68 (A!, K!, L! [2 sheets]); Digallorin, Divinisa camp site, [16°50’ N, 122°26’ E], 50 m, fr., 10 April 1992, Ridsdale et al. ISU 472 (A!, K!, L!); Guess, fr., 29 April 1991, Gaerlan et al. PPI 2757 (A!, K!, L!, 7 other dups. n.v.); Barangay San Isidro, Sitio Diago, 17°07.7’ N, 122°30.9’ E, 30 m, fr., 27 May 1991, Co 3591 (holotype A!; isotypes CAHUP!, CANB!, Isabela State University n.v., K! [2 sheets], KEP n.v., L!, PNH n.v., PUH!, US!). HABITAT. Over limestone; lowland dipterocarp forest; streamside forest on ultramafic soil; 30 – 50 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra coi has a conservation status of Endangered (EN B2ab(iii)). The species has been collected from four localities in Palanan and is not known from any other locations. At one time the species may have occurred elsewhere in the Sierra Madre mountains, but much of the mountain range has been logged for timber and charcoal or turned into agricultural land. 161

PHENOLOGY. Flowers in October, ripe fruits in May. ETYMOLOGY. The specific epithet honors Leonardo Co, the Philippines’ preeminent field botanist. NOTES. Gomphandra coi is undoubtedly closely related to G. psilandra Schori and G. mappioides Valeton. It has similar leaves, axillary inflorescences, and white fruit. It can easily be distinguished from Gomphandra mappioides by its much shorter infructescence (peduncle 2 – 3 mm versus 1 cm) which bears up to 9 fruit, instead of 4 – 5. Gomphandra psilandra is more similar to G. coi in infructescence length, but it only has 4 (rarely 5) female flowers or fruit, and its fruits are longer (2 – 2.5 cm vs. 1.6 – 1.8 ( – 2) cm), without a swollen base. The leaves of all three taxa are quite similar and sterile material cannot always be identified to species. Gomphandra psilandra and G. mappioides are related, based on molecular data, and G. coi is expected to have a similar insertion in the trnL-F spacer. Flowering material needs to be collected to complete the description of Gomphandra coi, though it is expected that the flowers are quite similar to those of G. psilandra and G. mappioides.

162

Map 3 [Fig. 5.33]. Distribution of Gomphandra coi (▲) and G. psilandra (■) in Luzon, Philippines.

Gomphandra psilandra Schori

Small tree to 6 m tall, 15 cm diam. Bark smooth, gray-brown, with lenticels. Twigs zigzag, young twigs green, puberulent, older twigs glabrescent, 1.5 – 2.5 cm in diam., pubescence short, dark brown to yellowish-brown. Leaves chartaceous, firmly so when fresh, medium green above and slightly glossy, paler beneath, quickly glabrescent, size and shape variable, ovate-elliptic to oblong, base rounded to acute, often somewhat oblique, apex acute to shortly acuminate, (9 – ) 10 – 16 ( – 21) × 3.5 – 7 ( – 9) cm, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 5 – 8 pairs, flat or impressed above and leaf bullate between veins when fresh, upper pairs joining at margin, raised below, tertiary veins flat and indistinct above, weakly percurrent and darker green than leaf surface below; petioles grooved, 0.9 – 1.2 ( – 1.5) cm long. Inflorescences axillary from previous year’s growth, glabrous or with few 163

scattered hairs, bracts minute, triangular, pubescent with short dark brown hairs, subtending each flower. Male inflorescences with peduncle 1 – 2 mm long, bearing 2 – 3 branches 1 – 2 mm long, flowers 7 – 10 per inflorescence, crowded, sessile or on pedicels 1 mm long. Male flowers: calyx cupular, apiculate, sparsely ciliate, 1.5 – 2 mm wide; petals 5, whitish at base, green and green-spotted at lobes, glabrous, 4 mm long; stamens 5, white, strongly exserted, 5 – 6 mm long, glabrous, anther sacs brownish, pollen white; ovary rudiment minute, yellowish, glabrous. No fragrance noted. Female inflorescences with peduncle <1 – 2 mm long, bearing 2 – 4 (rarely 5) flowers, pedicels 1 mm long. Female flowers: calyx cupular, apiculate, sparsely pubescent, 1 mm high by ca. 2.5 mm wide, petals (4 – ) 5, pale green, glabrous or with a few hairs at lobe tips, 4 – 5 mm long, corolla splitting on one side in bud; staminodes 4 – 5, strongly exserted, 6 – 7 mm long, white, glabrous, anther cells brownish-yellow, empty; ovary yellowish-cream, 4 – 5 mm long, cylindrical, slightly curved and gibbous at the base, glabrous, stigma cream, not clearly distinct from ovary, 5-lined, sometimes undulate at edges, 2.5 – 3 mm across. Infructescence axillary, bearing up to 4 fruit, peduncle 0.5 cm long, pedicels 0.2 – 0.4 cm long. Immature fruit elliptical, light green, glabrous, punctate, asymmetrically curved, becoming yellowish-green and more symmetric with age. Fruit ivory or cream when ripe, 2.0 – 2.5 × 1.3 – 1.4 cm when fresh, ± cylindrical, base acute, apex truncate, outer mesocarp 2 mm thick, fleshy when fresh; dried fruit 2.0 – 2.5 cm × 0.7 cm, narrowly obovoid-ellipsoid to cylindrical, apex and base slightly tapered, stigma displaced towards sulcus, 2.5 – 3 mm in diam., inner mesocarp with ca. 11 longitudinal ridges. Fig. 4 [Fig. 5.34]. 164

Fig. 4 [Fig. 5.34]. Gomphandra psilandra. Twig with fruit (Burley 56, scale bar = 1 cm).

DISTRIBUTION. Philippines, Luzon, Quezon and Laguna Provinces. Map 3 [Fig. 5.33]. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Quezon Province, Quezon Natural Park, road between Pagbilao and Atimonan, 13°59’ N, 121°50’ E, 250 – 300 m, fr., 2 April 1987, Burley 56 (holotype PNH!; isotypes A!, BISH [2 sheets], F!, K!, L!, 165

US!); ibid, 350 m [1150 ft.], fr., 23 Dec. 1964, Hernaez 992 (CAHUP! [2 sheets]); ibid, 200 m, sterile, 13 Oct. 2006, Fernando & Schori 1820 (BHO!, LBC!); ibid, 200 m, ♀, 13 Oct. 2006, Fernando & Schori 1821 (A!, BHO!, CAHUP!, PNH!); ibid, sterile, 13 Oct. 2006, Fernando & Schori 1822 (BHO); ibid, 220 m, imm. fr., 13 Oct. 2006, Fernando & Schori 1823 (BHO!, CAHUP!, K!, LBC!, MO!, PNH!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-1 (A!, K!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-2 (CAHUP!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-3 (A!, K!, L!, PNH!); ibid, 290 m, ♂ fl., 10 Feb. 2007, Schori & Breganza 2007-4 (A!, K!, PNH!); Llavac, University of the Philippines Land Grant, 300 m, fr., 17 Nov. 1970, Hernaez 1542 (CAHUP!); ibid, Lalawinan River, 270 m, imm. fr., 6 June 2007, Schori 2007-20 (CAHUP!, PNH!); Tayabas Province [now Aurora and Quezon Provinces], Mt. Pular, Jan. 1913, Ramos B. S. 19415 (K!, P!, US!); Luzon, Laguna Province, no specific locality, imm. fr., Nov. 1915, Amarillas F. B. 24672 (L!, NY!, US!). HABITAT. Lowland dipterocarp forest below 300 m, often near streams. CONSERVATION STATUS. Gomphandra psilandra has a conservation status of Endangered (EN B2ab(iii,iv)), based on IUCN (2001) guidelines. The species is known from two extant populations in Quezon Province, one of which is a protected area. In general, lowland forest does not occur in Laguna or Quezon Provinces outside of protected areas. The exact location of Mt. Pular has not been established, but both the population there and the one from Laguna Province should be considered extirpated. Unless more populations are found further north in the Sierra Madre mountains, Gomphandra psilandra can be considered restricted to two localities in Quezon Province. The population in Llavac may be threatened by logging operations, but it is likely the species will persist in small patches of forest. PHENOLOGY. In Quezon Province, flowers were present from February to April. Immature fruits were observed in October and February, with ripe fruits present in May. The endocarp and inner mesocarp are very slow to develop, and fruit maturation may take more than a year from the time of flowering. ETYMOLOGY. The epithet psilandra refers to the glabrous anthers. 166

NOTES. Gomphandra psilandra is only known from a few localities. Extant populations are present at Quezon Natural Park and at the UP land grant in Llavac, and other populations are likely in the appropriate lowland dipterocarp habitat. Gomphandra psilandra is related to G. mappioides Valeton, which has much longer peduncles and pedicels, stamens that are often pubescent, and a different fruit shape with a broader stigma. Gomphandra psilandra is probably closely related to G. coi Schori, which has more flowers in its inflorescences (up to 9 female and 15 – 30 male), and wider, shorter fruit (1.6 – 1.8 ( – 2) cm long) with a swollen base. Vegetatively these three species may be difficult to distinguish. Molecular data show that Gomphandra psilandra and G. mappioides are related to each other, though G. mappioides is more closely related to G. javanica, which has a similar inflorescence structure and white fruit.

Gomphandra dinagatensis Schori

Twigs 1.5 – 2.5 mm in diam., initially pubescent with minute appressed hairs, glabrescent. Leaves coriaceous, glabrous at maturity, shiny above when dry, narrowly ovate to ovate-elliptic, apex acuminate, base acute to attenuate, 6.5 – 13 × 2 – 4 cm, margin slightly revolute; midrib sunken above, raised below, secondary veins flat or impressed above, flat below, 4 – 6 pairs, parallel, upper pairs joining (brochidodromous) near the margin, tertiary veins not visible; petiole grooved above, glabrescent, 1.2 – 2 cm long. Male inflorescences and flowers unknown. Female inflorescences axillary, occasionally at the end of a branch but then clearly axillary (between the ultimate leaf and the terminal bud), peduncle 1 – 1.5 cm long, bearing 2 – 3 branches 2 – 4 mm long, branches either serving as pedicels or branching again and bearing 2 – 4 flowers, flowers subsessile or on pedicels to 2 mm long, up to 12 flowers per inflorescence. Female flowers not seen at anthesis, calyx glabrous, 1 – 1.5 mm wide, ovary cylindrical, glabrous, 2.5 – 3 mm long, stigma 1 – 1.5 mm in diam. Fruit submature, obovoid- ellipsoid, 1.4 – 1.6 × 0.7 – 0.9 cm, stigma lobed, scarcely raised, slightly displaced toward sulcus, 2 mm in diam., inner mesocarp with ca. 15 – 18 low, anastomosing longitudinal ribs. Fig. 5 [Fig. 5.35]. 167

DISTRIBUTION. Philippines: Dinagat Island. Endemic. See Map 4 [Fig. 5.37] for the location of Dinagat Island. SPECIMENS EXAMINED. PHILIPPINES. Dinagat Province, Dinagat, no specific locality, May 1919, Ramos & Pascasio B.S. 35264 (holotype K!; isotypes A!, BM! photo, L!, P!, US!). HABITAT. Dinagat Island is characterized by ultramafic soils, and although no specific locality was given on the type specimen, the only remaining forest on the island is on Mt. Redondo and in the Paragua Forest Reserve. Mt. Redondo is the highest point on the island, with an elevation of 935 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra dinagatensis has a conservation status of Critically Endangered (CR B1ab(iii)). The species is known from a single collection on Dinagat Island, and in 2008, only two areas on the island still had forest. Mt. Redondo is being actively mined, so the Paragua Forest Reserve in Tubajon is the only place that could reliably provide habitat for the species on Dinagat Island. PHENOLOGY. Fruits were present in May. NOTES. Gomphandra dinagatensis is only known from the type specimen. It resembles several other species, but its affinities are not clear. At first glance, the shiny leaves and branched infructescences resemble Gomphandra fernandoi Schori & Utteridge, which is also found on Dinagat, but the leaves of G. dinagatensis are glabrous, the infructescences are axillary rather than terminal, and the fruit are smaller with a less prominent stigma. The type also appears similar to a few specimens of Gomphandra ultramafiterrestris Schori, but the leaves of G. dinagatensis are longer, the fruits are larger, and the infructescences are axillary rather than terminal. Ramos & Pascasio B.S. 35264 was once identified as Gomphandra oblongifolia Merr., but that species has terminal or leaf- opposed inflorescences and a prominent, cap-like stigma on its fruit. Based on its leaves and inflorescence structure, one would expect it to belong to the Gomphandra luzoniensis (Merr.) Merr. group, but those taxa have terminal inflorescences, which are not present in G. dinagatensis. A recent collection from Mt. Redondo, Schori 2008-6, may belong to 168

Gomphandra dinagatensis, but fertile material was not present. The specimen has much shorter petioles and different secondary venation, so it might represent an undescribed species.

Fig. 5 [Fig. 5.35]. Gomphandra dinagatensis (Ramos & Pascasio B.S. 35264). A. Twig with infructescences; B. Fruit. Scale bars = 1 cm. 169

Gomphandra ultramafiterrestris Schori

Shrub or small tree to 8 m tall and 10 cm diam. Bark light gray to tan, slightly fissured in older trees. Twigs green when young, pubescent with minute appressed tawny or cinereous hairs, eventually somewhat glabrescent, 1 – 2 mm in diam. Leaves coriaceous, ovate to obovate, base rounded to acute, apex acute to acuminate, dark green and slightly shining above when fresh, pale green and matte below, glabrous above or sparsely pubescent by petiole, glabrous below, margin revolute, (4 – ) 5 – 10 × (1.8 – ) 2.5 – 5 cm; midrib impressed above, raised below, secondary veins 2 – 5 pairs, flat to impressed above, slightly raised and distinctly darker than lower leaf surface below, ± parallel or converging toward margin, upper pairs sometimes brochidodromous, tertiary veins not or scarcely evident, weakly percurrent; petioles grooved above, 0.4 – 1 ( – 1.5) cm long, pubescent with short somewhat appressed tawny hairs. Inflorescences terminal, axes pubescent with appressed hairs. Male inflorescences with peduncle 1.7 – 2 cm long, bearing 4 branches 0.4 – 1.5 cm long, branches often branched again, terminal segments bearing flowers in a scorpioid cyme, inflorescences to 5 cm long overall, 30 – 50 ( –100) flowers. Male flowers: calyx cupular, 1.5 – 2 mm across, sparsely ciliate, minutely apiculate, petals 5, yellowish-green, glabrous or very sparsely pubescent with minute hairs outside, 5 – 6 mm long; stamens 5, white, 0.8 – 0.9 cm long, strongly exserted 3 mm and recurved, with a penicillate tuft of clavate hairs dorsally below the anthers, a few scattered hairs ventrally, pollen white; ovary rudiment glabrous, 1 mm across, depressed globose and slightly 5-angled, apex apiculate. Female inflorescences with peduncle 1 – 1.5 cm long, bearing 4 branches 0.3 – 0.8 cm long, each with a simple or branched scorpioid cyme of 3 – 5 flowers on pedicels <1 – 4 mm long, up to 20 flowers per inflorescence. Female flowers: calyx cupular, 2 mm across, sparsely ciliate, 4-5-lobed or minutely dentate, petals 5 ( – 6), yellowish-green, 4 – 5 mm long, corolla splitting down one side; staminodes 5, white, scarcely exserted, 4 – 5 mm long, one reflexed through split in corolla, pubescent dorsally at the connective with long spreading and tangled clavate hairs, sparsely pubescent dorsally below the brownish anther cells; ovary glabrous, bright green, 3 – 4 mm long, 5-angled, stigma yellowish, sharply angled. Fruit 170

globose or obovoid, glabrous, punctate, pinkish-beige and flesh 1.5 mm thick when ripe, 1.1 – 1.4 × 0.8 – 0.9 cm, with ca. 12 low ridges, stigma brown, 2 – 2.5 mm across, lobed and sharply angled. Fig. 6 [Fig. 5.36].

DISTRIBUTION. Philippines, Mindanao: Dinagat Province, Dinagat; Davao Oriental Province, Mt. Hamiguitan. Map 4 [Fig. 5.37]. SPECIMENS EXAMINED. PHILIPPINES. Mindanao, Davao Oriental Province, Mt. Hamiguitan, 950 m, imm. fr., 18 April 2007, Schori & Hilario 2007-9 (A!); ibid, 990 m, ♀ fl., fr., 19 April 2007, Schori & Hilario 2007-10 (holotype PNH [fr., temporarily at A], isotypes A [2 sheets – fl.; fr.], K [2 sheets, fl], L [fl. & fr.], NY [fl.], US [sterile]); ibid, 890 m, ♂ fl., Schori & Hilario 2007-11 (A, K, L, NY); Dinagat Province, Dinagat Island, Mt. Redondo, KROMINCO mining site, 700 m, imm. fr., 30 Sept. 1991, Gaerlan et al. PPI 4727 (CAHUP!, K!, L!, MO! [2 sheets], PNH!, US!); Loreto, Santiago, Cambinliw, 200 m, imm. fr., 29 Sept. 1991, Gaerlan et al. PPI 4599 (MO!, PNH!). HABITAT. Gomphandra ultramafiterrestris is found on ultramafic soils in montane forest. On Dinagat, the species is found from 200 – 700 m. On Mt. Hamiguitan, it may be found at 800 – 1000 m. It is not present in the shortest “bonsai” forest that covers exposed ridges in both localities, but it may occur in the understory of taller forest, or at the edges of short canopy forest. CONSERVATION STATUS. Gomphandra ultramafiterrestris has a conservation status of Endangered (EN 2ab(iii,iv,v)), based on IUCN (2001) guidelines. The species is known from three localities. Populations on Dinagat and Mt. Hamiguitan are widely separated, with little or no suitable habitat in between. On Dinagat, Mt. Redondo and Paragua Forest Reserve are the only areas that are still forested, and Mt. Redondo is being actively mined. The plants on Mt. Hamiguitan are in a protected area and are presumably secure, but individual trees may be cut for local use by rattan collectors, and parts of the mountain near the population have accidentally burned in the past. PHENOLOGY. Flowers and ripe fruits in April on Mt. Hamiguitan. ETYMOLOGY. The specific epithet refers to the ultramafic soils on which this species grows. 171

Fig. 6 [Fig. 5.36]. Gomphandra ultramafiterrestris. Mt. Hamiguitan plants: A. Twig with infructescence (Schori & Hilario 2007-10); B. Male inflorescence (Schori & Hilario 2007-11); C. Male flower (Schori & Hilario 2007-11); D. Female flower (Schori & Hilario 2007-10); Dinagat plants: E. Leaf (Gaerlan et al. PPI 4599); F. Fruit (Gaerlan et al. PPI 4727); G. Leaf (Gaerlan et al. PPI 4727). All scale bars = 1 cm except D (scale bar = 5 mm). 172

Map 4 [Fig. 5.37]. Distribution of Gomphandra ultramafiterrestris (□) on Dinagat Island (upper arrow) and Mindanao (lower arrow).

NOTES. Gomphandra ultramafiterrestris is not the only species that occurs on ultramafic soils, but it seems to be restricted to them. Gomphandra oligantha Sleumer and G. fernandoi Schori & Utteridge also grow on Dinagat, whose geology is characterized by heavy metal content. Gomphandra ultramafiterrestris belongs to the G. luzoniensis (Merr.) Merr. group, based both on morphology and molecular data. It differs from all other members of the group in its small, coriaceous leaves and its small fruit. The fruit shape resembles that of Gomphandra oligantha and G. halconensis Schori, but both species can be easily distinguished by differences in their leaves and inflorescence structures. Collections from Dinagat and Mt. Hamiguitan are treated as the same species here, though there are minor morphological differences between the localities. PPI 4727 has small leaves and globose fruits, and although the fruits are immature, their inner mesocarps are sclerified so it is doubtful that their size or shape would change substantially at maturity. PPI 4599 also has immature globose fruits, and it has both small leaves and larger leaves with more secondary veins. The differences in leaf morphology 173

are probably due to environmental differences, as PPI 4599 was collected at 200 m and was likely more sheltered than PPI 4727, which was collected at 700 m at the edge of an open pit mine. Collections from Mt. Hamiguitan tend to have larger leaves and fruits, but there are no consistent characters that can be used to distinguish the populations. If mature fruiting and flowering material can be collected from Dinagat, and they show differences from the Mt. Hamiguitan population, it may be appropriate to recognize two subspecies. The description above is based primarily on material from Mt. Hamiguitan, but Gomphandra hamiguitanensis was dismissed as an appropriate name after the material from Dinagat was determined to represent the same taxon. Gomphandra ultramafiterrestris is unusual in that it is one of only a few species in the genus that exhibits pronounced floral dimorphism between stamens and staminodes. Some degree of floral dimorphism exists throughout the genus between pistillate and staminate flowers, but the difference in Gomphandra ultramafiterrestris between the stamens, which are exserted 3 mm, and the staminodes of pistillate flowers, which scarcely exceed the corolla, is striking.

Gomphandra borneensis Schori

Shrub or small tree to 5 m high and 5 cm diam. Bark smooth, grey. Twigs slender, somewhat zigzag and frequently branched, 0.8 – 1.5 mm in diam., initially pubescent with minute appressed tawny to brown hairs, glabrescent with age. Leaves variable in shape, chartaceous, glabrous above, glabrous to sparsely pubescent below at maturity, lanceolate to ovate to obovate-elliptic, base acute to attenuate, apex acute to caudate, margins flat to slightly revolute, (5 – ) 6 – 13 ( – 18) × 1.5 – 4.5 cm; midrib impressed above, raised below, secondary veins 3 – 5 ( – 6) pairs, impressed above, raised below, veins converging to ± parallel, upper pairs often joining near the margin, tertiary veins flat above, scarcely raised below, weakly percurrent; petiole narrowly grooved, 0.4 – 0.6 ( – 1) cm long, sparsely pubescent to glabrescent. Inflorescences axillary, on mature portions of twigs, often from flowering short shoots, 1 – 2 per axil. Male inflorescences with slender peduncle 0.2 – 0.8 ( – 1.5) cm long, with up to 4 branches 2 – 3 mm long, 174

these with up to 4 flowers on pedicels 1 – 2 mm long, inflorescences typically ~ 1 – 1.5 cm long overall, with 2 – 15 flowers. Male flowers: calyx cupular, minutely toothed, sparsely pubescent, 1 – 1.5 mm across; petals 4, white, 3.5 – 4 mm long, glabrous, stamens 4, exserted 1 mm, 4.5 – 5 mm long, pubescent dorsally at the connective with a tuft of clavate hairs and ventrally below the anther with scattered hairs, ovary rudiment minute. Female inflorescences axillary, peduncle 0.2 – 0.5 cm long, bearing up to 4 pedicels 1 – 3 mm long (elongating to 0.5 cm in fruit), up to 4 flowers per inflorescence, axes pubescent with minute appressed hairs. Female flowers: calyx cupular, petals glabrous, staminodes not seen, ovary glabrous, narrowly obconic, 2 mm long, stigma capping the ovary, 1 mm across. Fruit glabrous, reportedly white (fide Clemens & Clemens 35031) to pink (fide Clemens & Clemens 50013) but not necessarily at maturity, obovoid to clavate, sometimes curved, base attenuate, very base swollen, apex abruptly contracted and slightly beaked, 1.2 – 1.5 × 0.6 – 0.7 cm, stigma 2 – 2.5 mm in diam., inner mesocarp with 7 longitudinal ridges, several ridges usually quite prominent. Fig. 7 [Fig. 5.38]. 175

Fig. 7 [Fig. 5.38]. Gomphandra borneensis. Twig with male inflorescence (Beaman et al. 8212, scale bar = 1 cm). 176

DISTRIBUTION. Borneo. Map 5 [Fig. 5.39].

Map 5. [Fig. 5.39]. Distribution of Gomphandra borneensis (■) in Borneo.

SPECIMENS EXAMINED. MALAYSIA. Sabah, Mt. Kinabalu, Penibukan, 1200 – 1500 m [4000 – 5000 ft.], Dec. 1932, Clemens & Clemens s.n. (A!, L! [2 sheets] NY!); ibid, 17 Jan. 1933, Clemens & Clemens s.n. (K!, L!, UC!); ibid, 1200 – 1500 m [4000 – 5000 ft.], buds, 28 Dec. 1932, Clemens & Clemens 30487 (A!, BM!, L!, NY!); ibid, 1200 – 1500 m [4000 – 5000 ft.], imm. fr., 11 March 1933, Clemens & Clemens 35031 (A!, BM!, L!, NY!); ibid, ridge near Dahobang River, 1000 m [3300 ft.], ♂ buds, 27 Sept. 1933, Clemens & Clemens 40477 (A!, BM!, G n.v., K!, L!, MICH!, NY!, UC!); ibid, near Pinokok, 1980 m [6500 ft.], ♂ fl., 27 Oct. 1933, Clemens & Clemens 40937 (A!, BM!, K!, NY!, UC!); ibid, near Pinokok falls, 1830 m [6000 ft.], imm. fr. 18 Oct. 1933, Clemens & Clemens 50013 (A!, K!, NY!); Lobang, fr., Nov. 1915, Clemens 10321 (A!, L!, PNH!); Ranau District, Tenompok Ridge along Tamparuli – Ranau Road 6 km W of Kinabalu Park headquarters, 6°01’ N, 116°30’ E, 1400 – 1450 m, ♂ fl., 3 Jan. 1984, Beaman et al. 8212 (holotype MO!; isotypes GH!, K!, L!, MICH!, NY!); Crocker Range, 177

Bukit Lugas, Kg. Himbaan 8.5 km SE of Tenompok, 5°57’ N, 116°34’ E, 1250 m, imm. fr., 29 April 1984, Beaman et al. 9501 (K!, L!); ibid, 1250 – 1300 m, 7 July 1984, Beaman et al. 10575 (GH!, K!, L!, MO!); Tenompok, 1500 m [5000 ft.], imm. fr., 10 Feb. 1932, Clemens & Clemens 28226 (A!, BM!, BO n.v., K!, L!, NY!); ibid, 1500 m [5000 ft.], imm. fr., 11-12 Feb. 1932, Clemens & Clemens 28365 (A!, K! [Feb. 11], UC!); Jalan liring Sosopodon, 1400 m [4600 ft.], ♀ buds, imm. fr., 4 Jan. 1963, Tikau SAN 33713 (K!, SAN n.v.); Liwagu Sosopodon near Kundasang, 1200 m [4000 ft.], imm. fr., 6 Jan. 1965, Taipin SAN 47950 (K!, L!); Minitindok Gorge, imm. fr., Nov. 1915, Clemens 10436 (A!, PNH!); Tambunan District, Crocker Range, km 64 on Kota Kinabalu – Tambunan Road, 5°46’ N, 116°21’ E, 1250 m, buds, 27 April 1984, Beaman et al. 9498 (K!, L!); Trusmadi Forest Reserve above Ulu Koingaran River, 1830 m [6000 ft.], ♂ buds, 28 Oct. 1964, Mikil SAN 44333 (K!, L!, SAN n.v.); Rafflesia Virgin Jungle Reserve, fr., 9 Aug. 1990, SAN 130753 (K!, L!); Penampang District: Crocker Range, km 49.5 on Kota Kinabalu – Tambunan Road, 5°50’ N, 116°20’ E, 1350 – 1500 m, ♂ fl., 3 July 1984, Beaman et al. 10446 (GH!, K!, L!, MICH!, MO!); Dallas, 900 m [3000 ft.], buds, 21 Aug. or 1 Sept. 1931, Clemens & Clemens 26254 (26148) (A!, BM, K!, L!, NY!, UC!); ibid, 900 m [3000 ft.], ♂ buds, 15 Dec. 1931, Clemens & Clemens 27548 (A!, BM!, G n.v., K!, L!, NY!, UC!); Sandakan District, Bukit Tingka Kinabatangan, 670 m [2200 ft.], fr., 24 Nov. 1960, Meijer SAN 23286 (K!); Keningau District, Mt. Trusmadi Forest Reserve, 120 – 150 m [400 – 500 ft.], imm. fr., 23 Aug. 1977, Madani SAN 87188 (K!, L!); Kinabalu, Kadamaian, 1370 m [4500 ft.], fr., Haviland 1243 (K!); Sarawak, Baram, Ulu Melinau, imm. fr., 12 Aug. 1958, Ashton BRUN 3232 (BO n.v., K! [2 sheets], L!); BRUNEI. Temburong, Sungai Temburong Machang, 200 m, ♂ buds, 21 Aug. 1990, Wong WKM 1977 (K!); Temburong, Amo, Ulu Belalong, 4°29’ N, 115°11’ E, 900 m, fr., 22 Feb. 1992, Dransfield et al. JD7156 (K! [2 sheets], L!); ibid, 4°23.310’ N, 115°11.195’ E, 500 m, buds, 23 Jan. 1994, Dransfield et al. 7433 (A!, K!, L!); Temburong, Kuala Belalong National Park, imm. fr. 21 Feb. 1994, Nangkat et al. BRUN 15041 (A!, K!, L!). 178

HABITAT. Montane dipterocarp forest; oak-laurel forest; primary forest; steep slope; ultramafic soil; clay soil and sandstone; limestone boulders; 500 – 1500 m. Leaf galls present along veins. CONSERVATION STATUS. Based on its historical distribution, Gomphandra borneensis has a conservation status of Least Concern (LC) (IUCN 2001). However, a status of Vulnerable (VU A2c or VU A3c) may be more appropriate. Many of the collections from Sabah were from the 1930s, and while the species is still present on Mt. Kinabalu and in the surrounding area, deforestation is a threat and will continue to reduce the available habitat. Conversion of lowland forest to oil palm plantations poses a particular threat in parts of Sabah and Sarawak. VERNACULAR NAME(S). Kerak nasi (Sarawak), jirak (Ib., Brunei). NOTES. Gomphandra borneensis is superficially similar to G. quadrifida (Bl.) Sleumer and G. oligantha Sleumer in terms of leaf shape, pedicel thickness, or fruit shape, but both of those species have terminal inflorescences. Gomphandra borneensis is most likely to be confused with G. cumingiana (Miers) Fern.-Vill., which grows in the same areas in Borneo. The two species can overlap in leaf morphology, but a discriminant analysis confirmed that they are separate taxa. Gomphandra cumingiana has larger leaves with more veins, is persistently pubescent abaxially, and has pubescent fruit. Gomphandra cumingiana also has relatively straight, sparingly branched twigs. In contrast, many herbarium specimens of Gomphandra borneensis look somewhat messy, with many short branches and swollen nodes where several accessory buds have produced branches or inflorescences. Very short internodes are often present at the end of a season’s growth, giving the appearance of opposite leaf scars at intervals along the twigs. In the field, it may be possible to distinguish the two species by their habits.

Gomphandra kinabaluensis Schori var. kinabaluensis

Tree 9 – 23 m tall, to 10 cm diam. Twigs slightly zigzag, 1.5 – 2.5 mm in diam, initially covered with minute appressed pubescence, glabrescent with age. Leaves variable, thinly to thickly coriaceous, ovate to ovate-elliptic or obovate, acute to abruptly acute or 179

acuminate, base rounded to acute, (4.5 – ) 8.5 – 12.5 ( – 15.5) × (2.0 – ) 3.0 – 6.1 cm, margin slightly to distinctly revolute; midrib impressed above, raised below, secondary veins 5 – 6 ( – 7) pairs, obscure, flat, slightly raised, or slightly impressed above, raised below, upper pairs usually joining near margin, tertiary veins not visible to slightly raised on both sides, weakly reticulate; petioles 0.7 – 1.8 cm × 1 – 2 mm, grooved above, glabrescent with age. Inflorescences axillary, sometimes from accessory buds. Male inflorescences with peduncle (0.6 – ) 1 – 3 cm long, bearing 2 – 3 branches 2 – 5 mm long, each branch with 2 – 5 crowded sessile or shortly pedicellate flowers, up to 10 flowers per inflorescence. Male flowers: calyx cupular, 1 – 1.5 mm across, pubescent, lobed, petals 4 – 5, free, white, glabrous, 3 – 4 mm long, stamens 4 – 5, not or scarcely exserted, filaments 3 – 4 mm long, with short papillose hairs on inner face, ovary rudiment glabrous. Female inflorescences with peduncle 0.6 – 2 cm long, bearing 2 – 4 flowers on pedicels 1 – 4 mm long (pedicels elongating in fruit). Female flowers: calyx pubescent, lobed, 1 mm across, petals 4 – 5, free to base, white to cream, 4 mm long, glabrous, staminodes 4 – 5, 3 mm long, with at least a few short papillose hairs on the inner face, ovary glabrous, 3 – 4 mm long (Clemens & Clemens 32597). Fruit ellipsoid, pale pinkish (fide Clemens & Clemens 32462) to salmon-pink (fide Clemens & Clemens 35030) when mature, 11.4 – 1.9 × 0.6 – 0.8 cm, base sometimes very slightly swollen, apex asymmetric when dried, stigma 2 – 2.5 mm in diam., displaced toward sulcus, inner mesocarp with 8 – 10 low ridges. Fig. 8 [Fig. 5.40].

180

Fig. 8 [Fig. 5.40]. Gomphandra kinabaluensis var. kinabaluensis. A. Twig with female inflorescence (Clemens & Clemens 50307); B. Leaf variation – large leaf (Clemens & Clemens 32597); C. Leaf variation – small leaf (Clemens & Clemens 35039); D. Fruit (Clemens & Clemens 32462); E. Male inflorescence (Clemens & Clemens 50307). All scale bars = 1 cm. 181

DISTRIBUTION. Malaysia, Sabah, Mt. Kinabalu. Map 6 [Fig. 5.41].

Map 6 [Fig. 5.41]. Distribution of Gomphandra kinabaluensis var. kinabaluensis (Δ) and var. clemensiorum (□).

SPECIMENS EXAMINED. MALAYSIA. Clemens & Clemens 31997 pro parte (L!) Marai Parai, 1550 m [5000 ft]., imm fr., 22 March 1933, Clemens & Clemens 32260 (A!, BM!, L!, NY!); S of camp, ♀ buds, 24 March 1993, Clemens & Clemens 32341 (BM!, L!); 1550 m [5000 ft.], fr., 30 March 1933, Clemens & Clemens 32462 (K! holotype, isotypes A!, BM!, BO n.v., G n.v., L!, NY!, UC!); ♂ buds, 4 April 1993, Clemens & Clemens 32590 (A!, BM!, BO n.v., L!, NY!, UC!); ♀ buds, 4 April 1933, Clemens & Clemens 32597 (A!, BM!, BO n.v., G n.v., L!, NY!, UC!); 5 April 1933, ♂ buds, Clemens & Clemens 34030 (A! [as 35030], BM! photo, L!, NY!); 2150 m [7000 ft.], ♂ buds, 23 – 26 May 1933, Clemens & Clemens 35039 (L!, NY!); Penibukan, ridge E of camp, 1350 m [4500 ft.], ♂ buds, 11 Nov. 1932, Clemens & Clemens 50307 (A!, BM!, G n.v., K!, L!, NY!, UC!). HABITAT. 1350 – 2150 m. 182

CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra kinabaluensis var. kinabaluensis has a conservation status of Endangered (EN B2ab(iv,v)). A status of Critically Endangered might be more appropriate, given that the taxon is known from an area less than 10 km2 and has not been collected since 1933, but the other criteria for a status of Critically Endangered are not met at this time. Although Gomphandra kinabaluensis var. kinabaluensis may be more widespread on Mt. Kinabalu than currently known, and Mt. Kinabalu is a protected area, local use of the area and forest resources is likely to reduce the number of mature trees and may eliminate populations at or near the type locality. A survey for extant populations is needed. PHENOLOGY. Flowers in March, April. NOTES. Gomphandra kinabaluensis is similar to G. lysipetala Stapf but differs in its leaves, which are generally thicker and wider, usually with a clearly revolute margin, and in its fruits, which are larger and glabrous. The leaf morphology is variable, with some ovate and quite broad, while others are longer and obovate-ellipsoid, but intermediates between the extremes can be found. The petals and stamens are the same as those of Gomphandra lysipetala, but the ovary is glabrous and the inflorescences are branched, with female flowers borne on pedicels. Clemens & Clemens 35039 and 35030 have leaf morphology that begins to approach that of Gomphandra kinabaluensis var. clemensiorum Schori, but the venation does not match that variety. Clemens & Clemens 35039 is from 2135 m, and it may be that leaf morphology changes within Gomphandra kinabaluensis in response to increased elevation and exposure. Beaman et al.’s (2001) G. sp. 3 belongs here, as do some of their citations under Gomphandra indet.

Gomphandra kinabaluensis var. clemensiorum Schori

Tree 12 – 15 m high. Twigs somewhat zigzag, 2 – 3 mm in diam, initially pubescent with minute appressed hairs, glabrescent with age, leaves spaced 1 – 1.5 cm apart along the twigs. Leaves coriaceous, glabrous above and glabrescent below, with very short (0.1 mm long) appressed hairs (not visible without magnification), lanceolate-elliptic to slightly obovate-elliptic, base acute to attenuate, apex acute to very shortly acuminate, margins 183

flat to slightly revolute, (4.5 –) 7 – 9.5 × 2 – 3 ( – 4.5) cm; midrib impressed above, raised below, secondary veins 5 – 7 ( – 8) pairs, impressed above, raised below, vein course ± parallel, curving but generally not joining near the margin, tertiary veins not evident; petiole narrowly grooved, laterally compressed when dry (1 mm wide by ca. 2 mm high from adaxial to abaxial sides), 0.5 – 1 cm long, initially pubescent with very short appressed hairs, later glabrescent. Male inflorescences not known. Female inflorescences axillary, on mature twigs, peduncle 0.5 – 1.5 cm long, bearing 2 – 4 irregular branches, each 1 – 3 mm long and bearing 1 – 3 flowers, flowers subsessile or on pedicels 1 – 3 mm long, up to ca. 10 flowers per inflorescence, axes pubescent with minute appressed hairs. Female flowers not seen at anthesis, buds with 4 – 5 glabrous petals. Fruit evidently glabrous, salmon-pink when ripe (fide Clemens & Clemens 31997), ellipsoid-obovoid, base rounded, very base swollen, apex slightly asymmetrical with the stigma a bit displaced toward the sulcus, 1.8 – 2.7 × 0.9 – 1.2 cm, stigma 2 mm in diam., inner mesocarp with 8 - 11 low longitudinal ridges. Fig. 9 [Fig. 5.42].

DISTRIBUTION. Malaysia, Sabah, Mt. Kinabalu, endemic. Map 6 [Fig. 5.41]. SPECIMENS EXAMINED. MALAYSIA. Borneo, Sabah, Mt. Kinabalu, head of Kinataki River, 2700 m, fr., 26 Feb. 1933, Clemens & Clemens 31997 (A! holotype; BM! photo, BO, G, K!, L! [2 sheets], NY!, UC! isotypes). HABITAT. Montane forest (low [short canopy] jungle), with Calamus sp. and bamboo, 2700 m. CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra kinabaluensis var. clemensiorum has a conservation status of Critically Endangered (CR B2ab(iii,v)). The taxon is known from a single locality and has not been collected since 1933. The area of Mt. Kinabalu where the taxon was collected is characterized by ultramafic soils and is known to have many local endemics (Beaman et al. 2001). Although no immediate threats have been documented, if the taxon is as restricted in distribution as Clemens’ collection indicates, any habitat degradation or loss of reproductively mature trees will negatively impact Gomphandra kinabaluensis var. clemensiorum. 184

PHENOLOGY. Fruit were present in February. ETYMOLOGY. The epithet of the subspecies commemorates Joseph and Mary Strong Clemens, who collected extensively on Mt. Kinabalu. NOTES. Gomphandra kinabaluensis var. clemensiorum is only known from the type collection. The original label on the holotype specimen gives the collection date as February 26, 1933. A collecting number 31996 is written on the label, but that number seems to refer to a fungus, as the top of the label indicates 31997 as the host of the fungus. The correct number is here treated as 31997. Labels on the UC and one of the L duplicates incorrectly list March as the date of collection, and the L sheet II label includes data on associated species that is not found on any other sheet. Additional collections might prove this taxon to be a separate species, rather than a variety of Gomphandra kinabaluensis, but at this time it is more prudent to describe it as a variety. Gomphandra kinabaluensis var. clemensiorum is distinctive with its very coriaceous, lance-elliptic leaves and its large fruit. It is possible that this variety is merely a high-elevation form of Gomphandra kinabaluensis. The species may have formed ecotypes on Mt. Kinabalu, but with the limited collections available, it is impossible to say at this point. Taken alone, the Clemens collection seems to be quite different from typical Gomphandra kinabaluensis, until one looks at the leaf plasticity in the taxon. Gomphandra kinabaluensis appears closely related to G. lysipetala Stapf, but that species has pubescent ovaries and fruit, and a different branching pattern to the infructescences.

185

Fig. 9 [Fig. 5.42]. Gomphandra kinabaluensis var. clemensiorum (Clemens & Clemens 31997). A. Twig with immature fruit; B. Mature fruit. Scale bar = 1 cm.

Gomphandra lamanii Schori

Small tree to 10 m high and 10 cm diam. Bark smooth, light to dark grey. Twigs somewhat zigzag, initially pubescent with minute, reddish spreading hairs, glabrescent with age, youngest portions of twigs extremely slender, <1 mm in diameter. Leaves chartaceous, ovate to ovate-ellipsoid, rarely lanceolate or obovate, base acute to rounded, apex acuminate to caudate, drip tip to 2 cm long, 5 – 11.5 × 1.5 – 3.5 cm; midrib sunken above, raised below, secondary veins 2 – 4 pairs, flat above, raised below, typically strongly looping 2 – 3 mm from the margin, lowest pair usually forming an intramarginal 186

vein, tertiary veins flat above, flat to slightly raised below, distinctly percurrent and perpendicular to the midrib; petiole slender, (0.3 – ) 0.5 – 0.8 cm long. Inflorescences terminal or leaf-opposed on most recent growth, axillary (terminating short axillary branches) on mature growth, axes pubescent with reddish hairs. Male inflorescences with peduncle 0.5 – 1.5 cm long, bearing up to 3 branches, these to 1 cm, rebranched or not, up to 5 flowers per branch, subsessile or on pedicels to 2 mm long, 7 – 20 flowers per inflorescence. Male flowers: calyx cupular, apiculate, margin pubescent, especially in bud, 1.5 mm across; petals 4 – 5, pubescent apically in bud, glabrescent and essentially glabrous in flower, greenish (fide Laman et al. TL700), 3 – 4 mm long, staminodes 4 – 5, exserted, 4 – 6 mm long, pubescent ventrally below the anthers with clavate hairs, sparse dorsal tuft at the connective present or absent, ovary rudiment narrowly conical, glabrous. Female inflorescences with peduncle 0.5 cm long, with 1 ( – 2?) flower. Female flowers: calyx cupular, 1.5 mm across, ciliate; petals white (fide Laman et al. TL79), not seen; staminodes not seen; ovary cylindrical, green when fresh, glabrous, cylindrical, 3 mm long. Fruit submature (green), ellipsoid, 1.8 – 2 × 0.6 – 0.7 cm, base truncate, apex attenuate, slightly beaked, inner mesocarp with c. 6 anastomosing longitudinal ridges, sulcus complex ridges prominent, stigma 1.5 mm across, displaced toward sulcus complex. Fig. 10 [Fig. 5.43].

DISTRIBUTION. Borneo, W. Kalimantan, Sarawak (1 specimen). Map 7 [Fig. 5.44]. SPECIMENS EXAMINED. MALAYSIA. Sarawak, Bintulu Division, Tatau, Ulu Sungai Sanggan, Bukit Kana, 680 m, ♂ fl., 25 March 1995, Yii Puan Ching & Jugah S.71679 (K n.v., KEP n.v., L n.v., MO!, SAN n.v.). INDONESIA. Kalimantan Barat, Gunung Palung National Park, Cabang Panti Research Site, 1°13’ S, 110°6’ E, 40 m, submature fruit, 22 Oct. 1996, Laman et al. TL79 (holotype A!; isotypes BISH!, CANB!, E!, K!, L!, NY!); ibid, 40 m, ♂ fl., 9 March 1997, Laman et al. TL700 (A!, BO n.v., E!, K!, L!, NY!, WAN n.v.); Serawai, south of Uut Labang, 0°36’6.1” S, 112°38’56.2” E, 750 m, ♂ buds, 7 Oct. 1995, Church et al. 2266 (A!, BISH!, CANB!, E!, K!, L!, NY!); ibid, 1000 m, ♂ fl., 11 Oct. 1995, Church et al. 2421 (A!, BISH!, K!, L!). 187

HABITAT. Disturbed lowland dipterocarp forest, on sandy red-yellow soil; primary dipterocarp forest, ridge and slopes, red clay soil; gentle slope near creek; 40 – 1000 m. CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra lamanii has a conservation status of Endangered (EN B1ab(iii)). The species is known from three widely separated localities but is not likely to occur over most of the area that separates the localities. Lowland forest in Borneo, especially in Kalimantan, has been heavily logged and appropriate habitat is now fragmented. The Sarawak population is near a sustainable forestry center, which may afford it some habitat protection, but logging has occurred both at that location and within Gunung Palung National Park, the type locality. Logging and habitat destruction will continue to pose a threat to Gomphandra lamanii. PHENOLOGY. Flowers were present in October and in March. ETYMOLOGY. The specific epithet honors Timothy Laman, a botanist and wildlife photographer who has worked diligently to increase awareness of Southeast Asia’s imperiled diversity.

188

Fig. 10 [Fig. 5.43]. Gomphandra lamanii. A. Twig with immature fruit (Laman et al. TL79); B. Male inflorescence and leaf with distinctive brochidodromous venation (Church et al. 2266). Scale bars = 1 cm. 189

Map 7 [Fig. 5.44]. Distribution of Gomphandra lamanii (■) in Borneo.

NOTES. Gomphandra lamanii is probably related to G. quadrifida (Bl.) Sleumer, which also has terminal inflorescences. The slender twigs, solitary female flowers, caudate leaves with unusual venation, and distinctly ridged fruit all distinguish Gomphandra lamanii from G. quadrifida. Gomphandra palustris Schori is the only other species in Borneo with terminal inflorescences, but it is restricted to peat swamps and has quite different leaves and fruit. More collections of Gomphandra lamanii are needed to complete the description of the female flowers and fruit.

Gomphandra chimaera Schori

Shrub 2 – 2.5 m tall. Twigs green, moderately pubescent with minute spreading hairs, glabrescent, youngest portions 1 – 1.6 mm in diam. Leaves elliptic to oblong or obovate- elliptic, base acute to attenuate, apex acuminate, (9 – ) 15 – 19 × (2.5 – ) 4.5 – 7 cm, chartaceous, glabrous at maturity, margin flat to slightly revolute; midrib impressed 190

above, raised below, secondary veins (3 – ) 6 – 8 pairs, flat above, raised below, lowest pair(s) steeply ascending and converging towards margin, upper pairs ± parallel, brochidodromous, intramarginal vein often present, intersecondaries common, tertiary veins obscure to slightly raised above, raised and delicately percurrent below; petiole grooved, glabrescent, (0.6 – ) 1 – 1.6 cm long. Inflorescences axillary, on recent growth, axes pubescent with short, somewhat appressed reddish hairs. Male inflorescences subcapitate with peduncle 0.2 – 0.4 cm long, often bearing 2 – 3 branches 1 mm long, flowers subsessile on pedicels < 1 – 1 mm long, up to 12 flowers. Male flowers: calyx lobed, 1 – 1.5 mm across, sparsely pubescent; petals 4 – 5, white, glabrous, 2.5 – 3 mm long, lobes narrow and tips scarcely inflexed; staminodes 4 – 5, strongly exserted, 4 mm long, pubescent with a tuft of clavate hairs dorsally at the connective, scattered hairs ventrally below the anthers, ovary rudiment minute. Female inflorescences with peduncle 0.2 – 0.4 cm long, bearing (1 – ) 3 – 4 flowers on pedicels 1 – 2 mm long, pedicels elongating in fruit to 4 mm long. Female flowers: calyx cupular, lobed, 1.5 mm across, sparsely pubescent; petals 4 – 5, glabrous, lobes narrow and tips scarcely inflexed, 4 mm long; staminodes 4 – 5, not exserted, 3.5 mm long, glabrous except for a few hairs dorsally at the connective; ovary pubescent with spreading reddish hairs, 3.5 – 4 mm long. Fruit quite immature, likely fusiform or narrowly obovoid-ellipsoid, at least 1.6 – 1.8 cm long, sparsely pubescent but probably glabrous at maturity, stigma at least 2 mm across, apparently with a deep central groove. Fig. 11 [Fig. 5.45].

DISTRIBUTION. Indonesia – Sumatra. Map 8 [Fig. 5.46]. SPECIMENS EXAMINED. INDONESIA. Sumatra, Aceh Province, Kloët [Kluet] Nature reserve, S. Kloët [Kluet], along the Krung (River), Lembang/vicinity of Pucuk Lembang, c. 3°05’ N, 97°25’ E, c. 50 m, ♂ fl., 9 July 1985, de Wilde & de Wilde-Duyfjes 19843 (L!); ibid, c. 80 m, ♂ fl., 11 July 1985, de Wilde & de Wilde-Duyfjes 19938 (L!, sheet 2 only [L 0690039]); ibid, c. 80 m, ♀ fl., imm. fr., 11 July 1985, de Wilde & de Wilde-Duyfjes 19942 (holotype L! [2 sheets]; isotype US!). HABITAT. Primary flat riverine or foot-hill forest on alluvial soil, 50 – 80 m. 191

CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra chimaera has a conservation status of Critically Endangered (CR B1ab(iii)). The species has only been collected from a single locality, and the area where it occurred has been heavily logged (McCarthy 2006). Satellite images show a wide swath of barren land on either side of the river where this species was collected. Suitable habitat may still be available to the south and west, but it is also under intense logging pressure. ETYMOLOGY. Gomphandra chimaera is named for the similarity of various vegetative and reproductive parts to other Sumatran species of Gomphandra. The Chimaera was a mythical beast made of the parts of several other animals. NOTES. Gomphandra chimaera appears to be closely related to three different species. The leaf venation is similar to that of Gomphandra dolichocarpa Merr. The pubescent ovary is reminiscent of Gomphandra fusiformis Sleumer, though the stigma does not match that species. The male inflorescences and flowers are similar to Gomphandra subrostrata Merr., which has been found growing with G. chimaera at Kloët Nature Reserve. Gomphandra dolichocarpa and G. subrostrata have glabrous ovaries, and G. subrostrata has thicker twigs that are more pubescent. Northern Sumatra may have experienced a relatively recent species radiation, and more collections may reveal more cryptic taxa currently included within Gomphandra subrostrata. Gomphandra dolichocarpa and G. fusiformis are both known from very limited geographic areas, while G. subrostrata has been collected from multiple localities in the Gunung Leuser National Park area. 192

Fig. 11 [Fig. 5.45]. Gomphandra chimaera. A. Twig with immature fruit (de Wilde & de Wilde-Duyfjes 19942; scale bar = 1 cm); B. Female inflorescence (de Wilde & de Wilde- Duyfjes 19942; scale bar = 1 cm); C. Male flower (de Wilde & de Wilde-Duyfjes 19843; scale bar = 5 mm); D. Ovary rudiment (de Wilde & de Wilde-Duyfjes 19843; scale bar = 1 mm).

193

Map 8 [Fig. 5.46]. Distribution of Sumatran Gomphandra chimaera (□), G. jacobsii (■), G. parviflora var. magnifolia (▲), G. parviflora var. paucibarbata (○),and G. simulans (●).

Gomphandra jacobsii Schori

Treelet 2 m high. Twigs green, slender, initially pubescent with minute appressed reddish hairs, eventually glabrescent, 0.9 – 1.5 mm in diam. Leaves elliptic to obovate, base acute to attenuate, apex acuminate, (5 – ) 9 – 13 × (2 – ) 3 – 5 cm, chartaceous, glabrous at maturity, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (2 – ) 4 – 6 pairs, flat to slightly raised above, raised below, lowest pairs steeply ascending and somewhat converging towards margin, upper pairs ± parallel, brochidodromous, sometimes forming an intramarginal vein, intersecondaries common, tertiaries slightly raised to flat above, slightly raised below, weakly percurrent; petiole grooved, (0.6 – ) 1 – 1.5 cm long. Inflorescences axillary, 1 – 2 per axil, on recent seasons’ growth, including the twig apex, axes pubescent with minute appressed hairs. Male inflorescences to 2 cm long overall, with peduncle 0.3 – 0.8 cm long, bearing 2 – 3 194

branches 2 – 4 mm long, these bearing 1 – 5 flowers in a reduced cyme, pedicels <1 – 2 mm long, 5 – 16 flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, sparsely pubescent and ciliate, 1.5 – 2 mm across, light green, petals 5, glabrous, 3.5 – 4 mm long, stamens 5, white, strongly exserted, 5 mm long, glabrous, pollen white, ovary rudiment narrowly conical, glabrous. Female inflorescences with peduncle to 0.4 cm long, unbranched or with 2 short branches 1 mm long, 3 – 6 flowers on pedicels <1 – 2 mm long. Female flowers: calyx cupular, minutely apiculate, sparsely pubescent and ciliate, 2 mm across, petals 5, glabrous, 4 mm long, staminodes 5, ovary densely pubescent with minute appressed reddish hairs. Fruit submature, green turning white, narrowly ellipsoid, base attenuate, very base perhaps a bit swollen, apex somewhat attenuate, 1.8 – 1.9 × 0.5 cm, sparsely pubescent to glabrescent, inner mesocarp with ca. 10 low ridges, stigma ridged, 2.2 mm across. Fig. 12 [Fig. 5.47].

DISTRIBUTION. Indonesia – Sumatra. Map 8 [Fig. 5.46]. SPECIMENS EXAMINED. INDONESIA. Sumatra, Lampung Province, Bukit Palelawan [Pelelawan] w. of Ranau Lake, 1100 m, imm. fr., Dec. 1978, Wiriadinata s.n. (BO n.v., K!, L!); Bukit Barisan, Bukit Pelelawan, 1250 m, buds, 15 Dec. 1978, TFB 217 (L! [2 sheets, one incorrectly labeled 219]); Bukit Pelelawan, 1230 m, buds, Lamcnie [?] 564 (L!); Mt. Tanggamus, 5°26’ S, 104°41’ E, 1200 – 1300 m, ♂ fl., 29 April 1968, Jacobs 8140 (holotype L!; isotypes A!, BISH!, K!, 6 other dups. n.v). HABITAT. Forest, 1100 – 1300 m. CONSERVATION STATUS. Based on IUCN (2001) guidelines, the conservation status of Gomphandra jacobsii is Endangered (EN B1ab(iii)). The species is known from two mountains, and may be found in suitable habitat in between them. Bukit Pelelawan is in Bukit Barisan Selantan National Park, which has suffered from illegal logging and coffee plantations. Satellite images indicate that areas of high elevation forest may still be intact within the park, although lower elevation forest around the southern Barisan range and Mt. Tanggamus is mostly gone. Logging and habitat degradation will continue to be a threat to Gomphandra jacobsii. 195

ETYMOLOGY. The specific epithet honors Dr. Marius Jacobs, who collected the type specimen as part of work on the flora of Malesia.

Fig. 12 [Fig. 5.47]. Gomphandra jacobsii (Jacobs 8140). A. Twig with male inflorescence, scale bar = 1 cm; B. Male flower; scale bar = 5 mm. 196

NOTES. Gomphandra jacobsii is probably closely related to G. javanica (Bl.) Valeton and G. parviflora (Bl.) Valeton. It differs from Gomphandra javanica in its glabrous stamens, and from G. parviflora in its pubescent ovaries and smaller leaves with fewer veins and proportionately longer petioles. Its twigs are more slender than those of Gomphandra javanica (Bl.) Valeton var. pseudojavanica (Sleumer) Schori, and the calyx is more robust than that of G. javanica var. javanica. Sleumer recognized the type collection as a new species but chose not to describe it, citing a lack of female flowers.

Gomphandra parviflora (Bl.) Valeton var. magnifolia Schori

Twigs somewhat zigzag, 1.2 – 2 mm in diam., moderately pubescent with minute spreading hairs. Leaves ovate-elliptic to obovate, base acute, apex abruptly acuminate, chartaceous, 20 – 26 × 7 – 10 cm, essentially glabrous, margin flat; midrib raised below, secondary veins 10 – 15 pairs, slightly raised below, vein course parallel, brochidodromous and forming an intramarginal vein, intersecondaries common, tertiary veins flat to slightly raised below, very delicately percurrent; petioles 0.9 – 1.1 cm long, glabrous or with a few hairs. Inflorescences and flowers not known. Infructescences axillary, axes pubescent with minute appressed hairs, peduncle 0.4 cm long, bearing 1 fruit or 3 fruit on pedicels 2 mm long. Calyx cupular, minutely apiculate, sparsely pubescent. Fruit evidently glabrous, narrowly obovoid-ellipsoid, 2.4 – 2.6 × 0.6 – 0.7 cm, apex acute, base attenuate, very base slightly swollen, inner mesocarp with ca. 10 anastomosing ridges, stigma 2.2 – 2.5 mm across. Fig. 13 [Fig. 5.48].

DISTRIBUTION. Indonesia – Sumatra. Map 8 [Fig. 5.46]. SPECIMENS EXAMINED. INDONESIA. Sumatra, Korthals s.n. (L! [L 0014817]; Singalang [Singgalang], Korthals 882b-2 (holotype L! [L 0014815]). HABITAT. The type label says “sylvis Singalang.” CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra parviflora var. magnifolia has a conservation status of Critically Endangered (CR 197

B1ab(iii)). The taxon is known from a single collection from the 1800s. The exact locality is unknown, and if Korthals collected the specimen from lowland forest around Mt. Singgalang, the population or even the taxon could be extinct. Lowland forest in the area is mostly been logged or converted for agriculture and housing purposes. Montane forest is still present on Mt. Singgalang, so the taxon may prove to be extant. NOTES. The type, Korthals 882b-2, is clearly a different collection than Korthals 882b- 1, which is the lectotype of Gomphandra parviflora var. parviflora. Neither specimen of Gomphandra parviflora var. magnifolia has any type status under G. parviflora var. parviflora, despite Sleumer’s annotations. Gomphandra parviflora var. magnifolia was collected from the same area as var. parviflora, but its leaves are larger with more veins, and the fruit is longer as well. It might be a separate species, but with so little material of Gomphandra parviflora available, it is impossible to tell whether material treated as G. parviflora here represents the natural range in variation of one species, or whether there are two species that could be distinguished by additional features were more material available. 198

Fig. 13 [Fig. 5.48]. Gomphandra parviflora var. magnifolia (Korthals 882-b). A. Leaf and infructescence; B. Fruit. Scale bars = 1 cm.

199

Gomphandra parviflora (Bl.) Valeton var. paucibarbata Schori

Shrub to 3 m. Twigs relatively straight, 1.4 – 2.2 mm in diam., sparsely pubescent with minute spreading hairs, eventually glabrescent. Leaves chartaceous, glabrous above, glabrescent below, broadly lanceolate to lanceolate-obovate, 14 – 22 × 4 – 5.5 cm, apex acuminate, base acute to attenuate, margin slightly revolute; midrib impressed above, raised below, secondary veins 7 – 10 pairs, flat above, raised below, lowest pair steeply ascending and forming an intramarginal vein, upper pairs ± parallel, intersecondaries very common, tertiary veins flat above, flat to very slightly raised below, very delicately percurrent; petioles grooved, 0.6 – 1.2 cm long, sparsely pubescent with minute appressed hairs, glabrescent. Male inflorescences axillary, 1 mature inflorescence per axil and often 1 – 2 very immature inflorescences in bud as well, on recent growth, axes densely pubescent with short reddish pubescence, peduncle 1 – 3 mm long, bearing 2 – 4 branches 1 – 2 mm long, flowers on pedicels to 1 mm long, (1 – ) 6 – 11 flowers per inflorescence. Male flowers: calyx cupular, lobed, 1 mm across, margins densely ciliate with short reddish pubescence; petals 4 – 5, 3.5 – 4 mm long, tips sparsely pubescent with minute reddish hairs; stamens 4 – 5, strongly exserted, 4.5 – 5 mm long, glabrous or with a few long clavate hairs ventrally; ovary rudiment ovoid, glabrous. Female inflorescences, flowers, and fruit unknown. Fig. 14 [Fig. 5.49].

DISTRIBUTION. Indonesia – Sumatra. Map 8 [Fig. 5.46]. SPECIMENS EXAMINED. INDONESIA. Sumatra, West Sumatra Province, Pesisir Selantan District, Indrapura, 150 m, ♂ buds, 3 Jan. 1984, Rahayu 556 (holotype L!; isotypes BO n.v., K!, P n.v., SING n.v.). HABITAT. Secondary forest, 150 m. CONSERVATION STATUS. Based on IUCN (2001) guidelines, Gomphandra parviflora var. paucibarbata has a conservation status of Critically Endangered (CR B1ab(iii)). The taxon is known from a single location at low elevation. Satellite images indicate that no or very little intact lowland forest remains in the area where the specimen was collected. 200

NOTES. Gomphandra parviflora var. paucibarbata differs from var. parviflora in its narrower leaves with a distinct intramarginal vein and its densely ciliate calyx. It may also have larger flowers with longer stamens and less staminal pubescence, but mature staminate flowers are not known for var. parviflora, and floral dimensions cannot be accurately compared between buds and open flowers. More collections of either variety may prove Gomphandra parviflora var. paucibarbata to be a separate species, but given the lack of complete material for either taxon, there are no definitive reproductive characters that can currently be used to support G. parviflora var. paucibarbata as a distinct species. It can be distinguished from var. magnifolia by its much narrower, shorter leaves with fewer veins. 201

Fig. 14 [Fig. 5.49]. Gomphandra parviflora var. paucibarbata (Rahayu 556). A. Twig with male inflorescence (scale bar = 1 cm); B. Male flower (scale bar = 6 mm); C. Ovary rudiment. 202

Gomphandra simulans Schori

Shrub 2 m high. Twigs relatively straight, densely and persistently pubescent with tawny to reddish spreading hairs, 1.3 – 2 mm in diam. Leaves ovate-elliptic, base acute, inequilateral, apex acuminate, (7 – ) 9 – 14 × (2 – ) 3 – 4 cm, chartaceous, glabrous above, densely pubescent below with spreading hairs, margin narrowly revolute; midrib impressed above, raised below, secondary veins 5 – 7 pairs, flat to slightly raised above, raised below, lower pairs somewhat converging towards margin, upper pairs ± parallel, brochidodromous, intersecondaries common, tertiaries obscure above, flat below, weakly percurrent; petiole grooved, densely pubescent, 0.8 – 1 cm long. Inflorescences axillary, axes pubescent with minute appressed hairs. Male inflorescences capitate with peduncle 0.2 – 0.4 cm long, bearing up to 12 (possibly more) (sub)sessile flowers. Male flowers: calyx cupular, apiculate, pubescent, 1 – 1.5 mm across; petals 4 – 5, white, sparsely pubescent in bud, 3 ( – 4 ?) mm long, stamens 4 – 5, pubescent; ovary rudiment minute. Female inflorescences, flowers, and fruit unknown. Fig. 15 [Fig. 5.50].

DISTRIBUTION. Indonesia – Sumatra. Map 8 [Fig. 5.46]. SPECIMENS EXAMINED. INDONESIA. Sumatra, Aceh Province, Gunung Leuser Nature Reserve, Gunung Mamas, c. 12 km SW from the mouth of Lau Ketambe, 1500 – 1800 m, ♂ buds, 7 May 1975, de Wilde & de Wilde-Duyfjes 16666 (holotype L! [L 0690052]; isotype K!). HABITAT. Montane forest, 1500 – 1800 m. CONSERVATION STATUS. Following IUCN (2001) guidelines, Gomphandra simulans has a conservation status of Critically Endangered (CR B1ab(iii)). The species is known from a single locality and although it was collected within Gunung Leuser National Park, illegal logging is a threat throughout the park. Satellite images indicate that most of the park in the area around Ketambe has been logged and is degraded. ETYMOLOGY. The specific epithet refers to this species’ pubescence, which is similar to that of Gomphandra tomentella (Kurz) Mast. and G. velutina Sleumer. 203

NOTES. The specimen of Gomphandra simulans was identified by Sleumer as Gomphandra tomentella, but it is certainly not that species because the inflorescences are axillary rather than terminal. Gomphandra simulans is similar to G. velutina, which was collected in Sulawesi, but its leaves are smaller, its pubescence is longer and more persistent, and the petals are only sparsely pubescent.

Fig. 15 [Fig. 5.50]. Gomphandra simulans (de Wilde & de Wilde-Duyfjes 16666). A. Twig with male inflorescence; scale bar = 1 cm; B. Male bud, stamen with ovary rudiment at base; scale bar = 3 mm.

204

Gomphandra javanica Valeton subsp. pseudojavanica (Sleumer) Schori

DISTRIBUTION. Indonesia – Simeulue Is. SPECIMENS EXAMINED. INDONESIA. Simeulue Island, imm. fr., 8 Nov. 1917, Achmad 64 (L! [2 sheets]); imm. fr., 19 Jan. 1918, Achmad 191 (holotype L! [L 0014823]; isotypes BO, L! [L 0014824]); imm. fr., 20 Feb. 1918, Achmad 257 (L! [2 sheets]); imm. fr., 20 Nov. 1918, Achmad 748 (L!), imm. fr., 5 Mar. 1919, Achmad 963 (L!); ♂ fl., 23 May 1919, Achmad 1132 (BO, G, K!, L!, P, SING, U, W); Tapah (Defajan), imm. fr., 5 Jan 1920, Achmad 1594 (K!, L!); ibid, ♂ buds, 15 April 1920, Achmad 1797 (BO, K!, L!, SING, W). NOTES. Sleumer (1969) described Gomphandra pseudojavanica as a species and used the abaxial leaf pubescence and fruit base shape to distinguish it from G. javanica. However, when specimens from Java and Simeulue are examined side by side, leaf pubescence and stigma diameter are the only features which can be used to separate them, so Gomphandra pseudojavanica does not warrant recognition as a separate species. Twig characteristics, inflorescence position and structure, flower size, and fruit size and shape all overlap. Specimens from Simeulue may have larger leaves than typical Gomphandra javanica, and they do retain more of their pubescence, but otherwise fruit stigma width (2 mm vs. 2.5 – 3 mm) is the only consistent difference. The stigma of Gomphandra javanica subsp. javanica is accrescent during fruit development and can be nearly double the width of G. javanica subsp. pseudojavanica, which is not accrescent. Fruit base shape, which Sleumer used to distinguish Gomphandra pseudojavanica in his original description, is not a reliable character, especially in the submature fruit available for the taxon. Gomphandra javanica subsp. pseudojavanica is recognized at the subspecies level because its geographic distribution (7500 km distant from G. javanica), in combination with one leaf character and one fruit character, make it possible to separate it from Javan specimens.

205

Acknowledgements

Thanks to Dr. Neil Bernstein (Ohio University) for assistance with the Latin diagnoses, and to Tim Laman for photos of Gomphandra lamanii. Many thanks to curators at A, BH, BISH, BM, BRI, CANB, E, K, L, MICH, MO, NY, P, PNH, and US for specimen loans and photographs.

References

Beaman, J. H., Anderson, C. & Beaman, R. S. (2001). The plants of Mount Kinabalu Vol. 4: Dicotyledon families Acanthaceae to Lythraceae. Natural History Publications (Borneo), Kota Kinabalu, Sabah, Malaysia.

IUCN. 2001. IUCN red list categories and criteria. Ver. 3.1. Gland, Switzerland and Cambridge, UK.

McCarthy, J. F. (2006). The fourth circle: a political ecology of Sumatra's rainforest frontier. Stanford University Press, Stanford, CA.

Sleumer, H. O. (1969). Materials towards the knowledge of the Icacinaceae of Asia, Malesia, and adjacent areas. Blumea. 17: 181-264. 206

Article 4 – Nomenclature and typification in five genera of Stemonuraceae. Formatted for Taxon. This article provides nomenclatural corrections and/or typifications for 31 taxa. So many species of Gomphandra did not have properly designated types, and several had such complicated nomenclatural histories, that I decided publish corrections in a separate article, rather than in the taxonomic revision. Formal designations of types are not included here because electronic publication is not valid publication under the International Code of Botanical Nomenclature.

Nomenclature and typification in five genera of Stemonuraceae

Melanie Schori1

The family Stemonuraceae was circumscribed and separated from Icacinaceae s.str. in 2001 on the basis of molecular and morphological data (Kårehed 2001). The family is pantropical in distribution, though it is primarily Asian, with nine of the twelve genera occurring in Southeast Asia, Melanesia, or Australia. Seven genera were revised or described (Sleumer 1969) in preparation for the inclusion of Icacinaceae in Flora Malesiana (Sleumer 1971). Not all the species of widely distributed genera were included, and as Sleumer wrote in regard to Gomphandra, the largest genus, “This revision, however, turned out to remain highly unsatisfactory…” A treatment for all members of Stemonuraceae is being prepared, with a revision of Medusanthera recently completed (Utteridge, pers. comm.) and a revision of Gomphandra nearing completion. However, certain taxa, especially within Gomphandra, have complicated nomenclatural histories that require more analysis than straightforward synonymization and typification. In addition, while Sleumer designated lectotypes for some taxa in 1969, he designated two specimens in a few cases, and he frequently designated as lectotypes specimens that had been destroyed at B or PNH during World War II. At the time Sleumer was writing his manuscript, such designations were not explicitly disallowed,

1 Department of Environmental & Plant Biology, 315 Porter Hall, Ohio University, Athens, OH 45701 USA; email: [email protected]. 207

but after the 1969 Seattle Botanical Congress, lectotypes had to be extant specimens. The current Code does not have a provision that explains how to treat a lectotype that did not exist at the time of designation. I have chosen to indicate Sleumer’s designations as “incorrect”, but to follow Art. 9.17, which states that the author who first designates a lectotype must be followed. Sleumer’s designations cannot be considered “first-step” (Art. 9.15, Ex. 8) because he specified individual specimens at particular herbaria.

Types and synonyms are presented for 30 taxa in five genera: Codiocarpus, Gastrolepis, Gomphandra, Irvingbaileya, and Stemonurus. Nomenclatural issues are discussed individually below each species. Specimens cited by Sleumer (1969) as duplicates of types are listed below as isotypes or isolectotypes; however, some appear to be missing (specimen deperditus [“spec. dep.”]) or have not been found by the author at herbaria that are being reorganized (non inveni). Misidentifications, which Sleumer included in his synonym lists, are not included here and will be corrected in the revisions of genera and the family.

NOMENCLATURAL REVIEW

Codiocarpus andamanicus (Kurz) R.A. Howard, Brittonia 5: 57. 1943 ≡ Apodytes andamanica Kurz, J. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. xli II: 298 (cited incorrectly as 296 in King 1895). 1872 ≡ Gomphandra andamanica (Kurz) King, J. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 64 (2): 115. 1895 ≡ Tylecarpus andamanicus (Kurz) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 236. 1940 ≡ Medusanthera andamanica (Kurz) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 364. 1941 – Lectotype: India, Andamans, South Andaman, Port Mouat, Homfray’s Ghat, S. Kurz s.n. (CAL!, sheet 83495).

Note. – Kurz (1872) cited “Andam. Rep. Append. B. 5” in his protologue. “Andam. Rep. Append.” refers to Rep. Veg. Andaman Isl.: 33 (1870), where Apodytes andamanica appears as a nomen nudum; it is not clear what Kurz meant by “B. 5”. Kurz’s 1870 Report was a reprint of a report submitted to the government of India in 1868, but that 208

report was never circulated, so although Kurz may have decided on the combination Apodytes andamanica as early as 1868, the effective date of publication is 1872. Howard (1943) first published the combination Codiocarpus andamanicus in Lloydia 6: 143, but he did not provide a Latin description for the genus at that time. Under Articles 36.1 and 43.1 of the Code, Codiocarpus and the new combinations Howard made were not validly published in Lloydia. The Brittonia citation is the place of valid publication, and the Lloydia article should not be cited as the place of publication for either species of Codiocarpus.

Codiocarpus merrittii (Merr.) R.A. Howard, Brittonia 5: 57. 1943 ≡ Stemonurus merrittii Merr., Philipp. J. Sci. 3: 240. 1908 ≡ Tylecarpus merrittii (Merr.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 237. 1940 ≡ Medusanthera merrittii (Merr.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 364. 1941 – Lectotype: Philippines, Mindoro, (Pinamalayan), Merritt 9915 (NY!; isolectotypes: K!, US!).

Gastrolepis austrocaledonica (Baill.) R.A. Howard, J. Arnold Arbor. 21: 481. 1940 ≡ Lasianthera austrocaledonica Baill., Adansonia 11: 193. 1874 – Lectotype: New Caledonia, Forêts situées au-dessus de la Ferme-Modèle près de Nouméa, Oct. 1868, Balansa 600 (P! [P00625028]; isolectotypes: K!, L!, P! [2 sheets]).

Gomphandra comosa King, J. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 64, ii: 112. 1895 ≡ Urandra comosa (King) R.A. Howard, J. Arnold Arbor. 21: 468. 1940 – Lectotype (incorrectly designated by Sleumer 1969): India, South Andaman, 1890 and 1892, King’s Collector (CAL non viderat [1892]) – Lectotype: India, South Andaman, Hobdaypur, 30 Jan. 1892, King’s Collector s.n. (CAL! [sheet 83395]; isolectotype: K!).

Note. – Sleumer (1969) designated two separate collections, one from 1890 and the other from 1892, as the lectotype, and indicated that they were at CAL. Sleumer’s lectotypification cannot be accepted, as it included two different specimens. He did not see any specimens from CAL, and the specimens he cited as duplicates at other herbaria 209

were not all from the same year: G [1890], L [1890], K [1892]. CAL does not have a specimen from 1890, and the duplicates (years unknown) Sleumer cited at P and SING are missing. King cited “S. Andaman; King’s Collector’s” as the locality and collections for this species in his protologue, so all specimens collected before 1895 that list King’s Collectors on the label should be considered syntypes.

Gomphandra donnaiensis (Gagnep.) Sleumer, Blumea 17: 192. 1969 ≡ Lasianthera donnaiensis Gagnep., Fl. Indo-Chine (Suppl.) 6: 744. Dec. 1948 – Lectotype: Vietnam, Poilane 22016 (P!); isolectotypes: K!, L!, P! [2 sheets]).

Note. – Gagnepain cited one collection, Poilane 22016, in his protologue. However, since P has three specimens and none has an indication that it is the holotype, the specimens must be considered syntypes (Art. 9.4). One specimen [not yet barcoded] has been selected as the lectotype.

Gomphandra coriacea Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus coriaceus (Wight) Miers, Ann. Mag. Nat. Hist. II, 10: 37. 1852 ≡ Platea coriacea (Wight) Thwaites, Enum. Pl., Zeyl.: 44. Nov. 1858 – Lectotype: India, [Tamil Nadu or Kerala], Pulneys [Palani], Sept. 1836, Wight K.D. 427 (K!; isolectotypes: C!, FI n.v., GH!, L! [2 sheets], NY!, P!, S n.v.) = Stemonurus gardneri Miers, Ann. Mag. Nat. Hist. II, 10: 38. 1852 – Lectotype: India, [Tamil Nadu or Kerala], Nilgherries [Nilgiri], Gardner s.n. (K! K00058199]; isolectotype: BM n.v.) = Stemonurus walkeri Miers, Ann. Mag. Nat. Hist. II, 10: 43. 1852 – Lectotype (invalidly designated by Sleumer 1969): Sri Lanka, Gardner 101 & 101b (K). Lectotype: Sri Lanka, Bamboddi, Gardner 101 (K!) = Platea wightiana Miers, Ann. Mag. Nat. Hist., ser. 2, 10: 111. 1852 – Holotype [icon] “Gomphandra polymorpha ♂, [India, Tamil Nadu] Coonoor” in Wight, Icon. Pl. Ind. Orient.: 3, t. 953 [‘933’]. Nov. 1844.

210

Note. – Sleumer (1969) cited a specimen of Wight 427 at Harvard University Herbaria as “A, n.v.”, but the sheet is actually stamped GH, as reflected in the isolectotype list above. Platea wightiana Miers is treated as a synonym of Gomphandra coriacea Wight here. Miers’ name is based on an illustration of a staminate plant which was originally (incorrectly) labeled as “G. polymorpha Wight” in Wight’s Icones. Wight had written that the plants he illustrated as Gomphandra polymorpha seemed more like G. coriacea, except for their pentandrous flowers. It is worth noting that in his original description, Wight (1840) failed to describe the inflorescences of Gomphandra coriacea as opposite the leaves, even though the inflorescences on the lectotype and other Wight collections identified as G. coriacea have almost all of their inflorescences leaf-opposed. This situation is never encountered in specimens identified as Gomphandra polymorpha (now G. tetrandra), yet Wight’s illustrations of “G. polymorpha” (953 ♂, 954 ♀) show multiple leaf-opposed inflorescences, and the overall branching pattern of the inflorescences much more closely matches specimens of G. coriacea (as noted by Thwaites in 1858). Wight’s illustration of Gomphandra polymorpha is a misidentification of G. coriacea. Miers listed “G. polymorpha, var. Wight” (Wight as author, not as the name of a variety) as a synonym of Platea wightiana, even though Wight merely wrote that the illustrated plant “approaches most nearly to my variety G. angustifolia” [G. polymorpha var. angustifolia], and never treated it as a variety. Since Miers based Platea wightiana on an illustration of Gomphandra coriacea, Platea wightiana must be considered a synonym of G. coriacea, rather than of G. tetrandra as cited by Sleumer (1969).

Gomphandra tetrandra (Wall.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Lasianthera tetrandra Wall. in Roxb., Fl. Ind. 2: 328. 1824 ≡ Stemonurus tetrandrus (Wall.) Alston in Trimen, Handb. Fl. Ceylon 6: 48. 24 Mar. 1931 ≡ Gomphandra axillaris Wall. ex Voigt, Hort. Suburb. Calcutt.: 31. 1845, nom. illegit. ≡ Stemonurus axillaris (Wall. ex Voigt) Miers, Ann. Mag. Nat. Hist. II, 10: 41. 1852, nom. illegit. ≡ Platea axillaris (Wall. ex Voigt) Thwaites, Enum. Pl. Zeyl.: 44. Nov. 1858, nom. illegit. – Holotype: Smith s.n. (1815) (CAL n.v.) 211

= Gomphandra polymorpha Wight, Ill. Ind. Bot. I: 103. 1838 (p. p. lectotype) ≡ Stemonurus polymorphus (Wight) Miers, Ann. Mag. Nat. Hist. II, 10: 37. 1852 ≡ Gomphandra polymorpha var. angustifolia Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus polymorphus var. angustifolius (Wight) Miers, Ann. Mag. Nat. Hist. II, 10: 37. 1852, ‘angustifolia’. – Lectotype (designated by Sleumer 1969): Wight K.D. 428 (K!; isolectotypes: C!, E!, L!, P!) = Gomphandra polymorpha var. acuminata Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus polymorphus var. acuminatus (Wight) Miers, Ann. Mag. Nat. Hist. II 10: 37. 1852, ‘acuminata’ – Lectotype: India, Courtallum, Wight s.n. (K! [K000381719]) = Gomphandra polymorpha var. oblongifolia Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus polymorphus var. oblongifolius (Wight) Miers, Ann. Mag. Nat. Hist. II: 37. 1852, ‘oblongifolia’ – Lectotype: India, [Tamil Nadu], Courtallum [Kuttalam], Aug. 1835, Wight 430 (K!; isolectotypes: C spec. dep., GH!, L!, P!) = Gomphandra polymorpha var. longifolia Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus polymorphus var. longifolius (Wight) Miers, Ann. Mag. Nat. Hist. II: 37. 1852, ‘longifolia’ – Lectotype: India, [Tamil Nadu], Courtallum [Kuttalam], [Sept. 1835], Wight s.n. (K! [K000381688]; isolectotype: E!) = Gomphandra polymorpha var. ovalifolia Wight, Ill. Ind. Bot. I: 103. 1838 ≡ Stemonurus polymorphus var. ovalifolius (Wight) Miers, Ann. Mag. Nat. Hist. II: 37. 1852, ‘ovalifolia’ – Lectotype: Wight s.n. (K! [K000381718]) = Stemonurus heyneanus Miers, Ann. Mag. Nat. Hist. II, 10: 40. 1852 (based on Olax heyneana Wall., Numer. List: 6780. 1832, nom. nud.) – Lectotype: Wallich 6780 (K!) = Stemonurus longifolius (Wall.) Miers, Ann. Mag. Nat. Hist. II, 10: 40. 1852 (based on Olax longifolia Wall., Numer. List: 6782. 1832, nom. nud.) – Lectotype (designated by Sleumer 1969): Wallich 6782 B (K!; isolectotype: CGE n.v.) =Stemonurus ceylanicus Miers, Ann. Mag. Nat. Hist. II, 10: 42. 1852 – Lectotype: Macrae 428 (BM n.v.; isolectotype: LINN n.v.).

212

Note. – Sleumer (1969) treated Gomphandra tetrandra as a widespread species. Here the name is applied to specimens from India and Sri Lanka only. Specimens from Vietnam, Thailand, etc. belong to Gomphandra cambodiana. The combination Gomphandra axillaris, which has been widely used, warrants an explanation because the synonymy and authorships presented here differ substantially from previous accounts. Gomphandra axillaris first appeared as a nomen nudum in Wallich’s Catalogue (n. 3718) in 1831. The name was validly published by Voigt, who included it in his catalog, but Gomphandra axillaris Wall. ex Voigt is illegitimate because it is superfluous, since Voigt listed Lasianthera tetrandra as a synonym. There is a minimal diagnosis accompanying Gomphandra axillaris in Voigt’s catalog, just the statement “Fl. small, white,” but since an earlier name is given in synonymy a description is not necessary for valid publication. When Miers (1852) made the combination Stemonurus axillaris, he listed Gomphandra axillaris Wall. as a synonym and cited Wall. Cat. 3718 (presumably to designate it as the type), but he also cited Lasianthera tetrandra Wall. as a synonym, so S. axillaris is illegitimate. The same is true for Thwaites’ (1858) treatment of Gomphandra axillaris Wall. as Platea axillaris. Sleumer (1969) cited Gomphandra axillaris Wall. ex Voigt correctly as an illegitimate name for G. tetrandra, but then he cited Wallich 3718 as the type of G. axillaris. The type of Gomphandra axillaris is the same as the type of G. tetrandra, and Wallich 3718 has no type status. Sleumer (1969) designated Wight 429 as the (holo)type of Gomphandra polymorpha var. acuminata Wight, and Wight 428 as the lectotype of Gomphandra polymorpha. The holotype designation of Wight 429 was incorrect, as Wight did not designate a specimen as the type. Wight s.n. [K000381719] is designated here as the lectotype of Gomphandra polymorpha var. acuminata on the basis of the hand-written description attached to the sheet, which includes the description of G. polymorpha var. acuminata and most of the features Wight described for G. polymorpha. The evidence suggests that this is the sheet on which Wight based the name acuminata, not the sheet that was affixed with the number 429 more than 20 years later. It seems he originally intended to call the species Gomphandra acuminata, but then chose to recognize varieties. Given the description on the sheet, and the fact that var. acuminata is the only 213

one for which Wight did not specify leaf dimensions, Wight s.n. should have been chosen for the lectotype of Gomphandra polymorpha. However, since the specimen Sleumer chose is not in serious conflict with the protologue, his selection of Wight 428 as the lectotype must stand (Art. 9.17).

Gomphandra cambodiana Pierre ex Gagnep., Notul. Syst. (Paris) I: 199. 1910 ≡ Stemonurus cambodianus (Pierre ex Gagnep.) R.A. Howard, J. Arnold Arbor. 21: 468. 1940 – Holotype: Pierre 5202 (P! [P00632097]; isotypes: L!, P!) = Gomphandra pauciflora Craib, Kew Bull.: 123. 1914 – Lectotype (designated by Sleumer 1969): Kerr 2435 (K! [K000381666]; isolectotypes: E!, K!) = Gomphandra hainanensis Merr., Philipp. J. Sci. 21: 348. 1922 ≡ Stemonurus hainanensis (Merr.) Hu, J. Arnold Arbor. 5: 229. 1924 – Lectotype: McClure 8546 (UC!; isolectotypes: A! [2 sheets], BM n.v., C spec. dep., E spec. dep., G n.v., K!, L!, MO!, P non inveni, PNH!, US!) = Gomphandra hainanensis Merr. var. latifolia Gagnep. in Lecomte, Fl. Indo-Chine I (Suppl.) 6: 749. Dec. 1948 – Lectotype (designated by Sleumer 1969): Pételot 6360 (P [non inveni]; isolectotype: A!, MICH!, NY!, US!) = Stemonurus chingianus Hand.-Mazz., Sinensia 2: 3. 1931 ≡ Gomphandra chingiana (Hand.-Mazz.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 – Holotype: R.C. Ching 5226 (W! photo [cited incorrectly as WU n.v. by Sleumer 1969]; isotypes: A!, NY!) = Gomphandra obscurinervis Merr., J. Arnold Arbor. 19: 44. 1938 ≡ Stemonurus obscurinervis (Merr.) R.A. Howard in Dahl, J. Arnold Arbor. 33: 269. 1952 – Holotype: Pételot 4359 (NY! (incorrectly cited as A); isotypes: L!, P! [3 sheets]) = Gomphandra petelotii Merr., J. Arnold Arbor. 23: 176. 1942 ≡ Stemonurus petelotii (Merr.) R.A. Howard in Dahl, J. Arnold Arbor. 33: 269. 1952 – Holotype: Pételot 2647 (A!; isotype: P non inveni) = Gomphandra annamensis Gagnep., Notul. Syst. (Paris) 13: 132. 1947 – Lectotype (designated by Sleumer 1969): Clemens 3861 (P [non inveni]; isolectotypes: A!, BM n.v., K!, L!, MICH!, MO!, NY!, U! photo, UC!, US!) 214

= Gomphandra camchayensis Gagnep., Notul. Syst. (Paris) 13: 133. 1947 – Lectotype (designated by Sleumer 1969): Poilane 337 (P! [P00632086]; isolectotypes: A!, L!, P!) = Gomphandra kerrii Gagnep. in Lecomte, Fl. Indo-Chine I (Suppl.) 6: 747. Dec. 1948 – Holotype: Kerr 21154 (P!; isotypes: A!, K!, L!).

Note. – Gomphandra cambodiana and its synonyms have been removed from synonymy with G. tetrandra. The species differ in inflorescence position and structure.

Gomphandra cumingiana (Miers) Fern.-Vill., Nov. App.: 46. 1880 ≡ Stemonurus cumingianus Miers, Ann. Mag. Nat. Hist. II, 10: 42. 1852 – Lectotype: Cuming 796 (K!; isolectotypes: BM n.v., C!, CGE n.v., FI n.v., G n.v., K!, L! [3 sheets], P! [2 sheets], SING! photo, UPS n.v.) = Stemonurus agusanensis Elmer, Leafl. Philipp. Bot. 7: 2689. 1915 ≡ Gomphandra agusanensis (Elmer) Merr., Enum. Philipp. Fl. Pl. 2: 489. 29 July 1923 – Lectotype: Elmer 14018 (A!; isolectotypes: BISH!, BO n.v., C spec. dep., F!, FI n.v., G n.v., K!, L! [2 sheets], NY!, P!, PNH!, U!, US!).

Note. – The holotype of Stemonurus agusanensis was destroyed at PNH. An isotype was sent to PNH when the herbarium was rebuilt after the war.

Gomphandra flavicarpa (Elmer) Merr., Enum. Philipp. Fl. Pl. 2: 490. 26 July 1923 ≡ Stemonurus flavicarpus Elmer, Leafl. Philipp. Bot. 7: 2691. 1915 – Lectotype (incorrectly designated by Sleumer 1969): Elmer 11330 (PNH†). Lectotype: Elmer 11330 (MO!; isolectotypes: A!, BISH!, BM n.v., BO n.v., E!, F!, FI n.v., G n.v., GH!, K!, L!, NY!, P!, US!, WRSL n.v.).

Note. – Here and below, Sleumer’s 1969 designation of destroyed specimens at PNH and B as lectotypes is treated as incorrect, as the specimens were not extant at the time of designation.

215

Gomphandra fuliginea (Elmer) Merr., Enum. Philipp. Fl. Pl. ii: 490. 26 July 1923 ≡ Urandra fuliginea Elmer, Leafl. Philipp. Bot. 2: 491. 1908 ≡ Stemonurus fuligineus (‘fulgineus’) (Elmer) R.A. Howard, J. Arnold Arbor. 21: 468. 1940 – Lectotype: Elmer 8620 (US!; isolectotypes: A!, BO n.v., E! photo, FI n.v., G n.v., K!, L!, NY!, WRSL n.v.).

Note. – The holotype of Urandra fuliginea was destroyed at PNH. The lectotype was chosen from the isotypes, as provided by Art. 9.2, 9.9, and 9.10.

Gomphandra lancifolia Merr., Philipp. J. Sci. 17: 277. 1921 (cited incorrectly as 1920 in Sleumer 1969) – Lectotype: Philippines, Tayabas [Aurora] Province, Mt. Dingalan, Aug. – Sept. 1916, Ramos & Edaño B. S. 26544 (US!; isolectotypes: A!, K!, L!, P!).

Note. – Merrill described this species but neglected to cite a specimen. However, B. S. 26544 must be considered original material (Art. 9.2) because it is the only specimen Merrill cited for Gomphandra lancifolia in his Enumeration of Philippine Plants (1923). Sleumer (1969) indicated B. S. 26544 as the (holo)type (PNH†), but it is not clear whether he ever saw that specimen before it was destroyed. Merrill was at PNH when he described the species and wrote his Enumeration, so it is reasonable to assume that the specimen he used for his description was at PNH as well. As this presumptive holotype (Art. 9.1) was destroyed, a lectotype has been chosen (Art. 9.2, 9.9).

Gomphandra luzoniensis (Merr.) Merr., Enum. Philipp. Fl. Pl. 2: 490. 26 July 1923 ≡ Urandra luzoniensis Merr., Philipp. J. Sci. 3: 242. 1908 ≡ Stemonurus luzoniensis (Merr.) R.A. Howard, J. Arnold Arbor. 21: 468. 1940 – Lectotype (incorrectly designated by Sleumer 1969): Borden F. B. 711 (PNH†). Lectotype: Borden F. B. 711 (US!; isolectotypes: BRI!, K! [2 sheets], L!, MO!, NY!).

Note. – Elaeocarpus integrifolius Blanco, Fl. Filip. ed. 2: 306. 1845, non Lam. 1788, is excluded as a synonym. The name is illegitimate, as it is a later homonym of E. 216

integrifolius Lam. Type specimens for Blanco’s names have only been found in a few cases, so the protologue provides the only basis for the name, and certain elements do not match Gomphandra luzoniensis. The petioles of Gomphandra luzoniensis are not very short (brevissime), the flowers are not in an umbel (flores … umbellati), the petals, while inflexed, are never bifid (petala … apice longe 1-2 nervia / terminadas en el ápice con 1 ó 2 nérvios largos), and the stamens are strongly exserted, not equal to the corolla (stamina … corollam aequantia). Blanco supplied a common name that is used for other species of Elaeocarpus in the Philippines, and in his Novissma Appendix in 1880, he included plants from Mt. Makiling (where Gomphandra luzoniensis is abundant and the only species in the genus) under G. axillaris, but did not list Elaeocarpus integrifolius as a synonym. This suggests that Blanco did not consider Elaeocarpus integrifolius to be a Gomphandra. Merrill (1918), in his Species Blancoanae, was the first to list it as a synonym of Gomphandra luzoniensis, based on the pubescent anthers and the flowering time in Blanco’s description, but he chose an illustrative specimen in fruit from Ilocos Norte Province, which is at the northern edge of G. luzoniensis’ range. It seems more prudent to leave Elaeocarpus integrifolius Blanco as an illegitimate name without a type, rather than adopting Merrill’s specimen as a neotype and thereby having a type that conflicts with the protologue. Blanco’s description may well have been of Gomphandra luzoniensis and contained inaccuracies, but it is also possible that the taxon he described is extinct, as the forests around Manila were decimated long ago.

Gomphandra oblongifolia Merr., Philipp. J. Sci. 17: 276. 1920 ≡ Stemonurus oblongifolius (Merr.) R.A. Howard, J. Arnold Arbor. 21: 469. 1940 – Lectotype: Philippines, Camarines [Sur] Province, Paracale, Nov. – Dec. 1918, Ramos & Edaño B. S. 33727 (A!; isolectotypes: K!, L!, P!,US!).

Note. – The holotype of Gomphandra oblongifolius was destroyed at PNH. Sleumer (1969) incorrectly listed Gomphandra sorsogonensis Elmer, an invalidly published name, as a synonym of this species. The specimen on which Elmer’s name is based is clearly different from Gomphandra oblongifolia and belongs to G. mappioides Valeton. 217

Gomphandra oligantha Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Urandra pauciflora Merr., Philipp. J. Sci. 3: 243. 1908 ≡ Gomphandra pauciflora (Merr.) Merr., Enum. Philipp. fl. pl. 2: 491. 26 July 1923, nom. illeg., non Craib 1914 – Lectotype: Merritt F. B. 6770 (US!).

Gomphandra capitulata (Jungh. & de Vriese) Becc., Malesia I: 111. Sept. 1877 ≡ Aralia capitulata Jungh. & de Vriese, Ned. Kruidk. Arch. I: 17. 1846 ≡ Lasianthera capitulata (Jungh. & de Vriese) Miq., Fl. Ned. Ind. I: 791. 10 July 1856 ≡ Stemonurus capitulatus (Jungh. & de Vriese) Kuntze, Revis. Gen. Pl. I: 112. 5 Nov. 1891 – Lectotype: Sumatra, Tobing, Junghuhn s.n. (L! [L 0014740]) = Gomphandra nyssifolia King, J. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 64, ii: 114. 1895 ≡ Stemonurus nyssifolius (King) R. A. Howard, J. Arnold Arbor. 21: 468. 1940 – Lectotype (designated by Sleumer 1969): King’s Collector 6406 (CAL! [sheet 83462]; isolectotypes: BM n.v., CAL!, G n.v., K! [2 sheets], L!, P!).

Note. – Sleumer annotated two sheets at Leiden as the holotype of Aralia capitulata, and indicated five others as isotypes. There is no indication that all the material represents one collection, and it is doubtful that Junghuhn and De Vriese used all the specimens in their type description, as they made no mention of the fruit found on three sheets, or the larger leaves on two sheets. One of the specimens that has a label with field notes was certainly used for the type description, but it does not have mature flowers, so at least two specimens comprised the original material. Therefore Junghuhn s.n. [L 0014740] is designated as the lectotype, and the other specimens have no type status, though they are Junghuhn collections. Sleumer (1969) cited isotypes at K, P, and U, but these sheets are not duplicates of the lectotype, and they have no type status. Sleumer (1969) included as a synonym Nyssa sessiliflora Koord. (non Hook.), Pl. Jungh. Ined. n. 57. Koorders (1909) began to publish the names evidently found on a collection of specimens that were probably sent to Leiden after Junghuhn’s death, and he referred to his first publication as Plantae Junghuhnianae ineditae, which corresponds to 218

the labels he applied to the collection. There is a specimen at Leiden which bears the label Pl. Jungh. Ined. n. 57, and it was cited by Hallier f. (1910) as “Nyssa sessiliflora (non Hook.) Koord.”, but this name was never published. Nyssa sessiliflora Hook. was published in 1867, so Koorders’ name would have been a later homonym, but as it was never validly published, it has no standing.

Gomphandra javanica (Bl.) Valeton, Crit. Overz. Olacin. 217, pl. 4, f. 1-9 c, pl. 5, f. 23 a, pl. 6, f. 46. 1886 ≡ Stemonurus javanicus Bl., Bijdr. (13): 649. 24 Jan. 1826 ≡ Lasianthera javanica (Bl.) Miq., Fl. Ned. Ind. I: 790. 10 July 1856 – Lectotype: Blume s.n. (L! [L 0014769]) = Stemonurus javanicus Bl. var., Bijdr. (13): 649. 24 Jan. 1826 – Lectotype: Blume 1703 (L! [L 0014771]; isolectotype: L! [L 0014772]) = Stemonurus pauciflorus Bl., Bijdr. (13): 648. 24 Jan.1826 ≡ Lasianthera javanica var. pauciflora (Bl.) Miq., Fl. Ned. Ind. I: 791. 10 July 1856 – Lectotype: Blume 2149 (L! [L 0014777]; isolectotypes: L! [L 0014775, L 0690335]) = Gomphandra javanica (Bl.) Valeton var. lanceolata Koord. & Valeton, Bijdr. Boomsoort. Java 5: 151. 1900 – Lectotype (designated by Sleumer 1969): Koorders 27878 (BO n.v.; isolectotypes: K, L, P) = Gomphandra javanica (Bl..) Valeton var. dolichocarpa Koord. & Valeton, Bijdr. Boomsoort. Java 5: 151. 1900 – Lectotype (designated by Sleumer 1969): Koorders 23016 (BO n.v.; isolectotypes: K, L) = Gomphandra comosa (non King) Bak. f., J. Bot. 62 (1924) Suppl. 21.

Note. – Sleumer (1969) referred to “Bogor, in montosis, Blume [s.n.], (L)” as the type of Stemonurus javanicus, with duplicate specimens (isotypes) at C, K, P, and S. Two specimens at Leiden are annotated as the holotype of S. javanicus, which is not permitted by the Code. In addition, Blume did not indicate one specimen in his protologue, so there is no holotype, and neither specimen at Leiden has an original label that indicates the place of collection. A lectotype must be chosen, and I have selected the “holotype” specimen (L 0014769) that best matches Blume’s description of “cymis solitariis 219

geminisve.” The other Leiden specimen (L 0014770) has no type status, nor do any Blume collections of Gomphandra javanica at other herbaria. A similar situation exists for Blume’s Stemonurus javanicus var. Two specimens, which in this case have the same label, have been annotated as the holotype by Sleumer. The specimen with leaves that are more prominently oval and a clearly dichotomous inflorescence (L 0014771) has been chosen as the lectotype. The other specimen (L 0014722) is an isolectotype. Five specimens at Leiden were annotated as the holotype of Stemonurus pauciflorus. Again, there is no holotype, and a lectotype (L 0014777), which most closely matches Blume’s description, was chosen from the Blume collections. Two other sheets have the same collector’s number as the lectotype, so they can be considered isolectotypes. No other specimens labeled as S. pauciflorus have any type status.

Gomphandra quadrifida (Bl.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Stemonurus quadrifidus Bl., Mus. Bot. I: 249. July 1850 ≡ Lasianthera javanica (Bl.) Miq. var. quadrifida, Fl. Ned. Ind. I: 790. 10 July 1856 – Lectotype: Korthals s.n. (L! [L 0014829]) = Stemonurus prasinus Bl., Mus. Bot. I: 249. July. 1850 ≡ Lasianthera prasina (Bl.) Miq., Fl. Ned. Ind. I: 791. 10 July 1856 ≡ Gomphandra prasina (Bl.) Becc., Malesia I: 110. Sept. 1877 – Holotype: Korthals 1215 (L! [cited incorrectly as 1315 (Sleumer 1969)]) = Stemonurus penangianus Miers, Ann. Mag. Nat. Hist. II, 10: 39. 1852 (based on Gomphandra penangiana Wall., Numer. List: 7204, 1832, nom. nud.) ≡ G. penangiana (Miers) Mast. in Hook. f., Fl. Brit. India I (1875) 587 – Holotype: Wallich 7204 (BM n.v.; isotypes: A!, C n.v., CGE n.v., GH!, K! [4 sheets], L!, NY!, P n.v.) = Lasianthera ovalifolia Miq., Fl. Ned. Ind., Eerste Bijv. III: 342 (Dec 1861) – type: Teysmann H.B. 3992 (U! photo; isotypes: BO n.v., L! [2 sheets]) = Gomphandra penangiana Wall. var. ovalifolia (Miq.) Valeton, Crit. Overz. Olacin.: 225, pl. 4, f. 17 a-b. 1886 – type: Wallich 7204 (BM n.v.; isotype: K!) = Gomphandra oppositifolia Pierre ex Gagnep., Notul. Syst. (Paris) 1: 198. 1910 ≡ Stemonurus oppositifolius (Pierre ex Gagnep.) R.A. Howard, J. Arnold Arbor. 21: 469. 220

1940 – Holotype: Vietnam, Bien-hoa Province, Chiao-xhan Mts., Pierre 6250 (P non inveni; isotype: L! [fragment ex P]) = Gomphandra puberula Ridl., J. Fed. Malay States Mus. 6: 142. 1915 ≡ Gomphandra maingayi King. var. pubescens Ridl., Fl. Malay. Penins. I: 429. July 1922 – Holotype: Ridley 15950 (SING n.v.; isotypes: BM n.v., K!) = Gomphandra affinis var. floribunda Ridl., J. Fed. Malay States Mus. 6: 142. 1915 – Lectotype (designated by Sleumer 1969): Ridley s.n. (BM n.v.) = Gomphandra lanceolata (Mast.) King var. tenuifolia Craib, Fl. Siam. I: 273. 5 Mar. 1925 – Holotype: Kerr 7150 (BM n.v.; isotypes: K!, SING n.v.) = Gomphandra scorpioidea Gagnep., Notul. Syst. (Paris) 13: 133. 1947 – Holotype: Eberhardt 1552 (P, non inveni; isotypes: A!, L! [fragment ex P]).

Note. – In 1968, Sleumer annotated three specimens at Leiden as comprising the holotype of Stemonurus quadrifidus. Blume did not indicate a specimen, so there is no holotype. Sleumer’s 1969 designation of Korthals s.n. as the type conflicts with his earlier annotations, which have “part of holotype” on the Korthals sheet and “holotype” on the sheets with no collector. Blume cited Herb. Korth. for one of the species in his 1850 publication, but he did not specify a collector for S. quadrifidus. From his description, it is clear that he examined several sheets to obtain the range of leaf dimensions. One of the sheets that does not indicate a collector has been chosen as the lectotype, following Sleumer’s 1968 decision. The other sheets, while original material, have no type status. Korthals 1215 is indicated as the holotype of Stemonurus prasinus Bl. It is the only Korthals specimen at Leiden with a label that reads “Stemonurus javanicus,” which Blume specifically referenced in his protologue. Although the inflorescence(s) seem to have been lost from the specimen, the leaf dimensions given by Blume correspond quite well. Even though Blume did not cite a collection number, Korthals 1215 is the original material that Blume used for his description, and as such can be considered the holotype. Miquel first published Lasianthera ovalifolia in Fl. Ned. Ind., Eerste Bijv. I: 137 (Dec. 1860), but as there was no description, it was a nomen nudum until 1861. 221

Sleumer listed Gomphandra penangiana Wall. ex Mast. in Hook. f., Fl. Br. Ind. I (1875) 587, as a synonym of G. quadrifida, but this author citation is incorrect. Masters validly published Gomphandra penangiana, but he cited Stemonurus penangianus Miers as a synonym (the first valid publication of the epithet; both based on the same type, Wall. Cat. 7204). Following Art. 46.3, Note 2 and Ex. 22, the proper citation for Masters’ valid publication of the name is Gomphandra penangiana (Miers) Mast. in Hook. f.

Gomphandra mappioides Valeton, Crit. Overz. Olacin.: 227, fig. 21 a-f. 1886 ≡ Stemonurus mappioides (Valeton) Kuntze, Revis. Gen. Pl. I: 112. 5 Nov. 1891 – Lectotype (designated by Sleumer 1969): Teysmann 6711 (L!; isolectotype: BO n.v.) = Gomphandra australiana F. Muell. var. celebica Valeton in Koord., Versl. Minahasa: 392. 19 Aug. 1898 – Lectotype (designated by Sleumer 1969): Koorders 18350 (BO n.v.; isolectotypes: A!, K!, L! [2 sheets], P!) = Gomphandra apoensis (Elmer) Merr., Enum. Philipp. Fl. Pl. 2: 490. 29 July 1923 ≡ Stemonurus apoensis Elmer, Leafl. Philipp. Bot. 7: 2690. 1915 – Lectotype: Elmer 10658 (A!; isolectotypes: BISH!, BM n.v., BO n.v., E! photo, F!, FI n.v., G n.v., GH!, K!, L!, MO! [2 sheets], NY!, P!, US!, WRSL n.v.).

Note. – Gomphandra apoensis, which was considered a Philippine endemic by Sleumer (1971), is treated as a synonym of Gomphandra mappioides. Philippine and Indonesian plants differ only in stigma diameter. The holotype of Stemonurus apoensis was destroyed at PNH. Sleumer (1969) placed Gomphandra sorsogonensis Elmer in synonymy with G. oblongifolia Merr. Gomphandra sorsogonensis, which was published in Leafl. Philipp. Bot. 10: 3748 (1939), is not a valid name because it lacked a Latin description and therefore has no nomenclatural standing. Elmer presumably based his name on the specimen of Elmer 15295 that was destroyed at PNH. Duplicates (US!, A!, K!, L!, MO!, P!, NY!, U! photo) show that Gomphandra sorsogonensis and G. mappioides clearly represent the same species and are different from the type of G. oblongifolia.

222

Gomphandra simalurensis Sleumer, Blumea 17: 194. 1969 – Lectotype: Achmad 1570 (L! [L 0014839]; isolectotype: L! [L 0014838]).

Note. – Sleumer (1969) indicated Achmad 1570 as the type of Gomphandra simalurensis. Leiden has two sheets of this specimen, both of which are marked as the holotype and which bear an annotation slip that reads “Gomphandra simalurensis Sleum. Holotypus.” These sheets do not represent a single specimen, especially since the annotation slip on L 0014838 covers an Herbarium Bogoriense stamp on the sheet. Sleumer cited a duplicate specimen at BO, but it is not clear whether there is another sheet still at BO. Gomphandra simalurensis does not have a holotype – the two sheets at Leiden were syntypes, and one has now been chosen as a lectotype.

Gomphandra subrostrata Merr., Pap. Michigan Acad. Sci. 19: 164, t. 27. 1934 ≡ Stemonurus subrostratus (Merr.) R.A. Howard, J. Arnold Arbor. 21: 469. 1940 – Holotype: Rahmat Si Toroes 1323 (NY!; isotypes: A!, MICH!, US!).

Note. – Sleumer (1969) indicated that the type was at MICH. The holotype is in fact at NY. Although Merrill did not specify an herbarium in his protologue, he was at NY when he described the species, and the specimen at NY bears his handwriting: Gomphandra subrostrata n. sp.

Gomphandra montana (G. Schellenb.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Stemonurus montanus G. Schellenb., Bot. Jahrb. Syst. 58: 162. 1923 – Lectotype (incorrectly designated by Sleumer 1969): Ledermann 12478 (B†). Lectotype: Ledermann 12478 (L!; isolectotypes: A! photo of fragment, K!) = Gomphandra carrii Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 239. 1940 – Lectotype: Carr 14605 (K!; isolectotypes: A!, CANB!, L!, NY!, SING!).

Note. – The holotype of Gomphandra carrii was destroyed at B.

223

Gomphandra papuana (Becc.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Platea papuana Becc., Malesia I: 257. Dec. 1883 ≡ Stemonurus papuanaus (Becc.) G. Schellenb., Bot. Jahrb. Syst. 58: 161. 1923 – Holotype: d’Albertis s.n. (FI! Herb. Beccari n. 2469 photo; isotypes: FI! photo (n. 2469 A), K! [2 sheets], MEL n.v.) = Stemonurus zygomorphus Pulle, Nova Guinea 8: 658. 1912 ≡ Gomphandra zygomorpha (Pulle) Sleumer Notizbl. Bot. Gart. Berlin-Dahlem 15: 239. 1940 – Holotype: Versteeg 1755 (U! photo; isotypes: BO n.v., K!, L!) = Stemonurus sawiensis Birnie, Nova Guinea 14, 2: 275. 1926 ≡ Gomphandra sawiensis (Birnie) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 – Holotype: Gjellerup 608 (L!; isotypes: A!, BO n.v., K!, U! photo).

Note. – Sleumer cited two specimens at FI, Herb. Beccari n. 2469 and 2469A, as the holotype. The specimens are duplicates and have the same handwriting on the labels, but only sheet 2469 is marked as the holotype. Sleumer (1969) cited Lasianthera litoralis (non Miq.) F. v. M., Descr. Not. 2: 53. 1877, as a synonym of Gomphandra papuana. This citation is somewhat misleading because Von Mueller (1876) did not publish the combination Lasianthera litoralis. He provided a description of a D’Albertis collection from the Fly River under the name Lasianthera litoralis Miq. and wrote, “It is supposed, that it is this species, which Blume (Mus. Bot. Lugd. Batav. i. 250) had in view, when he described it, without having flowers or fruits, as a Stemonurus” (Stemonurus litoralis Bl. is the basionym of Lasianthera litoralis Miq.). Beccari (1877: 110) mentioned von Mueller’s ascription of the D’Albertis specimen to Lasianthera litoralis Miq., but wrote that although he (Beccari) had not seen the type, he did not believe that Blume and Miquel’s names applied to the same species as the specimen D’Albertis had collected. Beccari later described the specimen as a Platea, based on the large stigma and the symmetrical fruit and cited Lasianthera litoralis F. v. Muell. as a synonym. Miquel (1856) had transferred Blume’s (1850) Stemonurus litoralis to Lasianthera, and cited a Zipellius specimen. Blume did not cite a specimen in his protologue, but the Zipellius specimen at Leiden that is annotated Stemonurus litoralis Bl. is a Gonocaryum. So although he did not see the 224

type, Beccari’s publication of Platea papuana is legitimate with the D’Albertis specimen as its type, and Lasianthera litoralis F. v. M. should not be the basionym of Gomphandra papuana. The proper citation of von Mueller’s account should be Lasianthera litoralis sensu F. Muell. (non (Bl.) Miq.).

Gomphandra pseudoprasina Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 240. 1940 – Lectotype: Clemens 2012 (G! [G00191577]); isolectotypes: A!, G! [2 sheets]).

Note. – The holotype of Gomphandra pseudoprasina was destroyed at B.

Gomphandra ramuensis (Lauterb.) Sleum., Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 ≡ Stemonurus ramuensis Lauterb. in K. Schum. & Lauterb., Nachtr. Fl. Schutzgeb. Südsee: 305. 16 Nov 1905 – Lectotype: Schlechter 14139 (P!; isolectotypes: A! [3 sheets, fragments], BM n.v., BO n.v., G n.v., K!, L!, WRSL n.v.) = Stemonurus gracilis G. Schellenb., Bot. Jahrb. Syst. 58: 164. 1923, nom. illegit., non G. gracilis King 1895 ≡ Gomphandra pallida Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 238. 1940 – Lectotype (incorrectly designated by Sleumer 1969): Ledermann 7229 (B†). Lectotype: Ledermann 7229 (L!; isolectotype: K!) = Stemonurus viridis G. Schellenb., Bot. Jahrb. Syst. 58: 163. 1923 ≡ Gomphandra viridis (G. Schellenb.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 239. 1940 – Lectotype (incorrectly designated by Sleumer 1969): Ledermann 8013 (B†). Lectotype: Ledermann 8013 (K!; isolectotypes: E spec. dep., SING! photo).

Note. – The holotype of Stemonurus ramuensis was destroyed at B. Sleumer (1969) treated Gomphandra ramuensis as a synonym of G. australiana, but their types represent different species, so they cannot be considered synonyms.

Gomphandra schoepfiifolia Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 241. 1940 – Lectotype: Clemens 5160 (A!).

225

Note. – Sleumer (1969) incorrectly designated the paratype Carr 13617 (L!) as a neotype of Gomphandra schoepfiifolia, after the holotype (Clemens 5160) was destroyed at B. The Carr specimen should have been considered a lectotype (Art. 9.10). Sleumer did not see the isotype of Clemens 5160 at A, which must be designated as the lectotype (Art. 9.10). The “neotype” status of Carr 13617 is removed, and the specimen should again be regarded as a paratype.

Gomphandra australiana F. Muell., Fragm. Phyt. Austr. 6: 3. July 1867 ≡ Stemonurus australianus (F. Muell.) Kuntze, Rev. Gen. Pl. I: 112. 5 Nov. 1891 – Lectotype: Australia, Dalrymple’s Gap, 25 June 1866, Dallachy s.n. (MEL! photo).

Note. – Sleumer (1969) included Gomphandra polymorpha (non Wight) F. M. Bailey, Queensl. Bot. Bull. 8 (Dep. Agric. Brisbane, 1893) 71 as a synonym. Bailey (1893) identified a Cowley specimen (n.v.) as Gomphandra polymorpha Wight var. 6 and considered it to differ from G. australiana in its leaves and inflorescence. However, the specimen was collected along the Barron River, where Gomphandra australiana is known to grow, and Bailey’s description fits the species quite well. Gomphandra australiana is also the only species in the genus that has been found in Australia. Gomphandra polymorpha F. M. Bailey (non Wight) should be considered as a misidentification, not as a synonym, as Bailey did not provide an epithet for his variety so it has no nomenclatural standing.

Irvingbaileya australis (C.T. White) R.A. Howard, Brittonia 5: 52. 1943 ≡ Tylecarpus australis C.T. White, Queensland Agric. J. 20: 12. 1918 – Lectotype (designated by Howard 1943): Australia, Queensland, Johnstone River. Bancroft s.n. (BRI! photo; isolectotypes: A!, K!).

Note. – The specimen at Kew is labeled “fragment ex QRS,” but QRS does not have a duplicate. Either the specimen is missing or the label should read “fragment ex BRI.” Guymer (1984) indicated that the lectotype of Irvingbaileya australis was at A, but the 226

lectotype is actually at BRI. Howard received specimens from White, who was at BRI, and cited the specimen at A as “fragments of the type,” indicating that the type was at BRI. If Article 8.3 of the Code is applied the same way to lectotypes as it is to holotypes (see Example 5), the lectotype is at BRI and Harvard's fragment of the type is an isolectotype.

Stemonurus ammui (Kaneh.) Sleumer, Blumea 17: 260. 1969 ≡ Urandra elliptica G. Schellenb., Bot. Jahrb. Syst. 29: 17. 1924, nom. illegit., non Merr. 1910 ≡ Urandra ammui Kaneh., Bot. Mag. (Tokyo) 45: 293. 1931 ≡ Stemonurus ellipticus (G. Schellenb.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 242. 1940 – Holotype (incorrectly designated by Sleumer 1969): Ledermann 14528 (B†). Lectotype: Ledermann 14528 (K!).

Note. – Sleumer (1969) listed Ledermann 14528 (B†) as the (holo)type of Urandra elliptica Schellenb. However, Schellenberg (1924) cited two specimens, Ledermann 14527 and 14528. Both specimens were destroyed at B. The syntype Ledermann 14528 at K appears to be the only remaining original material, so Sleumer’s designation should be corrected to a lectotype (Art. 9.8).

Stemonurus gitingensis (Elmer) Sleumer, Blumea 17: 261. 1969 ≡ Urandra gitingensis Elmer, Leafl. Philipp. Bot. 4: 1476. 1912 – Lectotype (incorrectly designated by Sleumer 1969): Elmer 12277 (PNH†). Lectotype: Elmer 12277 (US!; isolectotypes: A, BM, BO, E, FI, G, GH!, K!, L!, NY!).

Stemonurus monticola (G. Schellenb.) Sleumer, Notizbl. Bot. Gart. Berlin-Dahlem 15: 243. 1940 ≡ Urandra monticola G. Schellenb., Bot. Jahrb. Syst. 58: 164. 1923 – Lectotype (invalidly designated by Sleumer 1969): Ledermann 9592 (B†). Lectotype: Ledermann 9592 (L!; isolectotype: K!) = Urandra brassii R.A. Howard, Lloydia 6: 146, pl. I, f. 1 & 2. 1943 – Holotype: Brass 7421 (A!; isotypes: BM, BO, BRI!, K!, L!). 227

Acknowledgements

Thanks to Peter Fraissinet, Bailey Hortorium (BH) librarian, for help with Apodytes andamanica Kurz, to Drs. Richard Brummitt, Kanchi Gandhi, John McNeill, and James Reveal for help with nomenclatural problems, to Dr. Neil Bernstein (Ohio University), for help with Latin verb tenses, and to the curators and staff at A/GH, BM, BRI, C, E, FI, G, K, LINN, MEL, P, and QRS who checked for and databased type specimens at those herbaria. Literature Cited

Bailey, F. M. (1893). Contributions to the Queensland flora. 8: 71-72. Edmund Gregory, Brisbane.

Beccari, O. (1877). Malesia. Tipografia del Reale Instituto Sordo-muti, Genova.

Blume, C. L. (1850). Museum Botanicum Lugduno-Batavum. E. J. Brill, Lugduni- Batavorum.

Guymer, G. P. (1984). Icacinaceae. In: Robertson, R. et al. (eds), Flora of Australia. 22: 204-211. Australian Government Publishing Service, Canberra, Australia.

Howard, R. A. (1943). Studies of the Icacinaceae. VII. A Revision of the Genus Medusanthera Seeman. Lloydia 6: 133-143.

Kårehed, J. (2001). Multiple origin of the tropical forest tree family Icacinaceae. American Journal of Botany 88: 2259-2274.

Kurz, S. (1872). New Burmese plants. Journal of the Asiatic Society of Bengal 41: 298. 228

Merrill, E. D. (1918). Species Blancoanae; a critical revision of the Philippine species of plants described by Blanco and by Llanos. 237. Bureau of Printing, Manila.

Merrill, E. D. (1923). An enumeration of Philippine flowering plants. Bureau of Printing, Manila.

Miers, J. (1852). On some genera of the Icacinaceae. The Annals and Magazine of Natural History Series 2, vol. 10: 31-44, 108-112, 118-119.

Miquel, F. A. W. (1856). Flora van Nederlandsch Indie. C. G. van der Post, Amsterdam.

Mueller, F. v. (1876). Descriptive notes on Papuan plants. George Skinner, Acting Government Printer, Melbourne.

Sleumer, H. O. (1969). Materials towards the knowledge of the Icacinaceae of Asia, Malesia, and adjacent areas. Blumea 17: 181-264.

Sleumer, H. O. (1971). Icacinaceae. Flora Malesiana Series 1. 7 (1): 1-63. Noordhoff- Kolff, Djakarta.

Wight, R. (1840). Illustrations of Indian Botany. J. B. Pharoah, Madras. 229

CHAPTER 6: TAXONOMIC TREATMENT

Gomphandra Wall. ex. Lindl.

Shrubs to medium sized trees. Young twigs green, more or less horizontal. Terminal buds falcate, pubescent. Wood with prominent multiseriate rays. Lower branches self-pruning, leaving scars. Growth monopodial, sympodial, or mixed, axillary branches forming a 90° angle perpendicular to the subtending leaf. Leaves showing webby strands of protoxylem from major veins when torn. Inflorescences axillary, leaf- opposed, or terminal on sympodial branches. Flowers functionally unisexual. Calyx cupular, entire to minutely apiculate or lobed. Disk absent in female flowers, reported as present in some male flowers but not well known. Petals 4 – 5, green to white or yellow. Stamens 4 – 5, generally exserted, white, filament flattened, glabrous or more often pubescent ventrally, dorsally, and/or at the connective. Anthers introrse, longitudinally dehiscent, pollen white. Ovary rudiment (♂ fls.) small, cylindrical to ovoid-conical, glabrous to sparsely pubescent, occasionally reported with ovules but not developing. Staminodes (♀ fls.) resembling stamens, sometimes with less pubescence, often exserted or equal in length to the petals, anther cells generally empty, usually brownish. Ovary cylindrical, sometimes gibbous at the base, glabrous to densely pubescent, without a lateral appendage. Stigma sessile, capitate, often lobed or ridged, persistent. Fruit uncompressed, drupe shape various, white, yellow, orange, pink, or reddish, glabrous or sparsely pubescent, often punctate, outer mesocarp thin, fleshy, inner mesocarp sclerified, longitudinally ridged, with prominent sulcus complex on one side, endocarp sclerified. Stigma often displaced toward sulcus. Seed 1, vascularized with a chalazal and post- chalazal bundle. Stigma attached to endocarp. Ca. 62 taxa.

As with all genera, there are exceptions to the above description. Individuals sometimes have 6 or 7 petals or stamens, but these instances are uncommon and do not characterize any species. Dimorphic stamens (unequal lengths) have been observed in Gomphandra pseudoprasina, but this is not a regular feature of the species. Gomphandra 230 has been reported as hermaphroditic or polygamo-dioecious by some authors (e.g. Miers 1852) and has been illustrated with ovules in the ovary rudiment (Wight 1844-1845), but there is no evidence that the ovary rudiment ever develops. Certain species, like Gomphandra mappioides, are frequently attacked by insects that produce galls in the ovary rudiments, but these galls have a distinct appearance and would not be mistaken for fruit by someone familiar with the genus. Gomphandra is best considered functionally dioecious, and indeed staminate and pistillate inflorescences are readily distinguishable. Male (staminate) flowers are more numerous and do not have a visible ovary, while female (pistillate) flowers produce no or little pollen in the staminodes, have a prominent ovary that is equal in length to the corolla, and have a stigma that is as wide or wider than the ovary. Female flowers show no evidence of a disk, but some male flowers seem to have the ovary rudiment embedded in an annular disk, although this has not been confirmed in fresh material. One specimen of Gomphandra melanesiensis, BSIP 15041 (A!), has what appears to be an ovary rudiment of a male flower in an inflorescence of female flowers. The petals and stamens are no longer attached to the flower, and a more plausible explanation might be that what appears to be an ovary rudiment is the ovary of a female flower that failed to develop normally. The staminate inflorescences of Gomphandra quadrifida are unusual in that they bloom repeatedly. Older inflorescences can appear distinctly scorpioid, with pedicels from previous flowerings retained along the axes. Minute buds can usually be found below the terminal flower on each branch of the inflorescence. These buds remain dormant for a period and then develop, causing the branch to elongate. While other species of Gomphandra (e.g. G. luzoniensis, G. flavicarpa) may have small buds that develop later than the majority of buds on an inflorescence, G. quadrifida appears to be the only species with serial elongation of male inflorescences. Gomphandra is readily distinguishable within Stemonuraceae by its fruit, which have a relatively large terminal stigma and a longitudinally ridged inner mesocarp. The ridging pattern is often distinctive, but it is not visible in fresh fruit when the fleshy outer mesocarp is present. Dried (sub)mature fruit clearly show the ridges. Sleumer (1971) and 231

others referred to the endocarp being ridged, but the ridges represent sclerified bundles of the inner mesocarp. Gomphandra grows monopodially, sympodially, or exhibits a mixture of both. In ten taxa, the inflorescence is usually terminal, with an axillary bud assuming further growth, so that the inflorescence eventually appears leaf-opposed. Other taxa have only axillary inflorescences. Accessory buds may be present in leaf axils, leading to the development of more than one inflorescence per leaf axil. Some species (e.g. Gomphandra bracteata, G. borneensis, G. javanica) have multiple accessory buds that produce inflorescences, and they may develop what appear to be short-shoot flowering spurs in the leaf axils. The timing of vegetative growth and flowering can provide distinguishing features for particular taxa as well. Gomphandra does not seem to experience continuous growth. Although there are no bud scales protecting the terminal (or pseudoterminal) bud, the bud can remain dormant for months. Most collections have a small terminal bud and fully developed leaves, indicating that growth does not occur continuously. New leaves are only produced on the terminal segment of each branch, as Gomphandra only produces long shoots. Epidermal leaf characters were studied by Van Staveren and Baas in 1973. Most of their characters require a microscope and are not useful for the routine identification of herbarium specimens. Trichome length can be an informative character, but most species have minute pubescence (< 1 mm) that is not easily distinguished among species. Lobreau-Callen (1973) showed SEM photos of the pollen grains of Gomphandra mappioides and G. quadrifida. The two species have oblate, porate pollen with different exine ornamentation, suggesting that pollen morphology could be used to delineate groups of species, if not individual species. The pollen tends to be small (10-20 µm), and must be acetolyzed prior to mounting for SEM imaging. Light microscopy is not adequate to differentiate among pollen sculpturings. Species of Gomphandra can be found in a range of habitats. Some species are restricted to a certain substrate or elevational range, and details can be found under individual species entries. As a genus, Gomphandra is found from sea level to 2000 m, on clayey and sandy soils, in peat swamps, on karst and ultramafic barrens, and on soils 232

derived from limestone and basalt. Wet evergreen forest, mixed evergreen forest, lowland dipterocarp forest, and lower montane to montane mossy forest provide suitable habitat. Gomphandra can tolerate some level of disturbance, and cut trees will sprout from the stump, but there is no evidence that populations can become established in open areas. Trees may persist in areas that have been cleared, but not without adverse effects. For example, Gomphandra oligantha exhibits misshapen leaves, stunted growth, and damaged flowers in full sun. Conservation statuses, following IUCN (2001) guidelines, are given for newly described and rare taxa below.

Keys to species are presented below according to geographical region. As most species of Gomphandra are endemic to a certain island or country, the keys are designed to minimize the number of taxa one must consider to arrive at a determination. A few specimens have been left without determination and are listed at the end of the treatment of each geographical area. Intermediate specimens, or those with a cf. or aff. determination, are listed after the Specimens Examined of the species they most closely resemble and are discussed in the Notes.

Continental Asia, including India, Andaman & Nicobar Islands, Myanmar, China (excl. Taiwan), Vietnam, Laos, Cambodia, Thailand, Peninsular Malaysia, and Singapore p. 4

Philippines & Taiwan p. 30

Borneo – Sabah, Sarawak, Brunei, Kalimantan p. 74

Indonesia & Timor-Leste p. 92

Papua New Guinea p. 122

Melanesia – Bismarck Archipelago, Solomon Islands & Fiji p. 145

Australia p. 151 233

CONTINENTAL ASIA [11 taxa] [India, Andaman & Nicobar Islands, Myanmar, China (excl. Taiwan), Vietnam, Laos, Cambodia, Thailand, Malay Peninsula (incl. Singapore)]

G. cambodiana complex, G. capitulata, G. comosa, G. coriacea, G. donnaiensis, G. microcarpa, G. mollis, G. quadrifida, G. tenuis, G. tetrandra, G. tomentella

1. Inflorescences always axillary, never terminal or leaf-opposed 2 2. Leaves generally large, 12 – 29 × 4 – 9 cm 3 3. Twigs velutinous, leaves persistently pubescent below, flowers large, Vietnam G. donnaiensis 3’. Twigs glabrescent, pubescence appressed, leaves glabrous at maturity, flowers smaller 4 4. Leaves chartaceous, inflorescences capitulate, fruit pubescent, Malaysia and Indonesia G. capitulata 4’. Leaves coriaceous, inflorescences not capitulate, fruit glabrous, Andaman & Nicobar Islands G. comosa 2’. Leaves generally smaller 5 5. Leaves always narrowly lanceolate, rarely ≥ 1.5 cm wide, fruit to 1 cm long, Malaysia G. microcarpa 5’. Leaves not narrowly lanceolate, normally ≥ 1.5 cm wide, fruit longer than 1 cm 6 6. Inflorescences usually ≤ 1.5 cm long, flowers often quite small, commonly 1.5 – 2 mm wide, India and Sri Lanka G. tetrandra 6’. Inflorescences commonly ≥ 1.5 cm long, flowers not especially small, usually 2 – 3 mm wide, Yunnan, Thailand “G. pauciflora” form of G. cambodiana 1’. Inflorescences leaf-opposed and/or terminal (if axillary, scars present opposite leaves) 7 7. Twigs and lower surface of leaves somewhat persistently pubescent with dense spreading hairs (occasionally glabrescent) 8 8. Leaves drying light greenish, vein number, Myanmar, southern Thailand, and Malaysia G. tomentella 8’. Leaves drying dark brown, vein number, inflorescences 4 – 5 cm, Vietnam & Yunnan G. mollis 7’. Twigs and leaves initially pubescent with appressed hairs, glabrescent 9 9. Leaves coriaceous, stamens glabrous except for sparse pubescence at the connective, female flowers 1 – 3 ( – 4), Sri Lanka and India G. coriacea 9’. Leaves chartaceous to coriaceous, stamens pubescent dorsally and ventrally, Female flowers often more than 3, elsewhere 10 10. Male inflorescences with tiny reserve buds, blooming multiple times, pedicels of female flowers and fruit not markedly slender G. quadrifida* 10’. Male inflorescences not reblooming, pedicels slender or not 11 234

11. Youngest twigs always < 1 mm in diam., pedicels very slender, inner Mesocarp ridges scarcely evident G. tenuis* 11’. Youngest twigs (greater or equal) 1 mm in diam., pedicels not very slender, inner mesocarp ridges low but clearly evident G. cambodiana complex

*For specimens intermediate between these two species, see the Specimens Examined and Notes sections of G. quadrifida.

1. Gomphandra cambodiana Pierre ex Gagnep. (1910: 199). Stemonurus cambodianus (Pierre ex Gagnep.) R. A. Howard (1940: 468). Type: Cambodia, Pierre 5202 (holotype P!; isotypes L! [fragment], P!). Gomphandra pauciflora Craib (1914: 123). Type: Thailand, Doi Wao, 750 m [2500 ft.], ♂ fl., 23 Feb. 1912, Kerr 2435 (lectotype K! (selected by Sleumer 1969); isolectotype E!). Gomphandra hainanensis Merr. (1922: 348). Stemonurus hainanensis (Merr.) Hu (1924: 229). Type: Ng Chi Leng, Five Finger Mountain [Wuzhishan], 700 m, 20 Dec. 1921, McClure 8546 (G. hainanensis, lectotype UC!; isolectotypes A! [2 sheets], BM n.v., (C & E missing), G n.v., K!, L!, MO!, P n.v., PNH!, US!). Gomphandra hainanensis var. latifolia Gagnep. in Humb. & Gagnep. (1948: 749). Type: Vietnam, Pételot 6360 (lectotype P; isolectotype A). Stemonurus chingianus Hand.-Mazz. (1931: 3). Gomphandra chingiana (Hand.-Mazz.) Sleumer (1940: 238). Type: China, Guangxi Province, Tang Gior Poo, SE Luchen, 300 m [1000 ft.], ♂ fl., 23 May 1928, Ching 5226 (W! photo, holotype of Stemonurus chingianus; isotypes A!, NY!). Gomphandra obscurinervis Merr. (1938a: 44). Stemonurus obscurinervis (Merr.) R. A. Howard in Dahl (1952: 269). Type: Vietnam, Vĩnh Phúc Province, Tam Đảo, 1100 m, May 1931, Pételot 4359 (holotype NY! photo; isotypes L!, P! [3 sheets]). Gomphandra petelotii Merr. (1942: 176). Stemonurus petelotii (Merr.) R. A. Howard in Dahl (1952: 269). 235

Type: Vietnam, Hà Nội, Sơn Tây, Mt. Bavi [Ba Vi], 500 m, ♂ fl., 18 May 1940, Pételot 2647 (A! holotype of Gomphandra petelotii; isotype P n.v.). Gomphandra annamensis Gagnep. (1947: 132). Type: Vietnam, Quảng Nam Province, Mt. Ba Na, ♂ buds, 7 – 13 July 1927, Clemens & Clemens 3861 (P n.v., lectotype of G. annamensis (selected by Sleumer 1969); isolectotypes A!, BM n.v., K!, L!, MICH!, MO!, NY!, U! photo, UC!, US!). Gomphandra camchayensis Gagnep. (1947: 133). Type: Cambodia, Elephant Mountain, Poilane 337 (lectotype P! (selected by Sleumer 1969); isolectotypes A!, L!, P!). Gomphandra kerrii Gagnep. in Humb. & Gagnep. (1948: 747). Type: Laos, 1500 m, 20 April 1932, Kerr 21154 (holotype P!; isotypes A!, K!, L!).

Shrub or small tree to 6 m. Bark grey. Twigs relatively slender, straight to zigzag, green, seasonal twig extension synchronous, terminal buds and youngest portions densely pubescent with short, appressed, often whitish hairs, glabrescent, 1 – 2 mm in diam. Leaves chartaceous to thinly coriaceous, green above when fresh, paler below, usually drying dark brown, sparsely pubescent along the midrib or glabrous above, sparsely pubescent with appressed hairs to glabrous below, lanceolate to oblanceolate, narrowly oblong-elliptic, ovate, or obovate, (5 – ) 9 – 13 ( – 21) × (1.5 – ) 2 – 4.5 ( – 7) cm, base rounded to acute, apex obtuse to attenuate, often acuminate, margin flat to revolute; midrib impressed above, raised below, secondary veins (2 – ) 4 – 6 ( – 8) pairs, obscure to slightly raised above, raised below, usually well-spaced, converging towards the margin, lowest pair often steeply ascending, sometimes forming an intramarginal vein (Poilane 27628) upper pairs brochidodromous, intersecondaries common, tertiary veins obscure to slightly raised above, obscure to slightly raised below, delicately percurrent; petioles slender, grooved above, glabrous or sparsely pubescent, 0.4 – 0.9 ( – 1.3) cm × 0.6 – 1.6 mm. Inflorescences terminal or leaf-opposed, sometimes terminating short axillary branches, axes pubescent with spreading reddish hairs. Male inflorescences to 3 236

(- 5) cm long overall, with peduncle 0.4 – 1 cm long, bearing 2 – 4 ( – 5) branches 0.4 – 1 cm long, rarely branched again (0.4 cm long), each branch terminating in a cyme with 3 – 15 flowers, flowers subsessile or on pedicels 1 mm long, 10 – 30 ( – 50) flowers per inflorescence. Male flowers: calyx cupular, minutely toothed to lobed, glabrous to pubescent, 1 mm across; petals 4 – 5, white to yellow, 3 – 4 ( – 5) mm long, glabrous; stamens 4, strongly exserted, 4 – 5 ( – 6) mm long, pubescent dorsally at the connective with a tuft of clavate hairs and ventrally below the anthers; ovary rudiment obovoid, glabrous. Female inflorescences with peduncle 0.2 – 1 cm long, bearing 2 – 4 branches 1 – 4 mm long, each branch with 1 – 5 flowers on pedicels 1 mm long, (2 – ) 6 – 15 ( – 20) flowers per inflorescence. Female flowers: calyx cupular, apiculate, 1 mm across, petals 3 – 4 mm long, staminodes 3 – 4 mm long, not or scarcely exserted, pubescent with clavate hairs, ovary glabrous, 2 – 3 mm long, capped by the broader stigma. Fruit white when ripe (possibly also yellow, pink, lavender), ovoid-ellipsoid to obovoid, glabrous, (1.2 – ) 1.5 – 2.0 ( – 2.4) × 0.5 – 0.75 cm, apex acute, slightly beaked, base slightly tapered, very base swollen, inner mesocarp with ca. 10 low, anastomosing ridges, stigma terminal, 1.5 – 2.5 mm in diam.

DISTRIBUTION. Myanmar, Vietnam, Thailand, Laos, Cambodia, China (Yunnan, Guizhou [Kweichow, Kouy-Tcheou], Guangxi [Kwangsi], Hainan). SPECIMENS EXAMINED. CHINA. ♂ buds, 8 April 1936, Liu 26135 (MO!); Y. Foo- ning, long-may, 1000 m, ♂ buds, 22 April 1940, Wang 88762 (MO!); Hainan, no specific locality, fr., 1936, Tang 481 (A!); ibid, fr., 18 Oct. 1956, Deng 2666 (MO!); ibid, imm. fr., 2 Nov. 1933, Wang 35030 (A!, NY!); ibid, buds, 21 Dec. 1933, Wang 35762 (A!, NY!); ibid, buds, 11 Jan. 1934, Wang 36389 (A!, MO!, NY!); ibid, buds, 13 Jan. 1934, Wang 36552 (K!, NY!); ibid, imm. fr., 2 Nov. 1933, Liang 63587 (NY!); ibid, 2 Nov. 1933, Liang 63612 (NY!); ibid, ♂ buds, 10 Jan. 1934, Liang 64409 (MICH!, NY!); ibid, ♂ buds, 12 Jan. 1934, Liang 64500 (MO!, NY!); ibid, 16 Jan. 1934, Liang 64705 (NY!, P!, US!); ibid, ♂ buds, 17 Jan. 1934, Liang 64743 (K!, MO!, NY!, UC!); ibid, 17 Jan. 1934, Liang 64793 (NY!, P!); ibid, 18 Jan. 1934, Liang 64795 (NY!, US!); ibid, ♂ buds, 24 Feb. 1934, Liang 65188 (A!, MO!, NY!); ibid, buds, 24 Feb. 1934, Liang 65189 237

(MICH!, NY!); ibid, buds, 24 Feb. 1934, Liang 65190 (A!, MO!, NY!); Ngai District, Yeung Ling Shan, imm. fr., 19 June 1932, Lau 127 (A!, K!, MICH!, MO!, NY!, P!, UC!, US!); Road to Bai Shui Ling waterfall, 18°42’35” N, 109°50’29” E, 620 m, fr., 30 Nov. 2000, Gilbert et al. 325 (MO!); 3rd District of Dongfang County, Jianfeng Mountain, imm. fr., 920 m, 16 Dec. 1955, Hainan Station 329 (MO!); Ngai District, Chiu Sam Tsuen, imm. fr., 7 – 25 Aug. 1932, Lau 377 (A!, K!, MICH!, MO!, NY!, P!, UC!, US!); Ngai District, Fung Leng, imm. fr., 28 Aug. 1932, Lau 450 (A!, K!, MICH!, MO!, NY!, P!, UC!, US!); Baoting County, Eiaoluo Mountain, fr., 23 Dec. 1954, Diaoluo Shan Team 3069 (MO!); Bawang Mountain, on the way from Dongsi to Dongliu, ♂ fl., 16 April 1988, Li 3283 (MO!); Kan-en District, Sam Mo Watt village, Chim Fung Ling, buds, 25 March 1934, Lau 3560 (A!, BISH! photo, P!); ibid, ♂ buds, 9 April 1934, Lau 3713 (A!, BISH!, P!); Qiongzhong County, Chenpo District, Dalishang Village, Baishui Mountain, imm. fr., 14 Dec. 1956, Deng 3733 (MO!); Kan-en District, Fong Ngau Po Village, Chim Fung Mt., ♂ buds, fr., 2 – 31 Jan. 1935, Lau 5257 (A!); Ng Chi Leng, Five Finger Mountain [Wuzhishan], 700 m, 20 Dec. 1921, McClure 8546 (G. hainanensis, lectotype UC!, isolectotypes A! [2 sheets], BM n.v., (C & E missing), G n.v., K!, L!, MO!, P n.v., UC!, US!); ibid, 6 May 1922, McClure 9467 (A!, P!); ibid, ♀ fl., 13 May 1922, McClure 9570 (A!, BISH! photo); Bak Sa, ♂ buds, 1936, Lau 26135 (A!, MO!); Bak Sa, ♂ fl., 29 April 1936, Lau 26556 (A!, MO!); Loktung, imm. fr., 18 June 1936, Lau 27177 (A!); Lokwui [Lehui County, Yun Village], imm. fr., 12 Dec. 1936, Lau [Liu] 28382 (A!, MO!); Ya County, Diaoluo Mountain, 700 m, ♀ fl., 27 April 1959, Chen 30061 (MO! [2 sheets]); Ledong County, Jianfeng Mountain Forestry Management office, 300 – 680 m, ♀ fl., 18 May 1959, Chen 30326 (MO! [2 sheets]); Ya County, Dabaokang, Dieniukeng Village, imm. fr., 23 July 1933, Huang 33311 (MO!) or Wang 33311 (A!, MO!, NY!, P!, US!); Ya Xiang, imm. fr., 27 Sept. 1933, Wang 34309 (A!, MICH!, MO!, NY!); between Dung Ka and Mo San, 520 m [1700 ft.], 18 Aug. 1932, Chun & Tso 43537 (NY!); Dung Ka to Wen Fi Shi, 520 m [1700 ft.], imm. fr., 1 Sept. 1932, Chen 43775 (MO!) or Chun & Tso 43775 (A!, NY!); Dai Land, Dung Ka [Darun, Tongjia], 730 m [2400 ft.], imm. fr., 22 Sept. 1932, Chun & Tso 43878 (A!, F!, NY!, P!) or Chen 43878 (MO!); Tingan, Tungkap, Mochong Mountain, ♂ buds, 29 April 1932, Ko 52239 (A!, NY!); way to 238

Seven Finger Mountain, 750 m [2500 ft.], ♂ buds, 27 April 1932, Liang 61619 (A!, K!, NY!, US!); Yaichow, imm. fr., 26 Sept. 1933, Liang 63148 (A!, NY!, UC!); Yaichow, 580 m [1900 ft.], buds, imm. fr., 6 March 1933, How 70317 (A!, NY!); Yazhou or Yaichow, 610 m [2000 ft.], ♂ fl., 20 March 1933, Hou 70388 (MO!) or How 70388 (A!, BISH! photo, MICH!, MO!, NY!); Po-ting, [Taiping, Shimi Village], 335 m [1100 ft.], 23 April 1935, How 72089 (A!, P!) or Hou 72089 (MO!); Po-ting [Baoting], Taipinggang, Changsha Village, 400 m [1300 ft.], imm. fr., 25 May 1935, Hou 72590 (MO!) or How 72590 (A!); Baoting, Qizhi Mountain, buds, 14 April 1959, Wei 122249 (MO!); Guangdong Province, Dongxing County, Dabang, Pinglong Mountain, ♂ buds, 3 May 1959, Zhou 2256 (MO!); Qin County, Guitai, Maqi Mountain, buds, 10 April 1959, Gan 40011 (MO!); ibid, 300 – 400 m, buds, 9 April 1959, Zhou 80009 (MO!); Dongguang County, Nasuo, Dong Mountain, 280 m, fr., 30 Oct. 1959, Gan 40090 (MO!); Guangxi Province, Shiwan Mountain, Toucha River, imm. fr., 17 July 1982, Huang 144 (MO!); Tang Gior Poo, SE Luchen, 305 m [1000 ft.], ♂ fl., 23 May 1928, Ching 5226 (W! photo, type of Stemonurus chingianus; isotypes A!, NY!); She-feng Dar Shan, S. Nanning, 610 m [2000 ft.], fr., 27 Oct. 1928, Ching 8262 (A!); Longjin County, Daquing Mountain, 690 – 720 m, ♀ fl., 31 May 1957, Chen 11575 (MO!); Fusui County, Zhongdong District, Daming Mountains, 350 – 400 m, ♂ fl., 9 May 1957, Chen 12411 (MO!); Longjin County, Wulian, Banbi Village, Jingang Mountain, 410 – 450 m, imm. fr., 2 Aug. 1957, Chen 13328 (MO!); Guangdong border, Shang-sze District, SE of Shang-sze, Tang Lung Village, Shap Man Taai Shan, near Iu Shan village, ♂ fl., 4 May 1933, Tsang 22204 (A!, P!); Shap Man Taai Shan, near Hoh Lung village, imm. fr., 11 July 1933, Tsang 22686 (A!, P!); Na Wai Village, Shap Man Taai Shan, imm. fr., 11 – 30 July 1934, Tsang 23869 (A!, MO!, NY!); Tang Lung Village, Shap Man Taai Shan, fr., 14 Sept. 1934, Tsang 24255 (A!, F!, MO!, NY!); ibid, Shap Man Taai Shan, fr., 22 – 31 Oct. 1934, Tsang 24500 (A!, MO!, NY!); Lingle Xian, buds, 23 April 1957, Wang 43242 (MO!); Tian’e Xian, ♂ fl., 15 May 1957, Wang 43273 (MO!); Tianwei County, Ronglong, ♂ fl., 17 May 1957, Huang 43326 (MO!); Longzhou County, Daquing Mountain or Tai Ching Shan, 945 m [3100 ft.], ♂ fl., 30 May 1935, Gao 55189 (MO!) or Ko 55189 (A!); Zhenbian County or Chen Pien District, imm. fr., 9 Oct. 1935, Gao 239

55880 (MO!) or Ko 55880 (A!); east of Tung Hing City, imm. fr., 6 July 1937, Liang 69417 (A!); Foo Lung, Sup Man Ta Shan, imm. fr., 16 July 1937, Liang 69727 (A!); Guizhou Province, no specific locality, imm. fr., 1936, Teng [Deng] 91063 (A!, L!, MO!); Libolao Village, 410 m, ♂ buds, 5 May 1983, Song 702 (MO!); Kouy-Tcheou [Guizhou] Province, Gam go, 2000 m, fr., 6 Dec. 1917, Esquirol 6396 (P!); ibid, 2000 m, fr., 6 Dec. 1917, Esquirol 6399 (P!); Yunnan Province, Ping-pien Hsien, 1400 m, ♂ buds, 16 May 1934, Tsai 55131 (A!); ibid, 1200 m, ♂ buds, 19 May 1934, Tsai 55253 (A!); ibid, 1350 m, ♀ fl., 20 May 1934, Tsai 55331 (A!); ibid, 1300 m, buds, 23 May 1934, Tsai 55378 (A!); ibid, 1400 m, buds, 25 May 1934, Tsai 55405 (A!); ibid, 1200 m, imm. fr., 29 June 1934, Tsai 60577 (A!); ibid, 1200 m, ♀ fl., 29 June 1934, Tsai 60583 (A!); ibid, 1400 m, imm. fr., 15 July 1934, Tsai 60908 (A!); ibid, 1100 m, imm. fr., 24 Aug. 1934, Tsai 61669 (A!); ibid, ♀ fl., 1 June 1934, Tsai 62090 (A!); ibid, buds, 2 June 1934, Tsai 62138 (A!). VIETNAM. Lào Cai Province, Sa Pa District, Chapa [Sa Pa], ♂ fl., Pételot s.n. (P! [P00601789]); ibid, 1500 m, ♂ fl., Sept. 1932, Pételot s.n. (A!, NY!); ibid, 1600 m, imm. fr., Sept. 1932, Pételot 4463 (A!, NY!, P! [2 sheets]); ibid, specimen matching Pételot 4463 but label matching Pételot 5450 in elevation and date, (A!); ibid, 1500 m, April 1935, Pételot 5450 (syntype of G. hainanensis var. latifolia, A!, NY! [2 sheets], P n.v., US!); Lao-kay [Lào Cai], Cha pa [Sa Pa], 1500 m, ♂ buds, April 1938, Pételot 6360 (P n.v., lectotype of G. hainanensis var. latifolia; isolectotypes A!, MICH!, NY!, US!); Văn Bàn District, Liêm Phủ, Khuoi Ngoa village, 21°58’20” N, 104°20’16” E, 527 – 1120 m, ♂ buds, 21 Feb. 2001, Harder et al. 6600 (MO! [3 sheets]); Chapa [Sa Pa], Song Ta Van massif, 1550 m, fr., 25 Sept. 1944, Pételot 8752 (A!, P!); Cha-pa [Sa Pa], 1400 – 1500 m, fr., 6 Dec. 1913, Chevalier 29396 (P!); Hà Giang Province, Vị Xuyên District, Cao Bo, Tam Ve village, 22°46’12” N, 104°49’33” E, 1310 m, fr., 9 Sept. 2000, Harder et al. 5339 (MO!); ibid, 22°46’03” N, 104°49’42” E, 1200 – 1360 m, imm. fr., 12 Sept. 2000, Harder et al. 5469 (MO! [2 sheets]); ibid, 22°46’09” N, 104°49’23” E, 1300 – 1750 m, imm. fr., 17 Sept. 2000, Harder et al. 5640 (MO! [3 sheets]); Quảng Ninh Province, Mon-cay [Móng Cái], Pac-si, fr., 1 – 8 Oct. 1936, Tsang 26934 (A!, K!, P!); ibid, fr., 1 – 8 Oct. 1936, Tsang 26943 (A!, K!, P!); Hải Hà District, Ha-coi [Quảng Hà], Chuk-phai, Shui Mei village, Taai Wong Mo Shan, fr., 10 – 17 Nov. 240

1936, Tsang 27254 (A!, E!, K!, P!); ibid, fr., 23 June – 31 Aug. 1939, Tsang 29355 (A!, K!, P!); Hải Hà District, Ha-coi [Quảng Hà], Tong Fa Market, Taai Wong Mo Shan, fr., 11-23 Sept. 1939, Tsang 29579 (A!, E!, K!, L!, P!); Đầm Hà District, Sai Wong Mo Shan (Sai Vong Mo Leng), Lung Wan Village, imm. fr., May 18 – July 5, 1940, Tsang 30111 (A!, K!, L!, P!); Sơn La Province, Mộc Châu District, Van Ho, Hua Tat village, 20°46’18” N, 104°47’45” E, 1250 – 1375 m, fr., 7 Oct. 2000, Harder et al. 5816 (MO! [5 sheets]); ibid, 20°46’13” N, 104°46’12” E, 1100 – 1300 m, ♂ buds, 7 March 2001, Harder et al. 7433 (MO! [2 sheets]); Vĩnh Phúc Province, Tam Đảo, Cascade d’Argent, c. 930 m, imm. fr., 25 Aug. 1994, Boyce 822 (K! [2 sheets]); Tam Đảo Forest Reserve, 21°27’09” N, 105°39’09” E, 990 m, 9 Sept. 1993, Harder et al. 1803 (MO! [2 sheets]); Tam Đảo, ♀ fl., Eberhardt 4963 (P!); ibid, ♂ fl., Eberhardt 4972 (K!, P!); ibid, ♀ fl., Eberhardt 5035 (BISH! photo, P!); Hà Nội [Hà Tây Province], Sơn Tây, Mt. Bavi [Ba Vi], 500 m, ♂ fl., 18 May 1940, Pételot 2647 (A! holotype of Gomphandra petelotii, P n.v.); ibid, Lankok Valley, fr., 27 Sept. 1887, Balansa 3134 (K!, P! [2 sheets]); Hà Tây, Tu-Phap (misplaced? – Tu Phap translates as Justice), fr., Dec. 1888, Balansa 3192 (K!); Hà Nội or Hòa Bình Province, Phương Lâm, 2 May 1888, Balansa 3890 (syntype of Gomphandra hainanensis var. latifolia, K!, P!); Hòa Bình Province, Mai Châu District, Pa Co, 20°44’41.0” N, 104°54’51.4’ E, 1178 m, imm. fr., 21 Sept. 2005, Phuong et al. HNK 664 (K!); Son La Province [locality now in Hòa Bình Province], Suyut, [20°46’0” N, 105°5’0” E] ♂ fl., 7 April 1942, Pételot 7870 (P!); Đà Bắc District, Cao Son, Nui Hen (BA Tri) Mountain System, 20°54’09” N, 105°12’15” E, 900 – 1150 m, ♂ fl., 4 April 2001, Hiep et al. HAL 585 (MO! [2 sheets]); Chobo [Chợ Bờ], Núi Biên massif, 900 m, 2 Sept. 1926, Poilane 13116 (P!); Hà Tĩnh Province, Hương Sơn District, Rao An-Ngam Them village, 18°20’50” N, 105°14’10” E, 900 – 1150 m, ♂ buds, 22 April 1998, Hiep et al. 258 (MO! [4 sheets]); Quảng Trị Province, Dong Co pat massif, imm. fr., 800 m, 4 July 1924, Poilane 11156 (P!, UC!); Thừa Thiên-Huế Province, Phú Lộc District, Bach Ma National Park, Bach Ma Mt., 16°11’46” N, 107°51’45” E, 1300 – 1350 m, ♂ fl., 18 April 2003, Phuong et al. 930 (MO!); Col des Nuages [Đèo Hải Vân], near Tourane [Đà Nẵng], 900 m, imm. fr., 18 Sept. 1923, Poilane 8124 (A!, P!); near Huế, Bach Ma, [1400 m], 6 Sept. 1938, Poilane 27600 (K!); ibid, 1400 – 1500 m, 6 Sept. 1938, Poilane 27628 241

(MO!, P!); ibid, fr., 8 Sept 1938, Poilane 27655 (P!, UC!); ibid, ♂ buds, 14 April 1939, Poilane 29645 (UC!); ibid, 1200 – 1500 m, fr., 14 Dec. 1940, Poilane 31151 (A!, P!); ibid, fr., 16 Dec. 1940, Poilane 31197 (P!); Quảng Nam Province, Mt. Ba Na, ♂ buds, 7 – 13 July 1927, Clemens & Clemens 3861 (P n.v., lectotype of G. annamensis; isolectotypes A!, BM n.v., K!, L!, MICH!, MO!, NY!, U! photo, UC!, US!); ibid, ♀ fl., July 1927, Clemens & Clemens 3867 (syntype of G. annamensis, K!, NY!, P!, UC!); ibid, imm. fr., 16 Aug. 1927, Clemens & Clemens 4224 (K!, NY!, P!, UC!); ibid, 1500 m, imm. fr., 13 July 1923, Poilane 7117 (E!, P!); ibid, imm. fr., 1923, Poilane 7174 (E!); ibid, 1200 m, imm. fr., 5 Aug. 1923, Poilane 7362 (P!); ibid, 1400 m, ♂ buds, 24 Feb. 1939, Poilane 29004 (A!, K!, P! [2 sheets]); ibid, 1000 – 1100 m, buds, 28 Feb. 1939, Poilane 29136 (BISH! photo, P!); ibid, 800 – 900 m, ♂ buds, 5 March 1939, Poilane 29232 (K!, P!); poste 6, ♂ buds, 24 March 1939, Poilane 29590 (syntype of G. annamensis, P!, UC!); between Go Oi and Moo, 1000 – 1200 m, Poilane 31709 (P!); Kon Tum Province, Kon Plông District, Hiếu, 14°39’ N, 108°25’ E, 1100 – 1200 m, buds, 21 April 2000, Averyanov et al. VH 5478 (MO! [3 sheets]); ibid, 14°39’ N, 108°25’ E, 1100 – 1200 m, ♀ buds, fr., 23 April 2000, Averyanov et al. VH 5683 (MO! [2 sheets]); ibid, 14°39’ N, 108°25’ E, 1100 – 1200 m, ♂ buds, 23 April 2000, Averyanov et al. 5684 (MO!); Sa Thầy District, Sa Son, Chu Mom Ray Protected Area, 14°26’33” N, 107°41’08” E, 500 – 800 m, ♂ buds, 28 Feb. 2000, Harder et al. 4558 (MO! [2 sheets]); Khánh Hòa Province, Diên Khánh District, Hon Ba Mtns., Suoi Cat village, 12°6.79’ N, 108°58.50’ E, 870 m, ♀ fl., 5 Dec. 2004, Soejarto & Ninh DDS 13681 (MO!). CAMBODIA. Kampot Province, [Bokor National Park], Elephant Mountain, 1000 m, buds, 6 Aug. 1919, Poilane 229 (syntype of G. camchayensis, A!, K!, P! [2 sheets]); Siem Reap Province, Phnom Kulen, 250 m, imm. fr., 15 Dec. 1968, Martin 1295 (P! [2 sheets); LAOS. Viang Chan Province, north coast of Nam Ngum Reservoir, 18°38’ N, 102°32’ E, 200 m, imm. fr., 13 Oct. 1974, Vidal 5874 (P! [2 sheets]); ibid, 18°38’ N, 102°32’ E, 200 m, buds, 13 Oct. 1974, Vidal 5876 (US!); ibid, 18°38’ N, 102°32’ E, 200 m, ♂ fl., 13 Oct. 1974, Vidal 5896 (US!); Kham Mouan Province, Nam On catchment, Phou Ak escarpment, Nakai-Nam Theun NBCA, 17°39’3” N, 105°44’26” E, 936 m, imm. fr., 23 May 2006, Newman et al. LAO 1432 (P!); Xiang Khoang Province, Tra 242

Ninh [Xiangkoang Plateau], between Muang Soui and Muang [J]ou, 1000 – 1500 m, buds, 10 Feb. 1932, Poilane 20122 (A!, P!); Kham Mouan Province, Nam Theun, 17°45’46.7” N, 105°20’21.1” E, 555 m, fr., 9 Feb. 2000, Darwin Initiative LAO 21 (E!).

“Gomphandra pauciflora” morphotype. The following specimens match the type of G. pauciflora Craib (1914: 123), which is treated as part of the G. cambodiana complex here.

CHINA. Yunnan Province, Mengze (or Mengtze), 1830 m [6000 ft.], fr., 20 Dec. [no year], Henry 10492 (A!, K!, MO!, US!); Mengze, 1525 m [5000 ft.], ♂ fl., Henry 10738 (A!, K!, MO!, NY!); Mengtze, Wa Ka, 1525 m [5000 ft.], fr., 12 Oct. [no year], Henry 11273 (A!, K!, MO!, NY! [2 sheets]); Szemao [?],1370 m [4500 ft.], ♀ fl., Henry 13007 (A!, [2 sheets], MO!, NY!, US!); Lan-Tsang Hsien, 1500 m, buds, May 1936, Wang 76585 (A!, US!); ibid, 1300 m, ♀ fl., May 1936, Wang 76625 (A!); Meng-soong, Dah- meng-lung, Che-li Hsien, 1850 m, ♀ fl., Sept. 1936, Wang 78332 (A!); THAILAND. THAILAND, Maharat, Doi Wao near Nan, 700 m [2300 ft.], ♀ fl., imm. fr., 23 Feb. 1912, Kerr 2430 (syntype of G. pauciflora, E!, K! [2 sheets]); ibid, 750 m [2500 ft.], ♂ fl., 23 Feb. 1912, Kerr 2435 (lectotype of G. pauciflora (selected by Sleumer 1969) K! [K000381666]; isolectotypes E!, K! [K000381667]); Kao Katakwan Pang-nja, 900 m, ♂ buds, 8 March 1930, Kerr 18440 (P!); Lampang Province, Wahng Nua District, Doi Luang National Park, Wahng Gayo Falls, 650 m, imm. fr., 26 March 1997, Maxwell 97- 240 (A!, MO!); Chiang Mai Province, Chiang Dao District, Doi Chiang Dao, Pa Blawng Cave area, 725 m, imm. fr., 16 Dec. 1989, Maxwell 89-1541 (A!, MO!); ibid, 625 m, imm. fr., 20 April 1989, Maxwell 89-482 (MO!); Nakhon Nayok Province, Muang District, Khao Yai National Park, Mo Singto area, 101°22’ E, 14°26’ N, 760 m, ♀ fl., imm. fr., 17 Nov. 1999, Charoenchai 725 (A!); ibid, Maw Sing To Reservoir area, Hin Dahng Subdistrict, 800 m, ♂fl., 12 Aug. 2000, Maxwell 00-358 (A!, MO!); ibid, 810 m, ♂ fl., 17 Aug. 2002, Chaengarun 1 (A! [2 sheets]); Kanchanburi Province(?), Kao Ri Yai Kanburi, 1400 m, ♀ fl., fr., 2 Feb. 1926, Kerr 10410 (K!, L!, P!); Mae Hong Song 243

Province, Pai (By) District, Doi Meun, near Wiang Hang, 1400 m, imm. fr., 18 April 1995, Maxwell 95-325 (A!).

The following specimen may also belong to G. cambodiana: MYANMAR. Amherst District, slopes of Mulayit [Kulayit?], 1430 m [4700 ft.], ♂ fl., 2 Feb. 1927, Parkinson 5124 (K!).

HABITAT. Secondary evergreen forest; evergreen primary mountain forest; seasonal dry forest; swampy thicket; dry sandy soil; steep slopes; clay soil; granitic soil; limestone; 500 – 1500 m. VERNACULAR NAME(S). Mao hùng chẻ tư, cây thần đân (Vietnam); khouay ling (Laos). USES. G. cambodiana is used medicinally in Laos. In Vietnam, G. mollis is used instead. NOTES. Gomphandra cambodiana was previously treated as a synonym of G. tetrandra. Gomphandra tetrandra is restricted to Sri Lanka, India, and Bangladesh, with inflorescences that are short and always axillary, sometimes on a flowering spur. Its venation is consistently fine and prominent, and the leaves do not dry dark. Gomphandra cambodiana is an incredibly variable species in twig pubescence, leaf shape, size, and venation, and fruit size. Specimens may be grouped based on leaf shape and texture or fruit size, but intermediate morphologies (even on the same herbarium sheet) exist, indicating that there is continuous variation overall. There is no geographical pattern to the variation. Unfortunately, it can be difficult to distinguish Gomphandra cambodiana because of its variability. Some collections approach Gomphandra mollis in their leaves, except the leaves and twigs are not persistently pubescent. Other specimens approach Gomphandra quadrifida, but none of the specimens has the distinctive staminate inflorescence type of that species, and the fruit are clearly ridged. Gomphandra cambodiana is clearly related to both G. mollis and G. quadrifida, and these three species may not be entirely differentiated yet. Some material from Thailand does not fit either Gomphandra cambodiana or G. quadrifida very well. Gomphandra pauciflora was described from northern Thailand, and 244

the specimens do seem distinctive, with a certain leaf morphology, axillary inflorescences along the older portions of the twigs, and short or sparse pubescence on the stamens. Certain specimens from Yunnan are very similar to the Thai specimens, but there is no clear morphological distinction between these specimens and Gomphandra cambodiana. Gomphandra pauciflora is therefore treated as a synonym, although the “G. pauciflora” morphotype is included separately in the key and the specimen citation list. More collections, field data, and population studies may be needed to assess variation within Gomphandra in continental Southeast Asia at the level of individual trees, populations, and species. Cryptic taxa may be present, but given the limited reproductively mature material available, it is not possible to recognize even varieties at this point. Ambiguous specimens are listed above as Gomphandra cf. cambodiana, although they may belong to another taxon.

2. Gomphandra capitulata (Jungh. & de Vriese) Becc. (1877: 111). Aralia capitulata Jungh. & de Vriese (1846: 17). Lasianthera capitulata (Jungh. & de Vriese) Miq. (1856: 791). Stemonurus capitulatus (Jungh. & de Vriese) Kuntze (1891: 112). Type: Sumatra, Tobing, Junghuhn s.n. (lectotype L! [L 0014740]). Gomphandra nyssifolia King (1895: 114). Stemonurus nyssifolius (King) R. A. Howard (1940: 468). Type: Malaysia, Perak, Larut, 1050 – 1220 m [3500 – 4000 ft.], ♀ fl., July 1884, King’s Collector 6406 (CAL! (selected by Sleumer 1969), isolectotypes BM, CAL!, G, K! [2 sheets], L!, P!). Nyssa sessiliflora Koord. (non Hook.), Hall. f., Meded. Rijksherb. I (1910) 13 [Pl. Jungh. Ined. n. 57].

Small tree 5 – 20 ( – 35) m, up to 60 cm in diam. Bark grey brown, smooth. Twigs 2 – 3 mm in diam., with a decurrent ridge below the insertion of the petioles, terminal buds pubescent with minute appressed hairs, twigs glabrescent with age. Leaves chartaceous, glabrous, 11 – 20 × 4 – 8.5 cm, elliptic to ovate or obovate, apex acute to acuminate, base 245 attenuate to acute, margin flat to slightly revolute; midrib sunken above, raised below, secondary veins 5 – 6 ( – 7) pairs, flat to raised above, raised below, somewhat steeply ascending, vein course parallel, usually not joining near the margin, tertiary veins obscure above, raised below and distinctly percurrent; petioles grooved, 0.7 – 1.5 cm × 1.5 – 2 mm, glabrescent. Inflorescences axillary, 1 – 3 per axil, capitate, peduncle 0.5 – 1.5 cm long, bearing 0 – 3 very short branches to 2 mm long, with up to 7 sessile (rarely pedicellate) flowers in female plants and 15 flowers in male plants, axes pubescent with short appressed hairs. Male flowers: calyx cupular, slightly lobed, 1 mm across, pubescent; petals 5, whitish, coherent to free, 3 – 4 mm long, pubescent; stamens 5, exserted, 5 mm long, filaments pubescent ventrally below the anthers; ovary rudiment pubescent. Female flowers: calyx cupular, slightly lobed, 1 – 2 mm across, pubescent; petals 5, coherent to free, 3 – 4 mm long, pubescent; staminodes 5, slightly exserted, 4 mm long, densely pubescent with short clavate hairs ventrally below the anthers; ovary cylindrical, 3 – 4 mm long, with short appressed pubescence except for the glabrous base, stigma 1 – 1.5 mm across. Fruit white when ripe (fide King’s Collector 3822), sparsely pubescent, obovoid to oblongoid, (1.8 – ) 2 – 2.4 × (0.6 – ) 0.7 – 0.8 cm, apex obtuse, very base swollen, inner mesocarp with ca. 10 prominent longitudinal ridges, stigma displaced towards sulcus, 1.8 – 2.4 mm across.

DISTRIBUTION. Malaysia – Kelantan, Pahang, Perak, Selangor; Indonesia. SPECIMENS EXAMINED. MALAYSIA. Perak, no specific locality, fr., Scortechini s.n. (BO n.v., CAL! [2 sheets], SING n.v.); Larut, 1220 – 1370 m [4000 – 4500 ft.], fr., Jan. 1883, King’s Collector 3822 (CAL!, L!, P!, US!); ibid, 1070 – 1220 m [3500 – 4000 ft.], ♀ fl., July 1884, King’s Collector 6406 (lectotype of G. nyssifolia, CAL! (selected by Sleumer 1969), isolectotypes BM n.v., CAL!, G n.v., K! [2 sheets], L!, P!); no specific locality, 1100 – 1220 m [3600 – 4000 ft.], imm. fr., Dec. 1884, King’s Collector 6984 (syntype of G. nyssifolia, A!, BM n.v., CAL!, CGE n.v., E!, K!, UPS n.v.); Gunung Hijau path above Bukit Maxwell, 1300 – 1400 m, ♂ fl., 7 June 1983, Stone 15478 (GH!, L!); Larut Hill, trail to Gunung Hijau, 1250 m, imm. fr., 20 Oct. 1988, Saw FRI 36392 (L!); Kelantan, Gunong Rahong, 1400 m [4600 ft.], imm. fr., 14 March 1972, Soepadmo & 246

Mahmud 1116 (L!); Pahang, Tanglin Forest, Fraser’s Hill, 1220 m [4000 ft.], ♂ buds, 31 Aug. 1972, Shah MS.2781 (A!, BRI!, US!); Fraser’s Hill, 1220 m [4000 ft.], fr., 18 March 1970, Kochummen FRI 2984 (L!); Fraser’s Hill, 1070 m [3500 ft.], ♂ fl., 5 Aug. 1966, Stone 6464 (BISH!, L!, MO!); ibid, 1220 m [4000 ft.], ♀ fl., 4 Sept. 1923, Nur 11260 (A!, UC!); ibid, 1280 m [4200 ft.], ♂ fl., 7 Nov. 1959, Abbe et al. 9069 (A!, K!, NY!); ibid, ♀ fl., 4 Sept. 1923, Henderson F. M. S. 11547 (BO n.v., UC!); Cameron Highlands, 1400 m [4600 ft.], fr., 9 April 1930, Henderson SFN 23478 (K!); Fraser’s Hill, fr., 14 Jan. 1981, Kochummen FRI 29163 (L!); Pahang/Selangor border, Ginting [Genting] Highlands Road, imm. fr., 5 Jan. 1972, Kochummen FRI 16467 (A!, K!, L!); Selangor, Ulu Langat, imm. fr., 7 May 1969, Suppiah FRI 11268 (K!, L!, SING!). HABITAT. Montane forest, 1065 – 1400 m. NOTES. Gomphandra capitulata is a distinctive species with pubescent fruits and a capitulate inflorescence. The species can often be recognized by its leaves, which have an acute to attenuate base and parallel, steeply ascending secondary veins. It might be closely related to Gomphandra javanica, which also has pubescent white fruits.

3. Gomphandra comosa King (1895: 112). Urandra comosa (King) R. A. Howard (1940: 468). Type: South Andaman, Hobdaypur, 30 Jan 1892, King’s Collector s.n. (lectotype CAL! [sheet 83395] (selected by Schori); isolectotype K!).

Small tree or shrub to 8 m. Bark grayish. Twigs straight to slightly zigzag, 1.5 – 3 mm in diam., initially cinereous with short appressed pubescence, quickly glabrescent. Leaves coriaceous, initially sparsely pubescent but quickly glabrous, oblong to elliptic-oblong, variable in size, (9 – ) 14 – 18.5 ( – 20.0) × (3 – ) 4 – 7 cm, apex shortly acuminate, base tapered, margins flat to slightly revolute; midrib sunken above, raised below, secondary veins 5 – 8 pairs, flat above, slightly raised below, parallel, upper ones joining near margin, tertiary veins scarcely evident; petioles grooved above, 0.5 – 1.2 cm long, 1.5 – 2 mm wide, essentially glabrous. Male inflorescences axillary, peduncle to 1 cm long, then often shortly branched, bearing ca. 10 flowers in a scorpioid cyme, flowers sessile or on 247

pedicels 1 – 3 mm long, axes sparsely pubescent with appressed hairs. Male flowers: calyx cupular, edge undulate, obscurely toothed, glabrous, 1.5 – 2 mm; petals 4 ( – 5?), reportedly 4 mm long, glabrous; stamens 4, exserted, 5 mm long, bearing long clavate hairs ventrally below the anthers and dorsally at the connective; ovary rudiment glabrous. Female inflorescences and flowers not seen. Infructescences axillary, on previous year’s growth, peduncle 1.0 – 1.3 cm long before branching, bearing 2 – 3 branches, each serving as a pedicel 0.5 – 0.9 cm long. Fruit glabrous, ellipsoid, very base slightly swollen, apex somewhat beaked, 2.7 – 2.9 × 1.0 – 1.2 cm, stigma 3 mm in diam., apical or slightly displaced toward sulcus, inner mesocarp bearing ca. 11 prominent anastomosing longitudinal ribs.

DISTRIBUTION. S. Andaman (North Bay near Port Blair), Katchall Island (Nicobars). Lakshminarasimhan (1999) listed North & South Nicobar, but did not specify which islands. Endemic. SPECIMENS EXAMINED. INDIA. South Andaman, no specific locality, 1884, King’s Collector s.n./414 (syntype, CAL! [2 sheets], K!, P!, US!); Port Mouat, 4 Oct. 1890, King’s Collector s.n. (syntype, CAL, G!, L!, P, SING); North Bay, 9 Aug. 1891, King’s Collector s.n. (syntype, BO, CAL!, G, K!, L!, P, UPS); Hobdaypur, 30 Jan 1892, King’s Collector s.n. (lectotype CAL! [sheet 83395] (selected by Schori); isolectotype K!); Chuldar, 8 June 1893, King’s Collector s.n. (syntype, CAL!, L!, P!); New Brookesabad, 2 June 1894, King’s Collector s.n. (syntype, A!, P!); Dhanikhari, 50 m, 6 Feb 1974, Nair 851 (K!); ibid, 30 m, 6 Feb 1974, Nair 848 (K!, L!); Nicobars, Katchall Island, near Kapanga Spring, inland forest, 0 m, 10 Oct. 1975, Chakraborty 2586 (L!). HABITAT. Hill jungle, inland forest, 0 – 50 m. The leaves frequently have round galls. PHENOLOGY. Flowers and fruit are reportedly present from June to March (Lakshminarasimhan 1999). CONSERVATION STATUS. Vulnerable, B1+2c (IUCN 2010). NOTES. Gomphandra comosa is distinguished by its coriaceous leaves and its large, somewhat beaked fruits. It is the only species in the genus that grows on the Andaman Islands, though Gomphandra tetrandra has been reported from the Nicobars 248

(Lakshminarasimhan 1999), and Codiocarpus and Stemonurus are also found on the islands. All of the South Andaman specimens appear to be from the Port Blair/North Bay area. The Nicobar site was struck by a tsunami in 2005, but the forest was not felled by the wave, so Gomphandra comosa may still be present there. It has apparently always been an uncommon to rare species throughout its range. All of King’s collections should be treated as syntypes. King did not cite any specimens, but he described the species from South Andaman and clearly studied both male and fruiting material before describing Gomphandra comosa. King’s Collectors 414 should be considered the same specimen as King’s Collectors s.n. (1884), as the 414 was written later in pencil on the labels.

4. Gomphandra coriacea Wight (1840: 103). Stemonurus coriaceus (Wight) Miers (1852: 37). Platea coriacea (Wight) Thwaites En. Pl., Zeyl. (1858: 44). Type: India, Pulneys, Sept. 1836, Wight K.D. 427 (lectotype K! (selected by Schori); isolectotypes C!, FI n.v., GH!, L! [2 sheets], NY!, P!, S n.v., US!). Stemonurus gardneri Miers (1852: 38). Type: India, Nilgherries, Gardner s.n. (lectotype K! [K000581990] (selected by Sleumer 1969); isolectotype BM n.v.). Stemonurus walkeri Miers (1852: 43). Type: Sri Lanka, Bamboddi, Gardner 101 (lectotype K! (selected by Schori)). Platea wightiana Miers (1852: 111). Type: Wight Icon. tab. 933 [icon].

Shrub to small tree, to 15 m high and 15 cm in diam. Bark dark brownish-green to gray, smooth. Twigs slender, straight to somewhat zigzag, 1 – 1.5 mm in diam., terminal bud very finely pubescent, twigs quickly glabrescent. Leaves thinly to firmly coriaceous, glabrous, variably lanceolate-ovate to obovate, 4 – 8.5 ( – 11) × 1.5 – 3 ( – 5.0) cm, apex generally bluntly acute (India) to acuminate (Sri Lanka), base tapered, margin revolute; midrib sunken above, raised below, secondary veins 4 – 6 pairs, flat above, slightly raised below, lower pairs converging, (lower and) upper pairs joining near margin, tertiary veins 249

not visible above, faint below, very delicately percurrent; petioles narrowly grooved above, 0.5 – 1.1 ( – 1.5) cm long. Inflorescences leaf-opposed (terminating sympodial branches), occasionally evidently axillary (terminating very short branches), on younger or current growth, pubescence minute, appressed. Male inflorescences to 2 cm long, with up to 25 – 30 flowers, peduncle to 1 cm long, then 2- or 3-branched, branches to 0.7 cm long and rebranched or bearing flowers on pedicels 1 – 3 mm long (or occasionally sessile). Male flowers: calyx cupular, with 5 minute teeth, 1.5 mm wide, glabrous; petals 5, white to yellow, 3 mm long, glabrous; stamens 5, slightly exserted, 4 mm long, glabrous or pubescent with short clavate hairs at the connective. Female inflorescences consisting of a single flower or a cyme with 2 – 3 ( – 4) flowers, peduncle 0.4 – 1.5 cm long, pedicels to 0.7 cm long, usually bearing 1 – 3 minute bracts. Female flowers: calyx cupular, 1.5 – 2 mm, glabrous; petals 5, white to yellow, 3 – 4 mm long; staminodes 5, included to slightly exserted, 3 – 5 mm long, with a few clavate hairs at the connective (or possibly glabrous); ovary glabrous, cylindrical, 3 mm long, stigma 1.5 mm in diam. Infructescence to 4 cm long, peduncle elongating in fruit. Fruit yellow (fide Huber 494) to orange-yellow (fide Cramer et al. 3928) when ripe, oblong to obovoid, 1.2 – 1.7 ( – 2.4) × 0.7 – 0.8 cm, very base swollen below sulcus, inner mesocarp with ca. 11 faint longitudinal ridges, stigma 3 mm in diam.

DISTRIBUTION. India, Sri Lanka. SPECIMENS EXAMINED. INDIA. No locality, no date, ♀ buds, fr., Wight s.n. (syntype of Gomphandra coriacea, K! [K000381685]); no locality, no date, ♂ buds, Wight 433 (syntype GH!, K! [K000381687], P!); Kerala, Cardamom Hills, 10 km from Kumili, ♀ fl., imm. fr., 16 June 1976, Ridsdale 150 (MO! [2 sheets], UC!); ibid, 30 km from Munnar, 18 June 1976, Ridsdale 171 (UC!); ibid, Mankulum, imm. fr., 22 June 1976, Ridsdale 232 (MO!, UC!); Manukulam forest near Munar, 1500 m, imm. fr., 22 June 1976, Kostermans 26188 (K!, L!, US!); Idukki District, Devicolam to Kumili Road, 2000 m, 23 March 1980, Ramamurthy 66306 (CAL!); ibid, 2000 m, 23 March 1980, Ramamurthy 66327 (CAL!); Munnaar to Bodi Road, 2300 m, 25 March 1980, Ramamurthy 66358 (CAL!); Tamil Nadu, Nilgherries [Nilgiri Mountains], Gardner s.n. 250

(lectotype of Stemonurus gardneri K! [K000581990]; isolectotype BM n.v.), ibid, ♂ buds, Gardner s.n. (K! [K000581991]); Nilagiri [Nilgiri] Mountains, ♂ fl., no date, Drake Herb. 1529 (P! [P00601836]); Niligiri Hills, Ooty, Lamb Rock, ♀ fl., 23 Jan. 1973, Townsend & Ramamoorthy 63 (A!, K!); Pulney [Palani] Mountains, ♂ buds, Sept. 1836, Wight 427 (lectotype K! [K000381686], isolectotypes C!, FI n.v., GH!, L! [2 sheets], NY!, P!, S n.v., US!); Madras, Perumal, 1675 m [5500 ft.], van Malderen 1341 (CAL!); Madras, Levuige palko, 2135 m [7000 ft.], van Malderen 1390 (CAL!); Madurai District, Pulney [Palani] Hills, Kodaikanal, 2135 m [7000 ft.], ♂ buds, May [1921?], Auglade 2179 (K!); ibid, ♂ buds, 1914, Saulière 5 (NY!, UC! [2 sheets]); ibid, ♂ buds, 15 June 1927, Bembower 185 (MO!); ibid, 1600 m, 21 Feb. 1978, Chandrabose 54223 (CAL!); Tinnevelli [Tirunelveli] District, Walaiyar cardamom Estate [Papanasam], 1100 m, fr., 10 July 1976, Kostermans 26254 (K!, L!, US!); ibid, fr., 12 July 1976, Kostermans 26294 (K!, L! [2 sheets], US!). SRI LANKA. No specific locality, Bamboddi, Gardner 101 (lectotype of Stemonurus walkeri, K! (selected by Sleumer 1969)), Adam’s Peak, 1866?, Thwaites 375 (GH!, K!, L!, P!); Sabargamuwa Province, Ratnapura District, Adam’s Peak, 1525 m [5000 ft.], 18 April 1970, Balakrishnan 284 (US!); Pinnawala, 30 June 1971, Balakrishnan 546 (L!, US!); Maratanne, 1500 m, 24 Aug. 1976, Waas 1783 (GH!, K!, L!, MO!; NY!, US!); Mukkuwatta forest, South of Adams Peak, 1200 m, 26 Aug. 1976, Waas 1813 (K!, MO!, US!); 6°23’ N, 80°40’ E, Jayasuriya et al. 2912 (A!, BISH!, MO!, NY!); Seetha-gagula, Peak Wilderness Sanctuary, 1757 m, fr., 28 Feb. 1985, Jayasuriya & Gunatilleke 3354 (A!, MO!); Uva Province, Badulla District, above Thotulagala Estate, 29 June 1975, Sumithraarachchi & Sumithraarachchi DBS 900 (K!, L!, MO!, US!); Haputale, 1500 m, imm. fr., 17 Oct. 1977, Nooteboom 3398 (L!, US! [2 sheets]); Haputale, ♀ buds, imm. fr., 1600 m, 7 May 1969, Kostermans 23374 (A!, K!, L! [2 sheets], P!, US!); Central Province, Kandy District, Hunasgiriya, 600 m, 29 Nov. 1972, Tirvengadum et al. 71 (L!, P!, US!); Corbet’s Gap, Knuckles, 10 Oct. 1973, Waas 187 (K!, MO!, US!); between Rangala and Knuckles, 610 m [2000 ft.], 28 March 1970, Balakrishnan 205 (K!, US!); Knuckles southeast of Bambrella, 1200 m, 26 Oct. 1977, Huber 494 (US!); Rangala, 20 March 1971, Balakrishnan 603 (K!, MO!, US!); between Corbet's Gap and Ferndale, 1270 m, 22 Nov. 1977, Huber 675 (US!); Kaboli [or Kahots], 251

Rangala Gap, 8 Sept. 1927, Alston 921 (K!, UC!); Hunasgiriya, 1370 m [4500 ft.], 19 Jan. 1975, Waas 974 (K!, MO!, NY!, UC!, US!); ibid, 1370 m [4500 ft.], 19 Jan. 1975, Waas 978 (K!, MO!, NY!, US!); Dotulugala, 1465 m [4800 ft.], 1 Feb. 1975, Waas 1034 (BISH!, K!, MO!, NY!, US!); ibid, 1465 m [4800 ft.], 1 Feb. 1975, Waas 1037 (BISH! [2 sheets], K!, MO!, NY!, US!); Kobonilgala, 1220 m [4000 ft.], 2 Feb. 1975, Waas 1067 (BISH! photo [2 sheets], K!, MO!, NY!, UC!, US!); Knuckles [Rangala], 1300 m, 11 Sept. 1977, Nooteboom 3060 (L!, US!); Knuckles (Madulkele), 800 – 900 m, 14 June 1973, Kostermans 25028 (K!, L! [2 sheets], US!); ibid, 800 m, 13 June 1973, Kostermans 25075A (US!); Corbet’s Gap, 1200 m, 29 Nov. 1972, Cramer et al. 3928 (US!); Rangala to Corbet’s Gap, 1000 m, 8 April 1969, Kostermans 23075A (A!, K!, L! [3 sheets]); Rajamally, 25 Oct. 1975, Sohmer & Sumithraarachchi 9848 (MO!); Hunnasgiriya Hill, Madulkele, imm. fr., 13 Nov. 1975, Sohmer & Jayasuriya 10623 (BISH! [2 sheets], F!, GH!, K!, MO!, NY!, P!); Nuwara Eliya District, Mool-Oya, 1615 m [5300 ft.], 5 Feb. 1975, Waas 1130 (US!); Temmetiya-kele, 7°02’ N, 80°45’ E, 1760 m, Jayasuriya et al. 3014 (A!, BISH!, MO!, NY!); ibid, 1580 m, Jayasuriya et al. 3022 (A!, BISH!, MO!, NY!); Maskeliya, 1400 m, 21 Nov. 1974, Davidse & Sumithraarachchi 8703 (US!); Maskeliya, Adams Peak, 1900 m, 13 Nov. 1978, Kostermans 27022A (US!); ibid, 1800 m, 14 Nov. 1978, Kostermans 27022B (F!, L!). HABITAT. Primary evergreen forest; shola forest; secondary montane forest; evergreen mixed forest; along a river, 600 – 1500 m, occasional to common. In the Western Ghats of Kerala, Gomphandra coriacea is one of the dominant species in stunted high-elevation forest (Kerala Government 2008). Ganesan and Davidar (2003), citing unpublished data and a PhD thesis, stated that Gomphandra coriacea flowers regularly, has an extended reproductive period, and the fruits are food for a wide variety of animals, though those animals were not listed. Davies and Oates (1994) reported that fruit of Gomphandra coriacea was preferentially eaten by Nilgiri langurs (Trachypithecus johnii) in the Western Ghats. Possible dispersers are a frugivore (Jerdon’s palm civet (Paradoxurus jerdoni)), and several seed predators (lion tail macaque (Macaca silenus), and Indian giant squirrel (Ratufa indica)) (Ganesh & Davidar 2005). Gomphandra coriacea is also 252

dispersed by birds (Ganesh & Davidar 2001), most likely the mountain imperial pigeon (Ducula badia) and Nilgiri wood pigeon (Columba elphinstonii). VERNACULAR NAME(S). Kambuli (Ganesan & Davidar 2003). NOTES. Gomphandra coriacea is restricted to the southern Indian hill districts and Sri Lanka. It is usually found at or above 1000 m. The coriaceous leaves and the inflorescences, which are almost always leaf-opposed, distinguish Gomphandra coriacea from G. tetrandra, which has thinner leaves and axillary inflorescences. The Sri Lankan specimens tend to have acuminate leaves, and specimens from higher elevations have thicker leaves. Flowers with four petals may be found, although they have not been observed in the herbarium specimens cited above. Mature female flowers are not well represented in herbarium collections.

5. Gomphandra donnaiensis (Gagnep.) Sleumer (1969: 192). Lasianthera donnaiensis Gagnep. (1948: 744). Type: Vietnam, [Lâm Đồng Province], Pnom Sapoum, south of the Blao (Bảo Lộc) Agriculture Station, 21 Feb. 1933, Poilane 22016 (lectotype P! (selected by Schori); isolectotypes K!, L!, P! [2 sheets]).

Tree to 15 m tall and 19 cm diam. Twigs stout, relatively straight, 2.5 – 3.5 mm in diam., apex velutinous with tawny pubescence, older twigs eventually somewhat glabrescent. Leaves chartaceous, at maturity glabrescent above, persistently and densely velutinous below, elliptic to obovate, 12 – 29 × 5 – 9 cm, apex abruptly short-acuminate, base acute to tapered, often subequal, margins revolute; midrib impressed above, raised below, secondary veins (5 – ) 7 – 9 ( – 12) pairs, flat above, raised below, vein course parallel, brochidodromous or forming an intramarginal vein, tertiary veins generally not evident above, flat to slightly raised and weakly percurrent below; petiole grooved above, 1.0 – 2.0 cm × 1.5 – 2.5 mm, persistently pubescent. Inflorescences axillary, on previous year’s growth, axes densely pubescent. Male inflorescences subcapitate, peduncle 0.4 – 0.5 cm long, with up to ca. 15 clustered flowers. Male flowers: calyx cupular, with 4 – 5 minute lobes, 3 mm across, pubescent; petals 4 – 5, coherent or free to base, 6 – 7 mm long at 253

anthesis, with a few hairs near the apex; stamens 4 – 5, exserted, 7 – 8 mm long, with abundant long clavate hairs ventrally below the anthers and dorsally at the connective; ovary rudiment minute, cylindrical, apex pubescent. Female inflorescences with peduncle 4 – 5 mm long, pubescent, 2 – 4 (sub)sessile flowers. Female flowers only known in bud. Fruit laxly pubescent, ellipsoid-obovoid, 2.7 – 2.9 × 1.1 – 1.2 cm, base tapered, subtended by the accrescent calyx 5 – 6 mm in diam., inner mesocarp with ca. 15 very low, anastomosing ridges, stigma ridged, 1 – 2 mm high × 3.0 – 3.5 mm wide.

DISTRIBUTION. Vietnam, Lâm Đồng and Đầk Lầk Provinces. SPECIMENS EXAMINED. VIETNAM. Lâm Đồng Province, Upper Donnai, between Dankia and Yanglo, 1000 m, 29 Jan. 1934, Poilane 23467 (BISH!, BO, L!, P!, UC!); Col Braian, near Djiring (Di Linh), 1400 – 1500 m, 1 Feb. 1935, Poilane 24054 (L! [2 sheets]); Braian massif, near to Djiring (Di Linh), 1500 m, 14 Feb. 1935, Poilane 24306 (P!); Col Braian, near Djiring (Di Linh), 1000 – 1100 m, 22 Feb. 1935, Poilane 24515 (A! [2 sheets], K!, L!, P!); Đầk Lầk Province, Darlac, [1960-1969], Schmid 1105 (P!); Dar lac, Buôn Ko Tam, 500 m, [1960-1969], Schmid s.n. (P!). HABITAT. Gallery forest in basalt zone; (500 – ) 1000 – 1500 m. ETYMOLOGY. The specific epithet comes from the Haut Donnai, or Upper Donnai region, which was named after the Đồng Nai River, which has its headwaters in what is now Lâm Đồng Province. The type locality is in the upper part of the province. VERNACULAR NAME(S). Mao hùng Đồng nai. NOTES. Gomphandra donnaiensis has been collected from four localities in Lâm Đồng and Đầk Lầk Provinces. It has also been reported from Nam Cat Tien National Park, which is in Đồng Nai and Bình Phước Provinces. Gomphandra donnaiensis is quite distinct from all other continental Asian species except G. mollis, which can have similar leaves and twigs. However, Gomphandra donnaiensis has short axillary inflorescences, large flowers, and large fruit, while G. mollis has long terminal or leaf-opposed inflorescences, small flowers, and smaller fruit. Both species have been reported from Nam Cat Tien National Park.

254

6. Gomphandra microcarpa Schori (Kew Bulletin). Type: Malaysia, Pahang, Taman Negara, Sungei Tembeling at Kuala Belau, high forested sandbank, fr., 7 March 1968, Whitmore FRI 8592 (holotype L!; isotypes A!, K!).

Bush, or occasionally small tree to 18 m high and 29 cm diam. Twigs with a decurrent ridge below the petiole insertion, 1 – 2 mm in diam., initially pubescent with minute reddish-brown hairs but soon glabrescent. Leaves firmly chartaceous to thinly coriaceous, glabrous or finely pubescent with appressed hairs on the midrib below, narrowly lanceolate, (3.5 – ) 5 – 9 ( – 11.5) × 0.7 – 1.2 ( – 1.8) cm, apex acuminate to caudate, base acute, margins revolute and decurrent onto petiole; midrib impressed above, raised below, secondary veins 5 – 8 pairs, flat above, slightly raised below, lowest pair often steeply ascending, other pairs slightly converging and tending to join near margin, intersecondaries difficult to distinguish from secondary veins, tertiary veins flat to not visible above, slightly raised below, scarcely percurrent; petiole narrowly grooved above, 1 – 3 ( – 5) mm long, subtly transversely ridged, often sparsely pubescent. Inflorescences axillary, usually solitary from repeatedly flowering short shoots, axes pubescent with minute appressed hairs. Male inflorescences to 1.5 cm long overall, with peduncle 0.5 – 0.8 cm long, bearing 3 branches, these branches usually unbranched with flowers arranged in a scorpioid cyme, occasionally branches to 2 mm long, then bearing scorpioid cymes, flowers subsessile or on pedicels to 4 mm long, up to 15 flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, 1 mm wide, glabrous; petals 5, yellow-green (fide Whitmore FRI 8946) or white (fide Shah & Noor MS 2041), 2 – 2.5 mm long, glabrous; stamens 5, slightly exserted, 2.5 – 3 mm long, filaments pubescent ventrally below the anthers with short clavate hairs; ovary rudiment minute, globose, apiculate, glabrous. Female inflorescences with peduncle 0.1 – 0.2 cm long, bearing 1 – 3 flowers on pedicels 1 – 3 ( – 4) mm long, pedicels elongating to 0.5 cm in fruit. Female flowers: calyx cupular, minutely apiculate, 1 mm wide, glabrous; petals 5, 2 – 2.5 mm long, glabrous; staminodes only seen in bud, 5, as long as the ovary, filaments with a dense fringe of clavate hairs on each edge dorsally, forming an inverted v up to the connective; ovary glabrous, cylindrical, 1.5 mm long, stigma ~ 1 mm wide. Fruit (fide 255

Wong & Khairuddin FRI 32624) or yellowish (fide Whitmore FRI 8592) when ripe, glabrous, slightly obovoid, 0.8 – 1 × 0.4 – 0.5 cm, apex and base somewhat acute, inner mesocarp with ca. 8 scarcely evident ridges, stigma lobed, 1.5 mm in diam., slightly displaced towards sulcus.

DISTRIBUTION. Peninsular Malaysia. SPECIMENS EXAMINED. MALAYSIA. Terengganu, Sungai Loh near Kuala Datok, rocky granite banks, 30 m [100 ft.], ♂ buds, ♀ fr., 5 July 1968, Whitmore FRI 8946 (A!, K!, L!); Ulu S. [Sungai] Trengan, between K. Biwa and K. Taat, Ulu Trengganu, riverside forest, 90 m [300 ft.], ♂ buds & fl., 13 June 1968, Cockburn FRI 10627 (K!, L!); Trengganu mountains, Sg. Kerbat at Jeram Keteh 1.5 miles below K. Trengan, sandstone, boulder stream flood channel, ♀ fl., 27 June 1971, Whitmore FRI 20260 (K!, L!); Sg. Trengganu near K. Panchor, ♀ fl., fr., 14 Feb. 1972, Whitmore FRI 20494 (K!, L!); Pahang, Jeram Panjang, ♂ buds, 22 July 1970, Shah & Noor MS.2041 (A!, CANB!, L!); Taman Negara, Sungei Tembeling at Kuala Belau, high forested sandbank, fr., 7 March 1968, Whitmore FRI 8592 (holotype L!; isotypes A!, K!); Taman Negara, beside river, ♀ fl., fr., 18 Aug. 1982, Wong & Khairudden FRI 32624 (A!, K!, L!); Kelantan, Kuala Rek, ♂ buds, 27 Jan. 1923, Haniff SFN 10174 (BRI! [2 sheets], UC!); Sungai Lebir, on shale rocks over river, ♀ or ♂ fl., fr., 7 July 1935, Henderson SFN 29609 (A!, K!, L!). HABITAT. Rheophyte, on sandstone, shale, or sand along rivers, 30 – 90 m. CONSERVATION STATUS. Vulnerable: VU B2ab(iii). PHENOLOGY. Flowers recorded from February to August. NOTES. Specimens of Gomphandra microcarpa were previously identified as G. quadrifida (Bl.) Sleumer var. angustifolia (King) Sleumer. However, material of Gomphandra microcarpa does not match the type material of G. quadrifida var. angustifolia. Both taxa have narrow leaves, but Gomphandra quadrifida has terminal inflorescences, whereas G. microcarpa only has axillary inflorescences. The decurrent ridges on the twigs below each petiole and the transverse ridges on the petiole, as well as the small fruit size, distinguish Gomphandra microcarpa. The 1968 population from the 256

Trengan River was probably destroyed during the creating of Tasik Kenyir. The species may be restricted to the Banjaran Timur Mountains and is found in Taman Negara National Park.

7. Gomphandra mollis Merr. (1942: 175). Stemonurus mollis (Merr.) R. A. Howard in Dahl (1952: 269). Type: Vietnam, 7 May 1936, Pételot 7949 (holotype A!; isotypes A!, NY!, P!). Gomphandra tonkinensis Gagnep. (1947: 134). Type: Vietnam, Bảo Thắng District, Phố Lu, buds, 8 Feb. 1936, Poilane 25186 (lectotype P! (selected by Sleumer 1969); isolectotypes K!, L!, P!).

Shrub or small tree to 8 m. Twigs straight to slightly zigzag, 1.8 – 2.8 mm in diam., densely pubescent with short spreading hairs, pubescence eventually becoming sparser. Growth sympodial and synchronous. Leaves firmly chartaceous to thinly coriaceous, sparsely pubescent to glabrous above, persistently pubescent below, ovate-elliptic to obovate, (10 – ) 15 – 21 ( – 26) × (4 – ) 6 – 8.5 ( – 10.0) cm, apex shortly and abruptly acuminate, base rounded to acute, often slightly asymmetrical, margin slightly to distinctly revolute; midrib impressed above, raised below, secondary veins (5 – ) 6 – 10 pairs, flat to impressed above, raised below, vein course ± parallel, lower pairs sometimes converging toward the margin, upper pairs often joining, sometimes forming an intramarginal vein, intersecondaries common, tertiary veins flat to slightly raised above, raised below, delicately but distinctly percurrent; petiole grooved, (0.6 – ) 1 – 1.7 cm long, densely pubescent. Inflorescences leaf-opposed or terminal, axes densely pubescent with spreading hairs. Male inflorescences with peduncle 1.3 – 2 cm long, bearing 3 – 4 branches 0.5 – 1.5 cm long, branches bearing several short branches 0.2 – 0.4 cm long, 5 – 10 flowers crowded at the end of the branches, appearing almost capitate, sessile or on pedicels to 1 mm long; with up to 50 ( – 120) flowers per inflorescence, 3 – 5 cm long overall. Male flowers: calyx minutely apiculate, 0.5 mm high × 1 mm wide, ciliate; petals 4 – 5, white (fide Averyanov et al. 2272), 3 – 4 mm long, glabrous or sparsely pubescent in bud; stamens strongly exserted, 4 – 5 mm long, pubescent dorsally with a tuft of 257 clavate hairs at the connective and ventrally below the anthers; ovary rudiment subconical, about 1 mm long, glabrous. Female inflorescences with peduncles 1.5 – 2 cm long, bearing 3 – 5 branches 0.4 – 1 cm long, each branch with several short branches 2 – 3 mm long or with a somewhat scorpioid cyme of 3 – 7 flowers on pedicels 1 – 3 mm long, 8 – 25 (– 40) flowers per inflorescence. Female flowers: calyx cupular, somewhat lobed, 1 mm high × 1 – 1.5 mm wide, accrescent in fruit; petals green-yellow (fide Hiep et al. 754), 3 – 4 mm long; evidently glabrous but not well represented in herbarium specimens, staminodes not seen; ovary cylindrical, 3 – 4 mm long, glabrous to sparsely pubescent and glabrescent, stigma capitate, 1.0 – 1.5 mm wide. Fruit not well-known at maturity, white (fide Averyanov et al. 4837) but not ripe, glabrous or occasionally with a few sparse hairs, oblong, 1.8 – 2.0 × 0.5 – 0.7 cm, asymmetrically curved toward the sulcus, apex truncate to acute and forming a slight beak, base truncate and somewhat swollen, inner mesocarp with about 8 low anastomosing ridges, stigma displaced toward sulcus, 2 – 2.6 mm across with deep central impression.

DISTRIBUTION. Vietnam; China, Yunnan Province. SPECIMENS EXAMINED. SPECIMENS EXAMINED. CHINA. Buds, April 1940, Wang 100241 (MO!); ♂ fl., April 1940, Wang 100384 (MO!); Yunnan Province, Ping- pien Hsien [22°53’60” N, 103°40’0” E], 1100 m, imm. fr., 20 June 1934, Tsai 60361 (A!); VIETNAM. Tonkin, no specific locality, fr., Dec. 1888, Balansa 3192 (K!, P! [2 sheets]); Lào Cai Province, Văn Bàn District, Liêm Phú, 22°00’31” N, 104°18’52”E, 260 m, ♂ fl., 13 March 2002, Averyanov et al. 2272 (MO! [2 sheets]); ibid, Khuổi Ngoa village, 21°58’14” N, 104°19’51” E, 606 m, ♂ fl., 21 Feb. 2001, Harder et al. 6553 (MO! [4 sheets]); Bảo Thắng District, Phố Lu, buds, 8 Feb. 1936, Poilane 25186 (G. tonkinensis lectotype P! (selected by Sleumer 1969); isolectotypes K!, L!, P!); Tuyên Quang Province, Chiêm Hoá, ♂ fl., Eberhardt 4824 (P!, syntype of G. tonkinensis); Na Hang District, Na Hang, Vĩnh Yên, 22°21’04” N, 105°25’35” E, 480 m, imm. fr., 6 March 1994, Harder et al. 2354 (MO! [2 sheets]); Bắc Kạn Province, Chợ Đồn District, Bản Thi, Cot Moc Mt., 22°16’10” N, 105°31’01” E, 800 – 900 m, imm. fr., 23 May 2004, Averyanov et al. 4837 (MO! [3 sheets]); Phú Thọ Province, Phu Ho [commune], imm. 258

fr., 1927, Du Pasquier 3059 (UC!); Thân-Mông forest reserve, ♀ fl., 17 – 18 April 1914, Fleury 32165 (syntype of G. tonkinensis, A!, P! [2 sheets]); Hà Nội [Hà Tây Province], Hà Tây, Tu-Phap (misplaced? – Tu Phap translates as Justice), fr., Dec. 1888, Balansa 3192 (P! [2 sheets); Mt. Bavi, ♂ buds, April 1909, d’Alleizette s.n. (P!); Sơn Tây, Đá Chông, ♂ fl., 7 May 1936, Pételot 7949 (holotype A! [00050240]; isotypes A!, NY!, P! [isotypes mislabeled as 5949 & therefore syntypes of G. tonkinensis]); ibid, ♂ fl., 4 May 1940, Pételot 2658 (A!, paratype of G. mollis, P non inveni); Hà Tĩnh Province, Hương Sơn District, Nga Doi, 18°29’55” N, 105°13’53”E, 200 – 250 m, ♀ fl., 20 May 1998, Hiep et al. 754 (MO! [3 sheets]); Quảng Nam Province, Quang Nam, Noi de Maug lum, 1500 m, fr., 3 March 1941, Poilane 31969 (P!).

The following specimen approaches Gomphandra mollis: Quảng Nam Province, Go-oi village, imm. fr., 23 Feb. 1941, Poilane 31500 (syntype of G. annamensis, K!).

PHENOLOGY. Flowers have been collected in February and May. According to a book on Vietnamese medicinal plants, flowering occurs from May to September (Dan 1989). HABITAT. Along streams from 200 – 1100 m elevation. On schist, limestone.

VERNACULAR NAME(S). Mao hùng mềm (Vietnam), 毛粗丝木 (mao cu si mu,

China). USES. The tuberous taproot is used medicinally for digestive problems (Dan and Nhu 1989; Nhu 1990). NOTES. Gomphandra mollis resembles G. cambodiana in inflorescence position, floral morphology, and fruit shape, and a few specimens of G. cambodiana approach G. mollis in leaf size. However, the leaves of Gomphandra mollis are softly pubescent beneath and usually larger with more secondary vein pairs, the male flowers are usually sessile, and the ovaries can be sparsely pubescent. Leaf galls may be present (Harder et al. 2354). The distributions of Gomphandra mollis and G. cambodiana do not appear to overlap greatly, though additional collecting may show that G. mollis has a wider distribution. 259

Currently, Gomphandra mollis is known from three northern provinces (Lào Cai, Tuyên Quang, and Bắc Kạn), two provinces west of Hà Nội (Phú Thọ and Hà Tây, now part of Hà Nội), and Hà Tĩnh Province, which is at the northern end of the Annam Highlands. Gomphandra cambodiana is found throughout Vietnam, but only two provinces are known to have both species: Lào Cai and Hà Nội (Hà Tây). All three species of Vietnamese Gomphandra (cambodiana, donnaiensis, and mollis) are reported for Nam Cat Tien National Park, where Lâm Đồng, Đồng Nai, and Bình Phước Provinces meet. However, the only collections seen for this revision from that area were of Gomphandra donnaiensis from Lâm Đồng Province. Gomphandra mollis was also reported from the proposed Kon Ka Kinh Nature Reserve in Gia Lai Province, but no collections of any Gomphandra have been seen from that province. Additional collecting is needed in Vietnam to document the distribution of Gomphandra species in the country.

8. Gomphandra quadrifida (Bl.) Sleumer (1940: 238). Stemonurus quadrifidus Bl. (1850: 249). Lasianthera javanica (Bl.) Miq. var. quadrifida (Bl.) Miq. (1856: 790). Type: Sumatra, Korthals s.n. (lectotype L! [L 0014829]). Stemonurus prasinus Bl. (1840: 249). Lasianthera prasina Miq. (1856: 791). Gomphandra prasina (Bl.) Becc. (1877: 110). Type: Sumatra, Padang Highlands, Korthals 1215 (holotype L! [L 0014828]). Stemonurus penangianus Miers (1852: 39). Gomphandra penangiana Wall. ex Mast. in Hook. f. (1875: 587). Type: Penang, Wallich 7204 (holotype BM n.v.; isotypes C n.v., CGE n.v., GH!, K! [4 sheets], L!, NY!, P n.v.). Lasianthera maingayi Mast. in Hook. f. (1875: 585). Stemonurus maingayi (Mast.) Valeton (1886: 236). Urandra maingayi (Mast.) Kuntze (1891: 113). Gomphandra maingayi (Mast.) King (1895: 114). Gomphandra quadrifida var. maingayi (Mast.) Sleumer (1969: 203). 260

Type: Penang, Government Hill, Maingay K.D. 374/2 (lectotype K!, isolectotypes BM n.v., CGE n.v., GH!, L!, P!). Lasianthera ovalifolia Miq. (1860: 137, 342 (descr.)). Gomphandra penangiana Wall. var. ovalifolia (Miq.) Valeton (1886: 225, pl. 4, f. 17 a- b). Type: Sumatra, Muara Enim, Teysmann H.B. 3992 (holotype U! photo [U 0002514]; isotypes BO n.v., L! [2 sheets]). Gomphandra oppositifolia Pierre ex Gagnep. (1910: 198). Stemonurus oppositifolius (Pierre ex Gagnep.) R. A. Howard (1940: 469). Type: Vietnam, Đồng Nai Province, Biên Hòa, Pierre 6250 (holotype P n.v.; isotype L!). Gomphandra puberula Ridl. (1915: 142). Gomphandra maingayi King var. pubescens Ridl. (1922: 429). Type: Malaysia, Terengganu, Mt. Tahan, Ridley 15950 (lectotype SING! photo, isolectotypes BM n.v., K!). Stemonurus affinis Miers (1852: 44). Gomphandra affinis (Miers) Mast. in Hook f. (1875: 586). Type: Malaysia, Malacca, Mt. Ophir, 1845, Griffith 805 (lectotype K! [K000381677]; isolectotypes CAL!, GH!, K! [K000381676], P!). Gomphandra affinis sensu Ridl. (1922: 427), non (Miers) Mast. var. floribunda Ridl. (1922: 427). Type: Malaysia, Weld Hill, 1915, Ridley s.n., (lectotype BM n.v. (selected by Sleumer 1969). Gomphandra lanceolata (Mast.) King var. tenuifolia Craib (1926: 273). Type: Thailand, Pattani, Kerr 1750 (holotype BM; isotypes K!, SING). Gomphandra scorpioidea Gagnep. (1947: 133). Type: Vietnam, Annam, Thua-thien, Hoi-mit, Eberhardt 1552 (A!, L!, P n.v.) Gomphandra quadrifida var. triplinervis (King) Sleumer (1969: 202). Type: Scortechini s.n. (holotype CAL; isotypes BM n.v., K!, L! [L 0014836], SING n.v.). 261

Gomphandra lanceolata (Mast.) King var. angustifolia King (1895: 113). Gomphandra quadrifida (Bl.) Sleumer var. angustifolia (King) Sleumer (1969: 202). Gomphandra salicifolia Ridl. (1922: 429). Stemonurus salicifolius (Ridl.) R. A. Howard (1940: 469). Type: Malaysia, Penang, Western Hill, Curtis 1265 (lectotype of G. lanceolata var. angustifolia CAL n.v. (selected by Sleumer 1969); K! & SING n.v. lectotype of G. salicifolia (selected by Sleumer 1969)). Gomphandra lanceolata (Mast.) King var. ovalifolia Ridl. (1922: 428). Gomphandra quadrifida (Bl.) Sleumer var. ovalifolia (Ridl.) Sleumer (1969: 203). Type: Malaysia, Selangor, Mt. Mengkuang Leban, 1913, Robinson s.n. (lectotype SING n.v.). Gomphandra pubescens Ridl. (1922: 429). Type: Selangor, Weld Hills, March 1915, Ridley s.n., (lectotype K!).

Excluded names (type is Medusanthera gracilis (King) Sleumer): Lasianthera lanceolata Mast. in Hook. f. (1875: 585). Stemonurus tomentellus Valeton (1886: 237, nom. illeg., nom. nov. pro Lasianthera lanceolata Mast., non Stemonurus lanceolatus Becc. 1877). Gomphandra lanceolata (Mast.) King (1895: 112). Gomphandra ophirensis Ridl. (1922: 427), nom. illeg. Type: Malaysia, Melaka, Mt. Ophir, Griffith 810 (lectotype K!; isolectotype P!).

Shrub or small tree to 6 m. Twigs slender, 0.8 – 2 mm in diam., initially pubescent with short somewhat appressed hairs, quickly glabrescent. Leaves chartaceous to thinly coriaceous, glabrous above, glabrous to sparsely pubescent below, extremely variable both within and between plants, lanceolate, oblong, ovate, elliptic, or obovate, (5 – ) 8.5 – 18 ( – 21) × (1 – ) 2 – 6.5 ( – 8.5) cm, apex acute to acuminate or somewhat caudate, base rounded to attenuate, margin flat to slightly revolute in specimens with thicker leaves; midrib sunken above, raised below, secondary veins 4 – 9 pairs, flat above, raised below, venation pattern ranging from triplinerved to penninerved, veins converging toward the 262 margin or parallel, joining near the margin or not, different venation often seen on adjacent leaves on the same twig, tertiary veins flat above, flat to slightly raised below, weakly to distinctly percurrent; petiole narrowly grooved above, 0.4 – 1 cm long, glabrescent. Inflorescences terminal, leaf-opposed, or sometimes appearing axillary by terminating short axillary branches on mature growth, axes pubescent with short appressed hairs. Male inflorescences potentially blooming for a period of months, with spent pedicels, open flowers, and minute buds present at the same time, axes often elongating to appear distinctly scorpioid by development of additional buds at inflorescence branch apices; peduncle 0.6 – 1.5 cm long, bearing up to 4 branches 0.3 – 0.5 ( – 1) cm long, these often rebranched 1 – 2 more times, terminal branches with 2 – 5 or more flowers in a scorpioid cyme, pedicels <1 – 2 mm long, often elongating after flowers disarticulate, first blooming with 12 – 15 ( – 35) flowers, up to 100 or more flowers per inflorescence before reserve buds are exhausted. Male flowers: calyx cupular, minutely lobed or apiculate, 1 – 1.5 mm wide, glabrous; petals 4 – 5, white, 3 – 4 ( – 5) mm long, glabrous; stamens 4 – 5, strongly exserted, 3.5 – 6 ( – 7) mm long, pubescent with a tuft of long clavate hairs dorsally at the connective and ventrally with clavate hairs below the anthers; ovary rudiment minute, cylindrical, glabrous. Female inflorescences with fewer flowers than male, usually not with reserve buds, common peduncle 0.4 – 0.7 ( – 2) cm long, bearing 2 – 4 branches 2 – 3 mm long, these with 2 – 4 flowers on pedicels 1 – 3 mm long, flowers 2 – 15 per inflorescence. Female flowers: calyx cupular, apiculate, glabrous; petals 4 – 5, greenish white, 3 – 4 mm long, glabrous; staminodes not exserted, pubescent; ovary cylindrical, glabrous, 2 – 3 mm long, capped by the broader stigma. Fruit white when ripe (fide Purseglove P4211), ovoid-ellipsoid, 1 – 1.6 × 0.6 – 0.8 cm, apex often slightly beaked in immature fruit, very base swollen (or not), inner mesocarp with 6 – 8 thickened anastomosing veins (rather than discrete ridges), stigma 1.5 – 2 mm in diam.

DISTRIBUTION. Malaysia, Singapore; Indonesia. SPECIMENS EXAMINED. MALAYSIA. No locality, no date, Scortechini s.n. (isotype of G. lanceolata var. triplinervis, L! [L 0014836]); Illegible label, Teysmann 263

3992 (cited as isotype of Lasianthera ovalifolia Miq., BO n.v., L! [L 0014833], U!); Palembang, Teysmann 3992 (cited as fragment of holotype of Lasianthera ovalifolia Miq., L! [L 0014832]); No locality, no date, Valeton label 69 [Griffith 809] (L! [L 0690148]); no locality, ♀ fl., Griffith 805 (K! lectotype of Stemonurus affinis Miers; isolectotypes CAL!, GH!, K!, P!); no locality, no date, Maingay 374/2 (isotype of Lasianthera maingayi Masters, K!, GH!, L!, P!); no locality, no date, Griffith 809 (CAL!, ♂ buds, GH!, K! [2 sheets], imm. fr., L!); no locality (Malaysia?), no date, no collector 125 (L! [L 0690166]); (Malaysia?) no locality, no date, ♂, Wallich 7204 (cited as isotype of G. penangiana) (GH!, K! [4 sheets, 381715, 381716, 381717], L! [L 0014827], NY!); Gopeng, 150 m [500 ft.], June 1883, King’s Collector 4363 (L!, US!); (Malaysia?) no locality, no date, ♂ fl., no collector s.n. (K!); Penang, No locality, Aug. [?] 1830, CBD s.n. (E! [E00260771]); Waterfall Road, ♂ fl., 14 Oct. 1951, Sinclair 6982 (SF 39340) (E!, K!, L!, P!, US!); Tiger Hill Road, 760 m [2500 ft.], imm. fr., Jan. 1928, Haniff 172 (UC!); Kelantan, Sungai Keteh, Gua Nenak, ♂ fl., 18 Feb. 1924, Nur & Foxworthy 12127 (UC!); Perak, Larut, 1050 – 1220 m [3500 – 4000 ft.], fr., Jan. 1883, Kunstler 3806 (A!); Larut, ♂ fl., June 1881, King’s Collector 1972 (UC!); no specific locality, 180 – 245 m [600 – 800 ft.], fr., June 1886, King’s Collector 10338 (K!, UC!); Dengong, Telok Anson, fr., 24 Sept 1924, Haniff SFN 14192 (UC!); Larut, 150 – 300 m [500 – 1000 ft.], buds, May 1883, Kunstler 4211 (UC!); Larut, 915 – 1070 m [3000 – 3500 ft.], imm. fr., Sept. 1881, King’s Collector 2430 (L!, P!); Ulu Bubong, 120 – 180 m [400 – 600 ft.], imm. fr., July 1886, King’s collector 10469 (L!, P!); Terengganu, Gunung Padang, 1220 m [4000 ft.], imm. fr., 19 June 1937, Moysey & Kiah SFN 31873 (A!, K!); Dungun, Bukit Bauk Forest Reserve, ♂ fl., 5 Sept. 1973, Chan FRI 16880 (K!, L!); Kemaman District, Kajang, Ulu Bendong, ♂ buds, 29 Oct. 1935, Corner SFN 30010 (A n.v., BO n.v., K!, L!, LAE n.v., MANI n.v., SING n.v.); Pahang, Pulau Tioman, Gunong Kajang, 760 – 1070 m [2500 – 3500 ft.], ♂ buds, 17 April 1962, Kadim & Noor KN 597 (A!, BO n.v., K!, L!, LAE n.v., MANI n.v., SAR n.v., SING n.v.); Gunung Ulu Kali, 1525 m [5000 ft.], ♂ buds, 4 Nov. 1979, Stone 14168 (L!); Bukit Cheras, 180 m [600 ft.], buds, imm. fr., 11 Oct. 1931, Henderson SFN 25068 (NY!); Fraser Hill, 1220 m [4000 ft.], imm. fr., 4 Sept. 1923, Henderson 11572 (UC!); Jerantut, ♂ buds, 24 Nov. 1924, 264

Burkill & Haniff SFN 16093 (UC!); Gunong Benom, 1525 m [5000 ft.], ♂ buds, 3 Aug. 1925, FMS Museum Collectors s.n. (K!, UC! [359633]); Cameron Highlands, just above Boh Tea Plantation, 1600 m, ♂ fl., 22 March 1992, Klackenberg & Lundin 771 (L!); Fraser’s Hill, Jalan Girdle, 1000 m, ♂ buds, 1 April 2000, Vermeulen & Duistermaat 2011 (L!); Fraser’s Hill, Pine Tree Hill Path, 1340 m [4400 ft.], fr., 19 April 1955, Purseglove P.4211 (K!, L!); ibid, Purseglove P.4210 (A!, K!, L!); Cameron Highlands, 1830 – 2010 m [6000 – 6600 ft.], fr., 25 – 31 Aug. 1975, Rao et al. K.8001 (L!); Fraser’s Hill, Girdle Rd., fr., 19 Dec. 1970, Whitmore FRI 15720 (K!, L!); Selangor, Kuala Lumpur University field station, 50 m, imm. fr., 1 Sep. 1972, Halle 2000 (MO!); Bangi, imm. fr., 10 Dec. 1974, van Balgooy 2194 (BRI! [2 sheets], L!, NY!); Templer Park, ♂ buds, 25 Oct. 1967, Shimizu et al. 13803 (A!, L!); Ulu Gombak, imm. fr., 2 April 1977, Kochummen FRI 18465 (A!, K!, L!); Templar Park (Air Terjan), 50 – 75 m, ♂ fl., 8 Jan. 1983, Davis 69153 (E!); Bukit Lagong Forest Reserve, 245 m [800 ft.], ♂ fl., 23 Jan. 1960, Kochummen 79038 (A!); Weld Hill, Kuala Lumpur, 75 m [250 ft.], ♂ fl., 9 Feb. 1969, Stone 8335 (BISH!, L!); Gombak, University of Malaya field study centre, imm. fr., 27 Nov. 2002, Jalaluddin 18 (L!); Gombak, Forest Research Institute Malaysia, 3°14’ N, 101°38’ E, 50 m, fr., 6 April 2005, Asnah et al. FRI 35599 (K n.v., KEP n.v., L!, SAN n.v., SING n.v.); Kanching Forest Reserve, fr., 28 Aug. 1976, Ng FRI 22198 (L!); Negeri Sembilan, Sungai Menyala, Port Dickson, imm. fr., 5 Aug. 1978, Suppiah FRI 28217 (K!, L!); Melaka, Bukit Sendanan Forest Reserve, imm. fr., 25 Nov. 1922, Holttum SFN 9706 (BRI!; UC!); Johor, Gunung Ledang, 1276 m, ♂ buds, 18 March 1981, Kochummen FRI 29211 (A!, K!, L!); Gunong Besar massif, below Gunong Pukin above Sungei Segamat, Labis Forest Reserve, fr., 12 March 1970, Everett FRI 14008 (K!, L! [2 sheets]). SINGAPORE. MacRitchie Reservoir, 25 m, ♂ fl., imm. fr., 9 Dec. 1976, Maxwell 76- 770 (L! [2 sheets]); ibid, ♂ fl., 14 Aug. 1948, Sinclair 4982 (E!, US!); Bukit Timah Nature Reserve, ♂ buds, fr., 16 April 1966, Hou 132 (K!, L!); ibid, 50 m, ♂ fl., 11 Sep. 1977, Maxwell 77-400 (L!); ibid, 50 m, fr., 5 Dec. 1976, Maxwell 76-729 (L!); 50 m, ♂ fl., 17 Mar. 1981, Maxwell 81-45 (L!); ibid, 100 m, ♂ fl., 3 July 1981, Maxwell 81-160 (L! [2 sheets]); ibid, 75 m, ♀ fl., imm. fr., 23 June 1982, Maxwell 82-170 (L!, MO!); ibid, 265

♂ fl., 14 Jan. 1970, van Beusekom 2673 (L!); ibid, 90 m [300 ft.], imm. fr., 12 July 1976, Shah & Samsuri MS 3902 (MO!). THAILAND. Krabi, Phanom Bencha, 1000 m, fr., 26 March 1930, Kerr 18686 (A!, K!, L!); Yala Province, Betong Subdistrict, Wang Sai, Khao Joh Tong, 650 m, ♂ fl., 22 May 2000, Niyomdham 6178 (MO!); Ranong Province, Amphoe Kra Buri, Thungraya Nasak Wildlife Sanctuary, 10°23’ N, 98°51’ E, 200 m, imm. fr., 28 Aug. 2002, Middleton et al. 1386 (A!, L!); Kanchanaburi Province, Sangklaburi Province, Toong Yai Naresuan Wildlife Reserve, Lai Wo Subdistrict, Ban Saneh Pawng village, near Ro Kee Stream, 200 m, imm. fr., 12 Aug. 1993, Maxwell 93- 878 (A!, L!); ibid, ♂ fl., 16 June 1993, Maxwell 93-642 (A!, L!); Satun Province, Kwan Dohn District, Talay Bahn National Park, 100 m, ♂ fl., 6 Sept. 1985, Maxwell 85-847 (A!, L!); Phatthalung Province, See Bahn Pohn Province [Si Banphot], Kao Boo [Khao Pu] National Park, near Mat Chai Cave, 100 m, imm. fr., 22 March 1986, Maxwell 86- 194 (A!, L!).

The following specimens may belong to Gomphandra quadrifida: Thailand, Trang, Amphoe Yan Ta Khao, Khao Banthat Mountains, near summit of Phu Pha Mek, 7°26.2’ N, 99°51.3’ E, 1150 m, ♂ fl., 7 April 2003, Middleton et al. 1976 (A!); Yala Province, Kue Long, 100 m, ♀ fl., 17 June 1970, Smitinand 46711 (K!, P!).

INTERMEDIATE SPECIMENS. MALAYSIA. Kelantan, Gunong Rabong, 1430 m [4700 ft.], ♂ buds, 15 March 1972, Soepadmo & Mahmud 1160 (L!); Perak, Gunong Bubu Forest Reserve, Sungei Guar, 670 m [2200 ft.], 18 Aug. 1966, Whitmore FRI 682 (L!); Terengganu, Gunong Padang, Ulu Brang, 1220 m [4000 ft.], imm. fr., 19 Sept. 1969, Whitmore FRI 12706 (L); Pahang, Fraser’s Hill, near Bishop’s House, ♂ buds, 27 Aug. 1970, Kochummen FRI 16168 (L!); Cameron Highlands, Gunong Jasar, 1585 m [5200 ft.], imm. fr., 26 Oct. 1972, Chan FRI 16825 (L!); path to Gunung Jasar, 1525 m [5000 ft.], imm. fr., 22 Aug. 1977, Kochummen FRI 19385 (L!); Cameron Highland, trail no. 10, fr., 12 Sept. 1985, Latiff et al. ALM 948 (L!); Kemanshul Division, Bentong, Sabai Estate, 90 – 120 m [300 – 400 ft.], imm. fr., 30 May 1958, Shah 158 (A, BO, K!, L!, SING); Cameron Highlands, 266

Mt. Berembun, 4°29’ N, 101°24’ E, 1585 m [5500 ft.], fr., 3 Oct. 1963, Chew CWL 758 (K!, L!, UC!); Fraser’s Hill, big tree plot, tree no. 33, imm. fr., 7 July 1972, Kochummen FRI 16573 (K!, L!); Cameron Highlands, Sungei Uruil, below golf course, imm. fr., 4 Sept. 1956, Burkill HMB 816 (K!, L!); Ulu Cheka, Benom forest, 13 June 1968, T[eo] & P. 107 (K!, L!); Fraser’s Hill, path to Pine Tree Hill, 1280 m [4200 ft.], fr., 11 Dec. 1962, Kochummen KEP 98160 (K!, L!); Cameron Highlands, trail to Gunung Berembun, 1525 m [5000 ft.], ♂ fl., 1 March 1968, Ng FRI 5923 (K!, L!); Cameron Highlands, start of trail to Gunung Jasar, ♂ buds, 23 Oct. 1970, Whitmore FRI 15571 (L!); Selangor, Bunga Buah, 1070 m [3500 ft.], 22 April 1965, Stone 5553-A (L!). HABITAT. Lowland dipterocarp forest, 50 – 2010 m. VERNACULAR NAME(S). Ubat kera. NOTES. Gomphandra quadrifida is an incredibly variable species overall. The type is from Sumatra, and Indonesian specimens are not especially variable. Collections from Singapore are also relatively uniform but tend to have larger leaves and smaller fruit than specimens from Indonesia or Malaysia. The Malaysian specimens, however, are very diverse in their morphology. Several varieties were described based on leaf variation, but distinctions do not hold up. Individual plants can have an ovate leaf with five pairs of strongly brochidodromous veins next to an oblong-elliptical leaf with nine pairs of veins that do not anastomose, so it is pointless to use leaf size, shape, and venation to distinguish among morphologies. The species is distinctive in its habit of a prolonged blooming period for male inflorescences. Other species of Gomphandra (e.g. flavicarpa, luzoniensis) may have small buds that persist for months and eventually mature, but only G. quadrifida seems to have inflorescence axes that will elongate multiple times as additional buds mature. Gomphandra quadrifida can also be distinguished from most other species by its terminal or leaf-opposed inflorescences. If only axillary inflorescences are present, twigs should be examined for scars opposite leaves or leaf- scars where inflorescences have abscised. Other Continental Asian species with terminal and leaf-opposed inflorescences are Gomphandra cambodiana (Thailand to Hainan, inflorescences not reblooming, fruit clearly ridged), G. mollis (Vietnam and Yunnan, leaves densely pubescent below), G. tomentella (leaves pubescent, flowers sessile, calyx 267

pubescent), G. coriacea (India & Sri Lanka, few-flowered inflorescences, different fruit), and G. tenuis (Malaysia, twigs and pedicels extremely slender, inflorescences not reblooming). Specimens that are intermediate between Gomphandra quadrifida and G. tenuis have been collected at the geographic boundary between the species, often from the same localities as G. quadrifida specimens. They may represent a hybrid between the two taxa. Williams and Petrides (1980) reported that Gomphandra quadrifida var. ovalifolia (ubat kera), which grows as a shrub in Taman Negara Park (located in Kelantan, Terengganu, and Pahang Provinces), is used as a food plant by Malayan tapirs (Tapirus indicus). Tapirs fed preferentially on Gomphandra, eating 83% of leaves on the four plants found during the study. Both Gomphandra quadrifida and G. tenuis grow in Taman Negara, so it is not clear which species the tapirs eat (or perhaps they eat both).

9. Gomphandra tenuis Schori (Kew Bulletin). Type: Bukit Lagong Forest Reserve, 150 m [500 ft.], ♂ fl., 6 Jan. 1967, Anuar KEP 115691 (holotype KEP n.v.; isotypes A!, K!, L!).

Small tree (or shrub) to 12 m tall and 19 cm diam. Bark greyish white to brown, smooth, often covered with crustose lichens. Twigs slender, only slightly zigzag, youngest twigs < 1 mm in diam., initially pubescent with minute appressed hairs, glabrescent with age. Leaves chartaceous, glabrous at maturity, ovate, ovate-elliptic, or somewhat obovate, rarely lanceolate, (4 – ) 5 – 11.5 × 1.5 – 3.5 cm, apex acute to acuminate, base rounded to acute, often inequilateral, margin flat to very slightly revolute; midrib sunken above, raised below, secondary veins 2 – 4 pairs, flat above, raised below, converging towards margin, lowest pair steeply ascending, at least the upper pairs brochidodromous, tertiary veins obscure above, flat to slightly raised below, weakly percurrent; petiole slender, grooved, 0.4 – 0.9 cm long, 0.6 – 1 mm wide, glabrescent. Inflorescences terminal or leaf-opposed, very slender, axes moderately pubescent with short appressed hairs. Male inflorescences with peduncle 0.5 – 1 cm long, then usually with 2 ( – 3) branches 1 – 1.5 cm long, each ending in a few-flowered cyme, rebranched or not, of 4 – 10 flowers on 268

pedicels 1 – 4 mm long, 4 – 10 ( – 20) flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, 1 mm across, < 1 mm high, glabrous; petals 4 – 5, white to yellowish-green, 3 mm long, glabrous; stamens 4 – 5, exserted, 4 mm long, with a tuft of clavate hairs dorsally at the connective and scattered hairs ventrally below the anthers, ovary rudiment minute. Female inflorescences variable, with peduncle 0.5 – 1 cm long, bearing a solitary flower or up to 4 branches, branches 0.3 – 0.9 mm long, each with 1 – 3 flowers on pedicels 0.1 – 0.5 cm long, flowers 1 – 10 per inflorescence. Female flowers: calyx cupular, minutely apiculate, 1 mm across, < 1 mm high, petals 4 – 5, white to yellowish, 3 – 4 mm long, glabrous; staminodes not seen, ovary cylindrical, glabrous, 2.5 – 3 mm long, capped by a prominent stigma 1 – 2 mm in diam. Fruit obovoid-ellipsoid, 1.4 – 1.5 × 0.6 cm, apex slightly beaked, base abruptly contracted, inner mesocarp ridges scarcely evident, c. 8 anastomosing veins, stigma with a short groove, 2 mm in diam.

DISTRIBUTION. Central Malaysia. SPECIMENS EXAMINED. MALAYSIA. Perak, Tapah Hills, Sungai Woh, 1050 m [3500 ft.], fr., 13 July 1966, Ng FRI 1357 (K!, L!); Trolak Forest Reserve, ♀ fl., 18 March 1967, Chelliah KEP 104608 (A!, K!, L!); Kelantan, Ulu Sungei Ketil [near Gua Musang], 150 m [500 ft.], imm. fr., 15 March 1972, Shah MS.2556 (BRI!, UC!); Terengganu, Kemaman District, Kajang, Ulu Bendong, 150 m [500 ft.], ♀ buds, 2 Nov. 1935, Corner SFN 30157 (A, K!, L!, LAE, SING); Bukit Kajang, 150 m [500 ft.], ♂ buds, 15 Nov. 1935, Corner SFN 30472 (A!, K!, L!, LAE, SING); Selangor, Gombak, Forest Research Institute Malaysia, keruing trail, 50 m, ♀ fl., imm. fr., 22 Sept 2005, Phoon et al. FRI 51551 (KEP, L!, SAN, SING); Bukit Lagong, 200 m [660 ft.], imm. fr., 12 April 1974, Ng FRI 22095 (K!, L!); Kepong, Forest Research Institute Plantations, imm. fr., 8 Oct. 1960, Yong KEP 94275 (L!); Bukit Lagong Forest Reserve, 150 m [500 ft.], ♂ fl., 6 Jan. 1967, Anuar KEP 115691 (A!, K!, L!); ibid, 150 m [500 ft.], imm. fr., 9 Jan. 1967, Gerus KEP 99453 (K!, L!); ibid, imm. fr., 18 Jan. 1979, Suppiah FRI 28323 (K!, L!); Genting Sempah, 450 m [1500 ft.], ♀ buds, fr., 15 May 1980, Stone 14505 (A!); Pahang, Taman Negara, path leading to Gunung Tahan, 150 m [500 ft.], ♂buds, 21 April 1975, Chan FRI 21796 (A!, K!, L!); Ulu Sungai Sat near Kuala Kelepah [Kelapah], 30 m 269

[100 ft.], imm. fr., 9 July 1970, Shah & Noor MS.1740 (L!, SING n.v.); Taman Negara, 90 m [300 ft.], ♂ buds, 19 April 1975, Ang Khoon Cheng FRI 23314 (K!, L!); Gunung Tapis, 550 m [1800 ft.], imm. fr., 27 Sept. 1971, Chan FRI 17693 (A!, K!, L!); Jerantut, Ulu Tekam, 150 m [500 ft.], imm. fr., 26 June 1972, Ng & Beltran FRI 6415 (A!, K!, L!); Taman Negara near Kuala Tahan, path to Bukit Tersek, ♂ buds, 10 June 1971, Whitmore FRI 20128 (A!). HABITAT. Ridge top, lowland forest, secondary forest on alluvium, 30 – 550 m, collected once at 1050 m. Galls are present on Suppiah FRI 28323 (L). CONSERVATION STATUS. Near Threatened (NT). VERNACULAR NAME(S). Minyak berok (now applied to species of Xanthophyllum, Polygalaceae), kayu melada. NOTES. Gomphandra tenuis is a somewhat cryptic species that has commonly been identified as G. quadrifida var. ovalifolia. It differs from Gomphandra quadrifida in its very slender twigs, petioles, and pedicels, its few-flowered inflorescences, and its habit (tree rather than shrub). The male inflorescences do not show any evidence of reblooming the way inflorescences of Gomphandra quadrifida do. Geographically, specimens of Gomphandra tenuis form a band across central Malaysia. At the edges of the species’ range, specimens morphologically intermediate with Gomphandra quadrifida may be found where the two species overlap. These intermediates, which may represent hybrids, are found at high elevations, while specimens of Gomphandra tenuis are mostly from below 150 m. Gomphandra tenuis is also similar to G. lamanii Schori, which occurs in Borneo, and G. oligantha Sleumer, found in the Philippines. Gomphandra lamanii has prominent brochidodromous secondary venation, appressed reddish pubescence, and distinct ridges on the fruit. Gomphandra oligantha has wider, caudate leaves with more veins, longer pedicels, fewer female flowers, and more prominently ridged fruit.

270

10. Gomphandra tetrandra (Wall. in Roxb.) Sleumer (1940: 238). Lasianthera tetrandra Wall. in Roxb. (1824: 328). Stemonurus tetrandrus (Wall.) Alston in Trimen (1931: 48). Type: 1815, M. R. Smith s.n. (holotype CAL? n.v.). Gomphandra axillaris Wall. in Voigt (1845: 31) nom. illeg. & nom. inval. (incorrectly cited as “Wall. ex Voigt”). Stemonurus axillaris Miers (1852: 41), nom. illeg. Platea axillaris Wall. ex Thwaites (1858: 44), nom. illeg. & nom. inval. Gomphandra axillaris Wall. ex Bedd. (1871: 61), nom. illeg. Type: Wallich 3718 (holotype BM n.v.; isotypes CGE n.v., K! [cited as type by Sleumer (1969)]). Gomphandra polymorpha Wight (1840: 103). Gomphandra polymorpha var. angustifolia Wight (1840: 103). Stemonurus polymorphus (Wight) Miers (1852: 37). Stemonurus polymorphus var. angustifolius (Wight) Miers (1852: 37), ‘angustifolia’. Type: Wight K.D. 428 (K! lectotype of G. polymorpha (selected by Sleumer 1969), type of G. polymorpha var. angustifolia; isolectotypes: C!, E!, L!, P!) Gomphandra polymorpha var. acuminata Wight (1840: 103). Stemonurus polymorphus var. acuminatus (Wight) Miers (1852: 37), ‘acuminata’. Type: India, Courtallum, Wight s.n. (lectotype K! [K000381719] (selected by Schori)). Gomphandra polymorpha var. oblongifolia Wight (1840: 103). Stemonurus polymorphus var. oblongifolius (Wight) Miers (1852: 37), ‘oblongifolia’. Type: India, Courtallum, Aug. 1835, Wight 430 (lectotype K! (selected by Schori); isolectotypes: C spec. dep., GH!, L!, P!). Gomphandra polymorpha var. longifolia Wight (1840: 103). Stemonurus polymorphus var. longifolius (Wight) Miers (1852: 37), ‘longifolia’. Type: India, Courtallum, [Sept. 1835], Wight s.n. (lectotype K! [K000381688] (selected by Schori); isolectotype: E!). Gomphandra polymorpha var. ovalifolia Wight (1840: 103). 271

Stemonurus polymorphus var. ovalifolius (Wight) Miers (1852: 37), ‘ovalifolia’. Type: Wight s.n. (lectotype K! [K000381718] (selected by Schori)). Stemonurus heyneanus Miers (1852: 40) (based on Olax heyneana Wall., Cat.: 6780. 1832, nom. nud.). Type: Wallich 6780 (lectotype BM n.v.; isolectotypes K! [3 sheets]). Stemonurus longifolius Miers (1852: 40) (based on Olax longifolia Wall., Cat.: 6782. 1832, nom. nud.) Type: Wallich 6782 B (lectotype BM n.v. (selected by Sleumer 1969); isolectotypes CGE n.v., K!). Stemonurus ceylanicus Miers (1852: 42). Type: Macrae 428 (holotype of Stemonurus ceylanicus, BM? n.v.).

Shrub or small tree to 9 m high, to 12 cm diam. Bark tan to grey. Twigs green, slender, straight to slightly zigzag, 1.5 – 2.5 mm in diam., pubescent with minute, appressed and often reddish hairs, terminal bud falcate, minutely pubescent. Leaves membranaceous to firmly chartaceous, glabrescent to glabrous, lanceolate to lance-ovate, narrowly ovate, oblong, or narrowly obovate, (5 – ) 8 – 11 ( – 16) × 1.5 – 4.0 ( – 5.6) cm, apex acuminate, base acute to attenuate, occasionally rounded, often asymmetric, margin slightly revolute; midrib impressed above, secondary veins 3 – 5 ( – 6) pairs, flat to slightly raised above, raised below, widely spaced and converging toward margin, brochidodromous, tertiary veins slightly raised to flat or not visible above, raised below and delicately percurrent; petiole narrowly grooved above, 0.4 – 1.2 cm long, 0.8 – 1.2 mm wide, pubescent with minute appressed hairs, somewhat glabrescent. Inflorescences axillary, usually on younger portions of twigs but sometimes from axillary flowering spurs, axes densely pubescent with minute, appressed reddish hairs. Male inflorescences with common peduncle to 1.1 cm long, with up to 4 short (1 – 2, rarely 3 mm) branches and bearing up to 15 ( – 25) flowers on branches or pedicels 1 – 2 mm long. Male flowers: calyx cupular, entire to apiculate, 1 mm across, glabrous; petals 4, white to greenish or yellowish, usually coherent but sometimes free, 2 – 3 mm long, glabrous; stamens 4, white, strongly exserted, 3 – 4 mm long, pubescent dorsally with a tuft of short hairs below the 272

connective. Female inflorescences with peduncle 2 – 3 mm long, bearing 2 – 4 flowers on pedicels 1 – 3 mm long. Female flowers: calyx cupular, apiculate, 1 mm across, glabrous; petals 4, white to yellow, coherent to free, glabrous, 3 mm long, staminodes 4, slightly exserted, glabrous or with a few clavate hairs, ovary cylindrical, glabrous, (1 – ) 2 – 3 mm long, capped by the broader stigma. Fruit translucent white when ripe, oblongoid to cylindrical, (1.2 – ) 1.4 – 1.8 × (0.5 – ) 0.7 – 0.8 cm, apex obtuse, base truncate, sometimes swollen, inner mesocarp with ca. 9 – 11 low anastomosing ridges, surface of dried fruit often appearing somewhat granular, stigma displaced toward sulcus, 2.0 – 2.5 mm across.

DISTRIBUTION. Sri Lanka, India. Rare to common. Lakshminarasimhan (1999) reports this species from “South Nicobar”, but no specimens have been seen. SPECIMENS EXAMINED. SRI LANKA. No specific locality, imm. fr., ♂ fl., unknown collector s.n. (GH!); no specific locality, imm. fr., unknown collector s.n. (US! sheet 201658); no specific locality, ♂ fl., fr., unknown collector 251 (US!); no specific locality, ♂ buds, Walker s.n. (GH!, also with label Wight 430, which is from India); no specific locality, buds, Thwaites 251 (GH!, K! [2 sheets], L!, P!, US!); Central Province, Matale District, Midlands, Rattota, 760 m, imm. fr., 12 Nov. 1972, Tirvengadum et al. 1 (K!, L!, US!); Gammaduwa, ♂ buds, 6 June 1927, Alston 666 (UC!); Rattota, 1000 m, 4 March 1977, Cramer 4869 (K!, MO! [2 sheets], NY!, US!); Rattota, Bambaragala, 750 m, ♂ fl., 25 Nov. 1977, Cramer 4994 (K! [3 sheets], MO!, US!); Kandy District, Ganoruwa [Gannoruwa] Hill, imm. fr., 9 July 1978, Meijer 1715 (L!, MO!); Kadugannawa, 160 m, imm. fr., 5 June 1973, Kostermans 24946 (K!, L! [2 sheets], P!, US!); Nuwara Eliya District, Ambagamuwa, 1220 m, [4000 ft.], buds, de Silva 58 (NY!); Sabaragamuwa Province, Ratnapura District, [Adam’s] Peak, 500 m, imm. fr., April 1971, Jayasuriya & Robyns 126 (K!, US!); Gilimale, 200 m, fr., 21 Dec. 1972, Tirvengadum & Cramer 178 (US!); Sri Palabaddala [Palabaddale], ♂ fl., 15 Feb. 1974, Waas 258 (US!); Palabeddala [Palabaddale], ♂ fl., 10 Sept. 1975, Sumithraarachchi et al. DBS 1017 (MO!, NY!, US!); Mandagala-Oya Forest, 700 m, imm. fr., 22 June 1976, Waas 1687 (GH!, K!, L!, MO!, NY!, US!); Marathagala, 1200 m, imm. fr., 26 June 1976, 273

Waas 1748 (A!, K!, L!, MO!, NY!, US!); Horagulkanda-Sinharaja, 300 m, 300 m, 25 Feb. 1977, Waas 2022 (K!, MO!, US!);Gilimale Forest Reserve, ♀ fl., imm. fr., 28 Jan. 1985, Jayasuriya & Gunatilleke 3066 (A!, BISH!, MO!, NY!, ); Gilimale Forest Reserve, imm. fr., 26 Feb. 1985, Jayasuriya & Bandara 3334 (A!, BISH! [2 sheets], MO!); Gilimale, 200 m, imm. fr., 21 Dec. 1972, Cramer et al. 3980 (US!); Rasagalla, imm. fr., 9 Nov. 1975, Sohmer & Waas 10518 (BISH!, F!, GH!, K!, MO!, NY!, P!); Adam’s Peak, 350 – 400 m, buds, 7 March 1973, Bernardi 14144 (L!, US!); Rassagalle above Balangoda, 750 m, ♀ fl., 19 May 1969, Kostermans 23578 (A!, K!, L!, P!, US!); Weddagala, Sinharaja Forest, ♂ buds, 28 Oct. 1976, Fosberg 56544 (GH!, MO!, NY!, UC! [2 sheets]); Kegalla District, Kitulgala, 180 m, fr., 6 Nov. 1976, Comanor 541 (K!, US!); ibid, 160 m, imm. fr., 12 Sept. 1977, Nooteboom & Huber 3087 (L!, US!); ibid, ♂ buds, 11 Nov. 1975, Sohmer & Waas 10550 (BISH!, F!, GH!, K!, MO!, NY!, P!); Southern Province, Galle District, Hiniduma, Haycock Mtn., 160 m, ♂ fl., 28 Sept. 1977, Huber 337 (US!); Kanneliya, imm. fr., 1 July 1975, Waas 1342 (BISH!, K!, US!); Hiniduma, Haycock Mtn., 300 m, fl., imm. fr., 21 Oct. 1974, Davidse 7840 (BRI!, K!, L!, MO!, US!); Kaneliya forest near Hiniduma, buds, 6 May 1973, Kostermans 24739 (A!, K!, L! [2 sheets], P!, US!); Western Province, Kalutara District, Denihena, near Badureliya, ♂ fl., 16 Feb. 1974, Wambeek et al. s.n. (US!); Morapitiya near Bardureliya, 250 m, ♀ buds, fr., 24 Sept. 1977, Huber 288 (US!); Morapitiya, ♂ fl., 7 Nov. 1974, Waas 919 (K!, L!, MO!, NY!, US!); Badureliya, 75 m, ♀ fl., 8 June 1973, Cramer 4166 (K!, US!); Colombo District, Labugama, buds, 18 March 1975, Waas 1237 (BISH! [2 sheets], K!, MO!, NY!, US!); North Western Province, Kurunegala District, Weudakanda, 400 m, ♀ fl., imm. fr., 18 June 1976, Waas 1644 (GH!, K!, MO!, NY!, US!); INDIA. Wight 428 (lectotype of G. polymorpha, G. polymorpha var. angustifolia, K!, isolectotypes C! [2 sheets], E!, L!, P!); Meghalaya State, East Khasi Hills District, Cherrapunjee [Cherrapunji], 1220 m [4000 ft.], buds, 24 May 1952, Chand 5746 (UC!); ibid, 1220 m [4000 ft.], buds, 23 June 1952, Chand 5962 (UC!); Khasia, 0 – 915 m, [0 – 3000 ft.], buds, Hooker & Thomson s.n. (NY!); Karnataka State, Hassan District. Mysore, Shiradi ghat, 400 m, 19 July 1970, Nicolson et al. HFP 250 (MO!, US!); Mysore, 13° N, 76° E, 680 m, imm. fr., 6 Oct. 1970, Jarrett et al. HFP 858 (K!, MICH!, 274

MO!, US!); ibid, Kencharkurmi, Shiradi ghat, 490 m, 8 July 1971, Ramamoorthy HFP 1902 (US!); Mysore, Bisle ghat, 26 May 1969, Saldanha 13201 (K!, MO!, US!); ibid, Shiradi ghat, imm. fr., 7 Jan. 1970, Saldanha 15987 (MO! [2 sheets], US! [2 sheets]); ibid, 4 Feb. 1970, Saldanha 16210 (US! [2 sheets]); Shimoga District. Agumbe, Someswar Ghats, imm. fr., 28 Oct. 1960, Raghavan 67875 (CAL!); Gubbiga near Yedur, ♂ fl., 21 May 1962, Raghavan 80840 (CAL!, MO!); Kerala State, no locality given [Travancore State], imm. fr., Calder & Ranuabwami [?] 1650 (CAL!); Palakkad District. Palghat [Palakkad], 675 m, imm. fr., 5 Nov. 1976, Vajrardu 48850 (CAL!); Pathanamthitta District. Perunthenaruvi, 100 m, buds, 10 Aug. 1988, Kumarini 723 (CAL!); Thiruvananthapuram District. Kallar, 350 m, fr., 22 Nov. 1979, Mohanan 65165 (CAL!); Tamil Nadu State, Tirunelveli District. Courtallum. Wight s.n. (holotype of G. polymorpha var. longifolia, K! [K000381688], E!); Wight 429 (holotype of G. polymorpha var. acuminata, K!; isotypes E! [2 sheets], GH!, L!, NY!); Courtallum, Aug. 1835, Wight 430 (holotype of G. polymorpha var. oblongifolia, K!, L!, NY!, P!). HABITAT. Tropical rain forest; secondary wet evergreen forest; stream edge in primary forest; in rocky stream bed; on slopes; red lateritic clay over gneiss; usually below 1000 m. NOTES. Gomphandra tetrandra is quite variable in its leaf size and shape. Collections from Sri Lanka are distinctive and easy to identify with fine, prominent venation, slender twigs, and oblong fruit. Collections from northeast India tend to have larger leaves, often with rounded bases, that dry a medium brown, and some specimens have many pairs of secondary or intersecondary veins (i.e. Prain’s Collector 100016). However, there are relatively few specimens from this region, and they are not substantially different from the type collections from southern India, even though they are clearly disjunct. Sleumer (1969) treated Gomphandra tetrandra as a widespread species occurring in Vietnam, Laos, Thailand, and China, but specimens from those countries belong to a separate species, G. cambodiana, which has leaf-opposed inflorescences. Gomphandra tetrandra is restricted to India, Sri Lanka, and perhaps Myanmar.

275

11. Gomphandra tomentella (Kurz) Mast. in Hook. f., (1875: 587). Stemonurus tomentellus Kurz (1872: 298). Urandra tomentella (Kurz) Kuntze (1891: 113). Type: Myanmar, ♂ buds, 4 July [18?]07, Griffith 813 (lectotype K! [K000381682]; isolectotypes C!, GH!, L!, P!).

Shrub 1 – 2.5 m high. Twigs 1.5 – 2 mm in diam., initially densely pubescent with minute spreading hairs, glabrescent with age. Leaves chartaceous, glabrous above, velutinous below, sometimes glabrescent with age, broadly lanceolate to obovate-elliptic or oblong, 13 – 23 by (1.5 – ) 3.5 – 8.5 ( – 10) cm, apex acute to shortly abruptly acuminate, base rounded to acute, margin slightly revolute; midrib impressed above, raised below, secondary veins (6 – ) 8 – 10 ( – 12) pairs, flat to raised above, raised below, lower pairs converging towards margin, upper pairs ± parallel, upper pairs brochidodromous, sometimes forming an intramarginal vein, tertiary veins flat to slightly raised above, slightly raised below, distinctly percurrent; petiole grooved, 0.8 – 1.4 cm long, pubescent. Inflorescences terminal or leaf-opposed, axes pubescent. Male inflorescences with peduncle 1.3 – 2.5 cm long, bearing up to 4 branches 1 – 1.2 cm long, each of these bearing up to 4 short branches which may rebranch, terminal branches of scorpioid cymes, evidently reblooming, inflorescences with 30 – 100 sessile or subsessile flowers. Male flowers: calyx cupular, minutely apiculate, pubescent; petals white, 4 mm long, stamens exserted, 5 mm long, pubescent dorsally at the connective, sparsely pubescent ventrally below the anthers. Female inflorescences, flowers, and fruit unknown.

DISTRIBUTION. Myanmar, Thailand, Malaysia. SPECIMENS EXAMINED. Myanmar, woods towards S. mines [Tenasserim?], 4 April [18?]07, Griffith 813 p.p. (K!); ♂ buds, 4 July [18?]07, Griffith 813 p.p. (lectotype K! [K000381682]; isolectotypes A! [fragment], C!, GH!, L!, P!); Thailand. Phatthalung Province, Tha Mot, ca. 30 km S of Phatthalung, 7°20’ N, 100°05’ E, 100 – 150 m, ♂ fl., 24 Nov. 1990, Larsen et al. 41668 (K!, MO!); Trang, Khao Chong [National Park], ♂ fl., 2 May 1969, Phusomsaeng 246 (BKF 52148) (L!, P!); ibid, ♂ fl., 17 May 1970, 276

Phusomsaeng & Pinnin 344 (BKF 53516) (K!); Malaysia. Kelantan, Gua Setir, on limestone, ♂ buds, 19 May 1990, Kiew & Anthonysamy RK 3040 (L!); Sungai Ketah, Batu Papan, ♂ fl., 12 Feb. 1924, Nur & Foxworthy 12082 (UC!); Perlis, Kaki Bukit, ♂ buds, 11 April 1938, Kiah SFN 35256 (A!, K! [2 sheets], L!, LAE, PAJ). HABITAT. Found on limestone or limestone-derived soils. NOTES. The description of Gomphandra tomentella has been emended here to include material from Thailand and Malaysia that probably belong to the species. Gomphandra tomentella was only known from one collection (Griffith 813), but the leaf shape, venation pattern, pubescence, inflorescence position, and sessile flowers with a pubescent calyx are very similar to the Thai and Malay specimens. Sleumer treated SFN 35256 as a pubescent form of Gomphandra quadrifida, and while the two species must be closely related, there are consistent differences. Gomphandra tomentella has more pairs of veins, the leaves are initially densely pubescent below, the male flowers are sessile or at most subsessile, and the calyx is pubescent. Gomphandra quadrifida has glabrous leaves, male flowers that are distinctly pedicelled, and a glabrous calyx. Masters’ description of Gomphandra tomentella in the Flora of British India included the ovary, but no female specimens are known to exist. The following specimens appear to be somewhat intermediate between Gomphandra tomentella and G. quadrifida in that the male specimens have pedicelled flowers. Thailand, Phetchaburi Province, Amphoe Kaeng Krachan, near road to Khao Phanoen Thung, 12°51’ N, 99°19’ E, 700 m, ♂ fl., 26 June 2000, Newman et al. 1082 (A!, MO!) [Leaves pubescent, flowers pedicelled]; ibid, road to Tor Tip [Thorthip] Waterfall, km 36, 0 m, imm. fr., 4 Dec. 1993, Larsen et al. 45052 (K!). 277

PHILIPPINES [17 taxa] & TAIWAN [1 taxon]

G. bracteata, G. conklinii, G. coi, G. cumingiana, G. dinagatensis, G. fernandoi, G. flavicarpa, G. fuliginea, G. halconensis, G. lancifolia, G. luzoniensis subsp. luzoniensis, G. luzoniensis subsp. septentrionalis, G. mappioides, G. oblongifolia, G. oligantha, G. psilandra, G. ultramafiterrestris

1. Leaves usually with 4 or fewer pairs of veins, or veins not visible 2. Leaves with persistent spreading pubescence below, Cordillera G. fuliginea 2’. Leaves not persistently pubescent below 3 3. Leaves chartaceous, not coriaceous 4 4. Leaves lanceolate, 7 – 10 cm long, Sierra Madres G. lancifolia 4’. Leaves ovate to elliptic, to 13 cm long 5 5. Leaves widest below the middle, apex acuminate to caudate, inflorescences terminal, peduncle < 0.5 mm thick, fruit (1 – ) 1.5 – 1.7 cm long, Mindoro, Panay, Sibuyan, Dinagat G. oligantha 5’. Some leaves oblong-obovate and widest above the middle, apex acute to acuminate, inflorescences axillary, peduncle > 0.5 mm thick, fruit 2.2 – 3.1 cm long, Banaue G. conklinii 3.’ Leaves coriaceous 6 6. Venation generally not visible, leaves acuminate to caudate, inflorescences axillary, fruit globose, 1.0 – 1.3 cm long, Mindoro G. halconensis 6’. Venation visible, leaves and inflorescences various, fruit not globose, not from Mindoro 7 7. Leaves obovate to orbicular, veins basally disposed, twigs 2 – 3.5 mm thick, fruit 1.5 – 2.1 cm long, Batanes and Taiwan G. luzoniensis subsp. septentrionalis 7’. Leaves ovate to elliptic, never orbicular, veins not crowded at base, twigs 1 – 2 mm thick, fruit smaller or larger than above, Luzon or Mindanao 8 8. Leaves thinly coriaceous, not shining when dried, inflorescences axillary, with fewer than 10 flowers, fruit 2.2 – 3.1 cm long, Banaue G. conklinii 8’. Leaves thickly coriaceous, often shining above when dried, inflorescences terminal with more than 10 flowers, fruit 1.1 – 1.4 cm long, eastern Mindanao, Dinagat G. ultramafiterrestris 1’. Leaves usually with 5 or more pairs of veins 9 9. Leaves persistently pubescent below with spreading hairs 10 10. Leaves thinly coriaceous, often shining when dry, inflorescences terminal, ovary glabrous, fruit ellipsoid, 1.8 – 2.2 cm long G. fernandoi 10’. Leaves chartaceous, not shining when dry, inflorescences axillary, ovary pubescent, fruit often beaked, 1.5 – 1.9 cm long G. cumingiana 9’. Leaves sparsely pubescent to glabrous, but without spreading hairs 11

278

11. Inflorescences terminal or leaf-opposed, if axillary then scars opposite the leaves 12 11’. Inflorescences axillary, never terminal or leaf-opposed 14 12. Youngest portion of twigs < 1 mm thick, leaves ovate, 5 – 10 ( – 12) cm long, shoots not reproductively mature G. oligantha (juvenile) 12’. Youngest portion of twigs ≥ 1 mm thick, leaves various, 9 – 17 ( – 18.5) cm long, shoots fertile 13 13. Leaves thinly coriaceous, fruit 1.5 – 1.8 cm long, stigma 2 mm, fez-shaped, Bicol, Catanduanes G. oblongifolia 13’. Leaves chartaceous, fruit (1.8 – ) 2 – 2.4 ( – 2.7) cm long, stigma 3.5 – 4.0 mm, shape not distinctive, Luzon, Palawan, Mindoro, Panay G. luzoniensis subsp. luzoniensis 14. Inflorescences 1 – 2 cm long or ♀ fl. solitary, flowers not crowded 15 14’. Inflorescences to 1 cm long (except G. mappioides), flowers generally crowded 18 15. Leaves thickly coriaceous, venation often obscure, fruit globose, Mindoro G. halconensis 15’. Leaves chartaceous to coriaceous but not thickly so, venation distinct, fruit not globose 16 16. Leaves 6.5 – 13 by 2 – 4 cm, up to 12 fruit per infructescence, Dinagat G. dinagatensis 16’. Leaves (6 – ) 10 – 18 by 3 – 6 ( – 7.5) cm, fruit 1 – 4 17 17. Leaves coriaceous, peduncles appearing very slender, male flowers few (up to 10), fruit solitary, stigma 2 mm across, Palawan G. bracteata 17’. Leaves chartaceous, peduncles not appearing especially slender, male flowers more than a few (up to 25), fruits 1 – 4, stigma 3 – 3.5 mm across G. mappioides 18. All secondary veins (except lowest pair) always strongly looping near margin, fruit (0.9 – ) 1.3 – 1.6 cm long, fruit pink to orange, Mindanao G. flavicarpa 18’. Upper vein pairs often joining near margin, fruit 1.6 – 2.5 cm long, white 19 19. Inflorescences short and crowded, peduncle and pedicels each 1 – 2 mm long, stigma 2 – 3 mm across, not spreading 20 19’. Inflorescences commonly to 1 cm, sometimes longer, flowers not crowded, peduncles longer than 2 mm, ♀ pedicels 3 – 6 mm long, stigma 3 – 3.5 mm across, spreading, widespread in eastern Philippines G. mappioides 20. Female inflorescences with 4 ( – 5) flowers, fruit 2.0 – 2.5 cm long, Quezon Province G. psilandra 20’. Female inflorescences with more than 4 flowers, fruit 1.6 – 1.8 ( – 2) cm long, Palanan G. coi 279

12. Gomphandra bracteata Schori (Kew Bulletin). Type: Philippines, Palawan, Palawan Province, Tindogan District, Mantalingajan Mountain Range, Mt. Gantung, imm. fr., 18 Aug. 1996, Pipoly & Romero PPI 37925 (holotype PNH!; isotypes A!, BRI!, BRIT!, K!, L!, MO!, US!).

Small tree 3 – 6 m tall, 5 – 11 cm in diam. Twigs straight to slightly zigzag, (1.5 – ) 2 – 3 mm in diam., initially sparsely pubescent with minute appressed hairs, quickly glabrescent. Leaves coriaceous, glabrous at maturity, shining above, lanceolate-ovate, ovate, or obovate, (8.5 – ) 10 – 18 by 3 – 6 ( – 7.5) cm, apex abruptly acuminate or caudate, base acute to rounded, margin revolute; midrib sunken above, raised below, secondary veins 4 – 6 pairs, flat, sunken, or obscure above, raised below, veins parallel, upper pairs joining near margin, tertiary veins not visible above, flat to slightly raised or obscure below, weakly percurrent; petiole narrowly grooved, (0.6 – ) 1 – 2.2 cm long, glabrescent. Male inflorescences axillary on recent growth or terminal, often from accessory buds, 1 – 2 per axil, peduncle slender, 1 – 2 cm long, bearing 1 – 2 branches, one branch sometimes in the axil of a bract or small, caducous leaf, branches up to 1 cm long, flowers sessile or borne on short pedicels, flowers up to 10 per inflorescence. Male flowers only known from buds, calyx sparsely ciliate, cupular, 2 – 2.5 mm across, with 4 small teeth, petals 4, white, glabrous, 4 mm long in bud, stamens 4, glabrous, mature length not known, ovary rudiment cylindrical, glabrous. Female inflorescences axillary, solitary, peduncle 0.5 – 1.2 cm long, bearing a single terminal flower. Female flower: calyx 2 mm across, margin with minute teeth, sparsely ciliate; petals and staminodes not seen; ovary 3 mm long, glabrous or with a few caducous hairs, stigma 1 mm in diam. Infructescences axillary, bearing 1 fruit on a peduncle 1.3 – 2 cm long, with 1 or 2 minute persistent bracts. Fruit submature, ovoid, slightly asymmetrical, 1.5 cm long, 0.6 – 0.7 cm wide, faintly ridged, glabrous, punctate, stigma grooved, 2 mm across.

DISTRIBUTION. Palawan, from Quezon south, apparently endemic. SPECIMENS EXAMINED. PHILIPPINES. Palawan, Palawan Province, Tindogan District, Mantalingajan Mountain Range, Mt. Gantung, imm. fr., 18 Aug. 1996, Pipoly & 280

Romero PPI 37925 (holotype PNH!; isotypes A!, BRI!, BRIT!, K!, L!, MO!, US!); Tindogan District, Mt. Mantalingajan Range, Mt. Gantung, NNW slopes at headwaters of Tagwaya River, steep slopes frequently subject to large landslides, lowland primary forest, ultramafic soils, 8°59.0’ N, 117°49.0’ E, 700 m, ♂ buds, 17 Aug. 1996, Pipoly et al. PPI 37833 (L!, MO!, 8 other duplicates n.v.); Quezon, Bundog Barangay, Sumindap River, tributary of Kinlugan River, swamp forest, lateritic soil, 9°02.0’ N, 117°48.0’ E, 250 m, ♂ buds, 22 Aug. 1996, Pipoly et al. PPI 38256 (GH!, L!, PNH! [2 sheets], 8 other duplicates, n.v.). HABITAT. Found on slopes, near rivers, and in swamp forest, on lateritic and ultramafic soils below 700 m. CONSERVATION STATUS. Critically Endangered: CR B2b(iii,v). PHENOLOGY. Flowers in August and September. NOTES. Gomphandra bracteata was first collected in 1996 and is only known from three collections. The species is distinguished by its coriaceous leaves with few veins and an acuminate to caudate apex, its solitary female flowers and fruits, and by the few- flowered male inflorescences that sometimes bear a small leaf. The inflorescence structure of Gomphandra bracteata is most similar to G. oligantha, which also has few- flowered inflorescences on relatively long, slender peduncles. However, the leaves are more like those of Gomphandra luzoniensis, which also occurs in Palawan, or G. palustris, which is found to the south in western Sarawak.

13. Gomphandra coi Schori (Kew Bulletin). Type: Barangay San Isidro, Sitio Diago, 17°07.7’ N, 122°30.9’ E, 30 m, fr., 27 May 1991, Co 3591 (holotype A!; isotypes CAHUP!, CANB!, Isabela State University n.v., K! [2 sheets], KEP n.v., L!, PNH n.v., PUH!, US!).

Shrub or small tree to 4 m tall and 2 cm in diam. Twigs green when fresh, apparently glabrous, 1.5 – 2.5 mm in diam., older portions of twigs stout. Leaves variable, shining above and bullate when fresh, ovate-oblong to elliptic or occasionally lance-ovate, tapered at base, acuminate at apex, chartaceous, apparently glabrous, 12 – 17 ( – 21) × (3 281

– ) 3.5 – 7 cm, midrib sunken above, raised below, secondary veins (3 – ) 6 – 8 pairs, sunken above when fresh, flat to slightly raised when dry, raised below, lowest pair often steeply ascending, converging, upper pairs often joining toward margin, intersecondary veins common, tertiary veins flat above, slightly raised below, percurrent; petiole possibly a bit decurrent on twig, grooved, (0.5 – ) 1 – 2 cm long, glabrescent. Inflorescences axillary on mature portions of the twigs, 1 ( – 2) per axil. Male inflorescences only known from photographs, with peduncle in crowded 5 – 9 branched cyme 15 – 30 flowers per inflorescence. Male flowers: calyx short, green, lobed; petals fused in lower part, greenish-white, 5-lobed, probably glabrous; stamens white, well exserted, possibly glabrous. Female inflorescences and flowers not known. Infructescences axillary, peduncle 2 – 3 mm long, with 1 or 2 branches 1 – 2 mm long, fruit crowded in a reduced cyme, pedicels 1 – 2 mm long, up to 9 fruit per infructescence. Fruit ovoid, white at maturity, base slightly to prominently swollen, apex slightly tapered, 1.6 – 1.8 ( – 2) cm long, 0.7 – 0.8 cm wide, stigma 2 – 2.5 mm across, brown when fresh, inner mesocarp with 10 – 13 low anastomosing ridges.

DISTRIBUTION. Philippines. Endemic. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Isabela Province, Palanan, Dipaguidin [17.07 N, 122.32 E], 100 [m?], imm. fr., 18 April 1991, Ridsdale et al. ISU 68 (A!, K!, L! [2 sheets]); Digallorin, Divinisa camp site, [16.50 N, 122.26 E], 50 m, fr., 10 April 1992, Ridsdale et al. ISU 472 (A!, K!, L!); Guess, fr., 29 April 1991, Gaerlan et al. PPI 2757 (A!, K!, L!, 7 other dups. n.v.); Barangay San Isidro, Sitio Diago, 17°07.7’ N, 122°30.9’ E, 30 m, fr., 27 May 1991, Co 3591 (holotype A!; isotypes CAHUP!, CANB!, Isabela State University n.v., K! [2 sheets], KEP n.v., L!, PNH n.v., PUH!, US!). HABITAT. Over limestone; lowland dipterocarp forest at 30 m; streamside forest on ultramafic soil, 50 m. CONSERVATION STATUS. Endangered: EN B2ab(iii). PHENOLOGY. Flowers in October, ripe fruit in May. ETYMOLOGY. The specific epithet honors Leonardo Co, the Philippines’ preeminent field botanist. 282

NOTES. Gomphandra coi is quite similar and presumably closely related to G. psilandra Schori and G. mappioides Valeton. It has similar leaves, axillary inflorescences, and white fruit. It can easily be distinguished from Gomphandra mappioides by its much shorter infructescence (peduncle 2 – 3 mm versus 1 cm) which bears up to 9 fruit, instead of 4 – 5. Gomphandra psilandra is more similar to G. coi in infructescence length, but it only has 4 (rarely 5) female flowers or fruit, and its fruits are longer (2 – 2.5 cm vs. 1.6 – 1.8 ( – 2) cm), without a swollen base. The leaves of all three taxa are quite similar, and sterile material cannot always be identified to species. Gomphandra psilandra and G. mappioides are closely related, based on molecular data, and G. coi is expected to have a similar insertion in the trnL-F spacer. Flowering material needs to be collected to complete the description of Gomphandra coi, though it is expected that the flowers will be quite similar to those of G. psilandra and G. mappioides.

14. Gomphandra conklinii Schori (Blumea). Type: Philippines, Luzon, Mountain (nunc Ifugao) Province, Banaue, Amganad, 11 Sept. 1961, Banlugan et al. PNH 72486 (holotype PNH!; isotypes A!, L!).

Shrub or small, slender tree to 8 m tall and 20 cm diam. Twigs slender, almost straight, with minute appressed hairs near the apex, glabrescent, 1 – 2 mm in diam., terminal buds small, falcate, rusty pubescent. Leaves ovate to elliptic, often conduplicate, apex acuminate, base rounded to tapered, coriaceous, glabrous or with sparse pubescent below on the veins, glossy above and dull and paler below when fresh (fide PPI 12920), drying brown on both sides, 4.4 – 13.0 × 2.2 – 4.0 cm; midrib sunken above, raised below, extending to tip, yellowish when fresh, secondary venation highly variable, 1 – 5 pairs, somewhat obscure above, raised below, lowest pairs converging toward margin, upper pairs joining 1 – 2 mm from margin, tertiary veins not visible above, raised and distinctly percurrent below; petioles 0.5 cm long, grooved, glabrescent. Male inflorescences and flowers unknown. Female inflorescences 6-7-flowered in an axillary reduced cyme on previous season’s growth, to 2 cm long when mature, peduncle 0.5 – 0.7 cm long, with up to 5 branches, branches either serving as pedicels or bearing 2 – 3 flowers on pedicels 283

2 mm long, peduncle and pedicels pubescent. Female flowers: calyx cupular, articulated at base, with minute teeth or ciliate, very sparsely pubescent to glabrous, 2 – 3 mm across, 1 – 2 mm high; petals 4 (or 5?), with very fine white hairs appressed along midveins or at petal apex on outside of buds, buds 3 – 4 mm long; staminodes glabrous (not seen at maturity); ovary cylindrical, glabrous, 4 × 2 mm, stigma apical, 2 mm wide, 5-lobed, edges undulate, capping ovary & slightly wider than it. Fruit oblong to obovoid, apex rounded, base swollen, yellowish (fide PNH 79571) or slightly red white (fide PPI 6987), 2.2 – 3.1 × 0.9 cm; inner mesocarp with ca. 10 – 11 low ridges, stigma 2.5 mm in diam., displaced toward sulcus.

DISTRIBUTION. Philippines, Luzon, Ifugao Province. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Mountain [Ifugao] Province, Banaue, Bayninan, steep slope, 1525 m [5000 ft.], 6 Mar. 1963, Conklin & Buwaya 79571 (K!, L!); Ifugao Province, Barangay Batad, Mt. Borbor, 1705 m (16°56.0’ N, 121°09.8’ E), 6 Apr. 1994, Barbon et al. PPI 12920 (L!, PNH!, 3 other duplicates, n.v.); Banaue, Barangay Dalikan, Mt. Bukung, 30 July 1992, Reynoso, Sagcal & Garcia PPI 6987 (CAHUP!, L!, PNH!, US!, 2 other duplicates, n.v.). HABITAT. On ridge at 1705 m, on clay loam in secondary disturbed forest and slightly disturbed gully forest. CONSERVATION STATUS. Critically Endangered: CRB2ab(iii). PHENOLOGY. Flowers in September. ETYMOLOGY. The specific epithet honors Dr. Harold C. Conklin, of Yale University’s Peabody Museum, who wrote an ethnographic atlas of Ifugao and first collected this species. NOTES. Gomphandra conklinii has the largest fruit of any Gomphandra in the Philippines. PPI collectors (12920) did not see ripe fruit but reported that they are purple when ripe. This anecdote is almost certainly incorrect, as all observations of ripe fruit in other species give the color as white, ivory, yellow, pink, salmon, or red. Based on herbarium records, this species blooms in September and fruits from March to July. Gomphandra conklinii was first collected in 1961 and has been found as recently as 284

1994. While Ifugao Province has retained its forested areas and in fact has more forest now than it did when Conklin first collected this species, much of the forest is highly degraded. The 1990s collection sites have been extensively cut or converted to agriculture and then abandoned to grassland. Conklin’s collector, Ballogan (Banlugan is a spelling variation), reported the Ifugao common name “halipan” for this species and said that the branches were used as a supplement to betel nuts. However, in 2007, “hali-pon” referred exclusively to Ficus spp., and no one could recall using twigs of any plant along with betel nuts. Mr. Ballogan said that while collecting for Conklin, he would ask locally about common names, and a common name was reported on the herbarium label if three people gave the same identification. On his own collection, Conklin reported “lungi” as a common name and said that the timber was used for house construction. This use is much more in line with other reports of economic uses of Gomphandra, but I have not had an opportunity to search for this species under this other common name. The local forester in Banaue did not recognize photos of herbarium specimens of this species. There are also reports that previously common species have become very scarce or even extirpated in the past generation, presumably as a result of overharvesting.

15. Gomphandra cumingiana (Miers) Fern.-Vill. (1880: 46). Stemonurus cumingianus Miers (1852: 42). Type: Philippines, Cuming 796, (lectotype K!; isotypes BM, C!, CGE, FI, G, K!, L! [3 sheets], P! [2 sheets], SING, UPS). Stemonurus agusanensis Elmer (1915: 2689). Gomphandra agusanensis (Elmer) Merr. (1923: 489). Type: Philippines, Mindanao, Agusan del Norte Province, Cabadbaran, Mt. Urdaneta, fr., Oct. 1912, Elmer 14018 (lectotype of Stemonurus agusanensis A!; isolectotypes BISH!, F!, K!, L! [2 sheets], MO!, NY!, P!, PNH!, U!, US!).

Tree 3 – 15 m tall, to 30 cm diam. Bark smooth, greyish to greyish green. Twigs somewhat zigzag, initially densely pubescent with short, spreading tawny to reddish hairs, eventually glabrescent, young twigs 1 – 1.5 mm in diam., terminal bud densely 285

pubescent, often composed of several dormant leaves. Leaves chartaceous, ovate to elliptic, less commonly oblong or somewhat rhombic, apex abruptly acuminate, base rounded to acute, glabrous above except along midrib, sparsely to moderately pubescent below, somewhat glabrescent with age, (6.5 – ) 9 – 18 ( – 26) × (2.5 – ) 3.5 – 7 ( – 12.5) cm, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 5 – 7 ( – 10) pairs, flat to sunken above, raised below, vein course parallel to somewhat converging, upper veins tending to join near the margin, tertiary veins flat above, raised below, distinctly percurrent; petiole grooved, (0.3 – ) 1 – 1.5 cm long, pubescent. Inflorescences axillary (rarely terminal?), 1 – 3 per axil, axes densely pubescent with appressed hairs. Male inflorescences with common peduncle 0.5 – 0.8 cm long, bearing up to 4 branches 0.3 – 1 cm long, branches shortly rebranched or bearing a somewhat scorpioid cyme of 3 – 15 flowers, flowers subsessile or on pedicels to 2 mm long, 10 – 30 ( – 60+) flowers per inflorescence. Male flowers: calyx cupular, entire to minutely apiculate, sparsely to moderately pubescent, 1.5 mm across; petals (4 – ) 5, sparsely pubescent at the apex in bud, glabrescent, white to yellowish-green, 4 mm long; stamens (4 – ) 5, strongly exserted, 5 – 6 mm long, densely pubescent dorsally at the connective with a long tuft of clavate hairs, pubescent ventrally below the anthers; ovary rudiment minute. Female inflorescences with peduncle 0.5 – 1 cm, bearing up to 6 flowers in an irregular cyme (sometimes appearing racemose), or with 3 – 4 branches 0.2 – 0.5 cm long, each bearing 2 – 4 flowers, pedicels 1 – 4 mm long, elongating in fruit, 2 – 7 ( – 15) flowers per inflorescence. Female flowers: calyx cupular, petals 4 mm long, staminodes (4 - ) 5, 3 – 4 mm long, with a tuft of clavate hairs dorsally at the anther cells, ovary sparsely to densely pubescent, sometimes glabrescent with age, 2.5 – 3 mm long, stigma 1 – 1.5 mm across. Fruit ellipsoid, apex usually slightly beaked, base rounded, 1.5 – 1.9 cm long, 0.7 – 0.8 cm wide, sparsely pubescent, whitish (fide PPI 15428) to apricot (fide Stone 15892) but perhaps not ripe, inner mesocarp with ca. 12 low longitudinal ribs, stigma often displaced towards sulcus, 2.5 mm in diam., grooved on one side or with a central depression.

286

DISTRIBUTION. Philippines – Palawan, Luzon (Bicol), Samar, Leyte, Biliran, Mindanao; Borneo. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Quezon Province, Real, Barangay Kawayan, 14°12.1’ N, 121°09.2’ E, imm. fr., 19 Feb. 1995, Romero et al. PPI 15688 (A!, K!, L!, MO!, PNH! [2 sheets], 4 other dups. n.v.); Polillo Island, Barangay Amot, Sitio Patik, 14°50.8’ N, 121°58.1’ E, imm. fr., 2 Aug. 1995, Romero et al. PPI 15428 (L!, MO!, PNH!, 7 other dups. n.v.); Camarines Province, no specific locality, ♂ fl., Dec. 1913, Ramos B. S. 1582 (A!, BRI!, L! [2 sheets], MO!, NY!, P!); Camarines Sur Province, Mt. Isarog, imm. fr., Nov. – Dec. 1913, Ramos B. S. 22068 (L!, NY!, P!, US!); Buhi, ♂ buds, Vidal 1036 (A!, K!); Sorsorgon Province, Irosin, Mt. Bulusan, fr., Nov. 1915, Elmer 15215 (A! [2 sheets], F!, K!, L! [2 sheets], MO!, NY!, P!, UC!, US! [2 sheets]); ibid, fr., Dec. 1915, Elmer 15449 (A! [2 sheets], F!, K!, L! [2 sheets], MO!, NY!, P!, UC!, US! [2 sheets]); ibid, ♂ buds, Nov. 1915, Elmer 15476 (A! [2 sheets], K!, L! [2 sheets], MO!, NY!, P!, PNH!, US! [2 sheets]); ibid, ♂ buds, April 1916, Elmer 15624 (A!, GH! [2 sheets], K!, L! [2 sheets], MO!, NY!, P!, PNH!, US! [2 sheets]); ibid, ♀ fl., June 1916, Elmer 16429 (A!, BISH!, GH!, K!, L! [2 sheets], MO!, NY!, P!, US! [2 sheets]); Mt. Bulusan, Lake Bulusan, 400 m, fr., 9 April 1987, Stone 15892 (F!, L! [2 sheets], MO! [2 sheets], NY!, PNH!, UC!, US!); Samar. No specific locality, imm. fr., June 1916, Acuña & Madrid B. S. 25765 (US!); Western Samar Province, Calbiga, Bo. Parasanon, Mt. Balud, 140 m, fr., 12 June 1952, Conese PNH 15771 (A!, L!); ibid, 140 m, ♂ fl., 12 June 1952, Conese PNH 15805 (A!); Biliran, Biliran Province, imm. fr., June 1914, McGregor B. S. 18782 (A!, BRI!, US!); Leyte, no specific locality, fr., 16 Mar. 1913, Wenzel 14 (US!); ibid, fr., 9 May 1913, Wenzel 14 B (A!, E!, F!, US!); ibid, fr., 9 June 1913, Wenzel 14 C (GH!); ibid, ♀ fl., 20 April 1914, Wenzel 14 D (MO! [2 sheets]); ibid, ♂ fl., 10 July 1913, Wenzel 350 (A!, GH!, US! [2 sheets]); ibid, ♂ buds, 20 April 1914, Wenzel 696 (A!, F!); ibid, ♀ fl., 1 June 1914, Wenzel 696 B (GH!, NY!); ibid, ♀ fl., May – July 1914, Wenzel 700 (US!); ibid, imm. fr., May – July 1914, Wenzel 829 (US!); ibid, ♀ fl., fr., 17 Aug. 1915, Wenzel 1580 (A!, F!, GH!, NY!); ibid, fr., 24 Aug 1915, Wenzel 1580 B (MO! [2 sheets]); ibid, fr., July 1916, Phasis B. S. 25784 (NY!); Leyte Province, Dagami, imm. fr., Aug. 1912, Ramos B. S. 15186 (K!, US!); Mt. 287

Abucayan, fr., Feb. 1923, Edaño B. S. 41710 (A!, BRI!, K!, L!, UC!, US!); Mindanao, Surigao, ♀ fl., 9 May 1927, Wenzel 2873 (A! [2 sheets], GH!, K!, MO!, NY! [2 sheets]); ibid, imm. fr., 3 Aug. 1927, Wenzel 2936 B (A!, K!, MO!, UC!);ibid, ♂ fl., 27 June 1927, Wenzel 3008 (NY! [2 sheets]); ibid, imm. fr., April – July 1917, Mallonga B. S. 27004 (K!, NY!, P!, US!); Surigao del Norte Province, Placer, Tubud [Tubod], Truagaan, buds, 14 May 1927, Wenzel 2632 (A!, GH!, K!, MO!, NY!, UC!); Placer, Tubud [Tubod], 150 m, 14 June 1927, Wenzel 2840 (UC!); [Placer], Manul (?), Tagbuyanan (?), 150 m, imm. fr., 23 June 1927, Wenzel 2873 B (UC!); Placer, Tubud [Tubod], Agsaui, 300 m, imm. fr., 12 July 1927, Wenzel 2936 (UC!); Placer, Tubud [Tubod], Camlan (?), 150 m, ♂ buds, 18 May 1928, Wenzel 3357 (UC!); Placer, Tubud [Tubod], Truagaan, 150 m, ♂ buds, 28 May 1927, Wenzel 3414 (UC!); Placer, Tubud [Tubod], 150 m, ♀ fl., 23 June 1927, Wenzel s.n. (UC!); Agusan del Norte Province, Cabadbaran, Mt. Urdaneta, fr., Oct. 1912, Elmer 14018 (isotype of Stemonurus agusanensis, A!, BISH!, F!, K!, L! [2 sheets], MO!, NY!, P!, PNH!, U!, US!); Zamboanga del Sur Province, Tetuan [Zamboanga City], galled imm. fr., Quadras 284 (US!); Basilan Province, Basilan, fr., Oct. 1912, Miranda F. B. 20073 (K!, US!); Sulu Province, Jolo, imm. fr., wood sections, 27 July 1905, Williams 3096 (NY! [2 sheets]); Mt. Daho, imm. fr., Sept. 1924, Ramos & Edaño B. S. 43929 (A!, P!, UC!, US!); Palawan, Taytay, Pagdanan Range at Ibangley, 50 m, buds, 31 Jan. 1991, Soejarto & Fernando 7447 (F!, PNH!); Puerto Princesa, Mt. Pulgar, 230 m [750 ft.], March 1911, Elmer 12893 (BISH!, F!, L!, NY!); Barangay Simpocan, NE base of Thumb Peak, 9°48’ N, 118°36’ E, 620 – 680 m, ♂ buds, 1 Dec. 1992, Horgen et al. 463 (F!); Irawan River valley, Tatanarom, Mt. Beaufort, 9°50’ N, 118°40’ E, 200 m, buds, 19 July 1988, Soejarto & Madulid 6102 (A!, F!, PNH!, US!); Irawan Forest, 9°46.8’ N, 118°41.7’ E, 520 m, imm. fr., 27 Aug. 1996, Romero et al. PPI 38440 (A!, L!, PNH!, 4 other dups. n.v.); Quezon, Barangay Bundog, near Sumindap River, 9°02.0’ N, 117°48.0’ E, 225 m, imm. fr., 21 Aug. 1996, Pipoly et al. PPI 38098 (L!, MO!, PNH!, 8 other dups. n.v.); ibid, ♂ buds, 21 Aug. 1996, Pipoly et al. PPI 38104 (L!, MO!); ibid, 225 m, 21 Aug. 1996, Pipoly et al. PPI 38117 (MO!, PNH! [2 sheets], 9 other dups. n.v.); Rizal, Ransang, Guimba, 8°56’4” N, 117°32’6” E, imm. fr., 25 Jan. 1994, Gaerlan et al. PPI 13342 (K!, L!, PNH!, 6 other dups. n.v.); Brooke’s Point, E of 288

Addison’s Peak, imm. fr., 25 Jan 1991, Gaerlan & Sagcal PPI 143 (CAHUP!, K!, L!, MO!, PNH!, US!, 4 other dups. n.v.); Addison Peak, southern slope, 8°50’ N, 117°50’ E, 450 m, imm. fr., 25 Jan. 1991, Soejarto & Fernando 7363 (A!, F!, L!, PNH!, US!); Brooke’s Point, Mt. Mantalingahan, 850 m [2800 ft.], ♂ buds, 5 May 1947, Edaño PNH 43 (A!, K!, L!, PNH! [2 sheets], SING n.v.); ibid, 850 m [2800 ft.], ♀ fl., 6 May 1947, Edaño PNH 49 (A!, BISH!, L!, PNH!, SING n.v., UC!); ibid, 900 m [3000 ft.], ♂ buds, 10 May 1947, Edaño PNH 160 (A!, L!, PNH!); ibid, 930 m, imm. fr., 6 May 1947, Edaño PNH 355 (A!, PNH!); Panalingahan River, 300 m [1000 ft.], imm. fr., 24 March 1929, Edaño B. S. 77436 (MICH!, NY!); Mt. Balagbag, 800 m [2600 ft.], ♂ buds, 22 May 1929, Edaño B. S. 77825 (BH!, MICH!, NY! [2 sheets], PUH!). HABITAT. Swamp forest, mixed dipterocarp forest, 225 m; secondary forest, clay loam soil at creek side; 930 m. Galls on leaves and twigs. PHENOLOGY. Flowers April through August, December. VERNACULAR NAME(S). Bayanotan (Visayan, Samar & Leyte), lambuan (Manobo, Mindanao), lipid (Sulu, Jolo; reported as Tausug (Bukindnon area of Mindanao) in Madulid 2001, probably incorrect), balinsowa, homay-homay, lanutan, mangoi, (Bikolano, Bicol region). Madulid (2001) reports the following additional names, though Gomphandra cumingiana has not been collected in these areas: anggagay (Sambal- Pinatubo, Luzon), barobo (Mangyan, Mindoro). NOTES. Gomphandra cumingiana is distinguished by the spreading pubescence on its leaves and twigs, its relatively short but many-flowered inflorescences, and its pubescent ovaries. The pubescent leaves and twigs may be mistaken for those of Gomphandra fernandoi, but that species has thicker leaves, terminal inflorescences, and glabrous ovaries. The inflorescences are somewhat similar to those of Gomphandra flavicarpa, but that species is not persistently pubescent, all but the lowest of its secondary veins are always strongly brochidodromous (vs. only upper pairs brochidodromous in G. cumingiana), and its ovaries are glabrous. Gomphandra cumingiana is most similar to G. borneensis, which does not occur in the Philippines, although the two species grow together in Borneo. They can be distinguished by ovary pubescence and branching pattern, and their leaf sizes and shapes are usually different. Gomphandra cumingiana 289

can be quite variable in leaf morphology. Specimens from Palawan tend to have smaller, narrower leaves with more veins and shorter petioles, smaller inflorescences with fewer flowers, sparsely pubescent ovaries, and narrower, more elongate fruits. However, Edaño B. S. 77436, from the San Antonio Bay region of southern Palawan, has the largest leaves recorded for the species. There is some indication that terminal inflorescences may rarely occur in the species, as scars have been observed opposite leaf scars (though this may instead be a case of very short internodes and the scars are actually leaf scars), but only one specimen with terminal inflorescences on short axillary branches has been seen (Wenzel 2873). All other specimens have axillary inflorescences from mature twigs. Gomphandra cumingiana has been widely collected in the Philippines, but there are few recent collections, indicating that habitat destruction or disturbance might constitute a major threat. Many specimens from Leyte were distributed as Urandra similis Merr., a name that was never published.

16. Gomphandra dinagatensis Schori (Kew Bulletin). Type: Philippines, Dinagat Province, Dinagat, fr., May 1919, Ramos & Pascasio B.S. 35264 (holotype US!; isotypes A!, BM! photo, K!, L!, P!, US!).

Twigs 1.5 – 2.5 mm in diam., initially pubescent with minute appressed hairs, glabrescent. Leaves coriaceous, glabrous at maturity, shiny above when dry, narrowly ovate to ovate-elliptic, apex acuminate, base acute to attenuate, 6.5 – 13 × 2 – 4 cm, margin slightly revolute; midrib sunken above, raised below, secondary veins flat or impressed above, flat below, 4 – 6 pairs, parallel, upper pairs joining (brochidodromous) near the margin, tertiary veins not visible; petiole grooved above, glabrescent, 1.2 – 2 cm long. Male inflorescences and flowers unknown. Female inflorescences axillary, occasionally at the end of a branch but then clearly axillary (between the ultimate leaf and the terminal bud), peduncle 1 – 1.5 cm long, bearing 2 – 3 branches 2 – 4 mm long, branches either serving as pedicels or branching again and bearing 2 – 4 flowers, flowers subsessile or on pedicels to 2 mm long, up to 12 flowers per inflorescence. Female 290 flowers not seen at anthesis, calyx glabrous, 1 – 1.5 mm wide, ovary cylindrical, glabrous, 2.5 – 3 mm long, stigma 1 – 1.5 mm in diam. Fruit submature, obovoid- ellipsoid, 1.4 – 1.6 × 0.7 – 0.9 cm, stigma lobed, scarcely raised, slightly displaced toward sulcus, 2 mm in diam., inner mesocarp with ca. 15 – 18 low, anastomosing longitudinal ribs.

DISTRIBUTION. Philippines, Dinagat Island. Endemic. SPECIMENS EXAMINED. PHILIPPINES. Dinagat Province, Dinagat, no specific locality, May 1919, Ramos & Pascasio B.S. 35264 (holotype K!; isotypes A!, BM! photo, L!, P!, US!). HABITAT. Dinagat Island is characterized by ultramafic soils, and although no specific locality was given on the type specimen, the only remaining forest on the island is on Mt. Redondo and in the Paragua Forest Reserve. Mt. Redondo is the highest point on the island, with an elevation of 935 m. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). PHENOLOGY. Fruits were present in May. NOTES. Gomphandra dinagatensis is only known from the type specimen. It appears similar to several other species in certain features. At first glance, the shiny leaves and branched infructescences resemble Gomphandra fernandoi Schori & Utteridge, which is also found on Dinagat, but the leaves of G. dinagatensis are glabrous, the infructescences are axillary rather than terminal, and the fruits are smaller with a less prominent stigma. The type also appears similar to a few specimens of Gomphandra ultramafiterrestris Schori, but the leaves of G. dinagatensis are longer, the fruits are larger, and the infructescences are axillary rather than terminal. Ramos & Pascasio B.S. 35264 was once identified as Gomphandra oblongifolia Merr., but that species has terminal or leaf- opposed inflorescences and a prominent, cap-like stigma on its fruit. Based on its leaves and inflorescence structure, one would expect it to belong to the Gomphandra luzoniensis (Merr.) Merr. group, but those taxa have terminal inflorescences, which are not present in G. dinagatensis. It may be more closely related to Gomphandra halconensis Schori, which has axillary inflorescences. A recent collection from Mt. Redondo, Schori 2008-6, 291

may belong to Gomphandra dinagatensis, but fertile material was not present. The specimen has much shorter petioles and different secondary venation, so it might represent an undescribed species. It is cited as Gomphandra sp. at the end of the Philippine section.

18. Gomphandra fernandoi Schori (Kew Bulletin). Type: Philippines, Samar, Western Samar Province, Paranas, Campo Uno [11°58.2’ N, 124°43.0’E], 400 m, 1 May 1996, Reynoso & Majaducon PPI 21977 (holotype PNH! [2 sheets]; isotypes A!, K!, L!, MO!).

Small tree to 20 m and 15 cm diam. Bark smooth, light brown to grey, with prominent branch scars from self-pruning of lower limbs. Young branches green to dark brown or black (from fungal smut) when fresh, pubescence tawny, spreading, branches held horizontally. Leaves variable with age of plant, on saplings lance-elliptic to ovate-elliptic and only thinly coriaceous, on mature trees ovate-elliptic to obovate or rounded-ovate, coriaceous, medium glossy green and glabrous above when fresh, usually drying somewhat shiny, paler green and dull below when fresh, persistently pubescent with tawny spreading hairs, eventually somewhat glabrescent on some leaves, apex acuminate, base rounded-acute, 11 – 20.5 × (4 – ) 5 – 7 ( – 9.5) cm; midrib sunken above, raised below, secondary veins flat or impressed above, raised below, 4 – 6 pairs, parallel or somewhat converging, often joining (brochidodromous) near the margins, tertiary veins flat above, delicately but distinctly percurrent below; petiole grooved above, pubescent, 1.0 – 2.4 cm × 1.3 – 1.7 mm. Inflorescences terminal, on newest flush of growth, leaving prominent scars opposite leaves on older portions of twigs. Male inflorescences with 3 – 4 ( – 5) orders of branching, common peduncle 0.4 – 3.5 cm long, primary branches 3 – 4, 0.9 – 1.9 cm long, each bearing up to 3 secondary branches which are branched (sometimes multiply) or not, bearing sessile or subsessile flowers in a scorpioid cyme, often with 100 or more flowers; all axes pubescent. Male flowers white, calyx cupular, 1.5 mm high, minutely 5-lobed, sparsely pubescent, petals 5, glabrous at anthesis, 4 – 5 mm long, stamens exserted, 5 – 6 mm long, bearing a tuft of clavate hairs dorsally at the 292

anthers, and usually with at least a few scattered clavate hairs ventrally below the anthers, ovary rudiment glabrous. Female inflorescences open cymes with 3 – 4 orders of branching and up to ca. 30 flowers, common peduncle 1.4 – 2.0 cm, bearing 3 – 5 branches 0.6 – 1.6 cm long, these unbranched or with 2 – 3 branches which may branch again, each terminal branch (often resembling pedicels) with one to several sessile to very shortly pedicelled flowers. Female flowers not seen at anthesis, calyx cupular, minutely pubescent to glabrescent in young fruiting state, with 5 minute teeth but tearing irregularly as ovary enlarges, ovary glabrous, 4 mm long and capped by a ridged stigma 1 mm high, maturing ovary (one to several months after anthesis) light green and punctate, obovoid, with a yellowish-brown stigma. Fruit ellipsoid, 1.8 – 2.2 × 0.8 – 1.1 cm, stigma slightly displaced toward sulcus, 3 – 4 mm in diam., inner mesocarp with ca. 12 low, anastomosing longitudinal ribs.

DISTRIBUTION. Philippines – Leyte, Samar, Biliran, Dinagat. SPECIMENS EXAMINED. PHILIPPINES. Samar, Northern Samar Province, Catarman, Lope de Vega, Mt Cansayao, 200 m, buds, fr., 3 April 1951, Sulit PNH 14345 (A!, K!, L! [2 sheets], PNH!, US!); ibid, fr., 7 May 1951, Sulit PNH 14592 (A!, K!, L!, US!); Western Samar Province, Paranas, Campo Uno [11°58.2’ N, 124°43.0’E], 400 m, ♂ fl., 1 May 1996, Reynoso & Majaducon PPI 21977 (holotype PNH! [2 sheets]; isotypes A!, K!, L!, MO!); Eastern Samar Province, Balangiga, Barangay [Poblacion] 1, Sitio Cantinoc, east of Forestry Station, [11°07’ N, 125°23.30’E], 150 m, imm. fr., 21 Aug. 1996, Gaerlan & Chavez PPI 26379 (K!, PNH!); Balangiga, Barangay [Poblacion] 1, Busong-busong, [11°07’N, 125°23.30’E], 300 m, imm. fr., 23 Aug. 1996, Gaerlan & Chavez PPI 26482 (K! [2 sheets], L! [2 sheets]); Balangiga, Barangay Guinmaayohan, imm. fr., May 1971, Madulid et al. PNH 118383 (L!); Biliran, Biliran Province, Mt Suiro, 530 m, ♂ fl., 30 April 1954, Sulit PNH 21575 (K!, L! [2 sheets], PNH!, US!); Leyte, Leyte Province, Abuyog-Silago inland road, 4 Nov. 2006, Fernando & Schori 1892 (BHO!); ibid, Fernando & Schori 1893 (A!); ibid, Fernando & Schori 1894 (PNH!); ibid, Fernando & Schori 1895 (A!, BHO!, BRI!, CAHUP!, LBC!, US!); ibid, imm. fr., Fernando & Schori 1896 (A!, BHO!, CAHUP!, K!, L!, MO!, PNH!); ibid, 26 293

Feb. 2008, Schori 2008-14 (BHO!, CAHUP!); Dinagat, Dinagat Province, Tubajon, Paragua Forest Reserve, 21 Feb. 2008, Schori 2008-8 (A!, BHO!, CAHUP!, PNH!). HABITAT. The species has been collected in lowland dipterocarp hill forest over limestone and ultramafic soils, up to 400 m elevation. PHENOLOGY. Flowers are recorded from April – May and may also be present from late July – September. ETYMOLOGY. The specific epithet honors Dr. Edwino S. Fernando, a palm taxonomist and one of the Philippines’ leading botanists. CONSERVATION STATUS. Vulnerable: VU B1ab(iii,iv,v). NOTES. Gomphandra fernandoi is closely related to G. luzoniensis (Merr.) Merr., as supported by molecular data and morphology. Both species have a characteristic inflorescence structure, with very similar flowers and fruits. However, the two species are easily distinguished by the dense pubescence on the underside of the leaves and on the twigs of Gomphandra fernandoi. Gomphandra luzoniensis is pubescent, but its pubescence is very short and appressed and is not easily visible on mature leaves and twigs. The two species do not overlap in distribution, as Gomphandra fernandoi is confined to the eastern Visayas, and G. luzoniensis is found in Taiwan, Luzon, Palawan, Mindoro, and Panay.

18. Gomphandra flavicarpa (Elmer) Merr. (1923: 490). Stemonurus flavicarpus Elmer (1915: 2691). Type: Philippines, Mindanao, Mt. Apo, Elmer 11330 (lectotype MO! (selected by Schori); isolectotypes A!, BM n.v., BO n.v., E!, F!, FI n.v., G n.v., GH!, K!, L!, NY!, P!, US!, WRSL n.v.).

Shrub to small tree 3 – 6 m high, 2 – 10 cm in diam., bark smooth, light brown to gray. Twigs slender, 1 – 2 mm in diam., sometimes swollen from galls, green or brownish when fresh, persistently pubescent with minute, appressed to somewhat spreading brown to gray hairs. Leaves firmly chartaceous to subcoriaceous or thinly coriaceous, medium green and matte to glossy above when fresh, often with epiphytes, paler green and dull 294

below, occasionally with corky galls along the veins below, usually obovate, sometimes oblong or rarely lanceolate, glabrous above, moderately pubescent with appressed hairs below, apex abruptly acute or shortly acuminate, base slightly rounded to acute, (7.5 – ) 8 – 14 ( – 16) × 2.5 – 4 ( – 6.5) cm; midrib impressed above, raised beneath, secondary veins (3 – ) 5 – 6 pairs, flat (impressed above when fresh), raised below, all but lowest usually clearly brochidodromous, tertiary veins flat or not visible above, raised and strongly to irregularly percurrent below; petiole 0.3 – 1.0 cm × 1 mm, narrowly grooved above, minutely pubescent. Inflorescences axillary or from the fallen leaf axils, typically short and condensed, pubescence minute, brown. Male inflorescences with peduncle 0.1 – 0.5 cm long, with 2 – 3 short branches, each bearing up to 6 flowers on pedicels 1 – 2 mm long, buds and flowers often at different stages of development and flowering over a long period. Male flowers: calyx cupular, minutely apiculate, sparsely pubescent, petals whitish, 4 – 5, glabrous, 3 – 5 mm long, stamens 4 or 5, exserted for 1.5 – 2 mm; filaments 6 – 7 mm long, glabrous or with a few hairs dorsally at the connective, with clavate hairs well below the anthers ventrally, ovary rudiment glabrous. Female inflorescences with peduncle to 0.7 cm long, bearing up to 4 flowers on pedicels 1 mm long, or occasionally branched, with up to 8 flowers. Female flowers: calyx cupular, minutely apiculate, sparsely pubescent, petals 4 – 5, whitish, glabrous, 3 – 4 mm long, staminodes 4 or 5, papillose, ovary glabrous, cylindrical, 2 – 3 mm long, capped by a stigma 1 mm across. Fruit glabrous, ovoid to ellipsoid, (0.9 – ) 1.3 – 1.6 × 0.5 – 0.6 cm, salmon to red when ripe, obovoid-fusiform yellow when submature, inner mesocarp with ca. 7 longitudinal ribs, stigma 1.5 – 2 mm in diam., apical or slightly displaced towards sulcus.

DISTRIBUTION. Philippines, Mindanao, Lake Lanao, Mt. Apo, Mt. Candoon, Mt. Kitanglad, may be locally common. Endemic to Mindanao. SPECIMENS EXAMINED. PHILIPPINES. Mindanao, Bukidnon Province, Sumilao, Barangay Lupiagan, Mt. Kitanglad, 8°11 5 N, 124°55’ E, 1450 m, 23 June 1998, Ingle & Baylomo 310 (F!); ibid, 1350 m, 10 March 1998, Ingle & Baylomo 475 (BH!, F!, GH!, K!, MO!); Intavas, Impasugong, Mt. Kitanglad, 22 July 1991, Gaerlan et 295 al. PPI 3406 (L!, PNH!, 4 other dups. n.v.); Mt. Kitanglad, 2200 m, imm. fr., 16 Mar. 1949, Sulit PNH 10065 (A!, L!, PNH!); Pigtaoranan, 3 April 1950, Añonuevo PNH 13511 (A!, L! [2 sheets], PNH!); Mt. Candoon, June – July 1920, Ramos & Edaño B. S. 38821 (A!, K!, L!, P!, US!); ibid, Ramos & Edaño B. S. 38864 (A!, K!, L!, P!, US!); Bukidnon, Tangkulan, June – July 1920, Ramos & Edaño B. S. 39074 (K!, US!); Davao del Sur Province, Mt. Apo, Todaya, 1220 m [4000 ft.], 28 March 1905, Williams 2582 (GH!, K!, NY! [2 sheets], US!); ibid, May 1909, Elmer 10527 (syntype of S. flavicarpus, BISH!, BM n.v., BO n.v., E!, FI n.v., G n.v., GH!, K!, L!, MO!, NY!, P!, PNH†, US!, WRSL n.v.); ibid, Mt. Colelan, Aug. 1909 Elmer 11330 (lectotype MO!, isolectotypes: A!, BM n.v., BO n.v., E!, F!, FI n.v., G n.v., GH!, K!, L!, NA! photo, NY!, P!, US!, WRSL n.v.); Lanao del Sur Province, Lake Lanao, Camp Keithly, Sept. – Oct. 1906, Clemens 713 (F!, US!); ibid, June 1907, Clemens 713 A (US! [3 sheets]); ibid, ♀ fl., June 1907, Clemens s.n. (NY!, P!, US!). Additional Specimens cited by Sleumer (1969), possibly destroyed at PNH: Warburg 14638; Alvarez F. B. 25247; Clemens 971. HABITAT. Montane to mossy forest, 700 – 2200 m. PHENOLOGY. Flowers may be present from July through November. Fruit take approximately one year to reach maturity. ETYMOLOGY. The specific epithet “flavicarpa” is a misnomer – the species was described from specimens with yellow immature fruit. The fruit are in fact salmon-orange to red when soft and ripe. VERNACULAR NAME(S). Mata-mate, maram-may (Bagobo), mantangali (Manobo). Also reported as “marumai-dilau” in Tagalog (Salvosa 1963), but probably erroneous as it does not grow in Tagalog-speaking regions. NOTES. Gomphandra flavicarpa is easily recognized by its obovate leaves and brochidodromous secondary veins. Its inflorescence structure is similar to Gomphandra cumingiana, but the fruits are glabrous. Although Gomphandra flavicarpa is common on some areas of Mt. Kitanglad, its flowers and fruit are still poorly known. It flowers as a small tree, and even young shoots from stumps will form flower buds.

296

19. Gomphandra fuliginea (Elmer) Merr. (1923: 490). Urandra fuliginea Elmer (1908: 491). Stemonurus fuligineus (sic fulgineus) (Elmer) R. A. Howard (1940: 468). Type: Philippines, Baguio, Elmer 8620 (lectotype US! (selected by Schori); isolectotypes: A!, BO n.v., E! photo, FI n.v., G n.v., K!, L!, NY!, WRSL n.v.).

Shrub or small tree to 11 m tall, 20 cm diam., twigs straight or slightly zigzag, 1.8 – 2.0 mm thick, velutinous with brown to grayish pubescence, somewhat glabrescent with age. Leaves thinly coriaceous, glabrous above, persistently velutinous below, lanceolate- elliptic, obovate-elliptic, oblanceolate or obovate, 6 – 12 ( – 14) × 2.5 – 5 cm, apex abruptly acute or shortly acuminate, base acute to attenuate, margins revolute; midrib impressed above, raised below, secondary veins 2 – 3 pairs, flat to slightly impressed above, raised below, steeply ascending, lower two pairs departing from the midrib in the proximal half of the blade; petiole 0.6 – 1 cm × 1.5 – 2 mm, pubescent. Inflorescences and flowers unknown. Infructescences axillary, often on older naked portions of twigs, bearing 1 – 2 fruit, peduncle 0.3 – 0.5 cm long, fruit sessile or on pedicels 1 – 4 mm long, axes pubescent, calyx cupular, apiculate or irregularly torn, 2 – 3 mm across, sparsely pubescent to glabrescent. Fruit evidently glabrous, (1.6 – ) 1.8 – 2.0 ( – 2.5) × 0.9 – 1.2 cm, ellipsoid to obovoid, slightly asymmetrical, base tapered, apex rounded to truncate, mostly submature, inner mesocarp with ca. 12 longitudinal ridges, stigma 2 – 3 mm in diam., eccentric, with a deep grove on the side toward the sulcus.

DISTRIBUTION. Philippines, Luzon, Benguet Province, Baguio; Nueva Vizcaya Province, Caraballo Mountains. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Benguet Province, Baguio, 13 July 1904, Williams 1270 (NY! [2 sheets], US!); ibid, March 1907, Elmer 8620 (lectotype US!; isolectotypes: A!, BO n.v., E! photo, FI n.v., G n.v., K!, L!, NY!, WRSL n.v.); Nueva Vizcaya Province, Caraballo Mts., fr., March 1915, Loher 13660 (UC!). 297

HABITAT. Elmer provided no notes on specific locality or habitat in his original description. Baguio had mossy forest on steep slopes and high elevation dipterocarp forest at 1400 – 1700 m. ETYMOLOGY. The epithet fuliginea refers to the sooty color of the pubescence. VERNACULAR NAME(S). Dan(g)ka in Igorot. NOTES. Gomphandra fuliginea is only known from three collections. Appropriate habitat is probably not present in Baguio at this point, as the area has been heavily developed, and the remaining cloud forest is fragmentary. Mountain tops that had intact forest in the late 1990s have largely been cut and burned to clear areas for growing vegetables. Unless a population survives in Nueva Vizcaya Province, the species is probably extinct.

20. Gomphandra halconensis Schori (Blumea). Type: Philippines, Mindoro, Oriental Mindoro Province, Mt. Halcon area near Paitan, Dulangan River, Ramayan village, c. 13 12’ N, 121 12’ E, 8 May 1986, Ridsdale, Coode & Reynoso 1702 (holotype K!; isotypes A!, L!, LBC!, PNH non inveni).

Small tree to 8 m tall, 20 cm in diam.; outer bark smooth, brown and greenish, sometimes with short vertical lines of lenticels, inner layer of outer bark green, inner bark cream. Twigs slender, slightly zigzag, 2.0 – 2.5 mm in diam., initially pubescent with minute reddish hairs, quickly glabrescent. Leaves coriaceous, glabrous above and glabrescent below, dark green when fresh, when dried pale yellowish brown, lanceolate-elliptic to ovate, mostly oblanceolate-elliptic, 5.5 – 9.0 × 2.0 – 3.5 cm, apex acuminate to caudate with an acumen ca. 7 mm long, base acute, margins revolute; midrib slightly impressed above, raised below, extending to tip, sometimes almost mucronate, secondary veins 4 – 8 pairs, flat or not evident above, scarcely evident below, joining near margin, intersecondaries common, tertiary veins not evident on mature leaves; petiole grooved, 0.9 – 1.5 cm × 1.1 – 1.5 mm, glabrescent. Inflorescences and flowers unknown, probably borne on new flushes of growth. Infructescences with 2 – 5 fruits in a very reduced cyme, 298

axillary, on previous season’s growth, peduncle 1 – 2 cm long, pedicels 1.5 – 5 mm long, glabrescent. Fruit globose, slightly asymmetrical, yellow-cream to yellowish-orange, glabrous, 1.0 – 1.3 × 0.8 – 0.9 cm; calyx cupular, 2.0 – 2.5 mm in diam.; inner mesocarp with ca. 12 faint ribs, stigma discoid, ca. 2 mm in diam., eccentric.

DISTRIBUTION. Philippines, Mindoro, Mt. Halcon. Endemic. SPECIMENS EXAMINED. PHILIPPINES. Mindoro, Oriental Mindoro Province, Mt. Halcon area near Paitan, Dulangan River, Ramayan village, c. 13 12’ N, 121 12’ E, 8 May 1986, Ridsdale, Coode & Reynoso 1702 (holotype K!; isotypes A!, L!, LBC!, PNH non inveni); Ramayan to Mustning, Mt. Halcon complex above Paitan on Dulangan River, 10 May 1986, Coode & Ridsdale 5757 (K!, L!). HABITAT. On a ridge at 1200 m, in a forest dominated by gymnosperms and Tristania, on gravel/sand, possibly from a quartz base, and from cloud forest at 1350 m. Leaf galls are present on A and K specimens. According to the Mangyan man who collected the specimen for Ridsdale, “bees” pollinated the flowers and birds ate the fruit. Fruit doves or hornbills might be able to swallow the fruit whole, but other birds would be limited to consuming the thin outer mesocarp. CONSERVATION STATUS. Critically Endangered: CR2ab(iii). NOTES. Gomphandra halconensis is known from two fruiting collections from Mt. Halcon. Mt. Halcon is under ancestral lands jurisdiction and has been closed to visitors. According to the Mangyan man who collected Ridsdale’s specimen, only one tree was present in Ramayan village, and the tree has since been cut. Apparently much of the forest on Mt. Halcon has been cut for charcoal production and slash-and-burn agriculture (kaingin), but perhaps this species can still be found on the mountain’s slopes. The Mangyan have no common name for Gomphandra halconensis. This species resembles Gomphandra oligantha, but it differs in its coriaceous leaves with a revolute margin, obscure venation, longer petioles, and shorter acumen, and in its axillary infructescence with a thick, shorter peduncle and globose fruit. 299

21. Gomphandra lancifolia Merr. (1921b: 277). Type: Philippines, Tayabas [Aurora] Province, Dingalan, Mt. Dingalan, ca. 200 m, Aug. – Sept. 1916, Ramos & Edaño B. S. 26544 (lectotype US! (selected by Schori); isolectotypes A!, K!, L!, P!).

Small tree to 6 m. Twigs slender, straight, 1.5 – 2.5 mm in diam., initially sparsely pubescent with minute appressed hairs, glabrescent with age, terminal bud falcate, pubescent. Leaves lanceolate, chartaceous to subcoriaceous, 7 – 10.5 × 1.5 – 2.8 cm, base attenuate, often slightly asymmetrical, apex acuminate to caudate, margin slightly revolute; midrib impressed above, raised below, secondary veins 3 ( – 4) pairs, flat above, slightly raised below, lower pairs steeply ascending, converging towards margin, tertiary veins generally not visible above, obscure to slightly raised below; petioles 0.5 – 0.7 ( – 1) cm × 1.5 mm. Inflorescences and flowers unknown. Infructescences axillary, drupes 1 or 2 ( – 3+?) per infructescence, peduncle 0.4 – 1.1 cm long, solitary or bearing 2 – 3 pedicels, pedicels to 0.6 cm long. Fruit subtended by the entire to slightly lobed calyx, 2 mm across, dried fruit glabrous, obovoid with an attenuate base, the very base swollen, exocarp salmon-colored (fide Ramos & Edaño B. S. 26544, but fruit submature), 2.5 – 3 × 1 cm, the inner mesocarp with ca. 11 low longitudinal ridges, stigma terminal, 3 mm across.

DISTRIBUTION. Philippines, Luzon, Aurora Province, Mt. Dingalan. SPECIMEN EXAMINED. PHILIPPINES. Tayabas [Aurora] Province, Dingalan, Mt. Dingalan, ca. 200 m, fr., Aug. – Sept. 1916, Ramos & Edaño B. S. 26544 (lectotype US! (selected by Schori); isolectotypes A!, K!, L!, P!). HABITAT. East coast of Luzon, dry forested slopes of Mt. Dingalan, c. 300 m. VERNACULAR NAME(S). Paranuyog (Negrito). NOTES. Gomphandra lancifolia is only known from one collection. The habitat information and fruit color are from Merrill’s original description. Sleumer (1969) speculated that this species might be a narrow-leaved form of Gomphandra luzoniensis. Given the substantial differences in infructescence structure, position, and fruit shape, 300

this seems quite doubtful. It is unlikely that additional specimens will be collected, as the Sierra Madre mountains have been extensively logged and much former potential habitat is now grasslands. The type locale, Mt. Dingalan, was logged in the 1990s, and though it is possible that the species is still present somewhere in the Sierra Madres, it is more likely that it is extinct. The local name was reported as “paranuyog” in Negrito, but none of the foresters in Dingalan recognized this name in 2007.

22. Gomphandra luzoniensis (Merr.) Merr. (1923: 490) subsp. luzoniensis Urandra luzoniensis Merr. (1908: 242). Stemonurus luzoniensis (Merr.) R. A. Howard (1940: 468). Type: Philippines, Luzon, Bataan Province, Mt. Mariveles, Lamao River, buds, May 1904, Borden F. B. 711 (lectotype US! (selected by Schori); isolectotypes BRI!, K!, L!, MO!, NY!). Elaeocarpus integrifolius Blanco (1845: 306), non Lamarck 1788.

Medium tree to 30 m high and 60 cm diam. Bole straight, base with very low or no buttresses, branches crowded at top. Bark smooth, light gray-brown, with prominent wide leaf/branch scars and lenticels. Young twigs green, minutely pubescent, somewhat zigzag, 2 – 3.5 mm in diam., terminal bud scalpel-shaped, tawny or pale reddish-brown. Leaves firmly chartaceous to thinly coriaceous in northern specimens, often conduplicate when pressed, glabrescent, elliptic to obovate, larger on young plants, (5.5 – ) 9 – 14.5 ( – 17) × (2.5 – ) 3.5 – 7.5 ( – 8.5) cm, base attenuate and slightly decurrent on the petiole, apex often deformed (and then usually rounded), normally acute to shortly acuminate, very tip usually blunt, dark green and a bit glossy above, paler green below; midrib impressed above, raised below, secondary veins 4 – 6 pairs, flat to slightly raised above, raised below, widely spaced and converging toward the margin, upper pairs usually brochidodromous, tertiary veins flat to slightly raised above, raised below, reticulation pattern not clearly defined; petiole grooved, 0.7 – 1.3 ( – 2) cm long, sometimes flattened on young trees but round in cross-section on older growth. Leaf tear with abundant webby protoxylem from primary and secondary veins. Inflorescences terminal, 301 occasionally appearing axillary when terminating short lateral branches, axes minutely pubescent with appressed hairs. Male inflorescences with common peduncle 2 – 3 ( – 3.5) cm long before bearing up to 4 primary branches, branches (0.4 – ) 1 – 1.5 ( – 2) cm long, each with up to 4 ( – 5) secondary branches (lacking in depauperate specimens), these usually 0.5 cm long, sometimes very shortly branched again to form a scorpioid cyme with up to 15 flowers that are sessile or on 1 – 2 mm long pedicels, robust plants with often more than 100 flowers per inflorescence, overall inflorescence commonly 5 – 6 cm long and equally wide. Male flowers: calyx minutely 5-toothed, sometimes tearing irregularly, 2 mm wide, glabrous, petals 4 – 5, glabrous, white or yellowish-green, 4 – 5 ( – 6) mm long, stamens 4 – 5, strongly exserted and recurved, 5 – 7 mm long, bearing a tuft of clavate hairs dorsally at the connective and pubescent ventrally below the anthers, ovary rudiment minute, glabrous. Female inflorescences with many fewer flowers than male, common peduncle to 1.5 cm, bearing up to 4 ( – 5) secondary branches 0.3 – 0.5 cm long, generally not branched further, bearing several flowers on pedicels to 4 mm long, fewer than 20 flowers per inflorescence. Female flowers: calyx glabrous, 2 – 3 mm across, minutely toothed, petals glabrous, 4 mm long, staminodes exserted, 5 mm long, less pubescent than stamens, ovary glabrous, 4 mm long, capped by the ridged stigma, 1.5 – 2 mm wide. Infructescences axillary or leaf-opposed at maturity, peduncle stout, 1 – 3 cm, bearing up to 4 branches up to 1 ( – 2) cm long, these sometimes branched again but usually with several short pedicels, fruit several. Fruit ellipsoid to obovoid, (1.8 – ) 2 – 2.4 ( – 2.7) × 1 – 1.2 cm, pink or salmon when ripe, yellow when immature, inner mesocarp with ca. 15 low, anastomosing ridges, stigma ridged, eccentric, displaced towards sulcus, 3.5 – 4.0 mm in diam. DISTRIBUTION. Philippines – Luzon, Mindoro, Palawan, Panay. SPECIMENS EXAMINED. PHILIPPINES. No locality, fr., Vidal’s Flora Forestal series No. 308 (L!). Luzon. Cagayan Province. No specific locality, May 1907, Klemme F. B. 7077 (syntype of Urandra luzoniensis, PNH†, US!); F. B. 23694 (SING n.v.); no specific locality, ♂ buds, July – Aug. 1915, Barros F. B. 24207 (US!); Camiguin Island, Calayan, Barangay Naguillan, Sitio Sisip, 18°55.7’ N, 121°54.8’ E, ♂ buds, 12 Mar. 1996, Fuentes & Fernando PPI 37141 (MO!, PNH!); Calayan Island, Barangay 302

Cabudadan Centro 2, 19°19.2’ N, 121°28.0’ E, 300 m, imm. fr., 9 Feb. 1997, Fuentes & de la Rosa PPI 38886 (GH!, L!, MO!, PNH!); Ilocos Norte Province. Burgos [Ilocos Sur Province?], imm. fr., March 1917, Merrill Sp. Bl. 671 (A!, K!, L!, MO!, NY!, US!); Mt. Quebrada, fr., Feb. – March 1953, Edaño PNH 17823 (CANB!, K!, L! [2 sheets], PNH!, US!); ibid, fr., Feb. – March 1953, Edaño PNH 17851 (A!, K!, L!); Pagudpod, Barangay Dampig, Mt. Pico de Loro, 450 m, imm. fr., 6 Feb. 1997, Garcia & Fernando PPI 25129 (A!, K!, L!, MO!, NY!, PNH!); Ilocos Sur Province. No specific locality, fr., Jan. 1915, Paraiso F. B. 23606 (US!); Abra Province. Bugas, ♀ buds, fr., 26 March 1924, Paraiso F. B. 29755 (BRI!, UC!); La Union Province. No specific locality, fr., Jan. 1912, Paraiso F. B. 22616 (K!, US!); Zambales Province. Mt. Pinatubo, 350 m, Oct. 1948, Balintay PNH 5608 (MICH!, PNH!); Nueva Ecija Province. Bongabon, ♀ fl., fr., Vidal 1332 (A!, K! [2 sheets]); no specific locality, fr., April 1918, Villavicencio F. B. 27203 (BRI!); Bataan Province. Lamao, fr., Borden s.n. (UC! [2 sheets]); Barnes F. B. 562 (syntype of Urandra luzoniensis, PNH†); Barnes F. B. 574 (syntype of Urandra luzoniensis, PNH†); Mt. Mariveles, Lamao River, buds, May 1904, Borden F. B. 711 (♂ fl., lectotype of Urandra luzoniensis, PNH† (selected by Sleumer 1969), new lectotype US! (selected by Schori); isolectotypes BRI!, K!, L!, MO!, NY!); Borden F. B. 1199 (BM! photo); ibid, buds, Sept. – Dec. 1904, Borden F. B. 1926 (syntype of Urandra luzoniensis BO, NY!, PNH†, US!); ibid, fr., March 1905, Borden F. B. 2949 (fr., syntype of Urandra luzoniensis, BO, L!, PNH†, SING, UC, US!); Mt. Mariveles, 200 m, fr., 24 Jan. 1992, Reynoso et al. PPI 3985 (CAHUP!, K!, L!, MO!, PNH!, US!); Tawawa, Mt. Natib, 14°42’ N, 120°24’ E, buds, 31 March 1995, Reynoso et al. PPI 17189 (L!, PNH!); Bagac, Barangay Banawang, Sitio Ulingan, Mt. Natib, 14°42.8’ N, 120°24.0’ E, 500 m, imm. fr., 12 Dec. 1996, Fuentes & de la Rosa PPI 38726 (K!, L!, PNH!, US!, 7 other dups. n.v.); Bulacan Province. Norzagaray, Barangay San Lorenzo, 14°51’3” N, 121°10’1” E, imm. fr., 17 Dec. 1994, Garcia et al. PPI 15235 (L!, PNH!, 8 other dups. n.v.); Rizal Province. No specific locality, fr., Jan. – March 1905, Ahern’s collector F. B. 2445 (fr., syntype of Urandra luzoniensis, BO, L!, MO!, NY!, PNH†, SING, US!); Bosoboso, fr., June 1903, Merrill 2669 (syntype of Urandra luzoniensis, BM, K, PNH†, US! [2 sheets]); no specific locality, fr., April 1905, Ahern’s collector F. B. 2989 303

(syntype of Urandra luzoniensis, BO, K, MO!, NY!, PNH†, US!); Bosoboso, buds, Vidal 3329 (A!); Montalban, imm. Fr., Dec. 1905, Loher 5754 (K!); ibid, fr., Oct. 1909, Loher 12318 (UC!); ibid, fr., May 1909, Loher 12526 (A!); ibid, buds, May 1909, Loher 12567 (A!, P!, UC!); ibid, fr., May 1915, Loher 13310 (BO n.v., TAIF! photo, UC!); no specific locality, fr., April – July 1916, Maneja F. B. 25973 (A!, BO n.v., P!); Cavite Province. Pico de Loro, Mt. Palay-palay, Ternate, 14°42’ N, 120°38’ E, imm. fr., 28 Mar. 1995, Reynoso et al. PPI 17155 (A!, K!, L!, MO!, PNH!); no specific locality, fr., April – May 1915, Ramos & Deroy B. S. 22566 (A!, K!, P!, US!); no specific locality, fr., May 1915, Ramos B. S. 28068 (GH!); Laguna Province. Los Baños, Mt. Makiling, fr., 4 Jan. 1972, Palisoc s.n. (MO!); ibid, ♂ fl., 22 April 1963, Figarola 236 (PNH!); ibid, 26 Aug. 1962, Lagrimas FPRI 570 (PNH!, PUH!); ibid, fr., 27 Aug. 1970, Hernaez 1934 (CAHUP!); ibid, buds, 28 March 1955, no collector, LBC 2787 (LBC! [3 sheets]); ibid, 115 m, buds, 23 April 1959, Canicosa 3477 (LBC!); ibid, fr., 2 Aug. 1979, Hernaez 3555 (CAHUP! [2 sheets]); ibid, 115 m, fr., 20 Jan. 1962, Seril 3892 (LBC! [2 sheets]); ibid, 115 m, buds, 23 April 1963, Figarela LBC 4382 (LBC!); ibid, 132 m, fr., 19 Dec. 1972, Barbon 5937 (LBC!); ibid, 150 m, ♂ fl., 12 May 1947, Sulit PNH 6966 (A!, PNH!); ibid, 120 m, ♂ fl., 10 Mar. 1949, Tadena 9544 (A!, BRI!, L! [2 sheets], LBC!, PNH! [2 sheets], UC!); ibid, fr., June – July 1917, Elmer 17801 (MO!); ibid, fr., June – July 1917, Elmer 17971 (MO!); ibid, fr., June – July 1917, Elmer 18452 (MO!); ibid, 300 m, fr., 5 March 1914, Gates & Villamil B. S. 20903 (CAHUP!); ibid, fr., Oct. 1914, Calacosa F. B. 22960 (P!); ibid, 400 m, buds, 15 April 1962, Orlido 27807 (CAHUP!); ibid, ♂ buds, 8 Feb. 1955, Bañaga PNH 33390 (L!, PNH!, US!); ibid, ♂ buds, 6 Feb. 1955, Forestry Student PNH 33439 (K!, L!, PNH! [2 sheets], US!); ibid, 200 m, buds, Jan. 1955, Reyes PNH 34152 (PNH!); ibid, buds, 4 May 1964, Hernaez 39939 (CAHUP!); ibid, 200 m, buds, 3 March 1955, Abuano PNH 40316 (PNH!); ibid, 150 m, ♂ fl., 15 March 1955, Rendorio PNH 40332 (L!, PNH!); ibid, 110 m, fr., 4 Jan. 1972, Palisoc PNH 121603 (L! [2 sheets], PNH!); Mindoro, Oriental Mindoro Province, Merritt F. B. 6214 (syntype of Urandra luzoniensis, PNH†); Mansalay, Mt. Yagaw, 400 m, buds, 11 March 1953, Conklin PNH 17411 (A!, L!, MICH!, PNH!); ibid, 400 m, 1 Nov. 1953, Conklin PNH 19052 (L!); ibid, 850 m, 31 March 1958, Conklin PNH 37894 (A!, L!); Paluan, ♀ buds, fr., April 1921, 304

Ramos B. S. 39502 (A!, L!, SING n.v.); B. S. 39771 (A n.v., SING n.v.); Panay, Aklan Province, Nabas, Barangay Libertad, Libertad Cave, 11 March 2008, Schori 2008-16 (CAHUP!). Iloilo Province, Miagao, ♂ buds, Vidal 3148 (A!, K!); Palawan, Puerto Princesa, Irawan River valley, 150 m, ♀ buds, fr., 15 March 1984, Ridsdale SMHI 65 (A!, BRI!, CAHUP!, CANB!, K!, L!, UC!); Puerto Princesa, Irawan River valley, Mt. Beaufort, 150 m, ♂ fl., 30 Mar. 1984, Ridsdale SMHI 300 (A!, K!, L!); Taytay, Lake Manguao (Danao), 50 m, ♂ fl., 4 April 1984, Ridsdale SMHI 310 (A!, BRI! [2 sheets], CAHUP!, CANB!, K!, L! [2 sheets], UC!); ibid, 50 – 90 m, ♂ fl., 6 April 1984, Ridsdale SMHI 335 (A!, CANB!, K!, L! [2 sheets]); St. Paul’s Bay, 220 m, ♂ fl., Podzorski SMHI 2027 (A!, BRI!, CANB!, K!, L! [2 sheets], UC!); Puerto Princes, Irawan, Impapai, 9°50’ N, 118°38’ E, 300 m, 15 March 1990, Soejarto & Madulid 6786 (A!, PNH!); Puerto Princesa, Tacduan Zigzag, 9°50’ N, 118°38’ E, ♀ fl., fr., 17 March 1990, Soejarto et al. 6843 (A!, F!, K!, L!, MO!, PNH!, UC!, US!); Puerto Princesa, Irawan, Impapai, 9°50’ N, 118°38’ E, 300 m, buds, 19 March 1990, Soejarto et al. 6861 (A!, F! [2 sheets], L!, US!); ibid, 300 m, 19 March 1990, Soejarto et al. 6863 (A! [2 sheets], PNH!, US!); ibid, 300 m, 19 March 1990, Soejarto et al. 6882 (A!, PNH!); ibid, 9°50’ N, 118°13’ E, 300 m, 21 March 1990, Soejarto et al. 6940 (A!, PNH!); ibid, 21 March 1990, Soejarto et al. 6945 (PNH!, US!); ibid, 300 m, 21 March 1990, Soejarto et al. 6947 (A!, PNH!); ibid, 9°50’ N, 118°38’ E, 300 m, 22 March 1990, Soejarto et al. 6979 (PNH!); ibid, 350 – 400 m, ♂ fl., 22 March 1990, Soejarto et al. 7016 (F! [2 sheets]); ibid, 350 m, 27 Feb. 1992, Soejarto 7573 (F!, PNH!); ibid, 350 m, imm. fr., 27 Feb. 1992, Soejarto 7577 (PNH! [2 sheets]); ibid, 300 m, 26 June 1992, Soejarto & Fernando 7747 (PNH!); Narra, Calatigas Range, 100 – 250 m, buds, 8 March 1995, Soejarto et al. 8948 (A!, F!, US!); Puerto Princesa, Irawan River valley, Mt. Beaufort, 9°0’ N, 118°40’ E, 200 m, ♀ buds, fr., 28 March 1995, Soejarto et al. 9149 (A!, L!, F!, US!); Puerto Princesa, Mt. Pulgar, ♂ fl., April 1911, Elmer 13110 (A!, BISH!, F!, GH!, K!, L!, MO!, NY!, P!, US! [2 sheets]). Cultivated. United States, Hawaii, National Tropical Botanical Garden, ♀ buds, fruit, 17 April 1990, Flynn 3854 (BH!, BISH! photo). HABITAT. Lowland dipterocarp forest or beach forest; on lateritic soil, limestone, ultramafic soil, or sand, 0 – 850 m. 305

PHENOLOGY. Flowers reported from November to May. Fruit take approximately one year to ripen and so may be present during all months. Seed production and germination appear to be high, but seedling mortality is high as well. On Mt. Makiling, young seedlings and empty endocarps were present in October (2006). Germination was through the apical portion of the fruit, splitting open the mesocarp through the stigma. Cotyledons were large and bluntly cordate, with palmate venation. VERNACULAR NAME(S). Mabunot (Tagalog, Mt. Makiling, Laguna Prov.), bitlag*, manankalau (Tagalog); anggaga-i (Mt. Pinatubo, Zambales Prov.), pan-ao (Rizal Prov., now extirpated), birlag (Tagalog, probably Rizal Prov.*); bayu-ubud (Hanonoo, Mindoro), buladlad (Mangyan, Mindoro); bibslakin, imus, rogrogso, arasaas (Ilocano, Dolores, Abra Prov.); maratuba (Ibanag), tambang (Miagao, Iloilo Prov., Panay). *Blanco (1845) gave “birlag” as a common name for Elaeocarpus integrifolius, the type of which was presumed destroyed, and which Merrill treated as a synonym of Gomphandra luzoniensis. Blanco was based in Rizal Province, so it is likely that the name “birlag” came from north of Laguna de Bay. Bitlag is probably an incorrect transcription of birlag. USES. Previously used for wooden shoes (Mt. Makiling); house construction; dried fruits currently used in beaded curtains and decorations (Palawan). NOTES. Gomphandra luzoniensis subsp. luzoniensis can be recognized by its usually obovate leaves that are attenuate at the base with 4 – 5 pairs of veins, and by its abundant flowers and fruits. It is one of the most widespread species in the Philippines, and not surprisingly, certain characters (leaf size, shape, and flower number), show a range of variation. Two recently described species, Gomphandra fernandoi Schori & Utteridge and G. ultramafiterrestris Schori, are quite closely related to G. luzoniensis subsp. luzoniensis, based both on morphological and molecular evidence. However, both species have fixed morphological differences and are found outside the known distribution of Gomphandra luzoniensis subsp. luzoniensis, so they have been recognized as distinct species. Within Gomphandra luzoniensis subsp. luzoniensis, collections are widely separated geographically and it is doubtful the species had a continuous distribution through the upper part of Luzon in modern times. Isolated populations are slowly 306 developing differences, but for most of the species’ range, it is more useful to describe trends in morphology than to formally recognize the variation, as intermediates can be found. The species was described from what is now the metropolitan Manila area, and for comparisons the specimens from Bataan and Mt. Makiling are considered “typical.” Plants from Palawan tend to have larger leaves, while plants from northern Luzon show a tendency toward smaller, rounder leaves. Collections from the Batanes Islands and Lanyu Island are treated here as a separate subspecies, Gomphandra luzoniensis subsp. septentrionalis, based on their rounded coriaceous leaves, fewer veins, and thick twigs. Collections from Cagayan and Ilocos Norte Provinces approach the morphology of Gomphandra luzoniensis subsp. septentrionalis, and discriminant analysis showed that a single tree can simultaneously have leaves that match both subspecies. This condition is not so unusual at the geographic boundary between the subspecies, but here those collections are treated as belonging to subsp. luzoniensis.

24. Gomphandra luzoniensis (Merr.) Merr. subsp. septentrionalis Schori (Kew Bulletin). Type: Taiwan, Taitung County, Lanyu Island, Lanyu Township, Yehyo Village, on the way to Hsiaotienchi Pond, 120 m alt., 27 Apr. 1997, Yang, Cheng, Hsu, & Yen 8250 (holotype TNM! photo [herb. no. S42996]; isotypes IBSC, MO!, PE, TAIF! photo, TNM! photo [herb. no. S42995], TNS, Department of Education, Ryukyu University).

Small tree, 6 – 10 ( – 15) m tall (Lanyu Island). Bark light gray. Twigs green, initially covered with minute appressed gray pubescence, glabrescent with age, 2 – 3.5 mm thick, older twigs thicker than those of Gomphandra luzoniensis subsp. luzoniensis. Leaves coriaceous, often erect and laxly involute in living specimens, orbicular to broadly ovate- elliptic, apex rounded to very shortly and abruptly acute, base rounded to obtuse, glabrous or with a few sparse hairs along the veins below, (4.5 – ) 6 – 9.5 × (3 – ) 5.5 – 7 cm, margin revolute; midrib flat to sunken above, raised below, midrib and secondary veins often lighter than the lamina and yellowish-green, secondary veins (1 – ) 3 – 4 307

pairs, flat to impressed above, raised below, lower pairs often somewhat crowded at leaf base, tertiary veins scarcely evident, weakly percurrent; petiole grooved, sparsely pubescent to glabrescent, 0.5 – 1 cm long. Inflorescences terminal on sympodial branches, with very short, appressed grayish pubescence. Male inflorescences with peduncle to 4 cm long, bearing 3 – 5 branches, these to 1.5 cm long, often bearing up to 3 branches of somewhat scorpioid cymes, or the branches dividing again (4, rarely 5 degrees of branching within the inflorescence), flowers sessile to on pedicels 3 mm long, inflorescence as a whole to 8 cm long, often with 70 or more flowers. Male flowers: calyx cupular, minutely apiculate, essentially glabrous, 1 – 2 mm across, petals 4 – 5, yellowish, 3 – 4 mm long, lobes free but corolla not splitting, stamens 4 – 5, white, strongly exserted, 4 – 5 mm long, somewhat reflexed, pubescent dorsally and ventrally with spreading hairs, ovary rudiment minute, glabrous. Female inflorescences with peduncle 1 – 2 cm long, bearing 3 – 4 branches, each branch somewhat irregularly rebranched into a cyme or bearing flowers on long pedicels, flowers subsessile or on pedicels to 6 mm long; inflorescence as a whole to 4 cm long with up to ca. 20 flowers. Female flowers: calyx cupular, minutely apiculate, green, essentially glabrous, 2 – 2.5 mm across, petals 4 – 5, yellowish, glabrous, 4 mm long, corolla sometimes split to base on one side, staminodes 4 – 5, white, exserted or 1 – 2 strongly reflexed, 5 mm long, bearing a tuft of clavate hairs at the connective and with scattered clavate hairs dorsally below the anther cells, ovary cylindrical, glabrous, bright green, 3 mm long, stigma yellowish, 4-5-lobed, 1 – 1.5 mm across. Fruit ellipsoid, glabrous, orangish to pinkish- beige, 1.5 – 2.1 × 0.9 cm, inner mesocarp with ca. 10 strong longitudinal ridges, stigma 4 mm across, ridged or with a slit on the side facing the sulcus.

DISTRIBUTION. Lanyu Island (Taiwan) and Batan Island (Philippines), also reported from Lu Tao Island (Flora of Taiwan), but no specimens seen. SPECIMENS EXAMINED. TAIWAN. Taitung County, Lanyu Is., Irunomirukusya [Tungching], 3 June 1947, Yamamoto s.n. (TAI! photo); no specified locality, ♀ buds, fr., 6 Apr. 1977, Chang 803 [13156] (L!); along the round-island road from the RadWaste Administration’s nuclear waste depository to Helmet Rock, on exposed road bank, 22° 308

01’ N, 121° 35’ 10” E, 5-30 m elev., ♂ buds, 28 Feb. 1993, Ho et al. 1115 (A!, HAST); no specified locality, 1 Apr. 1974, Ou et al. 2415 (TAI! photo); no specified locality, 200 m, 5 Apr. 2002, Lu 3932 (TAIF! photo); Hsiaotienchih, 180 m, fl., 28 Apr. 1997, Chiu & Chen 4093 (TAIF! photo); no specified locality, 150 – 350 m, fl., 20 July 2003, Lu 6279 (TAIF! photo); Lanyu Township, Yehyo Village, on the way to Hsiaotienchi Pond, 150 m, 27 Apr. 1997, Yang, Cheng, Hsu, & Yen 8246 (TNM! photo); ibid, 120 m alt., ♀ fl., fr., 27 Apr. 1997, Yang, Cheng, Hsu, & Yen 8250 (holotype TNM! photo [herb. no. S42996]; isotypes IBSC, MO!, PE, TAIF! photo, TNM! photo [herb. no. S42995], TNS, Department of Education, Ryukyu University); Tungching Village, Lungmen Bridge, forest margin, 20 m, ♀ buds, fr., 20 Jan. 1998, Yang, Hsu, & Wang 10016 (TAIF! photo, TNM! photo); Langtao, Pond Hsiaotienchih, in forests, 180 m, 25 Mar. 1998, Yang & Wang 10141, 10142 (TNM! photo); Taitung County, Tentsu [Tienchih], on the coast, fr., 17 Feb. 1986, Huang et al. 10514 (A!, L! [2 sheets], MO! [2 sheets], TAI! photo [2 sheets]); no specified locality, fr., 30 Jan. 1978, Chang 11636 [13161] (L!); no specified locality, buds, 1 May 1963, Chang 13158 (L!); Yehyo Village, on the way to Hsiaotienchi Pond, trailside, forest margin, 160 m, 24 May 2000, Yang, Chiang & Hsiao13178 (TNM! photo); Wangnanchiau, Tengchi, 20 – 350 m, fr., 12 Nov. 1982, Tateishi et al. 15231 (A!); no specified locality, 22°03’ N, 121°31’ E, imm. fr., 22 Oct. 1985, Lu 17547 (TAIF! photo); no specified locality, [22° 05’ 07” N, 121° 36’ 12” E], fr., 21 Feb. 1986, Lu 18409 (CANB!, TAIF! photo [2 sheets]). PHILIPPINES. Batanes Province, Batan Is., Valugan, SE slope of Iraya near forestry nursery, 20° 28.1’ N, 122° 00.6’ E, 20 m, ♂ buds, 8 May 1996, Madulid et al. PPI 26038 (11 duplicates); Mt. Iraya, in forest slopes, 425 m [1400 ft.], ♂ fl., 29 Apr. 1930, Ramos B. S. 79973 (BH!, MICH!, NY!); Mt. Matarim, in forest slopes, 305 m [1000 ft.], imm. fr., fr., 19 June 1930, Ramos B. S. 80423 (MICH!, NY!); Mt. Matarim, in forest slopes, 335 m [1100 ft.], imm. fr., July 22, 1930, Ramos B. S. 80643 (MICH!, NY!). HABITAT. This subspecies is found in short forests, in coastal forests, at forest margins and in exposed locations. On Lanyu it occurs at elevations up to 180 m, while on Batan it can grow at an elevation of 425 m. PHENOLOGY. Flowers and ripe fruit may be present from March through July. 309

VERNACULAR NAME(S). 吕宋毛蕊木 (lü song mao rui [rei] mu; Luzon furry- flowered bush); gala (Yami, Lanyu; Cheng & Lu 2000). CONSERVATION STATUS. Vulnerable: VU A2c. NOTES. Gomphandra luzoniensis subsp. septentrionalis differs from subsp. luzoniensis by its thicker twigs, rounded coriaceous leaves, and fewer veins. Batan and Lanyu Island are geographically isolated and are closer to each other than either one is to Luzon, so subsp. septentrionalis is restricted based on its distribution. Environmental conditions may influence the morphology of the northern plants, which probably became isolated at the end of the last ice age when sea levels rose and the land connection between Taiwan and the Philippines disappeared. On Lanyu Island, this subspecies is very common and can be found scattered in the forests and at forest edges. Trees bloom on a regular basis, and flowers and fruits can be found in the spring and summer. No living individuals have been found on Lu Tao Island in recent years, and much of the forest on the island has been destroyed (Aleck Yang, pers. comm.). The original record from Lu Tao has not been confirmed, but if Gomphandra luzoniensis subsp. septentrionalis grew on the island at one time, it has since been extirpated. The first collection from Lanyu Island was made in 1947, but the specimen was identified as Gonocaryum diospyrosifolia Hayata, so no species of Gomphandra was included in the first edition of Flora of Taiwan. Gomphandra was also not listed in Li’s (1963) Woody Flora of Taiwan, but G. luzoniensis was included in the second edition of Flora of Taiwan. 310

24. Gomphandra mappioides Valeton (1886: 227). Type: Sumba, Teysmann 6711 (lectotype L! (selected by Sleumer 1969); isolectotypes A!, BO n.v.). Stemonurus apoensis Elmer (1915: 2690). Gomphandra apoensis (Elmer) Merr. (1923: 490). Type: Philippines, Mindanao, Elmer 10658 (lectotype A!, (selected by Schori); isolectotypes BM n.v., BO n.v., E! photo, F!, FI n.v., G n.v., GH!, K!, L!, MO!, NY!, P!, WRSL n.v.). Gomphandra sorsogonensis Elmer (1939: 3748), nom. inval. Urandra leytensis Elmer ined.

Small to mid-sized tree to 15 – 20 m high and 45 cm in diam., bole straight, cylindrical, bark smooth with horizontal lenticels, light tan-gray, becoming lightly fissured when older. Twigs slightly zigzag, terete, 1.5 – 2.5 mm thick, often green when young, grayish when older, moderately pubescent with minute appressed hairs at the tips, quickly glabrescent. Terminal buds falcate, with light gray, blackish, yellowish-brown or colorless hairs, often appearing cinereous in dried specimens. Leaves medium green and a bit glossy above, paler and glossy below when fresh, chartaceous, often conduplicate, sparsely pubescent along the veins when young, quickly glabrescent, mature leaves glabrous, lanceolate-elliptic to oblong, apex abruptly acute to short-acuminate, base acute to rounded, often somewhat asymmetrical, margin flat to minutely revolute when dried, (6 – ) 10 – 15.5 ( – 19) × (2.5 – ) 4.5 – 5.5 ( – 6) cm; midrib impressed above, raised below, secondary veins impressed above when fresh, or flat to raised when dry, (4 – ) 5 – 6 ( – 8) pairs, slightly raised beneath, upper pairs faintly joining near the margin, tertiary veins flat to impressed above, raised below, delicately but distinctly percurrent; torn leaf with abundant strands of webby protoxylem from 1° and 2° veins; petiole glabrescent, grooved above, 0.5 – 1.5 cm × 1 – 1.5 mm. Inflorescences axillary, on recent growth or mature twigs, often on the older naked portions, 1 – 2 per axil, axes pubescent. Male inflorescences with peduncle 0.4 – 0.6 cm long, bearing 3 – 4 branches, each then branched 1 – 2 times, flowers up to ca. 25, subsessile or on short pedicels 1 – 3 mm. Male 311

flowers: calyx cupular, green, glabrous, entire or with minute teeth, sometimes irregularly tearing, 1.5 – 2 mm long, 2 – 3 mm wide; petals 5, glabrous, white, yellow, or yellowish green, 3.5 – 5 mm long; stamens 5, cream, 6 mm long, slightly exserted, filaments almost glabrous to dorsally pubescent with short, scattered hairs and more densely pubescent ventrally; ovary rudiment cream, minute, glabrous, evidently sunken in a disk. Female inflorescences with peduncles to 1 cm long before branching, typically bearing (1 – ) 4 (rarely 5) pedicels 0.3 – 0.6 cm long, peduncle and pedicels elongating during fruit maturation, flowers 1 – 4 ( – 5). Female flowers: calyx green, glabrous, cupular, entire or with minute teeth, often irregularly tearing, 2 – 3 mm across; petals 5, glabrous, 3 – 4 mm long, corolla sometimes splitting down one side, staminodes 5, not or scarcely exserted, 3 – 4 mm long, with short clavate hairs dorsally at the connective and ventrally below the anther cells; ovary light green, glabrous, cylindrical, 3 – 4 mm long; stigma 5-lobed and ridged, 2 – 3 mm in diam., capping young ovary. Infructescences with peduncles (0.4 – ) 0.8 – 1.2 ( – 2.2) cm long, pedicels 0.5 – 1 ( – 1.7) cm long, fruit subtended by the persistent patellar calyx, 5 mm in diam. Fruit ellipsoid-obovoid, base tapered, very base usually swollen, white to whitish at maturity, yellowish-orange or pinkish when submature, 1.6 – 2.2 × 0.8 – 1.0 cm, stigma apical, broad and spreading, 3 – 3.5 mm in diam.; inner mesocarp with ca. 11 low ridges.

DISTRIBUTION. Indonesia; Philippines: Alabat Island, Bicol Region (Luzon), Catanduanes, Samar, Leyte, Bohol, Negros, Mindanao, Cagayan?. Common in some areas and apparently tolerant of some disturbance. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Quezon Province, Alabat Island, Dec. 21 – 30, 1916, Merrill 10495 (A n.v., L!, US!); Camarines Sur Province, Mt. Isarog, May 1908, Curran F. B. 10446 (US!); Ponawa River, 670 m [2200 ft.], 11 Dec. 1928, Edaño B. S. 76412 (A!, BH!, MICH!, NY!); Sorsogon Province, Irosin, Mt. Bulusan, Sulit 2722 (A!); ibid, Nov. 1915, Elmer 15295 (type of G. sorsogonensis, A!, BM n.v., BO n.v., C n.v., FI n.v., K!, L!, MO!, NA! photo, NY!, P!, S n.v., U! photo, US!,); ibid, Elmer 15416 (A!, F!, GH!, K!, L! [2 sheets], MO!, NY!, P!, UC!, US! [2 sheets]); ibid, Elmer 15650 (A!, K!, L! [2 sheets], MO!, NY!, P!, US! [2 sheets]); Irosin, 312

Mt. Salihan, 200 m [685 ft.], 25 May 1957, Edaño & Gutierrez PNH 38543 (A!, K!, L!); Catanduanes, Catanduanes Province, Mt. Nagpakdib, 90 m [300 ft.], 16 Aug. 1928, Ramos & Edaño B. S. 75422 (NY!, SING n.v., U n.v., UC!); Samar, Western Samar Province, Basey, Mt. Sohoton Natural Bridge National Park, 31 Jan. 1992, Barbon et al. PPI 5801 (CAHUP!, K!, L!, MO!, PNH!, US!); ibid, 2 Feb. 1992, Barbon et al. PPI 5848 (CAHUP!, K!, L!, MO!, PNH!, US!, 4 other dups. n.v.); Paranas, Barangay Lokilokon, near Caughayanan bridge, 11°47 N, 125°10 E, 100 m, 20 June 1993, Soejarto et al. 7992 (F!, L!, US!); Leyte, Leyte Province, Palo, Jan. 1906, Elmer 7192 (BO n.v., K!, L!); Baybay, Hubasan, Visca forest reserve, 366 m, 23 March 1993, Gaerlan et al. PPI 10522 (CAHUP!, K!, L!, MO!, PNH!, US!, 4 other dups. n.v.); Bohol, Bohol Province, Valencia, 610 m [2000 ft], Aug. – Oct. 1923, Ramos B. S. 43240 (A!, K!, P!, UC!); Bilar, 610 m [2000 ft.], Aug. – Oct. 1923, Ramos B. S. 43342 (A!, L! [2 sheets], UC!, US!); Negros, Negros Oriental Province, Sibulan, Lake Danao, 976 m, 22 Aug. 1948, Edaño PNH 6627 (A!, L!); Mindanao, Bukidnon Province, Gantungan, Impalutao, Mt. Kitanglad, 22 July 1991, Gaerlan et al. PPI 3446 (CAHUP!, K!, L!, MO!, PNH!, US!); Davao Oriental Province, Mt. Galintan, 880 m [2900 ft.], 11 June 1927, Ramos & Edaño B. S. 48884 (NY!, UC!, flowers galled); Mati, 15 April 1927, Ramos & Edaño B. S. 49621 (NY!, P!, SING n.v., UC!).

Gomphandra cf. mappioides: Cagayan Province, PPI 18949 (no label) (PNH!). Quezon Province, Tagkawayan, Barangay Bagong Silang II, ♂ buds, 8 Sept. 1993, Barbon et al. PPI 12183 (L!, PNH!, 8 other dups. n.v.); ibid, ♂ buds, 16 Sept. 1993, Barbon et al. PPI 12290 (L!, PNH! [2 sheets], 7 other dups. n.v.) These specimens may belong to Gomphandra mappioides, or they may belong to G. psilandra or G. coi, neither of which is known from many collections. The morphologies of these three species are quite similar, and it may be hard to identify material that does not have mature reproductive parts.

313

HABITAT. Primary or secondary lowland dipterocarp forest, sometimes on steep slopes, over limestone or volcanic derivatives (Mt. Isarog, Mt. Apo), below 1000 m. According to local foresters, on Bohol the fruit are reportedly eaten by civet cats (Paradoxurus hermaphroditus and Viverra tangalunga). The seeds appear to germinate readily with or without passing through an animal. Germination is through the basal end of the fruit. The cotyledons are heart-shaped and similar to those of Gomphandra luzoniensis. PHENOLOGY. Flowers have been collected in April and from August through November, with (immature) fruit present from June through March. Seeds planted at a nursery in Bohol in September germinated during November. VERNACULAR NAME(S). Balinsowa (Bicolano, may refer to Gomphandra cumingiana instead), lanutan (Bicolano, Bicol), marumay (Bagobo, Mindanao), tagibokbok (Tagalog or Cebuano, Bohol), hindang (Tagalog or Cebuano Leyte). Bibislakin (Ilocano, Salvosa 1963) may be incorrect, because Gomphandra mappioides was not collected from Ilocano-speaking regions until the 1990s. Tagibokbok refers to the wood’s resistance to post borer beetles. NOTES. Gomphandra apoensis, which was considered a Philippine endemic by Sleumer (1971), is here treated as a synonym of Gomphandra mappioides, which is widespread in central Indonesia. The two taxa were previously distinguished by fruit size, but Sleumer did not annotate any specimens with mature fruit as Gomphandra apoensis, so his description of the taxon was incomplete. Gomphandra apoensis and G. mappioides clearly represent the same taxon, and the epithet mappioides has priority. The Philippine populations tend to have a broader stigma than the Indonesian populations, but that is the only consistent difference. As a species, Gomphandra mappioides is relatively variable in leaf shape and male flower number, but the variation is continuous, and Philippine specimens show less variation than Indonesian specimens. Gomphandra mappioides is much more widely distributed in the Philippines than previously reported (as G. apoensis) in Flora Malesiana (Sleumer 1971). Molecular data show that it is closely related to Gomphandra javanica, which might suggest that the species originated in Indonesia and dispersed to the Philippines. Its morphology is similar to the Philippine 314 species Gomphandra coi Schori and G. psilandra Schori, but its inflorescence structure differs – see notes under G. coi. Environmental stress may cause abnormal morphologies in Gomphandra mappioides (and other species of Gomphandra). A tree with staminate flowers was observed on Mt. Isarog in February 2007, two months after typhoon Reming passed over the area and stripped all mature leaves off the tree. The flowers were borne singly in the axils of newly emerging leaves, and the calyces were unusually deep (3 mm). A nearby tree had a single young galled fruit on a relatively long, denuded stalk. Both of the abnormal reproductive forms proved to be the products of severe stress on the trees, as the typical infructescences of Gomphandra mappioides were observed in February 2008 on individuals in the same population.

25. Gomphandra oblongifolia Merr. (1921b: 276). Stemonurus oblongifolius (Merr.) R. A. Howard (1940: 469). Type: Philippines, Luzon, Camarines Norte Province, Paracale, Nov. – Dec. 1918, Ramos & Edaño B. S. 33727 (lectotype A!, isolectotypes K!, L!, P!, PNH†, US!).

Small tree to 10 m. Twigs relatively straight, 1 – 2.5 mm in diam., terminal bud falcate, minutely pubescent with appressed hairs, young twigs glabrescent. Leaves firmly chartaceous to thinly coriaceous, ovate to oblong-elliptic or obovate, apex acute to acuminate, base rounded to acute, often subequal, often shining above when dry, paler and dull below, essentially glabrous, (7.5 – ) 12.5 – 15 ( – 18.5) × (3 – ) 4 – 6 ( – 7) cm; midrib impressed above, raised below, secondary veins (3 – ) 5 – 6, flat to slightly raised above, raised below, vein course ± parallel or converging toward margin, upper pairs joining near margin, tertiary veins indistinct above, flat to slightly raised below, delicately and weakly percurrent; petiole glabrous or minutely pubescent, (0.4 – ) 0.7 – 1.3 cm × 1 – 2 mm. Inflorescences and flowers unknown, female inflorescences most likely with up to ca. 30 flowers, male inflorescences with more (100?). Infructescences terminal or leaf-opposed, axes sparsely pubescent with minute appressed hairs, peduncle 0.4 – 1.7 cm long, bearing up to 4 primary branches, these either unbranched or branched 315

1 – 2 more times, pedicels to 5 mm, often with a minute bract, some fruits (sub)sessile, up to ca. 20 fruits developing. Fruit only known in submature state, calyx cupular but spreading, 2.5 mm across, glabrescent, margin entire or with 5 minute teeth, fruit obovoid-ellipsoid to oblong-ellipsoid, base tapered, 1.5 – 1.8 × 0.7 – 0.9 cm, outer surface with small light spots, inner mesocarp with ca. 13 faint longitudinal ridges, stigma eccentric, displaced towards sulcus, 2 mm in diam., faintly ridged.

DISTRIBUTION. Luzon (Bicol), Catanduanes. Endemic to the region. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Camarines Sur Province, no locality [Lagonoy according to Merrill], Apr. 1914, fr., Hsia F. B. 21103 (PNH†, US!); Paracale, Dec. 1918, imm. fr., Alambra F. B. 27406 (A!, K!, US!; cited incorrectly by Merrill as 27403); no locality, Dec. 1918, imm. fr., Ablaza & Ramos F. B. 27423 (A!, BRI!, SING, UC!, US!); Paracale, Nov. – Dec. 1918, imm. fr., Ramos & Edaño B. S. 33727 (lectotype A!; isolectotypes K!, L!, P!, PNH†, US!); Catanduanes, No locality, imm. fr., Nov. 14 – Dec. 11, 1917, Ramos B. S. 30258 (A!, PNH†, US!); ibid, imm. fr., Nov. 14 – Dec. 11, 1917, Ramos B. S. 30355 (NY!, PNH†, US!); Virac, So. Duguistro [Dugui Too]; imm. fr., 20 Apr. 1956, Canicosa 3043 (LBC!). HABITAT. In dipterocarp forests at low altitude. PHENOLOGY. Fruit have been collected in April, November, and December. VERNACULAR NAME(S). In Catanduanes, which has been largely deforested, a photograph of Canicosa 3043 was identified by a local man as “siniha,” although the name may refer to Gomphandra mappioides, which has been found in Catanduanes as recently as 2007. The common name has been reported as “laing” in Bicolano and Tagalog, but it is doubtful that the name still applies, as “laing” refers to a regional dish made with dried taro leaves and coconut milk. NOTES. Gomphandra oblongifolia is only known from collections with submature fruit. The species is easily recognized by its thinly coriaceous leaves with relatively few veins, the terminal or leaf-opposed (but truly terminal) infructescences, and the stigma, which resembles a small hat perched near the fruit apex. Based on its leaves, inflorescence position and structure, and the number of fruits, Gomphandra oblongifolia belongs to the 316

G. luzoniensis complex. Flowering specimens are likely to have up to 30 or 40 flowers in female plants, and up to 100 flowers in male plants.

26. Gomphandra oligantha Sleumer (1940: 238). Urandra pauciflora Merr. (1908: 243). Gomphandra pauciflora (Merr.) Merr. (1923: 491), nom. illeg.; non Craib 1914. Type: Philippines, Mindoro, Mar. – Apr. 1907, Merritt F. B. 6770 (lectotype US! (selected by Schori)).

Small tree to 12 m. Bark smooth, light gray to light brown. Twigs slender, 0.5 – 2 mm in diam., terete, green when young, faintly zigzag; terminal bud falcate, pubescent with light to dark brown minute appressed hairs, glabrescent with age. Leaves variable, noticeably different between young and mature trees, often appearing distichous, medium green above, paler below and firm when fresh, usually somewhat shining on both sides, thinly chartaceous and dull when dried, initially sparsely pubescent with minute appressed hairs, glabrescent with age, sometimes remaining pubescent on the veins below, ovate (juv.), ovate-elliptic, elliptic, lanceolate-elliptic, slightly oblanceolate-elliptic, often somewhat asymmetrical (mat.), base rounded to acute, slightly oblique, apex acuminate to caudate, often with an acumen 1 – 2 cm long, (4 – ) 5 – 10.3 ( – 12) × (1.5 – ) 2.5 – 4.5 ( – 5) cm; midrib flat or impressed above, raised below, pubescent when young, secondary veins (1 – ) 4 – 6 ( – 7) pairs, flat or raised above (impressed on juvenile growth, giving the leaves a somewhat bullate appearance), raised below, vein course ± parallel (juv.) or with a steeply ascending basal pair of veins (mat.), brochidodromous, intersecondary veins common, tertiary veins flat or raised above when fresh (flat to obscure when dried), flat to raised below and delicately percurrent; petiole grooved, 0.4 – 1 cm long, 0.5 – 1 mm wide, glabrescent. Inflorescences terminal or pseudoaxillary (terminating extremely short axillary branches), generally few-flowered on very long, slender peduncles (~0.5 mm thick), axes minutely pubescent with sparse appressed hairs. Male inflorescence with peduncle 1 – 2 ( – 3) cm long, bearing 2 – 4 branches, each to 1 ( – 1.5) cm long, branches occasionally shortly rebranched (to 1 cm long), flowers 317 cymosely arranged, subsessile or on pedicels 1 – 3 mm long, 3 – 23 flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, sparsely ciliate, 1 – 1.5 mm across; petals whitish, yellowish, or greenish, 4, glabrous, 3 – 4 mm long; stamens 4, exserted, 5 mm long, glabrous on the ventral side, with a few penicillate hairs dorsally at the connective and along the margins just below the anthers; ovary rudiment glabrous or maybe with a few hairs along edges. Female inflorescences with peduncle (0.3 – ) 1 – 3 cm long, bearing 2 – 3 branches, each branch serving as a pedicel (0.5 – ) 1 – 2.3 cm long. Female flowers: calyx cupular, minutely apiculate, sparsely ciliate, 1 – 1.5 mm across; petals whitish, yellowish, or greenish, 4, glabrous, 3 – 4 mm long, corolla split down 1 side; staminodes 4, slightly exserted, 4 – 5 mm long, one staminode reflexed, filaments with sparse clavate hairs dorsally at the connective and ventrally below the anther cells; ovary cylindrical, glabrous or with a few hairs just below the stigma, 2 – 3 mm long, stigma slightly lobed, 1 mm across. Fruit pendent on the slender peduncles, yellow with paler dots when ripe, also reportedly pink (but immature), ovoid-oblongoid, slightly asymmetrical, apex acute or somewhat beaked, base rounded, glabrous or very sparsely hairy near the apex, (1 – ) 1.5 – 1.7 × (0.6 – ) 0.7 – 0.9 cm; inner mesocarp thin, with 10 – 15 anastomosing low longitudinal ridges, stigma 1 – 2 mm across, often deeply grooved on one side.

DISTRIBUTION. Philippines: Mindoro, Panay, Sibuyan, Samar, Dinagat. SPECIMENS EXAMINED. PHILIPPINES. Mindoro, no locality, Mar. – Apr. 1907, ♀ fl., M. L. Merritt F. B. 6770 (US! lectotype); Oriental Mindoro Province, no locality, ♀ buds, April – May 1986, Ridsdale & Reynoso s.n. [PNH 162660] (TAIF! photo); San Teodoro, Sibuang River camp, 900 m, ♀ buds, 19 Feb. 1985, Ridsdale 914 (A!, K!, L!); San Teodoro, Subaan River, c. 13 22’ N, 121 00’ E, 750 m, ♀ fl., 25 Apr. 1986, Ridsdale 1240 (A!, K! [2 sheets], L!, LBC!); ibid, 570 m, ♂ buds, 18 Apr. 1986 Coode & Ridsdale 5398 (CANB!, K!, L! [2 sheets], LBC!, MO!); Pinamalayan, ♀ buds, imm. fr., June 1922, Ramos B. S. 41006 (A!, BO, K!, L!, P!, US!); ibid, ♀ buds, imm. fr., June 1922, Ramos B. S. 41107 (A!, K!, P!, US!); Occidental Mindoro Province, Paluan, ♀ buds, Apr. 1921, Ramos B. S. 39596 (A!, P!); ibid, ♀, Apr. 1921, Ramos B. S. 39658 (A!, K!); 318

Sibuyan, Romblon Province, Magdiwang, Kamingawan Valley, 12°28’ N, 122°32’ E, imm. fr., 1 June 1992, Stone et al. PPI 6856 (CAHUP!, K!, L!, MO! [2 sheets], PNH!, US!); Mt. Guiting-guiting, imm. fr., 18 June 1987, Madulid 6912 (A!, F!, L!, MO! [2 sheets], PNH!, US!); ibid, ♀ fl., imm. fr., Apr. 1910, Elmer 12202 (A!, BISH!, BM!, BO n.v., E!, G n.v., GH!, K!, L!, MO!, NY!, U n.v., US!, WRSL n.v.); ibid, ♂ buds, May 1910, Elmer 12508 (♂ fl., A! [2 sheets], BISH! photo, BM!, BO n.v., E!, FI n.v., G n.v., K!, L!, MO!, NY!, U n.v., US!, WRSL n.v.); ibid, 12°56.0’ N, 122°36.0’ E, 260 m, ♂ buds, 10 Dec. 1995, Reynoso et al. PPI 21500 (PNH!); ibid, 12°56.0’ N, 122°36.0’ E, 260 m, ♂ buds, 10 Dec. 1995, Reynoso et al. PPI 21528 (L!, PNH!); above Madiwang on ridge leading to Mayos Peak, Camp 3, 1300 m, fr., 28 Aug. 1989, Argent & Reynoso 89149 (K!, L!); Panay, Antique Province, Culasi, Hangod Tubig, Mt. Madia-as, 727 m, imm. fr., 9 Feb. 1992, Gaerlan & Fuentes PPI 4921 (CAHUP!, K!, L!, MO!, PNH!, US!); Samar, Eastern Samar Province, Balangiga, Barangay Sta. Rosa, ♂ buds, May 1971, Madulid et al. PNH 118454 (L! [2 sheets]); Dinagat, Dinagat Province, Loreto, Santiago, Cambinliw, 50 m, imm. fr., 28 Sept. 1991, Gaerlan et al. PPI 4569 (MO!); Kaantojan. 10°18’ N, 125°35’ E, 185 m, imm. fr., 24 Jan. 1995, Gaerlan et al. PPI 19085 (PNH! [2 sheets]); Tubajon, Paragua Forest Reserve, 21 Feb. 2008, Schori 2008-9 (BHO!, CAHUP!), ibid, Schori 2008-10 (PNH!); Kaantojan, Mabini, 10°18’ N, 125°35’ E, 185 m, imm. fr., 26 Jan. 1995, Gaerlan et al. PPI 19137 (L!, 6 other dups. n.v.). HABITAT. Lowland dipterocarp forest, on flat or steep terrain, over limestone, on lateritic clay soil, or on ultramafic soil, 260 – 1300 m. PHENOLOGY. Flowers and fruit have been collected from April to June. VERNACULAR NAME(S). Manangkalau (Tagalog). NOTES. Gomphandra oligantha is a distinctive and beautiful species, not likely to be confused with any other, especially if reproductive material is present. It may be locally common where it occurs. It shows stress responses to excessive sunlight, with deformed leaves and flowers. Juvenile trees may be mistaken for a different species, as their leaves tend to be much larger than those of mature trees. Juvenile suckering branches from the base of mature trees show the same differences in leaf size, shape, and vein number and arrangement. Gomphandra oligantha was historically known from Mindoro and Sibuyan, 319 but was first collected from Panay in 1992 and from Dinagat in 1991. There was a single collection from Samar in 1971. Molecular data show that Gomphandra oligantha is related to G. fernandoi, G. luzoniensis, and G. ultramafiterrestris, which also have terminal inflorescences.

27. Gomphandra psilandra Schori (Kew Bulletin). Type: Philippines, Luzon, Quezon Province, Quezon Natural Park, road between Pagbilao and Atimonan, 13°59’ N, 121°50’ E, 250 – 300 m, fr., 2 April 1987, Burley 56 (holotype PNH!; isotypes A!, BISH ! photo [2 sheets], F!, K!, L!, US!).

Small tree to 6 m tall, 15 cm diam. Bark smooth, gray-brown, with lenticels. Twigs zigzag, young twigs green, puberulent, older twigs glabrescent, 1.5 – 2.5 cm in diam., pubescence short, dark brown to yellowish-brown. Leaves chartaceous, firmly so when fresh, medium green above and slightly glossy, paler beneath, quickly glabrescent, size and shape variable, ovate-elliptic to oblong, base rounded to acute, often somewhat oblique, apex acute to shortly acuminate, (9 – ) 10 – 16 ( – 21) × 3.5 – 7 ( – 9) cm, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 5 – 8 pairs, flat or impressed above and leaf bullate between veins when fresh, upper pairs joining at margin, raised below, tertiary veins flat and indistinct above, weakly percurrent and darker green than leaf surface below; petioles grooved, 0.9 – 1.2 ( – 1.5) cm long. Inflorescences axillary from previous year’s growth, glabrous or with few scattered hairs, bracts minute, triangular, pubescent with short dark brown hairs, subtending each flower. Male inflorescences with peduncle 1 – 2 mm long, bearing 2 – 3 branches 1 – 2 mm long, flowers 7 – 10 per inflorescence, crowded, sessile or on pedicels 1 mm long. Male flowers: calyx cupular, apiculate, sparsely ciliate, 1.5 – 2 mm wide; petals 5, whitish at base, green and green-spotted at lobes, glabrous, 4 mm long; stamens 5, white, strongly exserted, 5 – 6 mm long, glabrous, anther sacs brownish, pollen white; ovary rudiment minute, yellowish, glabrous. No fragrance noted. Female inflorescences with peduncle <1 – 2 mm long, bearing 2 – 4 (rarely 5) flowers, pedicels 1 mm long. Female flowers: calyx cupular, apiculate, sparsely pubescent, 1 mm high × ca. 2.5 mm 320

wide, petals (4 – ) 5, pale green, glabrous or with a few hairs at lobe tips, 4 – 5 mm long, corolla splitting on one side in bud; staminodes 4 – 5, strongly exserted, 6 – 7 mm long, white, glabrous, anther cells brownish-yellow, empty; ovary yellowish-cream, 4 – 5 mm long, cylindrical, slightly curved and gibbous at the base, glabrous, stigma cream, not clearly distinct from ovary, 5-lined, sometimes undulate at edges, 2.5 – 3 mm across. Infructescence axillary, bearing up to 4 fruit, peduncle 0.5 cm long, pedicels 0.2 – 0.4 cm long. Immature fruit elliptical, light green, glabrous, punctate, asymmetrically curved, becoming yellowish-green and more symmetric with age. Fruit ivory or cream when ripe, 2.0 – 2.5 × 1.3 – 1.4 cm, ± cylindrical, base acute, apex truncate, outer mesocarp 2 mm thick, fleshy when fresh; dried fruit 2.0 – 2.5 × 0.7 cm, narrowly obovoid-ellipsoid to cylindrical, apex and base slightly tapered, stigma displaced towards sulcus, 2.5 – 3 mm in diam., inner mesocarp with ca. 11 longitudinal ridges.

DISTRIBUTION. Philippines, Luzon, Quezon, and Laguna Provinces. SPECIMENS EXAMINED. PHILIPPINES. Luzon, Quezon Province, Quezon Natural Park, road between Pagbilao and Atimonan, 13°59’ N, 121°50’ E, 250 – 300 m, fr., 2 April 1987, Burley 56 (holotype PNH!, isotypes A!, BISH [2 sheets], F!, K!, L!, US!); ibid, 350 m [1150 ft.], fr., 23 Dec. 1964, Hernaez 992 (CAHUP! [2 sheets]); ibid, 200 m, sterile, 13 Oct. 2006, Fernando & Schori 1820 (BHO!, LBC!); ibid, 200 m, ♀, 13 Oct. 2006, Fernando & Schori 1821 (A!, BHO!, CAHUP!, PNH!); ibid, sterile, 13 Oct. 2006, Fernando & Schori 1822 (BHO); ibid, 220 m, imm. fr., 13 Oct. 2006, Fernando & Schori 1823 (BHO!, CAHUP!, K!, LBC!, MO!, PNH!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-1 (A!, K!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-2 (CAHUP!); ibid, 220 m, ♀ fl., 10 Feb. 2007, Schori & Breganza 2007-3 (A!, K!, L!, PNH!); ibid, 290 m, ♂ fl., 10 Feb. 2007, Schori & Breganza 2007-4 (A!, K!, PNH!); Llavac, University of the Philippines Land Grant, 300 m, fr., 17 Nov. 1970, Hernaez 1542 (CAHUP!); ibid, Lalawinan River, 270 m, imm. fr., 6 June 2007, Schori 2007-20 (CAHUP!, PNH!); Tayabas Province [now Aurora and Quezon Provinces], Mt. Pular, Jan. 1913, Ramos B. S. 19415 (K!, P!, US!); Laguna Province, no specific locality, imm. fr., Nov. 1915, Amarillas F. B. 24672 (L!, NY!, US!). 321

HABITAT. Lowland dipterocarp forest below 300 m, often near streams. CONSERVATION STATUS. Endangered: EN B2ab(iii,iv). PHENOLOGY. In Quezon Province, flowers were present from February to April. Immature fruit were observed in October and February, with ripe fruit present in May. The inner mesocarp and endocarp are very slow to develop, and fruit maturation may take more than a year from the time of flowering. ETYMOLOGY. The epithet psilandra refers to the glabrous anthers. NOTES. Gomphandra psilandra is only known from a few localities. Extant populations are present at Quezon Natural Park and at the UP land grant in Llavac, and other populations are likely in the appropriate lowland dipterocarp habitat. Gomphandra psilandra is related to G. mappioides, which has much longer peduncles and pedicels, stamens that are often pubescent, and a different fruit shape with a broader stigma. Gomphandra psilandra is quite similar to G. coi, which has more flowers in its inflorescences (up to 9 female and 15 – 30 male), and wider, shorter fruit (1.6 – 1.8 ( – 2) cm long) with a swollen base. Vegetatively these three species may be difficult to distinguish. Molecular data show that Gomphandra psilandra and G. mappioides are related to each other, and based on morphology, it is likely that G. coi is related to G. psilandra as well.

28. Gomphandra ultramafiterrestris Schori (Kew Bulletin). Type: Philippines, Mindanao, Davao Oriental Province, San Isidro, Mt. Hamiguitan, 990 m, 19 April 2007, Schori & Hilario 2007-10 (holotype PNH!; isotypes A! [2 sheets], K!, L!, NY!, US!).

Shrub or small tree to 8 m tall and 10 cm diam. Bark light gray to tan, slightly fissured in older trees. Twigs green when young, pubescent with minute appressed tawny or cinereous hairs, eventually somewhat glabrescent, 1 – 2 mm in diam. Leaves coriaceous, ovate to obovate, base rounded to acute, apex acute to acuminate, dark green and slightly shining above when fresh, pale green and matte below, glabrous above or sparsely pubescent by petiole, glabrous below, margin revolute, (4 – ) 5 – 10 × (1.8 – ) 2.5 – 5 cm; 322 midrib impressed above, raised below, secondary veins 2 – 5 pairs, flat to impressed above, slightly raised and distinctly darker than lower leaf surface below, ± parallel or converging toward margin, upper pairs sometimes brochidodromous, tertiary veins not or scarcely evident, weakly percurrent; petioles grooved above, 0.4 – 1 ( – 1.5) cm long, pubescent with short somewhat appressed tawny hairs. Inflorescences terminal, axes pubescent with appressed hairs. Male inflorescences with peduncle 1.7 – 2 cm long, bearing 4 branches 0.4 – 1.5 cm long, branches often branched again, terminal segments bearing flowers in a scorpioid cyme, inflorescences to 5 cm long overall, 30 – 50 ( –100) flowers. Male flowers: calyx cupular, 1.5 – 2 mm across, sparsely ciliate, minutely apiculate, petals 5, yellowish-green, glabrous or very sparsely pubescent with minute hairs outside, 5 – 6 mm long; stamens 5, white, 0.8 – 0.9 cm long, strongly exserted 3 mm and recurved, with a penicillate tuft of clavate hairs dorsally below the anthers, a few scattered hairs ventrally, pollen white; ovary rudiment glabrous, 1 mm across, depressed globose and slightly 5-angled, apex apiculate. Female inflorescences with peduncle 1 – 1.5 cm long, bearing 4 branches 0.3 – 0.8 cm long, each with a simple or branched scorpioid cyme of 3 – 5 flowers on pedicels <1 – 4 mm long, up to 20 flowers per inflorescence. Female flowers: calyx cupular, 2 mm across, sparsely ciliate, 4-5-lobed or minutely dentate, petals 5 ( – 6), yellowish-green, 4 – 5 mm long, corolla splitting down one side; staminodes 5, white, scarcely exserted, 4 – 5 mm long, one reflexed through split in corolla, pubescent dorsally at the connective with long spreading and tangled clavate hairs, sparsely pubescent dorsally below the brownish anther cells; ovary glabrous, bright green, 3 – 4 mm long, 5-angled, stigma yellowish, sharply angled. Fruit globose or obovoid, glabrous, punctate, pinkish-beige and flesh 1.5 mm thick when ripe, 1.1 – 1.4 × 0.8 – 0.9 cm, with ca. 12 low ridges, stigma brown, 2 – 2.5 mm across, lobed and sharply angled.

DISTRIBUTION. Philippines, Mindanao, Dinagat Province, Dinagat; Davao Oriental Province, Mt. Hamiguitan. SPECIMENS EXAMINED. PHILIPPINES. Mindanao, Davao Oriental Province, Mt. Hamiguitan, 950 m, imm. fr., 18 April 2007, Schori & Hilario 2007-9 (A!); ibid, 990 323

m, ♀, 19 April 2007, Schori & Hilario 2007-10 (holotype PNH* [fr.]; isotypes A [2 sheets – fl.; fr.], K [fl], L [fl. & fr.], NY [fl.], US [sterile]); ibid, 890 m, ♂, Schori & Hilario 2007-11 (A, K, L, NY); Dinagat Province, Dinagat Island, Mt. Redondo, KROMINCO mining site, 700 m, imm. fr., 30 Sept. 1991, Gaerlan et al. PPI 4727 (CAHUP!, K!, MO! [2 sheets], PNH!, US!); Loreto, Santiago, Cambinliw, 200 m, imm. fr., 29 Sept. 1991, Gaerlan et al. PPI 4599 (MO!, PNH!). HABITAT. Gomphandra ultramafiterrestris is found on ultramafic soils in montane forest. On Dinagat, the species is found from 200 – 700 m. On Mt. Hamiguitan, it may be found at 800 – 1000 m. It is not present in the shortest “bonsai” forest that covers exposed ridges in both localities, but may occur in the understory of taller forest, or at the edges of short canopy forest. CONSERVATION STATUS. Endangered: EN 2ab(iii,iv,v). PHENOLOGY. Flowers and ripe fruit in April on Mt. Hamiguitan. ETYMOLOGY. The specific epithet refers to the ultramafic soils on which this species grows. NOTES. Gomphandra ultramafiterrestris is not the only species that occurs on ultramafic soils, but it seems to be restricted to them. Gomphandra oligantha Sleumer and G. fernandoi Schori & Utteridge also grow on Dinagat, whose geology is characterized by heavy metal content. Gomphandra ultramafiterrestris belongs to the G. luzoniensis (Merr.) Merr. group, based both on morphology and molecular data. It differs from all other members of the group in its small, coriaceous leaves and its small fruit. The fruit shape resembles that of Gomphandra oligantha and G. halconensis, but both species can be easily distinguished by differences in their leaves and inflorescence structures. Collections from Dinagat and Mt. Hamiguitan are treated as the same species here, though there are minor morphological differences between collections from the two areas. PPI 4727, from Dinagat, has small leaves and globose fruits, and although the fruits are immature, their inner mesocarp and endocarp are sclerified so it is doubtful that their size or shape would change substantially at maturity. Another Dinagat collection, PPI 4599, also has immature globose fruits, and it has both small leaves and larger leaves with more secondary veins. The differences in leaf morphology are probably due to 324

environmental differences, as PPI 4599 was collected at 200 m and was likely more sheltered than PPI 4727, which was collected at 700 m at the edge of an open pit mine. Collections from Mt. Hamiguitan tend to have larger leaves and fruits, but there are no consistent characters that can be used to distinguish the populations. If mature fruiting and flowering material can be collected from Dinagat, and they show differences from the Mt. Hamiguitan population, it may be appropriate to recognize two subspecies. The description above is based primarily on material from Mt. Hamiguitan, but the species was named for the mountain after the material from Dinagat was determined to represent the same taxon. Gomphandra ultramafiterrestris is unusual in that it is one of only a few species in the genus that exhibits pronounced floral dimorphism between stamens and staminodes. Some degree of floral dimorphism exists throughout the genus between pistillate and staminate flowers, but the difference in Gomphandra ultramafiterrestris between the stamens, which are exserted 3 mm, and the staminodes of pistillate flowers, which scarcely exceed the corolla, is striking.

Unassigned Material:

Luzon, Camarines Sur Province. Mt. Madooy, 580 m [1900 ft.], ♀ fl., imm. fr., 10 Nov. 1928, Edaño B. S. 76042 (BH!, NY!). This specimen has an inflorescence structure like that of Gomphandra psilandra, but the staminodes are pubescent and the immature fruit are ovoid, not ellipsoid. It may be an aberrant specimen of G. mappioides, except the inflorescence structure and the stigma are wrong for that species. If it does represent a new species, it is closely related to Gomphandra mappioides and G. psilandra.

Mindanao, Dinagat Province. Loreto, Mt. Redondo, forest fragment just down road from KROMINCO main mining building, N 10.36643°, E 125.62971°, 680 m, 20 Feb. 2008, Schori 2008-6 [sterile, 4 dups]; Tubajon, Paragua Forest Reserve, ♂ buds, 21 Feb. 2008, Schori 2008-7 [sterile, 3 dups].

325

BORNEO [10 taxa]

G. borneensis, G. capitulata, G. cumingiana, G. kinabaluensis var. clemensiorum, G. kinabaluensis var. kinabaluensis, G. lamanii, G. longipedunculata, G. lysipetala, G. macrosperma, G. palustris

1. Inflorescences terminal or leaf-opposed, if axillary then leaf-opposed scars present 2 2. Leaves chartaceous, apex caudate, secondary veins 2 – 4 pairs, usually strongly looping, forming an intramarginal vein G. lamanii 2’. Leaves coriaceous, not caudate, secondary veins 4 – 6 pairs, impressed, parallel, found in peat swamps G. palustris 1’. Inflorescences always axillary 3 3. Leaves firmly coriaceous 4 4. Leaves smaller, (5 – ) 7 – 10 × 1.5 – 3.5 cm, fruit pubescent G. lysipetala 4’. Leaves larger, (4.5 – ) 8.5 – 19 × (2.0 – ) 3.0 – 6.1 cm, fruit glabrous 5 5. Fruit 1.4 – 1.9 cm long, 2135 m or below G. kinabaluensis var. kinabaluensis 5’. Fruit 1.8 – 2.7 cm long, 2745 m G. kinabaluensis var. clemensiorum 3’. Leaves chartaceous to thinly coriaceous 6 6. Leaves larger, (6.5 – ) 12 – 19 ( – 26) × (2.5 – ) 3.5 – 7 ( – 12.5) cm 7 7. Twig pubescence sparse and appressed, leaves glabrous, peduncles 1 – 2.5 cm long 8 8. Peduncle 2 – 2.5 cm long, inflorescences with 2 – 3 orders of branching G. longipedunculata 8’. Peduncle 0.5 – 1.5 cm long, inflorescences unbranched (fls. sessile) or with one order of very short branches G. capitulata 7.’ Twig pubescence initially dense, spreading, leaves pubescent below, peduncles ≤ 1 cm long 9 9. Leaves with 3 – 4 ( – 5) well-spaced vein pairs, fruit 2.6 – 3.7 cm long, glabrous G. macrosperma 9’. Leaves with (3 – ) 5 – 7 ( – 10) closely spaced vein pairs, fruit (1 – ) 1.5 – 1.9 cm long, usually sparsely pubescent G. cumingiana 6’. Leaves smaller (5 – ) 7 – 10 × 1.5 – 3.5 cm 10 10. Twigs slender, petals united, inflorescences not capitate, ovaries glabrous G. borneensis 10’. Twigs stouter, petals free to base, inflorescences capitate, ovaries pubescent G. lysipetala 326

29. Gomphandra borneensis Schori (Kew Bulletin). Type: Malaysia, Borneo, Sabah, Ranau District, Tenompok Ridge along Tamparuli – Ranau Road 6 km W of Kinabalu Park headquarters, 6°01’ N, 116°30’ E, 1400 – 1450 m, ♂ fl., 3 Jan. 1984, Beaman et al. 8212 (holotype MO!; isotypes GH!, K!, L!, MICH!, NY!).

Shrub or small tree to 5 m high and 5 cm diam. Bark smooth, grey. Twigs slender, somewhat zigzag and frequently branched, 0.8 – 1.5 mm in diam., initially pubescent with minute appressed tawny to brown hairs, glabrescent with age. Leaves variable in shape, chartaceous, glabrous above, glabrous to sparsely pubescent below at maturity, lanceolate to ovate to obovate-elliptic, base acute to attenuate, apex acute to caudate, margins flat to slightly revolute, (5 – ) 6 – 13 ( – 18) cm long, 1.5 – 4.5 cm wide; midrib impressed above, raised below, secondary veins 3 – 5 ( – 6) pairs, impressed above, raised below, veins converging to ± parallel, upper pairs often joining near the margin, tertiary veins flat above, scarcely raised below, weakly percurrent; petiole narrowly grooved, 0.4 – 0.6 ( – 1) cm long, sparsely pubescent to glabrescent. Inflorescences axillary, on mature portions of twigs, often from flowering short shoots, 1 – 2 per axil. Male inflorescences with slender peduncle 0.2 – 0.8 ( – 1.5) cm long, with up to 4 branches 2 – 3 mm long, these with up to 4 flowers on pedicels 1 – 2 mm long, inflorescences typically ~ 1 – 1.5 cm long overall, with 2 – 15 flowers. Male flowers: calyx cupular, minutely toothed, sparsely pubescent, 1 – 1.5 mm across; petals 4, white, 3.5 – 4 mm long, glabrous, stamens 4, exserted 1 mm, 4.5 – 5 mm long, pubescent dorsally at the connective with a tuft of clavate hairs and ventrally below the anther with scattered hairs, ovary rudiment minute. Female inflorescences axillary, peduncle 0.2 – 0.5 cm long, bearing up to 4 pedicels 1 – 3 mm long (elongating to 0.5 cm in fruit), up to 4 flowers per inflorescence, axes pubescent with minute appressed hairs. Female flowers: calyx cupular, petals glabrous, staminodes not seen, ovary glabrous, narrowly obconic, 2 mm long, stigma capping the ovary, 1 mm across. Fruit glabrous, reportedly white (fide Clemens & Clemens 35031) to pink (fide Clemens & Clemens 50013) but not necessarily at maturity, obovoid to clavate, less commonly ovoid or cylindrical, sometimes curved, 327 base acute to attenuate, very base swollen, apex usually abruptly contracted and slightly beaked, 1.2 – 1.5 cm long, 0.6 – 0.7 cm wide, stigma 2 – 2.5 mm in diam., inner mesocarp with 7 longitudinal ridges, several ridges usually quite prominent.

DISTRIBUTION. Borneo. SPECIMENS EXAMINED. MALAYSIA. Sabah, Mt. Kinabalu, Penibukan, 1200 – 1500 m [4000 – 5000 ft.], Dec. 1932, Clemens & Clemens s.n. (A!, L! [2 sheets] NY!); ibid, 17 Jan. 1933, Clemens & Clemens s.n. (K!, L!, UC!); ibid, 1200 – 1500 m [4000 – 5000 ft.], buds, 28 Dec. 1932, Clemens & Clemens 30487 (A!, BM!, L!, NY!); ibid, 1200 – 1500 m [4000 – 5000 ft.], imm. fr., 11 March 1933, Clemens & Clemens 35031 (A!, BM!, L!, NY!); ibid, ridge near Dahobang River, 1000 m [3300 ft.], ♂ buds, 27 Sept. 1933, Clemens & Clemens 40477 (A!, BM!, G n.v., K!, L!, MICH!, NY!, UC!); ibid, near Pinokok, 1980 m [6500 ft.], ♂ fl., 27 Oct. 1933, Clemens & Clemens 40937 (A!, BM!, K!, NY!, UC!); ibid, near Pinokok falls, 1830 m [6000 ft.], imm. fr. 18 Oct. 1933, Clemens & Clemens 50013 (A!, K!, NY!); Lobang, fr., Nov. 1915, Clemens 10321 (A!, L!, PNH!); Ranau District, Tenompok Ridge along Tamparuli – Ranau Road 6 km W of Kinabalu Park headquarters, 6°01’ N, 116°30’ E, 1400 – 1450 m, ♂ fl., 3 Jan. 1984, Beaman et al. 8212 (holotype MO!; isotypes GH!, K!, L!, MICH!, NY!); Crocker Range, Bukit Lugas, Kg. Himbaan 8.5 km SE of Tenompok, 5°57’ N, 116°34’ E, 1250 m, imm. fr., 29 April 1984, Beaman et al. 9501 (K!, L!); ibid, 1250 – 1300 m, 7 July 1984, Beaman et al. 10575 (GH!, K!, L!, MO!); Jalan liring Sosopodon, 1400 m [4600 ft.], ♀ buds, imm. fr., 4 Jan. 1963, Tikau SAN 33713 (K!, SAN n.v.); Liwagu Sosopodon near Kundasang, 1200 m [4000 ft.], imm. fr., 6 Jan. 1965, Taipin SAN 47950 (K!, L!); Minitindok Gorge, imm. fr., Nov. 1915, Clemens 10436 (A!, PNH!); Tambunan District, Crocker Range, km 64 on Kota Kinabalu – Tambunan Road, 5°46’ N, 116°21’ E, 1250 m, buds, 27 April 1984, Beaman et al. 9498 (K!, L!); Trusmadi Forest Reserve above Ulu Koingaran River, 1830 m [6000 ft.], ♂ buds, 28 Oct. 1964, Mikil SAN 44333 (K!, L!, SAN n.v.); Rafflesia Virgin Jungle Reserve, fr., 9 Aug. 1990, SAN 130753 (K!, L!); Penampang District: Crocker Range, km 49.5 on Kota Kinabalu – Tambunan Road, 5°50’ N, 116°20’ E, 1350 – 1500 m, ♂ fl., 3 July 1984, Beaman et al. 10446 (GH!, K!, L!, 328

MICH!, MO!); Dallas, 900 m [3000 ft.], buds, 21 Aug. or 1 Sept. 1931, Clemens & Clemens 26254 (26148) (A!, BM, K!, L!, NY!, UC!); ibid, 900 m [3000 ft.], ♂ buds, 15 Dec. 1931, Clemens & Clemens 27548 (A!, BM!, G n.v., K!, L!, NY!, UC!); Keningau District, Mt. Trusmadi Forest Reserve, 120 – 150 m [400 – 500 ft.], imm. fr., 23 Aug. 1977, Madani SAN 87188 (K!, L!);Kinabalu, Kadamaian, 1370 m [4500 ft.], fr., Haviland 1243 (K!); Sarawak, Baram, Ulu Melinau, imm. fr., 12 Aug. 1958, Ashton BRUN 3232 (BO n.v., K! [2 sheets], L!); 5th Division, Limbang, G. Pagon, G. Pagon Periok, 730 m, imm. fr., 30 July 1984, Awa & Lee S.47573 (K!); ibid, 900 m, buds, 8 Aug. 1984, Awa & Lee S.47735 (K! [2 sheets], KEP n.v., L, MO!, SAN n.v.); 4th Division, G. Api, ulu Melinau, 180 m [600 ft.], imm. fr., 11 Sept. 1970, Chai S.30392 (K!, L); ibid, 140 m [450 ft.], buds, 11 Sept. 1970, Chai S.30398 (A, K!, L, SAN n.v., SING n.v.); Baram District, Entoyut River, buds, 13 Nov. 1894, Hose 700 (K!, NY!). BRUNEI. Temburong, Sungai Temburong Machang, 200 m, ♂ buds, 21 Aug. 1990, Wong WKM 1977 (K!); Temburong, Amo, Ulu Belalong, 4°29’ N, 115°11’ E, 900 m, fr., 22 Feb. 1992, Dransfield et al. JD7156 (K! [2 sheets], L!); ibid, 4°23.310’ N, 115°11.195’ E, 500 m, buds, 23 Jan. 1994, Dransfield et al. 7433 (A!, K!, L!); Temburong, Kuala Belalong National Park, imm. fr. 21 Feb. 1994, Nangkat et al. BRUN 15041 (A!, K!, L!); Belait, Labi, Tenajor, Jalan Bukit Melayan, 4°26’ N, 114°27’ E, 30 m, ♂ buds, 10 July 1995, Ismail et al. BRUN 16861 (K!).

The following specimens are somewhat ambiguous. They probably belong to Gomphandra borneensis, but they might be G. cumingiana. Tenompok, 1500 m [5000 ft.], imm. fr., 27 Jan. 1932, Clemens & Clemens 28114 (A!, K!, NY); ibid, 1500 m [5000 ft.], imm. fr., 10 Feb. 1932, Clemens & Clemens 28226 (A!, BM!, BO n.v., K!, L!, NY!); ibid, 1500 m [5000 ft.], imm. fr., 11-12 Feb. 1932, Clemens & Clemens 28365 (A!, K! [Feb. 11], UC!); ibid, 1500 m [5000 ft.], imm. fr., 30 Jan. 1932, Clemens & Clemens 28365 A (K!); Sandakan District, Bukit Tingka Kinabatangan, 670 m [2200 ft.], fr., 24 Nov. 1960, Meijer SAN 23286 (K!); Ranau District, Kampung Bundu Tuhan, Pitas, Kg. Himbaa, 5°57’11” N, 116°33’2” E, ♂ fl., 29 June 1993, Soibeh 247 (K!). 329

cf. G. cumingiana. Ranau District, Lohan River, 6°00’ N, 116°41’ E, 700 – 900 m, ♂ buds, 5 April 1984, Beaman et al. 9220 (GH!, K!). Twigs with spreading pubescence. Keningau District, Mt. Trusmadi Forest Reserve, 120 – 150 m [400 – 500 ft.], imm. fr., 23 Aug. 1977, Madani SAN 87188 (K!).

HABITAT. Montane dipterocarp forest; oak-laurel forest; primary forest; steep slope; ultramafic soil; clay soil and sandstone; limestone boulders; 500 – 1500 m. Leaf galls present along veins. CONSERVATION STATUS. Least Concern (LC). VERNACULAR NAME(S). Kerak nasi (Sarawak), jirak (Ib., Brunei). NOTES. Gomphandra borneensis is superficially similar to G. quadrifida and G. oligantha in terms of leaf and fruit shape, but both of the latter species have terminal inflorescences. Gomphandra borneensis is most likely to be confused with G. cumingiana, which grows in the same areas in Borneo. The two species can overlap in leaf morphology, but a discriminant analysis (see Chapter 4) confirmed that they are separate taxa. Gomphandra cumingiana has larger leaves with more veins, is persistently pubescent abaxially, and has pubescent fruit. Gomphandra cumingiana also has relatively straight, sparingly branched twigs. In contrast, many herbarium specimens of Gomphandra borneensis look somewhat messy, with many short branches and swollen nodes where several accessory buds have produced branches or inflorescences. Very short internodes are often present at the end of a season’s growth, giving the appearance of opposite leaf scars at intervals along the twigs. In the field, it may be possible to distinguish the two species by their habits. 330

2. Gomphandra capitulata (Jungh. & de Vriese) Becc. (1877: 111). Aralia capitulata Jungh. & de Vriese (1846: 17). Lasianthera capitulata (Jungh. & de Vriese) Miq. (1856: 791). Stemonurus capitulatus (Jungh. & de Vriese) Kuntze (1891: 112). Type: Sumatra, Tobing, Junghuhn s.n. (lectotype L! [L 0014740]). Gomphandra nyssifolia King (1895: 114). Stemonurus nyssifolius (King) R. A. Howard (1940: 468). Type: Malaysia, Perak, Larut, 1050 – 1220 m [3500 – 4000 ft.], ♀ fl., July 1884, King’s Collector 6406 (CAL! (selected by Sleumer 1969), isolectotypes BM, CAL!, G, K! [2 sheets], L!, P!). Nyssa sessiliflora Koord. (non Hook.), Hall. f., Meded. Rijksherb. I (1910) 13 [Pl. Jungh. Ined. n. 57].

Small tree 5 – 20 ( – 35) m, up to 60 cm in diam. Bark grey brown, smooth. Twigs 2 – 3 mm in diam., with a decurrent ridge below the insertion of the petioles, terminal buds pubescent with minute appressed hairs, twigs glabrescent with age. Leaves chartaceous, glabrous, 11 – 20 × 4 – 8.5 cm, elliptic to ovate or obovate, apex acute to acuminate, base attenuate to acute, margin flat to slightly revolute; midrib sunken above, raised below, secondary veins 5 – 6 ( – 7) pairs, flat to raised above, raised below, somewhat steeply ascending, vein course parallel, usually not joining near the margin, tertiary veins obscure above, raised below and distinctly percurrent; petioles grooved, 0.7 – 1.5 cm × 1.5 – 2 mm, glabrescent. Inflorescences axillary, 1 – 3 per axil, capitate, peduncle 0.5 – 1.5 cm long, bearing 0 – 3 very short branches to 2 mm long, with up to 7 sessile (rarely pedicellate) flowers in female plants and 15 flowers in male plants, axes pubescent with short appressed hairs. Male flowers: calyx cupular, slightly lobed, 1 mm across, pubescent; petals 5, whitish, coherent to free, 3 – 4 mm long, pubescent; stamens 5, exserted, 5 mm long, filaments pubescent ventrally below the anthers; ovary rudiment pubescent. Female flowers: calyx cupular, slightly lobed, 1 – 2 mm across, pubescent; petals 5, coherent to free, 3 – 4 mm long, pubescent; staminodes 5, slightly exserted, 4 mm long, densely pubescent with short clavate hairs ventrally below the anthers; ovary 331

cylindrical, 3 – 4 mm long, with short appressed pubescence except for the glabrous base, stigma 1 – 1.5 mm across. Fruit reportedly white when ripe, sparsely pubescent, obovoid to oblongoid, (1.8 – ) 2 – 2.4 × (0.6 – ) 0.7 – 0.8 cm, apex obtuse, very base swollen, inner mesocarp with ca. 10 prominent longitudinal ridges, stigma displaced towards sulcus, 1.8 – 2.4 mm across.

DISTRIBUTION. Indonesia, Malaysia. SPECIMENS EXAMINED. INDONESIA. Borneo, East Kalimantan, W. Koetai [Kutei, Telen River valley], no. 36, near Long Petah, 550 m, buds, 10 Sept. 1925, Endert 3125 (A!, BO n.v., K!, L!). HABITAT. Forest, hilly country, 550 m. NOTES. Gomphandra capitulata has only been collected once in Borneo. The specimens are not in especially good shape, but the twigs, leaves, and inflorescences are distinctive and allow a positive identification. Appropriate habitat may no longer exist in the Telen River valley, but Borneo may still have a disjunct population of this species.

15. Gomphandra cumingiana (Miers) Fern.-Vill. (1880: 46). Stemonurus cumingianus Miers (1852: 42). Type: Philippines, Cuming 796, (lectotype K!; isotypes BM n.v., C! photo, CGE n.v., FI n.v., G n.v., K!, L! [3 sheets], P! [2 sheets], SING n.v., UPS n.v.). Stemonurus agusanensis Elmer (1915: 2689). Gomphandra agusanensis (Elmer) Merr. (1923: 489). Type: Philippines, Mindanao, Agusan del Norte Province, Cabadbaran, Mt. Urdaneta, fr., Oct. 1912, Elmer 14018 (lectotype of Stemonurus agusanensis A!; isolectotypes BISH!, F!, K!, L! [2 sheets], MO!, NY!, P!, PNH!, U!, US!).

Shrub or tree 2 – 15 m tall, to 30 cm diam. Bark smooth, greyish to greyish green. Twigs somewhat zigzag, initially densely pubescent with short, spreading tawny to reddish hairs, eventually glabrescent, young twigs 1 – 1.5 mm in diam., terminal bud densely pubescent, often composed of several dormant leaves. Leaves chartaceous, ovate to 332 elliptic, occasionally oblong to obovate, apex abruptly acuminate, base rounded to acute, glabrous above except along midrib, sparsely to moderately pubescent below, somewhat glabrescent with age, (6.5 – ) 9 – 18 ( – 26) × (2.5 – ) 3.5 – 7 ( – 12.5) cm, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 5 – 7 ( – 10) pairs, flat to sunken above, raised below, vein course parallel to somewhat converging, upper veins tending to join near the margin, tertiary veins flat above, raised below, distinctly percurrent; petiole grooved, (0.3 – ) 1 – 1.5 cm long, pubescent. Inflorescences axillary (rarely terminal?), 1 – 3 per axil, axes densely pubescent with appressed hairs. Male inflorescences with common peduncle 0.1 – 0.3 cm long, bearing up to 4 branches 0.1 – 0.2 ( – 0.4) cm long, branches serving as pedicels to shortly rebranched or bearing a somewhat scorpioid cyme of 2 – 5 flowers, flowers subsessile or on pedicels to 2 mm long, 5 – 15 ( – 50+) flowers per inflorescence. Male flowers: calyx cupular, entire to minutely apiculate, sparsely to moderately pubescent, 1 mm across; petals (4 – ) 5, sparsely pubescent at the apex in bud, glabrescent, white to yellowish- green, 3 mm long; stamens (4 – ) 5, strongly exserted, 4 – 5 mm long, densely pubescent dorsally at the connective with a long tuft of clavate hairs, pubescent ventrally below the anthers; ovary rudiment minute. Female inflorescences more compact than in Philippine specimens, with stout peduncle 0.1 – 0.3 cm, bearing several very short branches 1 – 2 mm long, each with up to 4 flowers, pedicels 1 – 3 mm long, usually not elongating in fruit, (3 – ) 5 – 10 ( – 15) flowers per inflorescence. Female flowers: calyx cupular, petals 4 mm long, staminodes (4 – ) 5, 3 – 4 mm long, with a tuft of clavate hairs dorsally at the anther cells, ovary sparsely to densely pubescent, sometimes glabrescent with age, 2 – 3 mm long, stigma 1 – 1.5 mm across. Fruit ovoid to ellipsoid, apex usually slightly beaked, base rounded to truncate, rarely attenuate, very base sometimes swollen, (1 – ) 1.5 – 1.9 × (0.6 – ) 0.7 – 0.8 cm, sparsely pubescent, reportedly whitish to apricot (but perhaps not ripe), inner mesocarp with 8 – 14 longitudinal ribs, stigma often displaced towards sulcus, 2 – 3 mm in diam., usually grooved on one side or with a central depression. DISTRIBUTION. Borneo, Philippines. 333

SPECIMENS EXAMINED. MALAYSIA. Sabah, Mt. Kinabalu, imm. fr., 1932, Clemens & Clemens s.n. (NY!); Tenom District, Crocker Range, above Kallang Waterfall, 630 m, ♂ buds, 8 May 1988, Andrews 853 (K! [2 sheets]); Sandakan District, Kabili-Sepilok Forest Reserve, ♀ fl., imm. fr., 1 Dec. 1993, Wong & Buhari WKM 2583 (E n.v., K! [2 sheets], KEP n.v., L!); ibid, ♂ fl., 1 Dec. 1993, Wong & Buhari WKM 2584 (K!, L!); Bettotan, ♂ fl., 29 July 1927, Kloss 19013 (NY!, SING n.v., UC!); Sepilok Forest Reserve, Dj. Kabili, ♂ fl., 20 Sept. 1963, Meijer SAN 34312 (K!); Sungai Kun- Kun, imm. fr., 30 Mar. 1984, Sigin et al. SAN 56847 (K!, L!); Bukit Malawi Labuk Road, 245 m [800 ft.], fr., 22 June 1964, Mikil SAN 46666 (K!); Lungmanis Forest Reserve, imm. fr., 20 Oct. 1965, Kanis SAN 54341 (K!, L!); Tambunan District, Trusmadi Forest Reserve, above Koingaran River, 1675 m [5500 ft.], ♂ fl., 30 Oct. 1964, Mikil SAN 41751 (K!, L!, SAR n.v.); Ranau District, Kukit Kipungit above Poring Hot Springs, 6°03’ N, 116°42’ E, 700 m, ♀ fl., imm. fr., 9 Dec. 1983, Beaman et al. 7832 (K!, L!); Ulu Tungud Forest Reserve, Ulu Sungai Tungud, 5°52’05” N, 116°59’09” E, 500 m, imm. fr., 25 July 2005, Julia et al. SAN 146821 (K!, KEP n.v., SAN n.v., SAR n.v.); Kota Belud District, Melangkap Kappa, 6°09’ N, 116°31’ E, 600 – 700 m, ♀ fl., fr., 15 Feb. 1984, Beaman et al. 8591 (GH!, K!, L!); Lahad Datu District, Segama River, 5°10’ N, 117°56’ E, 250 – 300 m, fr., 12 June 1984, Beaman et al. 10118 (K!, L!); Lamag District, Bintang Mas logging area, Karamuak, ♂ fl., 18 June 1975, Madani SAN 81199 (K!, KEP n.v., L!, SAR n.v., SING n.v.); Sogo-Sogo, 11 miles from K. Tongod, fr., 19 Nov. 1979, Madani SAN 91113 (K!, L!); Kalabakan District, Benaword, ♀ fl., 21 April 1980, Fedilis & Sumbing, SAN 91814 (K!, L!); Kuala Penyu District, Gunong Limbayong Mansud, 15 m, ♂ buds, 22 Feb. 1984, Amin & Haya SAN 102271 (K!, L!); Tongod District, Imbak Valley, 80 m [270 ft.], ♂ buds, 21 May 2004, Sugau et al. SAN 145219 (K!); Telupid District, Bidu-Bidu Forest Reserve, along Bidu-Bidu River, 5°45’ N, 117°17’ E, 55 m, 14 July 2006, Suzana et al. SAN 148347 (K!, KEP n.v., L n.v., SAN n.v., SAR n.v.); Bukit Tangkunan, 5°39’ N, 117°13’ E, 100 – 400 m, imm. fr., 31 March 1977, Anderson 4304 (UC!); Dallas, 915 m [3000 ft.], imm. fr., 5 Nov. 1931, Clemens & Clemens 26943 (A!, K!, L!, NY!); ibid, 915 m [3000 ft.], fl., fr., 6 Nov. 1931, Clemens & Clemens 30322 (A! ♀, K!, L!, NY! ♂); Kampung Lakang, fr., 2 Sept. 1996, Andau 581 334

(K!); Kampung Nalumad, Mentimagas, ♂ buds, 7 Sept. 1996, Andau 613 (K!); Sarawak, Limbang, Kunaeng, ♂ buds, Haviland 777 (K!, SAR n.v., SING n.v.); 4th Division, Miri District, Gunong Subis near Sekaloh River, imm. fr., 30 Nov. 1966, Tan & Wright S.27263 (K!); Kapit District, between Sungei Balang and Sungei Balleh, 1°35’ N, 114°30’ E, 520 m [1700 ft.], imm. fr., 2 July 1969, Anderson & Paie S.28285 (A!, K!, L!); Ulu Mayeng, Kakus, 200 m, fr., 24 July 1964, Luang S.21789 (A!, BO n.v., K!, KEP n.v., L!, SAN n.v., SING n.v.); Miri District, Lambir National Park, Ulu S. Jangkang, imm. fr., 25 Oct. 1983, Mohtar et al. S.47149 (K!, KEP n.v., L!, SAN n.v.); Lambir Hills National Park, imm. fr., April – May 1992, LaFrankie 7158 (A!); Baram District, Baram, 29 Nov. 1894, Hose 154 (BM!, K! [2 sheets], L!); Entoyut River, ♂ buds, Dec. 1894, Hose 375 (BM!, K! [2 sheets], L! [2 sheets], NY!); ibid, ♂ buds, Nov. 1894, Hose 455 (BM!, K!, L! [2 sheets], NY!);. INDONESIA. E. Kalimantan, Kutai Barat, Jelemuk, Kelian, 0°04’ S, 115°26’ E, 450 m, imm. fr., Sidiyasa et al. 2980 (K!, L n.v.); Desa Pembeliangan, Sebuku-Nunukan, 4°00’ N, 117°02’ E, 45 m, ♀ buds, fr., 5 May 2000, Ambriansyah AA 2302 (A!, E!, K!, L! [2 sheets]); Berau, Labanan, Inhutani I area, 1.58.904 N, 117.15.069 E, 60 m, fr., 6 May 1997, Slik et al. Berau548 (A!, BO n.v., K!, L!, WAN n.v.); Central Kutei, G. Kelopok near Tabang, 30 m, imm. fr., 12 April 1955, Kostermans 10423 (K!, L!, US!); Balikpapan, Sembodja, ♂ buds, 24 Sept 1951, Sauveur K12a (A!, K!, L!); Tabang, Belajan [Belayan] River, 0 – 100 m, 25 Aug. 1956, Forman 525 (K! [2 sheets], L!, PNH!, US!); W. Kalimantan, Serawai, Uut Labang, 0°36’6.1” S, 112°38’56.2” E, 750 m, ♂ buds, 11 Oct. 1995, Church et al. 2410 (A!, CANB!, K!, L!).

cf G.. cumingiana. Sarawak, Bau District, Bau Hills, 1°25’20” N, 110°7’59” E, 100 m, ♂ fl., 10 Jan. 1996, Beaman et al. 11873 (K!).

HABITAT. Montane forest, 630 m; ultramafic soil; primary forest. PHENOLOGY. Flowers in September, October. VERNACULAR NAME(S). Sentikal (Iban); belian landak, miwi (Balikpapan area). NOTES. Gomphandra cumingiana is distinguished by the spreading pubescence on its leaves and twigs, its relatively short but many-flowered inflorescences, and its pubescent 335

ovaries. Specimens from Borneo differ somewhat from Philippine specimens in having generally shorter inflorescences with slightly smaller flowers, thicker pedicels and peduncles, and smaller, more varied fruit, but no consistent differences separate them. In time, the populations may become distinct enough to warrant treatment as subspecies, but for now the description above has been modified to reflect the tendencies of Bornean Gomphandra cumingiana. Gomphandra cumingiana is most similar to G. borneensis, which seems to be much more abundant on Mt. Kinabalu. Gomphandra borneensis can be distinguished by its more slender twigs which are not persistently pubescent with spreading hairs, its irregular branching, its generally smaller leaves, more slender peduncles and pedicels, glabrous ovaries, and obovoid fruit with a tapering base. Some specimens of Gomphandra borneensis are difficult to distinguish from G. cumingiana, especially if reproductive material is lacking, suggesting that the two species may be closely related.

30. Gomphandra kinabaluensis var. kinabaluensis Schori (Kew Bulletin). Type: Malaysia, Borneo, Sabah, Mt. Kinabalu, Marai Parai, 1550 m [5000 ft.], fr., 30 March 1933, Clemens & Clemens 32462 (holotype K!; isotypes A!, BM!, BO n.v., G n.v., L!, NY!, UC!).

Tree 9 – 23 m tall, to 10 cm diam. Twigs slightly zigzag, 1.5 – 2.5 mm in diam., initially covered with minute appressed pubescence, glabrescent with age. Leaves variable, thinly to thickly coriaceous, ovate to ovate-elliptic or obovate, acute to abruptly acute or acuminate, base rounded to acute, (4.5 – ) 8.5 – 12.5 ( – 15.5) × (2.0 – ) 3.0 – 6.1 cm, margin slightly to distinctly revolute; midrib impressed above, raised below, secondary veins 5 – 6 ( – 7) pairs, obscure, flat, slightly raised, or slightly impressed above, raised below, upper pairs usually joining near margin, tertiary veins not visible to slightly raised on both sides, weakly reticulate; petioles 0.7 – 1.8 cm × 1 – 2 mm, grooved above, glabrescent with age. Inflorescences axillary, sometimes from accessory buds. Male inflorescences with peduncle (0.6 – ) 1 – 3 cm long, bearing 2 – 3 branches 2 – 5 mm long, each branch with 2 – 5 crowded sessile or shortly pedicellate flowers, up to 10 336

flowers per inflorescence. Male flowers: calyx cupular, 1 – 1.5 mm across, pubescent, lobed, petals 4 – 5, free, white, glabrous, 3 – 4 mm long, stamens 4 – 5, not or scarcely exserted, filaments 3 – 4 mm long, with short papillose hairs on inner face, ovary rudiment glabrous. Female inflorescences with peduncle 0.6 – 2 cm long, bearing 2 – 4 flowers on pedicels 1 – 4 mm long (pedicels elongating in fruit). Female flowers: calyx pubescent, lobed, 1 mm across, petals 4 – 5, free to base, white to cream, 4 mm long, glabrous, staminodes 4 – 5, 3 mm long, with at least a few short papillose hairs on the inner face, ovary glabrous, 3 – 4 mm long (Clemens & Clemens 32597). Fruit ellipsoid, pale pinkish (fide Clemens & Clemens 32462) to salmon-pink (fide Clemens & Clemens 35030) when mature, 1.4 – 1.9 × 0.6 – 0.8 cm, base sometimes very slightly swollen, apex asymmetric when dried, stigma 2 – 2.5 mm in diam., displaced toward sulcus, inner mesocarp with 8 – 10 low ridges.

DISTRIBUTION. Malaysia, Sabah, Mt. Kinabalu, Marai Parai and Penibukan. SPECIMENS EXAMINED. MALAYSIA. Sabah, Clemens & Clemens 31997 (L! pro parte); Marai Parai, 1550 m [5000 ft]., imm fr., 22 March 1933, Clemens & Clemens 32260 (A!, BM!, L!, NY!); S of camp, ♀ buds, 24 March 1993, Clemens & Clemens 32341 (BM!, L!); 1550 m [5000 ft.], fr., 30 March 1933, Clemens & Clemens 32462 (K! holotype, isotypes A!, BM!, BO n.v., G n.v., L!, NY!, UC!); ♂ buds, 4 April 1993, Clemens & Clemens 32590 (A!, BM!, BO n.v., L!, NY!, UC!); ♀ buds, 4 April 1933, Clemens & Clemens 32597 (A!, BM!, BO n.v., G n.v., L!, NY!, UC!); 5 April 1933, ♂ buds, Clemens & Clemens 34030 (A! [as 35030], BM! photo, L!, NY!); 2150 m [7000 ft.], ♂ buds, 23 – 26 May 1933, Clemens & Clemens 35039 (L!, NY!); Penibukan, ridge E of camp, 1350 m [4500 ft.], ♂ buds, 11 Nov. 1932, Clemens & Clemens 50307 (A!, BM!, G n.v., K!, L!, NY!, UC!). HABITAT. Montane forest, 1350 – 2150 m. CONSERVATION STATUS. Endangered: EN B2ab(iv,v). PHENOLOGY. Flowers in March, April. NOTES. Gomphandra kinabaluensis is similar to G. lysipetala but differs in its leaves, which are generally thicker and wider, usually with a clearly revolute margin, and in its 337

fruits, which are larger and glabrous. The leaf morphology is variable, with some ovate and quite broad, while others are longer and obovate-ellipsoid, but intermediates between the extremes can be found. The petals and stamens are similar to those of Gomphandra lysipetala, but the ovary of G. kinabaluensis is glabrous and the inflorescences are branched, with female flowers always borne on pedicels. Clemens & Clemens 35039 and 35030 have leaf morphology that begins to approach that of Gomphandra kinabaluensis var. clemensiorum, but the venation does not match that variety. Clemens & Clemens 35039 is from 2150 m, and it may be that leaf morphology changes within Gomphandra kinabaluensis in response to increased elevation and exposure. Beaman et al.’s (2001) G. sp. 3 belongs here, as do some of their citations under Gomphandra indet.

31. Gomphandra kinabaluensis var. clemensiorum Schori (Kew Bulletin). Type: Malaysia, Borneo, Sabah, Mt. Kinabalu, head of Kinataki River, 2700 m, fr., 26 Feb. 1933, Clemens & Clemens 31997 (holotype A!; isotypes BM! photo, BO n.v., G n.v., K!, L! [2 sheets], NY!, UC!).

Tree 12 – 15 m high. Twigs somewhat zigzag, 2 – 3 mm in diam., initially pubescent with minute appressed hairs, glabrescent with age, leaves spaced 1 – 1.5 cm apart along the twigs. Leaves coriaceous, glabrous above and glabrescent below, with very short (0.1 mm long) appressed hairs (not visible without magnification), lanceolate-elliptic to slightly obovate-elliptic, base acute to attenuate, apex acute to very shortly acuminate, margins flat to slightly revolute, (4.5 –) 7 – 9.5 × 2 – 3 ( – 4.5) cm; midrib impressed above, raised below, secondary veins 5 – 7 ( – 8) pairs, impressed above, raised below, vein course ± parallel, curving but generally not joining near the margin, tertiary veins not evident; petiole narrowly grooved, laterally compressed when dry (1 mm wide × ca. 2 mm high from adaxial to abaxial sides), 0.5 – 1 cm long, initially pubescent with very short appressed hairs, later glabrescent. Male inflorescences and flowers not known. Female inflorescences axillary, on mature twigs, peduncle 0.5 – 1.5 cm long, bearing 2 – 4 irregular branches, each 1 – 3 mm long and bearing 1 – 3 flowers, flowers subsessile or on pedicels 1 – 3 mm long, up to ca. 10 flowers per inflorescence, axes pubescent with 338

minute appressed hairs. Female flowers not seen at anthesis, buds with 4 – 5 glabrous petals. Fruit evidently glabrous, salmon-pink when ripe (fide Clemens & Clemens 31997), ellipsoid-obovoid, base rounded, very base swollen, apex slightly asymmetrical with the stigma a bit displaced toward the sulcus, 1.8 – 2.7 × 0.9 – 1.2 cm, stigma 2 mm in diam., inner mesocarp with 8 – 11 low longitudinal ridges.

DISTRIBUTION. Borneo, Sabah, Mt. Kinabalu. Endemic. SPECIMENS EXAMINED. MALAYSIA. Sabah, Mt. Kinabalu, head of Kinataki River, 2700 m, fr., 26 Feb. 1933, Clemens & Clemens 31997 (holotype A!; isotypes BM! photo, BO n.v., G n.v., K!, L! [2 sheets], NY!, UC!). HABITAT. River valley, 2700 m. CONSERVATION STATUS. Critically Endangered: CR B2ab(iii,v). NOTES. Gomphandra kinabaluensis var. clemensiorum is only known from the type collection. The original label on the holotype specimen gives the collection date as February 26, 1933. The collection number 31996 is written on the label, but that number seems to refer to a fungus, as the top of the label indicates 31997 as the host of the fungus. The correct number is here treated as 31997. Labels on the UC and L duplicates incorrectly list March as the date of collection, and the L label includes field data on associated species that is not found on any other sheet. Additional collections might prove this taxon to be a separate species, rather than a variety of Gomphandra kinabaluensis, but at this time it is more prudent to describe it as a variety. Gomphandra kinabaluensis var. clemensiorum is distinctive with its very coriaceous, lance-elliptic leaves and its large fruit. It is possible that this variety is merely a high-elevation form of Gomphandra kinabaluensis. The species may have formed ecotypes on Mt. Kinabalu, but with the limited collections available, it is impossible to say at this point. Taken alone, the Clemens collection seems to be quite different from typical Gomphandra kinabaluensis, until one looks at the leaf plasticity in the taxon. Gomphandra kinabaluensis is similar to G. lysipetala, but the latter species has pubescent ovaries and fruit and a different branching pattern in the infructescences.

339

32. Gomphandra lamanii Schori (Kew Bulletin). Type: Indonesia, Borneo, Kalimantan Barat, Ketapang, Gunung Palung National Park, 40 m, fr., 22 Oct. 1969, Laman et al. TL79 (holotype A!; isotypes BISH!, CANB!, E!, K!, L!, NY!).

Small tree to 10 m high and 10 cm diam. Bark smooth, light to dark grey. Twigs somewhat zigzag, initially pubescent with minute, reddish spreading hairs, glabrescent with age, youngest portions of twigs extremely slender, <1 mm in diam. Leaves chartaceous, ovate to ovate-ellipsoid, rarely lanceolate or obovate, base acute to rounded, apex acuminate to caudate, drip tip to 2 cm long, 5 – 11.5 × 1.5 – 3.5 cm; midrib sunken above, raised below, secondary veins 2 – 4 pairs, flat above, raised below, typically strongly looping 2 – 3 mm from the margin, lowest pair usually forming an intramarginal vein, tertiary veins flat above, flat to slightly raised below, distinctly percurrent and perpendicular to the midrib; petiole slender, (0.3 – ) 0.5 – 0.8 cm long. Inflorescences terminal or leaf-opposed on most recent growth, axillary (terminating short axillary branches) on mature growth, axes pubescent with reddish hairs. Male inflorescences with peduncle 0.5 – 1.5 cm long, bearing up to 3 branches, these to 1 cm, rebranched or not, up to 5 flowers per branch, subsessile or on pedicels to 2 mm long, 7 – 20 flowers per inflorescence. Male flowers: calyx cupular, apiculate, margin pubescent, especially in bud, 1.5 mm across; petals 4 ( – 5), greenish, (fide Laman et al. TL700), pubescent apically in bud, glabrescent and essentially glabrous in flower, 3 – 4 mm long, staminodes exserted, 4 – 6 mm long, pubescent ventrally below the anthers with clavate hairs, sparse dorsal tuft at the connective present or absent, ovary rudiment narrowly conical, glabrous. Female inflorescences with peduncle 0.5 cm long, with 1 ( – 2?) flowers. Female flowers: calyx cupular, 1.5 mm across, ciliate; petals white (fide Laman et al. TL79), not seen; staminodes not seen; ovary cylindrical, green when fresh, glabrous, cylindrical, 3 mm long. Fruit submature, ellipsoid, 1.8 – 2 × 0.6 – 0.7 cm, base truncate, apex attenuate, slightly beaked, inner mesocarp with c. 6 anastomosing longitudinal ridges, sulcus complex ridges prominent, stigma 1.5 mm across, displaced toward sulcus complex. 340

DISTRIBUTION. Borneo, W. Kalimantan; Sarawak (1 specimen). SPECIMENS EXAMINED. MALAYSIA. Sarawak, Bintulu Division, Tatau, Ulu Sungai Sanggan, Bukit Kana, 680 m, ♂ fl., 25 March 1995, Yii Puan Ching & Jugah S.71679 (K n.v., KEP n.v., L n.v., MO!, SAN n.v.). INDONESIA. Kalimantan Barat, Gunung Palung National Park, Cabang Panti Research Site, 1°13’ S, 110°6’ E, 40 m, submature fruit, 22 Oct. 1996, Laman et al. TL79 (holotype A!; isotypes BISH!, CANB!, E!, K!, L!, NY!); ibid, 40 m, ♂ fl., 9 March 1997, Laman et al. TL700 (A!, BO n.v., E!, K!, L!, NY!, WAN n.v.); Serawai, south of Uut Labang, 0°36’6.1” S, 112°38’56.2” E, 750 m, ♂ buds, 7 Oct. 1995, Church et al. 2266 (A!, BISH!, CANB!, E!, K!, L!, NY!); ibid, 1000 m, ♂ fl., 11 Oct. 1995, Church et al. 2421 (A!, BISH!, K!, L!). HABITAT. Disturbed lowland dipterocarp forest, on sandy red-yellow soil; primary dipterocarp forest, ridge and slopes, red clay soil; gentle slope near creek; 40 – 1000 m. CONSERVATION STATUS. Endangered: EN B1ab(iii). PHENOLOGY. Flowers were present in October and in March. ETYMOLOGY. The specific epithet honors Timothy Laman, a botanist and wildlife photographer who has worked diligently to increase awareness of Southeast Asia’s imperiled diversity. NOTES. Gomphandra lamanii is probably related to G. quadrifida (Bl.) Sleumer, which also has terminal inflorescences. The slender twigs, solitary female flowers, caudate leaves with unusual venation, and distinctly ridged fruit all distinguish Gomphandra lamanii from G. quadrifida. Gomphandra palustris Schori is the only other species in Borneo with terminal inflorescences, but it is restricted to peat swamps and has quite different leaves and fruit. More collections of Gomphandra lamanii are needed to complete the description of the female flowers and fruit. 341

33. Gomphandra longipedunculata Schori (Kew Bulletin). Type: Malaysia, Borneo, Sarawak, 1st Division, Bukit Merubang, Tebedu, 9 Feb. 1985, Mohtar et al. S. 49257 (holotype K! [2 sheets]; isotypes KEP n.v., L!).

Tree 12 m tall, 25 cm girth. Twigs straight, quickly glabrous, 2.0 – 3.5 mm in diam. Terminal bud falcate, pubescent with minute appressed hairs. Leaves thinly coriaceous, lanceolate-elliptic, smooth and shiny above when fresh, slightly shining on both surfaces when dry, glabrous or glabrescent above and below, base attenuate and decurrent onto petiole, apex acuminate, margin slightly revolute, 14 – 19 × 4 – 6 cm; petiole narrowly grooved above, glabrescent, 1.5 – 2 cm × 1.5 – 2.0 mm; midrib sunken above, strongly raised below and usually paler than the lower leaf surface, secondary veins 4 – 6 pairs, flat to slightly sunken above, strongly raised below, lowest pair steeply ascending, upper pairs converging and joining near the margin, tertiary veins flat above, raised below, weakly percurrent. Inflorescences axillary, on previous seasons’ growth. Male inflorescences unknown. Female inflorescences axillary but apparently located below or next to a supra-axillary bud that develops into a branch, axes with appressed reddish pubescence; peduncle 2 – 2.5 cm long, bearing 3 – 4 branches, each branch then rebranching 1 – 2 times, flowers sessile or on pedicels up to 3 mm long, up to ca. 30 flowers per inflorescence. Female flowers: calyx cupular, minutely apiculate, ciliate or sparsely pubescent, 2 mm wide, petals 4, glabrous, united except for the tips, 4 – 5 mm long, staminodes 4, not or scarcely exserted, bearing a tuft of clavate hairs ventrally below the anther cells and dorsally at the connective, ovary ridged when dry, 3 – 4 mm long, densely pubescent with reddish hairs except for a zone at the base and the apex, capped by a broader, ridged stigma ca. 3 mm across. Fruit unknown.

DISTRIBUTION. Malaysia, Borneo, Sarawak. Endemic. SPECIMEN. MALAYSIA. Sarawak, 1st Division, Bukit Merubang, Tebedu, 9 Feb. 1985, Mohtar et al. S. 49257 (holotype K! [2 sheets]; isotypes KEP n.v., L!). HABITAT. Logged-over mixed dipterocarp forest. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). 342

NOTES. Gomphandra longipedunculata is a striking species that does not closely resemble any other Gomphandra in Borneo. The leaves are attenuate at the base and apex, the inflorescences are located above a leaf scar but below an axillary branch, the peduncle is quite long, and the petals are larger than those of most other Gomphandra. The pubescent ovary is shared with other species, like Gomphandra cumingiana, G. lysipetala, and G. javanica of Java, but none of those species has a similar inflorescence structure or position or a similar leaf shape. The species is only known from the type collection.

34. Gomphandra lysipetala Stapf (1894: 139). Stemonurus lysipetalus (Stapf) Merr. (1921a: 356). Type: Malaysia, Sabah, Haviland 1207 (holotype K!; isotypes L! (fragment), SAR n.v.).

Tree to 27 m tall and 32 cm diam. Bark dark grey. Twigs slender, 1.5 – 2.5 mm in diam., initially covered with minute appressed pubescence, glabrescent with age. Leaves lanceolate to lance-elliptic, firmly chartaceous to coriaceous, base acute to attenuate, apex acute to acuminate, glabrous above, (5 – ) 7 – 10 × 1.5 – 3.5 cm; midrib slightly impressed above, raised below, secondary veins 3 – 5 pairs, somewhat converging toward margin, tertiary veins scarcely evident, delicately percurrent; petiole grooved, 0.5 – 1 cm × 0.5 – 1 ( – 1.5) mm. Inflorescences short, axillary, 1 – 2 per axil, axes densely pubescent with minute appressed hairs. Male inflorescences with peduncle 0.3 – 0.7 cm long, bearing up to 4 branches 1 – 2 mm long, flowers crowded and subsessile on the branches, up to ca. 20 flowers per inflorescence. Male flowers: calyx pubescent, minutely lobed, 1 – 1.5 mm across, petals 4 – 5, free, glabrous except a few tiny hairs at the petal apex,, 2.5 – 3 mm long, stamens equal to petals or slightly exserted, 2.5 – 3 mm long, glabrous on the dorsal side, bearing short papillose hairs on the ventral side, ovary rudiment conical with short hairs near the base, glabrous at the apex. Female inflorescences with peduncle 0.2 – 0.7 cm long, capitate with 2 – 8 flowers clustered at the apex of the peduncle, sessile or on pedicels to 1 mm long, pedicels often elongating in 343 fruit to 1 – 3 mm long. Female flowers: calyx cupular, lobed, pubescent, 1.5 – 2 mm across, petals 4 – 5, free, glabrous, 2.5 – 3 mm long, staminodes not exserted, 2.5 – 3 mm long, pubescent ventrally below the anther cells with papillose hairs, ovary cylindrical, 2.5 mm long, densely pubescent with minute appressed hairs, usually somewhat glabrescent during fruit development. Fruit cream near or at maturity, pubescent (with magnification),ellipsoid, base slightly tapered to rounded, apex rounded with stigma displaced toward sulcus, 1.3 – 1.4 × 0.5 – 0.7 cm, inner mesocarp with 8 low ridges.

DISTRIBUTION. Malaysia, Borneo, Sabah and Sarawak. Endemic. SPECIMENS EXAMINED. MALAYSIA. Beaman list: Sabah, Mt. Kinabalu. Haviland 1207 (holotype K!; isotypes L!, SAR n.v.); Mt. Kinabalu, Bembangan River, 1520 m [5000 ft.]; 3 March 1964, Chew & Corner RSNB 4642 (K!, L!); Ranau District, Kamborongoh/Layang trail, Kinabalu National Park, 2300 m [7500 ft.], 15 March 1966, Mikil SAN 56526 (K!, L!); Ranau District, mile 36.5 Ranau Road, 1370 m [4500 ft.], imm. fr., 19 Nov. 1962, Badak SAN 32392 (K!, L!); Kota Belud District, Tenompok area toward Kadamaian, 6° 00’ 52” N, 116° 31’ 59” E, 1500 m, 5 Jan. 1995, Beaman et al. 11174 (K!); Tenompok, 1520 m [5000 ft.], 25 April 1932, Clemens & Clemens 29394 (A!, K! [2 sheets], L!, NY!, UC!); Sarawak, Sungei Belaban (Path to Gunung Murut), Lawas, 1705 m [5600 ft.], imm. fr., 20 Sept. 1967, Paie S.26335 (A!, K!, L!). G. cf. lysipetala: Sarawak, 1st Division, Lundu, Gunung Keranji, 1350 m, ♀ fl., 25 April 1984, Awa & Paie S.46389 (K!, L! [2 sheets]). HABITAT. Secondary forest at hill slope on dark brown soil, 1220 m; submotane mossy forest, 1350 m; ridge at 1700 m. NOTES. Specimens identified as Gomphandra lysipetala by Sleumer have pubescent fruit. Gomphandra lysipetala was described from a beautiful specimen with male flowers. The species is distinguished by flowers that are (sub)sessile, its free petals, the short papillose hairs on the stamens and staminodes, and the pubescent fruit. The type locality of Gomphandra lysipetala is Mt. Kinabalu, but several specimens from Sarawak are included here. Paie S.26335 has thicker leaves and more secondary veins than the type, the specimen matches Gomphandra lysipetala in inflorescence features. More 344

collections from Sarawak may lead to the description of a separate subspecies or species. Gomphandra cumingiana has short inflorescences and pubescent ovaries and fruit, but its leaves are much larger, the flowers are never sessile, and the leaf and twig pubescence is somewhat spreading, not tightly appressed as in Gomphandra lysipetala. Awa & Paie S.46389 has larger ovate-oblong leaves, up to 13 cm long by 5 cm wide, and peduncles 1 – 1.2 cm long. It is treated as Gomphandra cf. lysipetala on account of its inflorescence structure and pubescent ovaries, though there is a possibility it represents an undescribed species.

35. Gomphandra macrosperma Schori (Kew Bulletin). Type: Malaysia, Sabah, Telupid District, Ruku-Ruku, 26 Aug. 1992, Madani SAN 133979 (holotype K!; isotype L!).

Small tree to 12 m high, 8 cm diam., bole cylindrical, smooth, bark pale. Twigs slightly zigzag, 2 – 3 mm in diam., youngest portion velutinous with minute hairs, somewhat glabrescent with age. Leaves firmly chartaceous to thinly coriaceous, glabrous above, sparsely pubescent below, especially on the veins, ovate-elliptic to slightly obovate- elliptic, apex abruptly acuminate, base acute to rounded, slightly asymmetrical, (7 – ) 12 – 19 × (3 – ) 5 – 7 cm, margin revolute; midrib impressed above, raised below, secondary veins 3 – 4 ( – 5) pairs, flat above, raised below, well-spaced and converging toward margin, upper two pairs sometimes brochidodromous, tertiary veins flat to obscure above, slightly raised below, delicately percurrent; petiole 1 – 1.5 cm long, grooved above, pubescent. Inflorescences and flowers unknown. Infructescences axillary, peduncle 0.7 – 1 cm long, unbranched with 1 fruit or 2 short pedicels 2 mm long, axes pubescent. Fruit glabrous, ellipsoid-obovoid, base rounded to attenuate, apex somewhat rounded, ripe color unknown, 2.6 – 3.7 × 0.9 cm, stigma 3.5 – 4 mm across, deeply grooved and displaced towards the sulcus, inner mesocarp with ca. 10 low ridges.

DISTRIBUTION. Malaysia, Borneo, Sabah, Beluran District, Telupid District. 345

SPECIMENS EXAMINED. MALAYSIA. Sabah, Beluran District, Kiabau, near Labuk Bay, 6 July 1981, Amin et al. SAN 93819 (K! [K000271873], L non inveni, SAR n.v.); Telupid District, Ruku-ruku, along stream, 26 Aug. 1992, Madani SAN 133979 (holotype K!; isotype L!). HABITAT. Ridge of hill and along stream. CONSERVATION STATUS. Endangered: EN B2ab(iii). NOTES. Gomphandra macrosperma is only known from two collections in Sabah. It does not closely resemble any other Bornean species of Gomphandra, and it can be distinguished by its very long fruit, its velvety terminal buds and young twigs, and the thinly coriaceous leaves with only a few veins. Madani SAN 133979 was chosen as the type based on its mature leaves and intact peduncle. Amin et al. SAN 93819 has much smaller, younger leaves that were not fully developed at the time of collection.

36. Gomphandra palustris Schori (Blumea). Type: Malaysia, Sarawak, 3rd Division, Batang Igan, Sungai Tutus Logging Camp, 6 Sept. 1970, Haji Bujang S.30259 (holotype A!; isotypes K!, L!).

Small tree to 25 m, 40 cm diam.; trunk fluted (to 2 m) or not; bark smooth to narrowly longitudinally fissured with a somewhat scabrous surface, gray or pale yellowish gray, inner bark orange. Young twigs pubescent with minute, somewhat appressed hairs, eventually becoming glabrescent, 1.5 – 3.0 mm in diam., terminal buds falcate, densely covered with light brown pubescence. Leaves ovate-ellipsoid to obovate or almost orbicular, frequently conduplicate, apex acute to shortly and abruptly acuminate, base acute, a bit decurrent onto the petiole, margin flat to slightly revolute, coriaceous, glabrous above when mature, sparsely pubescent along the veins below, shining above when dried, matte below, 5.6 – 13 × 2.6 – 6.7 cm; midrib sunken above, raised below, secondary veins 4 – 6 pairs, impressed above, upper pairs joining 1 – 2 mm from the margin, concolorous above, darker than the leaf surface below and raised, tertiary veins generally not visible above, somewhat raised below, percurrent and perpendicular to the midrib; petioles grooved, initially tomentellous but glabrescent with age, 1.0 – 2.5 cm × 346

1.0 – 1.6 mm. Inflorescences and flowers not known. Infructescences with up to 5 fruits developing (out of perhaps 12 or more flowers), either terminal (leaf-opposed) or axillary, when axillary, most often on the older, naked portion of the twigs, cymose with 2 – 3 degrees of branching, up to 4 branches borne on a common peduncle to 1.5 ( – 2.0) cm long, branches to 1.2 cm long, frequently resembling pedicels, fruit sessile or on short pedicels when more than one fruit develops per branch, all axes and calyx with minutely appressed pubescence. Fruit obovate-elliptic, widest in upper half, apex and base rounded, mature fruit pinkish white, orangey-pink, or yellowish gray, 1.9 – 2.1 × 0.9 cm, glabrous; calyx 3 mm in diam.; inner mesocarp with ca. 7 strong longitudinal ridges, stigma distinctly eccentric in dried fruit, 3 mm in diam., facing away from sulcus.

DISTRIBUTION. Malaysia, Borneo, Sarawak. Endemic. SPECIMENS EXAMINED. MALAYSIA. Sarawak, 5 km S of Lundu, near Batang Kayan (River), 18 Oct. 1987, Burley & Lee 353 (A!, F!, K!, L!); 3rd Division, Rejang Delta, Lassa Protected Forest, 26 Aug. 1971, Hamdi S.27828 (A!, E!, K!, L!, SING n.v.); Betong District, Saribas F. R., 12 Aug. 1957, Anderson 8517 (K!, L!); Pulau Bruit in centre of island, 16 (or 10) Jun. 1957, Anderson 7914 (K!, L!). Other specimens cited by Sleumer (1969) but not seen: 2nd Division, Triso P. F., Anderson 3116, (SAR?, n.v.); ibid., Anderson 14502, (SAR?, n.v.); 4th Division, Sg. Dua, Anderson 4189, (SAR?, n.v.). HABITAT. Restricted to (peat) swamp forests, 0 – 3 m. PHENOLOGY. Fruit present from June through October. CONSERVATION STATUS. Endangered: EN B1ab(i,iii,iv). VERNACULAR NAME(S). Kerak nasi (language not specified). NOTES. All collections are fruiting specimens. On those with immature fruit, the young ovaries are strongly cylindrical, with no evident asymmetry. The leaf shape and venation and the fruit wall asymmetry and ridging in mature fruit readily distinguish this species from all others in Borneo. This species may belong to the Philippine Gomphandra luzoniensis group, with which it shares a robust, multiply branched terminal 347

inflorescence. Anderson (1963) mentioned this species as Gomphandra aff. comosa King, and listed it as “rare in P. C. 1 from Batang Lupar to Baram.”

Unassigned Specimens

Indonesia. West Kalimantan, Kabupaten Sanggau, Ngira village, Tembawang Koleio, ♀ fl., 6 Aug. 1993, de Jong 568 (L!, NY!). This collection is from a Dayak forest plot (tembawang). The common name is given as abak mporua. The leaves are reminiscent of Sumatran species like Gomphandra parviflora, and the inflorescences are extremely short. Indonesia. West Kalimantan, Bukit Raya, Tumbang Tubus, 112°51’ E, 0°45’ S, 150 m, buds, 8 Jan. 1983, Veldkamp 8143 (BO n.v., L!, US!). This specimen was collected not far from a specimen of Gomphandra lamanii, but it is not that species. The leaves are narrow with strongly brochidodromous veins, but the inflorescences are axillary. The common name is kayu seluang. 348

INDONESIA [17 taxa] & TIMOR-LESTE [1 taxon] [Excluding Kalimantan and Papua]

G. australiana, G. capitulata, G. chimaera, G. dolichocarpa, G. engganensis, G. fusiformis, G. jacobsii, G. javanica subsp. javanica, G. javanica subsp. pseudojavanica, G. mappioides, G. parviflora var. magnifolia, G. parviflora var. parviflora, G. parviflora var. paucibarbata, G. quadrifida, G. simalurensis, G. simulans, G. velutina

1. Inflorescences terminal or leaf-opposed, male inflorescences reblooming and becoming conspicuously scorpioid G. quadrifida 1’. Inflorescences axillary, male inflorescences not reblooming 2 2. Leaves densely pubescent below, petals conspicuously pubescent 3 3. Leaves (2 – ) 3 – 4 cm wide, petals sparsely pubescent, twigs persistently pubescent, Sumatra G. simulans 3’. Leaves 5.5 – 6 cm wide, petal apices densely pubescent, twigs glabrescent, Sulawesi G. velutina 2’. Leaves not densely pubescent below, petals glabrous (minutely pubescent at petal apex only) 4 4. Flowers and fruits sessile, ovary and fruits pubescent, Sumatra G. capitulata 4’. Flowers and fruits pedicelled, ovary and fruits pubescent or not 5 5. Secondary veins conspicuously brochidodromous and often forming an intramarginal vein 6 5’. Secondary veins often brochidodromous but not conspicuously so and not forming an intramarginal vein 14 6. Leaves > 5.5 cm wide 7 7. Ovary pubescent, Aceh Province G. chimaera 7’. Ovary glabrous, other provinces 8 8. Secondary veins very prominent below, intramarginal vein very distinct, fruit fusiform, North Sumatra Province G. dolichocarpa 8’. Secondary veins not especially prominent, intramarginal vein delicate, fruit not fusiform, West Sumatra Province 9 9. Leaves (3 – ) 5.5 – 7 cm wide, fruit 1.8 cm long G. parviflora var. parviflora 9’. Leaves 7 – 10 cm wide, fruit 2.4 – 2.6 cm long G. parviflora var. magnifolia 349

6. Leaves usually ≤ 5.5 cm wide 10 10. Peduncles 0.1 – 0.3 cm long, ovary (as far as known) glabrous, West Sumatra Province 11 11. Secondary veins not curving, extending straight to the intramarginal vein, stamens with only a few hairs G. parviflora var. paucibarbata 11’. Secondary veins curving in to form the intramarginal veins, stamens more densely pubescent G. parviflora var. parviflora 10’. Peduncles (0.2 – ) 0.4 – 0.8 cm long, ovary pubescent, other provinces 12 12. Fruit fusiform, 2.1 – 2.5 cm long, Mt. Sago G. fusiformis 12’. Fruit not fusiform, 1.6 – 1.9 cm long, elsewhere 13 13. Peduncles 0.2 – 0.4 cm long, stamens pubescent, North Sumatra Province G. chimaera 13’. Peduncles 0.3 – 0.8 cm long, stamens glabrous, Lampung Province G. jacobsii 14. Leaves pubescent below at maturity 15 14’. Leaves glabrous below at maturity 16 15. Twigs glabrous or with sparse appressed pubescence, Simeulue Is. G. javanica subsp. pseudojavanica 15’. Twigs pubescent with spreading hairs, Sumatra G. subrostrata 16. Leaves ovate, 14 – 18 × 7 – 9 cm, Enggano or Simeulue Is. 17 16’. Leaves usually not ovate, if ovate, not as long and wide, elsewhere 18 17. Peduncles < 0.5 cm long, 1 – 2 fruit per infructescence, Enggano Is. G. engganensis 17’. Peduncles up to 1.5 cm long, infructescences with more fruit (12 – 20 flowers in pistillate inflorescences), Simeulue Is. G. simalurensis 18. Twigs persistently pubescent with spreading reddish hairs, Sumatra G. subrostrata 18’. Twigs glabrescent, pubescence appressed, color various 19 19. Ovary and fruit pubescent, Java, Bali, & Lombok G. javanica 19’. Ovary and fruit glabrous, elsewhere 20 20. Inflorescences < 1 cm long, Sumatra G. parviflora var. parviflora 20’. Inflorescences > 1 cm long, Sulawesi and/or Moluccas 21 21. Fruit orange, stigma 3.0 – 4.5 mm wide, Kei Islands G. australiana 21’. Fruit white, stigma 2.5 – 3.5 mm wide, Sulawesi, Moluccas, Timor-Leste G. mappioides 350

37. Gomphandra australiana F. Muell. (1867: 3). Stemonurus australianus (F. Muell.) Kuntze (1891: 112). Type: Australia, Dalrymple’s Gap, Dallachy s.n. (lectotype MEL! photo (selected by Schori)). G. polymorpha F. M. Bailey, Queensl. Bot. Bull. 8 (Dep. Agric. Brisbane, 1893) 71, non Wight.

Small tree to 30 m tall, 30 cm in diam. Bark smooth, pale grey to tan. Twigs generally straight, 2 – 3.5 mm in diam., quickly glabrescent; terminal buds pubescent, tawny to somewhat cinereous with short appressed hairs. Leaves variable, glabrescent, usually drying somewhat chestnut brown to olive green above, chartaceous to thinly coriaceous, lance-elliptic to ovate, (9.5 – ) 16.5 – 19.5 ( – 22) × (3.5 – ) 5.5 – 8.5 ( – 9.5) cm, base acute, apex attenuate to bluntly acute or shortly acuminate, margin slightly revolute; midrib sunken above, raised below, secondary veins (4 – ) 5 – 6 ( – 8) pairs, flat above, raised below, often somewhat yellowish, converging towards margin, upper pairs joining, tertiary veins flat above, slightly raised below, delicately percurrent; petiole narrowly grooved above, 0.7 – 1.1 ( – 1.5) cm long, glabrescent. Inflorescences axillary, 1 – 2 per axil, axes pubescent. Male inflorescences variable with peduncle 0.6 – 1.0 cm long, bearing 2 – 4 branches, branches up to 0.7 cm long before bearing 2 – 4 branches, or unbranched, flowers shortly pedicellate (1 – 3 mm) or sessile, ca. 10 – 25 flowers per inflorescence (rarely up to 55). Male flowers: calyx cupular, sparsely pubescent, 1 mm high, minutely apiculate, green; petals 4 – 5, cream to greenish, glabrous, 4 mm long; stamens 5 – 6 mm long, exserted 1 – 2 mm, filaments glabrous; ovary rudiment ovoid, apex apiculate, glabrous. Female inflorescences variable with 1 – 2 orders of branching, main axis either branching and bearing up to 4 well-developed pedicels (sometimes shortly rebranched), or with short pedicels irregularly arranged along the main axis and up to 9 flowers. Female flowers: calyx apiculate, sparsely pubescent, petals 3 mm long, glabrous, staminodes not seen, ovary 3 mm long, glabrous. Infructescence with elongated peduncle to 1 cm long, pedicels 0.7 – 1 cm long, usually only 1 – 2 fruits developing. Fruit pale pink to orange when ripe, glabrous, ellipsoid to obovoid, slightly 351

asymmetrical, apex rounded, base a bit tapered to rounded 1.9 – 2.3 ( – 2.6) × 1.2 – 1.3 cm, stigma terminal, flattened, 3.0 – 4.5 mm across, inner mesocarp with ca. 11 prominent ridges.

DISTRIBUTION. Indonesia – Kei Islands; Papua New Guinea; Australia. SPECIMENS EXAMINED. INDONESIA. Malaka Province, Kei Islands, Jaheri 363 (L!); ibid, fr., Jaheri 375 A (L! [L 060503]); ibid, ♂ fl., Jaheri 375 B (L! [L 0690502]). HABITAT. Presumably primary lowland rainforest. NOTES. In Indonesia, Gomphandra australiana is only known from the Kei Islands in the Moluccas. It also occurs in southern Papua New Guinea and northern Australia, and the description above is primarily based on specimens from those areas. The three collections cited above were annotated as Gomphandra australiana forma keyensis by Thwaites in 1897, a combination that was never published and does not seem warranted as the specimens are clearly G. australiana. Jaheri collected in the Kei Islands in 1888 and 1893; no species of Gomphandra is known to have been collected from there since then.

2. Gomphandra capitulata (Jungh. & de Vriese) Becc. (1877: 111). Aralia capitulata Jungh. & de Vriese (1846: 17). Lasianthera capitulata (Jungh. & de Vriese) Miq. (1856: 791). Stemonurus capitulatus (Jungh. & de Vriese) Kuntze (1891: 112). Type: Sumatra, Tobing, Junghuhn s.n. (lectotype L! [L 0014740]). Gomphandra nyssifolia King (1895: 114). Stemonurus nyssifolius (King) R. A. Howard (1940: 468). Type: Malaysia, Perak, Larut, 1050 – 1220 m [3500 – 4000 ft.], ♀ fl., July 1884, King’s Collector 6406 (CAL! (selected by Sleumer 1969), isolectotypes BM n.v., CAL!, G n.v., K! [2 sheets], L!, P!). Nyssa sessiliflora Koord. (non Hook.), Hall. f., Meded. Rijksherb. I (1910) 13 [Pl. Jungh. Ined. n. 57].

352

Small tree 5 – 20 ( – 28) m, up to 40 cm in diam. Twigs 2 – 3 mm in diam., with a decurrent ridge below the insertion of the petioles, terminal buds pubescent with minute appressed hairs, twigs glabrescent with age. Leaves elliptic to ovate or obovate, apex acute to acuminate, base attenuate to acute, chartaceous, margin flat to slightly revolute, glabrous, 11 – 20 × 4 – 8.5 cm; midrib sunken above, raised below, secondary veins 5 – 6 ( – 7) pairs, flat to raised above, raised below, somewhat steeply ascending, vein course parallel, usually not joining near the margin, tertiary veins obscure above, raised below and distinctly percurrent; petiole grooved, 0.7 – 1.5 cm × 1.5 – 2 mm, glabrescent. Inflorescences axillary, 1 – 3 per axil, capitate, peduncle 0.5 – 1.5 cm long, bearing 0 – 3 very short branches (to 2 mm), with up to 7 sessile flowers in female plants and 15 flowers in male plants, axes pubescent with short appressed hairs. Male flower: calyx cupular, pubescent, slightly lobed, 1 mm; petals 5, pubescent, 3 – 4 mm long, coherent to free, whitish; stamens 5, exserted, 5 mm long, filaments pubescent ventrally below the anthers; ovary rudiment pubescent. Female flower: calyx cupular, slightly lobed, pubescent; petals 5, pubescent, 3 – 4 mm long, coherent to free; staminodes 5, densely pubescent with short clavate hairs ventrally below the anthers, 4 mm long; ovary cylindrical, 3 – 4 mm long, with short appressed pubescence except for the glabrous base, stigma 1 – 1.5 mm across. Fruit reportedly white (or pale pink to orange) when ripe, sparsely pubescent, obovoid to oblongoid, apex obtuse, very base swollen, (1.8 – ) 2 – 2.4 × (0.6 – ) 0.7 – 0.8 cm, stigma displaced towards sulcus, inner mesocarp with ca. 10 longitudinal ridges.

DISTRIBUTION. Indonesia – Sumatra, Kalimantan; Malaysia. SPECIMENS EXAMINED. No specific locality, buds, de Vriese & Teijsmann herbarium label (L! [L 0014744]); no specific locality, imm. fr., no collector (L! [L 0690471]); no specific locality, buds, Pl. Jungh. ined. 57 label (P!); no specific locality, buds, Lowe & de Vriese label (K!). INDONESIA. Sumatra, no specific locality [Tandjong Ning], 275 m [900? ft.], fr., 1881 [1880 on GH sheet], Forbes 2808 (GH!, K!, L! [3 sheets], P!); Hochangkola ?, fr., Junghuhn s.n. (L! [L 0014741]); ibid, ♂ fl., Junghuhn s.n. (L! [L 0014742]); Hochankola, 300 – 900 m [1000 – 3000 ft.], fr., 353

Junghuhn s.n. (L! [L 0014745]); ibid, 300 – 900 m [1000 – 3000 ft.], buds, Junghuhn s.n. (L! [L 0014743]); Hochangkola, imm. fr., Junghuhn s.n. (A!); Hochankola Tobing, buds, Junghuhn s.n. (lectotype of Aralia capitulata, L! [L 0014740] (selected by Schori)); Tobing, imm. fr., Junghuhn s.n. (Pl. Jungh. ined. 57 label) (L! [L 0014739], U! photo [2 sheets]); Aceh Province, Bandarbaroe [Bandar Baru], 850 m, buds, 12 Nov. 1919, Lörzing 7009 (L!); Lampung Province, Gisting, fr., 20 Aug. 1915, Cramer s.n. (L!); West Sumatra Province, Pajakumbuh [Payakumbuh] region, Halaban, Hutan Sinamo, 600 – 700 m, fr., 9 Jan. 1957, Maradjo 362 (K!, L!); near Padang, Ayer mancior (Ajer mantjoer), 360 m, ♂ fl., Aug. 1878, Beccari 673 (A!, K!, L!); Lembah Anai, 415 m, fr., 23 Dec. 1983, Rahayu 452 (K!, L!); Simeulue Island, ♂ fl., 10 Dec. 1917, Achmad 122 (L! [2 sheets]); ibid, ♀ buds, imm. fr., 19 Dec. 1917, Achmad 137 (L! [2 sheets]); ibid, buds, 28 Oct. 1918, Achmad 702 (L!, P!); ibid, buds, 5 Nov. 1918, Achmad 717 (L!); ibid, imm. fr., 22 Nov. 1918, Achmad 754 (L!, UC!); Landschap Tapah (Defajan), buds, 30 Sept. 1919, Achmad 1414 (K!, L!, P!). Cited by Sleumer (1969) but not seen: Achmad 970; Lörzing 4130 (BO); bb.4890. HABITAT. Forest, 1065 – 1370 m. VERNACULAR NAME(S). Poeloei-poeloei, poeloei-poeloei pajo, soerin-eoding, sasam dotan, awa soehie (Simeulue Is.). NOTES. Gomphandra capitulata is primarily found in Malaysia, but a few collections are from Sumatra. Two collections with no locality were identified as Gomphandra javanica, but the infructescence structure does not match that species. One collection is labeled “leg. Junghuhn,” and while Junghuhn spent most of his time in Java, he collected in northern Sumatra from 1840 – 1842. Gomphandra capitulata is not likely to be confused with any other species in Indonesia. 354

38. Gomphandra chimaera Schori (Kew Bulletin). Type: Indonesia, Sumatra, Aceh Province, Kloët [Kluet] Nature reserve, S. Kloët [Kluet], along the Krung (River), Lembang – vicinity of Pucuk Lembang, c. 3°05’ N, 97°25’ E, c. 80 m, ♀ fl., imm. fr., 11 July 1985, de Wilde & de Wilde-Duyfjes 19942 (holotype L! [2 sheets: L 0690033, L 0690032]; isotype US!).

Shrub 2 – 2.5 m tall. Twigs green, moderately pubescent with minute spreading hairs, glabrescent, youngest portions 1 – 1.6 mm in diam. Leaves elliptic to oblong or obovate- elliptic, base acute to attenuate, apex acuminate, (9 – ) 15 – 19 × (2.5 – ) 4.5 – 7 cm, chartaceous, glabrous at maturity, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 6 – 8 pairs, flat above, raised below, lowest pair(s) steeply ascending and converging towards margin, upper pairs ± parallel, brochidodromous, intramarginal vein often present, intersecondaries common, tertiary veins obscure to slightly raised above, raised and delicately percurrent below; petiole grooved, glabrescent, (0.4 – ) 1 – 1.6 cm long. Inflorescences axillary, on recent growth, axes pubescent with short, somewhat appressed reddish hairs. Male inflorescences subcapitate with peduncle 0.2 – 0.4 cm long, often bearing 2 – 3 branches 1 mm long, flowers subsessile on pedicels < 1 – 1 mm long, up to 12 flowers. Male flowers: calyx lobed, 1 – 1.5 mm across, sparsely pubescent; petals 4 – 5, white, glabrous, 2.5 – 3 mm long, lobes narrow and tips scarcely inflexed; staminodes 4 – 5, strongly exserted, 4 mm long, pubescent with a tuft of clavate hairs dorsally at the connective, scattered hairs ventrally below the anthers, ovary rudiment minute. Female inflorescences with peduncle 0.2 – 0.4 cm long, bearing (1 – ) 3 – 4 flowers on pedicels 1 – 2 mm long, pedicels elongating in fruit to 4 mm long. Female flowers: calyx cupular, lobed, 1.5 mm across, sparsely pubescent; petals 4 – 5, glabrous, lobes narrow and tips scarcely inflexed, 4 mm long; staminodes 4 – 5, not exserted, 3.5 mm long, glabrous except for a few hairs dorsally at the connective; ovary pubescent with spreading reddish hairs, 3.5 – 4 mm long. Fruit quite immature, likely fusiform or narrowly obovoid-ellipsoid, at least 1.6 – 1.8 cm long, sparsely pubescent but probably glabrous at maturity, stigma at least 2 mm across, apparently with a deep central groove. 355

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, Aceh Province, Kloët [Kluet] Nature reserve, S. Kloët [Kluet], along the Krung (River), Lembang/vicinity of Pucuk Lembang, c. 3°05’ N, 97°25’ E, c. 50 m, ♂ fl., 9 July 1985, de Wilde & de Wilde-Duyfjes 19843 (L!); ibid, c. 80 m, ♂ fl., 11 July 1985, de Wilde & de Wilde-Duyfjes 19938 (L!, sheet 2 only [L 0690039]); ibid, c. 80 m, ♀ fl., imm. fr., 11 July 1985, de Wilde & de Wilde-Duyfjes 19942 (holotype L! [2 sheets]; isotype US!). HABITAT. Primary flat riverine or foot-hill forest on alluvial soil, 50 – 80 m. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). ETYMOLOGY. Gomphandra chimaera is named for the similarity of various vegetative and reproductive parts to other Sumatran species of Gomphandra. NOTES. Gomphandra chimaera resembles three other species in different ways. The leaf venation is similar to that of Gomphandra dolichocarpa. The pubescent ovary is reminiscent of Gomphandra fusiformis, though the stigma does not match that species. The male inflorescences and flowers are similar to Gomphandra subrostrata, which has been found growing with G. chimaera at Kloët Nature Reserve. Gomphandra dolichocarpa and G. subrostrata have glabrous ovaries, and G. subrostrata has thicker twigs that are more pubescent. Northern Sumatra may have experienced a relatively recent species radiation, and more collections may reveal more cryptic taxa currently included within Gomphandra subrostrata. Gomphandra dolichocarpa and G. fusiformis are both known from very limited geographic areas, while G. subrostrata has been collected from multiple localities in the Gunung Leuser National Park area. 356

39. Gomphandra dolichocarpa Merr. (1938: 183). Stemonurus dolichocarpus (Merr.) R. A. Howard (1940: 468). Type: Indonesia, Sumatra, Rahmat Si Boeea 6703 (holotype A!; isotypes MICH!, S n.v., SING n.v., UC!, US!).

Twigs robust, slightly zigzag and angular, 1.7 – 3 mm in diam., pubescent with minute spreading hairs, eventually glabrescent. Leaves elliptic to obovate-elliptic, rarely ovate, base acute, apex acuminate, chartaceous, glabrous above, glabrescent below, (13.5 – ) 18 – 22.5 ( – 29) × (4.5 – ) 5.5 – 9.5 cm, margin slightly revolute; midrib impressed above, raised below, secondary veins 8 – 11 pairs, flat to slightly impressed above, raised below, vein course ± parallel, lower pair(s) somewhat ascending and converging, other pairs strongly brochidodromous, often forming an intramarginal vein, intersecondaries common, tertiary veins not visible above, raised below and distinctly percurrent; petioles grooved, relatively stout, 0.6 – 1.5 cm long, glabrescent. Inflorescences axillary, 1 – 2 per axil, usually on mature portions of twigs, axes pubescent with minute, somewhat appressed hairs. Male inflorescences with peduncle 2 – 4 mm long, flowers 4 – 12, crowded, or inflorescence with 3 short branches 1 mm long, 5 – 8 flowers per branch, up to 20 flowers, pedicels 1 mm long. Male flowers: calyx cupular, minutely apiculate, sparsely pubescent, 2 mm across, petals 4 – 5, 2.5 – 3 mm long, glabrous, stamens exserted, 4 mm long, bearing a tuft of clavate hairs dorsally at the connective, pubescent with clavate hairs ventrally below the anthers, ovary rudiment narrowly ovoid, glabrous. Female inflorescences with peduncle 2 mm long, bearing 4 – 5 flowers on pedicels 1 mm long, peduncle and pedicels elongating and thickening in fruit. Female flowers: calyx cupular, 1.5 – 2 mm across, sparsely pubescent, petals and staminodes not seen, ovary glabrous, 3 mm long. Fruit fusiform, apex and base narrowly attenuate, very base swollen, 3.4 – 3.6 × 0.5 – 0.6 cm, glabrous, stigma 1.4 – 1.8 mm across, ridged, inner mesocarp with ca. 10 low anastomosing ridges.

DISTRIBUTION. Indonesia – Sumatra. 357

SPECIMENS EXAMINED. INDONESIA. Sumatra, North Sumatra Province, Asahan, Hoeta [Huta] Bagasan, [2°56’15” N, 99° 4’46.00” E], imm. fr., Sept. 1934 – Feb. 1935, Rahmat Si Boeea 6703 (holotype A!; isotypes L!, MICH!, S n.v., SING n.v., UC!, US!); ibid, ♂ fl., Sept. 1934 – Feb. 1935, Rahmat Si Boeea 7039 (A, L!, MICH!, SING); ibid, ♂ buds, Sept. 1934 – Feb. 1935, Rahmat Si Boeea 7107 (A!, MICH!, SING n.v., UC!, US!); ibid, fr., Sept. 1934 – Feb. 1935, Rahmat Si Boeea 7140 (A!, MICH!, S n.v., UC!, US!). HABITAT. Gomphandra dolichocarpa probably grew in lowland dipterocarp forest below 500 m. CONSERVATION STATUS. Gomphandra dolichocarpa should have a conservation status of Critically Endangered. The extent of the original population near Huta Bagasan is unknown, but there is no forest remaining in the vicinity now, and the species could be extinct. VERNACULAR NAME(S). Kajoe atimang, kajoe barik, kajoe silango, kajoe rawet. NOTES. Gomphandra dolichocarpa has very distinctive fruits, which are long and fusiform with a very small stigma. It is similar to Gomphandra parviflora in leaf size and venation and inflorescence structure, but the secondary and tertiary veins of G. dolichocarpa are more prominent below, the twigs and peduncles are more robust, the stamens are more pubescent, and the fruit is much larger with a smaller stigma.

40. Gomphandra engganensis Schori (Kew Bulletin). Type: Indonesia, Enggano Island S. of Sumatra, Bengkulu Province, Bua-Bua, ± 100 m, 2 June 1936, Lutjeharms 4108 (holotype L!; isotypes A!, B†, K! [2 sheets], P!).

Small tree. Twigs slightly zigzag, younger portions 2 – 3 mm in diam., older portions to 5 mm, glabrescent. Terminal buds small, pubescence tightly appressed. Leaves large, chartaceous, pale green when fresh, initially pubescent but quickly glabrescent, ovate, base acute, apex shortly acute to acuminate, (14 – ) 18 – 22 ( – 26) × (6.5 – ) 8 – 11 ( – 13) cm, midrib sunken above, raised below, secondary veins 5 – 9 pairs, flat to slightly 358

impressed above, raised below, vein course parallel, brochidodromous, tertiary veins flat above, slightly raised below, distinctly and delicately percurrent; petiole 1.5 – 2 cm long, narrowly grooved above, with a few sparse hairs. Male inflorescences unknown. Female inflorescences axillary on older growth, presumably short and bearing 1 – 2 flowers. Female flowers not seen. Infructescence with short peduncle, 2 – 4 mm long, pedicels to 6 mm long. Fruit not seen at maturity, immature fruit evidently glabrous, 1.8 – 1.9 × 0.8 – 0.9 cm, base and apex somewhat tapered, stigma lobed, 1.7 – 2.3 mm across, displaced toward sulcus, inner mesocarp with 10 – 12 low anastomosing ridges.

DISTRIBUTION. Indonesia – Enggano Island. Endemic. SPECIMENS EXAMINED. INDONESIA. Enggano Island (S. of Sumatra), Bengkulu Province, Bua-Bua, ± 100 m, 2 June 1936, Lutjeharms 4108 (holotype L!; isotypes A!, B†, K! [2 sheets], P!); Malakoni, 21 June 1936, Lutjeharms 4933 (A!, BO, K!, L!, P!). HABITAT. Presumably from lowland rainforest near 100 m elevation. Bua bua, the highest part of Enggano, reaches 250 m. CONSERVATION STATUS. Endangered: EN B2ab(iii). VERNACULAR NAME(S). Medang poentoen in Malay Palembang; tjemetek. NOTES. Gomphandra engganensis is superficially similar to G. simalurensis, which is found on Simeulue Island in the Mentawi group. Both species have large leaves, but they are quite different in inflorescence structure and fruit. Gomphandra simalurensis has much longer peduncles, many more flowers, and a pubescent fruit with a somewhat flattened, unlobed stigma that is creased down the middle. Gomphandra engganensis is more similar to G. pseudojavanica, also of Simeulue Island, which has relatively small, few-flowered female inflorescences and a raised, lobed stigma. However, Gomphandra pseudojavanica has much smaller, narrow leaves that are persistently pubescent, a longer peduncle, more than two flowers, and pubescent ovaries. Sleumer (1969) reported three collections from Enggano: Lutjeharms 4108, 4931, and 4933. No specimen with the number 4931 was found at K, L, or P. Evidently this species has not been collected since 1936 and may be extinct. 359

41. Gomphandra fusiformis Sleumer (1969: 196). Type: Indonesia, Sumatra, Maradjo 121 (holotype L!).

Shrub or treelet to 3 m high and 2 – 4 cm in diam. Twigs slender, often with evidently leaf-opposed scars at the end of each season’s growth, presumably due to shoot abortion, 0.8 – 2 mm in diam., buds pubescent with minute appressed reddish hairs, quickly glabrescent. Leaves narrowly ovate or lanceolate-elliptic to oblong or obovate-elliptic, apex acute to acuminate, base acute to attenuate, chartaceous, glabrous, (7 – ) 11 – 17 × (1.5 – ) 2.5 – 5 cm, margin slightly revolute; midrib impressed above, raised below, secondary veins (3 – ) 5 – 6 ( – 8) pairs, flat to slightly raised above, raised below, lowest pair converging, upper pairs ± parallel but well-spaced, brochidodromous to forming an intramarginal vein, intersecondaries common, tertiary veins flat to slightly raised above, slightly raised below, weakly percurrent; petioles grooved, glabrous, (0.4 – ) 0.8 – 1.2 cm × c. 1 mm. Inflorescences axillary, pubescent with minute appressed hairs. Male inflorescences with peduncle (0.1 – ) 0.4 – 0.8 cm long, unbranched or bearing 2 – 3 branches 1 mm long, each with 3 – 5 subsessile flowers, 1 – 10 flowers per inflorescence. Male flowers: calyx cupular, apiculate, sparsely pubescent to ciliate, 1 mm across; petals green to white, glabrous, 3 – 3.5 mm long; stamens white, 4, shortly exserted, 4 mm long, bearing a tuft of clavate hairs dorsally at the connective, pubescent ventrally below the anthers; ovary rudiment glabrous. Female inflorescences with peduncle 0.4 – 0.8 cm long, unbranched or with 2 – 3 branches 1 mm long, flowers subsessile or on pedicels 1 – 2 mm long, 4 – 6 flowers per inflorescence. Female flowers: calyx cupular, minutely apiculate, 1 – 1.5 mm across, petals 4, glabrous, 4 mm long, staminodes 4, laxly penicillate (fide Sleumer), ovary cylindrical, 4 mm long, densely pubescent with short, appressed reddish hairs, ovary base glabrous, stigma 1.3 – 1.5 mm wide, accrescent. Fruit fusiform, apex attenuate, slightly curved toward sulcus (but not fully ripe), base attenuate, very base swollen, 2.1 – 2.5 × 0.6 – 0.7 cm, inner mesocarp with ca. 11 low anastomosing ridges, stigma 2 – 2.8 mm across.

360

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, West Sumatra Province, Mt. Sago near Pajakumbuh [Payakumbuh], 1000 m, ♀ fl., imm. fr., 4 Nov. 1956, Maradjo 121 (holotype L!); ibid, 900 – 1200 m, fr., 20 July 1955, Meijer 3706 (BM n.v., BO n.v., L!); S of Gunung Sago, from Kampung Puncak Pato to the summit, 0°22’ S, 100 °40’ E, 1400 m, ♂ buds, 10 March 1989, Nagamasu 3802 (L!); Mt. Sago near Pajakumbuh [Payakumbuh], 900 – 1000 m, ♂ fl., 27 Oct. 1955, Meijer 4066 (L!, SING n.v.); ibid, 900 m, fr., 9 March 1957, Meijer 5630 (A!, L!). HABITAT. Forest, 900 – 1400 m. NOTES. Gomphandra fusiformis is similar to a number of other Sumatran species, including G. dolichocarpa, G. jacobsii, and G. parviflora. It can be distinguished from Gomphandra dolichocarpa and G. parviflora by its pubescent ovary and its generally smaller, narrower leaves. Gomphandra jacobsii has a pubescent ovary, but it has longer petioles, a larger calyx, glabrous stamens, and smaller fruit. Gomphandra fusiformis is only known from the Mt. Sago area.

42. Gomphandra jacobsii Schori (Kew Bulletin). Type: Indonesia, Sumatra, Lampung Province, Mt. Tanggamus, 5°26’ S, 104°41’ E, 1200 – 1300 m, ♂ fl., 29 April 1968, Jacobs 8140 (holotype L!; isotypes A!, BISH!, K!, 6 other dups. n.v).

Treelet 2 m high. Twigs green, slender, initially pubescent with minute appressed reddish hairs, eventually glabrescent, 0.9 – 1.5 mm in diam. Leaves elliptic to obovate, base acute to attenuate, apex acuminate, (5 – ) 9 – 13 × (2 – ) 3 – 5 cm, chartaceous, glabrous at maturity, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins (2 – ) 4 – 6 pairs, flat to slightly raised above, raised below, lowest pairs steeply ascending and somewhat converging towards margin, upper pairs ± parallel, brochidodromous, sometimes forming an intramarginal vein, intersecondaries common, tertiaries slightly raised to flat above, slightly raised below, weakly percurrent; petiole grooved, (0.6 – ) 1 – 1.5 cm long. Inflorescences axillary, 1 – 2 per axil, on recent 361

seasons’ growth, including the twig apex, axes pubescent with minute appressed hairs. Male inflorescences to 2 cm long overall, with peduncle 0.3 – 0.8 cm long, bearing 2 – 3 branches 2 – 4 mm long, these bearing 1 – 5 flowers in a reduced cyme, pedicels <1 – 2 mm long, 5 – 16 flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, sparsely pubescent and ciliate, 1.5 – 2 mm across, light green, petals 5, glabrous, 3.5 – 4 mm long, stamens 5, white, strongly exserted, 5 mm long, glabrous, pollen white, ovary rudiment narrowly conical, glabrous. Female inflorescences with peduncle to 0.4 cm long, unbranched or with 2 short branches 1 mm long, 3 – 6 flowers on pedicels <1 – 2 mm long. Female flowers: calyx cupular, minutely apiculate, sparsely pubescent and ciliate, 2 mm across, petals 5, glabrous, 4 mm long, staminodes not seen, ovary densely pubescent with minute appressed reddish hairs. Fruit submature, green turning white, narrowly ellipsoid, base attenuate, very base perhaps a bit swollen, apex somewhat attenuate, 1.8 – 1.9 × 0.5 cm, sparsely pubescent to glabrescent, inner mesocarp with ca. 10 low ridges, stigma ridged, 2.2 mm across.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, Lampung Province, Bukit Palelawan [Pelelawan] w. of Ranau Lake, 1100 m, imm. fr., Dec. 1978, Wiriadinata s.n. (BO n.v., K!, L!); Bukit Barisan, Bukit Pelelawan, 1250 m, buds, 15 Dec. 1978, TFB 217 (L! [2 sheets, one incorrectly labeled 219]); Bukit Pelelawan, 1230 m, buds, Lamcnie[?] 564 (L!); Mt. Tanggamus, 5°26’ S, 104°41’ E, 1200 – 1300 m, ♂ fl., 29 April 1968, Jacobs 8140 (holotype L!; isotypes A!, BISH!, K!, 6 other dups. n.v). HABITAT. Forest, 1100 – 1300 m. CONSERVATION STATUS. Endangered: EN B1ab(iii). ETYMOLOGY. The specific epithet honors Dr. Marius Jacobs, who collected the type specimen as part of work on the flora of Malesia. NOTES. Gomphandra jacobsii is similar to G. javanica and G. parviflora. It differs from Gomphandra javanica in its glabrous stamens and intramarginal vein, and from G. parviflora in its pubescent ovaries and smaller leaves with fewer veins and proportionately longer petioles. Its twigs are more slender than those of Gomphandra 362

javanica subsp. pseudojavanica, and the calyx is more robust than that of G. javanica subsp. javanica. Sleumer recognized the type collection as a new species but chose not to describe it, citing a lack of female flowers.

43. Gomphandra javanica (Bl.) Valeton (1886: 217, pl. 4, f. 1-9 c, pl. 5, f. 23 , pl. 6, f. 46) subsp. javanica Stemonurus javanicus Bl. (1825: 649. Lasianthera javanica (Bl.) Miq. (1856: 790). Type: Blume s.n. (lectotype L! [L 0014769]). Stemonurus pauciflorus Bl. (1825: 648). Type: Blume 2149 (lectotype L! [L 0014777]; isolectotype L! [L 0014775]). G. javanica (Bl.) Valeton var. lanceolata Koord. & Valeton (1900: 151) (cited incorrectly as var. lanceolata K. & W. in Sleumer 1969). Type: Koorders 27878β (lectotype BO n.v. (selected by Sleumer 1969); isolectotypes K!, L!, P!). G. javanica (Bl..) Valeton var. dolichocarpa Koord. & Valeton, Bijdr. 5 (1900) 151. Type: Koorders 23016β (lectotype BO n.v. (selected by Sleumer 1969); isolectotypes L!). G. comosa (non King) Bak. f., J. Bot. 62 (1924) Suppl. 21.

Tree (3 – ) 5 – 15 m, up to 40 cm diam.; bark olive green to light brown, smooth. Twigs usually straight, slender, 1 – 2 mm in diam., pubescent with minute appressed reddish to cinereous hairs, glabrescent with age. Leaves variable, mostly obovate-elliptic but also lanceolate, or ovate-elliptic to oblong, apex acute, more commonly acuminate to subcaudate, base acute to attenuate, chartaceous to thinly coriaceous, essentially glabrous, scattered pubescence sometimes present near the petiole, margin flat to slightly revolute, (4 – ) 9 – 12 ( – 16) × (2 – ) 3 – 5.5 ( – 7.5) cm; midrib impressed above, raised below, secondary veins (4 – ) 6 – 8 ( – 9) pairs, flat to slightly raised above, raised below, lower pair ascending and converging near margin, upper ones parallel and more perpendicular to midrib, intersecondary veins common between upper secondaries, brochidodromous, 363 tertiary veins raised, flat, or not visible above, slightly raised below, delicately and a bit irregularly percurrent; petiole grooved above, pubescent, glabrescent with age, 0.5 – 1.5 cm × 1 – 1.5 mm. Inflorescences axillary, 1 – 2 per axil, often from accessory buds, axes pubescent with somewhat appressed, reddish hairs. Male inflorescences to 2 cm long overall, with peduncle 0.4 – 1.5 cm long, bearing 3 branches to 0.4 cm long, each branch with a cyme of subsessile to shortly pedicellate (2 – 4 mm), up to 20 flowers. Male flowers: reportedly fragrant, calyx cupular, apiculate, sparsely pubescent to ciliate, 1 – 1.5 mm across; petals 5, light green or white, glabrous, 3 – 4 mm; stamens 5, strongly exserted, 4 – 5 mm long, filaments with a long tuft of clavate hairs dorsally at the connective and pubescent ventrally below the anthers; ovary rudiment minute, glabrous. Female inflorescences with peduncle 0.3 – 1 cm, bearing up to 5 pedicels 0.3 – 0.5 cm long arranged in an umbel, or occasionally with a short branch (to 4 mm) bearing two pedicellate flowers. Female flower: calyx cupular, apiculate, sparsely pubescent to ciliate, 1.5 mm across; petals 5, glabrous, 3 – 4 mm long, corolla usually splitting to the base; staminodes 5, evidently not exserted, 3 – 4 mm long, with short clavate hairs at the connective and ventrally below the anther cells; ovary 3 – 4 mm long, usually with appressed pubescence except at base, but some specimens practically glabrous; stigma lobed, 1.5 – 2 mm across. Fruit reportedly white when ripe, often sparsely pubescent, oblong to ellipsoid, base and apex acute to rounded, apex usually slightly beaked, 1.5 – 2.2 × 0.6 – 0.8 cm, inner mesocarp with 8 – 12 pronounced longitudinal ribs, stigma 2.5 – 3.5 mm across.

DISTRIBUTION. Indonesia, Java, Bali, Lombok. SPECIMENS EXAMINED. INDONESIA. Java, No original label, ♂ fl., (A!); no specific locality, ♂ fl., 1838, Kollmann s.n. (NY!); no specific locality (as Stemonurus pauciflorus Bl.), (NY!); no specific locality (as S. javanicus Bl.), (NY!); no original label, imm. fr., no. 112, det. Valeton 1886, (L! [L 0690387]); no specific locality (as Jasminum glabrum), (L! [L 0690395]); no specific locality, imm. fr., Blume 2149 (isolectotype of S. pauciflorus, L! [L 0014775]); imm. fr., Blume? s.n. (L! [L 0014776]); ♀ fl., imm. fr., Blume 2149 (lectotype of S. pauciflorus, L! [L 0014777]); imm. fr., Blume 2149 364

(isolectotype of S. pauciflorus, L! [L 0690335]); Plantae Junghuhnianae ineditae No. 466, imm. fr., (L! [L 0690418]); no specific locality, ♀ fl., imm. fr., Teysmann 4867 (L! [L 0690310)]; no original label, fr., Junghuhn s.n. (L! [L 0690328]); imm. fr., Waits? s.n. (L! [L 0690342]); no original label, Preanger, Limbang, 1220 – 1525 m [4000 – 5000 ft.], imm. fr., Junghuhn 237 (L! [L 0690336]); ♂ buds, Blume 2299 (L! [2 sheets, L 0690398, L 0690397]); no collector 141, (L! [L 0690410]); no specific locality, ♂ buds, (L! [L 0690389]); Medinie Ungarang label, no collector, ♀, (L! [L 0690385]); no specific locality (as Stemonurus pauciflorus), ♂ fl., (L! [L 0690400]); no original label, ♂ fl., (L! [L 0690396]); no specific locality, no collector, ♂ buds, (L! [L 0690312]); no specific locality, no collector, (L! [L 0690343]); Blume s.n. (L! [L 0014774]); no original label, (L! [L 0014773]); ♂, Blume? 1703 (lectotype of Stemonurus javanicus var., L!, [L 0014771]; isolectotype L! [L 0014772]); ♂ fl., Blume? s.n. (lectotype of Stemonurus javanicus, L! [L 0014769]); ♂ fl., Blume s.n. (L! [L 0014770]); no specific locality, no collector, ♂ fl., (L! [L 0690334]); no specific locality, ♂ fl., Korthals? s.n. (L! [L 0690333]); no specific locality, ♂ buds, Blume 217 (L! [L 0690332]); no specific locality, ♂, (van de Malabav?) 838 (L! [L 0690344]); no original label, ♂ buds, (L! [L 0690340]); imm. fr., Junghuhn? 237 (L! [L 0690337]); no original label, imm. fr., (L! [L 0690338]); no specific locality, no collector, imm. fr., (L! [L 0690388]); W. Java, Tjiandur District, G. Beser, 1000 m, ♂fl., Jan. 1969, Kostermans s.n. (L!); Nusa Kambangan, ♂ buds, Valeton s.n. (L! [L 0690370]); Tjadas Malang, Tjidadadap, 1000 m, ♂ fl., 9 Jan. 1918, Winckel s.n. (L!); Preanger, Gunung Karang, Java Melang, 1100 m, ♂ fl., 9 Jan? 1918, Winckel 22 (L!); Preanger, Borfschen ran Pengalengang, 1310 m [4300 ft.], imm. fr. Junghuhn?, no. 165, L! [L 0690394]; Nusa Kambanga, ♀ buds, June 1909, Native collector s.n. [270] (L! [L 0690389]); Banjumas, Nusa Kambangan Island, SW part, between Solok Babakan to Karang anjer, ♂ buds, 22 Nov. 1938, Kostermans & van Woerden 99 (A!, L! 2 sheets [L 0690381, L 0690380]); ibid, ♀ fl., imm. fr., 22 Nov. 1938, Kostermans & van Woerden 119 (A!, L!); W. Java, Tjibodas, Gegerbentang ridge, 1600 m, imm. fr., 2 June 1948, Kakah 125 (L!); Banjumas, Nusa Kambangan Island, SW part, between Solok Babakan to Karang anjer, ♂ fl., 22 Nov. 1938, Kostermans & van Woerden 128 (A!, L!); Preanger, Pasir Gagah, Tjidadap, 105 m, fr., 25 Apr. 1918, 365

Winckel 159 (L! [L 0690406]); Tjibodas, Pasir Pangsalantan, 1500 m, imm. fr., 2 June 1948, Enoh 173 (L!); Udjung Kulon Nature Reserve, Mt. Pajung, [6°45’ S, 105°20’ E], 300 – 400 m, imm. fr., 1 July 1964, Wirawan 221 (CANB!, L!); Gunung Beser, Tjidadap, Tjibeber, 1000 m, ♀ fl., 22 Dec. 1918, Winckel 336β (BRI!, L! [3 sheets, L 0690383, L 0690368, L 0690369]); Tjidadap, Tjibeber, 1000 m, ♂ buds, 26 Oct. 1919, Winckel 451 (L!); South East Java [hand written on GH specimen “near Pengelingan on hills, Preanger 1370 m [4500 ft.], ♀ fl., 1880, Forbes 784 (BH!, CANB!, GH!, L! [2 sheets], MO!, US!); Deckoetan, fr., 1913, Mousset 892 (L!); W. Java, Tjibalanac, Tjipatudjah, Tasikmalaja, 5 m, imm. fr., 24 Jan. 1971, Dransfield 1167 (L!); Preanger, Tjibodas, ♂ buds, 1915, Sapiin 2263 (NY!); Batavia, G. Liiang, 600 m, ♀ fl., 30 Oct. 1928, Van Steenis 2420 (L!); W. Java, Sukabumi, Lengkong, 700 m, imm. fr., 28 Apr. 1972, Dransfield 2493 (L! [2 sheets]); E. Java, Malang, Pujon, Dadapan Kulon, 1100 m, 14 July 1980, Mogea 2512 (L!); Preanger, Reg. Gunung Tjisalak, imm. fr., 8 Apr. 1923, Bakhuizen van den Brink Jr. 2567 (L!); Bogor, Tjirarak, above Tjipatat, 1000 m, ♂ fl., Jan 1941, de Voogd 3148 (L!); W. Priangan, Tjampaka near Tjidadap, 1000 – 1300 m, ♀ fl., 25 Dec. 1937, Buwalda 3500 (L!); West Preanger, Tjampaka near Tjidadap, Mt. Karang, 1000 – 1300 m, ♂ fl., 29 Dec. 1937, Buwalda 3658 (A!, L!); W. Java, Lengkong, SW of Sukabumi, c. 800 m, imm. fr., 28 Jan. 1984, van Balgooy 4532 (BISH!, L!); E. Java., res. Besuki, Mt. Raung, S. slope above village Gunungsari, 114° E, 8°15’ S, 500 – 600 m, imm. fr., 17 May 1957, Jacobs 4797 (L!, NY!); Banjumas, [Nusa Kambangan], ♂ buds, 10 Dec. 1892, Koorders 6059β (L!); Nodicen? Province, fr., 13 Aug. 1897, Koorders 6061β (L!); Koorders 6062 (syntype of G. javanica var. dolichocarpa BO n.v.); Banjumas, [Nusa Kambangan], ♂ buds, 11 Dec. 1891, Koorders 6063β (syntype of G. javanica var. dolichocarpa, L!); C. Java, Gunung Muria, Tjollo, N of Kudus, 700 m, ♀ buds, 23 Nov. 1951, Kostermans 6205 (A!, L!); ibid, ♀ fl., 24 Nov. 1951, Kostermans 6241 (A!, BRI!, L!); G. Rendeng (Nirmala), 1250 m, ♂ buds, 1913, Backer 10977 (L!); Nirmala, 1100 m, ♂ fl., 1913., Backer 11164 (L!); Besuki Province, Pantjaer T[al]jen, 1000 m, imm. fr., 9 Nov. 1895, Koorders 14638β (syntype of G. javanica var. lanceolata, BO n.v., L! [L 0014765]); WSW of Buitenzorg, Nanggoen forest, Mt. Menapa, 500 m, ♀ fl., 18 Dec. 1940, Van Steenis 17409 (L!); Besuki, Pantjoer-Pradja[k]an?, 1000 m, imm. fr., 9 Nov. 1895, 366

Koorders 21757β (syntype of G. javanica var. lanceolata BO n.v., L! [L 0014763]); Kediri Province, Blitar, fr., 14 June 1896, Koorders 23016β (lectotype of G. javanica var. dolichocarpa BO n.v. (selected by Sleumer 1969); isolectotype L! [L 0014766]); Pasuruan Province, Tangkil Zuidergeb, fr., 18 June 1896, Koorders 23434β (L!); W. Java, Djampang tengah road from Bodjong lopang to Djampang kulon, Forest Tjimonjet, 700 m, ♂ fl., Nov. 1970, Kostermans 23921 (A!, L!); Banjumas, imm. fr., 21 Sept. 1896, Koorders 24650β (syntype of G. javanica var. dolichocarpa BO n.v., L! [L 0014768], P n.v.); Preanger, Pangantjongan, 1400 – 1700 m, ♀ buds, 25 Jan. 1897, Koorders 26325β (L!); Semarang, Telomojo, imm. fr., 14 June 1897, Koorders 27878β (lectotype of G. javanica var. lanceolata BO n.v. (selected by Sleumer 1969); isolectotypes K, L! [L 0014764], P); Besuki Province, fr., 5 Sept. 1897, Koorders 28801β (L!); Besuki Province, Pantjoer Idjen, imm. fr., 15 Aug. 1895, Koorders 28841β (syntype of G. javanica var. lanceolata BO n.v., K!, L! [L 0014762]); Besuki Province, fr., 13 Aug 1897, Besuki Province, Rogodjampi, 200 m, fr., 10 Sept. 1897, Koorders 29026β (L!); Koorders 29337β (UC!); Banjumas, [Nusa Kambangan], imm. fr., 15 Sept. 1901, Koorders 39268β (L!). Cultivated. Bogor Botanical Gardens. Korthals s.n. (L! [L 0690314]); ibid, ♂ buds, Hochreutiner 84 a (L!, NY!), imm. fr., Hochreutiner 84 b (L! [2 sheets], NY!). aff. G. javanica. Bali, Bali Timur. Bedugul forest region, Mt. Batukau complex, 1300 m, imm. fr., 24 June 1958, Kostermans et al. KK + SS 141 (A!, L!); B. Pohen, Batukau National Reserve, c. 1500 m, ♂ fl., 24 Mar. 1992, Afriastini Bl-199 (F!); north of Tabanan, Mt. Batukaru, 1300 m, imm fr., 19 July 1964, Wirawan 465 (A!, L!); ibid, 1100 m, ♀ fl., 20 July 1964, Wirawan 476 (L!); Mt. Agung, 1500 m, imm. fr., 7 Sept. 1934, de Voogd 2173 (A!, L! [2 sheets]); Karangasem, S slope of Gunung Agung, 1-2 km SW of Besakih, 8°21’ S, 115°26’ E, 750 m, ♂ buds, 30 June 1994, McDonald & Ismail 4739 (A!, L!, NY!); Karangasem, W shoulder of Gunung Agung, on Bukit Tapiz, volcanic hills 6 km N of Besakih, 8°20’ S, 115°26’ E, 750 m, imm. fr., 5 July 1994, McDonald & Ismail 4779 (A!, CANB!, E!, NY!); Tabanan, ridge of Gunung Catur, ca. 6 km NE of Bedugul, 8°18’ S, 115°9’ E, 1700 m, imm. fr., 27 July 1994, McDonald & Ismail 4892 (A!, CANB!, E!, NY!). 367

cf. G. javanica. Lombok, Rinjani, 1185 – 1265 m, 31 May 1909, Elbert 1617 [3189] (A!); Rinjani, Ost-Seite, 1300 – 1500 m, 2 June 1909, Elbert 1670 [3533] (L!); Rinjani, Pussuk, 1450 – 1650 m, 4 June 1909, Elbert 1741 [3683] (A!, L); Rinjani, SE site, 1250 – 1600 m, 7 June 1909, Elbert 1777 [3862] (L!). HABITAT. Forest, 100 – 1750 m. VERNACULAR NAME(S). Gesing. NOTES. Most collections of Gomphandra javanica subsp. javanica give no specific locality, which makes it difficult to assess variation within the species in a geographical context. However, both wide- and narrow-leaved forms have been collected from Nusa Kambanga, suggesting that location may have little relevance to leaf variation. Most material from Lombok is sterile, which makes its identification as Gomphandra javanica tentative. Gomphandra javanica has been collected from Bali, but there are also recent collections which may represent another taxon. Most of them have immature or galled fruit, so it is not possible to determine whether they should be recognized as a subspecies or a species. The male flowers are smaller and have few hairs on the stamens, and the infructescences can have up to 7 fruit. The collections clearly are similar to Gomphandra javanica, and more collections with appropriate stages of reproductive material may allow a new taxon to be described in the future. For now, these specimens are treated above as Gomphandra aff. javanica. Gomphandra javanica and G. mappioides are closely related. They share similar inflorescence structures and both are reported to have white fruits. DNA sequence data have also shown a close relationship (see Chapter 3). They differ in the pubescent ovary of Gomphandra javanica, in overall leaf shape and twig thickness, and in the stamen pubescence of G. javanica. Gomphandra mappioides is the most widespread species in Indonesia, but it does not appear to overlap in distribution with G. javanica. 368

44. Gomphandra javanica Valeton subsp. pseudojavanica (Sleumer) Schori (Kew Bulletin). Gomphandra pseudojavanica Sleumer (1969: 195). Type: Indonesia, Simeulue Island, 19 Jan. 1918, Achmad 191 (holotype L! [L 0014823]; isotypes BO n.v., L! [L 0014824]).

Tree 4 – 15 m. Twigs slender, straight to zigzag, apex pubescent with minute appressed hairs, glabrescent with age, 1.5 – 2.5 mm in diam. Leaves elliptic to ovate, apex abruptly acute to acuminate, base acute to attenuate, chartaceous, glabrous above, sparsely pubescent below, (8 – ) 10 – 15 ( – 20) × (3 – ) 4.5 – 8 cm, midrib impressed above, raised below, secondary nerves 5 – 6 ( – 7) pairs, somewhat converging towards margin and at least the upper pairs there brochidodromous, flat to slightly impressed above, raised below, intersecondaries common, tertiary veins flat to slightly raised above, raised below, percurrent; petiole narrowly grooved, glabrescent, 0.7 – 1.5 ( – 2) cm long, 1.5 – 2 mm thick. Inflorescences axillary on older portions of twigs, or on younger mature growth, 1 – 2 per axil, axes pubescent. Male inflorescences with slender peduncle 0.2 – 1.3 cm long, bearing 2 – 3 branches, branches 0.1 – 0.4 cm long, branches rebranched or not, each with a somewhat irregular cyme of up to 12 flowers, up to ca. 20 flowers per inflorescence. Male flowers: calyx cupular, minutely apiculate, ciliate, petals 5, whitish- green, glabrous, 4 mm long, stamens 5, exserted, 4.5 mm long, filaments pubescent with clavate hairs ventrally below the anthers and dorsally at the connective, ovary rudiment conical, glabrous or with a few hairs at the apex. Female inflorescences umbelliform, with 2 – 3 pedicellate flowers on a peduncle, or cymose, with up to 4 branches, each of which bears 1 – 2 flowers. Female flowers not seen at anthesis, ovary densely pubescent with minute appressed hairs, glabrescent with age. Infructescences with peduncle 0.5 – 0.6 cm long, bearing 1 – 3 fruit on pedicels 0.3 – 0.8 cm long. Fruit submature, subtended by calyx 2.5 – 3 mm across, narrowly obovoid to ellipsoid, apex and base both curved toward sulcus, apex slightly beaked, base attenuate, very base swollen, 1.7 – 2.0 × 0.6 – 0.7 cm, flesh white, inner mesocarp with c. 8 low ridges, stigma 2 mm across.

369

DISTRIBUTION. Indonesia – Simeulue Is. SPECIMENS EXAMINED. INDONESIA. Simeulue Island, imm. fr., 8 Nov. 1917, Achmad 64 (L! [2 sheets]); imm. fr., 19 Jan. 1918, Achmad 191 (holotype L! [L 0014823]; isotypes BO n.v., L! [L 0014824]); imm. fr., 20 Feb. 1918, Achmad 257 (L! [2 sheets]); imm. fr., 20 Nov. 1918, Achmad 748 (L!), imm. fr., 5 Mar. 1919, Achmad 963 (L!); ♂ fl., 23 May 1919, Achmad 1132 (BO n.v., G n.v., K!, L!, P n.v., SING n.v., U n.v., W n.v.); buds, 20 Aug. 1919, Achmad 1321 (A!, L!, P!); Tapah (Defajan), imm. fr., 5 Jan 1920, Achmad 1594 (K!, L!); ibid, ♂ buds, 15 April 1920, Achmad 1797 (BO n.v., K!, L!, SING n.v., W n.v.). PHENOLOGY. Flowers in April and May, immature fruit November through January. VERNACULAR NAME(S). Soerimanoe oeding, toeloen soerimanoe-delok, ansan delok oeding, bajoet oedeng, poeloei-poeloei silai, poeloejan etem, ansan delok, sosot manoe, toetoen lasoeri manoe pajo. NOTES. Sleumer (1969) described Gomphandra pseudojavanica as a separate species and used the abaxial leaf pubescence and fruit base shape to distinguish it from G. javanica. Gomphandra pseudojavanica does not warrant recognition as a separate species. Twig characteristics, inflorescence position and structure, flower size, and fruit size and shape all overlap with Gomphandra javanica. Specimens from Simeulue may have larger leaves than typical Gomphandra javanica, and they do retain more of their pubescence (sparsely pubescent vs. usually glabrous), but otherwise stigma width in the fruit is the only consistent difference. The stigma of Gomphandra javanica subsp. javanica is accrescent during fruit development (2.5 – 3.5 mm) and can be nearly double the width of Gomphandra javanica subsp. pseudojavanica, which is not accrescent (2 mm). Stigma width of other species, like Gomphandra mappioides, varies more within the species than it does between the subspecies of G. javanica. Stigma width and shape can be diagnostic for certain species, but only when used in combination with other features like fruit size and shape, inner mesocarp ridging pattern, or leaf morphology. Fruit base shape, which Sleumer used to distinguish Gomphandra pseudojavanica in his original description, is not a reliable character, especially in the submature fruit available for the taxon. Additional collections are not likely, but they might provide more reliable 370

characters to distinguish the Simeulue specimens and support the recognition of the taxon as a species again. Gomphandra javanica subsp. pseudojavanica is recognized at the subspecies level because its geographic distribution, in combination with one leaf character and one fruit character, make it possible to separate it from Javan specimens.

24. Gomphandra mappioides Valeton (1886: 227). Type: Sumba, Teysmann 6711 (lectotype L! (selected by Sleumer 1969); isolectotypes A!, BO n.v.). Stemonurus apoensis Elmer (1915: 2690). Gomphandra apoensis (Elmer) Merr. (1923: 490). Type: Philippines, Mindanao, Elmer 10658 (lectotype A!, (selected by Schori); isolectotypes BM n.v., BO n.v., E! photo, F!, FI n.v., G n.v., GH!, K!, L!, MO!, NY!, P!, WRSL n.v.). Gomphandra sorsogonensis Elmer (1939: 3748), nom. inval. G. australiana F. Muell. var. celebica Valeton in Koord. (1898: 392). G. javanica Holthuis & H. J. Lam [non (Bl.) Valeton], Blumea 5 (1942) 205.

Small to mid-sized tree to 15 – 35 m high and 45 cm in diam., bole straight, cylindrical, buttresses rare, to 0.5 m high and 10 cm thick, bark greyish-white to brown, smooth to fissured. Twigs slightly zigzag, terete, 1.5 – 2.5 mm thick, often green when young, greyish when older, moderately pubescent with minute appressed hairs at the tips, quickly glabrescent. Terminal buds falcate, with light gray, blackish, yellowish-brown or colorless hairs, often appearing cinereous in dried specimens. Leaves medium green and a bit glossy above, paler and glossy below when fresh, chartaceous to somewhat coriaceous in higher elevation plants, sparsely pubescent along the veins when young, quickly glabrescent, mature leaves glabrous, lanceolate-elliptic to ovate or oblong, apex acute to short-acuminate, base acute to rounded, often somewhat asymmetrical, margin flat to minutely revolute when dried, (6 – ) 10 – 15.5 ( – 19) × (2 – ) 4.5 – 5.5 ( – 9) cm; midrib impressed above, raised below, secondary veins impressed above when fresh, or flat to raised when dry, (3 – ) 5 – 6 ( – 9) pairs, slightly raised beneath, somewhat steeply 371

ascending, upper pairs joining near the margin, tertiary veins flat to impressed above, raised below, delicately but distinctly percurrent; petiole glabrescent, grooved above, 0.5 – 1.5 cm × 1 – 1.5 mm. Inflorescences axillary, on recent growth or mature twigs, often on the older naked portions, 1 – 2 per axil, axes pubescent. Male inflorescences with peduncle 0.4 – 1 ( – 2) cm long, bearing 3 – 4 branches to 0.5 ( – 1) cm long, each then branched 1 – 2 times, flowers 3 – 25 ( – 50), subsessile or on short pedicels 1 – 3 mm. Male flowers: calyx cupular, green, glabrous, entire or with minute teeth, sometimes irregularly tearing, 1.5 – 2 mm long, 2 – 3 mm wide; petals 5, glabrous, white, yellow, yellowish green, or pale green, sometimes fragrant, 3.5 – 5 mm long; stamens 5, cream, 6 mm long, slightly exserted, filaments almost glabrous to dorsally pubescent with short, scattered hairs and more densely pubescent ventrally; ovary rudiment cream, minute, glabrous, evidently sunken in a disk. Female inflorescences with peduncles to 1 cm long before branching, typically bearing (1 – ) 4 (rarely 5) pedicels 0.3 – 0.6 cm long, occasionally rebranched if more than 5 flowers are present, peduncle and pedicels elongating during fruit maturation, flowers 1 – 4 ( – 10). Female flowers: calyx green, glabrous, cupular, entire or with minute teeth, often irregularly tearing, 2 – 3 mm across; petals 5, glabrous, yellowish green, 3 – 4 mm long, corolla sometimes splitting down one side, staminodes 5, not or scarcely exserted, 3 – 4 mm long, with short clavate hairs dorsally at the connective and ventrally below the anther cells; ovary light green, glabrous, cylindrical, 3 – 4 mm long; stigma 5-lobed and ridged, 2 – 3 mm in diam., capping young ovary. Infructescences with peduncles (0.4 – ) 0.8 – 1.2 ( – 2.2) cm long, pedicels 0.5 – 1 ( – 1.7) cm long, fruit subtended by the persistent patellar calyx, 5 mm in diam. Fruit ellipsoid-obovoid, base tapered, very base usually swollen, white to cream tinged pink or orange at maturity, yellowish-orange or pinkish when submature, 1.6 – 2.3 × 0.8 – 1.1 cm, stigma apical to slightly displaced, 2.5 – 3.5 mm in diam., inner mesocarp with ca. 12 low ridges.

DISTRIBUTION. Philippines; Indonesia (Talaud, Sulawesi, Sumbawa, Sumba, Flores, Timor, Wetar, Tanimbar, Obi, Bacan, Halmahera, Tidore, Ternate, Morotai); Timor- Leste. 372

SPECIMENS EXAMINED. INDONESIA. Sulawesi, North Sulawesi Province, Talaud Is., Karakelang, Gunung Duata, 100 m, imm. fr., 5 May 1926, Lam 2847 (A!, K! [2 sheets], L!, NY!); Sulawesi Is., Minahasa, Bukit Timampas near Gunung Klabat, 1°28’ N, 125°03’ E, 500 m, fr., 31 Oct. 1973, de Vogel 2670 (L!); Pangi, Sungai Ilanga, 0°41’ N, 123°40’ E, 350 m, ♂ buds, 27 Feb. 1990, Burley et al. 3540 (A! [2 sheets], BISH!, CANB!, F!, K!, L!, US!); ibid, 350 – 750 m, imm. fr., 27 Feb. 1990, Burley et al. 3548 (A!, BISH!, CANB!, K!, L!, NY!); ibid, 350 m, ♂ fl., 12 March 1990, Burley et al. 3828 (A!, BISH!, CANB!, F!, K!, L!, US!); ibid, 350 – 750 m, ♂ buds, 14 March 1990, Burley et al. 3873 (A!, K!, L!, NY!); ibid, 350 – 750 m, ♂ fl., 18 March 1990, Burley et al. 4008 (A!, CANB!, K!, L!, NY!); Papayuto, Sungai Papayuto, 0°45’ N, 121°30’ E, 200 m, ♂ fl., 28 March 1990, Burley et al. 4123 (A!, CANB!, E!, K!, L!, MO!, NY!); Manado, ♀ fl., 12 March 1895, Koorders 17481β (L!); ibid, fr., 31 Feb. 1895, Koorders 18349β (BO n.v., L!); ibid, 700 m, imm. fr., 15 April 1895, Koorders 18350β (lectotype of G. australiana var. celebica (selected by Sleumer 1969), BO n.v.; isolectotypes A!, K! L! [2 sheets, L 0014791, L 0014783], P!); ibid, March 1895, Koorders 18351β (BO n.v., K!, L!); ibid, 29 April 1895, Koorders 18352β (BO n.v., L!); ibid, fr., 1895, Koorders 18353β (BO n.v., K!, L!); ibid, buds, 16 Jan. 1895, Koorders 18354β (BO!, L! [2 sheets], P!); ibid, imm. fr., 21 April 1895, Koorders 18355β (BO n.v., L!); ibid, 700 m, 13 April 1895, Koorders 18356β (BO n.v., L!, P!); ibid, fr., 1 March 1895, Koorders 18357β (BO n.v., L! [2 sheets]); ibid, 600 m, ♂ buds, 2 March 1895, Koorders 18362β (BO n.v., K!, L! [2 sheets], P!, UC!); Manado, Amoerang, 650 m, fr., 22 Aug. 1934, Neth. Ind. For. Ser. bb.18683 (L!); Central Sulawesi Province, Poso District, Ulubongka Subdistrict, Mire, Gunung Katopas, Lembah Rupiah, ♂ fl., 20 Feb. 2004, Hendrian et al. 829 (E!, L!); Morwali, 0 m, ♀ fl., 21 March 1980, Lack & Grimes 1676 (K!); Wuasa, Lore Lindu National Park, 1.2503 S, 120.1819 E, 1040 m, ♀ fl., 7 Oct. 2001, Kessler et al. PK 3165 (A!); West Sulawesi Province, Tapalang, ♀ fl., 4 Aug. 1912, Noerkas 445 (L!); South Sulawesi Province, Bulukumba District, Belutana near Malino, 5°16’ S, 119°51 E, 800 m, ♀ buds, 10 Feb. 2000, Argent et al. 39 (A!, E! [2 sheets], L!); ibid, 800 m, ♂ fl., 10 Feb. 2000, Argent et al. 43 (A!, E! [2 sheets], L!); Malili, Kawata, 250 m, fr., 14 Oct. 1932, Neth. Ind. For. Ser. Cel/V-197 (L!); ibid, ♀ fl., 26 Sept. 1933, Neth. Ind. For. Ser. 373

Cel/V-197 (L!); Malili, Ds. Manurung, Wai Mami, 3 m, fr., 16 April 1984, Ramlanto 213 (L!); Malili, Kawata, 200 m, galled fr., 20 Dec. 1932, Neth. Ind. For. Ser. Cel/V-230 (L!); ibid, ♂ fl., 25 Feb. 1933, Neth. Ind. For. Ser. Cel/V-230 (L!); Mt. Wawonseru, SW of Soroako, 2°15’ – 3° S, 121° - 121°45’ E, 1000 m, imm. fr., 1 July 1979, Hennipman 6084 (A!, K!, L! [2 sheets], UC!); ibid, 1000 m, galled fr., 1 July 1979, Hennipman 6085 (A!, K!, L!, UC!); Pangkadjene [Pangkajene], fr., Teysmann 11742 (L!); ibid, galled fr., Teysmann 11973 (L!); Maros, fr., Teysmann 12841 (L!); Lokka, Bouthain, fr., Teysmann 14033 (L!); Bouthain, ♂ buds, Teysmann 13783 (L!); East Sulawesi Province, Kabaena Is., Tangkeno, Gunung Sabampolulu, 5°16’ S, 121°56’ E, 700 – 900 m, imm. fr., 26 July 1993, McDonald & Ismail 4002 (A!, BISH!, CANB!, F!, K!, L!, US!); Sumbawa, Mt. Batulanteh, 700 – 800 m, imm. fr., 19 April 1961, Kostermans 18321 (A!, BH!, BISH!, BM!, BRI!, CANB!, K!, L!); ibid, 700 – 800, imm. fr., 19 April 1961, Kostermans 18328 (CANB!, K!, L!); ibid, 800 – 900 m, ♂ fl., galled, 25 April 1961, Kostermans 18479 (A!, K!, L!, US!); ibid, 500 – 700 m, imm. fr., Kostermans 18738 (A!, BH!, CANB!, K!, L!); ibid, 700 m, ♂ buds, 4 Nov. 1961, Kostermans 19173 (A!, BH!, CANB!, K!, L!); Sumba, Loko, Winggor, fr., Teysmann 6710 (syntype of G. mappioides, L! [L 0014796]; BO n.v., FI n.v.); ibid, fr., Teysmann 6711 (lectotype of G. mappioides, L! [L 0014795]; isolectotypes A!, BO n.v.); Ngallu, N of Baing, Gunung Duanda, 9°9’ S, 120°31’ E, 525 m, imm. fr., 5 Oct. 1994, McDonald & Sunaryo 4409 (L!, US!); Flores, Mt. Ndeki, 200 m, 13 April 1965, Kostermans & Wirawan 210 (L!); ibid, 200 m, ♀ fl., 14 April 1965, Kostermans & Wirawan 233 (K!, L!, US!); Ruteng, 1500 m, imm. fr., 20 July 1966, Schmutz 426 (L!); Nunang, See, 650 m, imm. fr., 15 Nov. 1966, Schmutz 757 (L!); Wae Mao, 1000 m, imm. fr., 7 May 1965, Kostermans & Wirawan 822 (K!, L!, US!); Ruteng, 1200 m, 17 May 1934, de Voogd 1793 (BO n.v., L!); Ruteng, Golo, 1585 m, imm. fr., 4 July 1964, Verheijen 2022-2B (L!); Ruteng, Golo, 1585 m, imm. fr., 4 July 1964, Verheijen 2024 (L!); West Manggarai, Nggoang, 900 m, ♀ fl., 25 Nov. 1971, Schmutz 2840 (L!); no specific locality, imm. fr., 1970, Verheijen 2879 (L!); Nunang, 900 m, imm. fr., 22 May 1972, Schmutz 2933 (L!); Golo, 1800 m, ♂ fl., Verheijen 3029 (L!); no specific locality, ♂ buds, 17 Jan. 1973, Verheijen 3235 (L!); Mandusawu, 2300 m, fr., 5 Oct. 1973, Schmutz 3405 (L!); Mt. Desu, Todo, 1375 m, fr., 22 Oct. 1973, Schmutz 3479 374

(L!); Poeoemere, Wawo, ♂ buds, 18 Jan. 1926, Neth. Ind. For. Ser. bb.9641 (BO n.v., L!): Wailako, 5 m, 30 June 1930, Neth. Ind. For. Ser. bb.14362 (L!); Timor, Nasimetan, Kapan, 900 m, ♂ fl., 15 March 1939, Neth. Ind. For. Ser., bb. 27128 (A!, K!, L!, NY!); Wetar, Ilwaki, 700 m, 1 April 1939, Neth. Ind. For. Ser., bb. 27198 (A!, L!, NY!); Tanimbar, Yamdena Is., Otimmer, ♀ fl., 28 March 1938, Buwalda 4473 (A!, K!, L!); ibid, 30 m, ♀ fl., 28 March 1938, Neth. Ind. For. Ser. bb.24358 (A!, L!); Maluku Province, Morotai Is., Gunung Sangowo, 900 m, 26 May 1949, Kostermans 1119 (L!); Gunung Sabatas, 60 m, imm. fr., 21 June 1926, Lam 3498 (K!, L!); Halmahera, Tobelo, 2 m, ♂ fl., 22 Dec. 1922, Beguin 2307 (BO n.v., L!); Gunung Sahu, near Susupu, 1°11’ N, 127°27’ E, 500 m, imm. fr., 6 Oct. 1974, de Vogel 3286 (CANB!, L!, MO!); ibid, 500 m, ♂ buds, 6 Oct. 1974, de Vogel 3299 (CANB!, K!, L!, MO!); Gunung Jailolo, 1°04’ N, 127°27’ E, 400 m, imm. fr., 13 Oct. 1974, de Vogel 3433 (CANB!, K!, L!, MO!); Bacan Island, fr., 2 Sept. 1985, Sidiyasa et al. TCW 3570 (K!, L!); Tidore Island, Gunung Mala- Mala, 800 m, imm. fr., 7 July 1926, Lam 3707 (L!); Gunung Sibela near Waiaua, 0°45’ S, 127°32’ E, 250 m, imm. fr., 30 Oct. 1974, de Vogel 3775 (CANB!, K!, L!, MO!); ibid, 250 m, imm. fr., 30 Oct. 1974, de Vogel 3781 (CANB!, K!, L!, MO!); Obi Is., Anggai, Gunung Batu Putih, 1°25’ S, 127°48’ E, 500 m, imm. fr., 12 Nov. 1974, de Vogel 3984 (CANB!, K!, L!, MO!); ibid, Jokodolong, 1°28’ S, 127°30’ E, 1 m, imm. fr., 25 Nov. 1974, de Vogel 4301 (CANB!, K!, L!, MO!); Akelamo Oba, 0°35’ N, 127°36’ E, 25 m, imm. fr., 4 Dec. 1974, de Vogel 4392 (CANB!, K!, L!, MO!). TIMOR-LESTE. Mehara, near Los Palos, 8°27’37” S, 127°10’47” E, 400 m, fr., 2 Oct. 2005, Cowie & Xavier 10710 (BRI n.v., CANB n.v., L!). Cultivated at Botanic Gardens, Bogor, Java. ♂ fl., 15 April 1958, Jacobs X E 90 (BH!, CANB!, K!, L!); plant originally from Sulawesi, sub No. XI.B.XVII.46, 250 m, ♂ buds, 22 March 1960, Martati 125 (A!, BRI! [4 sheets], K!, L!, NY!, P!); plant originally from Sulawesi, tree IIIG.12, imm. fr., 23 Sept. 1954, Alston 17133 (A!, L! [2 sheets]). HABITAT. Dipterocarp forest, primary forest on limestone; granitic soil; coastal alluvial flats; volcanic soils; ultramafic soil; 0 – 2300 m. Leaf galls present. PHENOLOGY. Flowers in August to April, fruit in August to October (February). 375

VERNACULAR NAME(S). Momodjo (Ternate); wai wai papaia, omodo [Tobaro], modoro (Halmahera); teoe, harju, kaong (Flores); anuwuk’a (Talaud); mali-mali (Tidore). NOTES. Gomphandra mappioides is a widespread and easily recognized species. The female inflorescences have 4 – 5 (rarely up to 10) flowers that are usually borne on relatively long pedicels. The male inflorescences have more flowers, and the stamens are glabrous or pubescent with short papillate hairs, which distinguishes Gomphandra mappioides from all other Indonesian species with pubescent stamens. In Indonesia, the species does not overlap in distribution with any other species of Gomphandra. In the Philippines, there is overlap but the species is more uniform, while in Indonesia, leaf morphology is quite variable. Gomphandra mappioides occurs on at least 13 different islands in the center of the Indonesian archipelago, and isolated populations may be accumulating differences that will eventually lead to speciation. For example, specimens from Sulawesi have broader leaves with steeply ascending basal vein pairs, while specimens from higher elevations in Sumbawa have very small, somewhat coriaceous leaves. Specimens from Flores have been collected at elevations from 5 to 2300 m and have some very aberrant morphologies. Indeed, enough variation may already be present to warrant recognizing varieties or subspecies, except not enough reproductively mature specimens are available from most parts of the species’ distribution, so variation cannot be easily assessed to identify discrete differences. Additional collections of mature flowers and fruits are needed from all islands within the species’ distribution. Some of the variation in Gomphandra mappioides may be due to environmental stress, as many collections have galled flowers or fruit, suggesting that the species is more vulnerable to insect attack than other species of Gomphandra.

45. Gomphandra parviflora (Bl.) Valeton (1886: 218) var. parviflora Stemonurus parviflorus Bl. (1850: 250). Lasianthera parviflora (Bl.) Miq. (1856: 791). Type: Indonesia, Sumatra, Korthals 882b-1 (lectotype L! [L 0014816] (selected by Schori)).

376

Treelet. Twigs relatively straight, 1.5 – 2.3 mm in diam., with minutely pubescent tips. Leaves elliptic to obovate-elliptic, occasionally lanceolate-elliptic or oblong, apex abruptly acuminate, base acute, often slightly asymmetrical, chartaceous, glabrous, (10 – ) 14 – 19 ( – 30) × (3 – ) 5.5 – 7 cm, margin flat to slightly revolute; midrib impressed above, raised below, secondary veins 6 – 9 ( – 10) pairs, flat to impressed above, raised below, vein course ± parallel, lowest pair often steeply ascending, most pairs brochidodromous, tertiary veins flat to slightly raised above, slightly raised below, delicately percurrent; petiole grooved, 0.6 – 1.3 cm × 1.5 mm. Inflorescences axillary, 1 – 2 per axil, often from flowering spurs, axes pubescent with minute appressed pubescence. Male inflorescences with peduncle 0.1 – 0.3 cm long, sometimes bearing 2 – 3 short branches 2 mm long each with up to 5 flowers on pedicels 0.5 – 1.5 mm long, or branches absent, flowers 5 – 10 per inflorescence. Male flowers: calyx cupular, minutely apiculate, 1.5 mm across, sparsely pubescent, 1 mm; petals 5, glabrous or with a few apical hairs in bud, 3 mm long; stamens 5, slightly exserted; glabrous to sparsely pubescent ventrally and with a tuft of clavate hairs dorsally at the connective; ovary rudiment glabrous. Female inflorescences with peduncle 0.1 – 0.3 cm long, bearing 1 – 3 flowers on pedicels 1 – 2 mm long. Female flowers: calyx cupular, 1.5 mm across, 1 mm high, petals and staminodes not seen, ovary glabrous, 2 – 3 mm long, stigma 1 mm across. Fruit obovoid-ellipsoid, apex acute, base acute, very base swollen, 1.8 × 0.6 – 0.7 cm, stigma broad and relatively flat, 3 mm in diam., inner mesocarp with ca. 10 anastomosing ridges.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. No specific locality, ♀ fl., no collector, (L! [L 0014822]); ibid, ♂ buds, Valeton determination label 124, (L! [L 0014821]); ibid, ♂ infl., Valeton determination label 22 (L! [L 0014812]); Sumatra, no specific locality, ♂ buds, fr., no collector (L! [L 0014814]); ♀ fl., Korthals 882b-1 (lectotype L! [L 0014816]); ibid, ♂ buds, ♀ fl., Korthals s.n. (L! [L 0014819]); ibid, Korthals s.n. (L! [L 0014813]); ibid, ♂ buds, Korthals s.n. (L! [L 0014818]); ibid, ♂ buds, Korthals s.n./Valeton determination label 115 (L! [L 0014820]); Singalang, Korthals s.n. (L! [L 377

0690007]); Padang Province, 360 m, Aug. 1878, Beccari P. S. 497 (FI, K, L! [L 0690200]); Blume s.n. (P! [P00632088]). NOTES. Gomphandra parviflora has been divided into three varieties. The typical variety is known from 12 collections from the Padang Highlands, so the species is not very well characterized. Gomphandra parviflora var. magnifolia was collected from the same area as var. parviflora, and it differs by having larger leaves and fruit. Gomphandra parviflora var. paucibarbata is known from one individual collected approximately 200 km away from the other varieties. It differs in its leaf venation and in several floral characters, but the flowers of var. parviflora are not well known, so var. paucibarbata was described as a variety of Gomphandra parviflora rather than as a separate species. It may well represent a new species, but more material of both taxa needs to be collected before they are reassessed. Gomphandra parviflora var. parviflora is primarily distinguished from other Sumatran species by the features it lacks: secondary veins that terminate in a more or less straight intramarginal vein, and pubescent fruit. Gomphandra parviflora var. parviflora may have an intramarginal vein, but it is formed by the incurving of the secondary veins and does not arise from the lowest pair of secondary veins.

46. Gomphandra parviflora var. magnifolia Schori (Kew Bulletin). Type: Indonesia, Sumatra, Singalang [Singgalang], Korthals 882b-2 (holotype L! [L 0014815]).

Twigs somewhat zigzag, 1.2 – 2 mm in diam., moderately pubescent with minute spreading hairs. Leaves ovate-elliptic to obovate, base acute, apex abruptly acuminate, chartaceous, 20 – 26 × 7 – 10 cm, essentially glabrous, margin flat; midrib raised below, secondary veins 10 – 15 pairs, slightly raised below, vein course parallel, brochidodromous and forming an intramarginal vein, intersecondaries common, tertiary veins flat to slightly raised below, very delicately percurrent; petioles 0.9 – 1.1 cm long, glabrous or with a few hairs. Inflorescences and flowers not known. Infructescences axillary, axes pubescent with minute appressed hairs, peduncle 0.4 cm long, bearing 1 378

fruit or 3 fruit on pedicels 2 mm long. Fruit subtended by the calyx, which is cupular, minutely apiculate, and sparsely pubescent; evidently glabrous, narrowly obovoid- ellipsoid, 2.4 – 2.6 × 0.6 – 0.7 cm, apex acute, base attenuate, very base slightly swollen, inner mesocarp with ca. 10 anastomosing ridges, stigma 2.2 – 2.5 mm across.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, Korthals s.n. (L! [L 0014817]; Singalang {Singgalang], Korthals 882b-2 (holotype L! [L 0014815]). HABITAT. The type label says “sylvis Singalang.” CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). NOTES. The type, Korthals 882b-2, is clearly a different collection than Korthals 882b- 1, which is the lectotype of Gomphandra parviflora var. parviflora. Neither specimen of Gomphandra parviflora var. magnifolia has any type status under G. parviflora var. parviflora, despite Sleumer’s annotations. Gomphandra parviflora var. magnifolia was collected from the same area as var. parviflora, but its leaves are larger with more veins, and the fruit is longer as well. It might be a separate species, but with so little material of Gomphandra parviflora available, it is impossible to tell whether material treated as G. parviflora here represents the natural range in variation of one species, or whether there are two species that could be distinguished by additional features were more material available.

47. Gomphandra parviflora var. paucibarbata Schori (Kew Bulletin). Type: Indonesia, Sumatra, West Sumatra Province, Pesisir Selantan District, Indrapura, 150 m, ♂ buds, 3 Jan. 1984, Rahayu 556 (holotype L!; isotypes BO n.v., K!, P n.v., SING n.v.).

Shrub to 3 m. Twigs relatively straight, 1.4 – 2.2 mm in diameter, sparsely pubescent with minute spreading hairs, eventually glabrescent. Leaves chartaceous, glabrous above, glabrescent below, broadly lanceolate to lanceolate-obovate, 14 – 22 by 4 – 5.5 cm, apex acuminate, base acute to attenuate, margin slightly revolute; midrib impressed above, 379

raised below, secondary veins 7 – 10 pairs, flat above, raised below, lowest pair steeply ascending and forming an intramarginal vein, upper pairs ± parallel, intersecondaries very common, tertiary veins flat above, flat to very slightly raised below, very delicately percurrent; petioles grooved, 0.6 – 1.2 cm long, sparsely pubescent with minute appressed hairs, glabrescent. Male inflorescences axillary, 1 mature inflorescence per axil and often 1 – 2 very immature inflorescences in bud as well, on recent growth, axes densely pubescent with short reddish pubescence, peduncle 0.1 – 0.3 cm long, bearing 2 – 4 branches 1 – 2 mm long, flowers on pedicels to 1 mm long, (1 – ) 6 – 11 flowers per inflorescence. Male flowers: calyx cupular, lobed, 1 mm across, margins densely ciliate with short reddish pubescence; petals 4 – 5, 3.5 – 4 mm long, tips sparsely pubescent with minute reddish hairs; stamens 4 – 5, strongly exserted, 4.5 – 5 mm long, glabrous or with a few long clavate hairs ventrally; ovary rudiment ovoid, glabrous. Female inflorescences, flowers, and fruit unknown.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, West Sumatra Province, Pesisir Selantan District, Indrapura, 150 m, ♂ buds, 3 Jan. 1984, Rahayu 556 (holotype L!; isotypes BO n.v., K!, P n.v., SING n.v.). HABITAT. Secondary forest, 150 m. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). NOTES. Gomphandra parviflora var. paucibarbata differs from var. parviflora in its somewhat narrower leaves with a distinct intramarginal vein and its densely ciliate calyx. It may also have larger flowers with longer stamens and less staminal pubescence, but mature staminate flowers are not known for var. parviflora, and floral dimensions cannot be accurately compared between buds and open flowers. More collections of either variety may prove Gomphandra parviflora var. paucibarbata to be a separate species, but given the lack of complete material for either taxon, there are no definitive reproductive characters that can currently be used to support G. parviflora var. paucibarbata as a distinct species. It can be distinguished from var. magnifolia by its much narrower, shorter leaves with fewer veins. 380

8. Gomphandra quadrifida (Bl.) Sleumer (1940: 238). Stemonurus quadrifidus Bl. (1850: 249). Lasianthera javanica (Bl.) Miq. var. quadrifida (Bl.) Miq. (1856: 790). Type: Sumatra, Korthals s.n. (lectotype L! [L 0014829]). Stemonurus prasinus Bl. (1840: 249). Lasianthera prasina Miq. (1856: 791). Gomphandra prasina (Bl.) Becc. (1877: 110). Type: Sumatra, Padang Highlands, Korthals 1215 (holotype L! [L 0014828]). Stemonurus penangianus Miers (1852: 39). Gomphandra penangiana Wall. ex Mast. in Hook. f. (1875: 587). Type: Penang, Wallich 7204 (holotype BM n.v.; isotypes C n.v., CGE n.v., GH!, K! [4 sheets], L!, NY!, P n.v.). Lasianthera maingayi Mast. in Hook. f. (1875: 585). Stemonurus maingayi (Mast.) Valeton (1886: 236). Urandra maingayi (Mast.) Kuntze (1891: 113). Gomphandra maingayi (Mast.) King (1895: 114). Gomphandra quadrifida var. maingayi (Mast.) Sleumer (1969: 203). Type: Penang, Government Hill, Maingay K.D. 374/2 (lectotype K!, isolectotypes BM n.v., CGE n.v., GH!, L!, P!). Lasianthera ovalifolia Miq. (1860: 137, 342 (descr.)). Gomphandra penangiana Wall. var. ovalifolia (Miq.) Valeton (1886: 225, pl. 4, f. 17 a- b). Type: Sumatra, Muara Enim, Teysmann H.B. 3992 (holotype U! photo [U 0002514]; isotypes BO n.v., L! [2 sheets]). Gomphandra oppositifolia Pierre ex Gagnep. (1910: 198). Stemonurus oppositifolius (Pierre ex Gagnep.) R. A. Howard (1940: 469). Type: Vietnam, Đồng Nai Province, Biên Hòa, Pierre 6250 (holotype P n.v.; isotype L!). Gomphandra puberula Ridl. (1915: 142). Gomphandra maingayi King var. pubescens Ridl. (1922: 429). 381

Type: Malaysia, Terengganu, Mt. Tahan, Ridley 15950 (lectotype SING! photo, isolectotypes BM n.v., K!). Stemonurus affinis Miers (1852: 44). Gomphandra affinis (Miers) Mast. in Hook f. (1875: 586). Type: Malaysia, Malacca, Mt. Ophir, 1845, Griffith 805 (lectotype K! [K000381677]; isolectotypes CAL!, GH!, K! [K000381676], P!). Gomphandra affinis sensu Ridl. (1922: 427), non (Miers) Mast. var. floribunda Ridl. (1922: 427). Type: Malaysia, Weld Hill, 1915, Ridley s.n., (lectotype BM n.v. (selected by Sleumer 1969). Gomphandra lanceolata (Mast.) King var. tenuifolia Craib (1926: 273). Type: Thailand, Pattani, Kerr 1750 (holotype BM; isotypes K!, SING). Gomphandra scorpioidea Gagnep. (1947: 133). Type: Vietnam, Annam, Thua-thien, Hoi-mit, Eberhardt 1552 (A!, L!, P n.v.) Gomphandra quadrifida var. triplinervis (King) Sleumer (1969: 202). Type: Scortechini s.n. (holotype CAL; isotypes BM n.v., K!, L! [L 0014836], SING n.v.). Gomphandra lanceolata (Mast.) King var. angustifolia King (1895: 113). Gomphandra quadrifida (Bl.) Sleumer var. angustifolia (King) Sleumer (1969: 202). Gomphandra salicifolia Ridl. (1922: 429). Stemonurus salicifolius (Ridl.) R. A. Howard (1940: 469). Type: Malaysia, Penang, Western Hill, Curtis 1265 (lectotype of G. lanceolata var. angustifolia CAL n.v. (selected by Sleumer 1969); K! & SING n.v. lectotype of G. salicifolia (selected by Sleumer 1969)). Gomphandra lanceolata (Mast.) King var. ovalifolia Ridl. (1922: 428). Gomphandra quadrifida (Bl.) Sleumer var. ovalifolia (Ridl.) Sleumer (1969: 203). Type: Malaysia, Selangor, Mt. Mengkuang Leban, 1913, Robinson s.n. (lectotype SING n.v.). Gomphandra pubescens Ridl. (1922: 429). Type: Selangor, Weld Hills, March 1915, Ridley s.n., (lectotype K!). 382

Shrub or small tree to 6 m. Twigs slender, initially pubescent with short somewhat appressed hairs, quickly glabrescent, 0.8 – 2 mm in diam. Leaves extremely variable both within and between plants, lanceolate, oblong, ovate, elliptic, or obovate, apex acute to acuminate or somewhat caudate, base rounded to attenuate, chartaceous to thinly coriaceous, (6 – ) 8.5 – 18 ( – 23) × 2 – 6 cm, margin flat to slightly revolute in specimens with thicker leaves; midrib sunken above, raised below, secondary veins 1 – 9 pairs, flat above, raised below, venation pattern ranging from triplinerved to penninerved, veins converging toward the margin or parallel, joining near the margin or not, different venation often seen on adjacent leaves on the same twig, tertiary veins flat above, flat to slightly raised below, weakly to distinctly percurrent; petiole narrowly grooved above, glabrescent, 0.4 – 0.9 cm long. Inflorescences terminal, leaf-opposed, or sometimes appearing axillary by terminating short axillary branches on mature growth, axes pubescent with short appressed hairs. Immature inflorescences often present opposite mature leaves. Male inflorescences potentially blooming for a period of months, with spent pedicels, open flowers, and minute buds present at the same time, axes often elongating to appear distinctly scorpioid by development of additional buds at inflorescence branch apices; common peduncle 0.6 – 1.5 cm long, bearing up to 4 branches 0.3 – 0.5 ( – 1) cm long, these often rebranched 1 – 2 more times, terminal branches with 2 – 5 or more flowers in a scorpioid cyme, pedicels <1 – 2 mm long, often elongating after flowers disarticulate, first blooming with 12 – 15 ( – 35) flowers, up to 100 or more flowers per inflorescence before reserve buds are exhausted. Male flowers: calyx cupular, glabrous, minutely lobed or apiculate, petals 4 – 5, glabrous, white, 3 – 4 ( – 5) mm long, stamens 4 – 5, strongly exserted, 3.5 – 6 ( – 7) mm long, pubescent with a tuft of long clavate hairs dorsally at the connective and ventrally with clavate hairs below the anthers, ovary rudiment minute, cylindrical, glabrous. Female inflorescences with fewer flowers than male, usually not with reserve buds, common peduncle 0.5 – 0.7 ( – 2) cm long, bearing 2 – 4 branches 2 – 3 mm long, these with 1 – 4 flowers on pedicels 2 – 5 mm long, flowers 2 – 15 per inflorescence. Female flowers: calyx cupular, glabrous, apiculate, petals glabrous, 4 – 5, 4 – 5 mm long, staminodes not exserted, pubescent, ovary cylindrical, glabrous, 3 – 4 mm long, capped by the broader stigma. Fruit variable 383

in size, ovoid-ellipsoid, 1.3 – 1.7 × 0.7 – 0.8 cm, very base swollen (or not), apex often slightly beaked in immature fruit, reportedly white when ripe, inner mesocarp with 6 – 8 thickened anastomosing veins (rather than discrete ridges), stigma 1.5 – 2 mm in diam.

DISTRIBUTION. Indonesia – Sumatra; Singapore; Malaysia. INDONESIA. Sumatra, Aceh Province, Mt. Goh Lemboeh [Lembu], Aer Poetih waterfall area, 700 m, fr., 18 Feb. 1937, van Steenis 8881 (A!, K!, L!); Ketambe, Lau Alas, 600 m, ♂ fl., 28 May 1972, de Wilde & de Wilde-Duyfjes 12384 (K!, L!, MO!, US!); Gunung Mamas, 800 – 1000 m, buds, 9 Feb. 1975, de Wilde & de Wilde-Duyfjes 14658 (L!); Gunung Mamas, 1200 – 1500 m, ♂ fl., 10 Feb. 1975, de Wilde & de Wilde- Duyfjes 14759 (K!, L!); Kutacane, 3°25’ N, 97°50’ E, 1250 m, ♂ buds, 1 July 1979, de Wilde & de Wilde-Duyfjes 18283 (K!, L!, MO!); Kutacane, 3°25’ N, 97°40’ E, 300 – 100 m, ♀ fl., 1 July 1979, de Wilde & de Wilde-Duyfjes 18291 (K!, L!, MO!); Sikundur Forest Reserve, Besitang River, 3°55’ N, 98°05’E, 50 – 100 m, fr., 8 Aug. 1979, de Wilde & de Wilde-Duyfjes 19582 (K!, L!); Kloët Nature Reserve, 3°05’ N, 97°25’ E, 40 m, imm. fr., 8 July 1985, de Wilde & de Wilde-Duyfjes 19784 (L!); Alas River, Gelombang, 2°55’ N, 97°57’ E, 50 m, ♀ fl., de Wilde & de Wilde-Duyfjes 20238 (L!, US!); Sekundur Forest Reserve, Langkat, Aras Napal, 3°55’ N, 98°00’ E, 50 – 100 m, ♂ buds, 10 Aug. 1991, de Wilde & de Wilde-Duyfjes 21336 (L!); Sekundur Forest Reserve, Langkat, Aras Napal, 3°55’ N, 98°00’ E, 50 – 100 m, ♂fl., 12 Aug. 1991, de Wilde & de Wilde-Duyfjes 21360 (K!, L!); North Sumatra Province, Tapanuli, Sipirok, Sumuran, Dolok sibuak- buali, 1200 m, fr., 8 Mar. 1983, Zahro 62 (L! [2 sheets]); Asahan, Bandar Poeloeh, 150 m [500 ft.], ♂ fl., 10 Jan. 1926, Yates 1915 (MICH!, NY!, UC!); Asahan, Masihi Forest Reserve, 14 Oct. 1932, Krukoff 4046 (A, BRI! [2 sheets], L!, MICH!, MO!, NY!, US!); Asahan, Hoeta Padang, ♂ fl., Nov. 18 1932, Krukoff 4288 (A!, BISH!, BRI!, L!, MICH!, MO!, NY!, US!); Pargambiran, imm. fr., 18 – 30 Oct. 1933, Si Boeea 5870 (A!, L!, MICH!, NY!); Pargambiran, ♂ fl., 16 – 21 Nov. 1933, Si Boeea 6278 (A, F!, K!, L!, MICH!, NY!, UC!, US!); Asahan, Hoeta Bagasan, ♂ fl., Sept. 1934 – Feb. 1935, Si Boeea 6636 (A!, MICH!, US!); Asahan, Hoeta Bagasan, ♂ buds, Sept. 1934 – Feb. 1935, Si Boeea 6647 (MICH!, SING, US! [2 sheets]); Asahan, Hoeta Bagasan, ♀ buds, imm. 384

fr., Sept. 1934 – Feb. 1935, Si Boeea 6711 (A, MICH!, US!); ibid, ♂ buds, Sept. 1934 – Feb. 1935, Si Boeea 6733 (A, MICH!, US!); ibid, buds, Sept. 1934 – Feb. 1935, Si Boeea 7018 (A!, MICH!); Asahan, Hoeta Bagasan, buds, Sept. 1934 – Feb. 1935, Si Boeea 7059 (A!, MICH!, US!); Asahan, Hoeta Bagasan, ♂ fl., Sept. 1934 – Feb. 1935, Si Boeea 7137 (A!, BISH!, MICH!, US!); Aek Kanopan, Loendoet Concession, Koealoe, imm. fr., Apr. 1927, Bartlett 7316 (F!, MICH!, NY!, US!); Aek Sordang, Loendoet Concession, Koealoe, imm. fr., 7 May 1927, Bartlett 7623 (F!, MICH!, NY!, US!); Asahan, Loemban Ria, fr., Feb. – April 1935, Si Boeea 7764 (A!, MICH!, US!); ibid, ♂ fl., Feb. – April 1935, Si Boeea 7888 (A!, MICH!, US!); Asahan, Loemban Ria, buds, Feb. – April 1935, Si Boeea 7911 (A, MICH!, US!); Asahan, Loemban Ria, ♂ buds, Feb. – Apr. 1934, Si Boeea 8028 (A, MICH!, US!); Asahan, Aek Moente (Aer Moette), ♂ buds, 15 June – 9 July 1936, Si Boeea 9382 (A!, L!, MICH!, NY!, UC!, US!); Taloen na Oeli, Toba, ♂ fl., 29 July 1936, Si Boeea 9739 (A!, L!, MICH!, NY!, US!); Padang Sidempuan, Grunggang, 150 m, buds, 13 Dec. 1965, Kostermans 22016 (K!, L!); Riau Province, Talanglakat, Bukit Karampal, 102°32’ E, 0°46’ S, 100 m, ♂ buds., 1 Dec. 1988, Burley et al. 1777 (A!); Talanglakat, Bukit Karampal, 102°32’ E, 0°46’ S, 600 m, ♂ fl., 7 Dec. 1988, Burley et al. 1949 (A!, K!, L!); Talanglakat, Bukit Karampal, 102°32’ E, 0°46’ S, 600 m, ♂ fl., 7 Dec. 1988, Burley et al. 1981 (A!, K!, L!); W. Indragiri, buds, 8 Jan. 1956, Meijer 4126 (L!); W. Indragiri, buds, 10 Jan. 1956, Meijer 4239 (L!); Lingga, Bukit Dewan [Uwan], ♂, Teysmann 6707 (BO n.v., L!); Bukit Dewan [Uwan], ♂, Teysmann 6708 (BO n.v., L!); Boekid, Sipintjang, ♂, Teysmann 6709 (BO n.v., L!); West Sumatra Province, Air Sirah, above Padang, 0°57’ S, 100°32’ E, 1000 m, ♂ buds, 5 May 1985, de Vogel & Vermeulen 7475 (L!); Mentawi, Sipara [Sipora Is.], buds, 31 Oct. 1942, Iboet 561 (BO n.v., L!); Tanang Taloe, ♀ fl., 1100 m, 18 June 1917, Bünnemeyer 1142 (BO n.v., L!); Jambi Province, Jami, Pasir Mayang, 100 – 300 m, ♂ buds., 6 Feb. 1982, Vreeken-Buijs 13 (L! [2 sheets]); South Sumatra Province, Palembang, ♂ fl., 20 Aug. 1928, de Voogd 219 (BO n.v., L!); Bengkulu Province, Kepahiang, Bengkulu, ♀ buds, imm. fr., 700 m, 25 Aug. 1973, Kasik 81 (L!). HABITAT. Lowland dipterocarp forest, 100 – 1500 m. 385

VERNACULAR NAME(S). Kajoe minak-minak, kajoe barik-barik, kajoe barik tombak, kajoe si topoe lomak, kajoe si topoe lappot, kajoe si gorga, kajoe si topoe minak, kajoe lote (Asahan). NOTES. Gomphandra quadrifida is an extremely variable species. Several varieties were described based on leaf variation, but the distinctions do not hold up. Individual plants can have an ovate leaf with five pairs of strongly brochidodromous veins next to an oblong-elliptical leaf with nine pairs of veins that do not anastomose, so it is pointless to use leaf size, shape, and venation to distinguish among morphologies. The species is somewhat distinctive in its habit of a prolonged blooming period for male inflorescences. Other species of Gomphandra (e.g. flavicarpa, luzoniensis) may have small buds that persist for months and eventually mature, but only G. quadrifida seems to have inflorescence axes that will elongate multiple times as additional buds mature. Gomphandra quadrifida can be distinguished from most other Indonesian species by its terminal or leaf-opposed inflorescences. Two species in Borneo also have terminal inflorescences, but neither is likely to be confused with Gomphandra quadrifida. Gomphandra palustris has coriaceous leaves and distinctive fruit, and G. lamanii has caudate leaves with striking brochidodromous venation, minute reddish pubescence, few- flowered inflorescences, and fruits that are clearly ridged.

48. Gomphandra simalurensis Sleumer (1969: 194). Type: Indonesia, Simeulue, ♀ fl., 19 Dec. 1919, Achmad 1570 (lectotype L! [L 0014839] (selected by Schori); isolectotypes BO n.v., L! [L 0014838]).

Tree 13 – 25 m tall. Twigs relatively stout, 2.5 – 4.5 mm in diam., terminal bud pubescent with tawny, appressed hairs, twigs and leaves quickly glabrescent. Leaves often quite large, ovate to ovate-elliptic, apex acute to acuminate, base acute, decurrent onto petiole, firmly chartaceous to thinly coriaceous, glabrescent to glabrous at maturity, 10 – 17 ( – 21) × (4 – ) 4.5 – 9 ( – 11) cm; midrib impressed above, raised below, secondary veins 5 – 6 ( – 8) pairs, flat to slightly raised above, raised below, vein course parallel, upper secondaries tending to join near margin, tertiary veins obscure above, 386

slightly raised below, weakly percurrent; petiole stout, grooved above, 1 – 2 ( – 2.5) cm × 2 – 3 mm, glabrous. Inflorescences cymose, axillary, commonly on older portions of twigs, 1 – 2 per axil, axes with short, somewhat appressed tawny to reddish pubescence. Male inflorescence with common peduncle 1.5 – 2.5 cm long, usually with 2 – 5 branches inserted at one point, but branches sometimes somewhat paniculiform, branches 0.3 – 0.8 cm long, then each bearing up to 3 branches about 3 mm long, terminating in reduced cymes, with ca. 30 ( – 100) subsessile or shortly pedicelled (1 – 2 mm) flowers per inflorescence. Male flowers: calyx cupular, apiculate to slightly lobed, ciliate or sparsely pubescent, 1.5 mm across, petals 5, glabrous, 4 mm long; stamens 5, exserted, 5 mm long, filaments pubescent with short clavate hairs below the anthers and with longer hairs at the connective, ovary rudiment minute, glabrous. Female inflorescence with common peduncle to 1.5 cm long, bearing 2 – 5 irregular short branches up to 1 cm long, branches occasionally rebranched, flowers sessile or very shortly pedicellate, 12 – 20+ flowers per inflorescence. Female flowers: calyx cupular, minutely apiculate to lobed, ciliate or only sparsely pubescent, 1.5 mm across, petals 5, glabrous, 2.5 mm long; staminodes 4 – 5, equal in length to corolla, ovary cylindrical, 2 mm long, densely pubescent with somewhat appressed tawny hairs except the base and apex, stigma 1 mm across. Fruit glabrous to sparsely pubescent, oblongoid-ellipsoid, slightly beaked, apex truncate, base rounded, very base sometimes slightly swollen, 1.6 – 2 × 0.7 – 0.8 cm, inner mesocarp with 10 – 12 anastomosing longitudinal ridges, stigma 2.5 – 3 mm across, slightly displaced towards sulcus.

DISTRIBUTION. Indonesia – Simeulue Island. SPECIMENS EXAMINED. INDONESIA. Simalur [Simeulue] Island, imm. fr., 11 Mar. 1918, Achmad 290 (L! [2 sheets]); ibid, fr., 22 Apr. 1918, Achmad 389 (L!); fr., 13 July 1918, Achmad 536 (L! [2 sheets, L 0690061 without label); ibid, ♂ fl., 12 Nov. 1918, Achmad 733 (L! [2 sheets]); ibid, imm. fr., 3 Dec. 1918, Achmad 774 (L!); Tapah, ♂ buds, 1 Dec. 1919, Achmad 1534 (L!); ibid, ♀ fl., 19 Dec. 1919, Achmad 1570 (lectotype L! [L 0014839]; isolectotypes BO n.v., L! [L 0014838]); ibid, ♀, 31 Mar. 1920, Achmad 1767 (L!). 387

PHENOLOGY. Flowers in November and March, fruit in April and July. VERNACULAR NAME(S). Toetoen bahoehoe dotan, toetoen bahoehoe oeding, roebi silai (awa roebie silay), toetoen bahoehoe alafai, bajoeh oeding, toetoen bahoehoe delok. NOTES. Gomphandra simalurensis is known from only eight collections. Its leaves are usually quite large, but some collections (Achmad 389, 1767) have leaves that are smaller and more similar to those of Gomphandra pseudojavanica, which also occurs on Simeulue Island. Both species have pubescent ovaries, and their fruits are similar sizes, but Gomphandra simalurensis has thicker twigs, larger leaves, and robust inflorescences with many more flowers than G. pseudojavanica. Gomphandra capitulata also has pubescent ovaries, but its flowers are sessile and its leaf venation is quite different from that of G. simalurensis. Simeulue has a total area of 2,310 km2, and with three different taxa, was a hotspot of Gomphandra diversity, second only to Dinagat Island in the Philippines (802 km2, at least 4 species). However, most of the lowland forest has been destroyed and converted to oil palm plantations. Both endemic taxa may well be extinct.

49. Gomphandra simulans Schori (Kew Bulletin). Type: Indonesia, Sumatra, Aceh Province, Gunung Leuser Nature Reserve, Gunung Mamas, c. 12 km SW from the mouth of Lau Ketambe, 1500 – 1800 m, ♂ buds, 7 May 1975, de Wilde & de Wilde-Duyfjes 16666 (holotype L! [L 0690052]; isotype K!).

Shrub 2 m high. Twigs relatively straight, densely and persistently pubescent with tawny to reddish spreading hairs, 1.3 – 2 mm in diam. Leaves ovate-elliptic, base acute, inequilateral, apex acuminate, (7 – ) 9 – 14 × (2 – ) 3 – 4 cm, chartaceous, glabrous above, densely pubescent below with spreading hairs, margin narrowly revolute; midrib impressed above, raised below, secondary veins 5 – 7 pairs, flat to slightly raised above, raised below, lower pairs somewhat converging towards margin, upper pairs ± parallel, brochidodromous, intersecondaries common, tertiaries obscure above, flat below, weakly percurrent; petiole grooved, densely pubescent, 0.8 – 1 cm long. Inflorescences axillary, axes pubescent with minute appressed hairs. Male inflorescences capitate with peduncle 388

0.2 – 0.4 cm long, bearing up to 12 (possibly more) (sub)sessile flowers. Male flowers: calyx cupular, apiculate, pubescent, 1 – 1.5 mm across; petals 4 – 5, white, sparsely pubescent in bud, 3 ( – 4 ?) mm long, stamens 4 – 5, pubescent; ovary rudiment minute. Female inflorescences, flowers, and fruit unknown.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, Aceh Province, Gunung Leuser Nature Reserve, Gunung Mamas, c. 12 km SW from the mouth of Lau Ketambe, 1500 – 1800 m, ♂ buds, 7 May 1975, de Wilde & de Wilde-Duyfjes 16666 (holotype L! [L 0690052]; isotype K!). HABITAT. Montane forest, 1500 – 1800 m. CONSERVATION STATUS. Critically Endangered: CR B1ab(iii). ETYMOLOGY. The specific epithet refers to the pubescence, which is similar to that of Gomphandra tomentella (Kurz) Mast. and G. velutina Sleumer. NOTES. The only specimen of Gomphandra simulans was identified by Sleumer as Gomphandra tomentella, but it is certainly not that species because the inflorescences are axillary rather than terminal. Gomphandra simulans is similar to G. velutina, which was collected in Sulawesi, but its leaves are smaller, its pubescence is longer and more persistent, and the petals are only sparsely pubescent.

49. Gomphandra subrostrata Merr. (1938: 164). Stemonurus subrostratus (Merr.) R. A. Howard (1940: 469). Type: Sumatra, Damoeli, Koealoe, fr., 13-14 Sept. 1928, Rahmat Si Toroes 1323 (holotype MICH!; isotypes A!, NY!, US!).

Shrub to small tree, 2.5 – 7 m. Twigs pubescent with somewhat spreading, minute reddish hairs, eventually somewhat glabrescent, zigzag, 1.5 – 3.5 mm in diam. Leaves elliptic to oblong, apex acuminate, base acute to attenuate, slightly asymmetrical, firmly chartaceous, remaining very finely pubescent below, eventually glabrescent, generally drying a dark brown, (10 – ) 15 – 26 × (3 – ) 4.5 – 9 ( – 10.5) cm, margin slightly 389 revolute; midrib impressed above, raised below, secondary veins (5 – ) 6 – 10 ( – 12) pairs, flat above, raised below, somewhat parallel to converging near the margin, intersecondaries common, tertiary veins flat above, slightly raised below, percurrent; petiole grooved, pubescent, eventually glabrescent, 0.8 – 1.5 ( – 2.3) cm × 2 mm. Inflorescences axillary, 1 – 2 per axil, small and sometimes reduced to only a few flowers in depauperate specimens, axes pubescent with somewhat spreading reddish hairs. Male inflorescences to 1.5 cm long overall, with peduncle 0.4 – 1 cm long, bearing 3 branches 2 – 3 mm long, each branch with a somewhat scorpioid cyme of flowers, flowers sessile or on pedicels up to 2 mm long, up to 20 flowers per inflorescence. Male flowers: calyx cupular, lobed, sparsely pubescent, 1 mm across, petals 4 – 5, glabrous, whitish or greenish, 3 – 4 mm; stamens 4 – 5, strongly exserted, 4 – 5 mm long, with clavate hairs ventrally below the anther cells and dorsally in a tuft at the connective, ovary rudiment glabrous. Female inflorescences with a short peduncle 2 – 3 mm long, bearing 1 – 3 branches 1 mm long, branches serving as pedicels (2 – 3 mm long) or bearing up to 3 flowers on pedicels 1 – 2 mm long, up to 7 (or more?) flowers per inflorescence. Female flowers: incompletely known, petals glabrous, 4 mm long, staminodes 2 mm long, glabrous or sparsely pubescent; ovary glabrous, 3 – 4 mm long. Fruit reportedly white when ripe, ovoid, apex attenuate to rostrate, beak slightly curved toward sulcus, base rounded to somewhat tapered, very base often swollen, 1.2 – 1.4 × 0.6 cm; inner mesocarp with c. 10 very slight longitudinal ridges, stigma 1.5 – 2 mm across.

DISTRIBUTION. Indonesia – Sumatra. SPECIMENS EXAMINED. INDONESIA. Sumatra, North Sumatra Province, general region of Marbau, Bilah, near Bilah Pertama (Parbasiran), imm. fr., Feb. – March 1928, Rahmat Si Toroes 252 (A!, L!, MICH!, NY!); Silo Maradja, Asahan, in the vicinity of Taloen Djoring, ♂ buds, July – Aug. 1928, Rahmat Si Toroes 844 (A!, MICH!, UC!); Damoeli, Koealoe, fr., 13 – 14 Sept. 1928, Rahmat Si Toroes 1323 (type, A!, MICH!, NY!, US!); Bukit Lawang, Bohorok, Langkat, 400 m, imm. fr., 19 Feb. 1973, Dransfield 3252 (K!, L! [2 sheets]); Sibolangit, 300 m, ♂ fl., 14 June 1919, Lörzing 6685 (L! [2 sheets]); ibid, 450 m, ♂ fl., 21 June 1919, Lörzing 6690 (L! [2 sheets]); ibid, 350 m, ♀ fl., 390

imm. fr., 18 April 1921, Lörzing 8362 (L!); Aceh Province, Gunung Leuser Nature Reserves, Ketambe, valley of Lau Alas, near tributary of Lau Ketambe, 200 – 400 m, fr., 18 May 1972, de Wilde & de Wilde-Duyfjes 12087 (L!); ibid, c. 500 m, ♂ buds, 24 May 1972, de Wilde & de Wilde-Duyfjes 12321 (L!); ibid, c. 600 m, ♂ buds, 28 May 1972, de Wilde & de Wilde-Duyfjes 12401 (K! [2 sheets], L! [2 sheets], US!); ibid, 200 – 400 m, imm. fr., 3 Sept. 1972, de Wilde & de Wilde-Duyfjes 14450 (K!, L!, US!); Gunung Mamas, c. 2 km SW from mouth of Lau Ketambe, c. 800 – 1100 m, fr., 7 Feb. 1975, de Wilde & de Wilde-Duyfjes 14631 (L!); Ketambe Research Station and vicinity, Alas River valley, along Guhra River, c. 3°40’ N, 97°50’ E, 300 – 350 m, 10 June 1979, de Wilde & de Wilde-Duyfjes 18065 (K!, MO!); ibid, near Ketambe River, ♂ fl., 13 June 1979, de Wilde & de Wilde-Duyfjes 18140 (K!, L!, MO!); ibid, along Guhra River, ♂ fl., 10 June 1979, de Wilde & de Wilde-Duyfjes 18065 (K!, L!, MO!); Southern part of the reserves, Alas River valley, near the mouth of the Bengkong River, c. 3° N, 97°50’ E, 50 – 125 m, 15 July 1979, de Wilde & de Wilde-Duyfjes 18732 (K!, L!); Ketambe Research Station and vicinity, Alas River valley, c. 3°40’ N, 97°40’ E, 300 – 350 m, ♀ fl., 28 July 1979, de Wilde & de Wilde-Duyfjes 19222 (L!); ibid, ♂ fl., 28 July 1979, de Wilde & de Wilde-Duyfjes 19224 (K!, L!, MO!); Kloët nature reserve, S. Kloët, along the Krung (River), Lembang/vicinity of Pucuk Lembang, c. 3°05’ N, 97°25’ E, c. 40 m, ♂ buds, 8 July 1985, de Wilde & de Wilde-Duyfjes 19812 (L! [2 sheets]); ibid, c. 60 m, ♂ buds, 10 July 1985, de Wilde & de Wilde-Duyfjes 19888 (L!); ibid, c. 80 m, ♂ fl., 11 July 1985, de Wilde & de Wilde-Duyfjes 19938 (L!, sheet 1 only [L 0690040]); Middle Alas River area, c. 15 km N of Gelombang, c. 50 m, fr., 24 July 1985, de Wilde & de Wilde-Duyfjes 20291 (L! [2 sheets]); SW Aceh, c. 20 km NW of Tapaktuan, 200 m, 28 June 1985, de Wilde & de Wilde-Duyfjes 20812 (L!, US!).

Gomphandra cf. subrostrata. Aceh Province, Gunung Leuser Nature Reserve, Camp Simpang and vicinity, 3 – 5 km upstream Lau Ketambe, 400 – 600 m, ♂ fl., 18 Aug. 1972, de Wilde & de Wilde-Duyfjes 14360 (L!); Ketambe, valley of Lau Alas, near tributary of Lau Ketambe, 200 – 400 m, imm. fr., 3 Sept. 1972, de Wilde & de Wilde- Duyfjes 14450 (K!, US!); climbing Gunung Mamas, c. 5 km SW from the mouth of Lau 391

Ketambe, c. 1200 – 1500 m, imm. fr., 10 Feb. 1975, de Wilde & de Wilde-Duyfjes 14722 (K! [2 sheets], L!).

HABITAT. Steep slope by stream, hill dipterocarp forest, mixed forest on sandstone plateau, 300 – 1500 m. PHENOLOGY. Flowers June – August. NOTES. Gomphandra subrostrata is more common than previously reported. De Wilde and de Wilde-Duyfjes collected it in northern Sumatra in the 1970s. Most specimens are consistent, though it is possible that at least one cryptic species is included in the material identified above. Leaf size and shape can be variable, but at this time there are no other characters available to separate specimens into groups, so leaf variation is assumed to reflect normal morphological diversity within the species. Female flowers are still not completely known – de Wilde & de Wilde-Duyfjes 19222 has one bud and a couple of persistent staminodes on developing ovaries. Gomphandra subrostrata grows in the same regions as G. chimaera, G. quadrifida, and G. dolichocarpa in northern Sumatra. Gomphandra chimaera is similar, though its venation is different, its leaves do not dry dark brown, its twigs are more slender and less pubescent, and its ovaries are pubescent. Gomphandra dolichocarpa has different leaf venation and much larger fruits, and G. quadrifida has terminal or leaf-opposed inflorescences. Two collections (de Wilde & de Wilde-Duyfjes 14450 and de Wilde & de Wilde- Duyfjes 14722) have longer female peduncles (0.5 – 0.9 cm) and larger fruit (1.5 cm long with a stigma 2 mm across, and 2.0 cm with a stigma 3 mm across). However, their leaves and twigs match Gomphandra subrostrata quite well, and it is likely that these two collections represent an extreme in variation. More collections are needed to determine whether the variation is continuous. Ripe fruit of Gomphandra subrostrata have not been collected yet, although it is doubtful that the small fruits on most specimens would enlarge to the size of de Wilde & de Wilde-Duyfjes 14722 in the course of their development. Another collection, de Wilde & de Wilde-Duyfjes 14360, has very large leaves, petals 5 mm long, and stamens 0.9 cm long. It resembles Gomphandra 392

simalurensis in its leaves, but its flowers are larger and the inflorescence structure is completely different.

51. Gomphandra velutina Sleumer (1969: 192). Type: Sulawesi, Porema, 1200 m, 28 Oct. 1929, Kjellberg 2683 (holotype L!; isotypes BO n.v., S n.v.).

Tree 10 m. Twigs densely pubescent with spreading reddish hairs, eventually somewhat glabrescent, 1.8 – 2.4 mm in diam. Leaves elliptic, apex acuminate, base acute to cuneate, chartaceous, glabrous above, persistently pubescent with spreading hairs below, 16 – 19.5 × 5.5 – 6 cm, margin flat; midrib impressed above, raised below, secondary veins 6 – 9 pairs, flat above, raised below, converging slightly toward the margin, tertiary veins flat above, flat to slightly raised below, weakly percurrent; petiole narrowly grooved, pubescent, 0.6 – 1.2 cm long. Inflorescences axillary, axes densely pubescent with spreading reddish hairs. Male inflorescences with peduncle 5 mm long (fide Sleumer), bearing at least 2 short scorpioid cymes with sessile flowers, flowers c. 15 per inflorescence (fide Sleumer). Male flower: calyx cupular, 2 – 3 mm across, densely pubescent, petals 5, upper third pubescent, 3 – 4 mm long, stamens 5, scarcely exserted in the type specimen, filaments bearded below the anther cells on the inside and dorsally at connective; ovary rudiment cylindrical, with erect hairs across the apex. Female inflorescences evidently short, with fewer sessile flowers arranged in scorpioid cymes. Female flowers: calyx cupular, minutely apiculate, densely pubescent, 3 mm across; petals pubescent in upper third, 4 mm long; staminodes with a long tuft of clavate hairs dorsally at the connective, not exserted, 3 mm long, ovary 3 mm long, densely pubescent. Fruit unknown.

DISTRIBUTION. Indonesia – Sulawesi. SPECIMEN. INDONESIA. Sulawesi, Central eastern part, Mengkoka Mts., Porema, 1200 m, ♂ buds & fl., 1 ♀ fl., 28 Oct. 1929, Kjellberg 2683 (holotype L!; isotypes BO n.v., S n.v.). 393

HABITAT. Rain forest, 1200 m. PHENOLOGY. Flowers in October. NOTES. This species is known only from the type collection. Unfortunately, the specimen is no longer in optimal condition. The inflorescences are detached from the twig, and there is no original indication of which twig was from a staminate tree and which was from a pistillate tree. The label indicates that both hermaphroditic (actually female) and male flowers were collected, so the type does not truly represent one individual, but at this point it is not possible to chose one of the twigs as the holotype. The pubescence on the flowers is relatively long for the genus. Gomphandra velutina is certainly distinctive and should be maintained as a species, but additional collections are needed to complete the species’ description.

394

PAPUA NEW GUINEA [10 taxa] [Including Papua, Excluding Bismarck Archipelago] G. angustata, G. australiana, G. montana, G. muscosa, G. papuana, G. pseudoprasina, G. ramuensis, G. rarinervis, G. schoepfiifolia, G. subcordata

1. Leaves large, at least 9 cm wide 2 2. Pubescence spreading, tawny, fruit 3 – 4 cm long, apex strongly beaked, inner mesocarp ridges prominent G. rarinervis 2.’ Pubescence appressed, fruit various 3 3. Twigs and leaves densely pubescent with appressed reddish hairs, leaf base usually rounded to subcordate G. subcordata 3. Twigs and leaves glabrescent, pubescence color various, leaf base never subcordate 4 4. Female inflorescences without a well-developed peduncle, flowers either solitary or inflorescence branched near base, male inflorescences pedunculate but with only up to 7 flowers, calyx 2 – 4 mm across G. papuana 4. Female inflorescences with a well-developed peduncle, not branched near base, male inflorescences usually with more than 7 flowers, calyx less than 2 mm across 5 5. Leaves usually chartaceous and drying flat, petals and stamens glabrous, fruit base often swollen, usually below 200 m G. ramuensis 5’. Leaves subcoriaceous, usually somewhat folded when dried, petals and stamens pubescent, fruit base sometimes slightly thickened on one side but not swollen, usually above 500 m G. pseudoprasina 1’. Leaves small to large but less than 9 cm wide 6 6. Leaves always ≤ 4 cm wide, (flowers not known), Fergusson Island G. angustata 6’. Leaves sometimes ≤ 4 cm wide but more commonly wider, elsewhere 7 7. Petals glabrous 8 7’. Petals pubescent 10 8. Pubescence distinctly reddish, stamens pubescent, fruit obovate, montane species from above 1000 m G. schoepfiifolia 8’. Pubescence greyish or tawny, not reddish, stamens glabrous, fruit ellipsoid, lowland species usually below 500 m 9 9. Leaves mostly with 3 – 4 pairs of secondary veins, finest-order venation not noticeable, fruit ellipsoid, apex and base rounded, Gulf and Central Provinces G. australiana 9’. Leaves often with more than 4 pairs of secondary veins, finest-order venation often conspicuous, fruit shape various, apex sometimes beaked or base swollen, western Madang Province west to West Papua Province, north of the central mountains G. ramuensis 10. Leaves chartaceous, tertiary veins finely and distinctly percurrent below, peduncles and first-order branches usually not well-developed, ♂ inflorescences 395

scarcely 1 cm long, inner mesocarp usually not developing, stigma unridged G. papuana 10’. Leaves chartaceous (rarely) to moderately coriaceous, tertiary veins obscure below, peduncles and/or first-order branches usually well-developed, together at least 1 cm long, inner mesocarp and stigma ridged 11 11. Uppermost vein pairs rather distant, converging and strongly arching towards leaf apex G. pseudoprasina 11’. Uppermost vein pairs not much more widely spaced than lower pairs, vein course ± parallel 12 12. Leaves mostly ovate to elliptical, apex abruptly and shortly acuminate, fruit 2.2 – 2.6 × 1.2 – 1.3 cm, Rossel and Misima Islands G. muscosa 12’. Leaves often obovate or markedly asymmetrical, apex often caudate, fruit larger, 2.5 – 3.2 × 1.5 cm, Owen Stanley Range G. montana

52 Gomphandra angustata Schori (Kew Bulletin). Type: Papua New Guinea, Milne Bay District, Esa’ala Subdistrict, Fergusson Island, Mt. Kilkerran (Woiatabu), 9°25’ S, 150°48’E, 8 Dec. 1976, Croft et al. LAE 71080 (holotype L!; isotypes BRI!, CANB!).

Tree to 10 m high and 25 cm in diam. Bark orange brown. Twigs slender, glabrescent, 1 – 2 mm in diam. Terminal bud falcate, covered with tightly appressed reddish pubescence. Leaves chartaceous, lanceolate to oblanceolate, glabrescent, dark green and somewhat glossy above when fresh, mid green below, drying dull and dark above, paler below, base acute to attenuate, apex acuminate, 7 – 14 x, 2 – 4 cm, margin flat to slightly revolute; midrib slightly impressed above, raised below, secondary veins 3 – 5 pairs, flat above, raised below, steeply ascending and converging toward margin, occasionally joining, tertiary veins generally not visible, delicately percurrent; petiole narrowly grooved above, eventually glabrescent, 0.5 – 0.8 ( – 1.0) cm × 1 – 1.5 mm. Male inflorescences and flowers unknown. Female inflorescences axillary, on older growth, bearing 1 – 3 flowers, axes with appressed reddish pubescence, common peduncle 0.4 – 1 cm long, bearing up to 3 peduncles 0.4 – 0.8 cm long. Female flowers: calyx deeply cupular, entire to irregularly splitting, covered with appressed reddish pubescence, 3.5 mm in diam., 2 mm high, petals not seen, staminodes not seen, ovary cylindrical, evidently glabrous, 4 – 5 mm long, stigma ridged, 2 mm in diam. Fruit submature, 396

glabrous, obovoid, apex acute, base tapering to a very narrow short stalk, 2 – 2.2 × 0.9 – 1.1 cm, pale orange when ripe (fide Croft et al. LAE 71080), stigma slightly displaced toward sulcus, 2.5 mm in diam., inner mesocarp with ca. 13 – 15 low anastomosing ridges.

DISTRIBUTION. Papua New Guinea, Fergusson Island. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Milne Bay District, Esa’ala Subdistrict, Fergusson Island, Mt Kilkerran (Woiatabu), (9° 25’ S, 150° 48’E), 700 m, fr., 8 Dec. 1976, Croft et al. LAE 71080 (holotype L!; isotypes BRI!, CANB!); ibid, 700 m, imm. fr., 8 Dec. 1976, Croft et al. LAE 71084 (A!, BISH!, BRI!, CANB!, E!, K!, L!, M n.v., NSW n.v., QRS n.v., US!). HABITAT. In montane forest, 700 m. CONSERVATION STATUS. Endangered: EN B2ab(iii). NOTES. Gomphandra angustata is readily recognizable by its narrow leaves and slender twigs. The species is only known from two collections and appears to be endemic to Fergusson Island. The infructescence structure and fruits are reminiscent of Gomphandra pseudoprasina and G. montana, both of which have larger leaves and fruit.

37. Gomphandra australiana F. Muell. (1867: 3). Stemonurus australianus (F. Muell.) Kuntze (1891: 112). Type: Australia, Dalrymple’s Gap, Dallachy s.n. (lectotype MEL! photo (selected by Schori)). G. polymorpha F. M. Bailey, Queensl. Bot. Bull. 8 (Dep. Agric. Brisbane, 1893: 71), non Wight.

Small tree to 30 m tall, 30 cm in diam. Bark smooth, pale grey to tan. Twigs generally straight, 2 – 3.5 mm in diam., quickly glabrescent; terminal buds pubescent, tawny to somewhat cinereous with short appressed hairs. Leaves variable, glabrescent, usually drying somewhat chestnut brown to olive green above, chartaceous to thinly coriaceous, lance-elliptic to ovate, (9.5 – ) 16.5 – 19.5 ( – 22) × (3.5 – ) 5.5 – 8.5 ( – 9.5) cm, base 397

acute, apex attenuate to bluntly acute or shortly acuminate, margin slightly revolute; midrib sunken above, raised below, secondary veins (4 – ) 5 – 6 ( – 8) pairs, flat above, raised below, often somewhat yellowish, converging towards margin, upper pairs joining, tertiary veins flat above, slightly raised below, delicately percurrent; petiole narrowly grooved above, 0.7 – 1.1 ( – 1.5) cm long, glabrescent. Inflorescences axillary, 1 – 2 per axil, axes pubescent. Male inflorescences variable with peduncle 0.6 – 1.0 cm long, bearing 2 – 4 branches, branches up to 0.7 cm long before bearing 2 – 4 branches, or unbranched, flowers shortly pedicellate (1 – 3 mm) or sessile, ca. 10 – 25 flowers per inflorescence (rarely up to 55). Male flowers: calyx cupular, sparsely pubescent, 1 mm high, minutely apiculate, green; petals 4 – 5, cream to greenish, glabrous, 4 mm long; stamens 5 – 6 mm long, exserted 1 – 2 mm, filaments glabrous; ovary rudiment ovoid, apex apiculate, glabrous. Female inflorescences variable with 1 – 2 orders of branching, main axis either branching and bearing up to 4 well-developed pedicels (sometimes shortly rebranched), or with short pedicels irregularly arranged along the main axis and up to 9 flowers. Female flowers: calyx apiculate, sparsely pubescent, petals 3 mm long, glabrous, staminodes not seen, ovary 3 mm long, glabrous. Infructescence with elongated peduncle to 1 cm long, pedicels 0.7 – 1 cm long, usually only 1 – 2 fruits developing. Fruit pale pink to orange when ripe, glabrous, ellipsoid, slightly asymmetrical, base and apex rounded, 1.9 – 2.3 ( – 2.6) × 1.2 – 1.3 cm, stigma terminal, flattened, 3.0 – 4.5 mm across, inner mesocarp with ca. 11 prominent ridges.

DISTRIBUTION. Gulf and Central Provinces, Papua New Guinea; Kei Islands, Indonesia; Australia. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Gulf Province, Malalaua, 0 m [10 ft.], ♂ fl., 2 March 1966, Craven & Schodde 922 (A!, BISH!, BO n.v., BRI!, CAL n.v., CANB! [2 sheets], K!, L!, LAE n.v.), Putei, junction of Tauri and Kapau Rivers, 200 m [650 ft.], ♂ fl., 9 March 1966, Craven & Schodde 966 (A!, BO n.v., BRI!, CANB! [2 sheets], CHR n.v., K!, LAE n.v., L!); Ihu, Vailala River, 90 m [300 ft.], fr., 16 Jan. 1966, Schodde & Craven 4243 (A! [2 sheets], BO n.v., BRI! [2 sheets], CANB! [2 sheets], K!, 398

L!, LAE n.v., SING n.v., US!); Central Province, Sogeri, Laloki River, Rouna Falls, 400 m [1300 ft.], fr., 7 Sept. 1962, Schodde 2938 (PNH! [2 sheets], US!). HABITAT. Primary lowland rainforest, on hills or in river valleys, 90 – 400 m. PHENOLOGY. Flowers in March. NOTES. In Papua New Guinea Gomphandra australiana is only found in the southern Gulf and Central Provinces. Identifications of material from other parts of the country as Gomphandra australiana are incorrect. The Craven & Schodde specimens cited above tend to have leaves that are somewhat smaller and narrower than those of specimens from Australia, but the inflorescences, flowers, and fruits are the same. Material from Gulf and Central Provinces was largely unidentified prior to this revision, though specimens at BRI were examined for the Flora of Australia project and correctly annotated as Gomphandra australiana.

53. Gomphandra montana (G. Schellenb.) Sleumer (1940: 238). Stemonurus montanus G. Schellenb. in Lauterb. & G. Schellenb. (1923: 162). Type: Ledermann 12478 (lectotype K!, (selected by Schori); isolectotypes A!, L!). Gomphandra carrii Sleumer (1940: 239). Type: Papua New Guinea, Central Province, Boridi, 1680 m [5500 ft.], 17 Oct. 1935, Carr 14605 (lectotype A! (selected by Schori); isolectotypes CANB!, K!, L!, NY!, SING!).

Small tree up to 15 meters. Twigs slightly zigzag, 1.5 – 2 mm in diam., initially densely pubescent with appressed reddish hairs, eventually glabrescent. Leaves elliptic to narrowly obovate, apex acuminate to caudate, base acute to attenuate, 11 – 16 × 3.5 – 6.5 cm, firmly chartaceous, glabrous above, sparsely pubescent with somewhat appressed hairs, margin flat; midrib impressed above, raised below, secondary veins 5 – 7 pairs, flat to slightly impressed above, slightly raised below, converging toward margin, upper pairs brochidodromous, tertiary veins obscure, delicately percurrent; petiole grooved, pubescent, 0.6 – 0.8 ( – 1.5) cm long. Inflorescences axillary on mature portion of twigs, 399

1 – 2 per axil, axes slender, pubescent with appressed reddish hairs. Male inflorescences to 3 cm long overall with 3 – 4 degrees of branching; peduncle 0.6 – 1.5 cm long, bearing 2 – 3 branches 0.5 – 1.2 cm long, each branch bearing another 2 – 3 branches 1 – 5 mm long, up to 4 subsessile flowers at the end of each branch, ca. 25 flowers per inflorescence. Male flowers: calyx cupular, toothed, sparsely pubescent, 2 mm across, petals 5, green or yellow-green, 4 – 5 mm long, sparsely pubescent apically in bud, often glabrous at anthesis, stamens 5, exserted, 5 – 8 mm long, pubescent dorsally and ventrally below the anthers with clavate hairs, ovary rudiment slightly globose, glabrous. Female inflorescences with peduncle 0.4 – 0.6 cm long, bearing 2 – 5 pedicels 3 – 5 mm long, each with a single flower. Female flowers: calyx cupular, minutely toothed, sparsely pubescent, 2 mm across, petals 5 mm long, sparsely pubescent at the apex, staminodes 4 mm long, pubescent with clavate hairs below the anthers, ovary cylindrical, glabrous, 2 – 3 mm long, stigma capitate, lobed, 1 mm across. Fruit ovoid, base tapered, apex acute, 2.5 – 3.2 × 1.5 cm, yellow, glabrous, inner mesocarp with ca. 15 prominent anastomosing longitudinal ridges, stigma 3 mm across.

DISTRIBUTION. Papua New Guinea, Central Province, Boridi. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Sepik District, April River, 1000 m, Dec. 1912, Ledermann 10089 (syntype, K!, L!); Felsspitze, ♂ buds, Ledermann 12712 (syntype, K!, L!); ibid, 1400 – 1500 m, 8 July – 29 Aug 1913, Ledermann 12478 (lectotype K!; isolectotypes A!, L!);no locality, ♂ buds, Ledermann 12891 (syntype, K!, L!); Central Province, Boridi, 1430 m [4700 ft.], ♂ fl., 15 Sept. 1935, Carr 13173 (paratype, A!, CANB! [2 sheets], K!, L!, NY!, SING n.v.); ibid, 1430 m [4700 ft.], ♂ buds, 20 Sept. 1935, Carr 13271 (A!, CANB!, K!, L!, NY!, SING n.v.); Carr 13301 (paratype, CANB! [2 sheets], L!, SING n.v.); ibid, 1460 m [4800 ft.], ♂ fl., 27 Sept. 1935, Carr 14219 (BM! photo [2 sheets], CANB! [2 sheets], K!, L!, NY!, SING n.v.); ibid, 1370 m [4500 ft.], ♂ fl., 9 Oct. 1935, Carr 14483 (paratype, A!, CANB! [2 sheets], K!, L!, NY!, SING n.v.); ibid, 1370 m [4500 ft.], ♀ fl., 10 Oct. 1935, Carr 14501 (A, CANB! [2 sheets], K!, L!, NY!, SING n.v.); ibid, 1680 m [5500 ft.], 17 Oct. 1935, Carr 14605 (A!, CANB!, K!, L!, NY!, SING! n.v.); ibid,1430 m [4700 ft.], ♀ fl., 25 Oct. 1935, 400

Carr 14748 (paratype, A!, CANB! [2 sheets], K!, L!, NY!, SING n.v.); ibid, 1280 m [4200 ft.], ♀, 18 Nov. 1935, Carr 14993 (A!, CANB! [2 sheets], K!, L!, NY!, SING n.v.); Isuarava, 1370 m [4500 ft.], fr., 11 Feb. 1936, Carr 15518, fr. (A!, CANB!, K!, L!, NY!); Carr 15884 (CANB!, L!, P!); Carr 15962 (CANB!, L! [2 sheets]). HABITAT. Forest, 1370 – 1680 m. NOTES. Very little of the original matter of Gomphandra montana is still available. The species, as described here, may represent more than one taxon. Carr collected flowering material from Boridi, and those specimens are quite consistent. A fruiting specimen (Carr 15518) from Isuarava has larger leaves with more steeply ascending veins and longer petioles. Its leaves are quite similar to Ledermann 12712 and 12891, syntypes of Stemonurus montanus. The Ledermann specimens have immature buds and damaged leaves, but the petal and stamen pubescence are the same as for the Boridi specimens, and the fruit size from Schellenberg’s original description matches the fruit on the specimen from Isuarava. All the specimens may represent one taxon, or the Boridi material, which was first described as Gomphandra carrii Sleumer, may be distinct. It is impossible to say without more material. Gomphandra montana, as described here, is in some ways quite similar to G. pseudoprasina, but its fruits are larger, the leaves are smaller and tend to have more closely spaced veins, and the petals have less pubescence. The two species may be closely related, and collections from further north in the Owen Stanley Range could be intermediate. The types of Gomphandra montana are from the northern edge of the Central Range, from 1400 – 1500 m. More collecting is needed in both localities. Material collected in the Hydrographer’s Range in Northern Province is probably the same as Gomphandra carrii. Specimens identified as Gomphandra schoepfiifolia have been collected from the same general area as G. montana in Central Province. Gomphandra schoepfiifolia is a poorly known species, but it has glabrous petals, its stamens are glabrous dorsally, and its fruit is distinctly obovoid. 401

54. Gomphandra muscosa Schori (Kew Bulletin). Type: Papua New Guinea, Milne Bay Province, Misima subprovince, Misima Island, Mt. Oia tau (10°39’ S, 152°42’ E), 600 m, 28 Mar. 1979, Gideon LAE 76053 (holotype A!; isotypes BISH!, CANB!, E! photo, K non inveni, L! [2 sheets], QRS n.v., US!).

Mid canopy tree, 20 m tall, to 30 cm in diam. Bark dark brown to grey brown or greenish brown. Twigs slightly zigzag, younger portions 1.5 – 2.5 mm in diam., pubescent with minute appressed hairs, glabrescent. Leaves coriaceous, lanceolate-elliptic to ovate- elliptic, base rounded to tapered, apex acute to acuminate, dark green above, light green above, initially pubescent but glabrous at maturity, margin slightly revolute, (5 – ) 10 – 12 × (2.0 –) 3.5 – 5.0 cm; midrib sunken above, raised below, secondary veins flat above, raised below, 5 – 7 pairs, upper pairs joining near margin, tertiary veins obscure above, slightly raised below, delicately percurrent; petiole (0.7 –) 1.0 – 1.5 cm long, grooved above, glabrescent. Inflorescences axillary, on previous year’s growth or on older portions of twigs, axes densely pubescent with minute appressed hairs. Male inflorescences to 3.5 cm long, with up to ca. 20 flowers, peduncle 1.0 – 1.8 cm long, bearing 3 – 4 branches, branches up to 1 cm long, often branched again and bearing 2 short (2 – 3 mm) branches, each with several sessile or very shortly pedicelled flowers. Male flowers with calyx cupular, sparsely pubescent, 2 mm across, petals 4, sparsely pubescent externally, 4 – 5 mm long in bud, stamens pubescent ventrally below the anthers, ovary rudiment conical, glabrous. Female inflorescences shorter, each with 1 – 4 flowers, peduncle 2 – 5 mm long before branching, branches serving as pedicels, up to 4 mm long, peduncle and pedicels elongating in fruit. Female flowers with calyx cupular, entire, sparsely pubescent, 2 mm across, petals 4, sparsely pubescent externally, 4 mm long in bud, staminodes pubescent below the empty anther cells, ovary cylindrical, glabrous, capped by the broader stigma. Fruit slightly obovoid, apex scarcely tapered, base tapered, very base swollen, 2.2 – 2.6 × 1.2 – 1.3 cm, inner mesocarp with ca. 11 – 14 ridges, sulcus distinctly sunken, stigma terminal, 4 mm in diam., ripe fruit color unknown. 402

DISTRIBUTION. Papua New Guinea, Rossel and Misima Islands. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Milne Bay Province, Misima Subprovince, Rossel Island, Mt. Rossel, (11°20’ S, 154°10’ E), 19 Mar. 1979, Katik et al. LAE 70949 (A!, BISH!, BM n.v., BRI!, CANB!, E!, K!, L!, M n.v., NSW n.v., QRS n.v., UPNG n.v., US!); ibid, Katik et al. LAE 70952 (A!, BISH!, BM n.v., BO n.v., BRI!, CANB!, E!, K!, L!, MO!, NSW n.v., PNH n.v., QRS n.v., UPNG n.v., US!); Misima Island, Mt. Oeatau (Foot), 720 m, 27 Mar. 1979, Damas et al. LAE 74602 (A!, BISH!, BM n.v., BRI n.v., CANB!, E!, K!, L!, NSW n.v., QRS n.v., US!); Mt. Oia tau (10°39’ S, 152°42’ E), 600 m, 28 Mar. 1979, Gideon LAE 76053 (holotype A!; isotypes BISH!, CANB!, E! photo, K non inveni, L! [2 sheets], QRS n.v., US!). HABITAT. Low montane mossy forest, 600 – 720 m. PHENOLOGY. Flowers in March, April. CONSERVATION STATUS. Endangered: EN B2ab(iii). NOTES. Gomphandra muscosa probably belongs to the G. australiana F. Muell. group, given its large ridged fruit with a large terminal stigma. It differs from Gomphandra australiana in its smaller leaves, pubescent petals, fewer and larger flowers, and fruits which are slightly tapered at the base and apex. Gomphandra muscosa is distinctive and not likely to be confused with any other species. It is only known from Rossel and Misima Islands, where it grows in mossy forests.

55. Gomphandra papuana (Becc.) Sleumer (1940: 238). Platea papuana Becc. (1883: 257). Stemonurus papuanaus (Becc.) G. Schellenb. in Lauterb. & G. Schellenb. (1923: 161). Type: Papua New Guinea, Gulf Province, Fly River, fr., d’Albertis s.n. (holotype FI! Herb. Beccari n. 2469 photo; isotypes FI! Herb. Beccari n. 2469A photo, K! [2 sheets], MEL n.v.). Stemonurus zygomorphus Pulle (1912: 648). Gomphandra zygomorpha (Pulle) Sleumer (1940: 239). Type: Versteeg 1755 (holotype U n.v.; isolectotypes BO n.v., K!, L!).

403

Stemonurus sawiensis Birnie (1926: 275). Gomphandra sawiensis (Birnie) Sleumer (1940: 238). Type: Gjellerup 608 (holotype L!; isotypes BO n.v., K!, U n.v.) Lasianthera litoralis sensu F. Muell., Descr. Not. 2 (1877) 53, non Miq.

Tree to 10 m high. Bark smooth, with scattered pustules, pale grey. Twigs straight, 2 – 3 mm in diam., with a decurrent ridge below the petiole, initially pubescent with very minute, tightly appressed reddish hairs, quickly glabrescent. Leaves glossy dark to mid- green above, paler below, glabrescent above, glabrescent to sparsely pubescent below, ellipsoid to obovate, base rounded to tapered, apex abruptly acuminate, 15.5 – 21.5 (– 26) × (4.5 – ) 5 – 10.5 cm; midrib sunken above, raised below, secondary veins 5 – 7 ( – 8) pairs, slightly impressed above, raised below, vein course mostly parallel, tertiary veins flat to not visible above, slightly raised below, distinctly percurrent; petiole (0.6 – ) 1.1 – 1.4 cm long, narrowly grooved above, glabrescent. Inflorescences axillary from older portions of twigs, solitary or paired, few-flowered, all parts covered with reddish appressed pubescence. Male inflorescences branching near the base or not, peduncle 0.2 – 0.7 cm long, with 0 – 2 branches, pedicels 0 – 3 mm long, up to 7 flowers per inflorescence. Male flowers: calyx entire to minutely apiculate, 2 – 4 mm across; petals 5, 5 – 6 mm long, sparsely to densely pubescent in upper 2/3, somewhat glabrescent with age, stamens 5, exserted 3 – 4 mm, with short sparse to dense pubescence on both sides below the anther, ovary rudiment minute, conical, glabrous or with a few sparse hairs. Female inflorescences branching at the base, common peduncle usually not evident or 1 – 2 mm long, occasionally branched again, pedicels 0.6 – 0.8 cm long, flowers 1 – 5 per inflorescence. Female flowers: calyx patellar, entire or tearing irregularly, pubescent, 4 – 5 mm across, petals 5, pubescent outside with reddish hairs, hairs denser towards the petal apex, 6 – 8 mm long, staminodes 5, exserted, 9 – 10 mm long, densely pubescent with short hairs below the anther, pubescence primarily ventrally distributed, ovary cylindrical, glabrous, 6 – 8 mm long, stigma lobed, 2 – 3 mm wide. Fruit usually not developing normally, subtended by the patellar calyx (4 mm wide), ellipsoid, reportedly yellow when mature (or at least when quite large), to 3.6 – 3.8 × 1.4 – 1.5 cm, exocarp 404 papillose when dry (best seen at 10 × magnification), inner mesocarp usually not developed, when developed, thickly woody, with several low, indistinct ridges, stigma usually at least 3 mm wide and not or scarcely ridged or lined.

DISTRIBUTION. Papua New Guinea, Indonesia (Irian Jaya). SPECIMENS EXAMINED. INDONESIA. Irian Jaya, Sawia, 100 m, ♂ fl., 20 Aug. 1911, Gjellerup 608 (type of Stemonurus sawiensis, holotype L!; isotypes A!, BO n.v., K!, U! photo); Sabang Island, Noord or Lorentz River, 27 Sept. 1907, Versteeg 1755 (type of S. zygomorphus, holotype U! photo [2 sheets]; isotypes BO n.v., K! [2 sheets], L! [2 sheets]). PAPUA NEW GUINEA. West Sepik Province, Vanimo Subdistrict, Ossima-Krissa Road, 2°54’ S, 141°16’ E, 30 m [100 ft.], fr., 1 Feb. 1969, Streimann & Kairo NGF 39306 (fr., CANB!, K!, L!, SING n.v.); Vanimo, 2°40’ S, 141°15’ E, 150 m, ♂ fl., 21 Nov. 1971, Streimann & Martin LAE 52808 (BRI! [2 sheets], L!); Southern Highlands Province, near Waro airstrip, 6°31’ S, 143°10’ E, 500 – 600 m, ♂ fl., 11 Oct. 1973, Jacobs 9121 (BISH! photo, CANB!, L!, US!); Western Province, Fly River, fr., 1876, d’Albertis s.n. (holotype FI Herb. Beccari n. 2469!; isotypes A n.v., FI Herb. Beccari n. 2469A!, K! [2 sheets], MEL n.v.); Fly River, Sturt Island, ♀ fl., Oct. 1936, Brass 8155 (A!, L!); Daru Subdistrict, Mogumogu, Fly River, 8° S, 141°5’ E, 30 m [100 ft.], fr., 21 March 1968, Millar NGF 35308 (A!, BRI!, CANB! [2 sheets], L!); Gulf Province, Purari River delta, 0 m, fr., 12 Feb. 1966, Schodde & Craven 4460 (A!, BRI n.v., CANB!, K!, L!, LAE n.v., US!); Lakekamu, Avi Avi River, 7°44’ S, 146°29’5” E, 105 m, ♂ fl., 17 Oct. 1996, Takeuchi & Kulang 11311 (A!, CANB!, E!, K n.v., L!, MO!, NY!, US!); border of Chimbu and Gulf Province, Crater Mt. Wildlife Management Area, 6°47’ S, 145°02’ E, 510 – 610 m, fr., 29 March 1997, Takeuchi 11937 (fr., A!, L! [2 sheets]); ibid, fr., March 1997, Takeuchi 11970 (A!, K!, L!); Central Province, Koitaki, 460 m [1500 ft.], fr., 29 April 1935, Carr 12081 (A!, K!, L!); Carr 12104 (♀ fl., A!, NY!); Carr 12105 (fr., A!, K!, NY!). G. aff. papuana. Northern Province, Dobadura [Dobodura], Samboga River, fr., 15 April 1943, de Zeeuw 26 (A? or NY, no stamp); Hoogland 3624 (♂ fl., A!, BRI!, K!, 405

US!); Dobodura Plain, Girua River, Soputa area, 30 m [100 ft.], imm. fr., 24 Feb. 1945, Cavanaugh & Fryar NGF 2047 (A!, BISH! photo, BRI!, L!). HABITAT. Lowland forest. NOTES. Gomphandra papuana is one of the most enigmatic species in the genus, and certainly the most peculiar in Papua New Guinea. Evidently the fruits do not usually mature properly – that is, the seed, endocarp, and inner mesocarp do not develop. The type specimen and a few others do have the typical ridged inner mesocarp that characterizes the genus, but all the other fruiting specimens have unique unridged fruit. Unfortunately, no chromosome count of the species is available, but one explanation for this phenomenon might be that the species is a mostly sterile hybrid that exhibits parthenocarpy. If that is the case, Gomphandra rarinervis is a likely parent, since the species have similar flowers, inflorescence structures, and leaf and fruit sizes. A disjunct population from northern New Guinea, with narrower leaves and smaller flowers, was described as Gomphandra sawiensis, but the inflorescence structure, pubescence, and fruits all match G. papuana, so G. sawiensis is now treated as a synonym of G. papuana. Collections from Northern Province, listed above as Gomphandra aff. papuana, appear to represent intermediates (possible hybrids?) between G. rarinervis and G. papuana – they have the appressed pubescence of the latter, but the sharply ridged, smooth exocarp fruit of the former. However, rather than being hybrids, these collections could represent a distinct species that differentiated into both Gomphandra rarinervis to the north and G. papuana to the west.

56. Gomphandra pseudoprasina Sleumer (1940 : 240). Type: Clemens 2012 (lectotype G! photo [G00191577] (selected by Schori); isolectotypes, A!, G! photo [2 sheets]).

Tree 4 – 8 m tall and to 14.5 cm diam. Bark grey brown to greenish brown, smooth, scaly, or with pustular horizontal lenticels. Twigs 1.8 – 2.7 mm in diam., terminal buds falcate, pubescent with reddish-brown, closely appressed hairs, twigs and leaves glabrescent. Leaves variable in size, generally slightly asymmetrical, chartaceous to 406

thinly coriaceous, dark to light green and shining above, paler to yellowish green below, glabrous above, minutely pubescent below, lanceolate-elliptic to ovate or elliptic-oblong, base acute to attenuate, apex acute to acuminate, margin flat to slightly revolute (6 – ) 11 – 18 ( – 27) × (3 – ) 5 – 8 ( – 11.5) cm; midrib sunken above, raised below, secondary veins 4 – 6 ( – 7) pairs, flat to slightly impressed above, raised below, weakly brochidodromous to somewhat camptodromous, basal pairs often crowded, steeply ascending and converging toward margin but not usually joining, intersecondaries weakly developed on larger leaves, tertiaries flat to slightly impressed above, flat to raised below, percurrent and perpendicular to the midrib, petiole grooved above, glabrescent, 0.6 – 1.1 ( – 2.0) cm × 1.0 – 1.9 ( – 2.2) mm. Inflorescences axillary, axes pubescent with closely appressed, ferruginous hairs. Male inflorescences 1 – 2 per axil, with up to 30 ( – 50) flowers and 2 – 3 orders of branching, peduncle to 3 ( – 3.5) cm long, occasionally branched near the base, usually bearing 3 branches 1 – 1.5 cm long, each of which is branched 1 – 2 times and bears a cymose cluster of sessile to shortly pedicelled flowers. Male flowers: calyx green, cupular, slightly lobed or apiculate, 2 mm across, pubescent; petals 5, white, pubescent, 4 – 5 mm long; stamens exserted, white, 5 ( – 7, seen with 4 long and 3 short stamens), pubescent with clavate hairs ventrally below the anther, and dorsally at the connective, glabrous to pubescent dorsally, ovary rudiment globose, glabrous or with a few hairs near the apex. Female inflorescences umbelliform or cymose, borne on previous year’s growth, 1 ( – 2) per axil, peduncle 0.5 – 1.0 cm long (often elongating after anthesis to 2 – 3 cm long), bearing up to 4 (rarely 5) pedicels 2 – 7 mm long, or with several pedicels and a longer branch (to 1 cm) bearing two flowers on shorter (1 – 3 mm) pedicels. Female flowers: calyx cupular, entire to somewhat lobed, 2 mm across, petals sparsely pubescent outside in bud, glabrescent, petals and staminodes not seen at anthesis, ovary cylindrical, 4 mm long, initially sparsely pubescent with lax hairs, glabrescent with age, stigma lobed, 2 mm across. Fruit ovoid to obovoid, usually with a very short beak, especially when submature, 1.9 – 2.5 ( – 2.9) × 0.9 – 1.3 cm, stigma 2.5 – 3.5 mm in diam., base rounded to attenuate (in submature state), subtended by the flattened or wavy calyx, reportedly cream, with ca. 11 – 15 low anastomosing ridges, yellow, pink to salmon when mature. 407

DISTRIBUTION. Papua New Guinea, Papua (?). SPECIMENS EXAMINED. PAPUA NEW GUINEA. Madang Province, ♀ buds, Schlechter 16706 (B†, L! (frag. ex P), P! sub 16906, UC sub 16906 n.v.); ♂ fl. Schlechter 17027 (UC!); Western Highlands Province, Vinas 7507 (L!, LAE n.v., QRS n.v., UPNG n.v.); imm. fr.,Millar NGF 37708 (CANB!, K!, L!); Vandenberg et al. NGF 39920 (BRI n.v., L!); fr., Kerenga et al. LAE 74452 (A!, CANB!, K!, L!, UPNG n.v.); Eastern Highlands Province, imm. fr., Hartley 12004 (A!, CANB!, K!, L!, US!); Henty & Vandenberg NGF 29312 (A n.v., BRI n.v., CANB!, K!, L!); ♂ fl., Brass 32295 (A!, CANB!, K!, L!, NY!, US!); Chimbu Province, imm. fr., Takeuchi 11280 (A!, CANB!, L!); Morobe Province, Kairo 75 (A n.v., BFC n.v., CBG!, K non inveni, L!, LAE n.v.); imm. fr., Rau 92 (K!); Clemens 185 (L!); Clemens 291 (L!); Nyman 687 (L!, UPS n.v.), imm. fr., Craven & Schodde 1445 (A!, BRI!, CANB n.v., K!, L!, LAE n.v.); Clemens 1647 (L!), ♀ fl., Clemens 2012 (lectotype G!; isolectotypes A!, G! [2 sheets]); ♂ fl., Floyd NGF 7487 (A!, CANB! [2 sheets], K!); imm. fr., Havel & Kairo NGF 9137 (BISH!, BRI!, CANB! [2 sheets], CBG!, K! [2 sheets], L!, MO!, US!); fr., Clemens 10567 (A!, MICH!, US!); imm. fr., Hartley 10586 (A!, CANB!); ♂ fl., Streimann & Kairo NGF 27919 (A!, BISH! [2 sheets], BRI!, E!, K!, L!); fr., Streimann NGF 27923 (A n.v., BISH n.v., BO n.v., CANB!, K!, L!, PNH n.v., SING n.v., SYD n.v.); Streimann LAE 51974 (BRI n.v., L!); imm. fr., Stevens LAE 54816 (A n.v., BO n.v., BRI! [2 sheets], CANB!, K!, L!); Milne Bay Province, fr., Katik NGF 46937 (A n.v., BISH!, BO n.v., BRI!, CANB!, K!, L!, PNH n.v., SING n.v., SYD n.v., US!). Gomphandra cf. pseudoprasina: Indonesia, West Papua Province, Manokwari, Gunung Meja, 0°51’ S, 134°05’ E, 100 [m?], imm. fr., 12 Oct. 2004, Arison et al. 3 (BO n.v., K!, LAE n.v., MAN n.v.). Additional Specimens cited by Sleumer (1969), not seen: Morobe Province, Hellwig 528 (B†); Warburg 20208 (B†, BM); Bamler 7 (B†); Clemens 2969 (B†); Madang Province, Schlechter 17072 (B†). HABITAT. Riverine lower montane rainforest; valley forest; Castanopsis forest; lower montane forest dominated by Fagaceae and Eugenia; (366 – ) 730 – 1700 m. Twig galls on LAE 54816. 408

PHENOLOGY. Fruit in August, flowers in September, December. NOTES. Gomphandra pseudoprasina is a relatively widespread species that is most easily recognized by its leaves. While the leaf size is quite variable, the thinly coriaceous texture is consistent, as are the few veins with their steeply angled course. The leaves do not tend to press flat, so many herbarium specimens have a rumpled look. The male inflorescences are relatively long, and the few-flowered female inflorescences are distinctive with their long peduncle and pedicels, which usually elongate in fruit. Katik NGF 46937 has chartaceous leaves and is found at a much lower elevation (366 m) than the other specimens cited below, but otherwise fits the species quite well. Gomphandra pseudoprasina overlaps in distribution with several other species, but it can be distinguished from G. rarinervis by its thicker, glabrescent leaves and appressed pubescence, and from G. subcordata by its tapered leaf bases and glabrescent leaves and twigs. It also overlaps with Gomphandra ramuensis, which can have similar leaves, but G. ramuensis is usually found below 200 m, has glabrous petals and stamens and the base of the fruit is often distinctly swollen. A number of specimens that could belong to either species (or to a cryptic species not yet described) are listed under Unassigned Specimens.

57. Gomphandra ramuensis (Lauterb.) Sleumer (1940: 238, cited incorrectly as G. ramuensis (Schellenb.) Sleumer in Sleumer 1969). Stemonurus ramuensis Lauterb. in K. Schum. & Lauterb. (1905: 305). Type: Papua New Guinea, Ramu, Jan. 1902, Schlechter 14139 (holotype B†, lectotype P!, isolectotypes A!, BM n.v., BO n.v., G n.v., K!, L!, P!, WRSL n.v.). Stemonurus gracilis G. Schellenb. in Lauterb. & G. Schellenb. (1923: 164), non G. gracilis King 1895. Gomphandra pallida Sleumer (1940: 238). Type: Ledermann 7229 (lectotype L!; isolectotype K!). Stemonurus viridis G. Schellenb. in Lauterb. & G. Schellenb. (1923: 163). Gomphandra viridis (G. Schellenb.) Sleumer (1940 : 239). Type: Ledermann 8013 (lectotype K!; isolectotypes: E spec. dep., SING! photo).

409

Small tree to 12 m high, 7.5 cm in diam. Bark dark grey to creamy brown, smooth to shallowly fissured in older trees, lenticels scattered. Twigs relatively slender and straight, 1.5 – 2.7 mm in diam., young twigs green, initially pubescent with short, appressed to spreading tawny hairs, quickly glabrescent. Leaves variable, medium to dark green above when fresh, yellow-green or paler below, chartaceous to subcoriaceous, initially sparsely pubescent but glabrous at maturity, ovate to ovate-elliptic, less commonly oblong or lanceolate-obovate, base rounded to acute, occasionally slightly oblique, apex bluntly acute to acuminate, (8 – ) 11 – 16.5 ( – 25.5) × (3.5 – ) 5 – 9 cm, margin flat to very slightly revolute when dry, glabrous; midrib impressed above, raised below, secondary veins 4 – 5 ( – 8) pairs, flat to slightly impressed above, raised below, parallel to well- spaced and converging toward margin, upper pairs brochidodromous, tertiary veins obscure to raised above, slightly raised below, percurrent, often quite prominent; petioles grooved above, (0.5 – ) 0.9 – 1.5 ( – 2) cm long, quickly glabrescent. Inflorescences axillary, on previous season’s growth or from flowering spurs on older growth, usually 1 – 2 per axil, up to 4 from spurs, axes pubescent with short appressed hairs. Male inflorescence with peduncle 0.7 – 1 cm long, unbranched or with up to 4 branches 2 – 3 mm long, each branch with a cyme of up to 8 – 10 flowers, subsessile or on pedicels 1 mm long, flowers per inflorescence ca. 11 – 30. Male flowers: calyx cupular, 1.5 – 2 mm across, minutely apiculate, sparsely pubescent; petals (4 – ) 5, glabrous, 3 mm long; stamens 5, slightly exserted, 4 mm long, glabrous, ovary rudiment minute, glabrous. Female inflorescences with peduncle 0.6 – 0.9 cm long, bearing up to 4 flowers in an umbel, pedicels 1 – 2 mm long, very rarely with 2 flowers along one pedicel; peduncle and pedicels elongating in fruit. Female flowers not seen at anthesis, calyx 1 mm across, petals not known, staminodes not known, ovary cylindrical, glabrous, 2.5 – 3 mm long, stigma 1 mm across. Fruit reportedly pearlescent to translucent white when ripe, shape variable, ellipsoid to obovoid, asymmetrical, base acute to tapered, very base often swollen with a prominent gibbosity below the sulcus (but sometimes not swollen at all), apex scarcely to noticeably subrostrate, often concave just below stigma at top of sulcus, (1.5 – ) 1.9 – 2.1 ( – 2.4) × (0.6 – ) 0.9 – 1.1 cm, stigma 3 – 3.5 mm across; inner mesocarp with ca. 11 ridges, several of which are prominent. 410

DISTRIBUTION. Papua New Guinea, Ramu River west, Sepik River basin; Indonesia. Common in areas. SPECIMENS EXAMINED. INDONESIA. Papua Province, Sarmi, coastal plain and Gunung Top, between Sungai Tor and Sungai Waske, on Titve Stream, 2°14’ S, 138°46’ E, 10 – 100 m, ♂ buds, 24 May 1993, McDonald & Ismail 3702 (A!, BISH!, CANB!, E!, K!, L!, US!); ibid, 2°4’ S, 138°46’ E, 10 – 100 m, ♂ buds, 29 May 1993, McDonald & Ismail 3749 (A!, BISH!, CANB!, L!, US!); Hollandia [Jayapura], 100 m, fr., 5 Oct. 1957, van der Sijde BW 5541 (A!, CANB!, K!, L!, PNH!, US!); Japen [Yapen] Is., Seroei [Serui], 50 m, ♂ buds, 11 Sept. 1939, Neth. Ind. For. Ser. bb.30592 (A!, BISH!, L!);. PAPUA NEW GUINEA. Sepik District, [Frieda River fide Sleumer], ♂ fl., Ledermann 7497 (BM, n.v., K!); Sepik District, imm. fr., Ledermann 8073 (E! photo); Sepik District, [April River fide Sleumer], imm. fr., Ledermann 8761 (syntype of Stemonurus gracilis, B†, E! photo, K!, SING!); May River, Ledermann 7229 (S. gracilis lectotype L!; isolectotype K!); Madang Province, Ramu Valley, near Faita airstrip (Bismarck Range), 180 m [600 ft.], 21 June 1955, Saunders 309 (BRI!, CANB!, L!); Ramu River, ♂ buds, Jan. 1902, Schlechter 14139 (holotype B†, lectotype P! (selected by Schori); isolectotypes A! [3 sheets], BM n.v., BO n.v., G n.v., K!, L!, P!, WRSL n.v.); West Sepik Province, Sepik River near Yellow River, ♀ fl., imm. fr., 5 Oct. 1949, Womersley NGF 3898 (A!, BRI!, K!, L!, SING n.v.); Sepik District, Ossima village, 3°00’ S, 141°15’ E, 30 m [100 ft.], imm. fr., 9 March 1964, Sayers NGF 13299 (A!, BISH! photo, BO n.v., BRI n.v., CANB!, K!, L!, PNH non inveni, SING n.v., SYD n.v., UH n.v.); Telefomin Subdistrict, Prospect Creek near Frieda River, 4°42’ S, 141°48’ E, 366 m [1200 ft.], 21 June 1969, Henty & Foreman NGF 42525 (A n.v., BISH!, BO n.v., BRI!, CANB n.v., K!, L!, PNH n.v., SING n.v., SYD n.v., US!); ibid, 490 m [1600 ft.], 22 June 1969, Henty & Foreman NGF 42529 (CANB!, E!, K!, L!, SING!, US!); Amanab Sub- district, Imonda Patrol Post, 3°20 S, 141°10 E, 300 m, fr., 25 Nov. 1971, Streimann & Martin LAE 52878 (A!, BO n.v., BRI!, CANB!, K!, L!, SING n.v., SYD n.v.); East Sepik Province, Hunstein Range, Mt. Samsai, 4°26’ S, 142°44’ E, fr., 14 Sept. 1989, Takeuchi & Moses 4780 (A!, BISH!, CANB!, K!, L!); Hunstein Range, 4°28’ S, 142°43’ 411

E, Mt. Samsai, fr., 25 Sept. 1989, Takeuchi 5015 (BISH!); Hunstein Range, 4°28’ S, 142°43’ 150 m, imm. fr., 14 July 1990, Takeuchi 6093 (BISH! photo, CANB!, F!, K! [2 sheets], L!, MO!, US!); Sepik District, near Ambunti, 90 m [300 ft.], imm. fr., 8 June 1966, Hoogland & Craven 10238 (A n.v., B n.v., BO n.v., BRI n.v., CANB! [2 sheets], K!, L!, LAE n.v., US!); Sepik District, Ambunti Subdistrict, near Wagu, 120 m [400 ft.], imm. fr., 7 July 1966, Hoogland & Craven 10494 (A n.v., BRI n.v., CANB!, K!, L!, LAE n.v., US!); Sepik District, Ambunti Subdistrict, Hunstein River, 140 m [450 ft.], imm. fr., 26 July 1966, Hoogland & Craven 10671 (A!, BO n.v., BRI n.v., CANB! [2 sheets], K!, L! [2 sheets], LAE n.v., US!). HABITAT. Transition zone between hill forest and alluvial flood plain of the Hunstein River; on ridge in secondary forest; swamp forest; mostly below 200 m. VERNACULAR NAME(S). Midyagia, midyagia-taram (Waskuk); babassua (Wagu). USES. Trunks are used in house construction by the Wagu and Waskuk. NOTES. Gomphandra ramuensis is a fairly variable species that may represent more than one cryptic taxon. Leaf size and shape are apparently quite plastic, even within the same tree, and the fruit may be quite gibbous at the base or not at all gibbous. However, given the lack of material with mature flowers and fruit, the specimens listed above are treated as one taxon, largely on the basis of inflorescence structure and leaf venation. The tertiary and lower order veinlets of Gomphandra ramuensis are often quite prominent, and the venation frequently does not resemble that of other species at all. Gomphandra ramuensis was previously treated as a synonym of G. australiana (Sleumer 1969). While the two species are similar in many respects, the tertiary and smaller order veins of Gomphandra ramuensis are much more prominent on dried leaves, the ripe fruit color is reportedly white rather than pink (although immature fruit may be pale pink), and the fruit shape is different (slightly beaked, usually with a swollen base). Gomphandra ramuensis may be confused with G. pseudoprasina, which can have similar leaves and fruit but has pubescent petals and stamens. Gomphandra pseudoprasina is generally found above 500 m, while G. ramuensis usually grows below 200 m. Most Gomphandra ramuensis specimens from Papua New Guinea are from the Sepik River valley. Type material of Gomphandra montana is also from the Sepik River 412

area, but the specimens are from higher elevations and were presumably collected in the Central Range. Gomphandra montana has more closely spaced secondary veins, larger male flowers, and pubescent stamens. Gomphandra pallida Sleumer, collected along tributaries of the Sepik River, is treated as a synonym of G. ramuensis here. Material from the province of Papua, mostly staminate collections with small buds, is treated here as Gomphandra ramuensis, though it could belong to undescribed species. More collections of mature reproductive material are needed. Ledermann 10089 may belong here, based on the leaf venation.

58. Gomphandra rarinervis Schori (Blumea). Stemonurus puberulus K. Schum. & Lauterb. (1900: 414), haud Gomphandra puberula Ridl. (1915: 142). Type: Papua New Guinea, Madang Province, Astrolabe Plain near Erima, 31 May 1896, Lauterbach 2204 (lectotype WRSL! photo (selected by Schori); isolectotype L!).

Small tree to 15 m high and 32 cm diam. Bark gray, gray-green, greenish brown, smooth or with pustular lenticels. Twigs usually zigzag, with spreading tawny to light brown pubescence, 2.5 – 3.0 mm in diam., terminal buds falcate, densely pubescent. Leaves chartaceous to thinly coriaceous, ovate, often somewhat asymmetrical, widest at or just below the middle, apex abruptly and shortly acuminate, base tapered, velutinous below, glabrescent above, dark to medium green and matte or shiny above, paler or yellow green and matte below, (12 – ) 18 – 26 × (6 – ) 10 – 13.5 cm; midrib sunken above, raised below, secondary veins 6 – 8 pairs, flat to slightly raised above, raised below, widely spaced (upper veins 1 – 3 cm apart), converging towards margin and upper few pairs ± brochidodromous, tertiary veins obscure above, flat to slightly raised below, percurrent and perpendicular to the midrib; petiole 0.8 – 1.1 cm × 2.0 – 2.6 mm. Inflorescences axillary, 1 – 2 per axil, from older leafy or leafless portion of twigs. Male inflorescences with up to ca. 12 flowers, to 2 cm long, peduncle to 0.5 cm long, usually bearing 2 branches, flowers crowded, sessile or on pedicels 1 – 3 mm long. Male flowers: calyx 413

green, pubescent, entire to slightly toothed, cupular, 4 – 5 mm in diam.; petals 5, light green, upper half of corolla pubescent abaxially, 5 – 6 mm long; stamens white, exserted, 8 mm long, filaments pubescent with short clavate hairs on both sides; ovary rudiment ovoid, apex acute, with a few hairs. Female inflorescences 1-2(-3)- flowered, to 1.6 cm long, peduncle short, to 0.6 cm long, pedicels 0.4 – 0.6 cm long, axes densely pubescent with spreading hairs. Female flowers incompletely known, calyx pubescent, evidently entire, cupular, 4 – 5 mm in diam.; ovary 4 – 5 mm long, sparsely pubescent, glabrescent, stigma lobed and ridged, 3.0-3.5 mm in diam. Fruit ovoid to obovoid, somewhat asymmetrical, apex curved and prominently beaked, reportedly yellow or orange when ripe, 3 – 4 × 1.5 – 1.7 cm; stigma displaced toward sulcus, inner mesocarp with ca. 8 sharp, prominent ridges.

DISTRIBUTION. Papua New Guinea, East Sepik, Madang, and Morobe Provinces (possibly Eastern Highlands as well). SPECIMENS EXAMINED. PAPUA NEW GUINEA. East Sepik Province, Robbins 2033b (CANB!); Madang Province, Regalado & Katik 1116 (BISH!, F!, L!, MO!); Simaga 1813 (A n.v., CANB! [3 sheets], K!, L! [2 sheets], LAE n.v.); Astrolabe Plain near Erima, 31 May 1896, Lauterbach 2204 (lectotype WRSL! photo (selected by Schori; isolectotype L!); Hoogland 5076 (A!, BRI!, L!); Schlechter 17021 (A!, B†, L!, P!, UC!); Henty NGF 28033 (A!, BO n.v., BRI n.v., CANB!, K!, L!, PNH!, SING n.v., SYD n.v., UH n.v.); Kiapranis et al. LAE 87104 (K!, L!, US!); Morobe Province, Lovave 129 (A n.v., BRIT n.v., CANB!, K non inveni, L!); Rau 542 (K!, L! [2 sheets]); Womersley NGF 3203 (A!, BRI!, CANB!); Okada & Katik 4324 (BRI!, KYO n.v., LAE n.v., U n.v.); Takeuchi & David 5935 (A!, BISH!, CANB!, K! [2 sheets], L!); Takeuchi & David 6963 (A!, BISH!, CANB!, L!); Hartley 10282 (A!, BRI!, CANB!, K!, L!); Hartley 10282 A (BRI!, CANB!); Hartley 11037 (CANB!, K!, L!); Millar NGF 12225 (A!, K!, L!); Henty NGF 12407 (CANB!, K!, L!, PNH!, SING!); Takeuchi & Ama 16229 (A!, CANB! [2 sheets], K!, L!); Takeuchi & Ama 17110 (A!, L!); Gillison NGF 22260 (A n.v., BO n.v., BRI n.v., CANB!, K!, L!, PNH n.v., SING n.v., SYD n.v., UH n.v.); Streimann NGF 24342 (A n.v., BO n.v., BRI n.v., CANB!, K!, L!); Ridsdale NGF 31689 (A!, BO n.v., 414

BRI n.v., CANB n.v., K n.v., L!); Womersley NGF 37107 (CANB!, K! [2 sheets], L! [2 sheets]); Katik NGF 46772 (A!, BISH n.v., BO n.v., BRI!, CANB!, K!, L!, PNH n.v., SING n.v., SYD n.v., US!); Katik & Larivita LAE 62056 (A!, BISH!, BRI! [2 sheets], CANB!, E!, K!, L!, PNH n.v., SYD n.v., US!); Kerenga et al. LAE 73883 (A!, BISH!, BRI!, CANB!, E!, K!, L!, MO!, NSW n.v., UPNG n.v., US!); Lovave LAE 82339 (A!, K!, L!); Bau LAE 82612 (A n.v., CANB!, E!, K!, L! [2 sheets], NSW n.v., PNH n.v., UPNG n.v., US!); Bau LAE 82682 (K, L! [2 sheets]). HABITAT. Primary and secondary rain forest, lower montane Castanopsis forest zone, lowland rain forest dominated by Anisoptera, tall alluvial forest and flood plain forest, on steep to moderate slopes, along streams, in riverine swamp forest, at forest edges, in a limestone area and on ultrabasic alluvial soil, and in disturbed forest on flat, well-drained land, 5 – 500 m. PHENOLOGY. Flowers were collected from August to December. ETYMOLOGY. From Latin rarus, referring to the wide spacing of the secondary veins. CONSERVATION STATUS. Least Concern (LC) to Near Threatened (NT). NOTES. Gomphandra rarinervis is one of the most easily recognized Gomphandra species in New Guinea, with large leaves, widely spaced veins, a long, prominently ribbed drupe, and spreading pubescence on both the twigs and leaves. This species has most often been identified as Gomphandra papuana (Becc.) Sleumer, or less frequently as G. montana (Schellenb.) Sleumer. Gomphandra rarinervis has been collected from the northern part of Papua New Guinea, and it does not appear to overlap in distribution with G. papuana, which occurs in Irian Jaya, West Sepik, Western, Southern Highlands, Gulf, Central, and Northern Provinces. Gomphandra papuana has similar leaves, but the pubescence on the leaves and twigs is very tightly appressed, and while the fruits are a similar size, the inner mesocarp seldom develops, so no ridges are evident, the stigma is much smoother, and the epicarp has a granular texture. Gomphandra montana was described from East Sepik Province, and unfortunately all the fruiting syntypes appear to have been destroyed at B, but the male specimens have much smaller leaves with close parallel veins and a long-peduncled inflorescence that is multiply branched. Material from Central Province, originally 415

described as Gomphandra carrii Sleumer, probably belongs to G. montana. The fruits are up to 3 cm long (matching Schellenberg’s description), but they lack the beak of Gomphandra rarinervis, have more numerous and less prominent ridges, and are borne on a long-peduncled, multiply branched infructescence. Gomphandra rarinervis matches type material of Stemonurus puberulus, but the epithet “puberula” was used in Gomphandra by Ridley (1915), so a replacement name was needed. The epithet “rarinervis” has been chosen in reference to the widely spaced veins on the leaves. The syntypes of Stemonurus puberulus were at B, and Sleumer inappropriately designated Lauterbach 2204 as a lectotype in 1969, after the specimen had been destroyed. The other specimen cited in the protologue of S. puberulus, Lauterbach 2483, evidently did not have any duplicates. The Lauterbach 2204 duplicate specimen at WRSL is the lectotype, and a fragment at Leiden (ex WRSL) is the isolectotype.

59. Gomphandra schoepfiifolia Sleumer (1940: 241). Type: Papua New Guinea, Morobe District, E. Ogeramnang, 1800 m [5900 ft.], ♂ buds, 27 Jan. 1937, Clemens 5160 (lectotype A! [2 sheets] (selected by Schori)).

Small to medium tree to 24 m tall, 10 – 30 cm in diam. Twigs relatively straight, often with a decurrent ridge below each petiole, 1.4 – 2 mm in diam., pubescent with minute, tightly appressed reddish hairs, glabrescent with age. Leaves oblong, base acute, apex acute to shortly acuminate, 10 – 11 × 4 – 5.5 cm, thinly coriaceous, initially pubescent but glabrous above at maturity, glabrescent below with sparse appressed pubescent along the midrib, margin slightly revolute; midrib impressed above, raised below, secondary veins 4 – 6 pairs, flat to slightly sunken above, raised below, vein course ± parallel, arching near the margin and upper pairs joining, tertiary veins not evident above, obscure to slightly raised below, weakly percurrent; petiole grooved above, 0.6 – 0.8 cm long, pubescent with minute appressed hairs. Inflorescences axillary on mature portion of twigs, axes pubescent with minute reddish hairs. Male inflorescence with peduncle 0.6 – 1.5 cm long, bearing 3 – 5 branches 2 – 8 mm long, branches unbranched or occasionally 416

rebranched, 2 – 10 flowers arranged in a somewhat scorpioid cyme at the end of each branch, subsessile or on pedicels 1 – 2 mm long, up to 30 flowers per inflorescence. Male flowers (fide Sleumer 1940): calyx cupular, minutely toothed, sparsely pubescent near the margin, petals 5, glabrous, 4 mm long, stamens 5, 3 mm long (probably immature), glabrous dorsally, sparsely pubescent ventrally below the anthers, ovary rudiment conical, glabrous. Female inflorescence with peduncle 0.8 cm long, bearing 3 – 4 pedicels 0.3 – 0.4 mm long, each with 1 – 3 (sub)sessile flowers. Female flowers (fide Sleumer 1940): calyx cupular, petals 5, glabrous, 5 mm long, staminodes 5, ovary cylindric, glabrous, 3.5 mm long. Fruit obovoid, base attenuate, apex acute, stigma displaced toward sulcus, 2.8 – 2.9 × 1 – 1.1 cm, stigma ridged, 2.5 mm across, inner mesocarp with ca. 15 low anastomosing ridges.

DISTRIBUTION. Papua New Guinea, Morobe Province, Saruwared Range. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Morobe Province, E Ogeramnang, 1800 m [5900 ft.], ♂ buds, 27 Jan. 1937, Clemens 5160 (holotype B†, lectotype A! [2 sheets](selected by Schori)); Matap, 1525 – 1830 m [5000 – 6000 ft.], fr., 6 Feb. – 6 April 1940, Clemens 11173 (A!, MICH!); Central Province, Alola, 2000 m [c. 6000 ft.], ♀ buds, 4 Dec. 1935, Carr 13617 (A!, B†, K!, L!, NY!, SING! in database); Lala Valley, 1830 m [c. 6000 ft.], ♀ buds, 29 Feb. 1936, Carr 15850 (BM! photo, CANB!, K!, L!, NY!, P!, SING n.v.); Lala River, 1525 m [c. 5000 ft.], 7 March 1936, Carr 16001 (BM! photo, CANB!, K!, L!, P!, NY!, SING n.v.). Additional Specimens cited by Sleumer (1969) but not seen: Morobe Province, Yunzaing, 1500 m, fr., Clemens 3266 A (B†); Ogeramnang trail, forest hill, Sarawaket, ca. 1850 m, ♂, Clemens 4766 (A not found, B†). HABITAT. Forest on hill, 1525 – 1830 m. ETYMOLOGY. Leaves like Schoepfia (Olacaceae). NOTES. Unfortunately, most of the original material cited by Sleumer in his 1940 description of this species was destroyed at B. Sleumer’s Latin description did not include leaf or fruit dimensions, nor details of female inflorescence or infructescence structure. The description above has been emended based on Clemens and Carr 417

specimens that Sleumer did not cite in his original description, but which seem to fit the species. None of the specimens available has mature floral material, and Sleumer’s original measurements may be based on buds as well. The Clemens collections are from the Saruwared Range in Morobe. Sleumer (1969) designated the Leiden specimen of Carr 13617 as a neotype. However, the isotype of Clemens 5160 at A takes precedence and is here designated as a lectotype, so the neotype status of Carr 13617 is removed.

60. Gomphandra subcordata Schori (Blumea). Type: Papua New Guinea, Morobe Province, Wau-Salamaua Road, near Skindewai, 7°10’ S, 147° E, 1645 m [5400 ft.], 7 Jan. 1956, Womersley & Millar NGF 8465 (holotype K!; isotypes A!, BRI! [2 sheets], CANB!, L!).

Small tree to 10 m tall. Bark grey-green. Twigs 2.5 – 3.5 mm in diam., slightly zigzag, evenly covered with minute, appressed reddish pubescence, eventually somewhat glabrescent on older twigs. Leaves dark to medium green, fleshy when living, glabrescent above, persistently pubescent below with minute appressed hairs, ovate-elliptic to slightly obovate, base rounded to subcordate or occasionally tapering, apex abruptly and shortly acuminate, 16 – 21 ( – 23) × 8 – 12 cm; midrib sunken above, raised below, secondary veins 5 – 7 pairs, widely spaced (1 – 5 cm apart), flat to slightly impressed above, raised below, upper pairs joining near the margin, tertiary veins obscure on both surfaces, percurrent, perpendicular to the midrib; petiole relatively short, 0.5 – 0.7 ( – 1.0) cm long. Male inflorescences unknown. Female inflorescences axillary, from previous year’s growth, flowers 2 – 3 per inflorescence, peduncle 6 mm long before branching, branches 2 – 3, serving as pedicels, 0.4 – 0.7 ( – 1.0) cm long, axes densely pubescent with appressed reddish hairs. Female flowers only seen in bud, calyx cupular, entire, sparsely pubescent, petals sparsely pubescent. Infructescences with elongated peduncles to 1.5 cm long before branching. Fruit evidently glabrous, pale pink when ripe (fide Womersley & Millar NGF 8465), punctate with small light spots, slightly obovoid, apex rounded, base a bit tapered, 2 – 2.6 × 1.1 – 1.3 cm, stigma terminal or slightly eccentric, inner mesocarp with ca. 15 anastomosing ridges. 418

DISTRIBUTION. Papua New Guinea, Morobe Province, endemic to Kupper Range. SPECIMENS EXAMINED. PAPUA NEW GUINEA. Morobe Province, Wagau – Labu Track, Mumeng, 6° 51’ S, 146° 48’ E, 8 Mar. 2000 Lovave 23 (L!); Wau-Salamaua Road, near Skindewai, 7°10’ S, 147° E, 1645 m [5400 ft.], 7 Jan. 1956, Womersley & Millar NGF 8465 (holotype K!, isotypes A!, BRI! [2 sheets], CANB!, L!); Gully due north of Wagau airstrip, (6°10’ S, 146° 50’ E, 1220 m [4000 ft.], 3 Nov. 1963, Womersley NGF 17882 (CANB! [2 sheets], K! [2 sheets], L!). HABITAT. Understory in mid mountain forest, low montane Castanopsis forest zone, 800 – 1645 m. PHENOLOGY. Flowers and fruits were present in January. CONSERVATION STATUS. Endangered: EN B2ab(iii). NOTES. This species seems closely related to Gomphandra rarinervis, with its large leaves and widely spaced veins. However, it differs in its reddish, appressed pubescence, smaller fruits, and longer peduncles, features it shares with Gomphandra pseudoprasina. It differs from G. pseudoprasina in its leaf shape, persistent pubescence, and few flowers. Gomphandra subcordata grows at a higher elevation than G. rarinervis but at the same elevations as G. pseudoprasina. It may be a fertile hybrid of the two species.

Unassigned Specimens

Indonesia. West Papua Province, Manokwari Subdistrict, Arfai, 70 m, fr., 2 Oct. 1956, Versteegh BW 3942 (A!, CANB!, L!). This specimen resembles Gomphandra ramuensis in some respects and G. pseudoprasina in others.

West Papua Province, S. Manokwari, Mt. Krabo, 500 m, 4 Nov. 1960, Koster BW 10787 (BISH! photo [2 sheets], BRI!, CANB!, L!). This specimen has very large leaves. It might be an odd Gomphandra ramuensis or G. australiana, but the fruit are missing.

West Papua Province, Idenburg River, 2 km SW of Bernhard Camp, 750 m, ♂ buds, 23 March 1939, Brass & Versteegh 13199 (A!, L!). This specimen has tiny glabrous buds 419

and appressed reddish pubescence on the twigs. It may Gomphandra schoepfiifolia or another similar species (possibly undescribed). The Bernhard Camp was near an airfield, since Brass flew to Jayapura the day after he finished collecting at the locality. It may have been near Hulu Atas or Dabera.

Papua New Guinea. Milne Bay Province, Normanby Island, near Waikaiuna Bay, 10°00’ S, 150°55’ E, 15 m [50 ft.], imm. fr., 18 April 1956, Womersley & Brass NGF 8610 (A!, BRI!). Possibly close to Gomphandra muscosa, but leaves chartaceous and fruit too immature to determine mature size or shape.

Milne Bay Province, Misima Island, Mt. Sisa, north slopes, 300 m, imm. fr., 25 July 1956, Brass 27504 (A!, US!). This specimen is not Gomphandra muscosa, which also grows on Misima. The leaves are much larger and chartaceous, and the fruits are long with a very broad stigma (4 mm). The fruits are clearly not ripe, but they are 3 cm long and show no signs of a sclerified endocarp or inner mesocarp, suggesting they might belong to Gomphandra papuana. However, the infructescences have a well-developed peduncle 1 cm long with pedicels 0.8 cm long, which does not match Gomphandra papuana. This is probably an undescribed species, but it is left without identification here partly because of its similarities to the next specimen.

Milne Bay Province, Woodlark Island, Kulumadau, 100 m, imm fr., 14 Nov. 1956, Brass 28741 (A!, K!, US!). This collection differs from Brass 27504 in its larger leaves with slightly different venation and its smaller immature fruit. Unless the fruits of this taxon increase dramatically in size and develop an accrescent stigma, they will never be very similar to the fruits of Brass 27504. The two collections look very similar but it is doubtful they represent the same taxon. As each morphology is only known from a single collection with immature fruit, it would be very difficult to distinguish them as separate species without additional material of flowers or mature fruit.

420

BISMARCK ARCHIPELAGO, SOLOMON ISLANDS & FIJI [2 taxa]

G. melanesiensis subsp. melanesiensis, G. melanesiensis subsp. macrocarpa

Leaves elliptic to obovate, fruit 1.7 – 2.2 cm long, western Melanesia G. melanesiensis subsp. melanesiensis Leaves ovate-elliptic, fruit 2.4 – 4.5 cm long, southeastern Solomon Islands and Rotuma G. melanesiensis subsp. macrocarpa

61. Gomphandra melanesiensis Schori subsp. melanesiensis (Kew Bulletin). Type: Solomon Islands, Bougainville, Aku village c. 10 miles w of Buin Station, 30 m [100 ft.], ♀ fl., fr., 14 Sept. 1964, Schodde & Craven 4038 (holotype A!; isotypes CANB! [2 sheets], K!, L!).

Tree to 20 m high, 33 cm diam., buttresses absent or up to 0.6 m high, bole straight, bark smooth with pustules to rough, grey or light grey-brown to brown. Twigs straight to slightly zigzag, 2 – 3.5 mm in diam., cinereous with short appressed pubescent, eventually glabrescent. Leaves firmly chartaceous to thinly coriaceous, glossy green above when fresh, paler and shiny to dull below, initially pubescent, glabrous above and sparsely pubescent on the veins below at maturity, elliptic to obovate, base acute to attenuate, apex abruptly acute or acuminate, 14 – 20 × (4 – ) 5 – 7 ( – 8.5) cm, margin flat to slightly revolute; midrib sunken above, raised below, secondary veins 4 – 6 ( – 8) pairs, flat to slightly raised above, raised below, somewhat steeply ascending and usually converging towards the margin, usually not joining, tertiary veins flat above, flat to slightly raised below, distinctly percurrent; petiole grooved, (0.3 – ) 0.7 – 1.5 cm × 1.5 – 2 mm, sparsely pubescent. Inflorescences axillary, on mature twigs, 1 – 2 per axil, axes pubescent with appressed hairs. Male inflorescences 3 – 5 cm long overall, with 3 – 5 orders of somewhat irregular branching, peduncle 0.3 – 1.5 cm long before branching, second order branches to 1 cm long, usually bearing 3 – 4 branches, these third order branches again to 1 cm long, then often dichotomously branched into several few- 421

flowered, somewhat scorpioid cymes, flowers subsessile or pedicels to 4 mm long, robust examples with up to ca. 100 flowers per inflorescence, 30 – 40 more common. Male flowers: calyx cupular, entire to slightly lobed, pubescent with tawny hairs, 2 – 2.5 mm across, petals 5, cream to yellowish-green, pubescent at apex, 3 – 4 mm long, stamens scarcely to slightly exserted, 3 – 4 mm long, filaments glabrous or with a few clavate hairs ventrally below the anthers; ovary rudiment globose to ovoid, glabrous. Female inflorescences with peduncle (0.3 – ) 0.7 – 1 cm long, bearing up to 4 branches 3 – 5 mm long, each branch cymose with 1 – 3 flowers on pedicels 3 – 5 mm long, 5 – 10 ( – 20) flowers per inflorescence. Female flowers: calyx cupular, entire to slightly lobed, 2.5 – 3 mm across, pubescent with tawny hairs, petals pubescent at apex, 3 – 4 mm long, staminodes 3 – 4 mm long, glabrous or with a few hairs, ovary cylindrical, glabrous, 2 – 3 mm long. Fruit cream (fide BSIP 12174) to creamy-yellow (fide Regalado & Sirikolo 717) when ripe, ovoid-ellipsoid, apex and base obtuse, 1.7 – 2.2 × 1.0 – 1.1 cm, inner mesocarp bearing ca. 20 close longitudinal ridges, stigma terminal, slightly angled toward sulcus complex, 2.5 mm wide, ridged with a central depression.

DISTRIBUTION. Papua New Guinea: Umboi Island, Rambutyo Island, New Ireland, Bougainville; Solomon Islands. New Britain specimens are Gomphandra aff. melanesiensis. SPECIMENS EXAMINED. Griffith s.n. (BRI!). PAPUA NEW GUINEA. Manus Province, Horno Islands, Rambutyo Is., Kerenga & Croft LAE 77393 (A!, BISH!, BRI! [2 sheets], CANB!, E!, K!, L!); Morobe Province, Umboi Is., Conn & Katik LAE 66107 (A n.v., BISH n.v., BO n.v., BRI!, CANB!, E!, K!, L!, PNH n.v., SYD n.v., US n.v.); New Ireland Province, New Ireland, Coode et al. NGF 29646 (A!, BO n.v., BRI!, CANB!, K! [2 sheets], L!); Feni Islands, Ambitle Is., Takeuchi 16787 (A!, CANB!, K!, L!, US!); Takeuchi 16805 (A!, CANB!, K!, L!); Bougainville, Craven & Schodde 233 (A!, BRI!, K!, L!, LAE n.v.); Craven & Schodde 270 (A!, BH!, BISH!, BO n.v., BRI!, CANB!, G n.v., K!, L!, LAE n.v., MEL n.v., NSW n.v., PNH!, US n.v.); Craven & Schodde 366 (A!, B n.v., BH!, BISH!, BO n.v., BRI!, CANB!, G n.v., K!, L!, LAE n.v., MEL n.v., NSW n.v., US n.v.); Kajewski 1801 (A!, BISH!, BRI! [2 sheets], L!, US!); 422

Schodde & Craven 4038 (holotype A!; isotypes; CANB! [2 sheets], K! [2 sheets], L!); Sayers NGF 19699 (A!, BISH!, BO n.v., BRI!, CANB!, K!, L!, PNH! [2 sheets], SING n.v., SYD n.v., US n.v.). SOLOMON ISLANDS. No specific locality, Griffith s.n. (BRI!); Choiseul Province, Choiseul Is., Whitmore BSIP 5241 (K!, L!); Whitmore’s Collectors BSIP 5654 (K!, L!); Gafui et al. BSIP 17429, 17555, 18468, 18617, 18643, 18816 (K!, L!); Wagina [Vaghena] Is., Whitmore’s Collectors BSIP 5426 (K!, L!); Western Province, Treasury Is., Mauriasi et al. BSIP 14070, 14076, 14249, 14263 (K!, L!); Mauriasi et al. BSIP 14144 (K!, L!); Shortland Is., Whitmore’s Collectors BSIP 5921 (K!, L!); Runikera et al. BSIP 12924, 13074, 13195 (K!, L!); Mauriasi et al. BSIP 13232 (K!, L!); Ovau Is., Mauriasi et al. BSIP 13758 (K!, L!); Fauro Is., Mauriasi et al. BSIP 13984 (L!); Vella Lavella Is. (New Georgia), Kotali et al. BSIP 9540 (K!, L!); Baga [Mbava] Is. (New Georgia), Whitmore BSIP 1308, 1329 (K!, L!); Whitmore’s Collectors BSIP 3023, 3077 (K!, L!); Ranongga Is., Mauriasi et al. BSIP 14362, 14482, 15565, 15682, 15720 (K!, L!); Gizo Is., Mauriasi et al. BSIP 11695, 15805 (K!, L!); Kolombangara Is., Regalado & Sirikolo 717 (MO!, K!, L!); Evans BSIP 1389 (K!, L!); Whitmore BSIP 1482 (K!, L!); Arifanata R.S.S. 2573 (A!, CANB!, K!, L!); Dennis et al. BSIP 8159 (A!, K!, L!, SING!); Mauriasi et al. BSIP 8492 (K!, L!); Gafui et al. BSIP 8660, 8928 (K!, L!); Mauriasi et al. BSIP 9562, 11378, 11569 (K!, L!); New Georgia Is., Waterhouse 232 (K!); Cowmeadow BSIP 3134 (K!, L!); Cowmeadow’s Collectors BSIP 3236 (A!, K!. L!, SING!); Cowmeadow’s Collectors BSIP 3257, 3775, 4824 (K!, L!); Maenu’u BSIP 5161, 6407 (K!, L!, US!); Burn-Murdoch’s Collectors BSIP 6865 (K!, L!, US!); Burn-Murdoch’s Collectors BSIP 6878 (K!, L!, SING!, US!); Burn- Murdoch’s Collectors BSIP 7161 (L!); Rendova Is. (New Georgia group), Whitmore BSIP 1904 (K!, L!); Tetepare Is. (New Georgia group), Mauriasi et al. BSIP 15865, 15914, 15975, 16145 (K!, L!); Vanganu Is. (New Georgia group), Walker & White BSIP 160 (BRI! [2 sheets!], CANB!, K!, L!); Isabel Province, Barora Fa Is., Mauriasi et al. BSIP 16236 (K!, L!); Barora Ite Is., Mauriasi et al. BSIP 16014, 16155 (K!, L!); Santa Isabel Is., Whitmore BSIP 2361, 2406, 2597 (K!, L!); Susui R.S.S. 2902 (A!, BRI!, CANB!, K!, L!); Beer’s Collectors BSIP 5122 (K!, L!, US!); Beer’s Collectors BSIP 6407 (K!, L!, SING!); Beer’s Collectors BSIP 6761 (K!, L!, SING!, US!); Beer’s 423

Collectors BSIP 7366 (K!, L!, SING!); Mauriasi et al. BSIP 16530 (K!, L!); Malaita Province, Malaita Is., Lipaqeto BSIP 3423 (K!, L!); Gafui et al. BSIP 10208, 10289 (K!, L!); Runikera et al. BSIP 10350 (K!, L!); Runikera et al. BSIP 10401 (K!, L!); Runikera et al. BSIP 10540, 10712, 10734 (K!, L!); Mauriasi et al. BSIP 13438, 13516 (K!, L!); Small Malaita Is., Gafui et al. BSIP 16234, 16366, 16922, 17285 (K!, L!); Ulawa Is., Teona BSIP 6232 (K!, L!, US!); Central Province, Nggela Sule Is., Gafui et al. BSIP 15041 (A!, K!, L!); Gafui et al. BSIP 15205, 16801, 16882 (K!, L!); Mauriasi et al. BSIP 18211, 18245 (K!, L!); Nggela Pile Is., Gafui BSIP 15305 (A!, K!, L!); Gafui BSIP 15393 (K!, L!); Guadalcanal Province, Guadalcanal, Griffith SJG 13/02 (BRI!); Whitmore BSIP 660, 785, 1833 (K!, L!); Kajewski 2564 (A!, BRI!); Whitmore BSIP 2788 (K!, L!); Whitmore’s Collectors BSIP 3555 (K!, L!); Kere BSIP 5035 (K!, L!); Whitmore R.S.S. 6075 (A!, CANB!, K!, L!); Gafui et al. BSIP 9064, 9242, 9353 (K!, L!); Sirute’e et al. BSIP 9998 (K!, L!); Gafui et al. BSIP 10108 (K!, L!); Mauriasi et al. BSIP 11217 (K!, L!); Farodo et al. BSIP 12027 (K!, L!); Fa’arodo et al. BSIP 12174 (K!, L!); Mauriasi et al. BSIP 12457 (K!, L!); Makira-Ulawa Province, San Cristobal Is., Whitmore BSIP 4232 (K!, L!); Kere’s Collectors BSIP 5591 (K!, L!, SING!); Gafui et al. BSIP 11008 (K!, L!); Runikera et al. BSIP 11097 (K!, L!); Gafui et al. BSIP 12793, 12692 (K!, L!); Anganawai River Area, SE San Cristobal no collector, no number (K!); Santa Ana Is., Mauriasi et al. BSIP 17862 (K!, L!); Santa Catalina Is., Mauriasi et al. BSIP 17813 (K!, L!). cf. Gomphandra melanesiensis: New Ireland. Coode & Lelean NGF 46096 (K!, L!). aff. G. melanesiensis: New Britain, Hart NGF 7029 (A!, BRI!, CANB!, K!, L!, PNH!, US!); Frodin NGF 26784 (CANB!, L!); Frodin NGF 26911 (CANB!, L!); Croft et al. NGF 41408 (A!, BRI!, CANB!, E!, K!, L!, MO!, US!); Stevens & Lelean LAE 58717 (A!, BISH!, BRI!, CANB!, E!, K!, L!, US!). HABITAT. Primary rainforest margin; disturbed primary rainforest; valley bottom, riverside, 10 – 700 m. ETYMOLOGY. The specific epithet comes from the region of Melanesia, where the species is found. 424

VERNACULAR NAME(S). Yamul (Bougainville), aialo (Kwara’ae, Solomon Isl.), tutuamauvo (Manukiki, Guadalcanal). CONSERVATION STATUS. The species was reportedly common in the 1960s and given its wide distribution, it has a status of Least Concern. However, habitat destruction may threaten the species. USES. Used for house supports. NOTES. Gomphandra melanesiensis is probably closely related to G. australiana, but it differs in its obovate leaves with an attenuate base, pubescent petals, twig pubescence, and fruit with more numerous, less prominent ridges. The rapid increase in twig diameter (from terminal bud to third or fourth leaf from the bud) is distinctive. The inflorescence structure is irregular, with few to many flowers seen in collections from the same area. Specimens from New Britain are ambiguous because they are comparable to species from Papua New Guinea as well as to Gomphandra melanesiensis. The leaves and fruits look more like those of Gomphandra ramuensis than those of G. australiana, G. montana, or G. pseudoprasina, but the very immature buds on NGF 7029 are pubescent, so the specimens are not G. ramuensis or G. australiana. The leaves do not match Gomphandra australiana or G. pseudoprasina. The specimens were identified by Sleumer as Gomphandra montana, but they do not belong to that species because the leaves are different and the fruits are smaller. The specimens are similar to Gomphandra melanesiensis, but the fruits do not have as many ridges and the leaves appear somewhat different. Collections of mature reproductive material are needed to either confirm New Britain specimens as Gomphandra melanesiensis subsp. melanesiensis or describe them as a new taxon. The Kwara’ae names of “aialo” (Auki dialect) and “maemae” (Kwai dialect) are applied to Gomphandra, Medusanthera, and Stemonurus, all of which grow in the Solomon Island lowlands. According to Whitmore’s (1966) tree guide, Gomphandra was common, Stemonurus was occasional, and Medusanthera was occasional to common. All specimens of Gomphandra, Stemonurus, and Medusanthera cited by Whitmore are G. melanesiensis, with the possible exceptions of BSIP 3025 and 5423, which have not been verified. His indication of two species of Gomphandra and three species each of 425

Medusanthera and Stemonurus in the Solomon Islands was incorrect – there is only a single species of each genus, plus Whitmorea, which was described in his honor.

62. Gomphandra melanesiensis subsp. macrocarpa Schori (Kew Bulletin). Type: Fiji, Rotuma, Itutiu District, Jarua, [12° 30’ S, 177° 05’ E], 15 m [50 ft.], fr., 22 July 1938, St. John 19243 (holotype A!; isotypes A!, BISH!, BRI!, K!, L!, NY!, US!).

Tree to 15 m high and 14.5 cm in diam. Similar to Gomphandra melanesiensis subsp. melanesiensis, but twigs 2 – 3 mm thick, not increasing in diameter as quickly, leaves ovate-elliptic, not obovate and generally more rounded in outline, base acute, apex acute to shortly acuminate, 11 – 18.5 × 5 – 8 cm fruit white (fide St. John 19243), ivory (fide St. John 19462), or creamy yellow (fide Kajewski 514) when ripe, ellipsoid to obovoid, curved or straight, apex asymmetrical, base swollen, 2.4 – 4.5 × 1.5 – 2.2 cm, stigma 3.5 – 5 mm wide.

DISTRIBUTION. Santa Cruz Is., Rotuma. SANTA CRUZ ISLANDS. Tomotu Noi. Ngambwani area, 10° 47’ S, 166° 04’ E, buds, 14 April 1972, Powell BSIP 19862 (BISH!, CANB!, L!) Temotu Province. Santa Cruz [Nendo]. SW part, Baenga area, 30 m [100 ft.], imm. fr., 6 Oct. 1969, Mauriasi et al. BSIP 16619 (K!, L!); SE part, Bwenja River area, 50 m [175 ft.], imm. fr., 11 Oct. 1969, Mauriasi et al. BSIP 16713 (K!, L!); SW part, Masoko area, 10 m [25 ft.], 11 Oct. 1969, Mauriasi et al. BSIP 16733 (K, L!); NE part, Charlisle Bay area, imm. fr., 22 Oct. 1969, Mauriasi et al. BSIP 17001 (K!, L!); NE part, Lausaleba area, 75 m [250 ft.], imm. fr., 27 Oct. 1969, Mauriasi et al. BSIP 17090 (K!, L!); NW part, Mbo area, 70 m [225 ft.], imm. fr., 30 Oct. 1969, Mauriasi et al. BSIP 17165 (K!, L!); Mbania area, 10 m [25 ft.], imm. fr., 9 Oct. 1969, Mauriasi et al. BSIP 17620 (K!, L!); SE part, Utongo area, imm. fr., 16 Oct. 1969, Mauriasi et al. BSIP 17675 (K!, L!); East Santa Cruz, 20 m [75 ft.], imm. fr., 18 Oct. 1969, Mauriasi et al. BSIP 17684 (K!, L!); NW Graciosa Bay, Kauri area, 120 m [400 ft.], imm. fr., 11 Nov. 1969, Mauriasi et al. BSIP 17800 (K!, L!); Vanikoro 426

[Vanikolo]. Kajewski 514 (A!, MO!, US!); Near Peou, buds, 20 March 1963, Whitmore BSIP 1568 (K!, L!); Sundi Valley, Middle Ridge, 300 m [1000 ft.], buds, 29 March 1963, Whitmore BSIP 1633 (K!, L!); South coast at Emwa, 450 m [1500 ft.], fr., 8 April 1963, Whitmore BSIP 1693 (K!, L!); East side of Saboe Bay, 300 m [1000 ft.], fl., 17 April 1963, Whitmore BSIP 1740 (K!, L!); no specific locality, flowers, March 1965, Pia(i)to BSIP 7022 (K!, L!); FIJI. Rotuma. Itutiu District, Jarua, 15 m [50 ft.], fr., 22 July 1938, St. John 19243 (holotype A!; isotypes: A!, BISH! photo, BRI!, K!, L!, NY!, US!); Paho, 200 m [650 ft.], fr., 8 Aug. 1938, St. John 19462 (A! [2 sheets], BISH! photo, NY!, US!). HABITAT. Rain forest, 50 – 450 m. CONSERVATION STATUS. Endangered: EN B2ab(iii,iv) (IUCN 2001). ETYMOLOGY. The epithet macrocarpa refers to this subspecies’ large fruit. VERNACULAR NAMES. Aialo (Kwara’ae), ngamume (Nangu), hahu’a (Rotuman). USES. Used for roofing cross-beams in Rotuma. NOTES. Gomphandra melanesiensis subsp. macrocarpa is similar to subsp. melanesiensis in most respects. However, its twigs tend to be more slender and do not increase in diameter as close to the apex, its leaves are usually ovate-elliptic rather than obovate and appear more rounded in outline, and its fruits are substantially larger than those of subsp. melanesiensis. Specimens from the Santa Cruz Islands have smaller fruits than specimens from Rotuma.

AUSTRALIA [1 taxon]

37. Gomphandra australiana F. Muell. (1867: 3). Stemonurus australianus (F. Muell.) Kuntze (1891: 112). Type: Australia, Dalrymple’s Gap, Dallachy s.n. (lectotype MEL! photo (selected by Schori)). G. polymorpha F. M. Bailey, Queensl. Bot. Bull. 8 (Dep. Agric. Brisbane, 1893) 71, non Wight.

427

Small tree to 30 m tall, 30 cm in diam. Bark pale grey to tan. Twigs generally straight, 2 – 3.5 mm in diam., quickly glabrescent; terminal buds pubescent, tawny to somewhat cinereous with short appressed hairs. Leaves variable, glabrescent, usually drying somewhat chestnut brown to olive green above, chartaceous to thinly coriaceous, lance- elliptic to ovate, (9.5 – ) 16.5 – 19.5 ( – 22) × (3.5 – ) 5.5 – 8.5 ( – 9.5) cm, base acute, apex attenuate to bluntly acute or shortly acuminate, margin slightly revolute; midrib sunken above, raised below, secondary veins (4 – ) 5 – 6 ( – 8) pairs, flat above, raised below, often somewhat yellowish, converging towards margin, upper pairs joining, tertiary veins flat above, slightly raised below, delicately percurrent; petiole narrowly grooved above, 0.7 – 1.1 ( – 1.5) cm long, glabrescent. Inflorescences axillary, 1 – 2 per axil, axes pubescent with short appressed hairs. Male inflorescences variable with peduncle 0.6 – 1.0 cm long, bearing 2 – 4 branches, branches up to 0.7 cm long before bearing 2 – 4 branches, or unbranched, flowers shortly pedicellate (1 – 3 mm) or sessile, ca. 10 – 25 flowers per inflorescence (rarely up to 55). Male flowers: calyx cupular, sparsely pubescent, 1 mm high, minutely apiculate, green; petals 4 – 5, cream to greenish, glabrous, 4 mm long; stamens 5 – 6 mm long, exserted 1 – 2 mm, filaments glabrous; ovary rudiment ovoid, apex apiculate, glabrous. Female inflorescences variable with 1 – 2 orders of branching, main axis either branching and bearing up to 4 well-developed pedicels (sometimes shortly rebranched), or with short pedicels irregularly arranged along the main axis and up to 9 flowers. Female flowers: calyx apiculate, sparsely pubescent, petals 3 mm long, glabrous, staminodes not seen, ovary 3 mm long, glabrous. Infructescence with elongated peduncle to 1 cm long, pedicels 0.7 – 1 cm long, usually only 1 – 2 fruits developing. Fruit pale pink to orange when ripe, glabrous, ellipsoid, slightly asymmetrical, base and apex rounded, 1.9 – 2.3 ( – 2.6) × 1.2 – 1.3 cm, stigma terminal, flattened, 3.0 – 4.5 mm across, inner mesocarp with ca. 11 prominent ridges.

DISTRIBUTION. Cook & North Kennedy Districts, Ingham north to Cape York, Australia; Kai Island; southern Papua New Guinea. SPECIMENS EXAMINED. No locality, no collector, ♂ buds, Log IX (BRI! [sheet 68817]); Cook District, No specific locality, fr., Bailey s.n. (BRI!); Johnstone River, 428

imm. fr., Sept. 1917, Ladbrook s.n. (BRI!); Cairns, ♀ fl., 1897, Nugent s.n. (BRI!); State Forest Reserve 675, 17°06’ S, 145°42’ E, 120 m, imm. fr., 26 Sept. 1978, Gray 1020 (BRI!, K!, MO!); Cape York, fr., Nov. 1955, White 1226 (BRI!); Earl Hill, Trinity Beach, 16°49’ S, 145°42’ E, McDonald 1930 (BRI!); Wasp Creek near Lockerbie, fr., 30 Nov. 1962, Hyland 2510 (BRI!); Forestry Reserve 1073, N of Kuranda, imm. fr., 18 July 1963, Dansie AFO/2556 (BRI!); Alexandra, 16°10’ S, 145°45’ E, 10 m, imm. fr., 31 Aug. 1972, Hyland 2636 (BRI!); Mt. Leach Range, N of Ingham, 18°31’03” S, 146°10’31” E, 180 m, 19 Mar. 2001, Ford AF 2701 (BRI!); Mount Cook National Park, 15°29’ S, 145°15’ E, 250 m, ♂ buds, 24 Feb. 1993, Fell & Stanton DGF 2842 (BRI!, MBA n.v., MEL n.v., QRS n.v.); Daintree, Oliver Creek, 16°8’14” S, 145°26’26” E, 20 m, fr., 18 Oct. 2001, Ford AF 3022 (BRI!); Intake, Mossman, fr., 2 Sept. 1948, Smith 3969A (BRI!); Carnegie Range plateau, 8 km west of Somerset, 10°44’ S, 142°31’ E, 100 m, ♂ buds, 20 Feb. 1994, Fell et al. DGF 4005 (BRI!); Mossman-Daintree, fr., 24 Sept. 1950, Smith 4653 (A!, BRI!); Cape Tribulation Road near Noah Head, 16°10’ S, 145°10’ E, 100 m, ♂ buds, 10 April 1972, Hyland 5967 (BRI!); Noah Creek, 16°10’ S, 145°10’ E, 5 m, ♂ fl., 11 April 1972, Hyland 5985 (BRI!); Granite Creek Rd., west of Bloomfield, imm. fr., 31 July 1962, Webb & Tracey 6211 (BRI! 2 sheets); Alexandra, 16°10’ S, 145°25 E, 5 m, fr., 19 Dec. 1972, Hyland 6610 (BRI!); Cape Tribulation Rd., between Cape Tribulation and the Daintree River, 16°14’10” S, 145°25’20” E, ♂ fl., 11 April 2005, Jago 6801 (BRI!); Mt. Cook, Cooktown, 15°28’ S, 145°15’ E, 16 May 1969, Webb & Tracey 9077 (BRI!); Graham Ra., 17°22’ S, 146°00’ E, 100 m, fr., Oct. 1971, Webb & Tracey 11219 (BRI!); Cape Kimberley Rd., 1.5 km E of Cape Tribulation Rd., 16°15’ S, 145°26’ E, 60 m, imm. fr., 23 July 1993, Forster et al. PIF 13684 (BRI!); Paycheck Creek, 16°15’36” S, 145°26’37” E, 40 m, imm. fr., 26 June 1997, Forster et al. PIF 21266 (BRI!), Nyleta Creek, State Forest 757, 17°48’ S, 145°56’ E, 100 m, imm. fr., 28 Oct. 1997, Forster et al. PIF 21819 (BRI!, MEL n.v., QRS n.v.); Malbon Thompson Range near Cairns, imm. fr., 14 Aug. 1959, Thorne & Tracey 23056 (BRI!); Leo Creek, 13°31’05” S, 143°28’30” E, 15 m, imm. fr., 27 June 1998, Forster et al. PIF 23073 (A!, BRI!, K!, MEL n.v., QRS n.v.); State Forest 607 Freshwater Creek, 16°57’02” S, 145°42’31” S, imm. fr., 2 Oct. 2001, Forster PIF 27563 (A!, BRI!, L, NY!, MEL n.v., 429

NSW n.v., NY!); North Kennedy District, Herbert River, imm. fr., Eaton s.n. (BRI!); Clump Point, Bingil Bay, Mission Beach, 17°52’ S, 146°07’ E, fr., 16 Oct. 1990, Jackson s.n. (BRI!); Lugger Bay, 3.5 km S of South Mission Beach, 17°53’ S, 146°05’ E, fr., 29 Nov. 1991, Halford Q695 (BISH n.v., BRI!); Clump Point, Mission Beach, 17°51’ S, 146°07’ E, fr., 30 Nov. 1991, Halford Q728 (BRI!, CANB n.v., CBG n.v., MEL n.v.); Cardwell Forest Reserve, 18°17’30” S, 145°52’30” E, 160 m, fr., 10 Dec. 2003, Ford AF 4266 (BRI!, L!, NSW n.v.); South Mission Beach, 17°57’11” S, 146°5’22” E, 50 m, ♂ fl., 1 Dec. 2006, Ford 4891 (BRI!, L n.v., MO n.v., QRS n.v.); North Brook Island, 18°08’ S, 146°17’ E, fr., 19 Dec. 1997, Cumming 16717 (BRI!). HABITAT. Rain forest, creek side, lowland loam soil near beach, on dunes, or on alluvium, 40 – 160 m. Eaten by Wompoo fruit doves (Ptilinopus magnificus) in November (Frith et al. 1976). PHENOLOGY. Flowers have been collected December to April, with ripe fruit present from September to December. VERNACULAR NAME(S). Buff alder, buff beech. NOTES. This species is characterized by its small, glabrous flowers, irregular inflorescences, and stout fruits with a large, flattened stigma and prominent inner mesocarp ridges. The leaves are variable, but the species has a characteristic look and is readily recognizable. Sleumer (1969) incorrectly stated that the filaments are equal in length to the anther cells. This is true for most species of Gomphandra when the male flowers are examined in bud, but as with most other species, open flowers of G. australiana have filaments that are approximately equal in length to the corolla tube and much longer than the anther cells. Sleumer also considered Gomphandra australiana and G. montana to be almost indistinguishable, but the species are not very similar. Gomphandra montana has pubescent leaves and stamens, larger flowers, and a different fruit shape. There are very few collections of pistillate flowers of Gomphandra australiana, so although the species is common in areas and has been widely collected in Australia, the female flower description above is still incomplete, as it was in the Flora of Australia (Guymer 1984). 430

References

Aiken, S. R. & Leigh, C. H. A. Hallam, B. R. Rosen & T. C. Whitmore. (1992). Vanishing rain forests: The ecological transition in Malaysia. Clarendon Press, Oxford, UK.

Albach, D. C., Soltis, P. S., Soltis, D. E. & Olmstead, R. G. (2001). Phylogenetic analysis of the Asteridae s. l. based on sequences of four genes. Annals of the Missouri botanical garden 88: 163-212.

Anderson, J. A. R. & Muller, J. (1975). Palynological study of a Holocene peat and a Miocene coal deposit from NW Borneo. Review of Palaeobotany and Palynology 19: 291-351.

APG III. (2009). An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Botanical Journal of the Linnean Society 161: 105-121.

Ash, A., Ellis, B., Hickey, L. J., Johnson, K., Wilf, P. & Wing, S. (1999). Manual of leaf architecture - morphological description and categorization of dicotyledonous and net- veined monocotyledonous angiosperms. Leaf Architecture Working Group, Washington, DC.

Baas, P. (1974). Stomatal types in Icacinaceae. Additional observations on genera outside Malesia. Acta Botanica Neerlandica 23: 193-200.

Bailey, F. M. (1893). Contributions to the Queensland flora. 8: 71-72. Edmund Gregory, Brisbane.

Bailey, I. W. & Howard, R. A. (1941a). The comparative morphology of the Icacinaceae I. Anatomy of the node and internode. Journal of the Arnold Arboretum 22: 125-132.

Bailey, I. W. & Howard, R. A. (1941b). The comparative morphology of the Icacinaceae II. Vessels. Journal of the Arnold Arboretum 22: 171-187.

Bailey, I. W. & Howard, R. A. (1941c). The comparative morphology of the Icacinaceae III. Imperforate tracheary elements and xylem parenchyma. Journal of the Arnold Arboretum 22: 432-442.

Bailey, I. W. & Howard, R. A. (1941d). The comparative morphology of the Icacinaceae IV. Rays of the secondary xylem. Journal of the Arnold Arboretum 22: 556-568.

431

Baillon, H. (1864). Description du nouveau genre Grisollea. Adansonia 4: 211-219.

Baker. (1924). Dr. H. O. Forbes’s Malayan plants. Journal of Botany, British and foreign, Supplement 62: 21.

Ballard, H. E. J., Casamatta, D. A., Hall, M. M., McCauley, R. A., Segovia-Salcedo, M. C. & Verb, R. G. (2001). Phenetic analysis shows conspecificity between Hispaniolan Viola domingensis Urban and North American Viola macloskeyi sensu lato (Violaceae). Brittonia 53: 122-136.

Ballard, H. E. J., Sytsma, K. J. & Kowal, R. R. (1999). Shrinking the violets: phylogenetic relationships of infrageneric groups in Viola (Violaceae) based on Internal Transcribed Spacer DNA sequences. Systematic Botany 23: 439-458.

Bande, M. B. & Khatri, S. K. (1980). Some more fossil woods from the Deccan Intertrappean beds of Mandla District, Madhya Pradesh, India. Palaeontographica Abt. B 173: 147-165.

Beaman, J. H., Anderson, C. & Beaman, R. S. (2001). Icacinaceae. The plants of Mount Kinabalu. Vol. 4: 380-386. Natural History Publications (Borneo), Kota Kinabalu, Sabah, Malaysia.

Beccari, O. (1877). Malesia. Tipografia del Reale Instituto Sordo-muti, Genova.

Beccari, O. (1883). Malesia. Tipografia del Reale Instituto Sordo-muti, Genova.

Beddome, R. H. (1871). The Flora Sylvatica for Southern India. Gantz Brothers, Madras.

Birnie, S. M. (1927). Icacinaceae. Nova Guinea 14: 275-276.

Blanco, M. (1845). Flora de Filipinas. D. Miguel Sanchez, Manila.

Blume, C. L. (1850). Museum Botanicum Lugduno-Batavum. E. J. Brill, Lugduni- Batavorum.

Blume, C. L. (1825). Bijdragen tot de flora van Nederlandsch Indie. Lands Drukkerij, Batavia.

Cantino, P. D., Doyle, J. A., Graham, S. W., Judd, W. S., Olmstead, R. G., Soltis, D. E., Soltis, P. S. & Donoghue, M. J. (2007). Towards a phylogenetic nomenclature of Tracheophyta. Taxon 56: 822-846.

Cheng, H. W. & Lu, S. Y. (2000). Botel tabaco, Yami & Plants: The Illustrations of Ethnic Plants of Yami. Lamper Enterprises Co. Ltd., Taipei. 432

Craib, W. G. (1914). XIX - Contributions to the flora of Siam. Additamenta VI. Kew Bulletin 123-124.

Craib, W. G. (1926). Florae Siamensis Enumeratio. The Bangkok Times Press, Ltd., Bangkok.

Cuénoud, P., Savolainen, V., Chatrou, L. W., Powell, M., Grayer, R. J. & Chase, M. W. (2002). Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany 89: 132-144.

Dahl, A. O. (1952). The comparative morphology of the Icacinaceae, VI. The pollen. Journal of the Arnold Arboretum 33: 252-286.

Dan, N. V. & Nhu, D. T. (1989). Medicinal Plants in Viet Nam. World Health Organization; Institute of Materia Medica, Hanoi, Manila, Philippines.

Davies, A. G. & Oates, J. F. (1994). Colobine Monkeys: their ecology, behaviour, and evolution. Cambridge University Press, Cambridge, UK.

Davies, G. (1991). Seed-eating by red leaf monkeys (Presbytis rubicunda) in dipterocarp forest of Northern Borneo. International Journal of Primatology 12: 119-144. de Queiroz, K. (2007). Species concepts and species delimitation. Systematic Biology 56: 879-886.

Docters van Leeuwen-Reijnvaan, M. J. & Docters van Leeuwen, D. W. M. (1926). The zoocecidia of the Netherlands East Indies. Drukkerij de Unie, Batavia.

Docters van Leeuwen-Reijnvaan, M. J. & Docters van Leeuwen, D. W. M. (1941). The Zoocecidia of the Netherland's East Indies. Nederlandsch kruidkundig archief 51, Supplement 1: 175.

Editorial Committee of the Flora of Taiwan. (1993). Flora of Taiwan. Republic of China, Taipei, Taiwan.

Elmer, A. D. E. (1908). Three score of new plants. Leaflets of Philippine Botany 2: 491.

Elmer, A. D. E. (1915). Two hundred twenty six new species - I. Leaflets of Philippine Botany 7: 2689-2693.

Elmer, A. D. E. (1939). Miscellaneous new species. Leaflets of Philippine Botany 10: 3748-3749.

433

Engler, A. & Prantl, K. (1896). Die naturlichen Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten, insbesondere den Nutzflanzen, unter Mitwirkung zahlreicher hervorragender Fachgelehrten begrundet. 3, Sections 4 & 5, Geraniaceae-Vitaceae: W. Engelmann, Leipzig.

Erdtman, G. (1986). Pollen Morphology and Plant Taxonomy. Angiosperms (An Introduction to Palynology). E. J. Brill, Leiden, the Netherlands.

Fagerlind, F. (1945). Bau des gynöceums, der samenanlage und des embryosackes bei einigen repräsentanten der familie Icacinaceae. Svensk Botanisk Tidskrift 39: 346-364.

Fernandez-Villar, C. (1880). Novissima appendix ad Floram Philippinarum. Flora de Filipinas. Apud Plana et Socios, Typographos et Bibliopolas, Manila.

Frith, H. J., Crome, F. H. J. & Wolfe, T. O. (1976). Food of fruit-pigeons in New Guinea. The Emu 76: 49-58.

Gagnepain, F. (1910). 39. Malvacée, Tiliacée, Santalacée et Olacacées nouvelles. Notulae Systematicae 1: 198-200.

Gagnepain, F. & Lecomte, H. (1947). Quelques Espèces Nouvelles Des Olacacées (sensu lato). Notulae Systematicae 13: 132-134.

Ganesan, R. & Davidar, P. (2003). Effect of logging on the structure and regeneration of important fruit bearing trees in a wet evergreen forest, southern Western Ghats, India. Journal of Tropical Forest Science 15: 12-25.

Ganesh, T. & Davidar, P. (2001). Dispersal modes of tree species in the wet forests of southern Western Ghats. Current Science 80: 394-399.

Ganesh, T. & Davidar, P. (2005). Fruiting phenology and pre-dispersal seed predation in a rainforest in southern Western Ghats, India. In: J. L. Dew & J. P. Boubli (eds), Tropical fruits and frugivores: the search for strong interactors. Springer, Dordrecht, The Netherlands.

Goloboff, P. A. (1993). NONA, version 2.0. Tucamán, Argentina.

Grant, V. (1981). Plant Speciation. Columbia University Press, New York.

Guleria, J. S. & Srivastava, R. (2001). Fossil dicotyledonous woods from the Deccan Intertrappean beds of Kachchh, Gujarat, Western India. Palaeontographica Abt. B 257: 17-33.

434

Guymer, G. P. (1984). Icacinaceae. In: R. Robertson et al. (eds), Flora of Australia. 22: 204-211. Australian Government Publishing Service, Canberra, Australia.

Hallé, F., Oldeman, R. A. A. & Tomlinson, P. B. (1978). Tropical Trees and Forests: An Architectural Analysis. Springer-Verlag, Berlin.

Hallier, H. (1910). Ueber Phanerogamen von unsicherer oder unrichtiger stellung. Mededeelingen van s’ Rijks herbarium 1: 13.

Handel-Mazzetti. (1931). Plantae Novae Chingianae. Sinensia: Contributions from the National Institute of Zoology and Botany, Academia Sinica 2: 3-4.

Heads, M. (2003). Ericaceae in Malesia: vicariance biogeography, terrane tectonics and ecology. Telopea 10: 311-449.

Heintzelman Jr., C. E. & Howard, R. A. (1948). The comparative morphology of the Icacinaceae. V. The pubescence and the crystals. American Journal of Botany 35: 42-52.

Hide, R. (2003). Pig Husbandry in New Guinea. A Literature Review and Bibliography. ACIAR Monograph No. 108, xvi, 291 pp.

Hilu, K. W., Borsch, T., Mueller, K., Soltis, D. E., Soltis, P. S., Savolainen, V., Chase, M. W., Powell, M. P., Alice, L. A., Evans, R., Sauquet, H., Neinhuis, C., Slotta, T. A. B., Rohwer, J. G., Campbell, C. S. & Chatrou, L. W. (2003). Angiosperm phylogeny based on matK sequence information. American Journal of Botany 90: 1758-1776.

Holmgren, P. K., N. H. Holmgren & L. C. Barnett. 1990. Index herbariorum. Part I: The herbaria of the world. Ed. 8. New York Botanical Garden, Bronx. Available at: http://sweetgum.nybg.org/ih/

Holthuis, L. B. & Lam, H. J. (1942). A Contribution to the Flora of the Talaud Islands and Morotai. Blumea 5: 205.

Hooker, J. D. (1874 [1978 reprint]). The flora of British India. Bishen Singh Mahendra Pal Singh, Dehra Dun.

Howard, R. A. (1940). Studies of the Icacinaceae, I. Preliminary Taxonomic Notes. Journal of the Arnold Arboretum 21: 461-483, 486-488, plates 1-2.

Howard, R. A. (1943). Studies of the Icacinaceae-VI. Irvingbaileya and Codiocarpus, two new genera of the Icacinaceae. Brittonia 5: 47-57.

Hu, H. H. (1924). Notes on Chinese Ligneous Plants. Journal of the Arnold Arboretum 5: 229. 435

Humbert, H. & Gagnepain, F. (1948). Supplément à la flore générale de l’Indo-Chine. Muséum National d’Histoire Naturelle, Paris.

IUCN. 2001. IUCN red list categories and criteria. Ver. 3.1. Gland, Switzerland and Cambridge, UK.

IUCN 2010. IUCN Red List of Threatened Species. Version 2010.1. . Downloaded on 22 April 2010.

Junghuhn, F. W. & de Vriese, W. H. (1846). Bijdragen tot de kennis der flora van Sumatra. Nederlandsch kruidkundig archief 1: 17-18.

Kalima, T. (2003). Gomphandra quadrifida (Blume) Sleumer. In: R. H. M. J. Lemmens & N. Bunyapraphatsara (eds), Plant Resources of South-East Asia No. 12 (3). Medicinal and poisonous plants 3. Prosea Foundation, Bogor, Indonesia.

Kårehed, J. (2001). Multiple origin of the tropical forest tree family Icacinaceae. American Journal of Botany 88: 2259-2274.

Kerala Government. (2008). Kerala Forests and Wildlife Department: Forest Types. 6 Jan. 2010. Accessed on: 2 April 2010. www.keralaforest.org/index.php?option=com_content&view=article&id=74:detailed- information&catid=36:type-of-forests

King, G. (1895). Materials for a Flora of the Malayan Peninsula. Journal of the Asiatic Society of Bengal 64: 111-118.

Koorders, S. H. (1898). Verslag eener botanische dienstreis door de Minahasa tevens eerste overzicht der flora van. N. O. Celebes. Mededeelingen van's Lands plantentuin 19: 392-395.

Koorders, S. H. & Valeton, T. (1894-1914). Bijdrage no. 1-13 tot de kennis der boomsoorten op Java. Mededeelingen ’s Lands Plantentuin 23. 5: 144-151.

Kuntze, O. (1891). Revisio Generum Plantarum. Arthur Felix, Leipzig.

Kurz, S. (1872). New Burmese plants. Journal of the Asiatic Society of Bengal 41: 298.

Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T. G. & Savolainen, V. (2008). DNA barcoding the floras of biodiversity hotspots. Proceedings of the national academy of sciences 105: 2923-2928.

436

Lakshminarasimhan, P. (1999). Icacinaceae. In: P. K. Hajra, P. S. N. Rao & V. Mudgal (eds), Flora of the Andaman & Nicobar Islands. 1: 252-259. Botanical Survey of India, Calcutta, India.

Lauterbach, C. & Schellenberg, G. (1923). Beitrage zur Flora von Papuasien. IX Opiliaceae, Olacaceae, und Icacinaceae. Botanische Jahrbucher fur Systematik, Pflanzengeschichte und Pflanzengeographie 58: 159-165.

LeCroy, M., Kulupi, A. & Peckover, W. S. (1980). Goldie’s bird of paradise: display, natural history and traditional relationships of people to the bird. The Wildon Bulletin 92: 289-301.

Lens, F., Kårehed, J., Baas, P., Jansen, S., Rabaey, D., Huysmans, S., Hamann, T. & Smets, E. (2008). The wood anatomy of the polyphyletic Icacinaceae s.l., and their relationships within asterids. Taxon 57: 525-552.

Li, H.-l. (1963). Woody flora of Taiwan. Livingston Publishing Co., Philadelphia, PA.

Lindley, J. (1836). A Natural System of Botany. Longman, Rees, Orme, Brown, Green, and Longman, London.

Lobreau-Callen, D. (1973). Le pollen des Icacinaceae: II. Observations en microscopie électronique, corrélations, conclusions (1). Pollen et Spores 15: 47-89.

Loizeau, P.-A., Savolainen, V., Andrews, S. & Spichiger, R. (in press). Aquifoliaceae. In: Kubitzki et al. (eds), Families and Genera of Vascular Plants. Springer-Verlag, Berlin.

Madulid, D. A. (2001). A Dictionary of Philippine Plant Names. Bookmark, Manila, Philippines.

Mauritzon, J. (1936). Embryologische angaben über Stackhousiaceae, Hippocrateaceae, und Icacinaceae. Svensk Botanisk Tidskrift 30: 541-550.

Mayden, R. L. (1999). Consilience and a hierarchy of species concepts: Advances toward closure on the species puzzle. Journal of Nematology 31: 95-116.

Mayr, E. & Diamond, J. (2001). The birds of Northern Melanesia. Oxford University Press, New York, NY.

Merrill, E. D. (1908). New or noteworthy Philippine plants, VI. The Philippine Journal of Science 3: 240-243.

Merrill, E. D. (1921a). A bibliographic enumeration of Bornean plants. Journal of the Straits Branch of the Royal Asiatic Society Special No. 356: 355-356. 437

Merrill, E. D. (1921b). Noteworthy Philippine plants, XVI. The Philippine Journal of Science 17: 276-278.

Merrill, E. D. (1922). Diagnoses of Hainan plants. Philippine Journal of Science 21: 348.

Merrill, E. D. (1923). An enumeration of Philippine flowering plants. Bureau of Printing, Manila.

Merrill, E. D. (1938a). New or noteworthy Indo-Chinese plants. Journal of the Arnold Arboretum 19: 44.

Merrill, E. D. (1938b). New Sumatran Plants. Michigan Academy of Science, Arts, and Letters 23: 183.

Merrill, E. D. (1942). Records of Indo-Chinese Plants, III. Journal of the Arnold Arboretum 23: 175-178.

Miers, J. (1852). On some genera of the Icacinaceae. The Annals and Magazine of Natural History Series 2, vol. 10: 31-44, 108-112, 118-119.

Miers, J. (1861). Contributions to botany, iconographic and descriptive detailing the character of plants that are either new or imperfectly described; to which are added remarks on their affinities. Williams and Norgate, London.

Miquel, F. A. W. (1856). Flora van Nederlandsch Indie (Flora Indiae Batavae). C. G. van der Post, Amsterdam.

Miquel, F. A. W. (1860). Flora van Nederlandsch Indie, Eerste Bijvoegsel. C. G. van der Post, Amsterdam.

Morley, R. J. & Flenley, J. R. (1987). Late Cainozoic vegetational and environmental changes in the Malay archipelago. In: T. C. Whitmore (eds), Biogeographical evolution of the Malay Archipelago. 4: Clarendon Press, Oxford, UK.

Mueller, F. v. (1867-1868). Fragmenta phytographiae australiae. Auctoritate Guberni Coloniae Victoriae, Melbourne.

Mueller, F. v. (1876). Descriptive notes on Papuan plants. George Skinner, Acting Government Printer, Melbourne.

Nhu, D. T. (1990). Icacinaceae. Les plantes médicinales au Vietnam. Livre II: 157. Agence de coopération Culturelle et Technique, Paris.

438

Nixon, K. C. (2002). WinClada, version 1.00.08. Ithaca, NY.

Oates, J. F., Waterman, P. G. & Choo, G. M. (1980). Food selection by the south Indian leaf-monkey, Presbytis johnii, in relation to leaf chemistry. Oecologia (Berlin) 45: 45-56.

Oginuma, K., Kiapranis, R., Damas, K. & Tobe, H. (1998). A cytological study of some plants from Papua New Guinea. Acta Phytotaxonomica et Geobotanica 49: 105-114.

Padmanabhan, D. (1961). A contribution to the embryology of Gomphandra polymorpha. Proceedings of the National Institute of Sciences of India. Part B, Biological sciences 27: 389-398.

Palisot de Beauvois, A. M. F. J. (1804-1807). Flore d’Oware et de Benin, en Afrique. Imprimerie de Fain Jeune et Compagnie, Paris.

Pulle, A. (1912). Icacinaceae. Nova Guinea 8: 657-660.

Rasoarimalala, L., Albers, F. & Straka, H. (1982). Palynologia Madagassica et Mascarenica. Pollen et Spores 24: 65-91.

Ridley, H. N. (1915). XIII. The botany of Gunong Tahan, Panang. Journal of the Federated Malay States Museums 6: 142.

Ridley, H. N. (1922). The Flora of the Malay Peninsula. L. Reeve & Co., Ltd., London.

Roxburgh, W. (1824). Flora indica; or, descriptions of Indian plants. The Mission Press, Serampore.

Salvosa, F. M. (1963). Lexicon of Philippine Trees. Forest Products Research Institute, College, Laguna, Philippines.

Sang, T., Crawford, D. J. & Stuessy, T. F. (1997). Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120-1136.

Savolainen, V., Fay, M. F., Albach, D. C., Backlund, A., van der Bank, M., Cameron, K. M., Johnson, S. A., Lledó, M. D., Pintaud, J.-C., Powell, M., Sheahan, M. C., Soltis, D. E., Soltis, P. S., Weston, P., Whitten, W. M., Wurdack, K. J. & Chase, M. W. (2000). Phylogeny of the eudicots: a nearly complete familial analysis based on rbcL gene sequences. Kew Bulletin 55: 257-309.

Schori, M. & Utteridge, T. M. A. (in press). Three new species and a new name in Southeast Asian Gomphandra (Stemonuraceae/Icacinaceae s.l.). Blumea

439

Schumann, K. (1900). Die Flora der Deutschen Schutzgebiete in der Südsee. Gebruder Borntraeger, Leipzig.

Schumann, K. (1905). Nachtrage zur Flora der deutschen Schutzgebiete in der Sudsee: mit Ausschluss Samoa’s und der Karolinen. Gebruder Borntraeger, Leipzig.

Seemann, B. (1864). New South Sea island plants. Journal of Botany, British and foreign 2: 74-75.

Shaw, J., Lickey, E. B., Beck, J. T., Farmer, S. B., Liu, W., Miller, J., Siripun, K. C., Winder, C. T., Schilling, E. E. & Small, R. L. (2005). The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: 142-166.

Sleumer, H. O. (1940). Beitrage zur kenntnis der Icacinaceen und Peripterygiaceen. Notizblatt des botanischen Gartens und Museums zu Berlin-Dahlem 15: 234-243.

Sleumer, H. O. (1969). Materials towards the knowledge of the Icacinaceae of Asia, Malesia, and adjacent areas. Blumea 17: 181-264.

Sleumer, H. O. (1971). Icacinaceae. Flora Malesiana Series 1. Vol. 7 (1): 1-63. Noordhoff-Kolff, Djakarta.

Sleumer, H. O., Engler, A. & Prantl, K. (1942). Icacinaceae. Die naturlichen Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten insbesondere den Nutzpflanzen, unter Mitwirkung zahlreicher hervorragender Fachgelehreten. Band 20b: 322-367. W. Engelmann, Leipzig.

Soltis, D. E., Senters, A. E., Zanis, M. J., Kim, S., Thompson, J. D., Soltis, P. S., Ronse De Craene, L. P., Endress, P. K. & Farris, J. S. (2003). Gunnerales are sister to other core Eudicots: implications for the evolution of pentamery. American Journal of Botany 90: 461-470.

Soltis, D. E., Soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Zanis, M. J., Savolainen, V., Hahn, W. H., Hoot, S. B., Fay, M. F., Axtell, M., Swensen, S. M., Prince, L. M., Kress, W. J., Nixon, K. C. & Farris, J. S. (2000). Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Botanical Journal of the Linnean Society 133: 381-461.

Stapf. (1894). II. On the flora of Mt. Kinabalu, in N. Borneo. Transactions of the Linnean Society of London, Second Series, Botany 4: 139.

Stevens, P. F. (2008). Angiosperm Phylogeny Website. Version 9, January 24, 2010. Accessed on: February 8, 2005. http://www.mobot.org/MOBOT/research/APweb/ 440

Supriatna, J., Manullang, B. O. & Soekara, E. (1986). Group composition, home range, and diet of the maroon leaf monkey (Presbytis rubicunda) at Tanjung Puting Reserve, Central Kalimantan, Indonesia. Primates 27: 185-190.

Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.

Tank, D. C. & Donoghue, M. J. (in press). Phylogeny and phylogenetic nomenclature of the Campanulidae based on an expanded sample of genes and taxa. Systematic Botany

Teo, S. P. & Haron, N. W. (1999 (1998)). Anatomical studies in West Malaysian Icacinaceae. Australian Systematic Botany 11: 729-738.

Thwaites, G. H. K. (1855). On Urandra, a new genus of Olacaceae, and some other Ceylon plants belonging to that natural order. Hooker’s Journal of Botany and Kew Garden Miscellany 7: 211-212.

Thwaites, G. H. K. (1858). Enumeration Plantarum Zeylaniae. Dulau & Co., London.

Thwaites, G. H. K. (1864). Enumeration Plantarum Zeylaniae. Dulau & Co., London.

Trimen, H. (1931). A Hand-book to the Flora of Ceylon. Dulau & Co., London.

Utteridge, T. M. A. & Schori, M. (2009). Stemonurus corrugatus (Stemonuraceae, Icacinaceae s.l.) a new species from Sarawak. Kew Bulletin 64: 327-331.

Valeton, T. (1886). Critisch Overzicht der Olacineae. P. Noordhoff, Groningen.

van Staveren, M. G. C. & Baas, P. (1973). Epidermal leaf characters of the Malesian Icacinaceae. Acta Botanica Neerlandica 22: 329-359.

van Tieghem, P. (1897). Sur les phanérogames sans graines, formant la division des inséminées. IV. Sur les inséminées a nucelle pourvu d’un seul tégument, formant la subdivision des Unitegminées ou Icacinées. Bulletin de la Société Botanique de France 44: 99-139.

Voigt, J. O. (1845). Hortus Suburbanus Calcuttensis. Ravendra Pal Singh Gahlot, Dehra Dun, India.

Weckerle, C. S. & Rutishauser, R. (2005). Gynoecium, fruit and seed structure of Paullinieae (Sapindaceae). Botanical Journal of the Linnean Society 147: 159-189.

441

Wight, R. (1840). Illustrations of Indian Botany. J. B. Pharoah, Madras.

Wight, R. (1844-1845). Icones Plantarum Indiae Orientalis. Vol. 3: Figures 953-955. J. B. Pharoah, Madras.

Williams, K. D. & Petrides, G. A. (1980). Browse use, feeding behavior, and management of the Malayan tapir. Journal of Wildlife Management 44: 489-494.

Winkworth, R. C., Lundberg, J. & Donoghue, M. J. (2008). Toward a resolution of Campanulid phylogeny, with special reference to the placement of Dipsacales. Taxon 57: 53-65.

Zumbroich, T. (2009). ‘Teeth as black as a bumble bee's wings’: The ethnobotany of teeth blackening in Southeast Asia. Ethnobotany Research and Applications 7: 381-398. 442

Appendix 1. GenBank Accession Numbers for Taxa used in Alignments and Analyses.

Taxon Gene Region GenBank accession number Cardiopteris quinqueloba rbcL AJ402936 ndhF AJ312963 Cassinopsis ilicifolia ndhF AJ312951 Cassinopsis sp. ndhF AJ312962 Citronella gongonha ndhF AJ312946 Citronella moorei ndhF AJ312971 Discophora guianensis ndhF AJ312964 Emmotum nitens ndhF AJ312965 Gomphandra javanica rbcL AJ402954 Gonocaryum litorale ndhF AJ400889 Grisollea myrianthea ndhF AJ312955 Helwingia japonica ndhF AF130207 Icacina mannii ndhF AJ400888 Icacina senegalensis ndhF AJ429111 Icacina senegalensis ndhF AJ312957 Ilex aquifolium trnL, trnL-F FJ394731 matK AF542607 Ilex canariensis rbcL X98727 Ilex cornuta ndhF GQ997315 Ilex crenata ndhF AF130206 Ilex goshiensis rbcL AF471640 Ilex repanda ndhF AY725870 Iodes liberica ndhF AJ312947 Irvingbaileya australis rbcL AF156733 ndhF AJ236255 Lasianthera africana ndhF AJ312948 Leptaulus citroides ndhF AJ312961 Leptaulus daphnoides ndhF AJ312954 Mappia racemosa ndhF AJ312959 Natsiatum herpeticum ndhF AJ312969 Nothapodytes foetida ndhF AJ312960 Ottoschulzia pallida ndhF AJ312966 Pennantia corymbosa ndhF AJ312949 Pennantia cunninghamii ndhF AJ312970 Phyllonoma laticuspis ndhF AF130208 Phytocrene oblonga ndhF AJ312968 Pyrenacantha grandifolia ndhF AJ312956 Pyrenacantha malvifolia ndhF AJ312952 Raphiostylis beninensis ndhF AJ312958 Stachyanthus zenkeri ndhF AJ312967 443

Appendix 2. Alignments.

A. rbcL alignment. Ig = Ilex goshiensis (GenBank); Ic = Ilex canariensis (GenBank); Ca = Cardiopteris quinqueloba (GenBank); Ir = Irvingbaileya australis (GenBank); Co = Codiocarpus merrittii (Jodrell Lab); Gm = Gomphandra mappioides; Gj = Gomphandra javanica (GenBank); Gl = Gomphandra luzoniensis (Jodrell Lab).

1 - 109 Ig ATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGAATATGAAACCAAAGATA Ic ...... A...... C...... Ca ------...... T..G....A.....A...... K..G..Y...... R.... Ir ------...... A...... A...... Co ------...... -...... A-...... A...... Gm ------.A-...... A...... Gj ------...... A.....C...... A...... A...... Gl ------TCAGCT.GTG...-...... A-....A...... A......

110 - 209 Ig CTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC Ic ...... Ca ...... A...... G..C...... T..A...... M...... Ir ...... A...... C...... Co ...... A...... C...... Gm ...... A...... C...... Gj ...... N...... A...... C...... Gl ...... A...... C......

210 - 309 Ig AACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCAAATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTAT Ic ...... A...... Ca ...... Y...... Y...... R...... Y..C...... G...... G...... A...... Ir ...... TC...... C....C...... A...... Co ...... TC...... C....C...... A...... Gm ...... TC...... C....C...N...... A...... Gj ...... TC...... C....C...... A...... Gl ...... TC...... C....C...... A...... 444

310 - 409 Ig GTAGCTTACCCATTAGATCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC Ic ...... T...... Ca ...... T...... C...... R...... C...... Y.....C...... A...... Ir ...... C...... C...... C.... Co ...... C...... C...... C.... Gm ...... C...... C...... C.... Gj ...... C...... C...... C.... Gl ...... C...... C...... C....

410 - 509 Ig GTCTGGAAGATTTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG Ic ...... Ca ...... R...C...... C...R.....TTC...... T...... Y..T...... R...... G...... Ir ....A...... A...... Co ....A...... Gm ....A...... A...... Gj ....A...... NNNNN...... Gl ....A...... A......

510 - 610 Ig TCCCCTGTTGGGATGTACTATTAAACCGAAATTGGGATTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTACGCGGTGGACTTGATTTTACC Ic ...... Ca ...T..C...... A...... R.....Y...... Y...... G...... G.....Y...... Ir ...... T...... G.....C...... T..T...... Co ...... T...... G.....C...... T..T...... Gm ...... T...... G.....C...... G...... T..T...... Gj ...... T...... G.....C...... G...... T..T...... Gl ...... T...... G.....C...... G...... T..T...... 445

610 - 709 Ig AAAGATGATGAGAATGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCGTATTTT-GTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGT Ic ...... T...... -...... Ca ...... A..N..N..Y..A...... Y...... K.C....-...... T...... N..Y...... Ir ...... T..T...... -...... C...... G... Co ...... T..T...... T...... C...... G... Gm ...... T..T...... -...... C...... ------Gj ...... T..T...... -...... C...... G... Gl ...... T..T...... -...... C...... G...

710 - 809 Ig GAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGC Ic ...... T...... G...... Ca ...... T.....G...... R...G...... Ir ...... A...... T...... C...... G...... Co ...... A...... T...... C...... G...... Gm ------Gj ...... T...... C...... G...... N...... Gl ...... A...... T...... C...... G......

810 - 909 Ig ATGACTACTTAACAGGGGGATTTACTGCAAATACTACCTTAGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGT Ic ...... Ca ...... G...... C...... R...G...... T...... Ir ...... G.C.G...... A...... Co ...... G.C.G...... A...... Gm ------Gj ...... G.C.G...... C...... N...... A...S...... M....G.. Gl ...... G.C.G...... A...... 446

910 - 1009 Ig TATTGATAGACAGAAGAATCATGGGATGCACTTTCGTGTACTAGCTAAAGGGTTACGTATGTCTGGTGGAGATCATATTCACGCCGGTACCGTAGTAGGT Ic ...... C...... Ca ...Y...... T...... Y..Y...... CA...... A...... T...... Ir ...... T...... C...... T...... A...... Co ...... T...... C...... T...... A...... Gm ------Gj ...... A..G...... T...... C...... G...... A...... Gl ...... T...... C...... T...... G...... A......

1010 - 1109 Ig AAACTTGAAGGGGAAAGGGAGATCACTTTGGGATTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAG Ic ...... T...... G...... Ca ...... A.....A..T.....C..A..C...... C.A...... G...... Y...... R. Ir ...... A..C..G...... C...... C...... G...... T....CA..... Co ...... A..T..G...... C...... C...... G...... T....CA..... Gm ------Gj ...... A.....A..C..G...... AC...... C...... G...... T....CA..... Gl ...... A..C..G...... C...... C...... G...... T....CA.....

1110 - 1209 Ig ATTGGGTCTCTCTACCAGGTGTTCTGCCCGTGGCTTCGGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATGCCGTACT Ic ...... T...... Ca ...... N..Y...... A...... A...... T...... Ir ...... T...... A..G...... C...... T...... Co ...... T...... A..G...... C...... T...... Gm ------Gj ...... T...... A..G...... A.....C...... T...... Gl ...... T...... A..G...... C...... T...... 447

1210 - 1309 Ig ACAGTTCGGTGGAGGAACTTTAGGCCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAG Ic ...... Ca C..A..T...... A...... A.....Y...... C.....R Ir ...... A...... Co ...... A...... Gm ------Gj ...... C...... C...A..T...... C.G...... Gl ...... A......

1310 - 1409 Ig GGGCGTGATCTTGCTCGTGAGGGTAATGAAATTATCCGTCAGGCTAGC------Ic ...... G....------Ca ..A...... A...... Y...G...... N.AAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAARGAGATCRWAT Ir ..A...... G.A...... AAAT------Co ..A...... G.A...... AAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAAGCGATCAAAT Gm ------Gj ..A...... G.A....A.AAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCGTAT Gl ..A...... GA..TAC------448

1410 - 1475 Ig ------Ic ------Ca TTGAATTY-TGCAAGCGAGTGGATACGTTT------Ir ------Co TTGAATTTGAAGCCGTGGATAAATTAGATGTAGTAGCAAAGTAGATCAAATTTTAATTTGTGGCAATGGATAC Gm ------Gj TTAATTTTGCAGCAGTGGACGTTTTGGAT------Gl ------449

B. ndhF alignment of Aquifoliales genera only, all sequences from GenBank. Di = Discophora guianensis; Gr = Grisollea sp.; Ir = Irvingbaileya australis; La = Lasianthera africana; Ca = Cardiopteris quinqueloba; Ph = Phyllonoma laticuspis; He = Helwingia japonica; Iu = Ilex cornuta; Ic = Ilex crenata; Ip = Ilex repanda.

1 - 109 Di ------TAATACCTTTCGTTCCACTTCCAGTTCCTTTGTTAATAGGAATAGGACTTATTCTTTTTCCGACGGCAACAA Gr ------GA...... Ir ------...... La ------GA....G...... A...... G...... Ca ------GA...... C...... A...... G.G...... C...... Ph ------GA....C..CC...... C...... A.....A...... G.G...... C...... A...... He ATGGAACAGACATATCAATATGCATGGA...... G...... A...... G.G...... C...... Iu ATGGAACAGACATATCAATATGCATGGA...... C...... A...... GG.G...... C...... C...... Ic ATGGAACAGACATATCAATATGCATGGA...... C...... A...... GG.G...... C...... C...... Ip -----ACATACATATGAATATGCGTGGA...... C...... A...... GG.G...... C...... C......

110 - 209 Di AAAATCTTCGTCGCGTGTGGGCCTTTCATAGTGTTTTATTGGTAAGTATAGTCATGATTTTTTCGATTGATGTATCTATTCATCAAATAAATAGTAGTTC Gr ...... A...... Ir ...... La ...... A...... T...... A...... Ca ...... TA...... T...... AT...... CAG...... G...... C.... Ph ...... TA...... T...T...... G....G..T...... C.G...... TG...... G.... He ...... A...... TA...... C...... G...... T...... C...... C.G...... G.....C.....C..... Iu ...... TA.....T...... A...... T...... C.G...... G...... C..... Ic ...... TA.....T.T...... A...... T...... C.G...... G...... C..... Ip ...... TA.....T...... A...... T...... C.G...... G...... C..... 450

210 - 309 Di TATCTATCAATATGTATGGTCTTGGGTCATTACTGATGATTTTTCYTTAGAATTTGGCTACTTAATTGATCCACTTACTTCTATTATGTCAATATTAATT Gr ...... C Ir ...... C La ...... Y...... C Ca ...... A..A...... Y..W...... C Ph ...... C...... C.T.A...... C He ...A...... A....C..GA...... C...... C Iu ...... A....C...A...... C...... C Ic ...... A....C...A...... C...... C Ip ...... A....C...A...... C...... C

310 - 409 Di ACTACTGTTGGAGTTATGGTTCTTATTTATAGTGATAATTATATGTCTCATGATCAAGGGTATTTAAGGTTTTTTGCTTATATGAGTCTTTTCAGTACTT Gr ...... G...... A...... Ir ...... A...... G...... La ...... A..G.....A.G...... G...... Ca ...... N...A.N.....N...... N..N.C.....NN...... A...N.G..A...... N...... N...... N..C. Ph ...... A..CC...... A.....G..A...... T...C...... He ...... A.G...... C...... A.....G..A...... T...... Iu ...... A...... A...G....A...... T...... Ic ...... A...... A...G....A...... T...... Ip ...... A...... A...G....A...... T......

410 - 509 Di CTATGTTGGGATTAGTTACCAGTTTGAATTTGATACAAATTTATATTTTTTGGGAATTGGTTGGAATGTGTTCGTATCTATTAATAGGGTTTTGGTTCAC Gr ...... A...... T.. Ir ...... T...... La ...... G....CT...... Ca .C...... T....CT...... N.N...... A..C...... Ph .G...... TT....CT...... A...... He .C...... T....CT...... A..G.....A.....C...... Iu .C...... T....CT...... A...... Ic .C...... T....CT...... A...... Ip .C...... T....CT...... A...... 451

510 - 609 Di ACGACCTGTTGCGGCAAATGCTTGTCAAAAAGCTTTTGTAACTAATCGTGTCGGGGATTTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACA Gr ...... Ir ...... T La ...... C...... G...... Ca ...... T...... C...... Ph ...T...... G...... C...... A.A...... C...... C He ...... C...... G...... Iu ...... C...... Ic ...... C...... Ip ...... C......

610 - 709 Di GGTAGTTTTGAATTTAGGAATTTATTCGAAATATTCAATAACCTGATTTATAACAATCAGGCCAATTTTTTATTTGTTACTTTGTGTGCCGTTCTAGTAT Gr ...... T...... G...... Ir ...... C...... T...... C...... La ...... T.C...... T...... T... Ca ..G..C...... C..G...... T...... T...... G..AT.C...... A..T.GT... Ph ...... G...... A...... A...A....T...G...T...C...... A...... T... He ...... C...... G...... T...... CG..T...G...T...... G...... A...... T... Iu ...... G...... T...... T...G...T...... G...... T... Ic ...... G...... T...... T...G...T...... G...... T... Ip ...... G...... T...... T...G...T...... C...... G...... T...

710 - 809 Di TTTCCGGTGCAGTTGCTAAATCTGCACAATTTCCCCTTCATGTGTGGTTACCTGATGCCATGGAAGGGCCTACTCCCATTTCGGCTCTTATACATGCTGC Gr ...G...... C...... A...... Ir ...... C...... A...... La ...... C...... Ca ..G.T...... G...... A...C....C...... G..A...... T...... C...... Ph ..GT...... C...... G...... A...... A...... T.....C...... He ....T...... C...... A...... A...... T.....C...... Iu ..G...... C...... A...... G...... A...... T...... Ic ..G...... C...... A...... G...... A...... T...... Ip ..G...... C...... A...... G...... A...... T...... 452

810 - 909 Di TACCCTGGTAGCAGCGGGAATTTTTCCTGTAGCTAGACTTCTTCCTCTTTTCATAGTAACACCTTCCATAATGAATTTAATCTCTTTGATAGGGATAATA Gr ....A...... T...... C...... Ir ...... T...... T...... C...... La ...TA...... G...... T...... C...... A...... C...... T...... Ca ...TA...... A...... T...... C...... T.T.....M...... KY..T...... T...... Ph ...TA...... G.....G...... T...C..GC.C...T....CT...... T.T.....T...... T...... He ...TA...... G...... T...C..GC.G...G...... C.T...... Iu ...TA...... T...C..GC.G...T....C...... C.T...... C...... G....A...... Ic ...TA...... T...C..GC.G...... C.T.....T.C...... G....A...... Ip ...TA...... T...C..GC.G...T....C...... C.T...... C...... G....A......

910 - 1009 Di ACAGTATTATTTGGAGCTACTTTAGCTCTTGCTCAAAAAGACATTAAAAGAGGTTTAGCCTATTCGACAATGTCTCAATTAGGTTATATGATGGTAGCTC Gr ...... Ir ...... G...... C....NNNNNNNNNNNNNNNNNNNNNN..... La ...... T...... Ca ..G...... G...... T.....G..G...... T...... T...... Ph ...A...... A.....C..C...... T...... C...... T...... He ...... C....A...... T.....G...... C...... T...... Iu ...... T..A...... T.....G...... C...... T...... Ic ...... T..A...... T.....G...... C...... T...... Ip ...... T..A...... T.....G...... C...... T......

1010 - 1109 Di TAGGTATGGGGTCTTATCGAAATGCTTTATTTCATTTGATTACTCATGCTTATTCAAAAGCATTATTGTTTTTAGGATCCGGATCTATTATTCATTCAAT Gr ...... G...... Ir ...... G...... La ...... G...... Ca ....C...... G...... A...... G...... Ph ...... A..G.T...... A...... G...... T.....CG...... He ...... A..G...... G...... A...... T.....CG...... Iu ...... A...... A..G...... G.....C...... T.....CG...... Ic ...... A...... A..G...... G.....C...... T.....CG...... Ip ...... A...... A..G...... G.....C...... T.....CG...... 453

1110 - 1209 Di GGAAACGGTTGTTGGATATTCTCCAGATAAAAGTCATAATATGGTTCTTATGGGAGGTTTAACAAAACATTTACCCCTTACAAAAACTGCTTTCTTATTA Gr ...... T...... Ir ...... A...... La ...... G...... G...... Ca ...... TA...... A...... AG...... A....AA...... T...... Ph ...... TC...... A...... G...... G...... G.G..AA....C....A.T....T..G... He ...... TC...... G...... G...... G.G..AA....C....A...... T...... Iu ...... TC...... G...... G...... G.G..AA....C....A...... T...... Ic ...... TC...... G...... G...... G.G..AA....C....T...... T...... Ip ...... TC...... G...... G...... G.G..AA....C....A...... T......

1210 - 1309 Di GGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCCTGTTTTTGGTCCAAAGATGAAATTCTTAATGATAGTTGGTTGTATTCACCGGTTTTCGCAATAA Gr ...... Ir ...... La ...... G...... Ca ...... G...... T...... C...... A.....G...A....T...... Ph ...... T...A....T...... C...... A....T...... He ...... G...... T...... C...... CC...... A...... Iu ...... C...... G...... T...... C...... C...... Ic ...... C...... G...... T...... C...... C...... Ip ...... C...... G...... T...... C...... C......

1310 - 1409 Di TAGCTTGGTTTACAGCGGGATTGACTGCATTTTATATGTTTCGGATTTATTTACTTACTTTTGGGGGGCATTTAAATGCTCATTTTCAATATTACAGCGG Gr ...... T...... Ir ...... La ...... A...... C...... A...... Ca ...... C...... A.....A..C...... K...... C...... AA...... AT...... A..A...... AT.. Ph ....G....CC...... A..C...... AA..A...... C.T...... A....T..T.. He ....G....CC...... A..C...... C...... G..C...AA...... C.T...... A....T..T.. Iu ....G....CC...... A..C...... C...... AA...... C.T...... A....T..T.. Ic ....G....CC...... C.T..A.AC.T....A...... C...... C...... G..C...AA...... C.T...... A....T..T.. Ip ....G....CC...... A..C...... C...... AA...... C.T...... A....T..T.. 454

1410 - 1509 Di CAAAAAAAACACTCCCTTCTATTCAATATCTATATGGGGTAAAGTAGGTGCAAAAGATATTAACCAAAATTTTCGTTTA------TTCCCCTTA Gr ...... A...... C....------...... Ir ...... TG...... A...... ------..A...... La ...... CT...... A...T...... ------...... Ca A...... TG.C...... C...... G.A..A.T.C...AGG...... A...T....T.....------..AA.A--- Ph A...... G...A.A...... C.....C...... A.C..T.GC..ATA.....GA.....------.CTTGT... He A..C.....T.....A...... C...... G.GG...T.GGGG.CG.....AA....------.------A.TAAT... Iu A...... T.....A...... C...... A..G.GG.A.T.G.G..GG...... AC...... ------..AAGT... Ic A...... T.....A...... C...... A..G.GG.A.T.G.G..GG...... AC...... ------..AAGT... Ip A...... T.....A...... C...... A..G.GG.A.T.G.G..GG...... AC...... A....------..AAGT...

1510 - 1609 Di TTAACA------ACGAATAGTAAGG----AAAATGC------TTCCTTTTTTTCAAAGAAGACA------TATCGAATTGATGAAAATGCCAGAAAGATG Gr ...... ------...... C.....----...... ------...... ------...... T...... Ir ...... ------...... C.....----...... ------...T...... ------...... T...... La ...... ------.G.....C...CA----...... ------....C...... ------...A...... C..TA...... G.. Ca ------GT.....A...CA----.G.G.A.------...... C...... ------G..AA...... G....AA...... A Ph ...... ------.T.....A...------..G.TA------...T..G.....GTT...A..C------..C.....C.....G....TA...... He ..CC..------.T.....A.C.------.GT...------...T..GAAAA...... ------..C...... G....TA.....C... Iu ...CG.------.T.....A...------...... ------...T..GAAAA....A...... ------..C...... G....TA.....C.G. Ic ...CG.------.T.....A...------...... ------...T..GAAAA....A...... ------..C...... G....TA.....C.G. Ip ...CG.------.T.....A.C.------...... ------...T..GAAAA....A...... ------..C...... G....TA.....C.G.

1610 - 1709 Di AGACGACCTTTTATTACTATTA------CTCATTTTGACAAAAA------AAAGACTTATTCGTATCCTTATGAAGCGGACACTACTATGTTATTGT Gr .C...... ------...... ------...... C Ir .C....G...... ------...... ------...... ------La .C..A...C...... ------...... ------...... C Ca CT..A...... ------.C...... C....T..------..G.....T...... T.A....A...... TC Ph .C..A....G.C..A...... ------...... T..------...... C.T..T...... T.A....A...... TC He .C..A....G.C..G...... ------.C...... G...T..------...... T...... T...... A...... CC Iu .C..A....G.C..G...... ------.C...... G...T..------...... T...... T...... A...... CC Ic .C..A...... G...... ------.C...... G...T..------...... T...... T...... A...... CC Ip .C..A....G.C..G...... ------.C...... G...T..------...... T...... T...... A...... CC 455

1710 - 1809 Di CTTTACTTCTATTGATTCTGCTTACTTTGTTCGTTGGATTCTTAGGAATTCCTTTCAATCAAGA---AG---GAACGGATTTGGATATATTATCAAAATG Gr ...... G...... AT...... R.....Y...... ---..---..G...... Ir ------La ...... G...... AT...... G...... ---..---..G.T...... Ca ..C.....G.....G..T.AT...... T...... A...... C..G..---..---.GGT...... T...... Ph .AA.....G.....GGAT.AT...... A...... C...... GGG.CAAT.GG.A...... C..... He ..C..T..A.....G....AT...... C...... C...... CGG.------GT.T...... C..... Iu ..C...... G....AT...... C...... A.AGG.------GT...... C..... Ic ..C...... G....AT...... C...... A.AGG.------GT...... C..... Ip ..C...... G....AT...... C...... A.AGG.------GT...... C.....

1810 - 1909 Di GTTAACTCCGTCTATAAACCTTTTACATCAAAATTCGACTAATTCGATAGATTGGTATGAATTTTTGAAAGATGCGGCTTTTTCAGTAAGCATAGCTTAT Gr ...... A...... Ir ------La ...... G...... A.T...... Ca ...G...... T.CC...... TA..C...... A....AAT...... T..T...... T. Ph ...... T..G..C...... G...... T.A...... C.CG.G...... G.C...... TAT...... C..T...... He ...... C...... GG...... T..A.G...... CG.G...... G.C...... T.G...... A.C..T...... Iu ...... T...... CG...... A...... C.AG...... G.C...... TT.G...... G..T...... Ic ...... T...... CG...... A...... C.AG...... G.C...... AA.G...... G..T...... Ip ...... T...... G...... A...... C.AG...... G.C...... T.G...... G..T......

1910 - 2009 Di TTCGGAATAGTTATAGCGTCCTTTTTATATAAACCTGTTTATTCATCTTTACAAAATTTAGACTTAATTAATTCATTTGTTAAAAGA------GGGCCTA Gr ...... G...... C.------...... Ir ------La ...... T...... A...... G...... C.------...... Ca .GG...... T...... A...... C...... G...... T...... ------...... Ph ..A...... A...... G...... G...... G...... G...... C.------..T.... He ..A...... T...... A.A...... C.....G...... G...... C.------..T.... Iu ..A...... T...... C...... G...... C.------..T.... Ic ..A...... T...... C...... G...... C.------..T.... Ip ..A...... T...... C...... G...... C.------..T.... 456

2010 - 2109 Di ACASAATTCTTTGGGACAMAATAATAAATGGCATATATGGG------Gr ...... TTGGTCATATAATCGTGGTTACATAGATACTTTTTTTTCGACATTATTAACGGGGGGGAT Ir ------La .G...... TTGGTCATATAATCGTGGTTACATAGATACTTTTTTTTCGAAATTCTTAACTGGGGGGAT Ca .T...... A...T...... C...... ATTGGTCAGATAATCGGGCTTCCATAGA------Ph .A....C...... C....T...... TTGGTCATATAATCGTGGTTACATAGATTCTTTTTATGCAACATCCTTAACTGGAGGGAT He .T....C....A...... TG...... TTGGTCATATAATCGTGGTTACATAGATACTTTTTATGCAACATCCTTAACTGGGGGGAT Iu .G....C...... T...... A.CTGGTCATATAATCGTGGTTACATAGATGCTTTTTATGCAAGATCCTTAACTGGGGGAAT Ic .G....C...... T...... A.CTGGTCATATAATCGTGGTTACATAGATGCTTTTTATGCAAGATCCTTAACTGGGGGAAT Ip .G....C...... T...... A.CTGGTCATATAATCGTGGTTACATAGATGCTTTTTATGCAAGATCCTTAACTGGGGGAAT

2110 - 2209 Di ------Gr AAGGAAATTAGCTGAATTAACTCATTTTTTTGATAGACGGATAATTGATGGAATTTCGAATGGAATTGGTGTTATGAGTTTCTTTATAGGAGAAGGTATC Ir ------La AAGGAGATTAGCTGAATTAACTCATTTTTTTGATAGACGAATAATTGATGGAATTACGAATGGAATTGGTGTTATGAGTTTCTTTATAGGAGAAGGGATT Ca ------Ph AAGGGGACTGGCTGAATTAAGTCATTTTTTTGATAGACGAGTAGTTGATGGAATTACAAATGGCATTGGGGTTATGAGTTTCTTTGTAGGAGAAGGTATC He AAGGGTACTGGCTGAATTAACTCATTTTTTTGATAGACGAGTCATTGATGGAATTACAAATGGAGTTGGTGTTATGAGTTTCTTTGTAGGAGAAGGTATC Iu AAGGGGATTGGCTGAATTAACTCATTTTTTTGATAGACGAGTAGTTGATGGAATTACAAATGGAGTTGGTGTTATGAGTTTCTTTGTAGGAGAAGGTATC Ic AAGGGGATTGGTGAAATTAACTCATTTTTTTGATAGACGAGTAGTTGATGGAATTACAAATGGAGTTGGTGTTATGAGTTTCTTTGTAGGAGAAGGTATC Ip AAGGGGCTTGGCTGAATTAACTCATTTTTTTGATAGACGAGTAGTTGATGGAATTACAAATGGAGTTGGTGTTATGAGTTTCTTTGT------

2210 - 2309 Di ------Gr AAATCGGTAGGGGGAGGGCGCATTTCTTCTTACCTTTTCTTGTATTTATCTTATGTATCAATCTTTTTATTAATTTATTCCTTTTTGTTTTGA------Ir ------La CAAATCGGTAGGGGG------Ca ------Ph AAATCTGTAGGGGGCGGACGCATCTCTTCTTATCTTTTCTTATATTTCTCTTATGTATCAATCTTTTTATTAATTTACTACTTGCTACTTTTTCA-TCTA He AAATCGGTAGGGGGTGGGCGCATCTCTTCTTATCTTTTCGTGTATTTATCTTATGTATCAATTTTTTTATTAATTTCCTACTTGTTAATTTTTGAATCTA Iu AAATCTGTAGGGGGCGGGCGCATCTCTTCTTATCTTTTCTTGTATTTATCTTATGTATCAATCTTTTTATTCATTTACTCTTTGTTATTTTTTGAATCTC Ic AAATCTGTAGGGGGCGGGCGCATCTCTTCTTACCTGTTCTTGTATTTATCTTATGTATCAATCTTTTTATTCATTTACTCTTTGTTATTTTTTGAATCTC Ip ------457

2310 - 2321 Di ------Gr ------Ir ------La ------Ca ------Ph TAA------He TAATAAAAATCATTCATTTTTAA Iu TAAGAAAAATCTTTTATTTTTAA Ic TAAGAAAAATCTTTTATTTTTAA Ip ------458

C. matK alignment. Ga = Gomphandra australiana; Gf = Gomphandra fernandoi; Gv = Gomphandra flavicarpa; Gj = Gomphandra javanica (GenBank); Gl = Gomphandra luzoniensis; Gm = Gomphandra mappioides; Go = Gomphandra oligantha; Gp = Gomphandra psilandra, Sa = Stemonurus ammui; Ia = Ilex aquifolium (GenBank).

1 - 109 Ga ------Gf ------Gv ------Gj ------Gl ------Gm ------...... Go ------Gp ------Sa ------Ia TCATTCATGATTAACCAAATCATTGATACAAATAATATCCAAATACCAAATCCGCCTTCTATATAACCGCCGTAAAGTAGAAG..TA.T.T..A.....C

110 - 209 Ga ------Gf ------Gv ------Gj ------Gl ------Gm ...... Go ------Gp ------Sa ------Ia ..A...... TT...... C.T....G...... T.A...... T...... T...T...... 459

210 - 309 Ga ------GGATCCACTATGATAATGAAAAAGATTTCTG-CCTATAC Gf ------...... A...... -.A..... Gv ------...... -A...... Gj ------.....G...... -...... Gl ------CTCT...... A...... -.A..... Gm ...... -...... Go ------T...... NA...... -.A..... Gp ------.....NN...... G...... Sa ------Ia .GT.CTA.TACA.GA...TC...... -TA.....

310 - 409 Ga GCCCAANTCGGCCAATAATATCCGAATCGGATAAATCGGCCNGAACCGGTTTACTAATGGGATGCCCCAATACGTTACAAAATTTAGCTTTAGCTAATGA Gf ...... T...... Gv ...... T...... T...... Gj ...... Gl ...... T...... Gm ...... Go ...... N...... T...... Gp ...... Sa ------Ia ...... AT...... A.....T...... A...... T...C...... C..T..C..C..C..

410 - 509 Ga TCCAATCAGAGGAATAATTGGAACATTGGTATCGAACTTCTTAATAGCATTATCAATTAGAAATGCATTTTCTAGCATTTGACTCCAGACCAGTAAAGTA Gf ...... N...... Gv ...... Gj ...... Gl ...... Gm ...... Go ...... Gp ...... Sa ------Ia ...... CC..A...... G...... T...GT....T.....G. 460

510 - 609 Ga TTTAGTTGCACACTTGAAAGATAACCCAGAAAGTCGAGAGAATAATCTGGATAATTGGTTTATCTGGATCCTTCCTGCTTGAGGCCATAGGTAAAAA-TA Gf ...... C...... -...... -.. Gv ...... C...... -...C...... -.. Gj ...... C...... -...... -.. Gl ...... C...... -...... -.. Gm ...... -...... Go ...... C...... -...... -.. Gp ...... C...... -...... -.. Sa ------...... -.N Ia ...... C.C...... A...G....T...... A...T...... -....A...... A.....T...... G.....A...C...... -..

610 - 709 Ga ACATTGCCAGAAATTGACAAGGTAATATTTCCATTTATTT-ATCAAAAGACCGGTCCCTTTTGAAGCCAGAAAAATTTTTCCTTGATACCTAACATAATG Gf ...... -...... Gv ...... -...... Gj ...... -...... Gl ...... -...... Gm ...... Go ...... -...... Gp ...... -...... Sa N..N...... -...... N...N...... N...... Ia ...... G...... C-...... GAC...... TTGA....T......

710 - 809 Ga CATCAAGGGGTCTTCGAACAACCATATGTTGACCTGAAAAGCCTTAGCAAAGACTTCTACAAGATGTTCTATTTTTT-CATAGAAATAT-ATTCGTTCAA Gf ...... A...... N...... N...... N...N...... N...... T...... -...... Gv ...... -...... -...... Gj ...... -...... -...... Gl ...... N...N...... T...... N....-...... Gm ...... -...... -...... Go ...... T..NN...... -...... Gp ...... -...... -...... Sa ...... -...... -...... Ia T..G..A..A..C.T...... G...... A...... C-...... -...... 461

810 - 909 Ga GAAAGGCTCCAGAAGATGTTGATCGTAAATGAAAAGATTGGTTACGGAGAAAAACGAAGATGGATTCGTATTCACATACATGAGAATTATATAGGAAGAA Gf ...... N...... Gv ...... N...... Gj ...... Gl ...... Gm ...... Go ...... N...... Gp ...... Sa ...... N...... Ia ...GAA...... G...... A...... A...... A......

910 - 1009 Ga AACAAATCTTTGATTCATTTTTGAAAAAGAAGACCTAAGTTTCGTTGAAATAATAAGACTATTCAAATTACGATATTCGTGAATAAAGAATCGTAATAAA Gf ...... NN...... C...... N...... Gv ...... A...... Gj ...... Gl ...... N...... Gm ...... Go ...... N...... N...... A...... N...... Gp ...... C...... A...... Sa ...... T...... G... Ia ..AG...... TC...... A.CGG.....TG....G...... C...... CC....AG.G......

1010 - 1109 Ga TGCAAAGAGGAAGCATCTTTTATCCAGCATCGAAGAGTTTGAACCAAGATTTCCAGATGGGTAGGG-TGAGGTATTAATATATCTAACACAGAATAAAAA Gf ...... -...... Gv ...... T...... G...... G..... Gj ...... A...... C....T.G...... -...... Gl ...... -...... Gm ...... -...... Go ...... -...... Gp ...... N...... -...... Sa ...... -...... Ia ...... A....T...... C....T.A...... ACG...-..G...... G...... T...TT... 462

1110 - 1209 Ga TGTGACAAATTGTCCTCTAAAAAAGGAAATATTGAATGAATTGATCGTAAATTATGAATTTTCTTATTGTTTT---CCCTTCTAGGGAAGATATTAATCG Gf ...... A...... T...... T...... C...... ---.....N...... Gv ...... G...... T...... T...... ---.....N...... Gj ...... A...... T...... ---...... Gl ...... A...... T...... T...... C...... ---...... Gm ...... -...... ---...... Go ...... A...... T...... T...... C...... ---...... Gp ...... A...... T...... T...... TTT...... Sa ....N...... A..A...... T...... T...... G...... ---...... Ia ...A.A..T..A...... A...... T...... T...... CTC...---......

1210 - 1309 Ga TAGAAAAAATGGAATTTCCACAATGACTACAAATCCCCCTGATATCATTTTCATTTGAGAATACAAATTTGTGATTGCGACCAAAAAATGGATTTTTATT Gf ...... N...... N...... -...... Gv ...... N...... C...... -....N...... Gj ...... C...... -...... Gl ...... C...... -...... Gm ...... -...... Go ...... C...... -...... Gp ...... C...... -...... Sa ...... C...... -...... Ia ..C.G...... G...... TC...... ------...... CT.-...... C...... T.TT.....GG..

1310 - 1409 Ga AGGATTATGAGCCGAAAGAATCAAATGATTCTGTTGATACATTCGAGTAATTAAACGTTTCACAATTAATAAGCTGAGTTTATTGTCATACCCTGCATTT Gf ...... N...... Gv ...... Gj ...... Gl ...... G...... Gm ...... Go ...... Gp ...... Sa ...... N...... A...... Ia ..A..C..T..T...... G...... GA...... A...... 463

1410 - 1509 Ga TCCAAGAAAATCGATCCCTTTAAAATGAAACCATGATCAGGAGCAAATGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTCGTGTTGTTGAG Gf ...... T....T...... A..CGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTTGTGTTGTTGAG Gv C...... T...... N...... A..NGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTCGTGTTGTTGAG Gj ...... T...... A..TGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTCGTGTTGTTGAG Gl ...... T....T...... A..TGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTTGTGTTGTTGAG Gm ...... ------Go ...... T....T...... A..NGCATAAATATACTCNTGAAAGATAAGTGGAGATAGGAAGTTGTGTTGTTGAG Gp ...... T....T...... A..TGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTCGTGTTGTTGAG Sa ...... A..T....T...... A..TGCATAAATATACTCCTGAAAGATAAGTGGAGATAGGAAGTCGTGTTGTTGAG Ia .T...C...... TA..T...------...... A.GTGCATAAATATACTCCTGAAAGATAAGTGGATATAGAAAGTCGTGTTGTTGAG

1510 - 1597 Ga ATCTATCTAGATCTAAATATCTTTGGAANTCTTCCATTATAGGATTGAACCAAAAG------Gf ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGATTGAACC------Gv ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGATTGAACCAAAAG------Gj ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGATTTGAACCAAAAGTGGAGGATTTTTGGGGTTATAAAATGATACATAGT Gl ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGATTGAACCAAA------Gm ------Go ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGATTGAACC------Gp ATCTATCTAGATCTAAATATCTTTGGAATTCTTCCATTATAGGAT------Sa ATCTATNTAGATCTAAATATCTTTGGAATTCTTCCATTAGAAT------Ia ATCTATCTAGCTCGAAATATCTTTGGAATTCCTCCAT------464

D. trnL plus trnL-F alignment. Ga = Gomphandra australiana; Gv = Gomphandra flavicarpa; Gj = Gomphandra javanica (GenBank); Gm = Gomphandra mappioides; Gp = Gomphandra psilandra; Gf = Gomphandra fernandoi; Gl = Gomphandra luzoniensis (Jodrell Lab); Gn = Gomphandra luzoniensis (Nabas); Gs = Gomphandra luzoniensis ssp. septentrionalis; Go = Gomphandra oligantha; Gu = Gomphandra ultramafiterrestris; Sa = Stemonurus ammui; Gr = Grisollea madagascariensis; Co = Codiocarpus merrittii (Jodrell Lab); Ia = Ilex aquifolium (GenBank).

1 - 109 Ga CCTACTAAGTGATCACTTTCCAATTCAGAGAAACCCCGGAATTAATAAAACTGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAATTCAGAAAGT Gv ...... Gj ...... Gm ...... Gp ------Gf ...... Gl ...... -...... -...... Gn ...... Gs ------Go ...... Gu ------Sa ...... A...... Gr ------...... T..... Co ...-...-.....-...... -...... Ia ...... A...... T...... A...... A...... ------.. 465

110 - 209 Ga GAAAATCAAAA-----GAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTGGACTGTGTTGCGTTGTTAAACGAATCCTTCTATCA Gv ...... -----...... A...... Gj ...... -----...... A...... Gm ...... -----...... A...... Gp ------Gf ...... -----...... Gl ...... -----...... Gn ...... -----...... Gs ------Go ...... -----...... Gu ------Sa ...... A....-----...... T...... A...... Gr ...... -----...... A...... Co ...... AAAAA...... A...... Ia ...... ------...... C...... A....T...... A...G..G.G.A...... G

210 - 309 Ga AAACTTCCGAAAGAATGAAGGATAAACG----TATATACGTACTAAAATACTATAACAAATGATTAATGAGAACCTGAAT------TGTATCTGCCTTTT Gv ...... ----...... C...... G...... ------...... Gj ...... ----...... C...... G...... ------...... Gm ...... ----...... C...... G...... ------...... Gp ------Gf ...... ----...... Gl ...... ----...... Gn ...... ----...... Gs ------Go ...... ----...... Gu ------Sa ...... ----...... C...... Gr ...... ----...... C...... N...... CN..CT...... Co ...... ------...... C...... Ia ....C..A.....G...... CTATA..C...... C...... C...TC...... CG...C...... ------466

310 - 409 Ga TCTATATGTTCTATATGAAAAATAAATGGAAGAATTAGCGCGAATCGATTCCACATTGAAGAAAGAGTCGAATATTCATTGATCCA----ATCATTCACT Gv ...... A...... ----...... Gj ...... A...... ----...... Gm ...... AG...... C...... ----...... Gp ------Gf ...... ----...... Gl ...... ----...... Gn ...... ----...... Gs ------Go ...... N.N...N..NN.TCCAN..N...... Gu ------Sa ...... A...... ----...... Gr .....N..N.NN.N.N.....N...NA.N...... ANN.NN.N.NN..N....A.N....N.N.NNNTN..NN..NN...... T----N..TN..... Co ...... A...... A...... ----...... Ia -...... -..T...... A..----...... GTTAT...... T.....A...... A...... ----CAA......

410 - 509 Ga CCATAGTCTGATATATCTTTTGACGAATTGATTAATCGGACAAGAATAAAGATAGAGTCCCGTTCTACATGTCACTACCGACAACAATGAAACTTTT-AG Gv ...... -.. Gj ...... -.. Gm ...... -.. Gp ------Gf ...... -.. Gl ...... -.. Gn ...... -.. Gs ------Go ...... T.. Gu ------Sa ...... T....G...... -.. Gr ..NN.NN...... NA..NN...A..N...... NA..N...... CN....N.NN.N...N....N...... N.N.N...... -G. Co ...... A...... G...... -.. Ia ...... G...... -.G...C...... G...... A...... A.....G...... -...AT.. 467

510 - 609 Ga TAATAGGAAAATCCGTCGACT-TTAGAAATCGTGAGGGCTCATTCACTCTACTT-CACTTATTTACAAATGAATCTGAGCGGAAATGTTTTTCTCTTAGC Gv ...... -...... -...... Gj ....G...... -...... ------Gm ....G...... -...... -...... Gp ------...... -...... Gf ...... -...... -...... Gl ...... -...... -...... Gn ...... -...... -...... Gs ------...... -...... A...... Go ...... -...... -...... A...... Gu ------...... -.N...... Sa ...... G...... -...... Gr G....N...... N.N..N.GN-...... G...N...------Co ...... -...... C...... -...... Ia ...G...... -...... T.CT------...... A.G..A...... C.G...... T.

610 - 709 Ga ACAAGTC--TTGNGATATAT---GTTATA-AAT----GAACATCTTTGAGGAANAAATCC-CATTTGAATGATTTACA-GGC-AATATCATTATGCCTAA Gv ...... --...... ------...... -...... -....-...... Gj ------Gm ...... --...... ------...... -...... -....-...... Gp ...... --.G...... ----AAAT...... A..-...... -....-...... Gf ...... --...... ------...... -...... -....-...... Gl ...... --...... ------AAT...... -...... -....-...... Gn ...... --...... ------...... -...... -....-...... Gs ...... --...... ------AAAT...... -...... -....-...... Go ...... --...... ------...... -...... -....-...... Gu ...... --...... ------...... -...... -....-...... Sa ...... --...... ------...... -...... -....-...... Gr ------Co ...... --...... ------AAT...... -...... -....-...... Ia ....ACAGG..T.T...... TG...C.CGTCCAAAT...... AC...G...... C...... C..C.T--..TTG....G.....T.A... 468

710 - 809 Ga TGAAACTGACCAAGTCTTCTTTTT------GAATATA-AAAAAATTTCAGGACCTGGATAAAGAANACTTTATACTAAATACCCTTTCTATTTTAGTATA Gv ...... ------...... A.-...... T...... A...... C...... Gj ------Gm ...... TTTTTT...... -...... T.N.....N...... A...... C...... N...... T Gp ...... ------...... -.A...... T...... C...... Gf ...... ------...... Gl ...... ------...... Gn ...... ------...... Gs ...... ------...... Go ...... ------...... A...... Gu ...... ------...... Sa ...... T...... ------...... T...... A...... Gr ------Co ...... T...... ------...... T...... A...... Ia ...... T..A...C....C....------...G.....AG...... T..A...... ----...... G..A..T.----.....ATA...------

810 - 909 Ga TTTTAAAATANAAAAATAGAAAAATAGAATCAAATAATATATTTTTAATATAATATAATTATAATAATATAATATAATTATAATAATAAATAATAATCTA Gv ...T------...... NAA------TAATAAATAATAATA.. Gj ------Gm ...TAAAATNT...... N...... GAA------TAATAAATAATAATC.. Gp ...------T...... GAA------TAATAAATAATAATA.. Gf ...------...... ------.. Gl ...------...... -----GAATA------.. Gn ...------...... -----GAATA------.. Gs ...------...... -----GAATA------.. Go ...------...... ------.. Gu ...------...... ------.. Sa ...TAAAATAT...... T...... A...... A------TAATA.. Gr ------Co ...TAAAATAT...... T...... ------Ia ------469

910 - 1009 Ga TTTCTAATAATATAATAATATATAATAATAAATAGAATAA---ATAATAAAATAGAATAAATAATNCCCTATAACCTATAATAATAATAAGACCCTTTCA Gv ...... AT...... TAT.G...GGGAA...NG..G.G.G.TNNNAAAA....GGN.NNN.....G...N...... ---...... NGN.. Gj ------Gm ...... AT...... T.T.....AATAA..NG.....G...TATTAAAN...... C...... A..A..A...... Gp ...... AT...... TAT.....AATAA...G...... TAATAAAA...... Gf ...... -----...... ------...... Gl ...... -----...... ------...... Gn ...... -----...... ------...... Gs ...... G...... -----...... ------...... Go ...... ---...... TA...... AATAT...------.TAATAAA-...... Gu ...... -----...... ------...... Sa ...... AT...T.TTC...... -----...... ------...... Gr ------Co ------T.AT.ATAATATA------T..TAATAAA-...... -----...... Ia ------

1010 - 1109 Ga AAAATACCCTTTCATCCTTTTAATTGACATANACCCAAGTCGNGTAGNAAAATTAGGATGCTGCGTAGNGCATGGTCGGGA-TAGCTCAGCTGGTAGAGC Gv ...... GT...... N.....NGNANN.....NNGNTG...T...... N..G.NNNNNN..NG..A.N.A.-...... GN..G Gj ------Gm ...... N...... N...... N..G....N...... N...... A..G...... C.....-...... N...... A... Gp ...... -...... Gf ...... -...... Gl ...... A------Gn ...... -...... Gs ...... -...... Go ...... -...... Gu ...... N.....-...... Sa ...... -...... Gr ------Co ...... A...... A.G..------Ia ------...... C....A.C...... G...... GAA.C...... -...... 470

1110 - 1121 Ga ANAGGACTGAAAATCCTCGNGTC Gv ...... G..N.NNNG....G... Gj ------Gm .N...... N.....G... Gp ...... Gf ...... Gl ------Gn ...... Gs ...... Go ...... Gu ...... Sa ...... Gr ------Co ------Ia ......

471

Appendix 3. Extraction Log.

The Date column indicates the date of the extractions. The Species column lists the taxa extracted. The Collector Name & Number column indicates which specimen was used. The Region column identifies the geographic origin of the specimen, and the Herb. column indicates which herbarium holds the voucher specimen. Notes on the extraction method used are in the same row as the date. Names in bold indicate extractions that yielded DNA sequences.

Date Species Collector Name & Number Region Herb. 20 Oct. 2005 Ballard lab SDS mini extraction S. monticola Brass 7421 PNG A S. ammui Streimann 8673 PNG A G. luzoniensis SMHI 335 Philippines A G. tetrandra Liang 63148 Hainan A G. mappioides Burley 35400 Indonesia A G. javanica Kostermans 6241 Indonesia A M. papuana Kalkman BW 3775 PNG A S. malaccensis Maxwell 85-909 Thailand A 26 Jan. 2006 G. lamanii TL 700 Borneo A M. laxiflora Takeuchi 10042 PNG A 27 Sept. 2007 G. palustris S.27828 Borneo A G. luzoniensis SMHI 335 Palawan A G. fernandoi PNH 14345 Samar A G. luzoniensis PPI 38886 Cagayan GH G. luzoniensis s. Ho 1115 Taiwan A G. ultramaf. Schori & Hilario 2 Philippines BHO G. fernandoi Fernando & Schori 1892 Philippines BHO G. mapp. (I) Schori 2007-5 Philippines BHO 25 Oct. 2007 G. mapp. (C) Schori 2007-8 Philippines BHO G. mapp. (B) Fernando 1817 Philippines BHO G. ultramaf. Schori & Hilario 2 Philippines BHO G. fernandoi Schori & Schori 1892 Philippines BHO G. psilandra Fernando & Schori 1821 Philippines BHO G. flavicarpa Schori 2007-13 Philippines BHO 472

6 Nov. 2007 HEPES/PVP G. fernandoi Schori 1892 Philippines BHO G. mapp. (B) Fernando 1818 Philippines BHO G. ultramaf. Schori & Hilario 2 Philippines BHO G. psilandra Schori & Breganza 2007-1 Philippines BHO 7 Nov. 2007 Reground, HEPES/PVP, Qiagen extraction Sept. 27 pellets re-extracted Nov. 6 pellets re-extracted 8 Nov. 2007 HEPES/PVP G. mapp. (Bay) Fernando & Schori 1854 Philippines BHO G. fernandoi Fernando & Schori 1896 Philippines BHO G. psilandra Fernando & Schori 1821 Philippines BHO 11 Dec. 2007 UltraCleaning extractions 1-5 Sept. 27 G. mapp. (C) Oct. 25 Philippines BHO G. flavicarpa Oct. 25 Philippines BHO G. mapp. (I) Oct. 25 Philippines BHO G. mapp. (B) Nov. 6 Philippines BHO G. psilandra Nov. 6 Philippines BHO G. ultramaf. Nov. 6 Philippines BHO G. fernandoi Nov. 8 Philippines BHO G. mapp. (Bay) Nov. 8 Philippines BHO 473

18 May 2008 G. coi ISU 472 Palanan A G. cf. mapp. PPI 18926 Philippines PNH G. lamanii TL 79 Borneo A G. cf. javanica McDonald & Ismail 4779 Borneo A L. africana Ekema 963 S. umbellatus TL 122 Borneo A G. palustris Burley & Lee 353 Borneo A G. mappioides Burley & Lee 3548 Sulawesi A G. borneensis Beaman 10446 Borneo GH G. pseudopras. Craven & Schodde 1445 PNG A G. pseudopras. Takeuchi 11280 PNG A G. ramuensis LAE 52878 PNG A G. muscosa LAE 76053 PNG A C. corniculata S.33522 Borneo A G. lamanii TL 700 Borneo A G. borneensis Beaman 10575 Borneo GH G. dinagatensis BS 35264 Philippines A G. halconensis Ridsdale 1702 Philippines A G. conklinii PPI 6987 Philippines US G. bracteata PPI 37925 Philippines A G. bracteata PPI 38256 Philippines GH G. coi Co 3591 Philippines A G. ultramaf. PPI 4727 Philippines MO G. sp. Schori 2008-6 Philippines BHO G. luzoniensis Schori 2008-1 Philippines BHO C. merrittii Schori 2008-15 Philippines BHO G. oligantha Schori 2008-9 Philippines BHO G. sp. Schori 2008-7 Philippines BHO G. luzoniensis Schori 2008-16 Philippines BHO 474

23 Sept. 2008 Genome Amplification of 18 May 2008 extractions L. africana Ekema 963 S. umbellatus TL 122 Borneo A G. palustris Burley & Lee 353 Borneo A C. corniculata S.33522 Borneo A G. halconensis Ridsdale 1702 Philippines A G. conklinii PPI 6987 Philippines G. coi Co 3591 Philippines A G. ultramaf. PPI 4727 Philippines G. sp. Schori 2008-6 Philippines BHO G. sp. Schori 2008-7 Philippines BHO 17 Dec. 2008 BioSprint G. luzoniensis Schori 2008-16 Philippines BHO G. psilandra Fernando & Schori 1821 Philippines BHO G. flavicarpa Schori 2007-13 Philippines BHO G. fernandoi Fernando & Schori 1896 Philippines BHO G. sp. Schori 2008-7 Paragua BHO G. sp. Schori 2008-6 Redondo BHO G. oligantha Schori 2008-9 Philippines BHO G. mappioides Schori 2008-13 Philippines BHO Jan 2009 CTAB, Phenol, H/P, K/B, overnight combos Grisollea Antilahimena et al. 778 Madagascar Gift G. mapp. (B) Fernando & Schori 1854 Philippines BHO 14 Aug. 2009 CTAB, H/P, K/B, overnight, UC, ½ hour precipitation G. halconensis Ridsdale 1702 Philippines A G. australiana Cumming 16717 Australia BRI G. palustris Burley & Lee 353 Borneo A S. ammui Takeuchi 4522 PNG A L. africana McPherson 13881 S. apicalis Kostermans 25538 Sri Lanka A C. corniculata S.33522 Borneo A 475

7 Mar. 2010 CTAB, H/P, K/B, overnight, ½ hour + precipitation, UC G. melanes. Griffith 12/02 Solomons BRI Medusanthera Takeuchi 10042 PNG A G. mollis Harder 6553 Vietnam MO G. cambodiana Harder 6600 Vietnam MO G. tetrandra Nicolson 250 India MO G. ultramaf. PPI 4599 Dinagat MO G. lamanii Church 2421 Borneo A G. ramuensis NGF 13299 PNG A G. quadrifida Burley et al. 1981 Indonesia A G. pseudopras. LAE 74452 PNG A G. bracteata PPI 38256 Philippines GH G. borneensis Beaman 8212 Borneo A G. cumingiana S.21789 Borneo A G. subrostrata de Wilde 18140 Sumatra MO Whitmorea Schodde 3629 Solomons A Hartleya Hartley 11836 PNG BRI G. sp. NGF 8610 PNG A G. angustata LAE 71084 PNG A G. lysipetala S.26335 Borneo A G. javanica McDonald & Ism. 4779 Indonesia A G. mappioides Kostermans 18738 Sumbawa A G. schoepf. NGF 41653 PNG A G. kinabalu. Clemens 32260 Borneo A G. montana Carr 13173 PNG A

476

Appendix 4. Amplification Log.

The first column indicates the dates amplifications were run, followed by the number of imaged bands out of the total number of samples (e.g. 4 (8)). The Taxa column lists which extractions were used for PCR. The Gene column lists the target gene(s). The Notes column provides comments on PCR variations and results. In the Taxa column, G. mapp. = G. mappioides, (I) = Isarog, (B) = Bohol, (P) = Palawan, (S) = Samar, (Cag.) = Cagayan, and (N) = Nabas.

Date Taxa Gene Notes 11 Nov. 2005 Oct. 20 extractions rbcL 0 (8) 9 Mar. 2006 Jan. 26 extractions rbcL, ITS 0 (16) 30 Mar. 2006 Jan. 26 extractions, rbcL 0 (24) diluted 27 Sept. 2007 Sept. 27 extractions trnL-F bad cleaning kit, 4 (8) G. luzoniensis sequencing failed G. ultramafiterrestris subsequent reamp. G. fernandoi failed G. mapp. (I) 19 Oct. 2007 Sept. 27 extractions, trnL-F 0 (8) 1-4 recleaned 24 Oct. 2007 Sept. 27 extractions trnL to trnL-F 0 (8) 24 Oct. 2007 Sept. 27 extractions rbcL 0 (8) 25 Oct. 2007 Oct. 25 extractions ITS, trnL-F 0 (14) 30 Oct. 2007 Oct. 25 & Sept. 27 trnL-F 0 (11) extractions 31 Oct. 2007 Sept. 27 extractions 5- trnL-F varied MgCl levels, 0 (12) 8, PCR prod. from used PCR products Oct. 30 as templates 1 Nov. 2007 Sept. 27 extractions 5- trnL-F used 2x dNTPs and 0 (12) 8 primers 6 Nov. 2007 Nov. 6 extractions trnL-F, ITS, rbcL rbcL worked 2 (8) 8 Nov. 2007 Nov. 7 extractions trn (Tab A & F), 0 (6) trnL-F

477

15 Nov. 2007 Nov. 6 & 8 trnL-F, rbcL 4 (12) extractions, diluted G. mapp. (B) rbcL G. psilandra rbcL G. ultramafiterrestris rbcL G. fernandoi rbcL 12 Dec. 2007 UltraCleaned samples 4 (7) – first 7 G. palustris trnL-F sequence failed G. luzoniensis (P) trnL-F G. fernandoi (S) trnL-F G. luzoniensis (Cag.) trnL-F 13 Dec. 2007 UltraCleaned samples trnL-F 0 (7) - second 7 14 Dec. 2007 UltraCleaned samples trnD-T 0 (8) 18 Dec. 2007 UltraCleaned samples 1:10 dilutions, ½ 0 (16) primer amounts 19 Dec. 2007 UltraCleaned samples trnL-F 1:10 dilution 7 (7) samples combined with Dec. 18 PCR, submitted for sequencing, product quantified rather than run on gel 9 Apr. 2008 G. mapp. (B) trnL-F, matK Multiple primer site 2 (6) G. fernandoi trnL-F, matK testing trnL-F amplified, not sequenced 23 May 2008 UltraCleaned samples trnL-F, matK designed primers 5 (10) G. mapp. (B) matK matK 38F, 1475R; G. mapp. (C) matK Tab E new, Tab F2 all submitted for sequencing 23 Oct. 2008 L. africana rbcL 0 (6) S. umbellatus rbcL C. corniculata rbcL 19 Dec. 2008 G. luzoniensis (N) trnL-F BioSprint 3 (6) G. flavicarpa trnL-F extractions G. luzoniensis (N) trn L to trnL-F 3 Feb. 2009 Grisollea trnL to trnL-F Extraction method 0 (6) G. mapp. (B) trnL to trnL-F testing 478

11 Feb. 2009 G. luzoniensis (N) trnL-F BioSprint 5 (10) G. flavicarpa trnL-F extractions, G. fernandoi trnL-F UltraCleaned G. oligantha trnL-F G. mapp. (B) trnL-F 16 Feb. 2009 G. luzoniensis (N) trnL-F, trnL 7 (7) G. flavicarpa trnL-F, trnL G. fernandoi trnL G. oligantha trnL G. mapp. (B) trnL 16 Mar. 2009 G. luzoniensis (N) matK partial testing of 10 (17) G. flavicarpa matK extraction methods G. fernandoi matK G. oligantha matK G. mapp. (B) matK, trnL Grisollea trnL 10 Feb. 2010 G. halconensis trnL, trnL-F Contaminated with 4 (16) Bakeridesia S. ammui trnL, trnL-F G. australiana trnL, trnL-F L. africana trnL contaminated 15 Feb. 2010 G. australiana matK Strong band 2 (6) S. ammui matK Strong band 8 Mar. 2010 G. oligantha trnL-F Strong band 4 (8) Grisollea trnL-F, matK G. australiana trnL-F Strong band G. psilandra trnL-F, matK Strong band

63 (295) = 21% successful amplifications 479

Appendix 5. Sequencing Log.

The first column includes the date samples were submitted (s), the date results became available, the number of useable sequences out of the total number submitted (e.g. 3 (8)), the taxa for which there were results (refer to Appendix 4, Extractions log, for more details), the primer used, the Q20 value of the chromatograph, and any notes on the sequencing or the chromatographs. In the Taxa column, G. luz. (T) = G. luzoniensis subsp. septentrionalis from Taiwan, G. ultra. = G. ultramafiterrestris, G. mapp. (B) = G. mappioides from Bohol, UC stands for UltraCleaned samples, G. mapp. (C) = G. mappioides from Catanduanes, and G. luz. (N) = G. luzoniensis from Nabas.

Sequencing

Date Taxa Primer Q20 Notes 1 Oct. 2007 A5 – A8 Tab E bad cleaning kit, reactions not run 13 Oct. 2007 G. luz. (T) Tab E 212 260 bp, background noise 3 (8) G. luz. (T) Tab F 221 250 bp, background noise G. ultra. Tab F 176 200 bp, TAA failure 7 Nov. 2007 (s) G. mapp (B) rbcL 1F 890 ~700 bp 8 Nov. 2007 G. psilandra rbcL 1F 839 ~700 bp 2 (4) 8 Nov. 2007 (s) G. mapp (B) rbcL 724R 568 background noise 10 Nov. 2007 G. psilandra rbcL 724R 448 background noise 4 (4) G. mapp (B) rbcL 636F 523 ~600 bp, background noise G. psilandra rbcL 636F 569 ~500 bp, background noise 16 Nov. 2007 (s) rbcL PCR products excised 0 (28) from gel, not enough DNA for sequencing 13 Dec. 2007 (s) G. luz. (T) UC Tab E 518 570 bp, complete sequence 15 Dec. 2007 G. luz. (T) UC Tab F 441 560 bp, good sequence 4 (14) G. fern UC Tab E 523 560 bp, complete sequence G. fern UC Tab F 356 565 bp, weak read 20 Dec. 2007 (s) G. ultramaf. Tab E 507 565 bp, complete sequence 21 Dec. 2007 G. mapp. (B) Tab E 433 616 bp, end noisy 3 (7) G. psilandra Tab E 0 complete sequence, noisy 21 Dec. 2007 (s) G. ultramaf. Tab F 0 Tab F consistently failed to 22 Dec. 2007 G. mapp. (B) Tab F 0 produce useable sequences 0 (3) G. psilandra Tab F 0 30 Apr. 2008 (s) G. mapp. (B) matK 1326R 862 ~700 bp 2 May 2008 G. mapp. (C) matK 1326R 843 ~700 bp 3 (12) G. psilandra matK 1326R 836 ~740 bp 480

29 May 2008 (s) G. mapp. (B) matK 38F 473 ~500 bp, noisy 31 May 2008 G. mapp. (B) matK 1273R 515 ~500 bp, noisy 3 (18) G. mapp. (B) matK 1475R 693 ~500 bp 17 Feb. 2009 (s) G. luz (N) Tab E 660 556 bp 20 Feb. 2009 G. luz (N) Tab C 565 555 bp, Tab E used instead 7 (7) G. flavicarpa Tab E 447 390 bp, G spikes G. flavicarpa Tab C 526 548 bp, Tab E used instead G. fernandoi Tab C 536 565 bp, Tab E used instead G. oligantha Tab C 447 370 bp, Tab E used instead G. mapp. (B) Tab C 525 559 bp, Tab E used instead 2 Apr. 2009 (s) G. luz. (N) matK 1F 808 ~650 bp 6 Apr. 2009 G. luz. (N) matK 1326R 904 ~700 bp 10 (10) G. flavicarpa matK 1F 720 ~650 bp, background noise G. flavicarpa matK 1326R 886 ~700 bp G. fernandoi matK 1F 677 ~600 bp, background noise G. fernandoi matK 1326R 890 ~600 bp G. oligantha matK 1F 745 ~600 bp, background noise G. oligantha matK 1326R 828 ~600 bp G. mapp. (B) Tab C 506 545 bp Grisollea Tab C 301 295 bp, G spikes 11 Feb. 2010 (s) G. halconensis Tab C 493 ~550 bp, end weak 15 Feb. 2010 S. ammui Tab C 520 ~560 bp, end weak 5 (7) G. australiana Tab C 517 ~556 bp, end weak L. africana Tab C 158 Overlap, contaminated w/G. halconensis S. ammui Tab E 540 ~570 bp 16 Feb. 2010 (s) G. halconensis matK 1F 34 50 bp, then huge peaks Feb. 2010 G. halconensis matK 1326R 0 3 (6) G. australiana matK 1F 731 ~700 bp G. australiana matK 1326R 944 ~800 bp S. ammui matK 1F 882 ~800 bp S. ammui matK 1326R 206 50 bp, then huge peaks 9 Mar. 2010 (s) G. oligantha Tab E 517 530 bp 13 Mar. 2010 G. australiana Tab E 526 600 bp, some noise 6 (6) G. psilandra Tab E 573 540 bp, some noise G. halconensis Tab E 367 370 bp G. psilandra matK 1F 967 ~800 bp G. psilandra matK 1326R 853 ~700 bp

53 (106) = 50% success rate of sequencing amplified products