Effects of fatty acid supplementation on gene expression, lifespan, and biochemical changes in wild type and mutant C. elegans strains

by

Amal Bouyanfif, MSc, BSc

A Dissertation

In

Plant and Soil Science

Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Approved

Dr. Eric Hequet Chair of Committee

Dr. Naima Moustaid-Moussa Co-chair

Dr. Michael Ballou

Dr. Latha Ramalingam

Dr. Venugopal Mendu

Dr. Iurii Koboziev

Mark Sheridan Dean of the Graduate School

August, 2019

Copyright 2019, Amal Bouyanfif Texas Tech University, Amal Bouyanfif, August 2019

DEDICATION

Every challenging work requires self-effort as well as guidance and support of those who are close to our heart. I dedicate this dissertation to my husband, my kids, and my family.

To my husband, Noureddine, because you believed in me, you encouraged me, and you were with me in every step since we met. Without your support, I would never have begun this journey.

To my kids, Merwan & Nabil, you were very patient with me, you will always be my greatest achievement and I am so proud of you. You are such a blessing to me and I love you so much.

To my parents and my family for their love and constant support even if thousands of miles separate us.

ii

Texas Tech University, Amal Bouyanfif, August 2019

ACKNOWLEDGMENTS

First, I would like to thank my advisors, Dr. Naima Moustaid-Moussa and Dr. Eric Hequet for guiding me throughout my dissertation. Dr. Moustaid-Moussa invited me into her laboratory, allowed me to work on this research project, and advised me during this research.

I would like to express my gratitude to all lab members who helped me during my research specially Drs. Latha Ramalingam, Iurii Koboziev, and Sumedha Liyanage.

I would like to thank my committee members, Dr. Michael Ballou, Dr. Venugopal Mendu, Dr. Latha Ramalingam, and Dr. Iurii Koboziev for serving on my dissertation committee.

I would like also to thank Dr. Seshardi Ramkumar for accepting to serve as Dean’s representative.

The work described in this research was initiated through a collaboration with Chemical Engineering Department at Texas Tech University. As such, I would like to acknowledge and thank Dr. Siva Vanappali for allowing me to train in his laboratory and Jennifer Hewitt who provided me with the training I needed to start this C. elegans research in Dr. Moustaid-Moussa’s lab.

I would like to knowledge the partial financial support from Texas Tech University Graduate School, the United States Department of Agriculture, and the Fiber and Biopolymer Research Institute.

Finally, I am most grateful to my husband and kids who supported me throughout this process. Without their love and support, I would never have been able to finish this work.

iii

Texas Tech University, Amal Bouyanfif, August 2019

TABLE OF CONTENTS

Dedication ...... ii

Acknowledgments ...... iii

Abstract ...... viii

List of Tables...... ix

List of Figures ...... x

Abbreviations ...... xv

General Introduction and overview ...... 1

References ...... 5 1. The nematode C. elegans as a model organism to study metabolic effects of omega 3 polyunsaturated fatty acids in obesity ...... 8

1.1. Abstract ...... 8 1.2. Introduction to the limitations of current omega-3 fatty acid research due to imperfect model organisms ...... 9 1.3. Overview of polyunsaturated fatty acids, and their lipid mediators ...... 13 1.4. Beneficial effect of omega-3 polyunsaturated fatty acids and mechanisms mediating their effects in mammals ...... 17 1.5. Review of the C. elegans as a model organism and its advantages ...... 23 1.6. Related research on omega-3 fatty acid metabolism that has been conducted in C elegans and knowledge gained ...... 29 1.7. Role of microRNAs in mediating nutritional and obesity- related effects in C. elegans and in other animal models ...... 34 1.8. Conclusions and future direction of the field ...... 39 1.9. References ...... 40 2. Translational aging research in Caenorhabditis elegans ...... 53

2.1. Abstract ...... 53 2.2. Overview of aging ...... 54 2.3. Oxidative Stress and Reactive Oxygen Species theory of aging ...... 56 2.4. C. elegans applications in aging studies ...... 58 2.4.1. Introduction to C. elegans ...... 58 2.4.2. Lifespan studies in C. elegans ...... 64 iv

Texas Tech University, Amal Bouyanfif, August 2019

2.5. Signaling pathways that modulate aging in C. elegans...... 68 2.5.1. Insulin/IGF-1/FOXO pathway ...... 68 2.5.2. AMP-activated kinase ...... 74 2.5.3. Target-of-rapamycin pathway ...... 74 2.5.4. Germline signaling ...... 75 2.5.5. Autophagy ...... 78 2.6. Cellular and epigenetic mechanisms of aging in C. elegans ...... 79 2.6.1. Lipid metabolism and energy ...... 79 2.6.2. MicroRNA and histone modification ...... 80 2.7. Genetic and environmental interventions influence longevity...... 82 2.7.1. Dietary restriction...... 82 2.7.2. Bioactive phytomolecules ...... 85 2.7.2.1. Resveratrol ...... 87 2.7.2.2. Polyphenols and Epigallocatechin gallate (EGCG) ...... 87 2.7.2.3. Beta-caryophellene ...... 88 2.7.2.4. Alkaloids ...... 89 2.7.2.5. Curcumin ...... 89 2.7.2.6. Polyunsaturated fatty acids ...... 90 2.8. Conclusions ...... 93 2.9. References ...... 95 3. Review of FTIR microspectroscopy applications to investigate biochemical changes in C. elegans ...... 122

3.1. Abstract ...... 122 3.2. Introduction ...... 123 3.3. FTIR applications for nematode research ...... 125 3.3.1. FTIR FPA imaging of whole nematode ...... 125 3.3.2. Nematode identification ...... 129 3.3.3. Diet and genotype-dependent changes in chemical composition ...... 130 3.3.4. Biochemical composition ...... 135 3.3.5. Toxicity assessment ...... 138 3.4. Conclusions and perspectives ...... 139 3.5. References ...... 141 4. Effects of eicosapentaenoic acid on Caenorhabditis elegan’s lifespan and gene expression ...... 147

4.1. Abstract ...... 147 4.2. Introduction ...... 148 4.3. Materials and methods ...... 151 4.3.1. C. elegans strains ...... 151 4.3.2. Nematode fluidic cultures ...... 151 4.3.3. Lifespan study ...... 154 4.3.4. Gene expression analyses ...... 155 v

Texas Tech University, Amal Bouyanfif, August 2019

4.3.5. Fatty acid analyses ...... 156 4.3.5.1. Lipid extraction...... 156 4.3.5.2. Gas Chromatography ...... 157 4.3.6. Statistical analyses ...... 157 4.4. Results and Discussion ...... 158 4.4.1. Genotype effects...... 158 4.4.1.1. Effects of tub-1 mutation on C. elegans lifespan ...... 158 4.4.1.2. Effects of fat-3 mutation on C. elegans lifespan ...... 160 4.4.2. Strain-Dependent Effects of EPA on C. elegans lifespan ...... 164 4.4.3. Gene expression ...... 167 4.4.3.1. Gene expression in tub-1 strain ...... 169 4.4.3.2. Gene expression in fat-3 strain ...... 171 4.4.4. Fatty acids composition ...... 176 4.5. Conclusions ...... 179 4.6. References ...... 180 5. Fourier Transform Infrared microspectroscopy detects biochemical changes during C. elegans lifespan ...... 187

5.1. Abstract ...... 187 5.2. Introduction ...... 188 5.3. Experimental ...... 190 5.3.1. Materials ...... 190 5.3.2. Lifespan Assay in NGM plates ...... 190 5.3.3. FTIR microspectroscopy analysis ...... 192 5.4. Results and Discussion ...... 193 5.5. Conclusions ...... 207 5.6. References ...... 209 6. FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains ...... 213

6.1. Abstract ...... 213 6.2. Introduction ...... 214 6.3. Experimental ...... 217 6.3.1. Materials ...... 217 6.3.2. FTIR microspectroscopy ...... 217 6.3.3. Spectroscopic data analysis ...... 218 6.4. Results and Discussion ...... 219 6.4.1. Wild-type cultured in CeMM without supplementation ...... 219 6.4.2. WT, tub-1, and fat-3 cultured in CeMM without supplementation ...... 223 6.4.3. Worms cultured in CeMM supplemented with EPA ...... 230 6.5. Conclusions ...... 235 6.6. References ...... 237

vi

Texas Tech University, Amal Bouyanfif, August 2019

7. FTIR microspectroscopy reveals fatty acid-induced biochemical changes in C. elegans ...... 240

7.1. Abstract ...... 240 7.2. Introduction ...... 241 7.3. Materials and Methods ...... 243 7.3.1. C. elegans strains, culture, and maintenance ...... 243 7.3.2. Fatty acids ...... 244 7.3.3. FTIR microspectroscopy ...... 244 7.4. Results and Discussion ...... 245 7.5. Conclusions ...... 255 7.6. References ...... 257 8. Summary, Conclusions, Perspectives, and Limitations ...... 262

8.1. Summary and Conclusions ...... 262 8.2. Perspectives ...... 265 8.3. Limitations ...... 266 Appendix A ...... 267

Appendix B ...... 268

Appendix C ...... 269

Appendix D ...... 280

Appendix E ...... 281

Appendix F ...... 282

vii

Texas Tech University, Amal Bouyanfif, August 2019

ABSTRACT

Supplementation of diet with omega-3 fatty acids has proven to be beneficial and directly associated with human health development. Polyunsaturated fatty acids (PUFAs) generate pro-resolving lipid mediators during the resolution phase of acute inflammation. In this dissertation, we were interested in studying the effects of fatty acid supplementation on gene expression, lifespan, and biochemical changes in wild-type and mutant C. elegans strains. The choice of C. elegans for this investigation is based on the fact that, unlike mammals, C. elegans does not require essential fatty acids in its diet because it is capable of synthesizing PUFAs such as arachidonic acid and eicosapentaenoic acid using saturated and monosaturated fatty acids from bacteria as precursors. In addition, C. elegans mutant strains such as tub-1 and fat-3 are also available. In contrast to wild-type, mutant strain fat-3 lacks ∆6 desaturase activity and fails to produce any of the common C20 PUFAs while in mutant strain tub-1 the functional loss of tubby ortholog called tub-1/F10B5.5 in C. elegans leads to accumulation of triglycerides, which are the major form of stored fat. Our findings show that C. elegans is suitable model to study the effects of PUFAs on aging, gene expression, fatty acid metabolism, and biochemical composition changes. Quantitative PCR did not show significant effects of EPA supplementation, probably because worms were not synchronized. When worms were synchronized using microfluidic device, long-term consumption of PUFAs (eicosapentaenoic acid) resulted in accelerated aging due to peroxidation of the unsaturation but statistically not significant. Our exploratory investigation using Fourier Transform Infrared microspectroscopy was revealed to be interesting. The results showed that not only biochemical change (in lipids and proteins) occur during C. elegans lifespan, but also as a result of supplementation of the growth media with saturated and unsaturated fatty acids.

viii

Texas Tech University, Amal Bouyanfif, August 2019

LIST OF TABLES

1.1: Comparisons between C. elegans and other model organisms ...... 25 1.2: Differences and similarities in lipid homeostasis among C. elegans and mammals ...... 26 1.3: Genes related to nutrition and obesity research in C. elegans mutants, strain: Bristol N2 ...... 28 1.4: miRNAs in C. elegans related to longevity and immunity ...... 38 2.1: Signaling pathways conservation in C. elegans and humans (Homo sapiens)...... 60 2.2: Ageing-associated genes in the model organism C. elegans nematode...... 63 2.3: Phytochemicals extending lifespan in C. elegans organism via different cellular processes ...... 91 4.1: Mean lifespan and Median of C. elegans WT and tub-1 at 20°C ...... 160 4.2: Mean lifespan and Median of C. elegans WT and fat-3 at 20°C ...... 164 4.3: Mean lifespan and Median of C. elegans WT(N2) and tub-1 at 20°C ...... 166 4.4: Mean lifespan and Median of C. elegans WT(N2) and fat-3 at 20°C ...... 167 4.5: Effect of EPA on gene expression in wild-type, tub-1 and fat-3 C. elegans strains ...... 173 4.6: Effect of EPA on gene expression in wild-type, tub-1, and fat-3 ...... 175

ix

Texas Tech University, Amal Bouyanfif, August 2019

LIST OF FIGURES

1.1: Major adipokines and adipose-derived soluble factors in regulating the energy homeostasis and immune status...... 12 1.2: Metabolism of ω-3 and ω-6 PUFAs in human body ...... 15 1.3: Molecular mediators of the long chain ω-3 polyunsaturated fatty acids (LC ω-3 PUFAs) effects...... 19 1.4: C. elegans life cycle at 20oC...... 25 1.5: Visualization of intestinal fat droplets in C. elegans body...... 30 1.6: Metabolism of ω-3 and ω--6 PUFAs in C. elegans...... 31 2.1: Aging overview ...... 54 2.2: Life cycle of the nematode C.elegans at 20˚C ...... 59 2.3: A microfluidic device for C. elegans lifespan assays...... 67 2.4: Glucose metabolism and molecular mechanisms of insulin signal transduction in mammalian tissues...... 69 2.5: Overview of the signaling pathways influencing aging in C. elegans...... 73 2.6: Longevity regulating germline-ablation in C. elegans nematode ...... 77 3.1: Fourier Transform Infrared microspectroscopy Spotlight coupled to Spectrum 400 ...... 125 3.2: (A) Light microscopy image of S. Kraussei nematode, (B) False color image resulting for HCA performed on IR spectra, showing five clusters, (C) Average IR spectra of the clusters resolved in the HCA (B) ...... 127 3.3: Attenuated Total Reflectance Fourier Transform Infrared average spectra of Heterorhabditis indica, Steinernema glaseri, and Caenorhabditis elegans ...... 128 3.4: Visual image of wild-type (N2) C. elegans, corresponding average absorbance FTIR image, and spectra extracted from selected areas of the IR image ...... 131 3.5: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain tub-1...... 133 3.6: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain fat-3...... 133 3.7: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation x

Texas Tech University, Amal Bouyanfif, August 2019

and mutant strain tub-1 grown on CeMM supplemented with 25 µM and 100 µM eicosapentaenoic acid (EPA) ...... 134 3.8: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation and mutant strain grown on CeMM supplemented with 25 µM and 100 µM eicosapentaenoic acid (EPA) ...... 135 4.1: A microfluidic device for lifespan study of C. elegans...... 153 4.2: Microfluidic culture lifespan assay was used to determine nematode survival curve for wild type N2 and tub-1 mutant strains...... 160 4.3: De novo synthesis of polyunsaturated fatty acid (PUFAs) in C. elegans...... 162 4.4: Microfluidic culture lifespan assay was used to determine nematode survival curve for wild type N2 and fat-3 mutant strains...... 163 4.5: Microfluidic culture lifespan assay was used to determine nematode survival curve for WT(N2) and tub-1 mutant strains...... 165 4.6: Microfluidic culture lifespan assay was used to determine nematode survival curve for WT(N2) and fat-3 mutant strains ...... 167 4.7: The hypothetical model for alterations in gene expression by EPA for genes regulating the adiposity, oxidative stress and aging-related pathways in C. elegans...... 168 4.8: Genotype effect on gene expression...... 171 4.9: Genotype effect on gene expression...... 175 4.10: Genotype effect on fatty acid (FA) composition...... 178 5.1: Study design of lifespan assay on solid media ...... 192 5.2: Image showing the location from which spectra were acquired ...... 193 5.3: Representative FTIR spectra acquired in transmission mode from WT(N2) at day 8, 11, and 15...... 194 5.4: Representative FTIR spectra acquired in transmission mode from tub-1 mutant strain at day 8, 11, and 15 ...... 194 5.5: Area of the vibration 1744 cm-1 in the spectra acquired in transmission mode from WT(N2) and tub-1 at day 8, 11 and 15 ...... 196 5.6: Area of the vibration 1648 cm-1 in the spectra acquired in transmission mode from WT(N2) and tub-1at day 8, 11 and 15 ...... 198

xi

Texas Tech University, Amal Bouyanfif, August 2019

5.7: Area of the vibration 1548 cm-1 in the spectra acquired in transmission mode from WT(N2) tub-1 at day 8, 11 and 15 ...... 198 5.8: Area of the vibrations 1155 cm-1 in the spectra acquired from WT(N2) and mutant strain tub-1 at day 8, 11 and 15 ...... 200 5.9: Principal component analysis scores of the FTIR spectra acquired from WT(N2) at day 8, 11, and 15 separate the spectra into 3 groups ...... 201 5.10: PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for WT(N2) ...... 201 5.11: Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the FTIR spectra acquired from WT(N2) at day 8, 11, and 15 ...... 202 5.12: Principal component analysis scores of the FTIR spectra acquired from tub-1 mutant strain at day 8, 11, and 15 ...... 203 5.13: PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for mutant strain tub-1...... 204 5.14: Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the FTIR spectra acquired from tub-1 mutant strain at day 8, 11, and 15 ...... 205 6.1: Visual image showing the location form which spectra were acquired ...... 218 6.2: FTIR detects differences in functional groups distribution in different regions of WT C. elegans ...... 220 6.3: Integrated intensity of the vibration 3008 cm-1 associated with unsaturated fatty acids present in the head, middle, and tail regions of WT(N2) ...... 222 6.4: Integrated intensity of the vibrations 2928 and 2855 cm-1 associated with lipids present in the head, middle, and tail regions of WT(N2) ...... 222 6.5: Integrated intensity of the vibration 1744 cm-1 associated with fatty acids, triglycerides, phospholipids, or esters present in the head, middle, and tail regions of WT(N2) ...... 223 6.6: FTIR spectra of WT, tub-1, and fat-3 C. elegans acquired from the middle region. Worms were cultured in CeMM without supplementation...... 224 6.7: Principal Component Analysis of FTIR spectra separates WT from mutant strain tub-1...... 227

xii

Texas Tech University, Amal Bouyanfif, August 2019

6.8: Principal Component Analysis of FTIR spectra separates WT from mutant strain fat-3 ...... 227 6.9: Principal Component Analysis of FTIR spectra of mutant strains tub-1 vs. fat-3 ...... 228 6.10: Difference spectrum obtained by digital subtraction of tub-1 spectrum from the WT spectrum ...... 229 6.11: Difference spectrum obtained by digital subtraction of fat-3 spectrum from the WT spectrum ...... 229 6.12: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. WT cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 231 6.13: Principal Component Analysis of FTIR spectra: tub-1 cultured in CeMM without supplementation vs. tub-1 cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 232 6.14: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. tub-1 cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 233 6.15: Principal Component Analysis of FTIR spectra: fat-3 cultured in CeMM without supplementation vs. fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 233 6.16: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 234 6.17: Principal Component Analysis of FTIR spectra of mutant strains tub-1 and fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA ...... 235 7.1: Image of the whole intact C. elegans illustrating the location from which spectra were recorded ...... 245 7.2: Representative FTIR spectra acquired from WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 µM ...... 247 7.3: PCA of the FTIR spectra acquired from WT (N2) cultured without and with either EPA or PA supplementation at 100 µM ...... 248 7.4: Loadings corresponding to PCA presented in Figure 3 as a function of wavenumbers for WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 µM ...... 249

xiii

Texas Tech University, Amal Bouyanfif, August 2019

7.5: Representative FTIR spectra acquired from tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM ...... 250 7.6: PCA of the FTIR spectra of tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM. Each data point represents a spectrum obtained with 128 co-added scans ...... 251 7.7: Loadings corresponding to PCA presented in Figure 6 as a function of wavenumbers for tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM (PC-1: 72%, PC-2: 9%, and PC-3: 8%) ...... 252 7.8: Representative FTIR spectra acquired from fat-3 C. elegans strain cultured without or with either EPA or PA supplementation at 100 µM ...... 254 7.9: PCA of the FTIR spectra: fat-3 strain cultured without or with either EPA or PA at 100 µM. Each data point represents spectra obtained with 128 co-added scans...... 254 7.10: Loadings corresponding to PCA presented in Figure 9 as a function of wavenumbers for fat-3 C. elegans cultured without or with EPA or PA supplementation at 100 µM (PC-1: 70%, PC-2: 12%, PC-3: 8%) ...... 255

xiv

Texas Tech University, Amal Bouyanfif, August 2019

ABBREVIATIONS aak AMP-activated kinase acs fatty Acid CoA Synthetase family age aging alteration AMPK AMP-activated protein kinase ATR Attenuated Total Reflectance BAT Brown adipose tissue CARS Coherent Anti-Stokes Raman Scattering C. elegans Caenorhabditis elegans CeMM C. elegans maintenance media CVD Cardiovascular diseases Cox Cyclooxygenase CPT1 Palmitoyl transferase1 DR Dietary restriction daf abnormal dauer formation eat eating-abnormal pharyngeal pumping EFA Essential fatty acid EPA eicosapentaenoic acid; FPA Focal Plane Array ETC electron transport chain FADS Fatty acid desaturases FTIR Fourier Transform Infrared FUdR 5’-fluorodeoxyuridine glp abnormal germ line proliferation GNPs Graphite nanoplatelets GPCRs G protein-coupled receptors HCA Hierarchical Cluster Analysis HETEs Hydroxyeicosatetraenoic acids HFD High fat diet hif hypoxia-inducible factor. IGF insulin-like growth factor ins insulin-related IR Insulin resistance KBr Potassium bromide LC-PUFA Long-chain polyunsaturated fatty acid lipl lipase Like Lox Lipoxygenase MaR Maresins MetS Metabolic syndrome NGM Nematode Growth Medium MIP Mid-Infrared Photothermal mmBCFAs Monomethyl branched chain fatty acids ii

Texas Tech University, Amal Bouyanfif, August 2019

NGM Nematode growth medium NPD1 Neuroprotection D1 OS Oxidative stress PCA Principal Component Analysis PDMS Polydimethylsiloxane PLA2 Phospholipases A2 PMNs Polymorphonuclear leukocytes RH Relative Humidity ROS reactive oxygen species RNS Reactive nitrogen species RV Resolvins skn skinhead SREBP Sterol regulatory element binding protein SRS Stimulated Raman Scattering T2D Type 2 diabetes TOR target of rapamycin tub tubby-related unc uncoordinated WAT White adipose tissue ω-3 PUFA Omega-3 polyunsaturated fatty acids

iii

Texas Tech University, Amal Bouyanfif, August 2019

GENERAL INTRODUCTION AND OVERVIEW

Obesity is a disease of a complex pathogenesis, which is influenced by multiple factors such diet, physical activity, developmental stage, age, genotype and gene interaction with the environment (Ashrafi 2007; Friedman 2003). This disease develops as a result of an expansion of fat mass when the excessive energy, typically stored as triglycerides, exceeds its expenditure (Flier 2004). Obesity is often aggravated by the underlying low grade inflammation and oxidative stress, which in turn increase the risk of developing health problems such as diabetes, hypertension, coronary heart disease and metabolic syndrome (Ruperez 2014). Several approaches including dietary and pharmacological interventions have been used to prevent and/or reduce obesity. These include caloric restriction which improve some of the metabolic dysfunctions (Raina et al. 2016; Chen and Pang 2013). Other strategies include bioactive food compounds, with anti-inflammatory and antioxidant properties, such as polyphenols and long-chain omega-3 polyunsaturated fatty acids (ω-3 PUFAs) referred to as nutraceuticals. We are specifically interested in ω-3 PUFAs, primarily of marine origin, such as eicosapentaenoic acid, EPA and docosahexaenoic acid, DHA. When supplemented in mouse diet, EPA prevented hepatic steatosis, glucose intolerance, insulin resistance, and reduced adipose and systemic markers of inflammation and oxidative stress in mice fed a high-fat diet (Kalupahana et al. 2010). However, while a body of data exists about their potential anti-inflammatory benefits in metabolic disorders (Calder 2010), limited information exists about specific mechanisms and signaling pathways mediating the effects of ω-3 PUFAs in obesity and longevity. Several animal and organism models have been used to study effects of PUFAs, including human, rodents and model organisms. In this dissertation, we are specifically using the nematode C elegans as a model organism in this dissertation. We recently reviewed the literature related to the beneficial effects of ω-3 PUFAs and the mechanisms mediating their effects in mammals and nematodes (Bouyanfif et al. 2019).

1

Texas Tech University, Amal Bouyanfif, August 2019

C. elegans nematode is an excellent model organism for obesity and regulation of fat metabolism (Ashrafi 2007; Zheng and Greenway 2012; Srinivasan 2015; Chen et al. 2016). Chapter 1 includes our recently published review with an up-to-date of literature on the use of the nematode C. elegans as a model organism to study metabolic effects of ω-3 PUFAs in obesity (Bouyanfif et al. 2019). C. elegans nematode possesses several advantages such as short life span, small size and transparent body through its life cycle, easy and affordable culturing protocols in solid and liquid media. Furthermore, the C. elegans use does not require certified animal protocols as with rodents and higher animals. Importantly, unlike mammals, wild type C. elegans worms do not require essential fatty acids in its diet because they are capable of synthesizing PUFAs such as arachidonic acid and eicosapentaenoic acid from saturated and monounsaturated fatty acids from their diet (bacteria) as precursors (Watts et al. 2003; Hutzell and Krusberg 1982). Various C. elegans strains carrying a metabolism-related mutations, such as tub-1 and fat-3, are available for investigators. fat-3 worms lack ∆6 desaturase activity and fail to produce any of the common C20 PUFAs; thus fat-3 is an excellent model for rodents and humans who don’t produce long chain PUFAs. The tub- 1 worms, which have the functional deletion of mammalian tubby gene ortholog called tub-1/F10B5.5, accumulate excessive amounts of fat, stored as triglycerides (Ashrafi et al. 2003; Mukhopadhyay et al. 2005; Mak et al. 2006), and is good model for obesity. The most important application of C. elegans is in aging research (Zhu et al. 2016), given it very short lifespan of 3 weeks. Several theories have been formulated to explain the aging process (Harman 1956; Harman 2001; Medawar 1952; Hughes and Reynolds 2005). The “free radical theory or oxidative stress theory” postulated by Harman (Harman 1956; Harman 1962, 1972) is prevalent in current literature. It states that reactive oxygen species (ROS) cause extensive oxidative damage to cellular components leading to accumulating the pathophysiological changes, which result in death (Kregel and Zhang 2007; Hagen 2003). ROS are generated as either products of normal aerobic metabolism, or under stress and pathological conditions, or may be taken-up from the external environment. In result of the lipid peroxidation, the process end-products such as malondialdehyde, 4-hydroxy-2-non-enol, and F2-isoprostanes, 2

Texas Tech University, Amal Bouyanfif, August 2019 accumulate in tissues (Kregel and Zhang 2007). Other biomacromolecules including proteins and nucleic acids (nuclear and mitochondrial) are also susceptible to oxidative damage by ROS. Their oxidation leads to accumulation of various oxidized residues affecting normal cellular functions and modifying the normal gene expression patterns (Kregel and Zhang 2007; van der Horst et al. 2004; Finkel 2001). The overall objective of this work was to investigate the effects of fatty acid supplementation on gene expression, lifespan, and lipid metabolism in C. elegans. We hypothesized that dietary ω-3 fatty acid reduces fat accumulation and oxidative stress and enhances longevity in fat-3 mutants that have severely reduced PUFAs production like mammals and tub-1 mutants that have an increased fat deposits compared to wild type worms. In addition, we expected to perceive changes to their biochemical composition due to the supplementation with these fatty acids. We designed the following aims to address these hypotheses: Aim I: Determine effects of dietary supplementation with fatty acids (EPA), on C. elegans lifespan Aim II: Determine effects of dietary supplementation of fatty acids on expression of genes related to aging, obesity, and oxidative stress Aim III: Evaluate the impact of dietary supplementation of fatty acids on the biochemical composition of the C. elegans using Fourier Transform Infrared microspectroscopy Three C. elegans strains were used in this study: wild-type (WT, N2) and two mutant strains tub-1 and fat-3. Worms are cultured either on on Nematode Growth Media (NGM) plates seeded with E. coli (Escherichia coli) OP50 strain; or in liquid cultures of CeMM (C. elegans Maintenance Media). Lifespan studies were performed using microfluidic chambers. This dissertation contains 8 chapters: • Chapter 1 is a literature review on the use of the nematode C. elegans as a model organism to study metabolic effects of ω-3 PUFAs in obesity (Bouyanfif et al. 2019).

3

Texas Tech University, Amal Bouyanfif, August 2019

• Chapter 2 is a literature review on the use of the C. elegans as a model for aging research (will be submitted for publication as a review paper in PLOS One). • Chapter 3 is a literature review on the Fourier Transform Infrared microspectroscopy applications in investigating the biochemical changes in C. elegans (Bouyanfif et al. 2018). • Chapter 4 presents our experimental data on the effects of EPA on aging and gene expression in 3 C. elegans strains (will be submitted for publication as a review paper in Aging Journal). • Chapter 5 is focused on the study of the biochemical changes in C. elegans wild- type and mutant strain tub-1 during lifespan. This study was performed using FTIR microspectroscopy at 3 critical stages of the nematode lifespan. This work “Fourier Transform Infrared microspectroscopy detects biochemical changes during C. elegans lifespan” is under revisions for consideration for publication in Analyst. • Chapter 6 is focused on the use of FTIR microspectroscopy to detect diet and genotype-dependent chemical composition changes in wild-type C. elegans and mutant strains tub-1 and fat-3 under diet supplemented with EPA (Bouyanfif et al. 2017). • Chapter 7 presents our experimental data on FTIR microspectroscopy that reveals fatty acid-induced biochemical changes in C. elegans. This chapter is under revisions for consideration for publication in Vibrational Spectroscopy. • Chapter 8 contains our summary, conclusions, and discussion of study limitations and future perspectives.

4

Texas Tech University, Amal Bouyanfif, August 2019

References Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of omega-3 Polyunsaturated Fatty Acids in Obesity. Adv Nutr 10 (1):165-178. doi:10.1093/advances/nmy059

Bouyanfif A, Liyanage S, Hequet E, Moustaid-Moussa N, Abidi N (2018) Review of FTIR microspectroscopy applications to investigate biochemical changes in C. elegans. Vib Spectrosc 96:74-82. doi:10.1016/j.vibspec.2018.03.001

Bouyanfif A, Liyanage S, Hewitt JE, Vanapalli SA, Moustaid-Moussa N, Hequet E, Abidi N (2017) FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains. Analyst 142 (24):4727-4736. doi:10.1039/c7an01432e

Calder PC (2010) Omega-3 Fatty Acids and Inflammatory Processes nutrients 2: 355- 374. doi:10.3390/nu2030355

Chen G, Pang Z (2013) Endocannabinoids and Obesity. In: Litwack G (ed) Vitamins and Hormones, vol 91. Elsevier Inc, pp 325-368. doi:https://doi.org/10.1016/B978-0-12-407766-9.00014-6

Chen W-W, Yi Y-H, Chien C-H, Hsiung K-C, Ma T-H, Lin Y-C, Lo SJ, Chang aT-C (2016) Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging. Scientific RepoRts. doi:10.1038/srep32021

Finkel T (2001) Reactive oxygen species and signal transduction. IUBMB Life 52 (1- 2):3-6. doi:10.1080/15216540252774694

Flier JS (2004) Obesity wars: Molecular progress confronts an expanding epidemic. Cell 116 (2):337-350. doi:Doi 10.1016/S0092-8674(03)01081-X

Friedman JM (2003) A war on obesity, not the obese. Science 299 (5608):856-858. doi:10.1126/science.1079856

5

Texas Tech University, Amal Bouyanfif, August 2019

Hagen TM (2003) Oxidative stress, redox imbalance, and the aging process. Antioxid Redox Signal 5 (5):503-506. doi:10.1089/152308603770310149

Harman D (1956) Aging: a theory based on free radical and radiation chemistry. Gerontol 11,:298‐300

Harman D (1962) Role of free radicals in mutation, cancer, aging, and the maintenance of life. Radiat Res 16:753-763

Harman D (1972) Free radical theory of aging: dietary implications. Am J Clin Nutr 25 (8):839-843. doi:10.1093/ajcn/25.8.839

Harman D (2001) Aging: overview. Ann N Y Acad Sci 928:1-21

Hughes KA, Reynolds RM (2005) Evolutionary and mechanistic theories of aging. Annu Rev Entomol 50:421-445. doi:10.1146/annurev.ento.50.071803.130409

Hutzell PA, Krusberg LR (1982) Fatty-Acid Compositions of Caenorhabditis-Elegans and Caenorhabditis-Briggsae. Comp Biochem Phys B 73 (3):517-520. doi:Doi 10.1016/0305-0491(82)90068-2

Kalupahana NS, Claycombe K, Newman SJ, Stewart T, Siriwardhana N, Matthan N, Lichtenstein AH, Moustaid-Moussa N (2010) Eicosapentaenoic Acid Prevents and Reverses Insulin Resistance in High-Fat Diet-Induced Obese Mice via Modulation of Adipose Tissue Inflammation. Journal of Nutrition 140 (11):1915-1922. doi:10.3945/jn.110.125732

Kregel KC, Zhang HJ (2007) An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am J Physiol Regul Integr Comp Physiol 292 (1):R18-36. doi:10.1152/ajpregu.00327.2006

Mak HY, Nelson LS, Basson M, Johnson CD, Ruvkun G (2006) Polygenic control of Caenorhabditis elegans fat storage. Nat Genet 38 (3):363-368. doi:10.1038/ng1739

Medawar PB (1952) An unsolved problem of biology: an inaugural lecture delivered at University College, London, 6 December, 1951. HK Lewis and Co, London

Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2005) C-elegans tubby regulates life span and fat storage by two independent mechanisms. Cell Metab 2 (1):35-42. doi:10.1016/j.cmet.2005.06.004

6

Texas Tech University, Amal Bouyanfif, August 2019

Raina R, Mondhe DM, Malik JK, Gupta RC (2016) Garcinia cambogia. In: Gupta RC (ed) Nutraceuticals. Efficacy, Safety and Toxicity. Elsevier Inc, pp 669-680. doi:https://doi.org/10.1016/B978-0-12-802147-7.00048-6

Ruperez AIG, A. Aguilera, C. M. (2014) Genetics of Oxidative Stress in Obesity. International Journal of Molecular Sciences 15 (2):3118-3144. doi:10.3390/ijms15023118

Srinivasan S (2015) Regulation of body fat in Caenorhabditis elegans. Annu Rev Physiol 77:161-178. doi:10.1146/annurev-physiol-021014-071704 van der Horst A, Tertoolen LG, de Vries-Smits LM, Frye RA, Medema RH, Burgering BM (2004) FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 279 (28):28873-28879. doi:10.1074/jbc.M401138200

Watts JL, Phillips E, Griffing KR, Browse J (2003) Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163 (2):581-589

Zheng J, Greenway FL (2012) Caenorhabditis elegans as a model for obesity research. Int J Obes (Lond) 36 (2):186-194. doi:10.1038/ijo.2011.93

Zhu G, Yin F, Wang L, Wei W, Jiang L, Qin J (2016) Modeling type 2 diabetes-like hyperglycemia in C. elegans on a microdevice. Integr Biol (Camb) 8 (1):30-38. doi:10.1039/c5ib00243e

7

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 1

The nematode C. elegans as a model organism to study metabolic effects of omega 3 polyunsaturated fatty acids in obesity

A. Bouyanfif1,2, S. Jayarathne2,3, I. Koboziev2,3, N. Moustaid-Moussa2,3* 1 Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 79409 2 Department of Nutritional Sciences, and 3Obesity Research Cluster, Texas Tech University, Lubbock, TX 79409

Disclaimer: A short version of the work presented in this chapter has been published in Advances in Nutrition 10 (2019) 165-178. The published paper is listed in Appendix A.

1.1. Abstract

Obesity is a complex disease that is influenced by several factors such as diet, physical activity, developmental stage, age, genes and their interactions with the environment. Obesity develops as a result of expansion of fat mass when the intake of energy, stored as triglycerides, exceeds its expenditure. About 40% of the US population suffers from obesity, which represents a worldwide public health problem associated with a chronic low grade adipose tissue and systemic inflammation (sterile inflammation), in part due to adipose tissue expansion. In patients with obesity, the energy homeostasis is further impaired by inflammation, oxidative stress, dyslipidemia and metabolic syndrome. These pathologic conditions increase the risk of developing other chronic diseases including diabetes, hypertension, coronary heart disease and certain forms of cancer. It is well documented that several bioactive compounds such as omega 3 polyunsaturated fatty acids (ω-3 PUFAs) are able to reduce adipose and systemic inflammation and blood triglycerides, and in some cases improve glucose intolerance and insulin resistance in vertebrate animal models of obesity. A promising model organism that is gaining tremendous interests for studies of lipid and energy metabolism is the nematode Caenorhabditis elegans. This roundworm stores fats as droplets within hypodermal and the intestinal cells. The nematode’s transparent skin enables for fat droplet visualization and quantification using dyes that have affinity to 8

Texas Tech University, Amal Bouyanfif, August 2019 lipids. This paper provides a review of major research over the past several years on the use of C. elegans to study the effects of ω-3 PUFAs on lipid metabolism and energy homeostasis as it relates to metabolic diseases.

Key words: C. elegans, obesity, omega 3 fatty acids, metabolism, inflammation, oxidative stress

1.2. Introduction to the limitations of current omega-3 fatty acid research due to imperfect model organisms During last few decades, the obesity prevalence has increased in many countries across the world with over 600 million adults reported as obese and 1.9 billion as overweight. This complex disease has acquired epidemic proportions projected to reach 700 million obese adults and 2.3 billion of overweight adult (Malik et al. 2013). United States is among the countries with highest obesity incidence and prevalence (Ahmad and Imam 2016). Obesity in the U.S affects about 40% of the adult population and 19% of the youth population (Sifferlin 2017); and close to 70.2% of U.S. adults are categorized as affected by obesity or overweight (What is Obesity? 2016; Overweight & Obesity Statistics 2017). The number of Americans suffering from obesity has progressively increased since 1960. According to the Behavioral Risk Factor Surveillance System (BRFSS), in 2014, the obesity prevalence among U.S. adults by State and Territory varies between the regions: it is highest in the Midwest (30.7%), followed by the South (30.6%), the Northeast (27.3%), and the West (25.7%) (Prevention Strategies & Guidelines 2015). In 2013, the American Medical Association recognized obesity as a disease, emphasizing the importance in public health (Deiuliis 2016). The estimated annual medical cost in the U.S. was $147 billion in 2008; and the annual medical costs for those suffering from obesity were $1,429 higher than those of normal weight (Prevention Strategies & Guidelines 2015). Thus, clearly novel and creative public health population-based strategies for preventing and treating obesity are needed, and represent an urgent health care challenge (Fernandez-Sanchez et al. 2011). Obesity is a universally classified disease. A Body Mass Index (BMI) is calculated by dividing a person's body weight in kilograms by their height in meters

9

Texas Tech University, Amal Bouyanfif, August 2019 squared (Ogden et al. 2014). According to the World Health Organization and other health agencies’ classification, a person with BMI>25 is considered overweight, and obese – with BMI>30. Morbid or extreme obesity refers to BMI>40 (Ogden et al. 2014). However, BMI does not provide an evaluation of total body adiposity, it is used extensively due to its strong association with mortality and health effects, convenience and ease of measurements and calculation by any primary care physician. According to National Institute of Health reports, high BMI is considered as a major risk factor for more than 30 chronic health conditions including type 2 diabetes (T2D), high blood cholesterol, hypertension, cardiovascular diseases (CVD), gallstones, fatty liver disease, sleep apnea, stress incontinence, degenerative joint disease, birth defects, stroke, asthma and other respiratory conditions, and numerous cancers (Grundy et al. 2005). Obesity develops when the intake of energy, which is principally stored as triglycerides, exceeds its expenditure (Flier 2004). In obese human subjects and laboratory animals, inflammation and oxidative stress occur due to imbalance between free radical production and antioxidant defenses, impaired energy homeostasis, adipocyte function and lipid metabolism (Ruperez 2014). In vast majority of cases, the pathogenesis of obesity is associated with development of metabolic syndrome (MetS). MetS represents a cluster of pathophysiologic conditions including hyperglycemia, dyslipidemia, and hypertension with underlying oxidative stress, thrombosis, and inflammation (Grundy et al. 2004). In addition, a body of evidence suggests that obesity is associated with chronic low-grade inflammation, which makes its contribution to the interruption of energy storage and metabolism regulation via producing various mediators of inflammation which interfere with intracellular and endocrine signaling pathways (Ahmad and Imam 2016; Medzhitov 2008). Obesity is one of the most pervasive chronic diseases of complex etiology. Its pathogenesis is driven by a combination of several contributing factors of behavioral, psychological, social, genetic, environmental, and metabolic nature (Fernandez- Sanchez et al. 2011; Brockmann and Bevova 2002; Bouyanfif et al. 2017). A hallmark of obesity is the expansion of fat mass, primarily in what is referred to as white adipose tissue (WAT). By contrast, brown adipose tissue (BAT) is primarily responsible for 10

Texas Tech University, Amal Bouyanfif, August 2019 thermogenesis and energy expenditure. WAT is the principal adipose tissue type associated with metabolic complications of obesity. This tissue functions as an endocrine organ that is composed of adipocytes, an extracellular matrix (ECM), vascular and neural cells, immune cells such as macrophages and T lymphocytes, stem cells, preadipocytes, fibroblasts and stem cells (Kalupahana et al. 2011). WAT is not only a triglyceride storage organ, but it also produces various bioactive metabolites and substances such as free fatty acids and adipose cytokines (adipokines) (Jung and Choi 2014). In particular, increased production of adipose tissue-derived pro-inflammatory adipokines, such as tumor necrosis factor-alpha (TNFα), monocyte chemotactic protein (MCP-1), plasminogen activator inhibitor-1 (PAI-1), interleukins 1, 6 and 18 (IL-1, IL- 6, and IL18 respectively), resistin as well as the leptin hormone, along with reduced secretion of the anti-inflammatory and insulin-sensitizing adipokines, such as IL-10 and adiponectin, have been reported to partially cause obesity-related insulin resistance (Kalupahana et al. 2011; Calder 2013a). Increased adipokine levels in obesity stimulate the production of reactive species of oxygen and nitrogen (ROS and RNS) by resident myeloid cells. Elevated ROS and RNS concentrations are accountable to increase the process of oxidative stress (OS) (Fernandez-Sanchez et al. 2011). Figure 1.1 summarizes the major adipocyte-derived factors which are engaged in energy homeostasis.

11

Texas Tech University, Amal Bouyanfif, August 2019

Figure 1.1: Major adipokines and adipose-derived soluble factors in regulating the energy homeostasis and immune status. A wide variety of white adipose tissue (WAT)- produced molecules contribute to regulation of lipid and carbohydrate metabolism in health and disease. In obese WAT, activation of energy deposition pathways is coupled with elevated pro-inflammatory signaling, causing the obesity-associated chronic inflammation. MCP-1, monocyte chemoattractant protein-1; IL-6, interleukin-6; IL-10, Interleukin 10; TNF-α, tumor necrosis factor-α; PAI-1, plasminogen activator inhibitor- 1. Adipocyte derived factors regulate a variety of metabolic pathways, such as lipid and glucose metabolism, and metabolic responses to hormones and nutrients (Coelho et al. 2013). The adipocytes of obese individuals are characterized by lower insulin receptor density and higher density of β-3 adrenergic receptors. Extensive lipolysis and release of free fatty acids (FFA) in obese adipocytes result in elevated production of oxygen-derived free radicals, in synergistically enhanced sensitivity to pro- inflammatory stimulation provided by IL-6 and TNF-α, and may trigger insulin resistance (IR), accompanied by apoptosis of pancreatic beta cells (Makki et al. 2013; Tan et al. 2013). Excessive lipid breakdown in obesity, and limited adipose tissue capacity for storage of these lipids leads to its deposition in other tissues such as liver, pancreas and muscle. This leads to impaired function of these organs due to lipotoxicity, closely linked to chronic inflammation and IR (Fernandez-Sanchez et al. 2011; Kalupahana et al. 2011).

12

Texas Tech University, Amal Bouyanfif, August 2019

Several approaches are used to alleviate inflammation and oxidative stress in obesity and metabolic disorders. These include dietary and pharmacological interventions, such as caloric restriction and anti-obesity drugs, which ameliorate some of the metabolic dysfunctions in obesity (Raina et al. 2016; Chen and Pang 2013). In addition, several bioactive compounds found in foods and botanicals possess anti- inflammatory properties and are attractive means to treat and/or prevent obesity-related inflammation. Other diet-based treatment strategies use bioactive food components, such as polyphenols and long-chain omega-3 (ω-3) polyunsaturated fatty acids (PUFAs), namely eicosapentaenoic and docosahexaenoic acids (EPA and DHA respectively). These fatty acids possess well documented anti-inflammatory properties, and while a body of data exists about their potential anti-inflammatory benefits in metabolic disorders (Calder 2010), limited information exists about specific mechanisms mediating the effects of (ω -3) PUFAs on metabolic inflammation, energy balance and cell signaling pathways. Clinical and animal model studies are very valuable in understanding mechanisms mediating effects of bioactive food compounds such as omega 3 fatty acids. However, these are both expensive and time consuming, and are often limited for research studies, due to ethical concerns. Therefore, there is critical need for affordable and efficient animal models for scaled screening of various bioactive compounds or pharmacological agents in various diseases including obesity. In this review, we focus on a specific model organism, the Caenorhabditis elegans nematode as an affordable, convenient and metabolically relevant model organism to understand the mechanisms mediating effects of ω-3 PUFAs effects in obesity and inflammation. This model can be further expanded and applied to other metabolic studies using dietary compounds and botanicals.

1.3. Overview of polyunsaturated fatty acids, and their lipid mediators

Fatty acids fall in one of two categories, saturated or unsaturated fats, depending on the presence of chemically active unsaturated double -C=C- bonds in their carbon skeleton. Likewise, unsaturated fatty acids are assorted to monounsaturated fatty acids

13

Texas Tech University, Amal Bouyanfif, August 2019

(MUFAs) which have only one double bond and polyunsaturated fatty acid (PUFAs) which carry two or more double bonds. PUFAs, in turn, are divided into two principal types: omega-3 which harbor a double bond at third carbon atom from the methyl moiety of the carbon chain, and omega-6 (ω-6), which have it at sixths carbon from the methyl end of the molecule. Long chain omega-3 fatty acids are potent dietary anti-inflammatory compounds described to date. Importantly, they represent an essential fatty acid type (EFA). Mammals and, in particular, human organisms are not capable of synthesizing them de novo due to the lack of delta-12 desaturase and delta-15 desaturase endogenous enzymes, required for ω-3 desaturation (Lee et al. 2016; Zhou et al. 2011). For this reason, supplementing these PUFAs with the diet is necessary. The short-chain (18: ω- 3) fatty acid, Alpha-linolenic acid (ALA), serves a metabolic precursor for longer chain omega 3 fatty acids. The most critically important for human diet and health of all long- chain ω-3 PUFAs are Docosahexaenoic (DHA, 22:5ω-3) and eicosapentaenoic (EPA, 20:5ω-3) acids, due to their ability to modify the cellular membrane composition and to modulate the gene transcription and cellular signaling, thus exerting numerous and versatile biological effects Certain amounts of DHA and EPA can be synthesized by mammals via elongation of short-chain ALA supplemented with diet, but the capacity of this function is limited. These long-chain ω-3 fatty acids have important therapeutic and nutritional benefits in humans. They are protective against non-alcoholic fatty liver disease; Type 2 diabetes; autoimmune disorders, CVD, cancers (Jump et al. 2012; Lu et al. 2016; Virtanen et al. 2014; Zivkovic et al. 2011). Moreover, DHA has been implicated into prevention of neurodegeneration in central nervous system (Lee et al. 2016). EPA and DHA are abundant in marine fish (sardines, herring, salmon, and tuna) oils. Sometimes they are referred to marine omega-3s. Some other ω-3 polyunsaturated fatty acids are found in plants including algae, soybeans, flax seeds, walnuts, and are present in plant oils produced from canola, olive, soybean, flaxseed, pumpkinseed, walnut oils. Linoleic acid (LA) is the most common omega-6 fatty acid in human diet (Harris et al. 2009). LA is an essential dietary component. All long-chain ω-3 fatty acids in 14

Texas Tech University, Amal Bouyanfif, August 2019 human cells are synthesized from ALA and all long chain ω-6 fatty acids are synthesized from LA. As summarized in Figure 1.2, dietary essential PUFAs ALA (ω-3) and LA (ω-6) are metabolized to become longer carbon chains (a range of 20- and 22-carbon ω- 6 and ω-3 fatty acids) with higher double bond numbers by successive reactions catalyzed by the same set of desaturase and elongase enzymes. Many of these are further metabolized into other lipid mediators such as prostanoids for ω-6 PUFAs metabolites, and resolvins, protectins or maresins for ω-3 PUFA metabolites discussed below (Yang et al. 2011).

Figure 1.2: Metabolism of ω-3 and ω-6 PUFAs in human body. Omega-3 fatty acids are synthesized from the ALA precursor and ω-6 fatty acids are synthesized from the LA precursor. LA is converted to AA. Eicosanoids derived from AA have pro- inflammatory properties. ALA is subsequently converted to EPA and DHA. The metabolites of EPA and DHA have anti-inflammatory properties. Cox–cyclooxygenase; Lox–lipoxygenase; LTB4–Leukotriene B4; PGE2–prostaglandin E2; TXA2– Thromboxane A2; LTB5–Leukotriene B5; PGE3–prostaglandin E3; TXA3– Thromboxane A3; RvDs – Resolvins D; NPD1 – Neuroprotectin D1; PD1 – Protectin D1; MaRs – Maresins.

Omega-6 PUFAs and omega-3 PUFAs serve as metabolic precursors for pro- and anti-Inflammatory molecules, bioactive lipid mediators, respectively, that regulate immune responses. Long-chain PUFAs, particularly EPA (ω-3), Dihomo-γ-linolenic 15

Texas Tech University, Amal Bouyanfif, August 2019 acid (DGLA) and Arachidonic Acid (AA) (both - ω-6) are cleaved off phospholipid membranes by phospholipases A2 (PLA2) and then are converted into two classes of signal molecules: eicosanoids and docosanoids. Eicosanoids derived from AA possess pro-inflammatory properties, whereas those derived from DGLA, as well as EPA- derived eicosanoids such as prostaglandins, prostacyclins, leukotrienes, and lipoxins have been implicated into anti-inflammatory responses (Yang et al. 2011). The lipoxygenase (Lox) enzyme produces leukotrienes and hydroxy derivatives; cyclooxygenase (Cox) synthesizes prostanoids such as prostaglandins, prostacyclins, and thromboxanes; and cytochrome P450 (CYP450) mono-oxygenases produce epoxides and hydroxyeicosatetraenoic acids ("HETEs") (Calder 2013a; Zhang et al. 2011; Calder 2009). Through competition for incorporation into membrane phospholipids, ω-3 PUFAs can reduce the content of membrane AA in endothelial and inflammatory cells. This results in less production of AA-derived pro-inflammatory mediators, including prostaglandin (PG)-E2, thromboxane (TX)-B2, leukotriene (LT)-B4, and hydroxyeicosatetraenoic acid (5-HETE) (Calder 2013b). Furthermore, EPA serves as a substrate for cyclooxygenase and lipoxygenase enzymes which may increase the production of different families of eicosanoids PGs and TXs (Kromhout et al. 2012). DHA, in turn, is a precursor for the biosynthesis of anti-inflammatory docosanoids such as protectins (neuroprotection D1 (NPD1) and protectin D1), maresins (MaR1 and MaR2), and resolvins (RV). Interestingly, the resolvins may originated from both DHA and EPA (Duvall and Levy 2016). DHA-derived resolvins are resolvin D (RVD1 to RVD6) while EPA-derived resolvins are resolvin E (Charles N. Serhan et al. 2015). These families of mediators from the ω-3 essential FAs metabolome that stimulate endogenous resolution mechanisms in inflammation, have various pathophysiologic actions in numerous processes such as inflammatory pain, rheumatoid arthritis, tissue regeneration, and neuroprotection-neurodegenerative disorders (Fetterman and Zdanowicz 2009). Moreover, they act as anti-inflammatory lipid mediators in the prevention and treatment of some cancers (Fetterman and Zdanowicz 2009; Serhan and Petasis 2011). 16

Texas Tech University, Amal Bouyanfif, August 2019

The biosynthesis of lipid mediators occurs at sites of inflammation and tissue injury. Maresins’ biosynthesis is initiated in macrophages by lipoxygenation of DHA, whereas protectins and resolvins are formed by a wide range of cells and tissues (Serhan and Petasis 2011; Kohli and Levy 2009). Overall, PUFAs generate proresolving lipid mediators, including arachidonic acid (AA)-derived lipoxins, n3-EPA-derived RVs of the E-series, DHA-derived RVs of the D-series, protectins and MaRs, during the resolution phase of acute inflammation. These endogenous hormone-like bioactive compounds are contributory factors of the regulation of pathologic inflammation and various physiologic activities in humans and animals. In humans, only a very small proportion of fatty acids, obtained from diet, is converted to long-chain PUFAs consisting of more than 20 carbons. The biosynthesis of these PUFAs is regulated by a set of fatty acid desaturases (FADS), the enzymes that catalyze the introduction of double bonds between the carboxylic end of a molecule and a pre-existing double bond (Lee et al. 2016). The effects of FADS on human health have been explored in several studies using genetic and genomic approaches (Lee and Park 2014). In subjects used to energy-rich Western Diet, low in fruits and vegetables, high fatty acid desaturase activity may serve as a pathogenesis driver for chronic inflammation and coronary artery diseases (Martinelli et al. 2008). Fatty acid desaturases are classified into front-end desaturases such as ∆4, ∆5, and ∆6 desaturases which introduce double bonds into the nascent PUFA molecules; and methyl-end desaturases such as ∆12 and ∆15 desaturases introduce double bonds between pre- existing double bond and methyl end of the molecule (Martinelli et al. 2008). Fatty acid desaturases are encoded by three genes in the human chromosome 11. FADS1 gene product is a ∆5 desaturase, FADS2 gene product is a ∆6 desaturase. The variability of desaturases is maintained by the alternative splicing of 12 exons spread between FADS1, FADS2 and FADS3 genes (Lee et al. 2016).

1.4. Beneficial effect of omega-3 polyunsaturated fatty acids and mechanisms mediating their effects in mammals Essential ω-3 PUFAs, supplemented with diet, lower cholesterol and triglyceride levels, reduce blood pressure and downregulate systemic low-grade inflammation, 17

Texas Tech University, Amal Bouyanfif, August 2019 associated with obesity (Kromhout et al. 2012; Leaf 2007). They minimize the risks and symptoms for other disorders including diabetes, rheumatoid arthritis, stroke, fatal cardiac arrhythmias, inflammatory bowel disease, and some cancers according to U.S. National Library of Medicine (Leaf 2007; Lee et al. 2016; Oh and Walenta 2014; Wang et al. 2014). In addition, ω-3 PUFAs accumulated in the brain promote the behavioral and cognitive (brain memory and performance) function (Aben and Danckaerts 2010). Moreover, they are an integral part of cell membranes all over the body, after their interaction with the membrane lipids such as phospholipids and cholesterol, PUFAs affect the physical properties of the cell membranes including flexibility, fluidity, permeability, as well as the activity of membrane-bound enzymes (Stillwell W and SR 2003). They take part in endocrine regulation of inflammation, contraction and relaxation of artery walls, and blood clotting. Likewise, they bind to receptors in cells that regulate genetic functions (Leaf et al. 2003). The wide biological activities of ω-3 PUFAs, which encompasses membrane structure and function, vision, nervous system, regulation of gene expression and lipid mediators synthesis (such as pro-resolving mediators, isoprostanes, and so forth), makes dietary long-chain ω-3 PUFAs, particularly EPA and DHA, a critical nutrients energy homeostasis and general health status of human organism (Lee et al. 2016). Numerous hypotheses have been proposed regarding anti-obesity and anti- inflammatory protective effects of ω-3 PUFAs (Figure 1.3) (Ahmad and Imam 2016; Zhang 2010; Bazan 2005). These fatty acids modulate the expression of genes associated with lipid oxidation in adipose, cardiac and liver tissues (Buckley and Howe 2010). This is consistent with reduced adipogenesis by DHA and EPA, and increased mitochondrial carnitine palmitoyl transferase 1 enzyme (CPT1) which controls fat oxidation in adipocytes, skeletal muscle and cardiac cells (Ahmad and Imam 2016). These catabolic effects is mediated in part by activation of peroxisome proliferator- activated receptor-gamma (PPAR-γ) and AMP-activated protein kinase (AMPK), the energy-sensing enzyme. This activation results in the inhibition of malonyl-CoA decarboxylase, a key lipid metabolism enzyme implicated in fatty acid biosynthesis (Flachs et al. 2005). On the other hand, as a ligands for PPARα and PPARγ, DHA and 18

Texas Tech University, Amal Bouyanfif, August 2019

EPA stimulate the expression of lipoprotein lipase and adipose triacylglycerol lipase, the lipolysis-mediating enzymes, essential for lipid utilization, further enhancing their anti-adipogenesis effects (Zimmermann et al. 2004).

Figure 1.3: Molecular mediators of the long chain ω-3 polyunsaturated fatty acids (LC ω-3 PUFAs) effects. In adipocytes, ω-3 PUFAs modulate gene expression and promote biosynthesis of regulatory which enhance the utilization of carbohydrates and fats, reduce the adipogenesis, increase the insulin sensitivity and ameliorate inflammation. Abbreviations: CPT-1: carnitine palmitoyl transferase1; PPAR-α: peroxi-some proliferator-activated receptor-α; SREBP-1: sterol regulatory element-binding protein- 1; AMPK: 5' AMP-activated protein kinase; IRS: insulin substrate receptor; NF-κB: nuclear factor κB; GPR: G-protein coupled receptor.

Long chain ω-3 PUFAs exert a wide spectrum of anti-obesity effects involving numerous molecular pathways. These include stimulating unique fat oxidation pathway that results in generating heat instead of ATP biosynthesis. This heat generating pathway is specifically associated with brown adipose tissue (BAT), whose physiologic functions are different from those of white adipose tissue (WAT) which serves an energy storage of the organism. ω-3 PUFAs modify modulate expression of uncoupling protein-1 (UCP-1) which mediates the thermogenesis function. Activating this pathway is associated with adipose tissue mass reduction (Reddy and Mannaerts 1994; Takahashi 19

Texas Tech University, Amal Bouyanfif, August 2019 and Ide 2000). Moreover, DHA and EPA suppress fat synthesis and increase metabolism in adipose tissue via suppression of sterol regulatory element-binding protein-1 (SREBP-1) (Jump et al. 2013). Long chain ω-3 PUFAs ameliorate obesity-induced insulin resistance and MetS by activating AMPK pathway and enhancing the expression of adiponectin, an insulin-sensitizing adipokine (Gonzalez-Periz et al. 2009). Both insulin resistance and obesity-associated inflammation are further improved by DHA and EPA via generation of the protective lipid mediators. Their mechanistic roles appeared interestingly more potent than their ω-3 PUFA precursors (Gonzalez-Periz et al. 2009). Some of the anti-inflammatory effects of ω-3 fatty acids are receptor mediated. Polymorphonuclear leukocytes (PMNs), monocytes/macrophages and blood vessel endothelium all have been implicated in the systemic anti-inflammatory effects triggered by ω-3 PUFAs (Calder 2010). Given the potent and stereo-selective actions of the specific lipid mediators generated from ω-3 fatty acids, they act via specific high affinity receptors G protein-coupled receptors (GPCRs) present in the membranes of the relevant cell types, including G protein-coupled receptor 32, lipoxin A4 receptor/formyl peptide receptor2, chemokine-like receptor 1, leukotriene B4 receptor type 1 and cannabinoid receptor2 (Serhan and Petasis 2011; Kohli and Levy 2009). Activation of these receptors affects directly different anti-inflammatory pathways that can further mediate the timely resolution of inflammation in mammals (Kohli and Levy 2009; Campbell and Bello 2012). The receptors GPR40 and GPR120 (Oh et al. 2010) also mediate some of the effects of omega-3 fatty acids. Oh et al. found that anti- inflammatory effects exerted by DHA and EPA are mediated by intracellular signaling transmitted through GPR120 receptor, (Also named FFAR4, Free Fatty Acid Receptor 4), highly expressed in mature adipocytes and pro-inflammatory macrophages (Oh and Walenta 2014). Upon binding its ligand, GPR120 couples to β-arrestin 2, thus providing the inhibition of both TLR4 (Toll Like Receptor-4) and TNF-α (Tumor Necrosis Factor alpha) pro-inflammatory signaling pathways associated with nuclear factor NF-κB (Oh and Walenta 2014). The NF-κB pathway is also inhibited via activating of peroxisome proliferator-activated receptors (PPARs) (Kromhout et al. 2012). The activation of 20

Texas Tech University, Amal Bouyanfif, August 2019

GPR120 by supplementing diet with ω-3 PUFAs increases cell sensitivity to insulin and reduces the incidence of diabetes in vivo by repressing macrophage-induced tissue inflammation (Oh et al. 2010). Clinical data regarding the beneficial effects ω-3 PUFAs are well consistent with numerous animals studies demonstrating that enriching mouse HFD with ω-3 PUFAs, particularly EPA, prevents and even reverses development of fatty liver, glucose intolerance, insulin resistance, reduces adiposity and oxidative stress, lowers serum and tissue lipids, as well as reduces the blood levels of such systemic inflammation markers TNFα, IL-6 and C-reactive protein (CRP) (Gonzalez-Periz et al. 2009; Kalupahana et al. 2010). The anti-oxidative stress protective effects of ω-3 fatty acids were previously reviewed in a paper by Puglisi et al. (Puglisi et al. 2011). These studies reported that consumption of ω-3-rich fish oil results in a significant reduction in F2-isoprostanes, a gold standard markers of systemic oxidative stress, levels in adipose tissue. In spite of the similarity of molecular structure of ω-3 and ω-6 PUFAs, their effects in lipid metabolism and inflammation are antagonistic. For this reason, supplementing right and balanced essential fatty acid ratio with diet is crucial for human health. Several studies concluded that high ω-6/ω-3 ratio promotes the development of various chronic diseases, whereas a reduced ω-6/ω-3 ratio may prevent or reverse these diseases (C. Gómez Candela et al. 2011). In the U.S and other countries which accepted “Western” way of life, inevitably associated with consuming energy- and fat-rich Western diet by significant portion of population, ω-6 fatty acids are over-supplied with the diet, while ω-3 fatty acids are under-supplied. Typically, the ratio is at 15:1 or higher in the modern Western diets, which promote the pathogenesis of many diseases. On contrast, the Mediterranean diet (traditional diet) enriched with foods containing the ω- 3 PUFAs (wild plants, eggs, fish, nuts and berries), provides much healthier ω-6/ω-3 balance (ratio 1-2:1) (Simopoulos 2006). Buckley and Howe reported that increasing intake of long chain ω-3 PUFA by 0.3g to 3g daily is effective to reduce body weight and body fat in individuals suffering from obesity (Buckley and Howe 2010; Kabir et al. 2007). Moreover, increased consumption of DHA and EPA portion or their ω-3

21

Texas Tech University, Amal Bouyanfif, August 2019 precursors has documented protective effect against chronic diseases associated with inflammation (Wall et al. 2010). Omega 3 fatty acids are refereed to nutraceutical, which means it may be beneficial in both preventing and improving a wide group of diseases. According to the American Heart Association recommendations, the ω-3-rich fatty marine fish such as mackerel, herring, sardines, tuna, and salmon, should be included into the diet at least twice a week. A minimal daily dose of 250-500 mg EPA and DHA combined is recommended by the 2015 Dietary Guidelines for Americans and most of mainstream health organizations to maintain overall health (Campbell and Bello 2012). Importantly, a significant segment of American population is not meeting the recommendations for ω-3 fatty acid intake. The estimated average intake of EPA and DHA from foods and dietary supplements is 0.41g/day and 0.72g/day respectively in US (Papanikolaou et al. 2014). Overall, dietary supplementation of ω-3 fatty acids has proven to be directly associated with human health and development. PUFAs generate pro-resolving lipid mediators, including AA-derived lipoxins, n3-EPA-derived resolvins of the E-series, DHA-derived resolvins of the D-series, protectins and maresins, during the resolution phase of acute inflammation. These Endogenous hormone-like bioactive compounds are contributory factors of the regulation of pathological inflammation and various physiological activities in humans and animals (Lee et al. 2016; Meesapyodsuk and Qiu 2012; Barden et al. 2016). All mentioned above suggests that science-based dietary interventions, using ω- 3 PUFAs or their combinations, represent a promising soft therapeutic approach to prevention and treatment diet-induced obesity and its associated co-morbidities, and provide insight to the mechanisms of ω-3 FAs and their actions (Campbell and Bello 2012). Dissecting molecular and physiologic mechanisms mediating the biologic effects of ω-3 PUFAs as well as the mechanisms regulating their metabolism has become a hot topic in the biomedical research. The next section will focus on the C. elegans nematode as a novel and exciting model organism for ω-3 PUFA-related studies. Unlike most other animal, C. elegans is capable of de novo synthesizing long chain PUFAs. This 22

Texas Tech University, Amal Bouyanfif, August 2019 model may yield new insights for the nutritional scientist interested in evaluating a therapeutic potential of ω-3 PUFAs and using them for developing science-based diets for prevention and/or treatment of obesity and its associated metabolic disorders.

1.5. Review of the C. elegans as a model organism and its advantages

In 1963, the South African biologist, Sydney Brenner introduced Caenorhabditis elegans (Caeno, recent; rhabditis, rod; elegans, nice) commonly named C. elegans as a model organism to pursue the research in developmental biology and neurology (Riddle et al. 1997; WormClassroom.org). C. elegans is a free-living, non-parasitic, non-hazardous, non-infectious and non-pathogenic soil nematode that has been widely used in laboratories worldwide. The roundworm is transparent throughout its life cycle and is about 1 mm in length at adulthood. In different regions of the world, C. elegans lives in the soil, mainly in rotting vegetation, where it can feed on bacteria. Under laboratory conditions, it is routinely cultured in an agar petri dish seeded with Escherichia coli (E. coli) as a food source providing carbohydrates, proteins, saturated and mono-unsaturated fatty acids derived from digestion of bacterial membranes (Brooks et al. 2009). Advantages of using these bacteria include their ability to form a thin layer after multiplying that allows for optimal visualization of worms development. Another important advantage of the C. elegans as a model organism is its short life span. As illustrated in Figure 1.4, an egg develops to an adult within about 3.5 days at 20°C. Alike in other nematodes, C. elegans develops through four larval stages (L1- L4), separated by molts (Figure 1.4) (Cassada and Russell 1975; Murgatroyd and Spengler 2010). The whole life span is about 3 weeks. The period required for generating adult nematodes capable of producing progeny is as short as 3.5 days, which is about 15 fold shorter than in mice and 3 fold shorter than in Drosophila melanogaster fruit fly or Danio rerio (zebrafish). C. elegans can be easily and cheaply cultivated in large numbers, i.e., about 10,000 worms per plate in the laboratory (300-350 progenies per nematode). There are two sexual forms of the worm; a self-fertilizing hermaphrodite and a male which is smaller in size and rare. The male can be recognized by its fan- shaped tail. The adult hermaphrodite, which is the first higher organism that had its

23

Texas Tech University, Amal Bouyanfif, August 2019 genome completely sequenced, harbors about 17,800 distinct genes, 65% of which are associated with human diseases (Zheng and Greenway 2012). Despite genetic homology between humans and C. elegans is lower than between humans and mouse, D. melanogaster or zebrafish, C. elegans still represents a physiologically relevant model for studying lipid metabolism due to its completely sequenced genome and easy of genetic manipulations and screening for mutants having necessary metabolic deviations. For instance, genetic defects in fatty acid desaturation and elongation provide a set of mutant worm strains (fat-1, fat-2, fat-3, fat-4, elo-1) incapable of PUFA synthesis, which makes the lipid metabolism in these strains similar to humans (Watts and Browse 2002). Interestingly, C. elegans has only 959 somatic cells, of which 302 are neurons and 95 are muscle cells (Imanikia and Stürzenbaum 2013). Last but not least, no ethics constraints are associated with culturing C. elegans. It reduces significantly the “indirect workload” related to getting quick answers for emerging research questions related to human or animal health. The same is true for D. melanogaster and zebrafish, but these otherwise simple model species are not as easily manageable and convenient for housing and reproduction purposes. Tables 1.1 and 1.2 provide comparison between C. elegans and other model organisms as well as differences and similarities in lipid metabolism among C. elegans and mammals.

24

Texas Tech University, Amal Bouyanfif, August 2019

Figure 1.4: C. elegans life cycle at 20oC. The life cycle of this nematode is about 3.5 days long. Under standard laboratory conditions, reproductive adult worms survive for approximately 3 weeks. The regular ontogenesis includes embryonic stage, four larval stages (L1 to L4; separated by molts) and adulthood. Under the stress conditions (starvation, crowding, high temperature), the roundworm can enter an alternative L3 stage called the Dauer state, which can last for several months. The Dauer Larva develops from a pre-Dauer L2 (L2d). Numbers in red underneath the arrows show the timespan that the worm stays at the indicated stage.

Table 1.1: Comparisons between C. elegans and other model organisms. Organism Advantages Drawbacks - Small size/ 959 somatic cells - Only 65% of worm genes - Simple anatomy homologous to human genes - Transparent body - Lacking some organs and Nematode - Short lifespan: 2–3 weeks tissues: blood, brain and (Caenorhabditis elegans) - Short generation time: 2–3 days internal organs - Inexpensive and easy to grow - Cultures may subject to - Cultures can be frozen contamination - Genome is sequenced and annotated - Numerous isogenic mutant strains available

- Small size - Only 50–80% of fly genes Fruit Fly - Short generation time: 10 days homologous to human genes (Drosophila melanogaster) - Inexpensive and easy to grow - Lack of physiologic similarity - Genome is sequenced and annotated with humans - Cultures cannot be frozen

25

Texas Tech University, Amal Bouyanfif, August 2019

Table 1.1. Continued.

- Small size - Long generation time: 2–4 Zebrafish - Transparent embryos months (Danio rerio) - Draft genome is available - Isogenic strains are not available Pufferfish - Genome is sequenced and annotated - Produces lethal toxin (Fugu rubripes) - Very small genome for a vertebrate - No transgenic technology exists - Strong genetic, physiological overlap - Comparatively expensive Mouse with humans - Comparatively long lifespan (Mus musculus) - Genome is sequenced and annotated - Comparatively long generation time: 2–3 months - Ethical concerns

Chimpanzee - Genome is sequenced and annotated - Long lifespan (Pan troglodytes) - Most closely related to humans - Long generation time - Very expensive and labor- consuming housing - Ethical concerns

Table 1.2: Differences and similarities in lipid homeostasis among C. elegans and mammals. Lipid metabolism regulators C. elegans Mammals - ∆-desaturase Fatty acids synthesis Fatty acids synthesis - ∆-12-desaturase Fatty acids synthesis Not available - ω-3 fatty acyl desaturase Fatty acids synthesis Not available - Insulin-like pathway Lipid metabolism Lipid metabolism - AMP-activated protein kinase Fat storage and use Fat storage and use - Serotonin signaling Fat metabolism and feeding behavior Fat metabolism and - Sterol response element binding Fat storage feeding behavior protein (SREBP) Fat storage - TUB-1 protein Peripheral lipid storage

- Leptin Not available Peripheral lipid storage - LDL family receptors Fatty acids transport Food intake and energy balance Fatty acids transport

Taken together, these unique characteristics make C. elegans an effective model and an attractive pool of resources for scientists to use in a variety of biomedical research. Key C. elegans advantages as a model organism include (Riddle et al. 1997; Jones and Ashrafi 2009):

26

Texas Tech University, Amal Bouyanfif, August 2019

. Small size and transparent body that enable for noninvasive imaging and scaled screening the effects of treatments using microscopy techniques. . Constant cell numbers and position between individual worms. . Rapid growth, quick turnover, and large brood sizes which reduce the experimental timeline compared to rodent and other animal studies. . Simple nervous system which dissects neural circuits that govern metabolism, nutrient perception as well as food-related behaviors. . C. elegans culture can be placed for a long-term storage as a frozen stock and avoid the expenses associated with long-term colony maintaining. . As C. elegans is a nematode, its use does not require an animal approval compared to rodents and higher animals, further facilitating research on this organism. . Small size of well-annotated genome which facilitates genetic analyses as well as producing genetically modified roundworm strains. The mutations can be easily introduced into C. elegans genome by a variety of mutagens. Thus, many highly affordable genetically modified strains, such as dumpy, small, and long mutated worms are available for biomedical research from the Caenorhabditis Genetics Center (CGC, Minnesota). This Center is funded by the National Institute of Health–National Center for Research Resources. Current studies report using C. elegans as a model organism for exploring a variety of biological processes including apoptosis, insulin signaling, gene regulation, metabolism, aging and satiety. Importantly, in obesity, C. elegans has been used for unraveling the mechanisms of dyslipidemia, for ascertaining endocrine regulation deviations, as well as for evaluating the effects of dietary interventions and other obesity therapies (Zheng and Greenway 2012). Table 1.3, adapted from the National Center for Biotechnology Information (NCBI), summarizes some key C. elegans metabolic genes.

27

Texas Tech University, Amal Bouyanfif, August 2019

Table 1.3: Genes related to nutrition and obesity research in C. elegans mutants, strain: Bristol N2. C. elegans Gene Name Description Location

Insulin-like growth factor receptor Chromosome III, NC_003281.10 daf-2 subunit beta (2995919..3028702, complement) (Dauer formation-2) Dauer larva development Chromosome III, NC_003281.10 daf-7 regulatory growth factor daf-7 (811938..813275) (Dauer formation-7) Forkhead box protein O Chromosome I, NC_003279.8 daf-16 (10750498..10775050) hypothetical protein Chromosome IV, NC_003282.8 daf-18 (420426..425148, complement) Tubby protein homolog 1 Chromosome II, NC_003280.10 tub-1 (8154771..8156937, complement) TryPtophan Hydroxylase Chromosome II, NC_003280.10 tph-1 (7549358..7551777) hypothetical protein Chromosome I, NC_003279.8 egl-30 (1835936..1840888) Omega-3 fatty acid desaturase fat-1 Chromosome IV, NC_003282.8 fat-1 (13315646..13318606) Delta(12) fatty acid desaturase fat-2 Chromosome IV, NC_003282.8 fat-2 (13323880..13326278) Delta(6)-fatty-acid desaturase fat-3 Chromosome IV, NC_003282.8 fat-3 (9803063..9805999) Delta(9)-fatty-acid desaturase fat-5 Chromosome V, NC_003283.11 fat-5 (17725005..17726717) Delta(9)-fatty-acid desaturase fat-6 Chromosome IV, NC_003282.8 fat-6 (11913819..11915668, complement)

Delta(9)-fatty-acid desaturase fat-7 Chromosome V, NC_003283.11 fat-7 (7151447..7153131, complement)

Acyl-CoA dehydrogenase family Chromosome III, NC_003281.10 acdh-11 member 11 (10566286..10571549)

Neuronal acetylcholine receptor Chromosome II, NC_003280.10 eat-2 subunit eat-2 (14166888..14171484, complement)

ACTin Chromosome III, NC_003281.10 act-5 (13604554..13606066, complement) Nuclear Hormone Receptor family Chromosome I, NC_003279.8 nhr-49 (9869718..9874124) fatty Acid CoA Synthetase family Chromosome V, NC_003283.11 acs-2 (15567408..15569685)

28

Texas Tech University, Amal Bouyanfif, August 2019

Table 1.3. Continued.

ATPase inhibitor mai-2, Chromosome IV, NC_003282.8 mai-2 mitochondrial (3385911..3386765) Mediator of RNA polymerase II Chromosome III, NC_003281.10 mdt-15 transcription subunit 15 (5830222..5833337, complement)

Suppressor of Constitutive Dauer Chromosome X, NC_003284.9 SCD-1 formation (12504620..12509217, complement) (Stearoyl-CoA Desaturase) ALK tyrosine kinase receptor Chromosome V, NC_003283.11 SCD-2 homolog scd-2 (6633269..6639420) (Stearoyl-CoA Desaturase) Acetyl-CoA acetyltransferase Chromosome II, NC_003280.10 kat-1 homolog, mitochondrial (7073815..7075409) Sterol regulatory element Binding Chromosome III, NC_003281.10 SBP-1 Protein (11428418..11442565, complement)

Very-long-chain 3-oxooacyl-coA Chromosome III, NC_003281.10 let-767 reductase let-767 (6338598..6339955, complement)

1.6. Related research on omega-3 fatty acid metabolism that has been conducted in C elegans and knowledge gained Wild type C. elegans nematode stores fat mainly in droplets within hypodermal and intestinal cells (Figure 1.5). The quantification of fats accumulated in C. elegans body may be conducted using biochemical assays, measuring fat uptake, fat oxidation, and other methods appropriate for most of models organism (Zheng and Greenway 2012). But in addition to that, due to transparency of C. elegans body, its fat depositions can be easily visualized in intact nematode using lipid-specific dyes, such as Nile Red, Oil Red O or Sudan Black, which do not affect the C. elegans brood-size, growth rate or lifespan (Ashrafi 2007). The quantification of visualized fats can be performed simply by measuring the intensity of the accumulated dye (Ashrafi et al. 2003; Yen et al. 2010).

29

Texas Tech University, Amal Bouyanfif, August 2019

Figure 1.5: Visualization of intestinal fat droplets in C. elegans body. (A) Oil Red O staining in N2 wild type (WT) and Fat-3 mutant worms. (B) Nile Red staining in N2 WT nematode. Due to the transparency of C. elegans body, lipid droplets, intestine, embryos are easily visualized using conventional staining protocols.

Like mammals, and as discussed above, a wide range of saturated, monounsaturated and polyunsaturated fatty acids such as ω-6 AA (20:4 ω-6) and ω-3 EPA (20:5 ω-3), as well as monomethyl branched chain fatty acids (mmBCFAs), is present in C. elegans (Ashrafi 2007; Kniazeva et al. 2004). Triglycerides in C. elegans represent approximately 40–55% of total body lipids depending on diet and growth stage (Ashrafi 2006). Principal phospholipids are 55% ethanolamine (about 55%), choline (32%) and sphingomyelin (8%). Cardiolipin, inositol and lyso-choline account for the remaining 5% phospholipids (Satouchi et al. 1993; Tanaka et al. 1996). In addition to mammals, ∆12 and ∆15 desaturases have been identified in some plants (Arabidopsis thaliana), lower eukaryotes, and animals such as nematodes. These enzymes introduce a double bond at the twelfth and fifteenth carbon-carbon position in 30

Texas Tech University, Amal Bouyanfif, August 2019 fatty acid molecules (Lee et al. 2016). Figure 1.6 indicates the synthetic pathways of ω- 3 and ω-6 PUFAs from their common precursors stearic and oleic acids to 20-carbon fatty acids in the C. elegans. It is noteworthy that, unlike other animals including humans, C. elegans organism does contain both Δ12 and Δ15 enzymes (Imanikia and Stürzenbaum 2013; Watts 2016). For this reason, C. elegans does not require essential fatty acids supplemented with diet.

Figure 1.6: Metabolism of ω-3 and ω--6 PUFAs in C. elegans. Unlike humans, C. elegans is capable of producing the ω-3 PUFAs via the enzymatic conversion of various ω-6 PUFAs, biosynthesized from the short-chain stearic and oleic acid precursors. Δ12D stands for delta-12 desaturase (encoded by fat-2 gene); ω-3D – for omega-3 desaturase (encoded by fat-1 gene); Δ6D – for delta-6 desaturase (encoded by fat-3 gene); Δ5D – for delta-5 desaturase (encoded by fat-4 gene).

Excluding the nematodes, all other mammals including humans lack ω-3 desaturase genes which convert ω-6 fatty acids to ω-3 fatty acids. Among nematodes, the roundworm C. elegans unlike most other animals, possesses the genes for the protein products mediating the endogenous biosynthesis of long chain ω-3 PUFAs including fat-1 gene, coding the ω-3 desaturase (Δ15 desaturase) required for converting 18- carbon LA and GLA ω-6 fatty acids into ω-3 ALA and STA respectively (Spychalla et al. 1997). Another unique fatty acid metabolism gene carried by C. elegans is a fat-2,

31

Texas Tech University, Amal Bouyanfif, August 2019 coding the Δ12 enzyme, which mediates the synthesis of 18-carbon ω-6 LA from its precursor, 18-carbon ω-6, the monounsaturated fatty acid (MUFA) OA (Wang et al. 2013; Kang et al. 2004). The other two enzymes, delta-6 desaturase encoded by fat-3 gene and delta-5 desaturase encoded by fat-4 gene, are involved in the biosynthesis of 20- carbon PUFAs (Fig. 6). However, like mammals, C. elegans delta-9 fatty acid desaturases, encoded by fat-5 and fat-6/fat-7 genes, are regulated by transcriptional regulator sterol response element binding protein (SREBP) and nuclear hormone receptors (NHRs). ∆9 fatty acid desaturases convert saturated fatty acids into monounsaturated FAs (MUFAs). Though, C. elegans lacks the specific enzyme required for fatty acid elongation to 22-carbon PUFAs (Ashrafi 2007). Similar to mammals, C. elegans possesses key enzymes (e.g., acetyl CoA carboxylase (ACC) and fatty acid synthase (FASN)) for fatty acid biosynthesis (Ashrafi 2007; Watts 2016). The presence of complete set of fatty acid metabolism genes which code all enzymes, found in plants and animals, required for desaturating and elongating fatty acid molecule, makes C. elegans a unique model organism for lipid metabolism studies. In addition, core fat and sugar metabolic pathways in C. elegans are similar to their mammalian analogues. Considerably, genetic alterations of metabolic enzymes affect fat deposition in C. elegans. Inactivation of specific proteins belonging to desaturases and elongases families, (encoded by fat and elo genes respectively), results in lipid metabolism deviations (Ashrafi 2007) which may mimic different aspects of dyslipidemia in humans. In worms, inactivation of these genes is associated with metabolic, physiological and behavioral nematode phenotypes, such as reduced body size, deviated body adiposity, growth retardation, reproductive defects, and changes in physiological rhythms, slowed movement, reduced adult lifespan, as well as defects in sensory signaling and neurotransmission (Watts 2006; Watts et al. 2003). Mutant C. elegans strains, lacking the activity of certain desaturases were used as a model organism in research devoted to anti-inflammatory PUFAs effects in reproduction, neurobiological studies, as well as in experiments over the nematode lifespan and ontogenesis (Watts 2016). Importantly, C. elegans does not express such 32

Texas Tech University, Amal Bouyanfif, August 2019 mediators of inflammation as TNF-α and nuclear factor kappa-B (NF-κβ), extensively used for evaluating the severity of inflammation in other vertebrate animal models and humans. Because C. elegans body does not have blood vessels, the roles of PUFAs can be studied independently of their inflammatory functions (Watts 2016). Furthermore, the impact of specific fatty acids on lifespan and aging processes in C. elegans were recently evaluated (Schroeder and Brunet 2015; Amrit et al. 2014). Previous studies demonstrated that PUFAs- derived mediators (F-series prostaglandins) synthesis in this worm is mediated by insulin signaling in the intestine and TGF-β signaling in sensory neurons to ensure the process of reproduction (Watts 2016; Edmonds et al. 2010). Furthermore, dietary supplementation of DGLA (20:3 ω-6) resulted in sterility associated with germ cell death due to apoptosis, caused by production of specific epoxy- and hydroxyl- toxic metabolites through the activity of CYP-33E2, one of the major isoforms of Cytochrom-P450 protein family, involved in the production of long chain fatty acids metabolites (Deline et al. 2015). On the contrary, high concentrations of EPA-rich fish oil intake did not affect C. elegans fertility (Watts 2006). However, it led to shorter lifespan due to oxidative stress caused by accumulation of reactive lipid peroxidation products, damaging cell proteins and nucleic acids. Recent study reported that oleic acid derivatives, ethanolamide oleoylethanolamid, accumulate in C. elegans over-expressing lysosomal acid lipase 4 (LIPL-4) and lacking the germline. LIPL-4 triggered nuclear translocation of LPB-8 (lysosomal lipid chaperone) thereby increasing longevity by activating nuclear hormone receptors NHR-49 and NHR-80 and regulating ∆9 desaturases expression (Folick 2015). Moreover, adding a low concentrations of glucose to C. elegans diet shortens the lifespan of the worm by inhibiting DAF-16 and HSF-1 transcription factors (Lee et al. 2009). In humans, high sugar content leads to excessive lipid accumulation and eventually causes obesity, diabetes, and heart disease (DiNicolantonio et al. 2016; Kolderup and Svihus 2015). Supplementing the C. elegans diet with oleic acid (ω-9, monounsaturated), arachidonic acid (ω-6, polyunsaturated), and EPA (ω-3, polyunsaturated) influence both reproduction and longevity of these animals (Lynn 2015). Regarding the neural function of C. elegans, Watts reported that 20-carbon 33

Texas Tech University, Amal Bouyanfif, August 2019

PUFAs are required for synaptic vesicle formation; and accumulation and both ω-6 and ω-3 PUFAs perform the required cellular functions but they have different roles in neurological processes while ω-3 fatty acids are specifically required for maintaining the neuroplasticity (Watts 2016). In particular, they are capable of compensating the effects of alcohol intoxication in this model (Raabe et al. 2014). Clinical and animal model studies are very valuable in understanding mechanisms mediating effects of bioactive food compounds such as omega 3 fatty acids. However, these are both expensive and time consuming, and are often limited for research studies, due to ethical concerns. Therefore, there is critical need for affordable and efficient animal models for scaled screening of various bioactive compounds or pharmacological agents in various diseases including obesity. In this review, we focused on Caenorhabditis elegans nematode as an affordable, convenient and metabolically relevant model organism to understand the mechanisms mediating effects of ω-3 PUFAs effects in obesity and inflammation. C. elegans can be further expanded and applied to other metabolic studies using dietary compounds and botanicals. However, in spite of all the excellent features discussed above, there are also numerous drawbacks for this nematode as a model organism. The long evolutionary distance between C. elegans and humans, including the fact that simple body of C. elegans lacks such essential for human physiology tissues and organs as blood, brain, defined fat cells and is subjected to significantly different mechanisms of central regulation, arises a question, whether the data, generated using this worm, can be directly extrapolated on humans. Most likely, the lipid metabolism data, generated using C. elegans, will require further validation using a mouse or another model organism, more closely related to humans. Also, the small size of C. elegans, can be an issue when comparatively high amounts of tissues or cells are required for biochemical and/or molecular analyses.

1.7. Role of microRNAs in mediating nutritional and obesity-related effects in C. elegans and in other animal models MicroRNAs (miRNAs) are a group of small non-coding RNAs which function as specific post-transcriptional inhibitors of target gene expression (Ha and Kim 2014). miRNAs are ubiquitous in both animal and plant genomes and are highly conserved 34

Texas Tech University, Amal Bouyanfif, August 2019 between related species. By their ability to quench gene expression, miRNAs are similar to small interfering RNAs (siRNAs), another class of regulatory non-coding RNA molecules, but miRNA biogenesis from maternal DNA sequences is quite different from siRNA synthesis (Bartel 2004). While still in nucleus, the primary long transcript of miRNA gene, a pri-miRNA, is cleaved by the protein complex which, in C. elegans, includes DRSH-1 RNase (Drosha in mammals) and PASH-1 (Partner of Drosha; Pasha in mammals) (Denli et al. 2004), to produce the 60-70 nucleotides long intermediate called pre-miRNA (Lima and Pasquinelli 2014). Following its transport to the cytoplasm, the pre-miRNA is converted to functional miRNA by additional cleavage performed by Dicer endoribonuclease as well as ALG-1 and ALG-2 proteins (Bouasker and Simard 2012; Hutvagner et al. 2004) which belong to argonaute (AGO) RNase family and are the only two AGOs in C. elegans, reported to take part in miRNA biosynthesis. Other 24 AGO proteins, described for the worm, participate in gene regulation processes, mediated by other small RNAs (Grishok 2013). In the cytoplasm, mature miRNA, complexed with ALG-1/ALG-2, AIN-1/AIN-2 (GW-182 in mammals) and poly(A)-binding protein (PABP) molecules to create an RNA-induced silencing complex (RISC) which binds the 3’-untranslated region of target mRNA and prevents protein biosynthesis on this molecule by interfering with the process of translation on its initiation and/or elongation phases or by destabilizing the target mRNA itself (Li and Rana 2014). Importantly, miRNAs are multipurpose molecules: a typical miRNA is capable of regulating the translation of about 200 target mRNAs (Krek et al. 2005). Several C. elegans strains as well as few other Caenorhabditis species were used by the group of Lee et al. to report the first ever miRNA molecule in their pioneer study published in 1993. They demonstrated that small RNA product, produced from non- protein encoding lin-4 genetic locus, directly inhibits the translation of lin-14 C. elegans gene, coding for the transcription factor involved in larva development regulation (Lee et al. 1993). Numerous other miRNAs regulating a wide variety of genes and biological processes were discovered for C. elegans and other species (Gesellchen and Boutros 2004; Lehrbach and Miska 2008; Lewis and Steel 2010). For humans, over 2,600 miRNAs are described to date (Kozomara and Griffiths-Jones 2014), and the predicted 35

Texas Tech University, Amal Bouyanfif, August 2019 number of miRNAs encoded by human genome is over 6,000 (Londin et al. 2015). The fact that among miRNA genes harbored by human genome, about a half have analogues in C. elegans (Lagos-Quintana et al. 2003), makes this roundworm a well fit model for studies of the role of miRNAs in regulating gene activity and physiological functions in health and disease. Despite the wealth of resources related to C. elegans and miRNA research in this organism, very limited studies have used the C. elegans as a model organism for the studies dissecting the role of miRNAs in regulation of diet-induced metabolic genes and pathways related to obesity or metabolic diseases. To date, rodents and cell systems remain a principal animal model for such studies. To certain extent surprisingly, in spite of numerous published studies of the mechanisms of miRNA-mediated regulation of metabolism and other vital functions in C. elegans reviewed in (Chandra et al. 2017; Zhu et al. 2016) and accumulated data regarding the role of miRNAs in obesity and inflammation in rodent models, studies of protective effects of ω-3 PUFAs (as well as other bioactive food components) using C. elegans are absent from the literature. Zheng et al. were first to use the in vivo rat model of diet-induced chronic inflammation to investigate the alterations in miRNA transcriptome caused by supplementing the rat diet with ω-3 EPA and DHA PUFAs vs ω-6 LA (Zheng et al. 2015). The authors found that after 16 weeks of respective diet, the expression of 54 miRNA genes was different in animals fed EPA/DHA (1.5:1) mix compared to those whose diet was enriched with ω- 6 PUFA. Feeding rats with EPA and DHA was associated with increased numbers of blood regulatory T-cells as well as levels of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) cytokine markers of inflammation. The list of pro- and anti- inflammatory pathways, presumably affected by these miRNAs included, in particular, pattern recognition receptors, the nucleotide-binding oligomerization domain (NOD)- like and Toll-like receptors and transforming growth factor beta (TGF-β). In the study, using a mouse model of high fat diet (HFD)-induced obesity to investigate the effects of ω-3 vs. ω-6 PUFAs on brown adipogenesis (Kim et al. 2016), the upregulation of miR-30b and miR-378 miRNAs in brown adipose tissue (BAT) after 12 weeks of the diet was reported for the HFD-fed animals whose diet was enriched with EPA, but not 36

Texas Tech University, Amal Bouyanfif, August 2019

ω-6 OA or LA. The observed increase was mediated by stimulation of FFAR4/GRP120, the ω-3 PUFA receptor expressed by adipocytes, and associated with elevation of cellular cAMP (cyclic adenosine monophosphate) levels. Moreover, silencing the activity of two above miRNAs in vitro by respective antisense inhibitors resulted in compromising regular BAT gene expression pattern. The expression of uncoupling protein 1 (UCP-1, thermogenin), a key mitochondrial transmembrane protein mediating a heat generation in brown, but not white adipocytes was significantly reduced when these miRNAs were inhibited. Nevertheless, in several nutritional studies, C. elegans was used to unravel the role of miRNAs in mediating the protective effects of diet restriction (DR). Expression of miR-80 gets upregulated in well fed worms and is reduced in fasting. Genetic deficiency of this miRNA mimics constitutively the conditions of DR and is associated with a lifespan extension in C. elegans (Vora et al. 2013). Consistently with this, at the absence of miR-80, C. elegans becomes hypersensitive to metformin, the anti-diabetic drug which also induces a DR-like state in these nematodes (Vora et al. 2013; Onken and Driscoll 2010). Authors hypothesize that miR-80 switches C. elegans metabolism to DR mode by inactivating the mRNA of CBP-1 transcription factor, the C. elegans homolog of mammalian CREB-binding protein (CREBP)/p300 family (Table 1.4). More transcription factors, involved in mediating the DR-induced longevity by miRNAs in C. elegans, were identified by network analysis of aging-associated mi-RNAs conducted by Smith-Vikos et al (Smith- Vikos et al. 2014). PHA-4, previously described as C. elegans embryonic development regulator and a homolog of mammalian hepatocyte nuclear factor 3 (HNF3) (Horner et al. 1998), is downregulated by miR-71 and miR-228. miR-71 additionally inhibits SKN- 1 (skinhead-1), the C. elegans homolog of Nrf (Nuclear factor-erythroid-related factor), the family of transcription factors regulating the metabolism and stress response in mammals (Blackwell et al. 2015). Expression of these both mi-RNAs is enhanced in DR. Interestingly, two targeted transcription factors exert different feedback regulation effects on inhibiting miRNAs. PHA-4 stimulates miR-228 expression. SKN-1 downregulates miR-228 and promotes miR-71. These findings suggest that a set of mi-

37

Texas Tech University, Amal Bouyanfif, August 2019

RNAs, induced by DR, acts as a coordinated network with a complicated system of feedback loops.

Table 1.4: miRNAs in C. elegans related to longevity and immunity. miRNA Factor, modulating Molecular Biologic function Reference expression targets regulated miR-48 bacterial infection SKN-1 resistance to infection (Horner et al. 1998) miR-71 diet restriction PHA-4, Longevity (Vora et al. SKN-1 2013) miR-80 ad lib feeding CBP-1 Longevity (Zheng et al. 2015) miR-84 bacterial infection SKN-1 longevity, resistance to (Horner et al. infection 1998) miR-228 diet restriction PHA-4 Longevity (Vora et al. 2013) miR-241 bacterial infection SKN-1 longevity, resistance to (Horner et al. infection 1998)

Recent study by Liu et al. illustrated that the innate immunity of C. elegans is also regulated by miRNAs (Liu et al. 2013). The resistance of infected worms against P. aeruginosa, opportunistic human pathogen provided as a food, is inhibited by the group of miRNAs which belong to let-7-Fam family. In particular, in wild type nematodes exposed to P. aeruginosa at early ontogenesis stages, miR-241 levels are decreased about 2-fold, indicating its negative association with the mechanisms of anti- bacterial defense. Moreover, two mutant C. elegans strains devoid of miR-84 or miR- 241 demonstrated the improved survival levels in response to challenge by P. aeruginosa or, to lesser extent, by other microbial pathogens. This data is corroborated by reports that let-7-family of miRNAs are downregulated in mammals in response to bacterial and protozoan infections (Chen et al. 2007; Hu et al. 2009; Schulte et al. 2011). The expression of these miRNAs in C. elegans is modulated via p38 MAPK pathway, which regulates also the roundworm’s developmental timing (Liu et al. 2013). Consistent with these effects of miRNAs on worm’s immunity, deficiency in the above mentioned Dicer protein, a crucial regulator of miRNA biosynthesis, is associated with significant alterations in expression of genes involved in C. elegans immune responses (Welker et al. 2007).

38

Texas Tech University, Amal Bouyanfif, August 2019

Taken together, the experiments described above suggest that C. elegans has emerged as a convenient and highly relevant research tool for elucidating the cellular and molecular mechanisms of the effects of dietary factors such as omega 3 fatty acids on animal and human health.

1.8. Conclusions and future direction of the field

Scientific evidence is accumulating that bioactive food components, including ω-3 PUFAs, discussed here, modulate the expression of genes involved in energy and lipid metabolism. Including these fatty acids into diets may provide both anti-obesity and anti-inflammatory benefits in metabolic diseases. The C elegans has emerged as a valuable model organism and tool for obesity and nutrition studies. Due to its short life cycle and unique fatty acid metabolism and availability and ease of generation of mutants with targeted deletions of long chain fatty acid metabolizing genes, simple genetics relevant to humans, the C. elegans represents a highly relevant time-sparing model organism, for biomedical and nutritional investigations. It can be conveniently used to further dissect mechanisms mediating metabolic effects ω-3 PUFAs and other bioactive compounds, as well as mechanistic studies of the role of miRNAs in health and disease.

Acknowledgments All authors (AB, SJ, IK and NMM) have contributed to this manuscript and have read and approved the submitted version. This work was funded in part by a USDA AFRI NIFA exploratory award 2014-07216 (NMM), and The Texas Tech University Obesity Research Cluster.

39

Texas Tech University, Amal Bouyanfif, August 2019

1.9. References Aben A, Danckaerts M (2010) [Omega-3 and omega-6 fatty acids in the treatment of children and adolescents with ADHD]. Tijdschr Psychiatr 52 (2):89-97

Ahmad SI, Imam SK (2016) Obesity: A practical guide. Springer, Switzerland doi:10.1007/978-3-319-19821-7

Amrit FRG, Ratnappan R, Keith SA, Ghazi A (2014) The C. elegans lifespan assay toolkit. Methods 68 (3):465-475. doi:10.1016/j.ymeth.2014.04.002

Ashrafi K (2006) Mapping out starvation responses. Elsevier Inc 3 (4):235–236. doi:http://dx.doi.org/10.1016/j.cmet.2006.03.002

Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Barden AE, Mas E, Mori TA (2016) n-3 Fatty acid supplementation and proresolving mediators of inflammation. Curr Opin Lipidol 27 (1):26-32. doi:10.1097/MOL.0000000000000262

Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 (2):281-297

Bazan NG (2005) Neuroprotectin D1 (NPD1): a DHA-derived mediator that protects brain and retina against cell injury-induced oxidative stress. Brain Pathol 15 (2):159-166

Blackwell TK, Steinbaugh MJ, Hourihan JM, Ewald CY, Isik M (2015) SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radic Biol Med 88 (Pt B):290-301. doi:10.1016/j.freeradbiomed.2015.06.008

Bouasker S, Simard MJ (2012) The slicing activity of miRNA-specific Argonautes is essential for the miRNA pathway in C. elegans. Nucleic Acids Res 40 (20):10452-10462. doi:10.1093/nar/gks748

Bouyanfif A, Liyanage S, Hewitt JE, Vanapalli SA, Moustaid-Moussa N, Hequet E, Abidi N (2017) FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains. Analyst 142 (24):4727-4736. doi:10.1039/c7an01432e

40

Texas Tech University, Amal Bouyanfif, August 2019

Brockmann GA, Bevova MR (2002) Using mouse models to dissect the genetics of obesity. Trends Genet 18 (7):367-376

Brooks KK, Liang B, Watts JL (2009) The influence of bacterial diet on fat storage in C. elegans. PLoS One 4 (10):e7545. doi:10.1371/journal.pone.0007545

Buckley JD, Howe PRC (2010) Long-Chain Omega-3 Polyunsaturated Fatty Acids May Be Beneficial for Reducing Obesity-A Review. Nutrients 2 (12):1212-1230. doi:10.3390/nu2121212

C. Gómez Candela LM, López B, Kohen VL (2011) Importance of a balanced omega 6/omega 3 ratio for the maintenance of health. Nutritional recommendations Nutr Hosp 26 (2):323-329. doi:10.3305/nh.2011.26.2.5117

Calder PC (2009) Polyunsaturated fatty acids and inflammatory processes: New twists in an old tale. Biochimie 91 (6):791-795. doi:10.1016/j.biochi.2009.01.008

Calder PC (2010) Omega-3 Fatty Acids and Inflammatory Processes nutrients 2: 355- 374. doi:10.3390/nu2030355

Calder PC (2013a) n-3 Fatty acids, inflammation and immunity: new mechanisms to explain old actions. Proceedings of the Nutrition Society 72 (3):326-336. doi:10.1017/S0029665113001031

Calder PC (2013b) Omega-3 polyunsaturated fatty acids and inflammatory processes: nutrition or pharmacology? Brit J Clin Pharmaco 75 (3):645-662. doi:10.1111/j.1365-2125.2012.04374.x

Campbell SC, Bello NT (2012) Omega-3 fatty acids and obesity. Journal of Food and Nutritional Disorders 1 (2). doi:10.4172/2324-9323.1000e105

Cassada RC, Russell RL (1975) The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans. Dev Biol 46 (2):326-342

Chandra S, Vimal D, Sharma D, Rai V, Gupta SC, Chowdhuri DK (2017) Role of miRNAs in development and disease: Lessons learnt from small organisms. Life Sci. doi:10.1016/j.lfs.2017.07.017

Charles N. Serhan, Jesmond Dalli, Romain A. Colas, Jeremy W. Winkler, Chiang N (2015) Protectins and Maresins: New Pro-Resolving Families of Mediators in Acute Inflammation and Resolution bioactive Metabolome. Biochim Biophys Acta, 185 (4):397–413. doi:10.1016/j.bbalip.2014.08.006.

41

Texas Tech University, Amal Bouyanfif, August 2019

Chen G, Pang Z (2013) Endocannabinoids and Obesity. In: Litwack G (ed) Vitamins and Hormones, vol 91. Elsevier Inc, pp 325-368. doi:https://doi.org/10.1016/B978-0-12-407766-9.00014-6

Chen XM, Splinter PL, O'Hara SP, LaRusso NF (2007) A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem 282 (39):28929-28938. doi:10.1074/jbc.M702633200

Coelho M, Oliveira T, Fernandes R (2013) Biochemistry of adipose tissue: an endocrine organ. Arch Med Sci 9 (2):191-200. doi:10.5114/aoms.2013.33181

Deiuliis JA (2016) MicroRNAs as regulators of metabolic disease: pathophysiologic significance and emerging role as biomarkers and therapeutics. Int J Obes (Lond) 40 (1):88-101. doi:10.1038/ijo.2015.170

Deline M, Keller J, Rothe M, Schunck WH, Menzel R, Watts JL (2015) Epoxides Derived from Dietary Dihomo-Gamma-Linolenic Acid Induce Germ Cell Death in C. elegans. Scientific Reports 5. doi:ARTN 1541710.1038/srep15417

Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ (2004) Processing of primary microRNAs by the Microprocessor complex. Nature 432 (7014):231-235. doi:10.1038/nature03049

DiNicolantonio JJ, Lucan SC, O'Keefe JH (2016) The Evidence for Saturated Fat and for Sugar Related to Coronary Heart Disease. Prog Cardiovasc Dis 58 (5):464- 472. doi:10.1016/j.pcad.2015.11.006

Duvall MG, Levy BD (2016) DHA- and EPA-derived resolvins, protectins, and maresins in airway inflammation. Eur J Pharmacol 785:144-155. doi:10.1016/j.ejphar.2015.11.001

Edmonds JW, Prasain JK, Dorand D, Yang Y, Hoang HD, Jack Vibbert1 HMK, Miller MA (2010) Insulin/FOXO Signaling Regulates Ovarian Prostaglandins Critical for Reproduction. Dev Cell 19 (6): 858–871. doi:10.1016/j.devcel.2010.11.005

Fernandez-Sanchez A, Madrigal-Santillan E, Bautista M, Esquivel-Soto J, Morales- Gonzalez A, Esquivel-Chirino C, Durante-Montiel I, Sanchez-Rivera G, Valadez-Vega C, Morales-Gonzalez JA (2011) Inflammation, oxidative stress, and obesity. Int J Mol Sci 12 (5):3117-3132. doi:10.3390/ijms12053117

Fetterman JW, Jr., Zdanowicz MM (2009) Therapeutic potential of n-3 polyunsaturated fatty acids in disease. Am J Health Syst Pharm 66 (13):1169-1179. doi:10.2146/ajhp080411

42

Texas Tech University, Amal Bouyanfif, August 2019

Flachs P, Horakova O, Brauner P, Rossmeisl M, Pecina P, Franssen-van Hal N, Ruzickova J, Sponarova J, Drahota Z, Vlcek C, Keijer J, Houstek J, Kopecky J (2005) Polyunsaturated fatty acids of marine origin upregulate mitochondrial biogenesis and induce beta-oxidation in white fat. Diabetologia 48 (11):2365- 2375. doi:10.1007/s00125-005-1944-7

Flier JS (2004) Obesity wars: Molecular progress confronts an expanding epidemic. Cell 116 (2):337-350. doi:Doi 10.1016/S0092-8674(03)01081-X

Folick A, Oakley, H. D., Yu, Y., Armstrong, E. H., Kumari, M., Sanor, L., Wang, M. C. (2015) Lysosomal Signaling Molecules Regulate Longevity in Caenorhabditis elegans. Science 347 (6217):83-86. doi:10.1126/science.1258857

Gesellchen V, Boutros M (2004) Managing the genome: microRNAs in Drosophila. Differentiation 72 (2-3):74-80. doi:10.1111/j.1432-0436.2004.07202003.x

Gonzalez-Periz A, Horrillo R, Ferre N, Gronert K, Dong B, Moran-Salvador E, Titos E, Martinez-Clemente M, Lopez-Parra M, Arroyo V, Claria J (2009) Obesity- induced insulin resistance and hepatic steatosis are alleviated by omega-3 fatty acids: a role for resolvins and protectins. Faseb Journal 23 (6):1946-1957. doi:10.1096/fj.08-125674

Grishok A (2013) Biology and Mechanisms of Short RNAs in Caenorhabditis elegans. Adv Genet 83:1-69. doi:10.1016/B978-0-12-407675-4.00001-8

Grundy SM, Brewer HB, Jr., Cleeman JI, Smith SC, Jr., Lenfant C, American Heart A, National Heart L, Blood I (2004) Definition of metabolic syndrome: Report of the National Heart, Lung, and Blood Institute/American Heart Association conference on scientific issues related to definition. Circulation 109 (3):433-438. doi:10.1161/01.CIR.0000111245.75752.C6

Grundy SM, Cleeman JI, Daniels SR, Donato KA, Eckel RH, Franklin BA, Gordon DJ, Krauss RM, Savage PJ, Smith SC, Spertus JA, Costa F (2005) Diagnosis and management of the metabolic syndrome - An American Heart Association/National Heart, Lung, and Blood Institute Scientific Statement. Circulation 112 (17):2735-2752. doi:10.1161/Circulationaha.105.169404

Ha M, Kim VN (2014) Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol 15 (8):509-524. doi:10.1038/nrm3838

Harris WS, Mozaffarian D, Rimm E, Kris-Etherton P, Rudel LL, Appel LJ, Engler MM, Engler MB, Sacks F (2009) Omega-6 Fatty Acids and Risk for Cardiovascular

43

Texas Tech University, Amal Bouyanfif, August 2019

Disease A Science Advisory From the American Heart Association Nutrition Subcommittee of the Council on Nutrition, Physical Activity, and Metabolism; Council on Cardiovascular Nursing; and Council on Epidemiology and Prevention. Circulation 119 (6):902-907. doi:10.1161/Circulationaha.108.191627

Horner MA, Quintin S, Domeier ME, Kimble J, Labouesse M, Mango SE (1998) pha- 4, an HNF-3 homolog, specifies pharyngeal organ identity in Caenorhabditis elegans. Genes Dev 12 (13):1947-1952

Hu G, Zhou R, Liu J, Gong AY, Eischeid AN, Dittman JW, Chen XM (2009) MicroRNA-98 and let-7 confer cholangiocyte expression of cytokine-inducible Src homology 2-containing protein in response to microbial challenge. J Immunol 183 (3):1617-1624. doi:10.4049/jimmunol.0804362

Hutvagner G, Simard MJ, Mello CC, Zamore PD (2004) Sequence-specific inhibition of small RNA function. PLoS Biol 2 (4):E98. doi:10.1371/journal.pbio.0020098

Imanikia S, Stürzenbaum SR (2013) Invertebrates in Obesity Research. A Worm's Perspective. Animal Models for the Study of Human Disease ELSEVIER ACADEMIC PRESS

Jones KT, Ashrafi K (2009) Caenorhabditis elegans as an emerging model for studying the basic biology of obesity. Disease Models & Mechanisms 2 (5-6):224–229. . doi: 10.1242/dmm.001933

Jump DB, Depner CM, Tripathy S (2012) Omega-3 fatty acid supplementation and cardiovascular disease. J Lipid Res 53 (12):2525-2545. doi:10.1194/jlr.R027904

Jump DB, Tripathy S, Depner CM (2013) Fatty Acid–Regulated Transcription Factors in the Liver. Annu Rev Nutr 33:249-269. doi:10.1146/annurev-nutr-071812- 161139

Jung UJ, Choi MS (2014) Obesity and Its Metabolic Complications: The Role of Adipokines and the Relationship between Obesity, Inflammation, Insulin Resistance, Dyslipidemia and Nonalcoholic Fatty Liver Disease. International Journal of Molecular Sciences 15 (4):6184-6223. doi:10.3390/ijms15046184

Kabir M, Skurnik G, Naour N, Pechtner V, Meugnier E, Rome S, Quignard-Boulange A, Vidal H, Slama G, Clement K, Guerre-Millo M, Rizkalla SW (2007) Treatment for 2 mo with n 3 polyunsaturated fatty acids reduces adiposity and some atherogenic factors but does not improve insulin sensitivity in women with type 2 diabetes: a randomized controlled study. Am J Clin Nutr 86 (6):1670- 1679. doi:10.1093/ajcn/86.5.1670

44

Texas Tech University, Amal Bouyanfif, August 2019

Kalupahana NS, Claycombe K, Newman SJ, Stewart T, Siriwardhana N, Matthan N, Lichtenstein AH, Moustaid-Moussa N (2010) Eicosapentaenoic Acid Prevents and Reverses Insulin Resistance in High-Fat Diet-Induced Obese Mice via Modulation of Adipose Tissue Inflammation. Journal of Nutrition 140 (11):1915-1922. doi:10.3945/jn.110.125732

Kalupahana NS, Claycombe KJ, Moustaid-Moussa N (2011) (n-3) Fatty acids alleviate adipose tissue inflammation and insulin resistance: mechanistic insights. Adv Nutr 2 (4):304-316. doi:10.3945/an.111.000505

Kang JX, Wang J, Wu L, Kang ZB (2004) Transgenic mice: fat-1 mice convert n-6 to n-3 fatty acids. Nature 427 (6974):504. doi:10.1038/427504a

Kim J, Okla M, Erickson A, Carr T, Natarajan SK, Chung S (2016) Eicosapentaenoic Acid Potentiates Brown Thermogenesis through FFAR4-dependent Up- regulation of miR-30b and miR-378. J Biol Chem 291 (39):20551-20562. doi:10.1074/jbc.M116.721480

Kniazeva M, Crawford QT, Seiber M, Wang CY, Han M (2004) Monomethyl branched- chain fatty acids play an essential role in Caenorhabditis elegans development. PLoS Biol 2 (9):E257. doi:10.1371/journal.pbio.0020257

Kohli P, Levy BD (2009) Resolvins and protectins: mediating solutions to inflammation. Br J Pharmacol 158 (4):960-971. doi:10.1111/j.1476- 5381.2009.00290.x

Kolderup A, Svihus B (2015) Fructose Metabolism and Relation to Atherosclerosis, Type 2 Diabetes, and Obesity. J Nutr Metab 2015:823081. doi:10.1155/2015/823081

Kozomara A, Griffiths-Jones S (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res 42 (Database issue):D68-73. doi:10.1093/nar/gkt1181

Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M, Rajewsky N (2005) Combinatorial microRNA target predictions. Nat Genet 37 (5):495-500. doi:10.1038/ng1536

Kromhout D, Yasuda S, Geleijnse JM, Shimokawa H (2012) Fish oil and omega-3 fatty acids in cardiovascular disease: do they really work? Eur Heart J 33 (4):436- 443. doi:10.1093/eurheartj/ehr362

45

Texas Tech University, Amal Bouyanfif, August 2019

Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T (2003) New microRNAs from mouse and human. RNA 9 (2):175-179

Leaf A (2007) Prevention of sudden cardiac death by n-3 polyunsaturated fatty acids. J Cardiovasc Med (Hagerstown) 8 Suppl 1:S27-29. doi:10.2459/01.JCM.0000289270.98105.b3

Leaf A, Xiao YF, Kang JX, Billman GE (2003) Prevention of sudden cardiac death by n-3 polyunsaturated fatty acids. Pharmacol Ther 98 (3):355-377

Lee H, Park WJ (2014) Unsaturated Fatty Acids, Desaturases, and Human Health. J Med Food 17 (2):189-197. doi:10.1089/jmf.2013.2917

Lee JM, Lee H, Kang S, Park WJ (2016) Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances. Nutrients 8 (1):23. doi:10.3390/nu8010023

Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75 (5):843- 854

Lee SJ, Murphy CT, Kenyon C (2009) Glucose Shortens the Life Span of C. elegans by Downregulating DAF-16/FOXO Activity and Aquaporin Gene Expression. Cell Metabolism 10 (5):379-391. doi:10.1016/j.cmet.2009.10.003

Lehrbach NJ, Miska EA (2008) Functional genomic, computational and proteomic analysis of C. elegans microRNAs. Brief Funct Genomic Proteomic 7 (3):228- 235. doi:10.1093/bfgp/eln024

Lewis MA, Steel KP (2010) MicroRNAs in mouse development and disease. Semin Cell Dev Biol 21 (7):774-780. doi:10.1016/j.semcdb.2010.02.004

Li Z, Rana TM (2014) Therapeutic targeting of microRNAs: current status and future challenges. Nat Rev Drug Discov 13 (8):622-638. doi:10.1038/nrd4359

Lima SA, Pasquinelli AE (2014) Identification of miRNAs and their targets in C. elegans. Adv Exp Med Biol 825:431-450. doi:10.1007/978-1-4939-1221-6_12

Liu F, He CX, Luo LJ, Zou QL, Zhao YX, Saini R, Han SF, Knolker HJ, Wang LS, Ge BX (2013) Nuclear hormone receptor regulation of microRNAs controls innate immune responses in C. elegans. PLoS Pathog 9 (8):e1003545. doi:10.1371/journal.ppat.1003545

46

Texas Tech University, Amal Bouyanfif, August 2019

Londin E, Loher P, Telonis AG, Quann K, Clark P, Jing Y, Hatzimichael E, Kirino Y, Honda S, Lally M, Ramratnam B, Comstock CE, Knudsen KE, Gomella L, Spaeth GL, Hark L, Katz LJ, Witkiewicz A, Rostami A, Jimenez SA, Hollingsworth MA, Yeh JJ, Shaw CA, McKenzie SE, Bray P, Nelson PT, Zupo S, Van Roosbroeck K, Keating MJ, Calin GA, Yeo C, Jimbo M, Cozzitorto J, Brody JR, Delgrosso K, Mattick JS, Fortina P, Rigoutsos I (2015) Analysis of 13 cell types reveals evidence for the expression of numerous novel primate- and tissue-specific microRNAs. Proc Natl Acad Sci U S A 112 (10):E1106- 1115. doi:10.1073/pnas.1420955112

Lu W, Li S, Li J, Wang J, Zhang R, Zhou Y, Yin Q, Zheng Y, Wang F, Xia Y, Chen K, Liu T, Lu J, Zhou Y, Guo C (2016) Effects of Omega-3 Fatty Acid in Nonalcoholic Fatty Liver Disease: A Meta-Analysis. Gastroenterol Res Pract 2016:1459790. doi:10.1155/2016/1459790

Lynn DAD, H.M.; Sowa, J.N.; Wang, M.C.; Soukas, A.A.; Curran, S.P. (2015) Omega- 3 and -6 fatty acids allocate somatic and germline lipids to ensure fitness during nutrient and oxidative stress in Caenorhabditis elegans. Proc Natl Acad Sci 112 (50):15378–15383. . doi:10.1073/pnas.1514012112

Makki K, Froguel P, Wolowczuk I (2013) Adipose tissue in obesity-related inflammation and insulin resistance: cells, cytokines, and chemokines. ISRN Inflamm 2013:139239. doi:10.1155/2013/139239

Malik VS, Willett WC, Hu FB (2013) Global obesity: trends, risk factors and policy implications. Nat Rev Endocrinol 9 (1):13-27. doi:10.1038/nrendo.2012.199

Martinelli N, Girelli D, Malerba G, Guarini P, Illig T, Trabetti E, Sandri M, Friso S, Pizzolo F, Schaeffer L, Heinrich J, Pignatti PF, Corrocher R, Olivieri O (2008) FADS genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease. Am J Clin Nutr 88 (4):941-949

Medzhitov R (2008) Origin and physiological roles of inflammation. Nature 454 (7203):428-435. doi:10.1038/nature07201

Meesapyodsuk D, Qiu X (2012) The front-end desaturase: structure, function, evolution and biotechnological use. Lipids 47 (3):227-237. doi:10.1007/s11745-011- 3617-2

Murgatroyd C, Spengler D (2010) Histone tales: echoes from the past, prospects for the future. Genome Biology 11 (2):105. doi:10.1186/gb-2010-11-2-105

47

Texas Tech University, Amal Bouyanfif, August 2019

NCBI National Center for BiotechnologyI nformation. Gene [Internet]. Avialable from https://www.ncbi.nlm.nih.gov/gene. U.S. National Library of Medicine

Ogden CL, Carroll MD, Kit BK, Flegal KM (2014) Prevalence of Childhood and Adult Obesity in the United States, 2011-2012. Jama-Journal of the American Medical Association 311 (8):806-814. doi:10.1001/jama.2014.732

Oh DY, Talukdar S, Bae EJ, Imamura T, Morinaga H, Fan WQ, Li PP, Lu WJ, Watkins SM, Olefsky JM (2010) GPR120 Is an Omega-3 Fatty Acid Receptor Mediating Potent Anti-inflammatory and Insulin-Sensitizing Effects. Cell 142 (5):687-698. doi:10.1016/j.cell.2010.07.041

Oh DY, Walenta E (2014) Omega-3 Fatty Acids and FFAR4. Front Endocrinol (Lausanne) 5:115. doi:10.3389/fendo.2014.00115

Onken B, Driscoll M (2010) Metformin induces a dietary restriction-like state and the oxidative stress response to extend C. elegans Healthspan via AMPK, LKB1, and SKN-1. PLoS One 5 (1):e8758. doi:10.1371/journal.pone.0008758

Overweight & Obesity Statistics. (2017) https://www.niddk.nih.gov/health- information/health-statistics/overweight-obesity.

Papanikolaou Y, Brooks J, Reider C, Fulgoni VL (2014) U.S. adults are not meeting recommended levels for fish and omega-3 fatty acid intake: results of an analysis using observational data from NHANES 2003–2008. Nutrition Journal 13 (31). doi: 10.1186/1475-2891-13-31

Prevention Strategies & Guidelines. (2015) http://www.cdc.gov/obesity/data/adult.html

Puglisi MJ, Hasty AH, Saraswathi V (2011) The role of adipose tissue in mediating the beneficial effects of dietary fish oil. Journal of Nutritional Biochemistry 22 (2):101-108. doi:10.1016/j.jnutbio.2010.07.003

Raabe RC, Mathies LD, Davies AG, Bettinger JC (2014) The Omega-3 Fatty Acid Eicosapentaenoic Acid Is Required for Normal Alcohol Response Behaviors in C. elegans. PLoS ONE 9 (8):e105999. doi:https://doi.org/10.1371/journal.pone.0105999

Raina R, Mondhe DM, Malik JK, Gupta RC (2016) Garcinia cambogia. In: Gupta RC (ed) Nutraceuticals. Efficacy, Safety and Toxicity. Elsevier Inc, pp 669-680. doi:https://doi.org/10.1016/B978-0-12-802147-7.00048-6

48

Texas Tech University, Amal Bouyanfif, August 2019

Reddy JK, Mannaerts GP (1994) Peroxisomal lipid metabolism. Annu Rev Nutr 14:343- 370. doi:10.1146/annurev.nu.14.070194.002015

Riddle DL, Blumenthal T, Meyer BJ, Priess JR (1997) Introduction to C. elegans. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR (eds) C. elegans II. 2nd edn., Cold Spring Harbor (NY)

Ruperez AIG, A. Aguilera, C. M. (2014) Genetics of Oxidative Stress in Obesity. International Journal of Molecular Sciences 15 (2):3118-3144. doi:10.3390/ijms15023118

Satouchi K, Hirano K, Sakaguchi M, Takehara H, Matsuura F (1993) Phospholipids from the free-living nematode Caenorhabditis elegans. Lipids 28 (9):837-840

Schroeder EA, Brunet A (2015) Lipid Profiles and Signals for Long Life. Trends Endocrinol Metab 26 (11):589-592. doi:10.1016/j.tem.2015.08.007

Schulte LN, Eulalio A, Mollenkopf HJ, Reinhardt R, Vogel J (2011) Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. EMBO J 30 (10):1977-1989. doi:10.1038/emboj.2011.94

Serhan CN, Petasis NA (2011) Resolvins and protectins in inflammation resolution. Chem Rev 111 (10):5922-5943. doi:10.1021/cr100396c

Sifferlin A (2017) 40% of Americans Are Obese—And the Trend Isn't Slowing. http://time.com/4980225/obesity-rates-adults-children/.

Simopoulos AP (2006) Evolutionary aspects of diet, the omega-6/omega-3 ratio and genetic variation: nutritional implications for chronic diseases. Elsevier Masson SAS 60:502–507. doi:10.1016/j.biopha.2006.07.080

Smith-Vikos T, de Lencastre A, Inukai S, Shlomchik M, Holtrup B, Slack FJ (2014) MicroRNAs mediate dietary-restriction-induced longevity through PHA- 4/FOXA and SKN-1/Nrf transcription factors. Curr Biol 24 (19):2238-2246. doi:10.1016/j.cub.2014.08.013

Spychalla JP, Kinney AJ, Browse J (1997) Identification of an animal omega-3 fatty acid desaturase by heterologous expression in Arabidopsis. Proc Natl Acad Sci U S A 94 (4):1142-1147

Stillwell W, SR W (2003) Docosahexaenoic acid: membrane properties of a unique fatty acid. Chem Phys Lipids 126 (1):1-27

49

Texas Tech University, Amal Bouyanfif, August 2019

Takahashi Y, Ide T (2000) Dietary n-3 fatty acids affect mRNA level of brown adipose tissue uncoupling protein 1, and white adipose tissue leptin and glucose transporter 4 in the rat. British Journal of Nutrition 84:175±184 doi:org/10.1017/S0007114500001409

Tan C, Voss U, Svensson S, Erlinge D, Olde B (2013) High glucose and free fatty acids induce beta cell apoptosis via autocrine effects of ADP acting on the P2Y(13) receptor. Purinergic Signal 9 (1):67-79. doi:10.1007/s11302-012-9331-6

Tanaka T, Ikita K, Ashida T, Motoyama Y, Yamaguchi Y, Satouchi K (1996) Effects of growth temperature on the fatty acid composition of the free-living nematodeCaenorhabditis elegans. Lipids 31 (11): 1173–1178

Virtanen JK, Mursu J, Voutilainen S, Uusitupa M, Tuomainen TP (2014) Serum omega- 3 polyunsaturated fatty acids and risk of incident type 2 diabetes in men: the Kuopio Ischemic Heart Disease Risk Factor study. Diabetes Care 37 (1):189- 196. doi:10.2337/dc13-1504

Vora M, Shah M, Ostafi S, Onken B, Xue J, Ni JZ, Gu S, Driscoll M (2013) Deletion of microRNA-80 activates dietary restriction to extend C. elegans healthspan and lifespan. PLoS Genet 9 (8):e1003737. doi:10.1371/journal.pgen.1003737

Wall R, Ross RP, Fitzgerald GF, Stanton C (2010) Fatty acids from fish: the anti- inflammatory potential of long-chain omega-3 fatty acids. Nutrition Reviews 68 (5):280-289. doi:10.1111/j.1753-4887.2010.00287.x

Wang J, Shi Y, Zhang L, Zhang F, Hu X, Zhang W, Leak RK, Gao Y, Chen L, Chen J (2014) Omega-3 polyunsaturated fatty acids enhance cerebral angiogenesis and provide long-term protection after stroke. Neurobiol Dis 68:91-103. doi:10.1016/j.nbd.2014.04.014

Wang M, Chen H, Gu Z, Zhang H, Chen W, Chen YQ (2013) omega3 fatty acid desaturases from microorganisms: structure, function, evolution, and biotechnological use. Appl Microbiol Biotechnol 97 (24):10255-10262. doi:10.1007/s00253-013-5336-5

Watts JL (2016) Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids. J Clin Med 5 (2). doi:10.3390/jcm5020019

Watts JL, and Browse, J. (2006) Dietary manipulation implicates lipid signaling in the regulation of germ cell maintenance in C. elegans. Developmental Biology, 292 (2):381–392. doi:https://doi.org/10.1016/j.ydbio.2006.01.013

50

Texas Tech University, Amal Bouyanfif, August 2019

Watts JL, Browse J (2002) Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99 (9):5854-5859. doi:10.1073/pnas.092064799

Watts JL, Phillips E, Griffing KR, Browse J (2003) Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163 (2):581-589

Welker NC, Habig JW, Bass BL (2007) Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes. RNA 13 (7):1090-1102. doi:10.1261/rna.542107

What is Obesity? (2016) http://www.obesity.org/obesity/resources/facts-about- obesity/what-is-obesity.

WormClassroom.org A Short History of C. elegans Research

Yang R, Chiang N, Oh SF, Serhan CN (2011) Metabolomics-Lipidomics of Eicosanoids and Docosanoids Generated By Phagocytes. Curr Protoc Immunol:14-26. doi: 10.1002/0471142735.im1426s95

Yen K, Le TT, Bansal A, Narasimhan SD, Cheng JX, Tissenbaum HA (2010) A comparative study of fat storage quantitation in nematode Caenorhabditis elegans using label and label-free methods. PLoS One 5 (9). doi:10.1371/journal.pone.0012810

Zhang P, Liu S, Cong B, Wu G, Liu C, Lin X, Shen J, Huang X (2011) A novel omega- 3 fatty acid desaturase involved in acclimation processes of polar condition from Antarctic ice algae Chlamydomonas sp. ICE-L. Mar Biotechnol (NY) 13 (3):393-401. doi:10.1007/s10126-010-9309-8

Zhang WH, X. Yang, W. Gao, Y. Chen, J. (2010) Omega-3 polyunsaturated fatty acid supplementation confers long-term neuroprotection against neonatal hypoxic- ischemic brain injury through anti-inflammatory actions. Stroke 41 (10):2341- 2347. doi:10.1161/STROKEAHA.110.586081

Zheng J, Greenway FL (2012) Caenorhabditis elegans as a model for obesity research. Int J Obes (Lond) 36 (2):186-194. doi:10.1038/ijo.2011.93

Zheng Z, Ge Y, Zhang J, Xue M, Li Q, Lin D, Ma W (2015) PUFA diets alter the microRNA expression profiles in an inflammation rat model. Mol Med Rep 11 (6):4149-4157. doi:10.3892/mmr.2015.3318

51

Texas Tech University, Amal Bouyanfif, August 2019

Zhou X-R, Green AG, Singh SP (2011) Caenorhabditis elegans Δ12-Desaturase FAT- 2 Is a Bifunctional Desaturase Able to Desaturate a Diverse Range of Fatty Acid Substrates at the Δ12 and Δ15 Positions. J Biol Chem 286 (51):43644–43650. . doi: 10.1074/jbc.M111.266114

Zhu Z, Zhang D, Lee H, Jin Y (2016) Caenorhabditis elegans: An important tool for dissecting microRNA functions. Biomed Genet Genom 1 (2):34-36. doi:10.15761/BGG.1000106

Zimmermann R, Strauss JG, Haemmerle G, Schoiswohl G, Birner-Gruenberger R, Riederer M, Lass A, Neuberger G, Eisenhaber F, Hermetter A, Zechner R (2004) Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306 (5700):1383-1386. doi:DOI 10.1126/science.1100747

Zivkovic AM, Telis N, German JB, Hammock BD (2011) Dietary omega-3 fatty acids aid in the modulation of inflammation and metabolic health. Calif Agr 65 (3):106-111. doi:10.3733/ca.v065n03p106

52

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 2

Translational aging research in CAENORHABDITIS elegans

A. Bouyanfif1,2, I. Koboziev2,3, E. Hequet1, N. Moustaid-Moussa2,3 1 Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 79409 2 Department of Nutritional Sciences, Texas Tech University, Lubbock, TX 79409 3Obesity Research Cluster, Texas Tech University, Lubbock, TX 79409

2.1. Abstract

Human development undergoes a series of changes and goes through different stages spanning from embryogenesis to old age. Aging is the process during which a living organism accumulates over time damage to its cells, tissues, and organs. Several factors affect aging, such as genetics, individual behaviors, and environmental factors. Numerous and specific theories of aging have been proposed, to explain how lifespan is biologically controlled, and include oxidative damage, telomere shortening, and reduced metabolic rate. Aging is among the highest known risk factors for most human diseases such as neurodegeneration, cancer, and diabetes. Thus, it is critical to understand mechanisms and the specific signaling pathways that influence aging, to help prevent age-related morbidities and pathologies. Model organisms (yeast and invertebrate fruit flies and nematodes), rodent and primate models are commonly used to understand the complex degenerative process of aging. In this review, we primarily focus on the Caenorhabditis elegans, a nematode that has become an excellent experimental system to dissect biological mechanisms and processes of aging. Here, we highlight both the evolutionary and mechanistic theories of aging as well as the biological and environmental factors influencing this process. We also describe in this review the key endocrine and nutrient-sensing signaling pathways including insulin/insulin-like growth factor (IGF), AMP-activated protein kinase (AMPK), target of rapamycin (TOR), and germline signaling pathways. These pathways modulate aging in C. elegans involving different transcription factors through multiple mechanisms such as lipid metabolism and autophagy. Further, we discuss some 53

Texas Tech University, Amal Bouyanfif, August 2019 interventional dietary sources of bioactive phytomolecules that yield to multiple beneficial physiologic effects on aging indicating that future studies should include exploration of more bioactive compounds using the nematode C. elegans to improve healthspan and decrease the risk of age-associated diseases.

Key Words: C. elegans, aging, insulin/ insulin-like growth signaling, dietary restriction, target of rapamycin, oxidative stress, genetics, microfluidics.

2.2. Overview of aging Aging is an universal and complex process that manifests itself within an organism at the molecular, genetic, cellular, and organ levels (Harman 1956; Kregel and Zhang 2007). It is characterized by the high susceptibility to age-related diseases resulting in numerous pathologies and comorbidities that are associated with chronic processes including inflammation (Figure 2.1) (Baierle et al. 2015). Aging has been defined as the progressive accumulation of deleterious changes within the organism in cells and tissues, which results in a decrease in the ability to survive and increased risk of disease development and death (Kregel and Zhang 2007; Harman 2001). Harman reported that, in animals or plants, the aging cycle which is growth, decline, and then death, is a direct function of their metabolic rate. The heredity, stress, and the strains of life change the metabolic activity of these species (Harman 1956).

Figure 2.1: Aging overview: Summary of potential factors and signaling pathways that may contribute to aging including dysregulation of nutrient-sensing pathways, accumulated DNA damage, reduced autophagy, accumulation of senescent cells, and increased sterile inflammation. AMPK, AMP-activated protein kinase; mTOR, mammalian target of rapamycin; IIS, insulin/insulin-like signaling; SITs, sirtuins.

54

Texas Tech University, Amal Bouyanfif, August 2019

Kregel and Zhang pointed out that the definition of aging led to the identification of two significant processes having equal importance (Kregel and Zhang 2007). The first aspect is characterized by the progressive decay with time in the biological function, while the second aspect is characterized by a decreased resistance to multiple forms of stress along with high susceptibility to multiple diseases (Kregel and Zhang 2007). The terms lifespan and aging are often used interchangeably. Tissenbaum indicated that, while aging is a biological process that is not easily defined or measured, lifespan is defined as the amount of time which starts with the birth and ends with death (Tissenbaum 2012). In this context, the definitions of aging can include changes occurring to an organism over time, such as changes in cells, tissues, and organs, or an increased probability of death (Tissenbaum 2012). Aging was described as one of the highest known risk factors for most human diseases including diabetes, neurodegeneration, cancer, and metabolic syndrome (Dillin et al. 2014); thus the critical need to better define and understand the biological basis for the processes of aging. Several theories have been formulated to explain the aging process (Medawar 1952; Harman 1956, 2001; Hughes and Reynolds 2005). These theories are divided into evolutionary and mechanistic theories of aging. The evolutionary theories such as mutation accumulation theory (Charlesworth 2001), antagonist pleiotropy theory (Rose and Charlesworth 1980) and disposable soma theory (Drenos and Kirkwood 2005) represent general models of aging based on different assumptions related to patterns of age-specific effects of mutations that cause mortality (Hughes and Reynolds 2005). The most widely accepted mechanistic theory of aging is based on the “free radical theory of aging or oxidative stress theory,” and addresses the cause of senescence at the molecular level (Harman 2001; Hughes and Reynolds 2005). Harman first proposed that aging is the result of the action of reactive oxygen species (ROS) which results in cellular damage (Harman 1956, 1962, 1972). Other theories include the mitochondrial decline theory of aging (Sun et al. 2016; Peng et al. 2014; Cui et al. 2012; Harman 1972; Beckman and Ames 1998), the decline theory of Ubiquitin proteasomal system (Peng et al. 2014; Lee et al. 2009), and the genetic theory of aging (Peng et al. 2014).

55

Texas Tech University, Amal Bouyanfif, August 2019

2.3. Oxidative Stress and Reactive Oxygen Species theory of aging This theory postulates that effects of reactive oxygen species (ROS) result in the accumulation of oxidative damage to cellular components leading to pathological conditions, functional changes, and ultimately death (Kregel and Zhang 2007; Hagen 2003). In animals, ROS occurs primarily in the mitochondria, where more than 90% of the oxygen used by the cells is consumed (Hughes and Reynolds 2005; Perez-Campo et al. 1998). ROS are generated as either metabolites of normal aerobic metabolism from oxygen molecule, under stress and pathological conditions, or could be taken up from the external environment. ROS can include unstable oxygen radicals (O•), superoxide

• - • -2 • - anion ( O2 ), peroxide ( O2 ), hydroxyl radical ( OH), hydroxyl ion (OH ), and hydrogen peroxide (H2O2). Accordingly, oxidative stress is associated with excessive bioavailability of ROS, resulting from an imbalance between production and destruction of these reactive species which leads to the progressive accumulation of oxidative damage with age, then progressive deterioration of several cellular functions (Kregel and Zhang 2007). As an oxidative stress response, in the cell, numerous enzymes are synthesized including SODs (superoxide dismutases), Gpx (glutathione peroxidase) and CATs (catalases) (Valko et al. 2007). Studies showed that ROS have a causal role in numerous diseases such as arthritis (Chung et al. 2006), cancer (Brandon et al. 2006; Aunan et al. 2017), vascular diseases (Madamanchi et al. 2005), and neurodegenerative diseases (Moreira et al. 2005). Furthermore, lipids are highly sensitive to ROS oxidation because of the bis-allylic structures of polyunsaturated fatty acids (Kregel and Zhang 2007). As a result of the lipid peroxidation, an accumulation of many end-products such as malondialdehyde, 4-hydroxy-2-non-enol, and F2-isoprostanes occurs in biological systems (Kregel and Zhang 2007), leading to functional changes such as changes in cellular membrane permeability (Schafer and Buettner 2000). Also, other biomacromolecules including proteins and nucleic acids (nuclear and mitochondrial) are prone to oxidative damage by ROS that leads to various oxidized residues affecting normal cellular functions and stimulating gene expression alterations (Kregel and Zhang 2007; van der Horst et al. 2004; Finkel 2001). These modifications can have a significant

56

Texas Tech University, Amal Bouyanfif, August 2019 physiological impact on cell survival, senescence, and death pathways (Blumberg 2004; Kregel and Zhang 2007; Evans et al. 2004). The mitochondrial theory of aging hypothesizes that electrons leaking from the electron transport chain (ETC) produce ROS. This hypothesis is based on the fact that mitochondria are cellular energy factories that generate ATP via the reaction of hydrocarbons with oxygen (Loeb et al. 2005). Produced ROS can damage ETC components and mitochondrial DNA, resulting in high intracellular ROS levels and deterioration of mitochondrial function (Loeb et al. 2005). The cellular senescence theory of aging is another theory that was reported and is based on the fact that cellular signal responses stimulate pathways related to cell senescence and death. These signaling responses to stress and damage are modulated by ROS to accelerate mitogenesis and premature cellular senescence (Beausejour et al. 2003; Hutter et al. 2002; Kregel and Zhang 2007). Chung and his colleagues proposed an additional explanation of aging termed molecular inflammatory theory of aging (Chung et al. 2006). The authors postulated that age-related oxidative stress activates redox-sensitive transcriptional factors causing upregulation of pro-inflammatory gene expression resulting in the generation of a number of pro-inflammatory molecules which lead to further inflammation in many tissues and organs over time and several age-associated pathologies (Chung et al. 2006). Furthermore, the accumulation of lipid peroxidation, oxidized proteins, and glycated products resulting from damage caused by oxidative stress, results in neuro- inflammation and cell death which in turn trigger neurons degeneration and consequently leads to memory loss, cognitive decline, and dementia (Jellinger 2013; Popa-Wagner et al. 2013). It was reported that with advancing age, the increased blood levels of inflammatory cytokines may be associated with higher risk of developing age- related neurodegenerative diseases (Simen et al. 2011). Campisi and his colleagues revealed that the accumulation of damaged cells, that increases with age, is associated with a high circulation of inflammatory cytokines (Campisi et al. 2011). Also, in a human study, it was shown that elevated pro-inflammatory cytokines levels such as IL-

57

Texas Tech University, Amal Bouyanfif, August 2019

6 and TNF- were accompanied with the oxidative damage in old-age people (Baierle et al. 2015).𝛼𝛼 Aging is universally conserved among all organisms (Harman 1956; Cui et al. 2012). Currently, to study this process, genetic, dietary, pharmacological and environmental interventions are used in various in vivo aging models (Ziehm et al. 2017; de Magalhaes et al. 2012). In general, two different types of models for “aging research” are used: long-lived or short-lived animals with respectively delayed or longer aging process. Evidence from these animal models supported the oxidative stress theory and provided a strong link between aging and oxidative stress. However, despite numerous studies that produced valuable information on biological systems, which have an impact on aging, the underlying molecular mechanisms of this phenomenon remain mainly elusive.

2.4. C. elegans applications in aging studies 2.4.1. Introduction to C. elegans In 1900, the zoologist Emile Maupas first isolated the nematode Rhabditis elegans in the soil in Algiers (Maupas 1900). Follow up work led to renaming the species as Caenorhabditis elegans. In 1974 and following the work of Brenner, C. elegans emerged as an important experimental model for biological research (Brenner 1974). The use of C. elegans has since led to important discoveries in numerous fields including aging, neuroscience, cell death, signal transduction, aging, and RNA interference (Leung et al. 2008). C. elegans is a millimeter scale eukaryote. It has well-differentiated tissues including muscles, nerves, and a ring-like central nervous system. Its generation time is only three days, and it has only a 3 to 5 weeks long life span (Figure 2.2). C. elegans goes through a complex developmental process from embryogenesis to adult, and the complete cell lineage has been well characterized. An adult hermaphrodite comprises 959 post-mitotic somatic cells that regularly undergo senescent decay, resulting in a pause of progeny production, slower movement, decrease in feeding and defecation frequencies and darker hue which is due to the accumulation of fat and pigment

58

Texas Tech University, Amal Bouyanfif, August 2019 lipofuscin. These discernible phenotypes are recognized as aging (Lionaki and Tavernarakis 2013). Furthermore, the whole genome of these animals has been fully sequenced and well-annotated and intensively studied using knockout mutant libraries and cutting edge genetic methodologies such as RNA interference (RNAi), mutagenesis and transgenesis (Hansen et al. 2005; Grishok 2005).

Figure 2.2: Life cycle of the nematode C.elegans at 20˚C. The worms’ life cycle takes approximately 3.5 days. Under favorable laboratory conditions, C. elegans reproductive adults live about 3 weeks. It develops via embryonic stage; L1 to L4 larval stages; and adulthood. When animals are under stressed conditions as in dense population; starvation; or high temperature, they can enter dauer state in which the worms can survive for several months. The dauer Larva develops from a pre-dauer L2 (L2d). We have recently reviewed in detail utility and applications of the C. elegans to nutrition and lipid metabolism studies (Bouyanfif et al. 2019). C. elegans has been successfully used in aging research because of its sufficient homology with mammals at the molecular level in vivo (Zhu et al. 2016). In addition, it contains numerous key components related to metabolism such as an insulin-signaling pathway and an oxidative stress resistance network which makes it a relevant system to improve our understanding of complex phenomena such as aging (Zhu et al. 2016). Although mammalian and nematode physiologies are significantly different, several signal transduction pathways are conserved between C. elegans and humans including12 out of 17 known cell signaling pathways (Table 2.1) (Leung et al. 2008).

59

Texas Tech University, Amal Bouyanfif, August 2019

Table 2.1: Signaling pathways conservation in C. elegans and humans (Homo sapiens). Adapted from (Leung et al. 2008). Signaling pathways conserved between C. elegans and H. Signaling pathways not conserved sapiens between C. elegans and H. sapiens

- Wnt pathway via β-catenin - Wnt pathway via c-Jun N-terminal - Receptor serine/threonine kinase (tumor growth factor-b kinase receptor) pathway - Hedgehog pathway (patched receptor - Receptor tyrosine kinase pathway protein) - Notch-delta pathway - Nuclear factor kappa-B pathway - Receptor-linked cytoplasmic tyrosine kinase (cytokine) - Nuclear hormone receptor pathway pathway - Receptor guanylate cyclase pathway - Apoptosis pathway - Nitric oxide receptor pathway - Receptor protein tyrosine phosphatase pathway - G-protein–coupled receptor (large G-protein) pathway - Integrins pathway - Cadherin pathway - Gap junction pathway - Ligand-gated cation channel pathway - Insulin /IGF­1 pathway - TOR­ kinase pathway - AMP­ activated protein kinase (AMPK)

The genetics of aging is related to lifespan linked to genetic changes. Among model organisms, 877 genes altering lifespan have been discovered in the soil roundworm C. elegans, 193 genes in the fruit fly Drosophila melanogaster, 909 genes in the bakers' yeast Saccharomyces cerevisiae, 136 genes in the mouse Mus musculus, and 307 genes in human according to the GenAge database of aging-related genes (GenAge 2016; Tacutu et al. 2018). A meta-analysis of the database of human genetic variants revealed that more than 200 gene variants are associated with human lifespan (Sebastiani et al. 2013). Table 2.1 includes some of the genes that are involved in lifespan regulation in C. elegans nematode within the above pathways. Furthermore, genes with positive effects on aging (i.e., physical, mental, and social well-being over time) can be clustered into several categories (Hamet and Tremblay 2003) including: • Genes involved in the regulation of cholesterol, lipid, and lipoprotein levels. Their products can metabolize and transport various molecules including cholesterol that directly influences physical activity levels and longevity. • Genes involved in drug metabolism and insulin signaling. • Genes coding for cytokines that influence inflammation and immune responses. 60

Texas Tech University, Amal Bouyanfif, August 2019

• Genes related to oxidative stress that is involved in many diseases such as atherosclerosis, Parkinson's, and Alzheimer's diseases • Genes linked to age-associated pathological processes such as Alzheimer’s disease.

Klass discovered the first mutation in age-1 gene, which encodes the catalytic subunit of class-I phosphatidylinositol 3-kinase (PI3K) and increases longevity in the free-living nematode C. elegans (Klass 1983). The author suggested that lifespan of some mutant strains could be altered by reduced caloric intake (Klass 1983). A decade after, it was reported that 60% of life extension was due to the mutation itself rather than a reduction in food consumption (Friedman and Johnson 1988b). Mutations in daf-2 that is an ortholog of human insulin receptor (INSR) and insulin-like growth factor 1 receptor (IGF1R), cause adult hermaphrodites to live more than twice as long as wild- type (Kenyon et al. 1993). This extension in C. elegans lifespan requires daf-16 gene activation. Both daf-2 and daf-16 genes play a crucial role in dauer larva formation (Kenyon et al. 1993). In high population density during periods of food limitation, C. elegans enters an alternative developmental stage known dauer in which it can live for several months. Dauer larvae show the same metabolism as long-term survivals under food deprivation (Riddle and Albert 1997). Dauer larvae have a decreased tricarboxylic acid cycle (TCA cycle) activity compared to adult animals which indicates the importance of lipid storage as an energy reserve at this alternative stage. Also, they have an increased phosphofructokinase activity pointing out that these worms significantly metabolize the glycogen during this larval arrest (Riddle and Albert 1997). Moreover, dauer larvae show high tolerance to oxygen deprivation and possess higher activities of the enzymes, catalase and superoxide dismutase, that are involved in oxidative stress response (O'Riordan and Burnell 1989; Wadsworth and Riddle 1989; O'Riordan and Burnell 1990; Anderson 1978, 1982; Larsen 1993; Vanfleteren and De Vreese 1995). Research on life extension has focused on the potential benefits of nutrition, and dietary supplements on healthy aging and lifespan (Ohlhorst et al. 2013). Although the long-term health effects of moderate caloric restriction (CR) without malnutrition are

61

Texas Tech University, Amal Bouyanfif, August 2019 unknown in human studies (Spindler 2010), some studies showed that CR extends the life of mice, yeast, and rhesus monkeys (Holloszy and Fontana 2007). Moreover, human life might be extended by antioxidant supplements according to the free-radical theory of aging (Kregel and Zhang 2007; Sadowska-Bartosz and Bartosz 2014). However, there is a study suggesting that β-carotene supplements and high doses of vitamin A and vitamin E may lead to decreased lifespan (Bjelakovic et al. 2007). Several C. elegans isolates of the N2 strain have significantly different lifespans (at 20°C), from 12 to 18 days (Kenyon 1997). Various environmental factors, including temperature, food, and oxygen levels also can impact the lifespan of C. elegans (Riddle et al. 1997). C. elegans longevity can be altered at any period of their life cycle by either temperature changes or food consumption (Klass 1977); the maximum egg production was observed at 20oC, and the maximum lifespan was at 10oC (Klass 1977). The average lifespan of C. elegans cultured in liquid media was reduced from 23 days at 16°C to 8.9 days at 25.5°C indicating that Wild-type worms control their rate of growth in response to temperature changes (Klass 1977). The higher the temperature, the shorter the lifespan (Klass 1977). Furthermore, WT worms (Bristol strain) cultured in liquid S medium and fed with 108 of bacteria (E. Coli strain OP50) displayed a mean lifespan of 25.9 ± 4.7 compared to those that were under normal diet (1010 bact/ml) having a mean lifespan of 15.0 ± 2.0, indicating that dietary restriction increased longevity of these worms. However, Klass demonstrated that a severe reduction in food concentrations (≤ 5x107 bact/ml) limits lifespan and fecundity and leads to death by starvation (Klass 1977). Moreover, other factors which affect aging include radiation and oxygen levels. Younger worms are more sensitive to ultraviolet radiation compared to older worms (Klass 1977), while lifespan was increased and decreased under low and high concentrations of oxygen exposure, respectively (Honda et al. 1993).

62

Texas Tech University, Amal Bouyanfif, August 2019

Table 2.2: Ageing-associated genes in the model organism C. elegans nematode. daf, abnormal dauer formation; age, ageing alteration; skn, skinhead; eat, eating-abnormal pharyngeal pumping; tub, tubby-related; aak, AMP-activated kinase; unc, uncoordinated; ins-7, insulin-related; lipl, lipase Like; acs, fatty Acid CoA Synthetase family; glp, abnormal germline proliferation; hif, hypoxia-inducible factor. Genes Description Functions Longevity effect

Insulin-like receptor - cellular response to salt subunit beta; Receptor - negative regulation of macromolecule Anti-Longevity daf-2 protein-tyrosine kinase; metabolic process hypothetical protein - positive regulation of developmental growth

- DNA-binding activity - transcription factor activity

- enzyme binding activity Forkhead box protein O - defense response to bacterium Pro-Longevity daf-16 - regulation of cellular biosynthetic process - regulation of post-embryonic development

- determination of adult lifespan - embryonic digestive tract development Protein skinhead-1 Pro-Longevity skn-1 - positive regulation of cellular metabolic process

- heme binding activity - iron ion binding activity Cytochrome P450 daf-9 Anti-Longevity daf-9 - oxidoreductase activity - cell-cell signaling - dauer larval development - regulation of cell migration

- monocarboxylic acid binding activity - nuclear receptor activity Nuclear hormone receptor Anti-Longevity daf-12 - sequence-specific DNA binding activity family member - chemotaxis to cAMP - dauer larval development - detection of chemical stimulus

- acetylcholine-gated cation-selective channel activity Neuronal acetylcholine Anti-Longevity eat-2 - action potential receptor subunit eat-2 - regulation of eating behavior - regulation of gene expression

5'-AMP-activated protein - determination of adult lifespan kinase catalytic subunit - peptidyl-serine phosphorylation Pro-Longevity aak-2 alpha-2 - regulation of establishment of protein localization 63

Texas Tech University, Amal Bouyanfif, August 2019

Table 2.2. Continued.

age-1 Phosphatidylinositol 3- - cellular response to salt Anti-Longevity kinase age-1 - chemosensory behavior - chemotaxis

tub-1 Tubby protein homolog 1 - receptor localization to non-motile Anti-Longevity cilium

- calmodulin binding activity - diacylglycerol binding activity Phorbol Anti-Longevity unc-13 - metal ion binding activity ester/diacylglycerol- - positive regulation of oocyte binding protein unc-13 development - regulation of pharyngeal pumping

hif-1 Hypoxia-inducible factor 1 - cellular response to caloric restriction Unclear - determination of adult lifespan - heat acclimation

- transcriptional activator activity - RNA polymerase II transcription factor Protein glp-1/abnormal Anti-Longevity glp-1 binding activity germ line proliferation - cell fate specification - embryonic pattern specification - positive regulation of cell proliferation

- triglyceride lipase activity - determination of adult lifespan Lipase Pro-Longevity lipl-4 - positive regulation of macro-autophagy - triglyceride catabolic process

acs-5 fatty acid CoA synthetase - catalytic activity Anti-Longevity family

ins-7 Probable insulin-like - hormone activity Pro-Longevity peptide beta-type 4 - olfactory learning

2.4.2. Lifespan studies in C. elegans Survival assays using C. elegans have been used as a means to study several physiological processes such as senescence, stress, and immunity (Park et al. 2017). C. elegans abiotic stress resistance assays include oxidative stress, hypoxic and hyperoxic stresses, heat and cold stresses, osmotic stress, UV stress, ER unfolded protein stress, and heavy metal stress (Park et al. 2017). Pathogen resistance assays include bacterial pathogens, fungi, and intracellular parasites (Park et al. 2017). Generally, C. elegans survival assays are performed with both solid and liquid media at temperatures range 64

Texas Tech University, Amal Bouyanfif, August 2019 from 10˚C to 25˚C, using a major bacterial food (E. coli strain OP50). To perform C. elegans oxidative stress resistance assays, worms are treated with several chemicals that generate reactive oxygen species (ROS). The most common chemicals used as oxidative stress inducers are Paraquat and Juglone that produce superoxide anions, Hydrogen peroxide (H2O2) and Arsenite that destroys the energy production systems through increasing intracellular ROS levels (Park et al. 2017). To obtain proper survival curves for statistical analysis, the counting process in oxidative stress resistance assays should be completed every 1 to 2 h because of the high chemical toxicity. However, lifespan assays are completed in relatively longer time than oxidative stress resistance assays. Due to the short generation time of C. elegans, it becomes an interesting system to study aging. Lifespan assays of C. elegans required multiple steps including the acquisition of age-synchronized populations and manual scoring of worms for lifespan at regular time (1 to 2 days) (Solis and Petrascheck 2011; Sutphin and Kaeberlein 2009). The most common method used for lifespan assay is performed with the nematode growth media (NGM), agar-based solid culture (Stiernagle 2006). Usually, synchronization of worms by egg laying is the standard protocol for solid culture-based lifespan assay. After gravid hermaphrodites lay eggs overnight on NGM plates seeded with E. coli OP50 bacteria, they are removed from the plates and hatched worms are subsequently transferred to fresh bacteria-seeded agar plates that are usually treated with 5’-fluorodeoxyuridine (FUdR) which is a common drug used to sterilize the age-synchronized worms to perform lifespan experiments. Agar-based solid culture has some limitations, frequently worms burrow into the agar or crawl off plates resulting in missing animals. Also agar plates become dried during lifespan assays and worms become flaccid as they age and moving them to fresh plates is not practical. In addition, it was shown that C. elegans lifespan could be influenced by FUdR treatment (Anderson et al. 2016). C. elegans lifespan can be increased by about 30% by combining hypertonic stress and FUdR treatment while hypertonic stress by itself reduced the lifespan (Anderson et al. 2016). Exposure of C. elegans to moderate osmotic stress-induced adaptive changes and resulted in decreased brood size and reduced lifespan (Dmitrieva and Burg 2007). Mechanisms by which hypertonic stress influences longevity may include damaging 65

Texas Tech University, Amal Bouyanfif, August 2019 effects such as double-stranded breaks in DNA (Dmitrieva et al. 2011) and protein misfolding (Burkewitz et al. 2011). FUdR treatment also results in increased DAF- 16/FOXO expression and GPDH-1 (Glycerol-3-phosphate dehydrogenase) level (Anderson et al. 2016). FUdR-induced hypertonic stress resistance was partially dependent on sirtuins and base excision repair (BER) pathways (Anderson et al. 2016). However, FUdR-induced lifespan extension under hypertonic stress requires DAF-16, BER, and sirtuin function (Anderson et al. 2016). Liquid culture-based media is another suitable method used in lifespan assays that generally includes either S basal buffer and concentrated E. coli (Stiernagle 2006). This method is amenable for investigating the effects of chemicals or bioactive compounds treatment on C. elegans lifespan as well as the effect of the dietary restriction (DR) by diluting the bacterial food concentration in the liquid (Park et al. 2017). However, handling, culturing, and counting worms are the main drawbacks in liquid culture. Thus, new devices to assess nematodes lifespan in liquid media are needed. Microfluidic devices have emerged as powerful tools for C. elegans aging research (San-Miguel and Lu 2013; Mondal et al. 2016; Ghorashian et al. 2016). A Microfluidic device is fabricated using a soft lithography replica molding of polydimethylsiloxane, a flexible silicone elastomer that is non-toxic, optically transparent, gas permeable, and compatible with an aqueous solution (San-Miguel and Lu 2013; Duffy et al. 1998; McDonald et al. 2000; Xia and Whitesides 1998). Microfluidic devices used for C. elegans research are composed of channels, chambers or pillars bonded to a glass slide with access ports for worms loading and feeding (Figure 2.3) (Rahman et al. 2018). Hulme et al. reported on the fabrication of a microfluidic device for the liquid culture of individual C. elegans and separate chambers to study lifespan (Hulme et al. 2010).

66

Texas Tech University, Amal Bouyanfif, August 2019

Figure 2.3: A microfluidic device for C. elegans lifespan assays. A) Complete view of the device; B) A view of a chamber a) worm inlet port; b) feeding and washing ports; c) barriers for worm retention.

Device chambers are filled with a suspension of E. coli, and L4 worms were loaded into the chambers (one worm per chamber). The dimension of the chamber allows loading the L4 worm with the flow of the liquid but is too narrow for the worm to swim through and escape in the absence of flow (Hulme et al. 2010). To remove eggs and/or newborn L1, each chamber is flushed with liquid leaving synchronized worms in each chamber (Hulme et al. 2010). Daily flushing and feeding are performed to remove eggs and score alive and dead worms. The Kaplan-Meier method is widely used for analysis and plotting survival data from lifespan studies (Kaplan 1958). Data representing the percentage of survival are plotted as a function of time. The median, mean and maximum life span values, as well as average of the percent survival value, are determined to compare survival data (Lionaki and Tavernarakis 2013). The Kaplan–Meier survival analysis takes into account censoring events during worms scoring. Nematodes are assessed daily for survival, and when either they show internal hatching of eggs (matricide worms/ bagging phenotype) or if they are killed by accidents and experimental mishandling, worms are excluded from the analysis (censored) (Lionaki and Tavernarakis 2013). Among numerous statistical methods, the log-rank test is used to analyze lifespan

67

Texas Tech University, Amal Bouyanfif, August 2019 survival curves by comparing the survival distributions under two conditions and subsequently giving average survival times and P values (Mantel 1966).

2.5. Signaling pathways that modulate aging in C. elegans 2.5.1. Insulin/IGF-1/FOXO pathway The insulin/IGF­1 (insulin/insulin-like growth factor-1) pathway is highly conserved and a principal regulator of metabolism, that coordinates food consumption and cellular energy homeostasis (Lapierre and Hansen 2012) across various species and organisms. It starts with glucose uptake which drives anabolic processes (Lapierre and Hansen 2012), as illustrated in Figure 2.4.

68

Texas Tech University, Amal Bouyanfif, August 2019

Figure 2.4: Glucose metabolism and molecular mechanisms of insulin signal transduction in mammalian tissues. Normally, upon intestinal glucose absorption, the portal vein transports glucose to pancreatic islets. Through insulin-independent glucose transporter 2 (GLUT2), glucose stimulates the secretion of insulin from pancreatic β cells. Insulin subsequently promotes glycogenesis and inhibits gluconeogenesis in the liver cells, promotes glucose uptake in muscle cells and adipocytes, and inhibits lipolysis in adipose cells. Insulin binds to insulin receptor (InsR) causing phosphorylation of IRS-1/2, insulin receptor substrate-1 at its tyrosine and then activating PI3K pathway, this activation requires a second phosphorylation by mTORC2 and consequently triggers the normal insulin response. Glucose uptake in adipocytes and myocytes is via GLUT-4 (glucose transporter-4) translocation and insertion into the plasma membrane by phosphorylation of the downstream target AS160 (RabGTPase activating protein). However in hepatocytes is through GLUT-2. mTORC2 indicates mammalian target of rapamycin complex 2; PI3K, phosphatidylinositol 3-kinases; GCKR, glucokinase regulatory protein; GCK, glucokinase; PIP3, phosphatidylinositol (3,4,5)-triphosphate; and PDK1 indicates serine threonine kinases phosphoinositide- dependent kinase 1. In mammals, the insulin signaling cascade is activated when the action of insulin is launched by binding to its receptor (InsR) which causes its activation by auto-

69

Texas Tech University, Amal Bouyanfif, August 2019 phosphorylation of tyrosine residues (Frojdo et al. 2009). This activation, in turn, phosphorylates the adapter molecules IRS1/2. At the plasma membrane, the phosphorylated IRS1/2 activates PI3K results in the production of lipid second messenger PIP3, which in turn binds to PDK1 and (PKB)/Akt and then activates them. Afterward, PDK1 phosphorylates first a threonine residue in AKT2, and this phosphorylation requires a second phosphorylation of a serine residue by the mTORC2 complex (Kim and Feldman 2012). Thus, the activation of AS160 (RabGTPase activating protein), which in turn regulates the insulin-stimulated translocation of the glucose transporter GLUT-4 towards the plasma membrane, which leads to the uptake of glucose. Also, the insulin pathway promotes glycogen synthesis via the inhibitory phosphorylation of GS (glycogen synthase) (Frojdo et al. 2009; Kim and Feldman 2012). In the normal state, after its intestinal absorption, glucose is transported via the portal vein to liver cells. GLUT2 which is an insulin-independent glucose transporter 2 facilitates glucose entry across the cell membrane (Bechmann et al. 2012). Therefore, the abundance of glucose induces conformational changes of the glucokinase regulatory protein (GCKR) that binds the glucokinase (GCK), which in turn phosphorylates glucose to glucose-6-phosphate. This phosphorylation takes place in the cytosol. However, in a fasting state, GCKR keeps GCK in the nucleus. Insulin, sterol regulatory element-binding protein (SREBP-1c) and hepatocyte nuclear factors (HNF4α and HNF6) regulate GCK. Glucose 6-P can be a substrate for glycolysis or glycogen synthesis in accordance with the nutritional state. During glycolysis, the degradation glucose 6-P into pyruvate provides energy in the form of two molecules of ATP and NADH per molecule of glucose (Bechmann et al. 2012). Insulin represses glycogenolysis, promotes glycogenesis and inhibits gluconeogenesis in the liver. It was reported that metabolic dysfunction is a common co-morbidity associated with aging and it is frequently because of glucose dysregulation (Brewer et al. 2016). This dysfunction may occur as a result of a decreased insulin secretion in response to glucose or an increased insulin resistance by multiple tissues (Reaven 1988; Leiter et al. 2005). Knock out of IGF-1 receptor in female mice results in lifespan extension of 33% compared to the wild-type (Holzenberger et al. 2003). Insulin signaling is important in 70

Texas Tech University, Amal Bouyanfif, August 2019 a number of tissues to prolong lifespan, Bluher and colleagues demonstrated that mice lacking insulin receptors in adipose tissues have an increase lifespan of approximately 18% compared ot the wild-type (Bluher et al. 2003), while a brain-specific insulin receptor substrate-2 (IRS2) knock out extends mice lifespan by approximately 18% (Taguchi et al. 2007). Also, it was shown that Ames and Snell dwarf mice that have pituitary defects displayed an increase in their lifespan of 42 to 67% (Brown-Borg et al. 1996; Flurkey et al. 2002) and mutations in upstream genes that regulate both IGF-1 and insulin lead to lifespan extension of about 50% (Coschigano et al. 2003). Remarkably, these mice have reduced levels of circulating IGF1, fasting insulin and glucose (Brown-Borg et al. 1996; Coschigano et al. 2003). Hence, both insulin and IGF- 1 signaling pathways influence mice lifespan. In C. elegans, Lee et al. reported that glucose shortens the lifespan by downregulating DAF-16/FOXO (Lee et al. 2009). However, reducing glucose availability by exposing adult worms to 2-deoxy-D-glucose (DOG) at a concentration of 5 mM results in 17% extension of their mean lifespan compared to the control. This increase in lifespan is due in part to increased mitochondrial metabolism and oxidative stress (Schulz et al. 2007). To determine effects of glucose on C. elegans lifespan, (Schlotterer et al. 2009) treated wild-type (N2) and mutant strain eat-2 ([ad465] II), were cultivated in nematode growth media with a high concentration of glucose (10 to 15 mmol/l). This concentration mimics serum glucose levels in people with diabetes, and poor glucose control (Schlotterer et al. 2009). The results showed that high glucose diet reduced the mean lifespan from 18.5 ± 0.4 days to 16.5 ± 0.6 days, while the maximum lifespan was reduced from 25.9 ± 0.4 days to 23.2 ± 0.4 days (Schlotterer et al. 2009). High glucose levels also resulted in a rise in ROS formation; a significant decline in lifespan; and a permanent accumulation of methylglyoxal which is a highly reactive dicarbonyl that leads to rapid mitochondrial proteins modification (Schlotterer et al. 2009). The first pathway that was implicated in the regulation of animal aging process was insulin/insulin-like growth factor-1(IGF-1) signaling (IIS) pathway (Kenyon et al. 1993; Brown-Borg et al. 1996; Bartke et al. 2000; Bartke 2008). IIS controls longevity 71

Texas Tech University, Amal Bouyanfif, August 2019 in fruit-flies and rodents (Tatar et al. 2003). In invertebrate studies, Friedman and

Johnson revealed that a mutation in the gene age-1 lengthens lifespan and reduces C. elegans fertility (Friedman and Johnson 1988a). In addition, Kenyon et al. discovered that C. elegans carrying mutations in the gene daf-2 could live more than twice as long as the wild-type (Kenyon et al. 1993). This lifespan extension requires the activity of daf-16; and both daf-2 and daf-16 genes regulate the formation of dauer larva, which is an arrested developmental stage that is induced by overcrowding and starvation (Lapierre and Hansen 2012; Johnson and Wood 1982). Figure 2.5 below provides an overview of the signaling pathways in C. elegans that are involved in aging. Key genes in the IIS pathway include daf-2 which encodes an IIS receptor. DAF- 2 is an homolog of the human insulin/IGF-1, age-1, which encodes the catalytic subunit of the phosphatidylinositol 3 kinase (PI3k), and daf-16, which encodes the transcription factor forkhead box O (FOXO) downstream of the PI 3-kinase signaling cascade (Tissenbaum 2015). FOXO is a central regulator of lifespan in C. elegans and Drosophila (Lin et al. 1997; Ogg et al. 1997; Giannakou et al. 2004; Hwangbo et al. 2004), consistent with single nucleotide polymorphisms linked to aging delay, that were reported in the human FOXO3 gene (Lunetta et al. 2007; Willcox et al. 2008; Anselmi et al. 2009; Flachsbart et al. 2009; Li et al. 2009; Soerensen et al. 2010; Zeng et al. 2010; Banasik et al. 2011; Malovini et al. 2011).

72

Texas Tech University, Amal Bouyanfif, August 2019

Figure 2.5: Overview of the signaling pathways influencing aging in C. elegans. INS- 7 (insulin-like peptide, ILP) is the ligand for which initiates the insulin (IIS)/ insulin- like growth factor (IGF-1) signaling pathway. Upon ILP binding to DAF-2/InR receptor, its tyrosine kinase is activated and thus successive phosphorylation and activation of a kinase cascade: AGE-1/PI3K, PDK-1pyruvate dehydrogenase lipoamide kinase isozyme, AKT-1/2, and SGK-1 (serine/threonine-protein kinase). Eventually, AKT and SGK-1 phosphorylate and inactivate the transcription factor DAF-16/FOXO by preventing its translocation to the nucleus where it would otherwise regulate the expression of genes contributing to longevity, stress response, and metabolism. DAF- 16/FOXO is also enhanced by AAK-2/AMPK when the AMP:ATP ratios are high and inhibited by phosphorylation of LET-363/mTOR (Target-of-rapamycin) which in turn acts on SBP-1/SREBP (Sterol regulatory element Binding Protein) to enhance the transcription of lipogenic-associated genes, such as fatty acid synthase (fasn-1/FAS) and acetyl CoA carboxylase (pod-2/ACC). Nuclear translocation of DAF-16/FOXO can be inhibited by DAF-18/PTEN phosphatase, which dephosphorylates and inhibits AGE- 1/PI3K. The transcription factor SKN-1/Nrf is also required for longevity and is activated during oxidative stress to promote the transcription of stress resistance associated genes such as superoxide dismutase (sod-3/ SOD-2); heat-shock proteins; and catalase. TOR responds to nutrients and is co-activated by DAF-15/Raptor to impair the activity of DAF-16/FOXO and SKN-1/Nrf. In response to increased cellular AMP/ATP ratio, AAK-2/AMPK complex inhibits the activity of LET-363/mTOR, which inhibits the expression of a set of lipolysis-, autophagy- and antioxidation- associated genes such as lipase like lipl-4/LIPF, ectopic p granules epg-3/VMP1, and sod-3/ SOD-2. As a cytoplasmic process, TOR signaling also likely modulates aging through activation of AKT1/2. In germline ablation, the activated DAF-12 and nuclear localized DAF-16/FOXO promote longevity. Factors with longevity-promoting effects are in green, and those with aging-promoting effects are in orange. Arrows indicate a directional and stimulatory relationship, whereas blunt-ended red lines indicate an inhibitory effect. 73

Texas Tech University, Amal Bouyanfif, August 2019

2.5.2. AMP-activated kinase C. elegans’ lifespan is linked to energy metabolism, and its major regulator, the AMP-activated protein kinase (AMPK) (Figure 2.5), the energy-sensing enzyme (Lapierre and Hansen 2012). AMPK cascade, part of the conserved family of eukaryotic protein kinases, is a sensor of the cellular energy charge (Hardie and Hawley 2001).When daf2/InR mutants and wild-type C. elegans were exposed to starvation or heat stress, AMPK is activated when the intracellular AMP/ATP ratio is high (Apfeld et al. 2004). AMP/ATP ratio in living C. elegans increases from less than 0.1 at day 4 to 0.8 at day 18, which represented the maximum lifespan of the worm population (Apfeld et al. 2004). The study concluded that AMP-activated kinase α subunit AAK-2 is activated by AMP to extend lifespan in response to environmental conditions (heat and starvation) and insulin-like signaling (Apfeld et al. 2004). The increase in lifespan in a manner that is dependent on an AAK2 was attributed either to the increase in AMP/ATP ratio or to mutations that lead to lower insulin-like signaling. The study indicated that both aak-2 and daf-16/FOXO act in parallel to influence lifespan (Apfeld et al. 2004). Apfeld and colleagues demonstrated that deletion in the aak-2 gene encoding for the C. elegans AMPK protein results in 12% reduction in lifespan in aak- 2(ok524) mutants than in WT worms. This mutation also leads to high accumulation in lipofuscin-like fluorescent pigment in the intestine (Apfeld et al. 2004). Whereas, overexpression of aak-2 gene results in 13% lifespan prolongation in transgenic worms compared to controls (Apfeld et al. 2004).

2.5.3. Target-of-rapamycin pathway The Target-of-rapamycin (TOR) pathway (Figure 2.5) has been reported to control growth and reproduction in response to amino acid/nutrient availability and growth factors (Apfeld et al. 2004). TOR is a kinase that was originally identified in the yeast Saccharomyces cerevisiae as the target of rapamycin (Hansen and Kapahi 2010). The nutrient sensor mTOR (or LET-363 in C. elegans) is a growth-inhibitor and immuno-suppressing compound initially identified in a soil bacterium (Streptomyces hygroscopicus) (Hansen and Kapahi 2010; Seto 2012). TOR has been linked to lifespan

74

Texas Tech University, Amal Bouyanfif, August 2019 extension by acting as a mediator of the beneficial effects of dietary restriction (reducing nutrient intake without malnutrition) (Hansen and Kapahi 2010). Two growth- regulatory complexes of TOR were described (Hansen and Kapahi 2010). TOR complex 1 (TORC1) integrates mitogen and nutrient signals to control cell proliferation and size, while TOR complex 2 (TORC2) regulates cell shape (Laplante and Sabatini 2012). Downregulation of the mTOR pathway extends longevity in various laboratory animals and treatment with rapamycin prolongs the lifespan in mice (Lopez-Otin et al. 2013). Partial inhibition of the single gene tor (let-363) can extend lifespan in C. elegans (Hansen and Kapahi 2010). Heterozygous C. elegans animals carrying a mutation in the TORC1 regulatory associated protein daf-15/raptor live longer (Jia et al. 2004). It was shown that mutations in daf-15/raptor extend adults lifespan, also daf-15 and let-363 C. elegans mutants change their metabolism to accumulate fat, this fat deposition was confirmed by Sudan black and Nile red staining (Jia et al. 2004). TOR regulates the expression of the insulin-like peptide ins-7, which could indicate that TOR similar to DAF-2/InR may modulate aging using systemic effect of hormones (Honjoh et al. 2009; Lapierre and Hansen 2012). TORC1 has been reported to influence lifespan and regulate the expression of target genes such as daf-16/FOXO- and skn-1/Nrf and stress defense genes such as sod-3 (superoxide dismutase) and hsf-1 (heat shock factor) (Robida-Stubbs et al. 2012).

2.5.4. Germline signaling

C. elegans aging is modulated by the germline which integrates nutrient signaling and communicates with other tissues (Lapierre and Hansen 2012). Illuminating cells that give rise to the germline using a laser microbeam led to 60% extension of C. elegans lifespan (Hsin and Kenyon 1999), suggesting that the activity of the insulin/IGF-1 pathway, linked to aging in the C. elegans aging, is modulated by germline signals (Hsin and Kenyon 1999). Furthermore, the lifespan extension associated with the germline ablation requires the activity of a series of pro-longevity transcription factors such as DAF-16/FOXO and DAF-12/LXRα along with the signals from the somatic gonad, which requires DAF-2 activity (Hsin and Kenyon 1999).

75

Texas Tech University, Amal Bouyanfif, August 2019

Additionally, germline removal in daf-2 /InR mutants results in extreme longevity in these animals by doubling their lifespan (Arantes-Oliveira et al. 2003). A key site for modulation of longevity through germline signaling is the intestinal cells (Lapierre and Hansen 2012). As previously mentioned, DAF-16 is negatively regulated by the DAF- 2/IIS signaling pathway however its nuclear translocation regulates downstream genes that increase stress resistance, metabolism, and eventually extend lifespan (Figure 2.6). The removal of germline causes downregulation of TOR, resulting in stimulation of both expression of forkhead transcription factors PHA-4/FOXA (defective pharyngeal development protein 4) and DAF-16/FOXO. Additionally, the nuclear localization of DAF-16 is enhanced by the activation of DAF-9/cytochrome P450 and activation of the steroid hormone receptor DAF-12/LXRα through somatic gonad signaling (Yamawaki et al. 2010; Kenyon 2010a). Gonadal longevity relies on the activation of PHA-4/FOXA transcription factor and the NHR-80/HNF-4-like nuclear receptor in C. elegans (Antebi 2013).

76

Texas Tech University, Amal Bouyanfif, August 2019

Figure 2.6: Longevity regulating germline-ablation in C. elegans nematode. Lifespan extension through the removal of germline depends on 1) the regulation of DAF- 16/FOXO thus the regulation of lipolysis genes including lip-4 and lips-17. 2) The reduction of TOR signaling regulating autophagy-related genes such as lgg-1 (LC3, GABARAP, and GATE-16 family) and unc-51 (serine/threonine-protein kinase). 3) The increased steroid signaling via DAF-36 (cholesterol 7-desaturase)/DAF-9/DAF-12 pathway that influences the regulation of the fatty acid desaturation via fatty acid desaturase encoding fat-6 gene. 4) The high nuclear hormone receptor family NHR- 80/HNF-4 signaling regulating fatty acyl-CoA reductase (fard-1) gene.

Various activators are required to extend lifespan in germline-removal animals and function in insulin/IGF-1 signaling pathway such as transcription factors DAF- 18/PTEN and HSF-1 (Berman and Kenyon 2006; Hansen et al. 2005). KRI-1/KRIT-1 (ankyrin repeat-containing protein) is one of the factors that function in germline signaling to modulate lifespan through stimulating the nuclear translocation of DAF- 16/FOXO as well as the upregulation of transcription elongation regulator homolog TCER- 1/TCERG1 in germline-less animals (Berman and Kenyon 2006). Also, DAF- 9, an ortholog of the mammalian cytochrome P450 enzyme, is involved in the steroid

77

Texas Tech University, Amal Bouyanfif, August 2019 signaling pathway. DAF-9/ CYP450 stimulates the synthesis of the endogenous ligands for the nuclear hormone receptor DAF-12/LXR that are 3-keto bile acid-like steroids, called dafachronic acids (Gerisch et al. 2007). The activated nuclear hormone DAF-12, in turn, interacts coordinately with DAF-16 resulting in its activation to extend lifespan in response to germline removal (Gerisch et al. 2007; Lapierre and Hansen 2012).

2.5.5. Autophagy Autophagy is a cellular catabolic process that involves lysosomal degradation and recycling of cellular material and organelles using several acid hydrolases (Lapierre and Hansen 2012). This multistep process is conserved in all eukaryotic cells and is involved in a number of long-lived mutants such as daf-2/ IIS mutants and lifespan extension interventions (Melendez and Levine 2009). Depending on the mode of delivery to the lysosome, autophagy is categorized into macro-autophagy in which the cytoplasm is sequestrated into an auto-phagosome that fuses with a lysosome, where the hydrolases degrade the isolated cellular material. This form of autophagy is the major regulated cellular pathway. In micro-autophagy, the lysosome directly engulfs the cytoplasmic material for degradation. Whereas, the mechanism of chaperone-mediated autophagy allows direct lysosomal import of a particular pentapeptide motif (Melendez and Levine 2009). Autophagy can be stimulated by intracellular stress, starvation, high temperature as well as hormones (Levine and Klionsky 2004). Upregulation of autophagy can occur upon a cellular remodeling, intracellular nutrients, energy generation, processing of damaging cytoplasmic material during inflammation; oxidative stress; and aging (Melendez and Levine 2009). In C. elegans, autophagy is a regulated response to dietary-restriction, and it was associated directly with aging as it controls several nutrient-sensing lifespan-extension pathways including insulin-IGF-1 and TOR signaling pathways. As in mammals, AMPK stimulates autophagy in C. elegans by phosphorylation of aak-2/AMPK (UNC-51 /ULK1 homolog) and partially in daf-2 mutants (Egan et al. 2011). Autophagy can be transcriptionally regulated by DAF-16/FOXO in daf-2/ InR mutants (Lapierre et al. 2011). Moreover, in C. elegans, energy depletion causes an

78

Texas Tech University, Amal Bouyanfif, August 2019 inhibition of TORC1 which in turn induces autophagy. Whereas, the energy reduction results in an increased expression of AAK-2/AMPK that also activates autophagy via the transcription factor PHA-4/FOXA (Hansen et al. 2008; Robida-Stubbs et al. 2012; Lapierre et al. 2011). Studies showed that both pha-4/ FOXA and autophagy genes are required to extend lifespan in let-363/TORC1 mutants (Hansen et al. 2008; Sheaffer et al. 2008). Lapierre and his colleague demonstrated that germline-deficient glp-1/ NotchR animals show an increase in autophagy to prolong their lifespan partially via PHA-4/ FOXA and upregulation of LIPL-4 lipase in the intestine (Lapierre et al. 2011). This study provided evidence that autophagy and lipid breakdown are functionally linked and are important in lifespan extension induced by germline ablation.

2.6. Cellular and epigenetic mechanisms of aging in C. elegans 2.6.1. Lipid metabolism and energy C. elegans expresses about 40 insulin-like genes of which products INS-7 and DAF-28 are two of DAF-2/InR agonist ligands and INS-1 functions as its antagonist (Pierce et al. 2001). Insulin/IGF-1 signaling is a major regulator of metabolism coordinating food intake and cellular energy homeostasis. As discussed above, in C. elegans, glucose intake stimulates insulin signaling that inhibits DAF-16/FOXO which results in reducing lifespan, whereas glucose restriction leads to an extension of lifespan (Lee et al. 2009; Schulz et al. 2007). daf-2/InR mutants show an increase in expression of the lipase LIPL-4 which increases lipolysis (Wang et al. 2008). This lipase is also upregulated by the inhibition of TOR (Lapierre et al. 2011). However, daf-2/InR, daf- 15 /Raptor, and TOR mutants accumulate more lipid droplets compared to wild type worms (Lapierre and Hansen 2012). Moreover, germline-removal animals also display remarkable changes in lipid metabolism. They show an increase in the lipase lipl-4 expression as well as upregulation of other lipid genes that are required for the long lifespan extension including lips-17 lipase and fard-17 the fatty acyl reductase (Wang et al. 2008; McCormick et al. 2012). Goudeau and his colleagues showed the key role of the fatty acid desaturation in germline signaling, including that oleic acid synthesis is regulated

79

Texas Tech University, Amal Bouyanfif, August 2019 by NHR-80/HNF-4 (nuclear hormone receptor) through FAT-6 /SCD-1 that promotes lifespan of germline-ablation animals (Goudeau et al. 2011). A study conducted by Yuan et al. to identify how CR in eat-2 long-lived mutants modifies their energy metabolism and contributes to the DR-mediated longevity, indicated a shift to fatty acid metabolism as an energy source, and enhanced rate of energy metabolism through many changes in the Krebs cycle in these mutants compared to wild-type animals. Pod-2 (acetyl-CoA carboxylase) is one of many metabolic genes linked to DR-mediated life extension that was identified (Yuan et al. 2012). A catalytic subunit of the energy-sensing enzyme AMP-activated kinase (AAK- 2/AMPK) plays a crucial role in energy metabolism and lifespan regulation. High intracellular AMP to ATP ratios induces AAK-2 during heat stress or starvation condition in daf-2/InR mutants and in wild-type animals, which leads to lifespan extension through the inhibition of the coactivator CRTC- 1/CREBP (Apfeld et al. 2004; Mair et al. 2011).

2.6.2. MicroRNA and histone modification Epigenetic mechanisms involve chemical modifications of DNA nucleotide residues, such as cytosine methylation, and its related proteins, such as histones, altering the structure and function of DNA which subsequently results in the regulation of the interpretation of genetic information (Goldberg et al. 2007). Histone modification, DNA methylation, and noncoding RNAs are alterations due to diet and stress and these epigenetic changes correlate with older age in normal individuals contributing to lifelong health (Mathers 2006; Fraga and Esteller 2007; Uno and Nishida 2016). miRNAs are a class of short noncoding RNAs molecules that regulate the expression of multiple target genes (Ha and Kim 2014). We previously reviewed miRNAs studies in detail (Bouyanfif et al. 2019). MicroRNAs are multipurpose molecules and emerged as important regulators of lifespan (Uno and Nishida 2016). lin- 4 was the first miRNA discovered in C. elegans that regulates the larva stages development (Lee et al. 1993). Later on, Boehm and Slack demonstrated that lin-4 loss- of-function mutants showed a decrease in their lifespan and multiple accelerated aging

80

Texas Tech University, Amal Bouyanfif, August 2019 phenotypes (Boehm and Slack 2005). Further, Guo’s group observed that lin-4 mutants displayed increased ROS levels and decreased locomotion rates indicating an increased rate of aging compared to wild type worms (Zhu et al. 2010). Kato and colleagues found that a knockdown of C. elegans Argonaute gene, alg-1, results in a significant lifespan reduction compared with wild-type lifespan, showing that miRNA maturation and function regulate aging (Kato et al. 2011). To date, various miRNAs have been identified to be involved in lifespan regulation via insulin and insulin-like growth factor- 1 signaling and DNA damage factors (Smith-Vikos and Slack 2012). Smith-Vikos and colleagues revealed that miR-71 and miR-228 regulate lifespan through calorie restriction responsive transcription factors PHA-4/FOXA and SKN-1/Nrf2 (Smith- Vikos et al. 2014). Furthermore, mir-71 miRNA regulates the localization of DAF- 16/FOXO in the intestine (Boulias and Horvitz 2012), and it targets the AGE-1/PI3K and PDK-1 components of the IIS pathway (de Lencastre et al. 2010). It was demonstrated that miR-71, miR-238, miR-239, and miR-246 are involved in pathways that regulate oxidative/heat stress responses in C. elegans supporting that miRNAs are crucial for normal lifespan in these nematodes (de Lencastre et al. 2010). Mammalian studies showed that numerous miRNAs are upregulated during aging (de Lencastre et al. 2010). In both long-lived Ames dwarf mice and growth-hormone-receptor-knockout strains, miR-470, miR-669b, and miR-681 inhibit IGF1R and AKT expression in the hippocampus resulting in FOXO3 activation (Liang et al. 2011). In humans, macaques, and chimpanzees, it was shown that miR-144 targets the gene responsible for spinocerebellar ataxia type 1 (SCA1), ataxin-1, was upregulated in the brain during aging (Persengiev et al. 2011). It was reported that histone-modifying enzymes also regulate lifespan (Uno and Nishida 2016). It was demonstrated that overexpression of the enzyme that mediates H3K4 demethylation, RBR-2, results in increased lifespan and the inhibition of the histone H3K4 methylation complex that contains ASH-2, WDR-5, and the H3K4 methyltransferase SET-2 leads to lifespan extension as well (Greer et al. 2010). Moreover, inhibition of H3K27 demethylase UTX-1 results in lifespan extension depending on the insulin/IGF-1 signaling pathways (Jin et al. 2011; Maures et al. 2011). 81

Texas Tech University, Amal Bouyanfif, August 2019

2.7. Genetic and environmental interventions influence longevity 2.7.1. Dietary restriction Longevity is modulated by genetic, pharmacologic, caloric restriction, and other dietary interventions in various model systems (Fontana and Partridge 2015). As discussed above, aging is a complex process can be genetically manipulated, and multiple genes that are modulating lifespan have been identified in model organisms (de Magalhaes et al. 2009; Kenyon 2010b). These hundreds of genes interact with each other and with the environment such as diet and lifestyle. Dietary restriction (DR) represents the most robust intervention that can successfully slow down the aging process in many model organisms (Katewa and Kapahi 2010). DR is a decrease of the total nutrient intake without causing malnutrition (Kapahi et al. 2017). In mammals, this intervention relies on a complex network of interconnecting regulatory cellular pathways including adiposity, insulin signaling, AMPK and mTOR signaling, thyroid hormone levels, reduced cytokine levels as well as increased adiponectin. These pathways can contribute to an extensive genetic response leading to aging alteration through activation of autophagy and stress defense mechanisms (Barzilai et al. 2012). The term caloric restriction (CR) is initially used in mammalian studies because rodent studies have proposed that the energy content that is critical in the DR affects the lifespan (Weindruch et al. 1986). Bartke et al. reported that mutant mice Ames dwarf, which carry the Prop1df longevity gene, lived about 50% longer than the wild-type mice (Bartke et al. 2001). The authors showed that calorie restriction contributes to longevity increase in the dwarfs, indicating that the mutation and the reduced caloric intake may act via different pathways (Bartke et al. 2001). McCay and his colleague discovered that dietary intake reduction without starvation significantly extends lifespan in rats (McCay et al. 1989). The effects of this treatment (DR/CR) have been observed later in many species including fruit-fly Drosophila (Chapman and Partridge 1996), yeast Saccharomyces cerevisiae (Jiang et al. 2000), mice (Weindruch et al. 1986), and non- human primates (monkeys) (Lane et al. 2002). DR effects on longevity are significant

82

Texas Tech University, Amal Bouyanfif, August 2019 and consistent across animal species. However the biological mechanisms involved differ. C. elegans has been subjected to DR by food dilution, using mutations causing defects in feeding behavior and growth in axenic medium (Walker et al. 2005). Chemosensory and olfactory neurons of the amphids and the apical surface of intestinal cells have been proposed as interfaces with the nutrient environment in C. elegans (Walker et al. 2005). Also, a dilution in S medium buffer (liquid culture of worms) of the main food source, Escherichia coli (E. coli), was used as another DR regimen and resulted in increased lifespan and reduced fertility (Klass 1977). A reduction in the thickness of bacterial lawns results in an extension in lifespan of the nematodes (Hosono et al. 1989). Another regimen that was used to subject C. elegans to DR includes a complete dietary deprivation in which no bacterium is seeded onto the plates during adulthood or intermittent fasting (IF) where worms are transferred between plates with or without E.coli (Kaeberlein et al. 2006; Honjoh et al. 2009). Several DR-inducing genetic models such as eat-1 (ad427), eat-6 (ad467) and eat-2 (ad1116) increase longevity by 33, 37 and 57%, respectively (Lakowski and Hekimi 1998). These mutations cause neuronal and muscular defects that damage pumping of the pharynx which leads to slow-growth and a starved appearance (Avery 1993). Furthermore, studies focused on altered nutrition showed that C. elegans axenic culture (semi-defined sterile liquid media) demonstrated 50 to 80% increase in lifespan compared to monoxenic culture conditions (Vanfleteren and Braeckman 1999; Hosono et al. 1989; Castelein et al. 2008). Among the mechanisms by which DR extends lifespan is a reduction of insulin/IGF-1signalling. Several insulin genes that encode putative insulin-like peptides in C. elegans may be expressed in chemosensory neurons (Pierce et al. 2001). Mutants with defects in chemo-sensation that reflect a failure to detect food showed extension in their lifespan due to reduced IIS (Apfeld and Kenyon 1999). DR and IIS act in parallel on a common longevity process (Walker et al. 2005). DR leads to an inhibition of TOR activity which results in lifespan extension in various species (Kapahi et al. 2010). Interestingly, reduction in TOR activity combined with DR does not increase longevity 83

Texas Tech University, Amal Bouyanfif, August 2019

(Hansen et al. 2007). A key mechanism that mediates the effects of DR and TOR inhibition in lifespan extension is autophagy, which is induced by nutrient deprivation (Feng et al. 2014). Dietary restricted eat-2 mutants have shown an inhibition of numerous autophagy-associated genes such as unc-51/ATG1/Ulk1, vps-34, atg-18/Wip, and atg-7; and this inhibition, in turn, reduces the long lifespan of eat-2 mutants (Jia and Levine 2007; Gelino et al. 2016). Also, these genes are required for animals carrying mutations in daf-15/Raptor, the interaction partner of TOR (Gelino et al. 2016; Toth et al. 2008; Jia and Levine 2007; Hansen et al. 2008). The transcription factors, NHR-62, PHA-4/FOXA and HLH-30/TFEB increase the expression of numerous autophagy genes in these mutants leading to improved stress resistances and slow aging (Heestand et al. 2013; Lapierre et al. 2015). Among other genetic factors that have been associated with lifespan extension mediated by DR, the gene daf-16, which acts in the insulin/IGF- 1 pathway (Kenyon 2011). Likewise, the nutrient sensor AMP-activated kinase AAK-2 activates DAF-16 in DR regimen (Greer et al. 2009). RHEB-1, an upstream regulator of TOR, was reduced by DR, causing inhibition of INS-7, which in turn activates DAF- 16/FOXO, thus extending C. elegans’s lifespan (Honjoh et al. 2009). Stimulation of sirtuins (NAD+-dependent histone deacetylases) is another potential mediator of DR effects on longevity. Indeed, overexpression of C. elegans’ sir-2.1, the orthologue of yeast Sir2, extends lifespan (Tissenbaum and Guarente 2001). Resveratrol, a sirtuin- activating compound, delays aging of C. elegans and Drosophila melanogaster without reducing fecundity in these animals (Wood et al. 2004). Other genetic factors regulated by DR in C. elegans include the transcription factor PHA-4/FOXA, which is required during adulthood for the long lifespan of animals subjected to DR by bacterial dilution, eat-2 mutants, and germline-removal glp- 1 mutants. However, PHA-4/FOXA is not required for insulin/IGF-1 receptor mutants and mitochondrial respiration mutants (gas-1(fc21)) to extend their lifespan (Lapierre et al. 2011; Kapahi et al. 2017). SKN-1/ Nrf transcription factor, which is critical for regulation of the oxidative stress response, regulates diet-restriction-induced longevity and is essential for daf-2 /insulin/IGF-1 mutants to live longer (Tullet et al. 2008). Another transcription factor complex that has been linked to DR in C. elegans and is 84

Texas Tech University, Amal Bouyanfif, August 2019 one of the targets of the TOR pathway in mammalian cells, is HIF-1 (hypoxia-inducible factor) that plays crucial roles in glucose metabolism, cell survival, oxygen homeostasis, as well as inflammatory responses (Chen et al. 2009). This study showed that a deficiency in HIF-1 results in prolonged lifespan by inhibiting RSKS-1/S6 kinase, a key component of the TOR pathway (Chen et al. 2009). In addition, it was found that ubiquitin ligase WWP-1/ HECT E3 positively regulates C. elegans lifespan in response to DR (Carrano et al. 2009). Overexpression of WWP-1 and its substrate KLF-1 (Kruppel- like factor) is sufficient to extend lifespan in these animals (Carrano et al. 2009; Carrano et al. 2014). Several new genes related to DR-mediated longevity were recently identified, such as sams-1 (S-adenosyl methionine synthetase) and GTPase rab- 10. Inhibition of these genes results in lifespan extension of wild-type animals (Hansen et al. 2005). Pharmacologic approaches can promote lifespan extension. For instance, rapamycin blocks mTOR signaling, metformin stimulates AMPK activity, and resveratrol enhances a member of the sirtuin family (silent information regulators) of proteins, SIRT1 activity. The protein deacetylases Sir 2 is found to prolong lifespan in yeast, Drosophila, and C .elegans (Guarente and Kenyon 2000). Histone deacetylase, SIR-2.1, during DR, modulates longevity, induces stress resistance to maintain cellular stress level, and regulates heat shock response (Kenyon 2010b; Raynes et al. 2012). Mammalian SIRT1 is a key player in controlling insulin action, glucose metabolism, fat storage, nutrient sensing as well as deacetylation of the inflammatory regulator nuclear factor NF-κB which may play an essential role in insulin resistance and metabolic syndrome (Barzilai et al. 2012; Haigis and Sinclair 2010; Yeung et al. 2004).

2.7.2. Bioactive phytomolecules Discovery of new chemicals capable of effective modulation of the aging process may result in a new strategy for age-related pathogenesis. Recently, the importance of natural molecules increased tremendously and proportionally to the awareness of the side effects associated with synthetic drugs. Annually, approximately 4,000 new bioactive compounds are discovered (Pant and Pandey 2015). These 85

Texas Tech University, Amal Bouyanfif, August 2019 molecules are usually secondary plant metabolites, produced along with the primary biosynthetic routes of compounds involved in plant growth and development including proteins, carbohydrates, amino acids, and lipids (Briskin 2000). Based on their chemical nature, phytochemicals can be categorized into different classes including phenolic compounds which contain flavonoids, stilbenoids, phenolic acids, tyrosol esters, alkylresorcinols, terpenes that comprise carotenoids, saponins, monoterpenes, and triterpenoids, betalains which encompass betacyanins and betaxanthins (Leonov et al. 2015). Some phytomolecules such as flavonoids and alkaloids, protect against free radicals and predators respectively, and terpenoids play a key role in cell signaling and metabolic pathways (Briskin 2000; Croteau et al. 2000). Wahlqvist and Savige showed in their study that rich diet with alkaloids, flavonoids as well as polyphenols promote optimal health, reduce the risk of cancer, coronary heart diseases, and neurodegenerative disorders and delay the aging process (Wahlqvist and Saviage 2000; Tripathi et al. 2005; Petrascheck et al. 2007; Collins et al. 2006). Many bioactive compounds regulate genes involved in multiple cellular signaling pathways, which play a key role in lifespan extension (Pant and Pandey 2015; Lithgow et al. 2005). There are countless natural molecules that prolong lifespan and alleviate age-related pathologies in different heterotrophic organisms and cultured cells (Leonov et al. 2015) such as mosquitoes (Richie et al. 1986); Saccharomyces cerevisiae and Schizosaccharomyces pombe budding and fission yeast respectively (Howitz et al. 2003; Rallis et al. 2013); Nothobranchius Furzeri short-lived fish (Valenzano et al. 2006); C. elegans nematode (Kampkotter et al. 2008; Pietsch et al. 2011; Canuelo et al. 2012; Grunz et al. 2012; Sutphin et al. 2012); Drosophila melanogaster fruit-fly (Pan et al. 2008; Miquel et al. 1982); Apis mellifera honey bee (Rascon et al. 2012); laboratory mice and rats (Buu-Hoi and Ratsimamanga 1959; Moriguchi et al. 1994; Strong et al. 2008); and both cultured human fibroblasts and peripheral blood mononuclear cells (Wang et al. 2003; Eisenberg et al. 2009). However, Strong and colleagues demonstrated that some phenolic compounds such as curcumin and resveratrol did not influence mice lifespan (Strong et al. 2013). In this review, we highlight only some of

86

Texas Tech University, Amal Bouyanfif, August 2019 these bioactive compounds. Table 2.3 summarizes some bioactive compounds that extend longevity in C. elegans via certain cellular processes.

2.7.2.1. Resveratrol 3, 4’, 5-trihydroxystilbene or resveratrol is a phytoestrogen found in the skin of red grapes blueberries, raspberries as well as other fruits (Jang and Surh 2003). Resveratrol suppresses the oxidative DNA damage in rats (Mizutani et al. 2001), delays aging in Saccharomyces cerevisiae; C. elegans; and D. melanogaster by directly stimulating SIR2 (sirtuins) activity (Howitz et al. 2003; Viswanathan et al. 2005; Bauer et al. 2004; Collins et al. 2006), and acts as an anti-carcinogenic (Jang et al. 1997). In different organisms, from yeast to mammals, resveratrol has a number of health benefits involving similar overlapping mechanisms of DR and other signaling pathways (Pant and Pandey 2015; Guarente and Kenyon 2000). Resveratrol triggers the AMP‐activated kinase-forkhead box O3A protein cascade (AMPK-FOXO3) to prevent oxidative stress‐ induced senescence and proliferative dysfunction (Ido et al. 2015). It was found that resveratrol reduces the pro‐inflammatory cytokines TNF‐α (cytokines tumor necrosis factor alpha) and IL‐1β (interleukin 1 β) level which increases during aging in mice liver (Tung et al. 2015).

2.7.2.2. Polyphenols and Epigallocatechin gallate (EGCG)

Polyphenols are found in green tea, berries, citrus fruits and chocolate (Pant and Pandey 2015). They exhibit natural antibacterial, antifungal, and antioxidant properties (Pandey and Rizvi 2009). Several studies in animal models and human revealed that long-term consumption of certain plant polyphenols may protect against age-linked chronic disorders such as diabetes, cancers, cardiovascular diseases, osteoporosis and neurodegenerative diseases (Pandey and Rizvi 2009; Graf et al. 2005; Arts and Hollman 2005; Scalbert et al. 2005b). Approximately, 8,000 polyphenolic compounds derivatives have been identified and classified into numerous groups including anthocyanins, flavonols, isoflavones, flavanones, flavones, and catechins (Scalbert et al. 2005a; Kris- Etherton et al. 2002). In C. elegans, quercetin that belongs to the subcategory flavonoids, showed an intracellular ROS scavenging, thermos-tolerance and reduced 87

Texas Tech University, Amal Bouyanfif, August 2019 aggregation of lipofuscin which is known as an aging biomarker (Kampkotter et al. 2007). It results in lifespan prolongation of these animals by activating the translocation of DAF-16/FOXO into the nucleus and upregulation of glutathione Stransferase enzyme GST-4 (Pietsch et al. 2009; Kampkotter et al. 2007; Gerstbrein et al. 2005). Cameron and his colleagues showed that black tea polyphenols affect insulin/IGF-1 activity by modulating the activity of mammalian FOXO1a, PEPCK (Cameron et al. 2008). Epigallocatechin gallate (EGCG) is the most abundant of catechins, polyphenols found in green tea (Singh et al. 2011). Several studies demonstrated that green tea possesses antioxidant activity and has chemopreventive effects on cancer mediated by its catechins (Singh et al. 2011; Higdon and Frei 2003). Moreover, its consumption has been used to reduce diabetes, stroke, obesity, as well as Parkinson and Alzheimer diseases (Shankar et al. 2008b; Khan et al. 2006). This flavonoid has effects on several biological pathways such as growth factor-mediated pathway, ubiquitin/proteasome degradation pathways and AKT/ FOXO signaling (Singh et al. 2011; Shankar et al. 2008a). Studies conducted in C. elegans demonstrated that EGCG provides a strong stress response and prolongs lifespan by upregulating the expression of antioxidant genes including sod-3, daf-16, skn-1, and hsp-16.2, which results in extension of lifespan (Zhang et al. 2009; Abbas and Wink 2009).

2.7.2.3. Beta-caryophellene Beta-caryophyllene (BCP), a natural bicyclic sesquiterpene found in essential oils and eatable plants, acts as anti-oxidant, anti-inflammatory, anticancerous agent and has local anaesthetics activity (Pant et al. 2014). Pant et al. demonstrated in C. elegans, intracellular ROS levels and reduction aggregation of age pigment lipofuscin, caused by intake of BCP, resulted in increased oxidative stress resistance (Pant et al. 2014). The authors demonstrated that dietary BCP interacts with several cellular signaling pathways including SIR-2.1, SKN-1, and DAF-16 modulating cellular stress response and further mediating lifespan extension (Pant et al. 2014). In differentiated C2C12 myotubes, it was found that a specific agonist trans-caryophyllene of the type 2 cannabinoid receptor (CB2R) stimulates SIRT1 (sirtuin) deacetylase activity by

88

Texas Tech University, Amal Bouyanfif, August 2019 increasing CREB (cAMP response element-binding protein) phosphorylation. Consequently, increased levels of PGC-1α (peroxisome proliferator-activated receptor- gamma coactivator 1α) deacetylation which in turn increases the activity of hormone nuclear receptors PPARα and ERRα resulting in activation of transcription of fatty acid oxidation enzymes (Zheng et al. 2013).

2.7.2.4. Alkaloids Alkaloids contain chemical compounds of plant origin, are pharmacologically active and are used as psychedelic psilocin (caffeine, nicotine), anti-bacterial (berberine), anticancer (vincristine) and anti-aging (resperine) in different organisms (Pant and Pandey 2015). In yeast cell, Wanke et al. showed that caffeine inhibits kinase cascade TORC1 and releases Rim15 which results in lifespan extension (Wanke et al. 2008). Another study conducted by Xin and his colleagues demonstrated that some alkaloid derivatives from Lycoris radiata viz reduce β-amyloid aggregation which delays the paralysis of the transgenic C. elegans strain CL4176, an amyloid β- expressing transgenic worms, resulting in lifespan extension (Xin et al. 2013). Reserpine, an indole alkaloid that has been used as a treatment for high blood pressure, showed a significant lifespan extension of C. elegans when treatment was done during their life cycle (Srivastava et al. 2008).

2.7.2.5. Curcumin Curcumin is a low molecular weight polyphenol isolated from Curcuma longa L. Curcumin is known as a wound healing bioactive molecule and used for treating stomach dysfunction, ulcers, jaundice, arthritis, skin and eye infections (Pant and Pandey 2015; Singh et al. 2007). Curcumin works as an anti-inflammatory drug with anti-carcinogenic and antioxidant functions due to its inhibition activity against the formation and progression of carcinogenic tumors in mammals (Bengmark 2006; Maheshwari et al. 2006; Nishino et al. 2004). Currently, it has been shown that this potent antioxidant increases longevity in C. elegans by modulating protein homeostasis and regulating numerous genes including skn-1, unc-43, osr-1, sir-2.1, sek-1, and age- 1 (Liao et al. 2011). Lifespan extension by curcumin in C. elegans was via multiple 89

Texas Tech University, Amal Bouyanfif, August 2019 cellular proteins and signaling pathways including the osmotic stress resistant/ calcium- calmodulin-dependent protein kinase type II/ dual specificity mitogen-activated protein kinase kinase sek-1 (OSR-1/UNC43/SEK-1) signaling; SIR-2.1 sirtuins; the phosphatidylinositol 3-kinase AGE-1; the transcription factor SKN1/Nrf and MAPK kinase MEK-1 (Liao et al. 2011). The results of this study revealed that the pharyngeal pumping rate and the body size of treated worms were influenced whereas their reproduction was not affected. Moreover, worms displayed a reduced intracellular reactive oxygen species (ROS) and lipofuscin during aging (Liao et al. 2011).

2.7.2.6. Polyunsaturated fatty acids

Polyunsaturated fatty acids are required for normal lifespan and contribute to lifespan extension (Watts and Browse 2002) Van Gilst and his colleagues showed that depletion of the essential Δ-9 fatty acid desaturase encoded by fat-7 accelerates aging (Van Gilst et al. 2005). mdt-15/MED15 knockdown resulted in shortening lifespan through downregulation of both genes fat-5 and fat-7 and reduction in unsaturated fatty acid biosynthesis (Taubert et al. 2006). Dietary supplementation with omega-6 polyunsaturated fatty acids (PUFAs) or overexpression of LIPL-4 (lysosomal acid lipase) stimulates resistance to starvation and prolongs lifespan in C. elegans through the activation of autophagy (Folick et al. 2015; O'Rourke et al. 2013). LIPL-4 hydrolyzes oleoylethanolamide (OEA), a phospholipid-derived molecule that is relocated to the intestinal nucleus via LBP-8 and binds directly to the nuclear receptor NHR-80, Changes in lipid biosynthesis contributes to stress resistance and longevity of C. elegans mutants (Shmookler Reis et al. 2011). Ten C. elegans strains of nearly identical genetic background were maintained on agar plates spotted with E. coli without supplementation (control) and with supplementation with eicosapentaenoic acid (EPA, C20:5 (n-3)), docosahexaenoic acid, DHA, C22:6 (n-3)), and palmitic acid (PA, C16:0). Changes in fatty acid composition were corroborated by transcript-level changes observed for genes involved in fatty acid biosynthesis (Shmookler Reis et al. 2011). The results of this study showed that supplementing the worm diet with 40 μM EPA significantly reduced the longevity of the wild-type Bristol-N2 as compared to

90

Texas Tech University, Amal Bouyanfif, August 2019 worms maintained on diet supplemented with PA (Shmookler Reis et al. 2011). It was suggested that fatty acids and lifespan relations are likely attributed to reduced elongase and certain desaturase activities, indicating that lifespan can be altered by dietary supplements (Shmookler Reis et al. 2011). In addition, fish oil altered longevity of C. elegans through lipid peroxidation (Sugawara et al. 2013). Moreover, Hillyard and German study showed that supplementation with omega 3 PUFAs of fat-3 mutant worms which lack delta 6 desaturase enzyme required for long-chain fatty acids synthesis, did not significantly affect the lifespan (Hillyard and German 2009). These findings are also consistent with our data reported in this dissertation).

Table 2.3: Phytochemicals extending lifespan in C. elegans organism via different cellular processes. FOXO; forkhead box protein O, ROS; reactive oxygen species; DAF, abnormal dauer formation. The table is adapted from (Leonov et al. 2015). Phytochemical Source Class Antiaging activity Reference

Resveratrol - Vitis plants phenolic compounds - Induces autophagy (Morselli et al. - Vaccinium (Stilbenoid) 2010; Wood et alaskaense al. 2004) - Vaccinium angustifolium - Rubus idaeus - Rubus occidentalis - Broussonetia papyrifera

Glaucarubi- - Simaroubaceae Terpenes - Increases oxygen (Zarse et al. none plants (triterpenoid) consumption rate 2011) - Reduces neutral lipids levels

91

Texas Tech University, Amal Bouyanfif, August 2019

Table 2.3. Continued.

Quercetin - Capparis spinose Phenolic compounds - Decreases ROS (Pietsch et al. - Levisticum (Flavonols) levels and oxidative 2009; officinale damage to Kampkotter et - Rumex acetosa macromolecules. al. 2008) - Raphanus sativus - Decreases - Ceratonia silique susceptibility to - Anethum thermal and graveolens oxidative stresses - Reduces neutral lipids level - Induces nuclear translocation of DAF-16/FOXO

Catechin - Vascular plants phenolic compounds - Reduces (Saul et al. (Flavan-3-ol) susceptibility to 2009) thermal stress and body length - Increases pumping rate

Reserpine - Rauvolfia Indole compounds - Reduces (Srivastava et serpentina (Indole alkaloid) susceptibility to al. 2008; Arya thermal stress et al. 2009) - Reduces pharyngeal pumping rate - Delays postembryonic development - Delays the paralysis caused by the proteo-toxicity of Abeta

Epigallocatechi - Camellia sinensis phenolic compounds - Lowers ROS levels. (Abbas and n gallate (Flavan-3-ol) - Decreases oxidative Wink 2009,

damage to lipids. 2010) - Reduces nuclear genes expression encoding HSP-16. - Stimulates nuclear translocation of DAF-16/FOXO.

92

Texas Tech University, Amal Bouyanfif, August 2019

Table 2.3. Continued.

Curcumin Curcuma longa phenolic compounds - Decreases levels of (Liao et al. (Diarylheptanoids) ROS and oxidative 2011) damage to macromolecules. - Reduces the susceptibility to oxidative and thermal stresses. - Lower body length and pumping rate.

Caffeine Coffea plants Purines - Reduces protein (Lublin et al. (Methylxanthine) aggregation in 2011; Sutphin models of et al. 2012) Alzheimer’s and Huntington’s diseases - delays the onset of paralysis

Caffeic and - Eucalyptus phenolic compounds - Change lipid (Pietsch et al. Rosmarinic globulus (Hydroxycinnamic metabolism. 2011) acids - Salvinia molesta acids) - Decrease susceptibility to thermal stress, oxidative damage to macromolecules, and body size. - delay reproductive timing - Extend lifespan

2.8. Conclusions Despite its apparent simplicity, C. elegans has been developed into a versatile and efficient model for biomedical research, particularly aging research. This model organism was used to identify countless new genes such as age-1 and daf-2 as well as biological processes with key roles in modulating aging by different and overlapping mechanisms. The availability of many different mutants has been a strength to the field and helped understand biological processes related to humans. A number of highly regulated nutrient-sensing pathways appear to be essential for aging delay across a variety of different dietary restriction approaches in C. elegans. Bioactive food and botanical compounds and their derivatives emerged as alternative medicinal approaches 93

Texas Tech University, Amal Bouyanfif, August 2019 in aging- related diseases. A better understanding of the mechanisms involved in aging will help develop new therapeutic approaches to prevent and ameliorate age-associated pathogenesis. The C. elegans is a promising and ideal model organism for such studies.

94

Texas Tech University, Amal Bouyanfif, August 2019

2.9. References Abbas S, Wink M (2009) Epigallocatechin gallate from green tea (Camellia sinensis) increases lifespan and stress resistance in Caenorhabditis elegans. Planta Med 75 (3):216-221. doi:10.1055/s-0028-1088378

Abbas S, Wink M (2010) Epigallocatechin gallate inhibits beta amyloid oligomerization in Caenorhabditis elegans and affects the daf-2/insulin-like signaling pathway. Phytomedicine 17 (11):902-909. doi:10.1016/j.phymed.2010.03.008

Anderson EN, Corkins ME, Li JC, Singh K, Parsons S, Tucey TM, Sorkac A, Huang HY, Dimitriadi M, Sinclair DA, Hart AC (2016) C-elegans lifespan extension by osmotic stress requires FUdR, base excision repair, FOXO, and sirtuins. Mechanisms of Ageing and Development 154:30-42. doi:10.1016/j.mad.2016.01.004

Anderson GL (1978) Responses of dauer larvae of Caenorhabditis elegans (Nematoda: Rhabditidae) to thermal stress and oxygen deprivation. Can J Zool 56::1786– 1791

Anderson GL (1982) Superoxide dismutase activity in the dauerlarvae of Caenorhabditis elegans. Can J Zool 60::288–291

Anselmi CV, Malovini A, Roncarati R, Novelli V, Villa F, Condorelli G, Bellazzi R, Puca AA (2009) Association of the FOXO3A locus with extreme longevity in a southern Italian centenarian study. Rejuvenation Res 12 (2):95-104. doi:10.1089/rej.2008.0827

Antebi A (2013) Regulation of longevity by the reproductive system. Exp Gerontol 48 (7):596-602. doi:10.1016/j.exger.2012.09.009

Apfeld J, Kenyon C (1999) Regulation of lifespan by sensory perception in Caenorhabditis elegans. Nature 402 (6763):804-809. doi:10.1038/45544

Apfeld J, O'Connor G, McDonagh T, DiStefano PS, Curtis R (2004) The AMP-activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C-elegans. Gene Dev 18 (24):3004-3009. doi:10.1101/gad.1255404

Arantes-Oliveira N, Berman JR, Kenyon C (2003) Healthy animals with extreme longevity. Science 302 (5645):611. doi:10.1126/science.1089169

Arts IC, Hollman PC (2005) Polyphenols and disease risk in epidemiologic studies. Am J Clin Nutr 81 (1 Suppl):317S-325S. doi:10.1093/ajcn/81.1.317S

95

Texas Tech University, Amal Bouyanfif, August 2019

Arya U, Dwivedi H, Subramaniam JR (2009) Reserpine ameliorates Abeta toxicity in the Alzheimer's disease model in Caenorhabditis elegans. Exp Gerontol 44 (6- 7):462-466. doi:10.1016/j.exger.2009.02.010

Aunan JR, Cho WC, Soreide K (2017) The Biology of Aging and Cancer: A Brief Overview of Shared and Divergent Molecular Hallmarks. Aging Dis 8 (5):628- 642. doi:10.14336/AD.2017.0103

Avery L (1993) The genetics of feeding in Caenorhabditis elegans. Genetics 133 (4):897-917

Baierle M, Nascimento SN, Moro AM, Brucker N, Freitas F, Gauer B, Durgante J, Bordignon S, Zibetti M, Trentini CM, Duarte MM, Grune T, Breusing N, Garcia SC (2015) Relationship between inflammation and oxidative stress and cognitive decline in the institutionalized elderly. Oxid Med Cell Longev 2015:804198. doi:10.1155/2015/804198

Banasik K, Ribel-Madsen R, Gjesing AP, Wegner L, Andersson A, Poulsen P, Borglykke A, Witte DR, Pedersen O, Hansen T, Vaag A (2011) The FOXO3A rs2802292 G-allele associates with improved peripheral and hepatic insulin sensitivity and increased skeletal muscle-FOXO3A mRNA expression in twins. J Clin Endocrinol Metab 96 (1):E119-124. doi:10.1210/jc.2010-0881

Bartke A (2008) Insulin and aging. Cell Cycle 7 (21):3338-3343. doi:10.4161/cc.7.21.7012

Bartke A, Brown-Borg H, Kinney B, Mattison J, Wright C, Hauck S, Coschigano K, Kopchick J (2000) Growth hormone and aging. J Am Aging Assoc 23 (4):219- 225. doi:10.1007/s11357-000-0021-x

Bartke A, Wright JC, Mattison JA, Ingram DK, Miller RA, Roth GS (2001) Extending the lifespan of long-lived mice. Nature 414 (6862):412. doi:10.1038/35106646

Barzilai N, Huffman DM, Muzumdar RH, Bartke A (2012) The critical role of metabolic pathways in aging. Diabetes 61 (6):1315-1322. doi:10.2337/db11-1300

Bauer JH, Goupil S, Garber GB, Helfand SL (2004) An accelerated assay for the identification of lifespan-extending interventions in Drosophila melanogaster. Proc Natl Acad Sci U S A 101 (35):12980-12985. doi:10.1073/pnas.0403493101

Beausejour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P, Campisi J (2003) Reversal of human cellular senescence: roles of the p53 and p16 pathways. EMBO J 22 (16):4212-4222. doi:10.1093/emboj/cdg417

96

Texas Tech University, Amal Bouyanfif, August 2019

Bechmann LP, Hannivoort RA, Gerken G, Hotamisligil GS, Trauner M, Canbay A (2012) The interaction of hepatic lipid and glucose metabolism in liver diseases. J Hepatol 56 (4):952-964. doi:10.1016/j.jhep.2011.08.025

Beckman KB, Ames BN (1998) Mitochondrial aging: open questions. Ann N Y Acad Sci 854:118-127

Bengmark S (2006) Curcumin, an atoxic antioxidant and natural NFkappaB, cyclooxygenase-2, lipooxygenase, and inducible nitric oxide synthase inhibitor: a shield against acute and chronic diseases. JPEN J Parenter Enteral Nutr 30 (1):45-51

Berman JR, Kenyon C (2006) Germ-cell loss extends C. elegans life span through regulation of DAF-16 by kri-1 and lipophilic-hormone signaling. Cell 124 (5):1055-1068. doi:10.1016/j.cell.2006.01.039

Bjelakovic G, Nikolova D, Lotte Gluud L, G SR, Christian G (2007) Mortality in Randomized Trials of Antioxidant Supplements for Primary and Secondary Prevention, a Systematic Review and Meta-analysis. Jama-Journal of the American Medical Association 297 (8):842–857. doi:10.1001/jama.297.8.842

Bluher M, Kahn BB, Kahn CR (2003) Extended longevity in mice lacking the insulin receptor in adipose tissue. Science 299 (5606):572-574. doi:10.1126/science.1078223

Blumberg J (2004) Use of biomarkers of oxidative stress in research studies. J Nutr 134 (11):3188S-3189S. doi:10.1093/jn/134.11.3188S

Boehm M, Slack F (2005) A developmental timing microRNA and its target regulate life span in C. elegans. Science 310 (5756):1954-1957. doi:10.1126/science.1115596

Boulias K, Horvitz HR (2012) The C. elegans microRNA mir-71 acts in neurons to promote germline-mediated longevity through regulation of DAF-16/FOXO. Cell Metab 15 (4):439-450. doi:10.1016/j.cmet.2012.02.014

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode C.elegans as a Model Organism to Study Metabolic Effects of ω-3 Polyunsaturated Fatty Acids in Obesit. AdvNutr 0:1-14. doi:https://doi.org/10.1093/advances/nmy059.

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of

97

Texas Tech University, Amal Bouyanfif, August 2019

omega-3 Polyunsaturated Fatty Acids in Obesity. Adv Nutr 10 (1):165-178. doi:10.1093/advances/nmy059

Brandon M, Baldi P, Wallace DC (2006) Mitochondrial mutations in cancer. Oncogene 25 (34):4647-4662. doi:10.1038/sj.onc.1209607

Brenner S (1974) THE GENETICS OF CAENORHABDZTZS ELEGANS Genetlcs 77 71-94

Brewer RA, Gibbs VK, Smith DL, Jr. (2016) Targeting glucose metabolism for healthy aging. Nutr Healthy Aging 4 (1):31-46. doi:10.3233/NHA-160007

Briskin DP (2000) Medicinal plants and phytomedicines. Linking plant biochemistry and physiology to human health. Plant Physiol 124 (2):507-514

Brown-Borg HM, Borg KE, Meliska CJ, Bartke A (1996) Dwarf mice and the ageing process. Nature 384 (6604):33. doi:10.1038/384033a0

Burkewitz K, Choe K, Strange K (2011) Hypertonic stress induces rapid and widespread protein damage in C. elegans. Am J Physiol-Cell Ph 301 (3):C566-C576. doi:10.1152/ajpcell.00030.2011

Buu-Hoi NP, Ratsimamanga AR (1959) [Retarding action of nordihydroguiaiaretic acid on aging in the rat]. C R Seances Soc Biol Fil 153:1180-1182

Cameron AR, Anton S, Melville L, Houston NP, Dayal S, McDougall GJ, Stewart D, Rena G (2008) Black tea polyphenols mimic insulin/insulin-like growth factor- 1 signalling to the longevity factor FOXO1a. Aging Cell 7 (1):69-77. doi:10.1111/j.1474-9726.2007.00353.x

Campisi J, Andersen JK, Kapahi P, Melov S (2011) Cellular senescence: a link between cancer and age-related degenerative disease? Semin Cancer Biol 21 (6):354-359. doi:10.1016/j.semcancer.2011.09.001

Canuelo A, Gilbert-Lopez B, Pacheco-Linan P, Martinez-Lara E, Siles E, Miranda- Vizuete A (2012) Tyrosol, a main phenol present in extra virgin olive oil, increases lifespan and stress resistance in Caenorhabditis elegans. Mech Ageing Dev 133 (8):563-574. doi:10.1016/j.mad.2012.07.004

Carrano AC, Dillin A, Hunter T (2014) A Kruppel-like factor downstream of the E3 ligase WWP-1 mediates dietary-restriction-induced longevity in Caenorhabditis elegans. Nat Commun 5:3772. doi:10.1038/ncomms4772

98

Texas Tech University, Amal Bouyanfif, August 2019

Carrano AC, Liu Z, Dillin A, Hunter T (2009) A conserved ubiquitination pathway determines longevity in response to diet restriction. Nature 460 (7253):396-399. doi:10.1038/nature08130

Castelein N, Hoogewijs D, De Vreese A, Braeckman BP, Vanfleteren JR (2008) Dietary restriction by growth in axenic medium induces discrete changes in the transcriptional output of genes involved in energy metabolism in Caenorhabditis elegans. Biotechnol J 3 (6):803-812. doi:10.1002/biot.200800003

Chapman T, Partridge L (1996) Female fitness in Drosophila melanogaster: an interaction between the effect of nutrition and of encounter rate with males. Proc Biol Sci 263 (1371):755-759. doi:10.1098/rspb.1996.0113

Charlesworth B (2001) Patterns of age-specific means and genetic variances of mortality rates predicted by the mutation-accumulation theory of ageing. J Theor Biol 210 (1):47-65. doi:10.1006/jtbi.2001.2296

Chen D, Thomas EL, Kapahi P (2009) HIF-1 modulates dietary restriction-mediated lifespan extension via IRE-1 in Caenorhabditis elegans. PLoS Genet 5 (5):e1000486. doi:10.1371/journal.pgen.1000486

Chung HY, Sung B, Jung KJ, Zou Y, Yu BP (2006) The molecular inflammatory process in aging. Antioxid Redox Signal 8 (3-4):572-581. doi:10.1089/ars.2006.8.572

Collins JJ, Evason K, Kornfeld K (2006) Pharmacology of delayed aging and extended lifespan of Caenorhabditis elegans. Exp Gerontol 41 (10):1032-1039. doi:10.1016/j.exger.2006.06.038

Coschigano KT, Holland AN, Riders ME, List EO, Flyvbjerg A, Kopchick JJ (2003) Deletion, but not antagonism, of the mouse growth hormone receptor results in severely decreased body weights, insulin, and insulin-like growth factor I levels and increased life span. Endocrinology 144 (9):3799-3810. doi:10.1210/en.2003-0374

Croteau R, Kutchan T, Lewis N (2000) Natural products (secondary metabolites). In: B B, W G, R J (eds) Biochemistry and molecular biology of plants. Rockville, MD, USA: American Society of Plant Biologists, pp 1250–1319

Cui H, Kong Y, Zhang H (2012) Oxidative stress, mitochondrial dysfunction, and aging. J Signal Transduct 2012:646354. doi:10.1155/2012/646354

99

Texas Tech University, Amal Bouyanfif, August 2019 de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ (2010) MicroRNAs both promote and antagonize longevity in C. elegans. Curr Biol 20 (24):2159-2168. doi:10.1016/j.cub.2010.11.015 de Magalhaes JP, Curado J, Church GM (2009) Meta-analysis of age-related gene expression profiles identifies common signatures of aging. Bioinformatics 25 (7):875-881. doi:10.1093/bioinformatics/btp073 de Magalhaes JP, Wuttke D, Wood SH, Plank M, Vora C (2012) Genome-environment interactions that modulate aging: powerful targets for drug discovery. Pharmacol Rev 64 (1):88-101. doi:10.1124/pr.110.004499

Dillin A, Gottschling DE, Nyström T (2014) The good and the bad of being connected: the integrons of aging. Curr Opin Cell Biol:107–112. doi:10.1016/j.ceb.2013.12.003

Dmitrieva NI, Burg MB (2007) High NaCl promotes cellular senescence. Cell Cycle 6 (24):3108-3113. doi:DOI 10.4161/cc.6.24.5084

Dmitrieva NI, Cui KR, Kitchaev DA, Zhao KJ, Burg MB (2011) DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts. P Natl Acad Sci USA 108 (51):20796-20801. doi:10.1073/pnas.1114677108

Drenos F, Kirkwood TB (2005) Modelling the disposable soma theory of ageing. Mech Ageing Dev 126 (1):99-103. doi:10.1016/j.mad.2004.09.026

Duffy DC, McDonald JC, Schueller OJA, Whitesides GM (1998) Rapid prototyping of microfluidic systems in poly(dimethylsiloxane). Anal Chem 70 (23):4974-4984. doi:DOI 10.1021/ac980656z

Egan DF, Shackelford DB, Mihaylova MM, Gelino S, Kohnz RA, Mair W, Vasquez DS, Joshi A, Gwinn DM, Taylor R, Asara JM, Fitzpatrick J, Dillin A, Viollet B, Kundu M, Hansen M, Shaw RJ (2011) Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331 (6016):456-461. doi:10.1126/science.1196371

Eisenberg T, Knauer H, Schauer A, Buttner S, Ruckenstuhl C, Carmona-Gutierrez D, Ring J, Schroeder S, Magnes C, Antonacci L, Fussi H, Deszcz L, Hartl R, Schraml E, Criollo A, Megalou E, Weiskopf D, Laun P, Heeren G, Breitenbach M, Grubeck-Loebenstein B, Herker E, Fahrenkrog B, Frohlich KU, Sinner F, Tavernarakis N, Minois N, Kroemer G, Madeo F (2009) Induction of autophagy by spermidine promotes longevity. Nat Cell Biol 11 (11):1305-1314. doi:10.1038/ncb1975

100

Texas Tech University, Amal Bouyanfif, August 2019

Evans MD, Dizdaroglu M, Cooke MS (2004) Oxidative DNA damage and disease: induction, repair and significance. Mutat Res 567 (1):1-61. doi:10.1016/j.mrrev.2003.11.001

Feng Y, He D, Yao Z, Klionsky DJ (2014) The machinery of macroautophagy. Cell Res 24 (1):24-41. doi:10.1038/cr.2013.168

Finkel T (2001) Reactive oxygen species and signal transduction. IUBMB Life 52 (1- 2):3-6. doi:10.1080/15216540252774694

Flachsbart F, Caliebe A, Kleindorp R, Blanche H, von Eller-Eberstein H, Nikolaus S, Schreiber S, Nebel A (2009) Association of FOXO3A variation with human longevity confirmed in German centenarians. Proc Natl Acad Sci U S A 106 (8):2700-2705. doi:10.1073/pnas.0809594106

Flurkey K, Papaconstantinou J, Harrison DE (2002) The Snell dwarf mutation Pit1(dw) can increase life span in mice. Mech Ageing Dev 123 (2-3):121-130

Folick A, Oakley HD, Yu Y, Armstrong EH, Kumari M, Sanor L, Moore DD, Ortlund EA, Zechner R, Wang MC (2015) Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans. Science 347 (6217):83-86. doi:10.1126/science.1258857

Fontana L, Partridge L (2015) Promoting health and longevity through diet: from model organisms to humans. Cell 161 (1):106-118. doi:10.1016/j.cell.2015.02.020

Fraga MF, Esteller M (2007) Epigenetics and aging: the targets and the marks. Trends Genet 23 (8):413-418. doi:10.1016/j.tig.2007.05.008

Friedman DB, Johnson TE (1988a) A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 118 (1):75- 86

Friedman DB, Johnson TE (1988b) A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 188 (1):75- 86

Frojdo S, Vidal H, Pirola L (2009) Alterations of insulin signaling in type 2 diabetes: a review of the current evidence from humans. Biochim Biophys Acta 1792 (2):83-92. doi:10.1016/j.bbadis.2008.10.019

Gelino S, Chang JT, Kumsta C, She X, Davis A, Nguyen C, Panowski S, Hansen M (2016) Intestinal Autophagy Improves Healthspan and Longevity in C. elegans

101

Texas Tech University, Amal Bouyanfif, August 2019

during Dietary Restriction. PLoS Genet 12 (7):e1006135. doi:10.1371/journal.pgen.1006135

GenAge (2016) GenAge Model Organisms

Gerisch B, Rottiers V, Li D, Motola DL, Cummins CL, Lehrach H, Mangelsdorf DJ, Antebi A (2007) A bile acid-like steroid modulates Caenorhabditis elegans lifespan through nuclear receptor signaling. Proc Natl Acad Sci U S A 104 (12):5014-5019. doi:10.1073/pnas.0700847104

Gerstbrein B, Stamatas G, Kollias N, Driscoll M (2005) In vivo spectrofluorimetry reveals endogenous biomarkers that report healthspan and dietary restriction in Caenorhabditis elegans. Aging Cell 4 (3):127-137. doi:10.1111/j.1474- 9726.2005.00153.x

Ghorashian N, Gokce SK, Ben-Yakar A (2016) Microfluidic systems for whole-animal screening. Micro- and Nanosystems for Biotechnology. Wiley-VCH Verlag GmbH & Co. KGaA

Giannakou ME, Goss M, Junger MA, Hafen E, Leevers SJ, Partridge L (2004) Long- lived Drosophila with overexpressed dFOXO in adult fat body. Science 305 (5682):361. doi:10.1126/science.1098219

Goldberg AD, Allis CD, Bernstein E (2007) Epigenetics: a landscape takes shape. Cell 128 (4):635-638. doi:10.1016/j.cell.2007.02.006

Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H (2011) Fatty acid desaturation links germ cell loss to longevity through NHR- 80/HNF4 in C. elegans. PLoS Biol 9 (3):e1000599. doi:10.1371/journal.pbio.1000599

Graf BA, Milbury PE, Blumberg JB (2005) Flavonols, flavones, flavanones, and human health: epidemiological evidence. J Med Food 8 (3):281-290. doi:10.1089/jmf.2005.8.281

Greer EL, Banko MR, Brunet A (2009) AMP-activated protein kinase and FoxO transcription factors in dietary restriction-induced longevity. Ann N Y Acad Sci 1170:688-692. doi:10.1111/j.1749-6632.2009.04019.x

Greer EL, Maures TJ, Hauswirth AG, Green EM, Leeman DS, Maro GS, Han S, Banko MR, Gozani O, Brunet A (2010) Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans. Nature 466 (7304):383-387. doi:10.1038/nature09195

102

Texas Tech University, Amal Bouyanfif, August 2019

Grishok A (2005) RNAi mechanisms in Caenorhabditis elegans. FEBS Lett 579 (26):5932-5939. doi:10.1016/j.febslet.2005.08.001

Grunz G, Haas K, Soukup S, Klingenspor M, Kulling SE, Daniel H, Spanier B (2012) Structural features and bioavailability of four flavonoids and their implications for lifespan-extending and antioxidant actions in C. elegans. Mech Ageing Dev 133 (1):1-10. doi:10.1016/j.mad.2011.11.005

Guarente L, Kenyon C (2000) Genetic pathways that regulate ageing in model organisms. Nature 408 (6809):255-262. doi:10.1038/35041700

Ha M, Kim VN (2014) Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol 15 (8):509-524. doi:10.1038/nrm3838

Hagen TM (2003) Oxidative stress, redox imbalance, and the aging process. Antioxid Redox Signal 5 (5):503-506. doi:10.1089/152308603770310149

Haigis MC, Sinclair DA (2010) Mammalian sirtuins: biological insights and disease relevance. Annu Rev Pathol 5:253-295. doi:10.1146/annurev.pathol.4.110807.092250

Hamet P, Tremblay J (2003) Genes of aging. Metabolism 52 (10 Suppl 2):5-9

Hansen M, Chandra A, Mitic LL, Onken B, Driscoll M, Kenyon C (2008) A role for autophagy in the extension of lifespan by dietary restriction in C. elegans. PLoS Genet 4 (2):e24. doi:10.1371/journal.pgen.0040024

Hansen M, Hsu AL, Dillin A, Kenyon C (2005) New genes tied to endocrine, metabolic, and dietary regulation of lifespan from a Caenorhabditis elegans genomic RNAi screen. PLoS Genet 1 (1):119-128. doi:10.1371/journal.pgen.0010017

Hansen M, Kapahi P (2010) TOR Signaling and Aging. Enzymes 28:279-299. doi:10.1016/S1874-6047(10)28014-9

Hansen M, Taubert S, Crawford D, Libina N, Lee SJ, Kenyon C (2007) Lifespan extension by conditions that inhibit translation in Caenorhabditis elegans. Aging Cell 6 (1):95-110. doi:10.1111/j.1474-9726.2006.00267.x

Hardie DG, Hawley SA (2001) AMP-activated protein kinase: the energy charge hypothesis revisited. Bioessays 23 (12):1112-1119. doi:DOI 10.1002/bies.10009

Harman D (1956) Aging: a theory based on free radical and radiation chemistry. J Gerontol 11 (3):298-300

103

Texas Tech University, Amal Bouyanfif, August 2019

Harman D (1962) Role of free radicals in mutation, cancer, aging, and the maintenance of life. Radiat Res 16:753-763

Harman D (1972) Free radical theory of aging: dietary implications. Am J Clin Nutr 25 (8):839-843. doi:10.1093/ajcn/25.8.839

Harman D (2001) Aging: overview. Ann N Y Acad Sci 928:1-21

Heestand BN, Shen Y, Liu W, Magner DB, Storm N, Meharg C, Habermann B, Antebi A (2013) Dietary restriction induced longevity is mediated by nuclear receptor NHR-62 in Caenorhabditis elegans. PLoS Genet 9 (7):e1003651. doi:10.1371/journal.pgen.1003651

Higdon JV, Frei B (2003) Tea catechins and polyphenols: health effects, metabolism, and antioxidant functions. Crit Rev Food Sci Nutr 43 (1):89-143. doi:10.1080/10408690390826464

Hillyard SL, German JB (2009) Quantitative lipid analysis and life span of the fat-3 mutant of Caenorhabditis elegans. J Agric Food Chem 57 (8):3389-3396. doi:10.1021/jf8031414

Holloszy JO, Fontana L (2007) Caloric Restriction in Humans. Exp Gerontol 42 (8): 709–712. doi:10.1016/j.exger.2007.03.009

Holzenberger M, Dupont J, Ducos B, Leneuve P, Geloen A, Even PC, Cervera P, Le Bouc Y (2003) IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature 421 (6919):182-187. doi:10.1038/nature01298

Honda S, Ishii N, Suzuki K, Matsuo M (1993) Oxygen-dependent perturbation of life span and aging rate in the nematode. J Gerontol 48 (2):B57-61

Honjoh S, Yamamoto T, Uno M, Nishida E (2009) Signalling through RHEB-1 mediates intermittent fasting-induced longevity in C. elegans. Nature 457 (7230):726-730. doi:10.1038/nature07583

Hosono R, Nishimoto S, Kuno S (1989) Alterations of life span in the nematode Caenorhabditis elegans under monoxenic culture conditions. Exp Gerontol 24 (3):251-264

Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, Zipkin RE, Chung P, Kisielewski A, Zhang LL, Scherer B, Sinclair DA (2003) Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425 (6954):191-196. doi:10.1038/nature01960

104

Texas Tech University, Amal Bouyanfif, August 2019

Hsin H, Kenyon C (1999) Signals from the reproductive system regulate the lifespan of C-elegans. Nature 399 (6734):362-366

Hughes KA, Reynolds RM (2005) Evolutionary and mechanistic theories of aging. Annu Rev Entomol 50:421-445. doi:10.1146/annurev.ento.50.071803.130409

Hulme SE, Shevkoplyas SS, McGuigan AP, Apfeld J, Fontana W, Whitesides GM (2010) Lifespan-on-a-chip: microfluidic chambers for performing lifelong observation of C. elegans. Lab Chip 10 (5):589-597. doi:10.1039/b919265d

Hutter E, Unterluggauer H, Uberall F, Schramek H, Jansen-Durr P (2002) Replicative senescence of human fibroblasts: the role of Ras-dependent signaling and oxidative stress. Exp Gerontol 37 (10-11):1165-1174

Hwangbo DS, Gershman B, Tu MP, Palmer M, Tatar M (2004) Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature 429 (6991):562-566. doi:10.1038/nature02549

Ido Y, Duranton A, Lan F, Weikel KA, Breton L, Ruderman NB (2015) Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes. PLoS One 10 (2):e0115341. doi:10.1371/journal.pone.0115341

Jang JH, Surh YJ (2003) Protective effect of resveratrol on beta-amyloid-induced oxidative PC12 cell death. Free Radic Biol Med 34 (8):1100-1110

Jang M, Cai L, Udeani GO, Slowing KV, Thomas CF, Beecher CW, Fong HH, Farnsworth NR, Kinghorn AD, Mehta RG, Moon RC, Pezzuto JM (1997) Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275 (5297):218-220

Jellinger KA (2013) Pathology and pathogenesis of vascular cognitive impairment-a critical update. Front Aging Neurosci 5:17. doi:10.3389/fnagi.2013.00017

Jia K, Chen D, Riddle DL (2004) The TOR pathway interacts with the insulin signaling pathway to regulate C. elegans larval development, metabolism and life span. Development 131 (16):3897-3906. doi:10.1242/dev.01255

Jia K, Levine B (2007) Autophagy is required for dietary restriction-mediated life span extension in C. elegans. Autophagy 3 (6):597-599

105

Texas Tech University, Amal Bouyanfif, August 2019

Jiang JC, Jaruga E, Repnevskaya MV, Jazwinski SM (2000) An intervention resembling caloric restriction prolongs life span and retards aging in yeast. FASEB J 14 (14):2135-2137. doi:10.1096/fj.00-0242fje

Jin C, Li J, Green CD, Yu X, Tang X, Han D, Xian B, Wang D, Huang X, Cao X, Yan Z, Hou L, Liu J, Shukeir N, Khaitovich P, Chen CD, Zhang H, Jenuwein T, Han JD (2011) Histone demethylase UTX-1 regulates C. elegans life span by targeting the insulin/IGF-1 signaling pathway. Cell Metab 14 (2):161-172. doi:10.1016/j.cmet.2011.07.001

Johnson TE, Wood WB (1982) Genetic-Analysis of Life-Span in Caenorhabditis- Elegans. P Natl Acad Sci-Biol 79 (21):6603-6607. doi:DOI 10.1073/pnas.79.21.6603

Kaeberlein TL, Smith ED, Tsuchiya M, Welton KL, Thomas JH, Fields S, Kennedy BK, Kaeberlein M (2006) Lifespan extension in Caenorhabditis elegans by complete removal of food. Aging Cell 5 (6):487-494. doi:10.1111/j.1474- 9726.2006.00238.x

Kampkotter A, Nkwonkam CG, Zurawski RF, Timpel C, Chovolou Y, Watjen W, Kahl R (2007) Investigations of protective effects of the flavonoids quercetin and rutin on stress resistance in the model organism Caenorhabditis elegans. Toxicology 234 (1-2):113-123. doi:10.1016/j.tox.2007.02.006

Kampkotter A, Timpel C, Zurawski RF, Ruhl S, Chovolou Y, Proksch P, Watjen W (2008) Increase of stress resistance and lifespan of Caenorhabditis elegans by quercetin. Comp Biochem Physiol B Biochem Mol Biol 149 (2):314-323. doi:10.1016/j.cbpb.2007.10.004

Kapahi P, Chen D, Rogers AN, Katewa SD, Li PW, Thomas EL, Kockel L (2010) With TOR, less is more: a key role for the conserved nutrient-sensing TOR pathway in aging. Cell Metab 11 (6):453-465. doi:10.1016/j.cmet.2010.05.001

Kapahi P, Kaeberlein M, Hansen M (2017) Dietary restriction and lifespan: Lessons from invertebrate models. Ageing Res Rev 39:3-14. doi:10.1016/j.arr.2016.12.005

Kaplan EL, and Meier, P. (1958) Nonparametric estimation from incomplete observations. J Am Statistical Association 53:457-481

Katewa SD, Kapahi P (2010) Dietary restriction and aging, 2009. Aging Cell 9 (2):105- 112. doi:10.1111/j.1474-9726.2010.00552.x

106

Texas Tech University, Amal Bouyanfif, August 2019

Kato M, Chen X, Inukai S, Zhao H, Slack FJ (2011) Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans. RNA 17 (10):1804-1820. doi:10.1261/rna.2714411

Kenyon C (1997) C. elegans II. 2nd edition. Chapter 28- Environmental Factors and Gene Activities That Influence Life Span. Cold Spring Harbor Laboratory Press

Kenyon C (2010a) A pathway that links reproductive status to lifespan in Caenorhabditis elegans. Ann N Y Acad Sci 1204:156-162. doi:10.1111/j.1749- 6632.2010.05640.x

Kenyon C (2011) The first long-lived mutants: discovery of the insulin/IGF-1 pathway for ageing. Philos Trans R Soc Lond B Biol Sci 366 (1561):9-16. doi:10.1098/rstb.2010.0276

Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993) A C. elegans mutant that lives twice as long as wild type. Nature 366 (6454):461-464. doi:10.1038/366461a0

Kenyon CJ (2010b) The genetics of ageing. Nature 464 (7288):504-512. doi:10.1038/nature08980

Khan N, Afaq F, Saleem M, Ahmad N, Mukhtar H (2006) Targeting multiple signaling pathways by green tea polyphenol (-)-epigallocatechin-3-gallate. Cancer Res 66 (5):2500-2505. doi:10.1158/0008-5472.CAN-05-3636

Kim B, Feldman EL (2012) Insulin resistance in the nervous system. Trends Endocrinol Metab 23 (3):133-141. doi:10.1016/j.tem.2011.12.004

Klass MR (1977) Aging in the nematode Caenorhabditis elegans: major biological and environmental factors influencing life span. Mech Ageing Dev 6 (6):413-429

Klass MR (1983) A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results. Mech Ageing Dev 22 (3-4):279-286

Kregel KC, Zhang HJ (2007) An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am J Physiol Regul Integr Comp Physiol 292 (1):R18-36. doi:10.1152/ajpregu.00327.2006

Kris-Etherton PM, Hecker KD, Bonanome A, Coval SM, Binkoski AE, Hilpert KF, Griel AE, Etherton TD (2002) Bioactive compounds in foods: their role in the prevention of cardiovascular disease and cancer. Am J Med 113 Suppl 9B:71S- 88S

107

Texas Tech University, Amal Bouyanfif, August 2019

Lakowski B, Hekimi S (1998) The genetics of caloric restriction in Caenorhabditis elegans. Proc Natl Acad Sci U S A 95 (22):13091-13096

Lane MA, Mattison J, Ingram DK, Roth GS (2002) Caloric restriction and aging in primates: Relevance to humans and possible CR mimetics. Microsc Res Tech 59 (4):335-338. doi:10.1002/jemt.10214

Lapierre LR, Gelino S, Melendez A, Hansen M (2011) Autophagy and lipid metabolism coordinately modulate life span in germline-less C. elegans. Curr Biol 21 (18):1507-1514. doi:10.1016/j.cub.2011.07.042

Lapierre LR, Hansen M (2012) Lessons from C. elegans: signaling pathways for longevity. Trends Endocrin Met 23 (12):637-644. doi:10.1016/j.tem.2012.07.007

Lapierre LR, Kumsta C, Sandri M, Ballabio A, Hansen M (2015) Transcriptional and epigenetic regulation of autophagy in aging. Autophagy 11 (6):867-880. doi:10.1080/15548627.2015.1034410

Laplante M, Sabatini DM (2012) mTOR signaling in growth control and disease. Cell 149 (2):274-293. doi:10.1016/j.cell.2012.03.017

Larsen PL (1993) Aging and resistance to oxidative damage in Caenorhabditis elegans. Proc Natl Acad Sci U S A 90 (19):8905-8909

Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75 (5):843- 854

Lee SJ, Murphy CT, Kenyon C (2009) Glucose shortens the life span of C. elegans by downregulating DAF-16/FOXO activity and aquaporin gene expression. Cell Metab 10 (5):379-391. doi:10.1016/j.cmet.2009.10.003

Leiter LA, Ceriello A, Davidson JA, Hanefeld M, Monnier L, Owens DR, Tajima N, Tuomilehto J, International Prandial Glucose Regulation Study G (2005) Postprandial glucose regulation: new data and new implications. Clin Ther 27 Suppl B:S42-56

Leonov A, Arlia-Ciommo A, Piano A, Svistkova V, Lutchman V, Medkour Y, Titorenko VI (2015) Longevity extension by phytochemicals. Molecules 20 (4):6544-6572. doi:10.3390/molecules20046544

108

Texas Tech University, Amal Bouyanfif, August 2019

Leung MC, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN (2008) Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicol Sci 106 (1):5-28. doi:10.1093/toxsci/kfn121 Levine B, Klionsky DJ (2004) Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell 6 (4):463-477

Li Y, Wang WJ, Cao H, Lu J, Wu C, Hu FY, Guo J, Zhao L, Yang F, Zhang YX, Li W, Zheng GY, Cui H, Chen X, Zhu Z, He H, Dong B, Mo X, Zeng Y, Tian XL (2009) Genetic association of FOXO1A and FOXO3A with longevity trait in Han Chinese populations. Hum Mol Genet 18 (24):4897-4904. doi:10.1093/hmg/ddp459

Liang R, Khanna A, Muthusamy S, Li N, Sarojini H, Kopchick JJ, Masternak MM, Bartke A, Wang E (2011) Post-transcriptional regulation of IGF1R by key microRNAs in long-lived mutant mice. Aging Cell 10 (6):1080-1088. doi:10.1111/j.1474-9726.2011.00751.x

Liao VH, Yu CW, Chu YJ, Li WH, Hsieh YC, Wang TT (2011) Curcumin-mediated lifespan extension in Caenorhabditis elegans. Mech Ageing Dev 132 (10):480- 487. doi:10.1016/j.mad.2011.07.008

Lin K, Dorman JB, Rodan A, Kenyon C (1997) daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science 278 (5341):1319-1322

Lionaki E, Tavernarakis N (2013) Assessing aging and senescent decline in Caenorhabditis elegans: cohort survival analysis. Methods Mol Biol 965:473- 484. doi:10.1007/978-1-62703-239-1_31

Lithgow GJ, Gill MS, Olsen A, Sampayo JN (2005) Pharmacological intervention in invertebrate aging. Age (Dordr) 27 (3):213-223. doi:10.1007/s11357-005-3625- 3

Loeb LA, Wallace DC, Martin GM (2005) The mitochondrial theory of aging and its relationship to reactive oxygen species damage and somatic mtDNA mutations. Proc Natl Acad Sci U S A 102 (52):18769-18770. doi:10.1073/pnas.0509776102

Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging. Cell 153 (6):1194-1217. doi:10.1016/j.cell.2013.05.039

Lublin A, Isoda F, Patel H, Yen K, Nguyen L, Hajje D, Schwartz M, Mobbs C (2011) FDA-approved drugs that protect mammalian neurons from glucose toxicity

109

Texas Tech University, Amal Bouyanfif, August 2019

slow aging dependent on cbp and protect against proteotoxicity. PLoS One 6 (11):e27762. doi:10.1371/journal.pone.0027762

Lunetta KL, D'Agostino RB, Sr., Karasik D, Benjamin EJ, Guo CY, Govindaraju R, Kiel DP, Kelly-Hayes M, Massaro JM, Pencina MJ, Seshadri S, Murabito JM (2007) Genetic correlates of longevity and selected age-related phenotypes: a genome-wide association study in the Framingham Study. BMC Med Genet 8 Suppl 1:S13. doi:10.1186/1471-2350-8-S1-S13

Madamanchi NR, Vendrov A, Runge MS (2005) Oxidative stress and vascular disease. Arterioscler Thromb Vasc Biol 25 (1):29-38. doi:10.1161/01.ATV.0000150649.39934.13

Maheshwari RK, Singh AK, Gaddipati J, Srimal RC (2006) Multiple biological activities of curcumin: a short review. Life Sci 78 (18):2081-2087. doi:10.1016/j.lfs.2005.12.007

Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, Shaw RJ, Dillin A (2011) Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB. Nature 470 (7334):404-408. doi:10.1038/nature09706

Malovini A, Illario M, Iaccarino G, Villa F, Ferrario A, Roncarati R, Anselmi CV, Novelli V, Cipolletta E, Leggiero E, Orro A, Rusciano MR, Milanesi L, Maione AS, Condorelli G, Bellazzi R, Puca AA (2011) Association study on long-living individuals from Southern Italy identifies rs10491334 in the CAMKIV gene that regulates survival proteins. Rejuvenation Res 14 (3):283-291. doi:10.1089/rej.2010.1114

Mantel N (1966) Evaluation of survival data and two new rank order statistics arising in its consideration. Cancer Chemother Rep 50 (3):163-170

Mathers JC (2006) Nutritional modulation of ageing: genomic and epigenetic approaches. Mech Ageing Dev 127 (6):584-589. doi:10.1016/j.mad.2006.01.018

Maupas E (1900) Modes et formes de reproduction des nématodes. . Arch Zool Exp Gen 8:463-624

Maures TJ, Greer EL, Hauswirth AG, Brunet A (2011) The H3K27 demethylase UTX- 1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner. Aging Cell 10 (6):980-990. doi:10.1111/j.1474-9726.2011.00738.x

110

Texas Tech University, Amal Bouyanfif, August 2019

McCay CM, Crowell MF, Maynard LA (1989) The effect of retarded growth upon the length of life span and upon the ultimate body size. 1935. Nutrition 5 (3):155- 171; discussion 172

McCormick M, Chen K, Ramaswamy P, Kenyon C (2012) New genes that extend Caenorhabditis elegans' lifespan in response to reproductive signals. Aging Cell 11 (2):192-202. doi:10.1111/j.1474-9726.2011.00768.x

McDonald JC, Duffy DC, Anderson JR, Chiu DT, Wu HK, Schueller OJA, Whitesides GM (2000) Fabrication of microfluidic systems in poly(dimethylsiloxane). Electrophoresis 21 (1):27-40. doi:Doi 10.1002/(Sici)1522- 2683(20000101)21:1<27::Aid-Elps27>3.3.Co;2-3

Medawar PB (1952) An unsolved problem of biology: an inaugural lecture delivered at University College, London, 6 December, 1951. HK Lewis and Co, London Melendez A, Levine B (2009) Autophagy in C. elegans. WormBook:1-26. doi:10.1895/wormbook.1.147.1

Miquel J, Fleming J, Economos AC (1982) Antioxidants, metabolic rate and aging in Drosophila. Arch Gerontol Geriatr 1 (2):159-165

Mizutani K, Ikeda K, Kawai Y, Yamori Y (2001) Protective effect of resveratrol on oxidative damage in male and female stroke-prone spontaneously hypertensive rats. Clin Exp Pharmacol Physiol 28 (1-2):55-59

Mondal S, Hegarty E, Martin C, Gokce SK, Ghorashian N, Ben-Yakar A (2016) Large- scale microfluidics providing high-resolution and high-throughput screening of Caenorhabditis elegans poly-glutamine aggregation model. Nat Commun 7:13023. doi:10.1038/ncomms13023

Moreira PI, Smith MA, Zhu X, Nunomura A, Castellani RJ, Perry G (2005) Oxidative stress and neurodegeneration. Ann N Y Acad Sci 1043:545-552. doi:10.1196/annals.1333.062

Moriguchi T, Takashina K, Chu PJ, Saito H, Nishiyama N (1994) Prolongation of life span and improved learning in the senescence accelerated mouse produced by aged garlic extract. Biol Pharm Bull 17 (12):1589-1594

Morselli E, Maiuri MC, Markaki M, Megalou E, Pasparaki A, Palikaras K, Criollo A, Galluzzi L, Malik SA, Vitale I, Michaud M, Madeo F, Tavernarakis N, Kroemer G (2010) Caloric restriction and resveratrol promote longevity through the Sirtuin-1-dependent induction of autophagy. Cell Death Dis 1:e10. doi:10.1038/cddis.2009.8

111

Texas Tech University, Amal Bouyanfif, August 2019

Nishino H, Tokuda H, Satomi Y, Masuda M, Osaka Y, Yogosawa S, Wada S, Mou XY, Takayasu J, Murakoshi M, Jinnno K, Yano M (2004) Cancer prevention by antioxidants. Biofactors 22 (1-4):57-61

O'Riordan VB, Burnell AM (1989) Intermediary metabolism in the dauer larva of the nematode Caenorhabditis elegans— 1. Glycolysis, gluconeogenesis, oxidative phosphorylation and the tricarboxylic acid cycle. In: Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, vol 92. pp 233-238. doi:https://doi.org/10.1016/0305-0491(89)90271-X

O'Riordan VB, Burnell AM (1990) Intermediary metabolism in the dauer larva of the nematode Caenorhabditis elegans—II. The glyoxylate cycle and fatty-acid oxidation, vol 95. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry. Elsevier Inc. doi:https://doi.org/10.1016/0305- 0491(90)90258-U

O'Rourke EJ, Kuballa P, Xavier R, Ruvkun G (2013) omega-6 Polyunsaturated fatty acids extend life span through the activation of autophagy. Genes Dev 27 (4):429-440. doi:10.1101/gad.205294.112

Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G (1997) The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389 (6654):994-999. doi:10.1038/40194

Ohlhorst SD, Russell R, Bier D, Klurfeld DM, Li Z, Mein JR, Milner J, Ross AC, Stover P, Konopka E (2013) Nutrition research to affect food and a healthy life span. Am J Clin Nutr 98 (2):620-625. doi:10.3945/ajcn.113.067744

Pan W, Jiang S, Luo P, Wu J, Gao P (2008) Isolation, purification and structure identification of antioxidant compound from the roots of Incarvillea younghusbandii Sprague and its life span prolonging effect in Drosophila melanogaster. Nat Prod Res 22 (8):719-725. doi:10.1080/14786410802102246

Pandey KB, Rizvi SI (2009) Plant polyphenols as dietary antioxidants in human health and disease. Oxid Med Cell Longev 2 (5):270-278. doi:10.4161/oxim.2.5.9498

Pant A, Mishra V, Saikia SK, Shukla V, Asthana J, Akhoon BA, Pandey R (2014) Beta- caryophyllene modulates expression of stress response genes and mediates longevity in Caenorhabditis elegans. Exp Gerontol 57:81-95. doi:10.1016/j.exger.2014.05.007

Pant A, Pandey R (2015) Bioactive phytomolecules and aging in Caenorhabditis elegans. Healthy Aging Research 4 (19). doi:10.12715/har.2015.4.19

112

Texas Tech University, Amal Bouyanfif, August 2019

Park HEH, Jung Y, Lee SJV (2017) Survival assays using Caenorhabditis elegans. Mol Cells 40 (2):90-99. doi:10.14348/molcells.2017.0017

Peng C, Wang X, Chen J, Jiao R, Wang L, Li YM, Zuo Y, Liu Y, Lei L, Ma KY, Huang Y, Chen ZY (2014) Biology of ageing and role of dietary antioxidants. Biomed Res Int 2014:831841. doi:10.1155/2014/831841

Perez-Campo R, Lopez-Torres M, Cadenas S, Rojas C, Barja G (1998) The rate of free radical production as a determinant of the rate of aging: evidence from the comparative approach. J Comp Physiol B 168 (3):149-158

Persengiev S, Kondova I, Otting N, Koeppen AH, Bontrop RE (2011) Genome-wide analysis of miRNA expression reveals a potential role for miR-144 in brain aging and spinocerebellar ataxia pathogenesis. Neurobiol Aging 32 (12):2316 e2317-2327. doi:10.1016/j.neurobiolaging.2010.03.014

Petrascheck M, Ye X, Buck LB (2007) An antidepressant that extends lifespan in adult Caenorhabditis elegans. Nature 450 (7169):553-556. doi:10.1038/nature05991

Pierce SB, Costa M, Wisotzkey R, Devadhar S, Homburger SA, Buchman AR, Ferguson KC, Heller J, Platt DM, Pasquinelli AA, Liu LX, Doberstein SK, Ruvkun G (2001) Regulation of DAF-2 receptor signaling by human insulin and ins-1, a member of the unusually large and diverse C. elegans insulin gene family. Genes Dev 15 (6):672-686. doi:10.1101/gad.867301

Pietsch K, Saul N, Chakrabarti S, Sturzenbaum SR, Menzel R, Steinberg CE (2011) Hormetins, antioxidants and prooxidants: defining quercetin-, caffeic acid- and rosmarinic acid-mediated life extension in C. elegans. Biogerontology 12 (4):329-347. doi:10.1007/s10522-011-9334-7

Pietsch K, Saul N, Menzel R, Sturzenbaum SR, Steinberg CE (2009) Quercetin mediated lifespan extension in Caenorhabditis elegans is modulated by age-1, daf-2, sek-1 and unc-43. Biogerontology 10 (5):565-578. doi:10.1007/s10522- 008-9199-6

Popa-Wagner A, Mitran S, Sivanesan S, Chang E, Buga AM (2013) ROS and brain diseases: the good, the bad, and the ugly. Oxid Med Cell Longev 2013:963520. doi:10.1155/2013/963520

Rahman M, Hewitt JE, Van-Bussel F, Edwards H, Blawzdziewicz J, Szewczyk NJ, Driscoll M, Vanapalli SA (2018) NemaFlex: a microfluidics-based technology for standardized measurement of muscular strength of C. elegans. Lab Chip 18 (15):2187-2201. doi:10.1039/c8lc00103k

113

Texas Tech University, Amal Bouyanfif, August 2019

Rallis C, Codlin S, Bahler J (2013) TORC1 signaling inhibition by rapamycin and caffeine affect lifespan, global gene expression, and cell proliferation of fission yeast. Aging Cell 12 (4):563-573. doi:10.1111/acel.12080

Rascon B, Hubbard BP, Sinclair DA, Amdam GV (2012) The lifespan extension effects of resveratrol are conserved in the honey bee and may be driven by a mechanism related to caloric restriction. Aging (Albany NY) 4 (7):499-508. doi:10.18632/aging.100474

Raynes R, Leckey BD, Jr., Nguyen K, Westerheide SD (2012) Heat shock and caloric restriction have a synergistic effect on the heat shock response in a sir2.1- dependent manner in Caenorhabditis elegans. J Biol Chem 287 (34):29045- 29053. doi:10.1074/jbc.M112.353714

Reaven GM (1988) Banting lecture 1988. Role of insulin resistance in human disease. Diabetes 37 (12):1595-1607

Richie JP, Jr., Mills BJ, Lang CA (1986) Dietary nordihydroguaiaretic acid increases the life span of the mosquito. Proc Soc Exp Biol Med 183 (1):81-85

Riddle DL, Albert PS (1997) Genetic and Environmental Regulation of Dauer Larva Development. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR (eds) C. elegans II. 2nd edn., Cold Spring Harbor (NY)

Riddle DL, Blumenthal T, Meyer BJ, Priess JR (1997) Introduction to C. elegans. In: Riddle DL, Blumenthal T, Meyer BJ, Priess JR (eds) C. elegans II. 2nd edn., Cold Spring Harbor (NY)

Robida-Stubbs S, Glover-Cutter K, Lamming DW, Mizunuma M, Narasimhan SD, Neumann-Haefelin E, Sabatini DM, Blackwell TK (2012) TOR signaling and rapamycin influence longevity by regulating SKN-1/Nrf and DAF-16/FoxO. Cell Metab 15 (5):713-724. doi:10.1016/j.cmet.2012.04.007

Rose M, Charlesworth B (1980) A test of evolutionary theories of senescence. Nature 287 (5778):141-142

Sadowska-Bartosz I, Bartosz G (2014) Effect of antioxidants supplementation on aging and longevity. Biomed Res Int 2014:404680. doi:10.1155/2014/404680

San-Miguel A, Lu H (2013) Microfluidics as a tool for C. elegans research. WormBook, ed. The C. elegans Research Community, WormBook. doi:10.1895/wormbook.1.162.1

114

Texas Tech University, Amal Bouyanfif, August 2019

Saul N, Pietsch K, Menzel R, Sturzenbaum SR, Steinberg CE (2009) Catechin induced longevity in C. elegans: from key regulator genes to disposable soma. Mech Ageing Dev 130 (8):477-486. doi:10.1016/j.mad.2009.05.005

Scalbert A, Johnson IT, Saltmarsh M (2005a) Polyphenols: antioxidants and beyond. Am J Clin Nutr 81 (1 Suppl):215S-217S. doi:10.1093/ajcn/81.1.215S

Scalbert A, Manach C, Morand C, Remesy C, Jimenez L (2005b) Dietary polyphenols and the prevention of diseases. Crit Rev Food Sci Nutr 45 (4):287-306. doi:10.1080/1040869059096

Schafer FQ, Buettner GR (2000) Acidic pH amplifies iron-mediated lipid peroxidation in cells. Free Radic Biol Med 28 (8):1175-1181

Schlotterer A, Kukudov G, Bozorgmehr F, Hutter H, Du X, Oikonomou D, Ibrahim Y, Pfisterer F, Rabbani N, Thornalley P, Sayed A, Fleming T, Humpert P, Schwenger V, Zeier M, Hamann A, Stern D, Brownlee M, Bierhaus A, Nawroth P, Morcos M (2009) C. elegans as model for the study of high glucose- mediated life span reduction. Diabetes 58 (11):2450-2456. doi:10.2337/db09-0567

Schulz TJ, Zarse K, Voigt A, Urban N, Birringer M, Ristow M (2007) Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab 6 (4):280-293. doi:10.1016/j.cmet.2007.08.011

Sebastiani P, Bae H, Sun FX, Andersen SL, Daw EW, Malovini A, Kojima T, Hirose N, Schupf N, Puca A, Perls TT (2013) Meta-analysis of genetic variants associated with human exceptional longevity. Aging (Albany NY) 5 (9):653- 661. doi:10.18632/aging.100594

Seto B (2012) Rapamycin and mTOR: a serendipitous discovery and implications for breast cancer. Clin Transl Med 1 (1):29. doi:10.1186/2001-1326-1-29

Shankar S, Chen Q, Srivastava RK (2008a) Inhibition of PI3K/AKT and MEK/ERK pathways act synergistically to enhance antiangiogenic effects of EGCG through activation of FOXO transcription factor. J Mol Signal 3:7. doi:10.1186/1750- 2187-3-7

Shankar S, Ganapathy S, Hingorani SR, Srivastava RK (2008b) EGCG inhibits growth, invasion, angiogenesis and metastasis of pancreatic cancer. Front Biosci 13:440- 452

115

Texas Tech University, Amal Bouyanfif, August 2019

Sheaffer KL, Updike DL, Mango SE (2008) The Target of Rapamycin pathway antagonizes pha-4/FoxA to control development and aging. Curr Biol 18 (18):1355-1364. doi:10.1016/j.cub.2008.07.097

Shmookler Reis RJ, Xu L, Lee H, Chae M, Thaden JJ, Bharill P, Tazearslan C, Siegel E, Alla R, Zimniak P, Ayyadevara S (2011) Modulation of lipid biosynthesis contributes to stress resistance and longevity of C. elegans mutants. Aging (Albany NY) 3 (2):125-147. doi:10.18632/aging.100275

Simen AA, Bordner KA, Martin MP, Moy LA, Barry LC (2011) Cognitive dysfunction with aging and the role of inflammation. Ther Adv Chronic Dis 2 (3):175-195. doi:10.1177/2040622311399145

Singh AK, Jiang Y, Benlhabib E, Gupta S (2007) Herbal mixtures consisting of puerarin and either polyenylphosphatidylcholine or curcumin provide comprehensive protection against alcohol-related disorders in P rats receiving free choice water and 15% ethanol in pure water. J Med Food 10 (3):526-542. doi:10.1089/jmf.2006.228

Singh BN, Shankar S, Srivastava RK (2011) Green tea catechin, epigallocatechin-3- gallate (EGCG): mechanisms, perspectives and clinical applications. Biochem Pharmacol 82 (12):1807-1821. doi:10.1016/j.bcp.2011.07.093

Smith-Vikos T, de Lencastre A, Inukai S, Shlomchik M, Holtrup B, Slack FJ (2014) MicroRNAs mediate dietary-restriction-induced longevity through PHA- 4/FOXA and SKN-1/Nrf transcription factors. Curr Biol 24 (19):2238-2246. doi:10.1016/j.cub.2014.08.013

Smith-Vikos T, Slack FJ (2012) MicroRNAs and their roles in aging. J Cell Sci 125 (Pt 1):7-17. doi:10.1242/jcs.099200

Soerensen M, Dato S, Christensen K, McGue M, Stevnsner T, Bohr VA, Christiansen L (2010) Replication of an association of variation in the FOXO3A gene with human longevity using both case-control and longitudinal data. Aging Cell 9 (6):1010-1017. doi:10.1111/j.1474-9726.2010.00627.x

Solis GM, Petrascheck M (2011) Measuring Caenorhabditis elegans Life Span in 96 Well Microtiter Plates. Jove-J Vis Exp (49). doi:UNSP e2496 10.3791/2496

Spindler SR (2010) Biological Effects of Calorie Restriction: Implications for Modification of Human Aging. The Future of Aging. Springer, Dordrecht. doi:10.1007/978-90-481-3999-6_12

116

Texas Tech University, Amal Bouyanfif, August 2019

Srivastava D, Arya U, SoundaraRajan T, Dwivedi H, Kumar S, Subramaniam JR (2008) Reserpine can confer stress tolerance and lifespan extension in the nematode C. elegans. Biogerontology 9 (5):309-316. doi:10.1007/s10522-008-9139-5

Stiernagle T (2006) Maintenance of C. elegans. WormBook:1-11. doi:10.1895/wormbook.1.101.1

Strong R, Miller RA, Astle CM, Baur JA, de Cabo R, Fernandez E, Guo W, Javors M, Kirkland JL, Nelson JF, Sinclair DA, Teter B, Williams D, Zaveri N, Nadon NL, Harrison DE (2013) Evaluation of resveratrol, green tea extract, curcumin, oxaloacetic acid, and medium-chain triglyceride oil on life span of genetically heterogeneous mice. J Gerontol A Biol Sci Med Sci 68 (1):6-16. doi:10.1093/gerona/gls070

Strong R, Miller RA, Astle CM, Floyd RA, Flurkey K, Hensley KL, Javors MA, Leeuwenburgh C, Nelson JF, Ongini E, Nadon NL, Warner HR, Harrison DE (2008) Nordihydroguaiaretic acid and aspirin increase lifespan of genetically heterogeneous male mice. Aging Cell 7 (5):641-650. doi:10.1111/j.1474- 9726.2008.00414.x

Sugawara S, Honma T, Ito J, Kijima R, Tsuduki T (2013) Fish oil changes the lifespan of Caenorhabditis elegans via lipid peroxidation. J Clin Biochem Nutr 52 (2):139-145. doi:10.3164/jcbn.12-88

Sun N, Youle RJ, Finkel T (2016) The Mitochondrial Basis of Aging. Mol Cell 61 (5):654-666. doi:10.1016/j.molcel.2016.01.028

Sutphin GL, Bishop E, Yanos ME, Moller RM, Kaeberlein M (2012) Caffeine extends life span, improves healthspan, and delays age-associated pathology in Caenorhabditis elegans. Longev Healthspan 1:9. doi:10.1186/2046-2395-1-9

Sutphin GL, Kaeberlein M (2009) Measuring Caenorhabditis elegans life span on solid media. J Vis Exp (27). doi:10.3791/1152

Tacutu R, Thornton D, Johnson E, Budovsky A, Barardo D, Craig T, Diana E, Lehmann G, Toren D, Wang J, Fraifeld VE, de Magalhaes JP (2018) Human Ageing Genomic Resources: new and updated databases. Nucleic Acids Res 46 (D1):D1083-D1090. doi:10.1093/nar/gkx1042

Taguchi A, Wartschow LM, White MF (2007) Brain IRS2 signaling coordinates life span and nutrient homeostasis. Science 317 (5836):369-372. doi:10.1126/science.1142179

117

Texas Tech University, Amal Bouyanfif, August 2019

Tatar M, Bartke A, Antebi A (2003) The endocrine regulation of aging by insulin-like signals. Science 299 (5611):1346-1351. doi:10.1126/science.1081447

Taubert S, Van Gilst MR, Hansen M, Yamamoto KR (2006) A Mediator subunit, MDT- 15, integrates regulation of fatty acid metabolism by NHR-49-dependent and - independent pathways in C. elegans. Genes Dev 20 (9):1137-1149. doi:10.1101/gad.1395406

Tissenbaum HA (2012) Genetics, life span, health span, and the aging process in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 67 (5):503-510. doi:10.1093/gerona/gls088

Tissenbaum HA (2015) Using C. elegans for aging research. Invertebr Reprod Dev 59 (sup1):59-63. doi:10.1080/07924259.2014.940470

Tissenbaum HA, Guarente L (2001) Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature 410 (6825):227-230. doi:10.1038/35065638

Toth ML, Sigmond T, Borsos E, Barna J, Erdelyi P, Takacs-Vellai K, Orosz L, Kovacs AL, Csikos G, Sass M, Vellai T (2008) Longevity pathways converge on autophagy genes to regulate life span in Caenorhabditis elegans. Autophagy 4 (3):330-338

Tripathi YB, Tripathi P, Arjmandi BH (2005) Nutraceuticals and cancer management. Front Biosci 10:1607-1618

Tullet JM, Hertweck M, An JH, Baker J, Hwang JY, Liu S, Oliveira RP, Baumeister R, Blackwell TK (2008) Direct inhibition of the longevity-promoting factor SKN- 1 by insulin-like signaling in C. elegans. Cell 132 (6):1025-1038. doi:10.1016/j.cell.2008.01.030

Tung BT, Rodriguez-Bies E, Talero E, Gamero-Estevez E, Motilva V, Navas P, Lopez- Lluch G (2015) Anti-inflammatory effect of resveratrol in old mice liver. Exp Gerontol 64:1-7. doi:10.1016/j.exger.2015.02.004

Uno M, Nishida E (2016) Lifespan-regulating genes in C. elegans. Npj Aging Mech Dis 2:16010. doi:10.1038/npjamd.2016.10

Valenzano DR, Terzibasi E, Genade T, Cattaneo A, Domenici L, Cellerino A (2006) Resveratrol prolongs lifespan and retards the onset of age-related markers in a short-lived vertebrate. Curr Biol 16 (3):296-300. doi:10.1016/j.cub.2005.12.038

118

Texas Tech University, Amal Bouyanfif, August 2019

Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J (2007) Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 39 (1):44-84. doi:10.1016/j.biocel.2006.07.001 van der Horst A, Tertoolen LG, de Vries-Smits LM, Frye RA, Medema RH, Burgering BM (2004) FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 279 (28):28873-28879. doi:10.1074/jbc.M401138200

Van Gilst MR, Hadjivassiliou H, Jolly A, Yamamoto KR (2005) Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans. PLoS Biol 3 (2):e53. doi:10.1371/journal.pbio.0030053

Vanfleteren JR, Braeckman BP (1999) Mechanisms of life span determination in Caenorhabditis elegans. Neurobiol Aging 20 (5):487-502

Vanfleteren JR, De Vreese A (1995) The gerontogenes age-1 and daf-2 determine metabolic rate potential in aging Caenorhabditis elegans. FASEB J 9 (13):1355- 1361

Viswanathan M, Kim SK, Berdichevsky A, Guarente L (2005) A role for SIR-2.1 regulation of ER stress response genes in determining C. elegans life span. Dev Cell 9 (5):605-615. doi:10.1016/j.devcel.2005.09.017

Wadsworth WG, Riddle DL (1989) Developmental regulation of energy metabolism in Caenorhabditis elegans. Dev Biol 132 (1):167-173

Wahlqvist ML, Saviage GS (2000) Interventions aimed at dietary and lifestyle changes to promote healthy aging. Eur J Clin Nutr 54 Suppl 3:S148-156

Walker G, Houthoofd K, Vanfleteren JR, Gems D (2005) Dietary restriction in C. elegans: from rate-of-living effects to nutrient sensing pathways. Mech Ageing Dev 126 (9):929-937. doi:10.1016/j.mad.2005.03.014

Wang MC, O'Rourke EJ, Ruvkun G (2008) Fat metabolism links germline stem cells and longevity in C. elegans. Science 322 (5903):957-960. doi:10.1126/science.1162011

Wang P, Zhang Z, Ma X, Huang Y, Liu X, Tu P, Tong T (2003) HDTIC-1 and HDTIC- 2, two compounds extracted from Astragali Radix, delay replicative senescence of human diploid fibroblasts. Mech Ageing Dev 124 (10-12):1025-1034

119

Texas Tech University, Amal Bouyanfif, August 2019

Wanke V, Cameroni E, Uotila A, Piccolis M, Urban J, Loewith R, De Virgilio C (2008) Caffeine extends yeast lifespan by targeting TORC1. Mol Microbiol 69 (1):277- 285. doi:10.1111/j.1365-2958.2008.06292.x

Watts JL, Browse J (2002) Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99 (9):5854-5859. doi:10.1073/pnas.092064799

Weindruch R, Walford RL, Fligiel S, Guthrie D (1986) The retardation of aging in mice by dietary restriction: longevity, cancer, immunity and lifetime energy intake. J Nutr 116 (4):641-654. doi:10.1093/jn/116.4.641

Willcox BJ, Donlon TA, He Q, Chen R, Grove JS, Yano K, Masaki KH, Willcox DC, Rodriguez B, Curb JD (2008) FOXO3A genotype is strongly associated with human longevity. Proc Natl Acad Sci U S A 105 (37):13987-13992. doi:10.1073/pnas.0801030105

Wood JG, Rogina B, Lavu S, Howitz K, Helfand SL, Tatar M, Sinclair D (2004) Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature 430 (7000):686-689. doi:10.1038/nature02789

Xia YN, Whitesides GM (1998) Soft lithography. Annu Rev Mater Sci 28:153-184. doi:DOI 10.1146/annurev.matsci.28.1.153

Xin L, Yamujala R, Wang Y, Wang H, Wu WH, Lawton MA, Long C, Di R (2013) Acetylcholineestarase-inhibiting alkaloids from Lycoris radiata delay paralysis of amyloid beta-expressing transgenic C. elegans CL4176. PLoS One 8 (5):e63874. doi:10.1371/journal.pone.0063874

Yamawaki TM, Berman JR, Suchanek-Kavipurapu M, McCormick M, Gaglia MM, Lee SJ, Kenyon C (2010) The somatic reproductive tissues of C. elegans promote longevity through steroid hormone signaling. PLoS Biol 8 (8). doi:10.1371/journal.pbio.1000468

Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA, Mayo MW (2004) Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J 23 (12):2369-2380. doi:10.1038/sj.emboj.7600244

Yuan Y, Kadiyala CS, Ching TT, Hakimi P, Saha S, Xu H, Yuan C, Mullangi V, Wang L, Fivenson E, Hanson RW, Ewing R, Hsu AL, Miyagi M, Feng Z (2012) Enhanced energy metabolism contributes to the extended life span of calorie- restricted Caenorhabditis elegans. J Biol Chem 287 (37):31414-31426. doi:10.1074/jbc.M112.377275

120

Texas Tech University, Amal Bouyanfif, August 2019

Zarse K, Bossecker A, Muller-Kuhrt L, Siems K, Hernandez MA, Berendsohn WG, Birringer M, Ristow M (2011) The phytochemical glaucarubinone promotes mitochondrial metabolism, reduces body fat, and extends lifespan of Caenorhabditis elegans. Horm Metab Res 43 (4):241-243. doi:10.1055/s-0030- 1270524

Zeng Y, Cheng L, Chen H, Cao H, Hauser ER, Liu Y, Xiao Z, Tan Q, Tian XL, Vaupel JW (2010) Effects of FOXO genotypes on longevity: a biodemographic analysis. J Gerontol A Biol Sci Med Sci 65 (12):1285-1299. doi:10.1093/gerona/glq156

Zhang L, Jie G, Zhang J, Zhao B (2009) Significant longevity-extending effects of EGCG on Caenorhabditis elegans under stress. Free Radic Biol Med 46 (3):414- 421. doi:10.1016/j.freeradbiomed.2008.10.041

Zheng X, Sun T, Wang X (2013) Activation of type 2 cannabinoid receptors (CB2R) promotes fatty acid oxidation through the SIRT1/PGC-1alpha pathway. Biochem Biophys Res Commun 436 (3):377-381. doi:10.1016/j.bbrc.2013.05.108

Zhu C, Ji CB, Zhang CM, Gao CL, Zhu JG, Qin DN, Kou CZ, Zhu GZ, Shi CM, Guo XR (2010) The lin-4 gene controls fat accumulation and longevity in Caenorhabditis elegans. Int J Mol Sci 11 (12):4814-4825. doi:10.3390/ijms11124814

Zhu G, Yin F, Wang L, Wei W, Jiang L, Qin J (2016) Modeling type 2 diabetes-like hyperglycemia in C. elegans on a microdevice. Integr Biol (Camb) 8 (1):30-38. doi:10.1039/c5ib00243e

Ziehm M, Kaur S, Ivanov DK, Ballester PJ, Marcus D, Partridge L, Thornton JM (2017) Drug repurposing for aging research using model organisms. Aging Cell 16 (5):1006-1015. doi:10.1111/acel.12626

121

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 3

Review of FTIR microspectroscopy applications to investigate biochemical changes in C. elegans

A. Bouyanfif a,b,c, S. Liyanagea, E. Hequeta, N. Moustaid-Moussaa,b,c, N. Abidia,* a Fiber and Biopolymer Research Institute, Texas Tech University Lubbock, TX, USA b Department of Nutritional Sciences, Texas Tech University Lubbock, TX, USA c Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

Disclaimer: The work presented in this chapter in its entirety, has been published in Vibrational Spectroscopy 96 (2018) 74-82, with only minor modifications. The printed publication is located in Appendix B.

3.1. Abstract

Caenorhabditis elegans nematode has emerged as a model organism paving the ways for multidisciplinary research in biomedical, environmental toxicology, aging, metabolism, obesity, and drug discovery. The wide range of applications of this model organism are attributed to C. elegans’ unique features: C. elegans are inexpensive, easy to grow and maintain in a laboratory, has a short lifespan, and has a small body size. With this increased interest, the need for analytical techniques to assess the biochemical information on intact worms continues to grow. Fourier Transform Infrared (FTIR) microspectroscopy is considered a powerful technique that can be used to determine the chemical structure and composition of various materials, including biological samples. Furthermore, the development of focal plane array detectors has made this technique attractive to study complex biological systems such as whole nematodes. This review focuses on the use of FTIR microspectroscopy to study C. elegans. The first published work on the use of FTIR micro spectroscopy to study a complex whole animal was reported in 2004. Since then, very few other studies were carried out. The objective of this review is to summarize work conducted to date using FTIR microspectroscopy to study nematodes and to discuss the information that can be gained by using this technique. This could allow scientists to add this technique to the arsenal of techniques already in use for C. elegans studies. 122

Texas Tech University, Amal Bouyanfif, August 2019

Key words: C. elegans, FTIR imaging, Microspectroscopy, Nematodes

3.2. Introduction

Caenorhabditis elegans is a millimeter-long, transparent round-worm that is currently used as a model organism for several investigations such as: obesity research (Zheng and Greenway 2012), chemical and biological research (Leung et al. 2008; Hulme and Whitesides 2011), drug discovery (O'Reilly et al. 2014; Artal-Sanz et al. 2006), lipid storage and metabolism (Folick et al. 2011; Tserevelakis et al. 2014; Hellerer et al. 2007; Chen et al. 2016; Wharton et al. 2008; Wang et al. 2014), and nanoparticle effects assessment (Mohan et al. 2010; Goodwin et al. 2014; Gonzalez- Moragas et al. 2017a; Gonzalez-Moragas et al. 2015; Barman et al. 2013; Meyer et al. 2010). This nematode has gained popularity as a model for various studies because it is easy and inexpensive to grow and maintain in a laboratory, has a simple anatomy, short life-span (~ 3 weeks) (Watts 2016), and reproductive cycles of 3 days. In addition, the development of C. elegans has been well studied and, therefore, induced changes can be easily detectable. Furthermore, it does not require the approval of the animal care committee to conduct experiments. The possibility of adopting C. elegans as a model organism for various studies has created the need for analytical techniques that can be used to determine the chemical composition on intact worms. Fourier Transform Infrared (FTIR) microspectroscopy has emerged as a powerful and non-destructive technique to study various materials, including intact nematodes (Baker et al. 2014; Dorling and Baker 2013; Miller et al. 2013). This technique provides not only information on the presence of chemical species in the sample but is also able to provide their spatial distribution in the area of interest within the sample. FTIR microspectroscopy has been established as a powerful tool for the study of plant (Abidi et al. 2014), nematodes (Ami et al. 2004; Bouyanfif et al. 2017), biological macromolecules (Siebert 1995; Orsini et al. 2000; Ami et al. 2003) and complex biological systems (Jackson et al. 1997; Diem et al. 1999). FTIR spectroscopy deals with the measurement of infrared (IR) radiation absorbed by the sample allowing 123

Texas Tech University, Amal Bouyanfif, August 2019 the study of the molecular structure. When IR radiation is absorbed by molecules in the sample, transitions between vibrational energy states of the chemical bonds occur. Since these vibrational energies are specific to the chemical bonds, the spectra contain information about the functional groups and the chemical structure of the compounds in the sample. Traditional IR measurements were performed using Potassium bromide (KBr) technique. In this technique, a small amount of the sample (powder) is dispersed in KBr, a pellet is made, and then spectra are acquired in transmission mode. Diffuse reflectance can be performed directly on powdered samples. These techniques are destructive, limiting further analysis to be performed on the same sample. Technological advances in FTIR instrumentation resulted in the development of Universal Attenuated Total Reflectance and microscopes for imaging experiments (Figure 3.1). Furthermore, the development of Focal Plane Array (FPA) detectors allows rapid imaging of a sample (with no special preparation), which opens new horizons for FTIR microspectroscopy. FTIR images of a sample can be obtained by mapping using microscope aperture and a computer controlled motorized stage. The use of FPA detector allows consecutive measurements on an array of points on the sample, which generates a chemical image of the sample. The original average absorbance image is represented using a false-colour scheme, where similar colours are used to cluster pixels with similar level of infrared absorbance. This image can be further processed to obtain distributions of different chemical functional groups.

124

Texas Tech University, Amal Bouyanfif, August 2019

Figure 3.1: Fourier Transform Infrared microspectroscopy Spotlight coupled to Spectrum 400 (PerkinElmer, MA, USA), equipped with liquid nitrogen cooled 128x128 Mercury-Cadmium-Telluride Focal Plane Array detector (FPA). UATR: universal attenuated total reflectance.

3.3. FTIR applications for nematode research

3.3.1. FTIR FPA imaging of whole nematode

Hobro and Lendl used FPA-FTIR imaging to study complex multicellular nematodes S. feltiae and H. heliothidis (Hobro and Lendl 2011). Dried nematodes were added to distilled water, mixed, centrifuged, and then the supernatant was removed. The authors re-suspended the pellet in water and repeated the process twice to make sure that the media was completely removed. Nematodes were then deposited on ZnSe slide and dried at the room temperature and spectra were collected in transmission mode. IR images of nematodes were acquired using an FPA detector with 64x64 pixels. The authors used Hierarchical Cluster Analysis (HCA) of the acquired IR image. This technique measures the dissimilarity between the IR spectra in the image, so that the most similar spectra are combined to form one cluster. The number of clusters indicates different chemical compounds in the sample. When analysing H. heliothidis nematode, the HCA of the IR image showed different clusters depicted in different colours: dark- 125

Texas Tech University, Amal Bouyanfif, August 2019 blue, light blue, grey, and green. The dark-blue region was attributed to the digestive tract of the nematode, which represents the methylene stretching group in fatty acids (vibrations at 2920 and 2850 cm-1 (Hobro and Lendl 2011). light blue cluster was associated with the head/pharynx, lower body, and tail region, while the grey cluster was associated with the main part of the body on either side of the digestive tract (Hobro and Lendl 2011). The authors indicated that both clusters (light blue and grey clusters) have high α-helical protein components and low amount of lipids compared to the cluster depicted in dark-blue colour. The cluster depicted in green colour represented the edge of the nematode and was essentially associated with C=O stretching of esters, amide II, and tyrosine vibrations. These results demonstrated that HCA of IR images could illustrate biochemical differences in different part of the nematode (digestive tract, cuticle, and different protein constituent in the body cavity). Furthermore, the authors used HCA to compare seven different nematode species (two S. feltiae and five H. heliothidis). The results showed that the clusters can be associated specifically to a particular species, demonstrating the potential of IR microspectroscopy to discriminate between nematode species and to provide biochemical composition within each individual worm (Hobro and Lendl 2011). FPA-FTIR and Raman spectroscopy imaging were used as non-destructive in- situ biochemical analysis of Steinernema Kraussei nematode worms (Lau et al. 2012). S. kraussei is approximately 20 µm in diameter and 80-100 µm in length. The preparation of the worm for FTIR imaging is described in detail in (Lau et al. 2012). IR images were recorded in transmission mode using a Bruker Hyperion 3000 IR microscope (Bruker, USA) equipped with an FPA detector (64 x 64 pixels, covering an area of 170 µm x 170 µm). The results showed that different anatomical regions of the nematode can be distinguished based on the IR spectral variation. The authors indicated that the use of the HCA to analyse the spectra acquired from the S. kraussei worm led to biochemical information related to the digestive tract and the body cavity (Lau et al. 2012). The authors selected five clusters (Figure 3.2). The blue cluster represented the head and tail and exhibited a low total lipids (absence of C=O, CH2, and CH3 vibrations) but high protein content (prominent vibrations assigned to amide I and amide II) (Lau 126

Texas Tech University, Amal Bouyanfif, August 2019 et al. 2012). The grey cluster, along the length of the nematode, showed high protein content but low lipid levels. The cyan cluster contains significant contribution of proteins (vibrations 1652 and 1547 cm-1 assigned to amide I and amid II). The red and green clusters showed intense vibrations at 2927 and 2855 cm-1 (assigned to asymmetric

CH2 and symmetric CH3 of methylene group in fatty acids), indicating a region rich in lipids. The red cluster was associated with a relative increase in proteins and carbohydrates (vibration 1162 cm-1 assigned to C-O). It was suggested that the red cluster reflected the contents of the digestive tract (Lau et al. 2012).

Figure 3.2: (A) Light microscopy image of S. Kraussei nematode, (B) False color image resulting for HCA performed on IR spectra, showing five clusters, (C) Average IR spectra of the clusters resolved in the HCA (B). Reprinted from (Lau et al. 2012) with permission from Elsevier.

127

Texas Tech University, Amal Bouyanfif, August 2019

Attenuated Total Reflectance (ATR) FTIR was used to characterize entomopathogenic nematodes (Steinernema glaseri and Heterorhabditis indica) and to assess the differences between these nematodes and C. elegans N2 wild strains (San- Blas et al. 2011). The spectra were collected in reflectance mode using a Shimadzu IR Prestige-21 FTIR with a Deuterated Lanthanum Triglycine Sulfate (DLATGS) detector coupled to a 6 mm 3-refelction diamond-ZnSe crystal ATR plate MIRacle (Pike technologies). The ATR-FTIR spectra showed some similarities between S. glaseri, H. indica, and C. elegans (Figure 3). However, some major important differences were observed at 1745 cm-1 and between 1200 and 900 cm-1. These results indicated that biochemical differences in triglycerides (vibration 1745 cm-1 assigned to C=O), lipids, and carbohydrates exist between different species. Furthermore, the authors indicated that the IR region between 1300 and 800 cm-1 is of particular interest to differentiate between nematode species, because this region has been reported as a fingerprint region of other organisms (San-Blas et al. 2011; Essendoubi et al. 2005).

Figure 3.3: Attenuated Total Reflectance Fourier Transform Infrared average spectra of Heterorhabditis indica, Steinernema glaseri, and Caenorhabditis elegans. Reprinted from (San-Blas et al. 2011) with permission from Elsevier.

128

Texas Tech University, Amal Bouyanfif, August 2019

3.3.2. Nematode identification To study the chemical composition of C. elegans, FTIR microspectroscopy imaging was used (Ami et al. 2004; Ami et al. 2012; Diomede et al. 2010; Sheng et al. 2016). The interaction of the infrared radiation with the chemical bonds of biomolecules in C. elegans led to useful information related to the chemical composition of the microorganism. The first reported FTIR study on a complex whole and dried C. elegans was performed by Ami et al. (Ami et al. 2004). The authors investigated four soil free- living nematode species (Caenorhabditis elegans, Pristionchus lheritieri, Panagrolaimus rigidus, Geomonhystera sp.). Single worms were washed twice with distilled water, placed on ZnSe window, and then dried at room temperature for 30 min. Using an IR infrared microscope (UMA 500, Digilab-USA) coupled to a spectrometer (FTS 40A, Digilab-USA), the authors were able to acquire IR spectra in transmission mode from different regions of a single worm: pharynx, intestine, and tail regions. The authors indicated that infrared spectroscopy combined with multivariate analysis such as principal component analysis (PCA) can be used to illustrate biochemical events at the molecular level by identifying metabolic fingerprints (Ami et al. 2004). Due to differences in the FTIR spectra from selected parts in the worm, the spectra from the pharynx areas could be used to distinguish between nematode species (Ami et al. 2004). The authors indicated that amide I and amide II protein bands (which are assigned to vibrational modes of backbone amide bonds) were of particular interest. Indeed, it has been reported that the stretching mode of the C=O is sensitive to the protein secondary structures (Tamm and Tatulian 1997). The use of the second derivative of the spectra acquired from pharynx, intestine, and tail areas in the amide I region allowed to identify β-structures, α-helices, and collagen. The results indicated that different proteins are present in different regions of the worm based on the analysis of the amide I band. Furthermore, it was concluded that the principal chemical component in the tail was collagen. Ami et al. concluded that FTIR microspectroscopy could be used as a new tool for nematode identification (Ami et al. 2004). Four nematode species with clear phylogenetic relationships were selected to explore the usefulness of FTIR imaging: Caenorhabditis elegans, Pristionchus lheritieri, Panagrolaimus rigidus, and 129

Texas Tech University, Amal Bouyanfif, August 2019

Geomonhystera sp. The results showed that the region 1700 – 1500 cm-1, which contains amide I and amide II bands, could be used to identify nematode species because band components vary among the different nematode taxa (Ami et al. 2004).

3.3.3. Diet and genotype-dependent changes in chemical composition Recently, Bouyanfif et al. used FTIR imaging to detect diet and genotype- dependent changes in chemical composition in wild-type (N2) C. elegans and mutant strains tub-1 and fat-3 (Bouyanfif et al. 2017). The objective of the work was to investigate changes in chemical composition when wild-type and mutant strains tub-1 and fat-3 were grown in bacteria-free C. elegans maintenance media (CeMM) alone, and in CeMM media supplemented with eicosapentaenoic acid (EPA) at 25 or 100 µM. Wild-type (N2) naturally makes omega-3 polyunsaturated fatty acids (ω-3 PUFAs) including EPA, while the mutant strain fat-3 lacks specific PUFA synthesis enzymes and mutation in tub-1 leads to increased fat deposition and life span extension (Mukhopadhyay et al. 2005; Watts et al. 2003). This research documented the ability of supplementing the growth media with varying amounts of PUFAs. In this study, worms were rinsed with distilled water, and individual hermaphrodite adult worms were mounted on BaF2 slides and dried in a vacuum desiccator for 1 h. IR spectra were acquired in transmission mode using N2-cooled Mercury-Cadmium-Telluride FPA detector (128x128). Figure 3.4 shows the visible image of an individual worm along with the corresponding average absorbance IR image. The red colour in the IR image indicates higher IR absorbance while the purple colour indicates lower IR absorbance. Information on the distribution of functional groups within individual worms could be obtained by developing functional group distribution images. Each pixel in the IR image (6.25 x 6.25 µm) is associated with an IR spectrum, which is developed by co-adding 128 spectra collected from the same pixel between 4000 and 1000 cm-1. These spectra are further analysed to get biochemical information in individual worms.

130

Texas Tech University, Amal Bouyanfif, August 2019

Figure 3.4: Visual image of wild-type (N2) C. elegans, corresponding average absorbance FTIR image, and spectra extracted from selected areas of the IR image.

The analysis of the FTIR spectra acquired from different anatomical regions of wild-type C. elegans (head, middle, and tail) indicated that the major differences are in unsaturated fatty acyl groups (vibration 3008 cm-1 assigned to -CH=CH- stretching), -1 saturated acyl groups (vibrations 2928 and 2848 cm assigned to asymmetric –CH2 and symmetric –CH2 stretching respectively), and fatty acids, triglycerides, phospholipids,

131

Texas Tech University, Amal Bouyanfif, August 2019 or cholesterol esters (vibration 1744 cm-1 assigned to C=O stretching). The results indicated that saturated acyl groups and unsaturated fatty acids are stored primarily in the intestines. These results confirmed previous studies, which reported that C. elegans nematodes store fats mainly as droplets within the hypodermal and intestinal cells (Ashrafi 2007; O'Rourke et al. 2009). Fat storage quantification was performed by measuring the intensity of staining of C. elegans by lipid-binding dyes (Nile Red, Oil Red O, or Sudan Black) (Ashrafi et al. 2003; Yen et al. 2010) or by using Coherent Anti- Stokes Raman Scattering (CARS) and Stimulated Raman Scattering (SRS) (Zheng and Greenway 2012; Folick et al. 2011). Bouyanfif et al. used PCA to illustrate the differences in chemical composition between worms raised in CeMM media without supplementation with EPA and when supplemented with EPA at 25 µM and 100 µM (Bouyanfif et al. 2017). PCA of FTIR spectra acquired from worms raised in CeMM alone separated wild-type (N2) from mutant strains tub-1 and fat-3 (Bouyanfif et al. 2017). However, the spectra of tub-1 could not be separated from those of fat-3. This indicated that differences in chemical composition exist between wild-type and mutant strains. The difference spectra obtained by digital subtraction of mutant strains’ spectra (tub-1 and fat-3) from these of wild-type indicated that the major difference between the wild-type and mutant strains was in unsaturated and saturated lipids. When worms were cultured in CeMM supplemented with EPA, PCA separated the spectra of worms raised on CeMM without supplementation from those raised on CeMM supplemented with EPA. In addition to PCA, a cluster analysis can be performed using squared Euclidean distance. The result is presented as a tree diagram that is frequently used to illustrate the arrangement of the clusters produced by hierarchical clustering. Depending on the selected numbers of clusters, the sample name is displayed by cluster colour. The clusters are separated based on the distance between the clusters. Figures 3.5 and 3.6 show the dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strains tub-1 and fat-3 raised on normal CeMM. Two clusters are identified: one cluster for wild-type and another cluster for mutant strains tub-1 and fat-3. 132

Texas Tech University, Amal Bouyanfif, August 2019

Figure 3.5: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain tub-1.

Figure 3.6: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain fat-3.

133

Texas Tech University, Amal Bouyanfif, August 2019

Interestingly, IR data of tub-1 showed that supplementing the CeMM with 100 µM EPA resulted in spectra similar to those of wild-type with no supplementation (Figure 7). However, the spectra extracted from mutant fat-3 worms grown on the media supplemented with 25 or 100 µM EPA are not similar to those extracted from wild-type (Figure 8). Further studies are needed with increased concentrations of EPA to determine the effects of EPA concentration on fat-3 mutants.

Figure 3.7: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation and mutant strain tub-1 grown on CeMM supplemented with 25 µM and 100 µM eicosapentaenoic acid (EPA).

134

Texas Tech University, Amal Bouyanfif, August 2019

Figure 3.8: Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation and mutant strain grown on CeMM supplemented with 25 µM and 100 µM eicosapentaenoic acid (EPA).

3.3.4. Biochemical composition Sheng et al. reported on the use of FTIR microspectroscopy to investigate the biochemical composition of C. elegans (Sheng et al. 2016). The authors indicated that traditional biochemical analysis techniques require relatively large amounts of materials for compositional analysis. In addition, these techniques may be inefficient due to difficulty in isolating the desired cell type from tissues or insufficient material can be extracted for biochemical analysis (Sheng et al. 2016). Several analytical techniques that are based on vibrational microspectroscopy have been developed to overcome the above mentioned difficulty (Baker et al. 2014; Evans and Xie 2008; Freudiger et al. 2008). In their experiments, the authors used Bristol N2 as a wild-type along with mutant strains LG I: VB2485, aex-5 (sv75); LG III: CB1370, daf-2(e1370); VB0027, ncl-1(e1865). Hermaphrodite worms were washed in M9 buffer and placed on CaF2 slides and dried in a desiccator for at least 48 hours (Sheng et al. 2016).The FTIR spectra were acquired in transmission mode using Bruker Tensor 27 spectrometer equipped with Hyperion 3000 microscope (Bruker Optik GmbH). The spectra were normalized 135

Texas Tech University, Amal Bouyanfif, August 2019 over the entire spectral range, which enabled the authors to compare the relative amount of a particular chemical compound in different pixels. The results demonstrated that changes in the relative levels of carbohydrates, proteins and lipids in a single worm could be determined using FTIR microspectroscopy. Specifically, the IR results indicated that the relative intensities of the lipid-associated bands between 2800 and 3000 cm-1 were higher in daf-2 mutant intestines compared to those of the wild-type. The authors indicated that the results obtained from IR imaging are in agreement with results obtained from gas-liquid chromatography and that the daf-2 mutant contains higher levels of triglycerides. The high polysaccharide intensities (vibrations in the range 1140-1180 cm-1) in daf-2 mutant compared to wild-type (N2) were attributed either to the rate at which polysaccharides are synthesized from sugars or to the rate at which polysaccharides are broken down. FTIR microspectroscopy was also used to investigate the molecular mechanisms of anydrobiosis and illustrate the role of trehalose to preserve native membrane lipid packing during extreme desiccation followed by rehydration of Dauer Larva of C. elegans (Erkut et al. 2011). Worm strains used were: C. elegans wild-type (N2), daf- 2(e1370), daf-7(e1372), tps-1(ok373), tps-2(ok526) and crossed strains (tps- 2(ok526);daf-2(e1370);tps-1(ok373) (daf-2;∆∆tps), and tps-2(ok526);tps-1(ok373) (∆∆tps). A controlled desiccation assay was developed to allow accurate quantification of the survival rate under definite relative humidity (RH). Worms were preconditioned on the surface of a diamond attenuated-total-reflectance cell for 4 days at 98% RH and then desiccated for 1 day at 45% RH and subsequently rehydrated at 97% RH. Preconditioning of worms increased the levels of trehalose by 5-fold, which indicated that nematodes were able to respond to humidity changes by synthesizing trehalose. Therefore, the authors investigated the role of trehalose using mutant strain (∆∆tps) which lacks the enzyme catalysing trehalose biosynthesis (trehalose 6-phosphate synthase). The results showed that desiccation followed by rehydration led to changes in the FTIR absorption spectra. The focus was on the frequency region between 2800 and 3000 cm-1 (representing CH stretching vibrations of acyl chain methylene), which indicates lipid-packing changes (Barth 2007; Goormaghtigh et al. 1999). The intensities 136

Texas Tech University, Amal Bouyanfif, August 2019 of the vibrations 2916 and 2849 cm-1 decreased upon drying of both strains. However, during desiccation the vibrations assigned to lipids increased only in mutant strain daf- 2;∆∆tps. The rehydration of daf-2 resulted in IR spectra that are mirror images of those acquired upon drying, indicating a reversible process. However, the desiccation of mutant strain daf-2;∆∆tps led to irreversible changes in the FTIR spectra. The authors concluded that native packing of lipids are preserved during desiccation due to the effect of trehalose on cell membranes (Erkut et al. 2011). Abusharkh et al. investigated the role of phospholipid headgroup composition and trehalose in the desiccation tolerance of C. elegans (Abusharkh et al. 2014). The authors used time-resolved FTIR difference spectroscopy to monitor fast hydration- induced structural changes in the phospholipids film prepared from preconditioned and non-preconditioned Dauer Larvae. The analysis of the FTIR data indicated that the -1 - -1 vibrations at 1260 cm (assigned to PO2 ), 1740 cm (assigned to C=O), and vibrations -1 between 3000 and 2800 cm (assigned to CH2) were affected directly by hydration- induced H-bonding. CH2 stretching responded to changes in acyl chain free volume. The authors concluded that IR signatures provided a view on the extent of H-bonding at different sites in the phospholipids headgroups and on the acyl chain order (Abusharkh et al. 2014). Recently, Zhang et al. reported on the use of the mid-infrared photothermal imaging (MIP) to study living cells organisms (Zhang et al. 2016). In their study, the authors placed live C. elegans (with liquid media mixed with 200 mM sodium azide for anesthesia) in a calcium-fluoride glass bottom dish for MIP imaging. FTIR spectra were acquired in reflectance mode. The authors were able to perform in-vivo MIP imaging of lipid and protein in C. elegans (Zhang et al. 2016). The lipid distribution of the worm body was assessed at 1750 cm-1 (C=O band), while the protein distribution in the same area was assessed at 1655 cm-1 (amide I band) (Zhang et al. 2016). The authors concluded that MIP technology is promising approach for broad applications ranging from investigating metabolic activities to high-resolution mapping of drug molecules in living cells (Zhang et al. 2016).

137

Texas Tech University, Amal Bouyanfif, August 2019

3.3.5. Toxicity assessment In addition to its use as model in biology for varieties of studies, C. elegans has been used in chemistry (Hulme and Whitesides 2011; Corsi 2006), materials science and medicine (Leung et al. 2008), as a tool for in-vivo assessment of nanoparticles toxicity (Gonzalez-Moragas et al. 2017a; Gonzalez-Moragas et al. 2015; Gonzalez- Moragas et al. 2017b; Gonzalez-Moragas et al. 2017c), and as a versatile platform for drug discovery (Artal-Sanz et al. 2006). Diomede et al. reported that tetracycline and its analogues protect C. elegans from β amyloid-induced toxicity by targeting oligomer (Diomede et al. 2010). The authors seeded the Nematode Growth Medium (NGM) plates with tetracycline-resistant E. coli for 54 h at 16oC then the temperature was raised to 24oC to induce the transgene expression. Paralysis was scored at 2 h intervals until worms were paralyzed (Diomede et al. 2010). FTIR measurements were performed on single intact worms taken directly from the agar plate. Worms were washed with distilled water, deposited on BaF2 IR window and dried at room temperature for 30 min. The IR spectra were acquired in transmission mode at different times from the pharynx region to monitor the aggregation kinetics of amyloid beta (Aβ) peptide (muscle specific gene Aβ1-42) in CL4176 worms (Diomede et al. 2010). To identify the secondary structure and the response of protein aggregates, the authors calculated the second derivative of the IR spectra between 1700 and 1600 cm-1 (amide I region). The results showed that the induction of Aβ1-42 expression resulted in a time-dependent shift of the 1636 cm-1 vibration towards lower energy and in a new component around 1623 cm-1 which was assigned to the intermolecular β-sheet structure of protein aggregates (Diomede et al. 2010; Kneipp et al. 2003). The authors found that when the majority of worms were paralyzed, the intensity of the vibration 1623 cm-1 increases (Diomede et al. 2010). IR results were instrumental to indicate that administrating tetracyclines to worms, significantly reduced the intensity of the vibration 1623 cm-1, which indicated that these drugs disassembled Aβ oligomeric and fibrillary β-sheet assemblies, restoring their non-amyloidogenic structures (Diomede et al. 2010).

138

Texas Tech University, Amal Bouyanfif, August 2019

Zanni et al. used C. elegans to study the toxicity of graphite nanoparticles (GNPs) (Zanni et al. 2012). Synchronized hermaphrodites wild-type (N2) were incubated with GNPs at 16oC at different concentrations for 24 h, extensively washed with deionised water, and then transferred onto bacteria-seeded NGM plates. After treatments, worms were washed several times with deionised water to remove external GNPs, deposited on ZnSe window, and then dried at room temperature. Micro- Attenuated Total Reflectance FTIR (µATR-FTIR) was used to investigate the efficiency of GNPs intake as well as their distribution inside the worms. The authors used the vibration 865 cm-1 (assigned to C-C lattice mode (Nemanich et al. 1977)) to illustrate the spatial distribution of GNPs (Zanni et al. 2012). The results showed that the spectra of untreated worms did not exhibit any vibrations assigned to C-C. However, mapping of treated worms showed that GNPs were distributed along the worm body. Furthermore, the same vibration was observed in the embryos laid by the adult worm on the ZnSe window. The authors concluded that observing a vibration assigned to C- C (originating from GNPs) in the embryos was strong evidence that GNPs could transition from the intestine to gonads (Zanni et al. 2012). The outcomes of this study confirmed the usefulness of the FTIR microspectroscopy to study the distribution of carbon nanomaterials in C. elegans.

3.4. Conclusions and perspectives

Due to its unique characteristics, C. elegans nematode has attracted tremendous interests for varieties of studies. This increase has created a need for tools to study intact whole nematodes. FTIR microspectroscopy has been widely adopted to determine vibrational characteristics of chemical bonds in various compounds, thus, allowing the determination of the molecular structure as well as the chemical composition. In biological samples (such as C. elegans), the FTIR spectra are composed of vibrations assigned to carbon-hydrogen bonds, amide bonds, hydroxyl bonds, carbonyl bonds, and sugar rings. These vibrations originate from the major biomolecules found in cells (such as polypeptides, carbohydrates, and compounds containing long-chain fatty acyl moieties such as triglycerides and phospholipids). Therefore, any change in the 139

Texas Tech University, Amal Bouyanfif, August 2019 biochemical composition of C. elegans will translate into changes in the FTIR spectra. Furthermore, the development of FPA detectors coupled with a microscope allow visualization of the sample as well as quickly generate an IR image from a sample, which provides a spatial distribution of the chemical functional groups of the sample being investigated. The major goal for this review is to stimulate the application of the FTIR microspectroscopy to study C. elegans and doing so will provide a useful addition to the already available techniques for various investigations using C. elegans as an experimental model.

Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-profit sectors.

140

Texas Tech University, Amal Bouyanfif, August 2019

3.5. References Abidi N, Cabrales L, Haigler CH (2014) Changes in the cell wall and cellulose content of developing cotton fibers investigated by FTIR spectroscopy. Carbohyd Polym 100:9-16. doi:10.1016/j.carbpol.2013.01.074

Abusharkh SE, Erkut C, Oertel J, Kurzchalia TV, Fahmy K (2014) The Role of Phospholipid Headgroup Composition and Trehalose in the Desiccation Tolerance of Caenorhabditis elegans. Langmuir 30 (43):12897-12906. doi:10.1021/la502654j

Ami D, Bonecchi L, Cali S, Orsini G, Tonon G, Doglia SM (2003) FT-IR study of heterologous protein expression in recombinant Escherichia coli strains. Bba- Gen Subjects 1624 (1-3):6-10. doi:10.1016/j.bbagen.2003.09.008

Ami D, Natalello A, Doglia SM (2012) Fourier transform infrared microspectroscopy of complex biological systems: from intact cells to whole organisms. Methods Mol Biol 895:85-100. doi:10.1007/978-1-61779-927-3_7

Ami D, Natalello A, Zullini A, Doglia SM (2004) Fourier transform infrared microspectroscopy as a new tool for nematode studies. FEBS Lett 576 (3):297- 300. doi:10.1016/j.febslet.2004.09.022

Artal-Sanz M, de Jong L, Tavernarakis N (2006) Caenorhabditis elegans: a versatile platform for drug discovery. Biotechnol J 1 (12):1405-1418. doi:10.1002/biot.200600176

Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Baker MJ, Trevisan J, Bassan P, Bhargava R, Butler HJ, Dorling KM, Fielden PR, Fogarty SW, Fullwood NJ, Heys KA, Hughes C, Lasch P, Martin-Hirsch PL, Obinaju B, Sockalingum GD, Sule-Suso J, Strong RJ, Walsh MJ, Wood BR, Gardner P, Martin FL (2014) Using Fourier transform IR spectroscopy to analyze biological materials. Nat Protoc 9 (8):1771-1791. doi:10.1038/nprot.2014.110

Barman A, Chaturbedi A, Subramaniam K, Verma S (2013) Imaging C. elegans with thiolated tryptophan-based NIR fluorescent gold nanoclusters. J Nanopart Res 15 (11). doi:UNSP 208310.1007/s11051-013-2083-6

141

Texas Tech University, Amal Bouyanfif, August 2019

Barth A (2007) Infrared spectroscopy of proteins. Biochim Biophys Acta 1767 (9):1073-1101. doi:10.1016/j.bbabio.2007.06.004

Bouyanfif A, Liyanage S, Hewitt JE, Vanapalli SA, Moustaid-Moussa N, Hequet E, Abidi N (2017) FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains. Analyst 142 (24):4727-4736. doi:10.1039/c7an01432e

Chen W-W, Yi Y-H, Chien C-H, Hsiung K-C, Ma T-H, Lin Y-C, Lo SJ, Chang aT-C (2016) Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging. Scientific RepoRts. doi:10.1038/srep32021

Corsi AK (2006) A biochemist's guide to Caenorhabditis elegans. Anal Biochem 359 (1):1-17. doi:10.1016/j.ab.2006.07.033

Diem M, Boydston-White S, Chiriboga L (1999) Infrared spectroscopy of cells and tissues: Shining light onto a novel subject. Appl Spectrosc 53 (4):148a-161a

Diomede L, Cassata G, Fiordaliso F, Salio M, Ami D, Natalello A, Doglia SM, De Luigi A, Salmona M (2010) Tetracycline and its analogues protect Caenorhabditis elegans from beta amyloid-induced toxicity by targeting oligomers. Neurobiol Dis 40 (2):424-431. doi:10.1016/j.nbd.2010.07.002

Dorling KM, Baker MJ (2013) Rapid FTIR chemical imaging: highlighting FPA detectors. Trends Biotechnol 31 (8):437-438. doi:10.1016/j.tibtech.2013.05.008

Erkut C, Penkov S, Khesbak H, Vorkel D, Verbavatz JM, Fahmy K, Kurzchalia TV (2011) Trehalose renders the dauer larva of Caenorhabditis elegans resistant to extreme desiccation. Curr Biol 21 (15):1331-1336. doi:10.1016/j.cub.2011.06.064

Essendoubi M, Toubas D, Bouzaggou M, Pinon JM, Manfait M, Sockalingum GD (2005) Rapid identification of Candida species by FT-IR microspectroscopy. Bba-Gen Subjects 1724 (3):239-247. doi:10.1016/j.bbagen.2005.04.019

Evans CL, Xie XS (2008) Coherent anti-stokes Raman scattering microscopy: chemical imaging for biology and medicine. Annu Rev Anal Chem (Palo Alto Calif) 1:883-909. doi:10.1146/annurev.anchem.1.031207.112754

Folick A, Min W, Wang MC (2011) Label-free imaging of lipid dynamics using Coherent Anti-stokes Raman Scattering (CARS) and Stimulated Raman Scattering (SRS) microscopy. Curr Opin Genet Dev 21 (5):585-590. doi:10.1016/j.gde.2011.09.003

142

Texas Tech University, Amal Bouyanfif, August 2019

Freudiger CW, Min W, Saar BG, Lu S, Holtom GR, He C, Tsai JC, Kang JX, Xie XS (2008) Label-free biomedical imaging with high sensitivity by stimulated Raman scattering microscopy. Science 322 (5909):1857-1861. doi:10.1126/science.1165758

Gonzalez-Moragas L, Berto P, Vilches C, Quidant R, Kolovou A, Santarella-Mellwig R, Schwab Y, Sturzenbaum S, Roig A, Laromaine A (2017a) In vivo testing of gold nanoparticles using the Caenorhabditis elegans model organism. Acta Biomater 53:598-609. doi:10.1016/j.actbio.2017.01.080

Gonzalez-Moragas L, Maurer LL, Harms VM, Meyer JN, Laromaine A, Roig A (2017b) Materials and toxicological approaches to study metal and metal-oxide nanoparticles in the model organism Caenorhabditis elegans. Mater Horiz 4 (5):719-746. doi:10.1039/c7mh00166e

Gonzalez-Moragas L, Roig A, Laromaine A (2015) C-elegans as a tool for in vivo nanoparticle assessment. Advances in Colloid and Interface Science 219:10-26. doi:10.1016/j.cis.2015.02.001

Gonzalez-Moragas L, Yu SM, Benseny-Cases N, Sturzenbaum S, Roig A, Laromaine A (2017c) Toxicogenomics of iron oxide nanoparticles in the nematode C- elegans. Nanotoxicology 11 (5):647-657. doi:10.1080/17435390.2017.1342011

Goodwin CM, Lewis GG, Fiorella A, Ellison MD, Kohn R (2014) Synthesis and toxicity testing of cysteine-functionalized single-walled carbon nanotubes with Caenorhabditis elegans. Rsc Adv 4 (12):5893-5900. doi:10.1039/c3ra44888f

Goormaghtigh E, Raussens V, Ruysschaert JM (1999) Attenuated total reflection infrared spectroscopy of proteins and lipids in biological membranes. Biochim Biophys Acta 1422 (2):105-185

Hellerer T, Axang C, Brackmann C, Hillertz P, Pilon M, Enejder A (2007) Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proc Natl Acad Sci U S A 104 (37):14658- 14663. doi:10.1073/pnas.0703594104

Hobro AJ, Lendl B (2011) Fourier-transform mid-infrared FPA imaging of a complex multicellular nematode. Vib Spectrosc 57 (2):213-219

Hulme SE, Whitesides GM (2011) Chemistry and the worm: Caenorhabditis elegans as a platform for integrating chemical and biological research. Angew Chem Int Ed Engl 50 (21):4774-4807. doi:10.1002/anie.201005461

143

Texas Tech University, Amal Bouyanfif, August 2019

Jackson M, Sowa MG, Mantsch HH (1997) Infrared spectroscopy: a new frontier in medicine. Biophys Chem 68 (1-3):109-125. doi:Doi 10.1016/S0301- 4622(97)80555-8

Kneipp J, Miller LM, Joncic M, Kittel M, Lasch P, Beekes M, Naumann D (2003) In situ identification of protein structural changes in prion-infected tissue. Biochim Biophys Acta 1639 (3):152-158

Lau K, Hobro A, Smith T, Thurston T, Lendl B (2012) Label-free non-destructive in situ biochemical analysis of nematode Steinernema kraussei using FPA-FTIR and Raman spectroscopic imaging. Vib Spectrosc 60:34-42. doi:10.1016/j.vibspec.2012.01.009

Leung MC, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN (2008) Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicol Sci 106 (1):5-28. doi:10.1093/toxsci/kfn121

Meyer JN, Lord CA, Yang XYY, Turner EA, Badireddy AR, Marinakos SM, Chilkoti A, Wiesner MR, Auffan M (2010) Intracellular uptake and associated toxicity of silver nanoparticles in Caenorhabditis elegans. Aquat Toxicol 100 (2):140- 150. doi:10.1016/j.aquatox.2010.07.016

Miller LM, Bourassa MW, Smith RJ (2013) FTIR spectroscopic imaging of protein aggregation in living cells. Bba-Biomembranes 1828 (10):2339-2346. doi:10.1016/j.bbamem.2013.01.014

Mohan N, Chen CS, Hsieh HH, Wu YC, Chang HC (2010) In vivo imaging and toxicity assessments of fluorescent nanodiamonds in Caenorhabditis elegans. Nano Lett 10 (9):3692-3699. doi:10.1021/nl1021909

Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2005) C-elegans tubby regulates life span and fat storage by two independent mechanisms. Cell Metab 2 (1):35-42. doi:10.1016/j.cmet.2005.06.004

Nemanich RJ, Lucovsky G, Solin SA (1977) Ir Active Optical Vibrations of Graphite/Phite. Solid State Communications 23 (2):117-120. doi:Doi 10.1016/0038-1098(77)90663-9

O'Reilly LP, Luke CJ, Perlmutter DH, Silverman GA, Pak SC (2014) C. elegans in high- throughput drug discovery. Adv Drug Deliver Rev 69:247-253. doi:10.1016/j.addr.2013.12.001

144

Texas Tech University, Amal Bouyanfif, August 2019

O'Rourke EJ, Soukas AA, Carr CE, Ruvkun G (2009) C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab 10 (5):430- 435. doi:10.1016/j.cmet.2009.10.002

Orsini F, Ami D, Villa AM, Sala G, Bellotti MG, Doglia SM (2000) FT-IR microspectroscopy for microbiological studies. J Microbiol Meth 42 (1):17-27. doi:Doi 10.1016/S0167-7012(00)00168-8

San-Blas E, Guerra M, Portillo E, Esteves I, Cubillan N, Alvarado Y (2011) ATR/FTIR characterization of Steinernema glaseri and Heterorhabditis indica. Vib Spectrosc 57 (2):220-228. doi:10.1016/j.vibspec.2011.07.008

Sheng M, Gorzsas A, Tuck S (2016) Fourier transform infrared microspectroscopy for the analysis of the biochemical composition of C. elegans worms. Worm 5 (1):e1132978. doi:10.1080/21624054.2015.1132978

Siebert F (1995) Infrared-Spectroscopy Applied to Biochemical and Biological Problems. Method Enzymol 246:501-526

Tamm LK, Tatulian SA (1997) Infrared spectroscopy of proteins and peptides in lipid bilayers. Q Rev Biophys 30 (4):365-429. doi:Doi 10.1017/S0033583597003375

Tserevelakis GJ, Megalou EV, Filippidis G, Petanidou B, Fotakis C, Tavernarakis N (2014) Label-free imaging of lipid depositions in C. elegans using third- harmonic generation microscopy. PLoS One 9 (1):e84431. doi:10.1371/journal.pone.0084431

Wang P, Liu B, Zhang D, Belew MY, Tissenbaum HA, Cheng JX (2014) Imaging lipid metabolism in live Caenorhabditis elegans using fingerprint vibrations. Angew Chem Int Ed Engl 53 (44):11787-11792. doi:10.1002/anie.201406029

Watts JL (2016) Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids. J Clin Med 5 (2). doi:10.3390/jcm5020019

Watts JL, Phillips E, Griffing KR, Browse J (2003) Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163 (2):581-589

Wharton DA, Petrone L, Duncan A, McQuillan AJ (2008) A surface lipid may control the permeability slump associated with entry into anhydrobiosis in the plant parasitic nematode Ditylenchus dipsaci. J Exp Biol 211 (Pt 18):2901-2908. doi:10.1242/jeb.020743

145

Texas Tech University, Amal Bouyanfif, August 2019

Yen K, Le TT, Bansal A, Narasimhan SD, Cheng JX, Tissenbaum HA (2010) A comparative study of fat storage quantitation in nematode Caenorhabditis elegans using label and label-free methods. PLoS One 5 (9). doi:10.1371/journal.pone.0012810

Zanni E, De Bellis G, Bracciale MP, Broggi A, Santarelli ML, Sarto MS, Palleschi C, Uccelletti D (2012) Graphite nanoplatelets and Caenorhabditis elegans: insights from an in vivo model. Nano Lett 12 (6):2740-2744. doi:10.1021/nl204388p

Zhang D, Li C, Zhang C, Slipchenko MN, Eakins G, Cheng JX (2016) Depth-resolved mid-infrared photothermal imaging of living cells and organisms with submicrometer spatial resolution. Sci Adv 2 (9):e1600521. doi:10.1126/sciadv.1600521

Zheng J, Greenway FL (2012) Caenorhabditis elegans as a model for obesity research. Int J Obes (Lond) 36 (2):186-194. doi:10.1038/ijo.2011.93

146

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 4

Effects of eicosapentaenoic acid on Caenorhabditis elegan’s lifespan and gene expression

A. Bouyanfif1,2, J.E. Hewitt3, I. Koboziev2,4, S.A. Vanapalli3, E. Hequet1, N. Moustaid-Moussa2,4 1 Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 79409 2 Department of Nutritional Sciences, Texas Tech University, Lubbock, TX 79409 3 Department of Chemical Engineering, Texas Tech University, Lubbock, TX 79409 4Obesity Research Cluster, Texas Tech University, Lubbock, TX 79409

4.1. Abstract Bioactive compounds such as long chain omega-3 polyunsaturated fatty acids (LC PUFAs) have been associated with many health benefits. Eicosapentaenoic (EPA, 20:5n-3) and docosahexaenoic (DHA, 22:5n-3) are the major PUFAs of marine origin and exert numerous biological effects and health span effects as anti-obesity and anti- inflammatory agents, due to their ability to alter the cellular membrane composition, gene transcription and cellular signaling. The present study was aimed to investigate the effects of dietary omega-3 fatty acid, specifically EPA, on lipid metabolism and lifespan using Caenorhabditis elegans (C. elegans) as a model organism. We investigated lifespan, gene expression, and fatty acid composition in C. elegans wild type N2 strain as well as tub-1 (nr2044) and fat-3 (wa22) mutant strains. The tub-1 strain, predisposed to increased fats accumulation, was used to mimic the obesity phenotype. The fat-3 nematodes, characterized by decreased fat accumulation, were used as a lean phenotype model. The lifespan of C. elegans was evaluated using a novel microfluidic chamber based technique. The tub-1 mutation extends worms’ lifespan whereas the fat-3 mutation shortens it, compared to the WT lifespan. EPA caused no obvious changes in roundworm longevity in mutant strains. However, N2 worms cultured in axenic media displayed the same mean lifespan as those cultured under standard and traditional lifespan studies. Yet, the addition of exogenous EPA to WT reduced their longevity.

147

Texas Tech University, Amal Bouyanfif, August 2019

Exposure to dietary EPA did not alter gene expression and fatty acids profiles in all used C. elegans strains.

Key Words: C. elegans, omega 3 polyunsaturated fatty acid, gene expression, microfluidics, lifespan

4.2. Introduction Despite notable limitations of C. elegans as a model organism for biomedical studies, which include inability to complete pathophysiology of diseases, absence of some signal transduction pathways, and lack of some tissues and internal organs compared to higher organisms, this nematode has been a distinguished organism for unraveling genetic and physiological mechanisms regulating aging and fat metabolism. Unlike mammals, C. elegans stores fats primarily in intestinal and skin-like epidermal cells and lacks leptin that is the key regulator of adiposity. This non-parasitic nematode has proved to be an effective in vivo model for numerous fields of experimental biology including genetics, neurobiology, biomedical, developmental and gerontology studies due to sharing a wide homology with mammals on the genetic and biochemical levels (Leung et al. 2008). Like mammals, this organism contains many key components related to fat metabolism such as lipid uptake and transport, fatty acids synthesis and breakdown, glycolysis and storage pathways, as well as many fat regulatory mechanisms such as neuroendocrine regulators insulin and serotonin, transcriptional regulator sterol response element binding protein (SREBP), and energy-sensing kinases AMP activated kinase (AMPK) and TOR kinase (Ashrafi 2007; et.al 2018; Srinivasan et al. 2008). It is noteworthy that C. elegans has the set of elongases found in higher organisms as well as Δ12 (FAT-2) and Δ15 (FAT-1) desaturases found in plants and (Δ5 (FAT-4) and Δ6 (FAT-3) desaturases found in animals. These enzymes are necessary for the synthesis of polyunsaturated fatty acids (PUFAs) both omega 3 and 6. This metabolic feature makes the nematodes independent from dietary PUFA supplies while humans have to obtain the essential PUFAs from the diet (Watts and Browse 2002; Napier and Michaelson 2001; et.al 2018). In mammals, long chain PUFAs, 148

Texas Tech University, Amal Bouyanfif, August 2019 supplemented with diet, became the structural components of membranes and precursors for signaling lipid molecules and have several protective health effects in metabolic diseases (Kalupahana et al. 2010; Kromhout et al. 2012; C. Gómez Candela et al. 2011). Obesity is one of the most pervasive chronic diseases of complex etiology principally involving an interaction between multiple factors including eating behavior, food sensation and intake signals, food transport and storage, energy expenditure, and physical activity. Clinical data regarding the beneficial effects ω-3 PUFAs are consistent with numerous animal studies demonstrating that enriching a high fat diet (HFD) with ω-3 PUFAs, particularly eicosapentaenoic acid (EPA, 20:5ω-3), prevents and even reverses development of fatty liver, glucose intolerance, insulin resistance, reduces adiposity and oxidative stress, lowers serum and tissue lipids, as well as reduces the blood levels of such systemic inflammation markers as TNFα, IL-6 and C-reactive protein (CRP) (Kalupahana et al. 2010; Gonzalez-Periz et al. 2009). Improper PUFA intake and metabolism have been implicated in pathogenesis of human diseases such as prostate cancer and coronary heart disease (CHD) (Simopoulos 2010). Puglisi and his colleagues reported the anti-oxidative stress protective effects of ω-3 fatty acids (Puglisi et al. 2011). However, it has been suggested that consumption of ω-3 PUFAs may contribute to alter aging due to their high susceptibility to oxidation (Hillyard and German 2009). Moreover, fish oil increases lifespan by over 40% in autoimmune-prone female mice (Jolly et al. 2001), and was associated with decreased inflammation and body weight and enhanced antioxidant enzymes activities (Jolly et al. 2001). Tsuduki et al. showed that lifespan in senescence-accelerated (SAMP8) mice fed a fish oil diet containing high levels of EPA and DHA, from 12 week of age, was significantly shorter compared to those fed safflower oil which does not contain EPA. They suggested that the observed aging delay in mice under long-term fish oil supplementation may be explained by the hyper-oxidation of membrane phospholipids due to the high levels of oxidative stress (Tsuduki et al. 2011). A study by Strong et al. contradicted the previous studies showing that fish oil supplementation at either high or low concentration has no effect on the lifespan of male or female mice (Strong et al. 2016). 149

Texas Tech University, Amal Bouyanfif, August 2019

A number of studies have been focused on C. elegans to investigate the roles of omega 3 fatty acids in lipid metabolism, growth, development, aging, and various biological processes. Watts et al. study showed that all deficiency by each of LC PUFAs affects the development and behavior of C. elegans fat-3 mutants without altering their lifespan (Watts et al. 2003). Also, the study revealed that supplementation of these worms at an earlier developmental stage rescued all the pleiotropic effects (Watts et al. 2003). Tsuduki’s group investigated also the effect of fish oil on C. elegans lifespan and demonstrated that a large amount of fish oil shortens the lifespan of these worms (Sugawara et al. 2013). The authors measured TBARS (thiobarbituric acid reactive substances) levels to assess the oxidative degradation of PUFAs in fish oil-fed worms hypothesizing that fish oil promotes lipid peroxidation. TBARS levels increased significantly in the fish oil groups compared to the control. Also, the addition of the antioxidant α-tocopherol to cultures supplemented with fish oil increased significantly the nematodes lifespans compared to the control group, demonstrating that lipid peroxidation was involved with the lifespan reduction (Sugawara, Honma et al. 2013). Also, Hillyard and German revealed that supplementing fat-3 mutants, cultured on solid media, with omega 3 PUFAs did not significantly affect their lifespan (Hillyard and German 2009). Aging enhances tissue integrity and function deterioration throughout the organism (Lopez-Otin et al. 2013). Traditionally, C. elegans lifespan was investigated using the Nematode Growth Medium (NGM) agar plates. More recently, a micro-pillar based technology (microfluidic chamber based devices) was developed to study lifespan of C. elegans. As manufacturing of microfluidic devices is easy, fast and inexpensive, the microfluidics-based protocols provide an affordable platform for easy animal handling and manipulation Microfluidics has emerged as a new technology for small scale C. elegans studies. Such microfluidics devices known as lab-on-chip (LOC) are instrumental in studying cellomics, trapping and imaging individual cells as well as whole organisms such as Drosophila melanogaster (HeleneAnderssona and Berg 2003; Kwanghun Chung et al. 2011; Chung et al. 2011).

150

Texas Tech University, Amal Bouyanfif, August 2019

Taken together C. elegans advantages make it a highly suitable experimental platform for energy homeostasis, metabolism, and longevity studies. The goal of the present study was to investigate the effects of EPA, a dietary fatty acid of marine origine on lifespan, lipid metabolism and gene expression in different C. elegans strains. We hypothesized that dietary ω-3 fatty acid reduces fat accumulation and oxidative stress and enhances longevity in fat 3 mutants that have severely reduced PUFAs production like mammals and tub-1 mutants that have an increased fat deposits compared to wild type worms. For this purpose, we assayed lifespan of these mutant strains under EPA supplementation using microfluidic-based technique. The present study further, tested the influence of this long chain fatty acid on the gene expression and the fatty acid composition after dietary exposure over several generations in both axenic and monoaxenic media.

4.3. Materials and methods 4.3.1. C. elegans strains The wild type (WT) Bristol N2, tub-1 (nr2044), and fat-3 (wa22) C. elegans strains were obtained from our collaborator, Dr. Vanapalli, who purchased them from Caenorhabditis Genetics Center (CGC, University of Minnesota, Minneapolis, MN, USA). The fat-3 strain carries a loss-of-function mutation in the FAT-3 gene that encodes delta-6-desaturase. It makes this strain unable to produce a sufficient amount of long-chain PUFAs. The deletion of the tub-1, human tubby ortholog gene, results in increased deposition of triglycerides (Ashrafi 2007; Carroll et al. 2004).

4.3.2. Nematode fluidic cultures Nematode culturing on monoxenic NGM (nematode growth media) was conducted at 20°C on plates seeded with E. coli (OP50) strain as a food source according to standard methods unless otherwise noted (Stiernagle 2006). Culturing on axenic liquid media was performed using a chemically defined C. elegans Maintenance Medium (CeMM; Cell Guidance Systems, Babraham, Cambridge, UK). Worms were cultured on NGM agar plates containing a large number of eggs. Gravid hermaphrodite adults were then bleached (see supplementary materials section Appendix C), and eggs 151

Texas Tech University, Amal Bouyanfif, August 2019 were left overnight to hatch in sterile M9 Buffer, a C. elegans preparation sample buffer. The next morning, L1 animals were transferred to CeMM containing 20 µg/mL of kanamycin sulfate (Fisher Scientific) and 200 µg/mL of streptomycin sulfate (Fisher Scientific) as previously described by Szewczyk et al. (Szewczyk et al. 2006). Highly purified Eicosapentaenoic acid (EPA) was purchased from Nu-Check Prep (Elysian, MN, USA), diluted with absolute ethanol to 1M concentration, aliquoted and stored at −80°C under gas nitrogen. EPA concentration in CeMM liquid media was 100 μM. Feeding was performed for 72 hours on worm cultures of mixed ages. However, for NGM media as previously described (Deline et al. 2013), after the agar was prepared and then cooled to 55°C, EPA was added slowly and stirred for a few seconds. Agar mixture was poured into plates instantly, and after one day they were seeded with E.coli and then allowed to dry at room temperature for 2 days in the dark. Worm cultures of mixed ages of several generations were washed off the plates in autoclaved M9 buffer and moderately centrifuged to pellet the worms then transferred to treated agar plates with EPA. The feeding was performed for 72 hours in the dark at 20°C. For lifespan assay, E.coli (OP50) bacteria suspension of 100 mg/mL in NGM medium Lite was used (see Material section). The bacteria suspension was prepared by centrifuging 210 mL of overnight culture of E. coli for 5 min at 3500 rpm and re-suspending the pellet in NGM Lite to a concentration of 100 mg/ml. Clumps of bacteria should not be left in the suspension. The OP50 suspension are used fresh or stored at 4°C up to two days. The PDMS part of the device is strongly and irreversibly bonded to a glass slide, which makes it isolated from the environment and rendered hydrophilic by plasma cleaning. Devices contain an array of 30 transparent chambers, which allows for the real-time microscopic control over all the worms in the device. Each chamber consists of three components: micro-pillar arena (chamber) where worms can crawl; barriers, permeable to bacteria, eggs, and progeny but that prevents the migration of adult worms; and worm loading inlet/outlet ports that can be used as feeding and washing ports (Figures 4.1A and 4.1B) (Rahman et al. 2018). Microfluidic devices were designed and produced by Dr. Vanapalli’s lab (Department of Chemical Engineering, Texas Tech University). 152

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.1: A microfluidic device for lifespan study of C. elegans. A) General view of the device; B) A chamber view (1: worm inlet port; 2: feeding ports, 3: barriers for worm retention). C) Live worms in lifespan microfluidic device.

Worms were cultured in 60 mm petri-dishes on NGM seeded with E. coli and incubated for 48 to 72 hours at 20°C until they reach L4 stage. To synchronize the culture, approximately 20 hermaphrodite worms were transferred to new NGM agar plates pre-seeded with E. coli. After 3 to 6 hours, the gravid worms laid eggs, which were collected by picking. The age-synchronized eggs were incubated for 72 hours to allow for hatching and growing the worms to adulthood stage. The microfluidic devices, were washed with 70% ethanol and loaded with NGM Lite solution. Age synchronized worms were washed with NGM Lite solution from 72 hours agar culture plate. The worm solution of 50 worms/ml in NGM Lite solution was collected and prepared for loading. 20-30 worms were loaded per device. To feed the worms loaded into the devices, the suspension of bacteria was administered through the inlet port until all channels, and the chambers were filled (approximately 500µL of E.coli suspension per device). The worms were supplemented with freshly prepared EPA daily. During the culture, devices were placed in 100 mm petri dishes filled with DI water to maintain humidity. The progeny was washed off devices daily by rinsing the device with NGM Lite solution. Figure 4.1 shows the components of a microfluidic device loaded with live worms in individual chambers.

153

Texas Tech University, Amal Bouyanfif, August 2019

4.3.3. Lifespan study A survival study was performed on 100 hermaphrodites of each strain. Animals were counted manually using a Nikon microscope. The worms were scored dead if they failed to move, either spontaneously or in response to gentle stimuli (natural deaths). Worms found killed by internal hatching of progeny (bagging phenotype) and worms lost or killed accidentally, were also counted dead and were censored from the assay. To calculate lifespan, the day animals were laying eggs was accepted as Day 0. Longevity experiments were carried out at 20°C. Young adults move and pump actively whereas older adults move and pump more slowly. During the final stages of the nematodes life, they became pale, appeared flaccid and decrepit, and some were gutted or have a burst-vulva. A day or two before the animals die, they stop moving altogether, they move if prodded, but only the nose wiggles feebly. Likewise, hermaphrodites, under laboratory conditions, enter their reproductive stage on day 3 and reproduce for the next 3 days. Up to day seven, adulthood worms do not produce progeny and that might be happening because their gonad was ablated. The % survival at time t is calculated using the following equation:

The median represents to time interval at which 50% of the population was scored dead. The Mean Lifespan (MLS) was calculated using the following equation (GraphPad Prism):

1 =

𝑀𝑀𝑀𝑀𝑀𝑀 � 𝑥𝑥𝑗𝑗 𝑑𝑑𝑗𝑗 𝑁𝑁 𝑗𝑗

Where j is the age (day), dj is the number of worms that died at day j, and N is the total number of dead worms.

154

Texas Tech University, Amal Bouyanfif, August 2019

The standard error (SE) of the estimated MLS was calculated using the following equation (GraphPad Prism): 1 = ( 1) 2 𝑗𝑗 𝑗𝑗 𝑆𝑆𝑆𝑆 � ��𝑀𝑀𝑀𝑀𝑀𝑀 − 𝑥𝑥 � 𝑑𝑑 𝑁𝑁 𝑁𝑁 − 𝑗𝑗 4.3.4. Gene expression analyses Total RNA samples were generated from four individual mixed stage worm cultures. Worms were harvested from CeMM plates by washing with M9 buffer. Worm suspensions were collected by centrifugation at 14,000 rpm for 3 to 5 min. Four hundred (400) µl of Trizol reagent (Thermo Scientific) was added to the pellets under RNase- free conditions. The mixture was shaken by hand vigorously for about 30 seconds, and then vortexed at 4°C for 20 min. 26G1/2 syringes were used to break down the tissues at RT. Whereas, harvested nematodes that were grown in agar cultures, were cleaned out from bacteria before the lysis step to avoid total RNA contamination. Plates full of healthy nematodes were washed with 2 to 3 ml of M9 buffer at room temperature then transferred to 15 ml conical tube, centrifuged at 4°C for 4 min at 3200 g, and the supernatant was discarded. Seven ml of 0.1M NaCl and 7ml of 60% w/v sucrose (stored at 4°C) were added. The mixture was placed on ice for 15 min, then centrifuged for 4 min at 4°C at 3200g. The pellet was transferred to a new conical tube using sterile pipette and washed 2 times with 15 ml RNase-free water followed by a 3200 g centrifugation at 4°C for 2 min. The bacteria-free pellet was transferred to a 1.5 ml microcentrifuge tube and centrifuged at 10,000 g for 30 s as described in the manufacturer’s manuals (QIAGEN and Thermo Fisher kits). 1 µg total RNA was reverse transcribed to cDNA using the iScript (QIAGEN) or Maxima (Thermo Fisher) cDNA synthesis kits. RT-PCR was performed on a Bio-Rad and Thermo Fisher systems (BioRad,Hercules,CA /QuantStudio™ 3) on selected genes fasn-1, oxi-1, MCP-1, TOR, sbp-1, daf-2, daf-9, sod-3, daf-16, and aak-2, related to aging and metabolism. Four independent experiments were completed for each strain and/or treatment. Primer sequences for the target and housekeeping genes, used for normalization, were designed using the OligoArchitect software at Sigma-Aldrich.com. The primer sequences used 155

Texas Tech University, Amal Bouyanfif, August 2019 are listed in Table 1-Appendix C. 18S or act-1 genes was used as internal housekeeping control.

4.3.5. Fatty acid analyses Fatty acids composition in WT worms and mutant strains was determined using gas chromatography as described previously (Bligh and Dyer 1959). The nematode samples for analysis were prepared from several generations of animals grown in axenic liquid medium CeMM liquid media maintained in 60 mm plates.

4.3.5.1. Lipid extraction The lipid extraction method described by Bligh and Dyer (Bligh and Dyer 1959) with minor modifications was used in our studies. Using M9 buffer, mixed age nematodes were washed from 2 large plates of C. elegans cultured in axenic liquid medium CeMM. 300-500 ml suspension containing worms collected was placed into a large glass tube (16 x 125mm), washed several times with water by pipetting. The suspension was incubated on desk for 5-10 minutes to allow the pellet formation. After that, water was removed. For quantification, 50 µg of 15:0 free fatty acid was added to the tubes as an internal standard. Oil samples were placed into Pyrex glass vial. 1.5 ml of 14% Boron trifluoride (BF3) methanol solution was added to the tubes. The samples were incubated in boiling water bath for 30 min, then cooled down to RT. 2 ml water and 1.5 ml hexane were added. The mixture was vortexed and centrifuged at low speed. The hexane extract was transferred to GC injection vial and capped. For fatty acid methyl esther (FAME) content analysis, 5 ml ice cold chloroform:methanol solution (1:1) was added to the tubes. The tube content was mixed thoroughly to produce a homogenous emulsion. To extract the lipids, the tubes were incubated overnight at -

20°C. Next day, 2.2 ml buffer solution, containing 0.2 M H3PO4 and 1 M KCl was added to the tube. The content of the tube was mixed thoroughly and centrifuged for 1 min at 6,000 rpm. The lower chloroform phase, containing the extracted lipids, was transferred into a new glass tube (16 x 125 mm) using a Pasteur pipette. 1 ml chloroform was added to the upper phase to extract the remaining lipids. The content of the tube was mixed thoroughly and centrifuged at 6,000 rpm. The bottom phase, produced by this 156

Texas Tech University, Amal Bouyanfif, August 2019 centrifugation, was combined with the previously extracted lipids. The combined extracts were evaporated under argon to reach approximately 100 µl. The tubes were additionally washed with 200 µl chloroform, which was then also evaporated down again to approximately 100 µl. The lipid extract volume was brought to 200 ml with chloroform. The air was removed from the extract by flushing with argon. The extracts were stored at -20°C (Bligh and Dyer 1959).

4.3.5.2. Gas Chromatography Gas chromatography (GC) analysis was conducted using an Agilent Technologies 6890N gas chromatograph equipped with a 100 m x 0.25 mm x df 0.20 µm (Length x inside diameter x film thickness) SP-2560 capillary column (Supelco), G2614 autosampler, and helium as carrier gas at a flow rate of 1.2 mL/min. The initial temperature of the oven was set to 140°C for 5 min and then increased to 280°C at a rate of 4°C/min and then held constant for 20 min. The injector temperature was set to 280°C, and the transfer line was kept at 250°C. Fatty acids were identified by comparing their retention times with the fatty acid methyl standards.

4.3.6. Statistical analyses Microsoft Excel (Microsoft Corporation, Redmond, WA, USA) software was used to perform survival data analysis based on the Kaplan–Meier method. Graphical representation for survival data using the Prism software (GraphPad Software San Diego, CA, USA) and comparisons of the curves were performed using the Log-rank test. Two-way ANOVA analysis was performed using the Statistica software (TIBCO Software Inc Version 13) and independent t-test. The lifespan evaluation was based on determining the % survival, MLS (Mean LifeSpan) and the Median. Data are expressed as the mean ± SE. Statistical significance is reported at the P < 0.05 level as specified.

157

Texas Tech University, Amal Bouyanfif, August 2019

4.4. Results and Discussion 4.4.1. Genotype effects 4.4.1.1. Effects of tub-1 mutation on C. elegans lifespan Figure 4.2 shows the % survival for WT and tub-1. Mean lifespan of WT worms under conditions of microfluidics culture is 14.1 ± 0.4 days (Table 4.1). This value is lower than C. elegans lifespan on NGM plates, reported by other investigators: 15.2 ± 3.6 days (Huang et al. 2004), 14.5 ± 4.1 (Hillyard and German 2009), and 19.8 ± 5.6 (Reisner et al. 2011). It is noteworthy that WT Bristol N2 strain lifespan cultured in solid media may vary from 12.0 ± 0.8 to 17.0 ± 0.6 days depending on the laboratory stock used (Gems and Riddle 2000). Several lifespan-extending mutations in C. elegans have been reported and mutant strains life extension has also been assessed (Shmookler Reis et al. 2011; Gems and Riddle 2000). Tubby protein is encoded by the mammalian TUB gene and generally expressed in the central nervous system (Mukhopadhyay et al. 2005). Tubby protein, first identified in mice, can bind to phosphatidylinositol, small cell signaling molecule, localized in the cell membrane (Carroll et al. 2004). In mice, mutations in tubby protein result in insulin resistance, infertility, and sensory deficits (Coleman and Eicher 1990; Ohlemiller et al. 1995; Noben-Trauth et al. 1996). They also affect lifespan and fat storage (Mukhopadhyay et al. 2005) as well as carbohydrate metabolism (Wang et al. 2006). In C. elegans, the tubby mutation in the homolog of the mammalian, tub-1 gene, results in increased triglycerides (TG) accumulation (Mukhopadhyay et al. 2005). Tissenbaum’s group demonstrated that mutation in tub-1 results in extended C. elegans lifespan, requiring DAF-16/FOXO pathway. Whereas, tub-1 regulates fat storage through TUB-RabGAP fat pathway in which RBG-3, a novel RabGTPase-activating protein, interacts with TUB-1 independently of DAF-16. Both RBG-3 and TUB-1 proteins are expressed in the same set of neurons (Mukhopadhyay et al. 2005). Several genetic mutations in C. elegans, such as tub-1, daf-2, and tph-1, promote lifespan extension and increased fat deposition in nematode intestine on NGM agar media (Ashrafi et al. 2003; Mukhopadhyay et al. 2005). The mutation in tub-1 (nr2044) is a 1816 kbp deletion which removes the entire coding region (Liu et al. 1999). To investigate the effect of EPA on lifespan and fat 158

Texas Tech University, Amal Bouyanfif, August 2019 accumulation in tub-1 worms, the first longevity analysis was conducted over the tub-1 (nr2044) animals cultured in microfluidics devices. The Log-rank test indicates that the survival curves are significantly different (p = 0.0002). Also, independent t-test analysis shows significant increase in MLS (p < 0.05). We found that tub-1 deficiency increases lifespan to 15.5 ± 0.4 days (15.1 ± 0.3 days median) compared to 14.1 ± 0.4 days (13.3 ± 0.3 days median) in WT (Table 4.1). The calculated lifespan extension was 10%. Figure 4.2 indicates that in addition to an increase in mean lifespan of tub-1 mutants compared to that of WT worms, there was also an increase in the maximum lifespan. tub-1 mutants lived a maximum of 24 days at 20°C, whereas WT worms had maximum lifespans of 20 days. Our finding is consistent with the previous study conducted by Mukhopadhyay et al. in which they reported that mutation in tub-1 leads to a 20% extension of lifespan in tub-1 mutants compared to WT control (Mukhopadhyay et al. 2005). In that study, the worms were cultured at 25oC. As shown previously, tub-1 mutants are defective in neurons-mediated chemo-sensation (Mukhopadhyay et al. 2005). It was shown that in C. elegans, ciliated sensory neurons control chemotaxis (Scholey 2003) and defect in these neurons results in an extension of lifespan (Apfeld and Kenyon 1999) which may explain the increased lifespan of tub-1 mutants.

159

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.2: Microfluidic culture lifespan assay was used to determine nematode survival curve for wild type N2 and tub-1 mutant strains. The worms were fed daily with E. coli suspension as described in the appendix C.

Table 4.1: Mean lifespan and Median of C. elegans WT and tub-1 at 20°C. All lifespan data are presented as mean ± standard error (SE); MLS – Mean lifespan; Median – 50% total survival; N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals. Data shown represent 4 different biological experiments. Data related to each replication is presented in Table 2- Appendix C. Strains MLS (days) ± SE Median ± SE N (D/C)

WT 14.1 ± 0.4 13.3 ± 0.3 108 (81/27) tub-1 *** *** tub-1 15.5 ± 0.4 15.1 ± 0.3 108 (90/18) *** p-value < 0.05.

4.4.1.2. Effects of fat-3 mutation on C. elegans lifespan In C. elegans fatty acids define physical parameters of cell membrane lipid bilayer thus modulating membrane fluidity, permeability, and its signaling functions. Two sources, from which C. elegans obtains fatty acids, are the diet and the endogenous synthesis from acetyl CoA (Figure 4.3). Acetyl CoA is carboxylated by acetyl-CoA carboxylase (ACC) to form malonyl-CoA, which, in turn, is elongated by fatty acid

160

Texas Tech University, Amal Bouyanfif, August 2019 synthase (FAS) to generate palmitic acid (16:0). Then palmitic acid can be further processed by fatty acid desaturases and elongases to yield a variety of long-chain polyunsaturated fatty acids (PUFAs) or used for triacylglyceride (TGA) or phospholipid biosynthesis (Watts and Browse 2002; Brock et al. 2006; Wallis et al. 2002; Kniazeva et al. 2003). TGA, produced by esterification of glycerol with fatty acids provides a principal storage molecule for energy deposition. TGA is stored within distinct droplet- like structures and yolk primarily in intestinal and skin-like epidermal cells of C. elegans. The energy, stored in deposited fats, is used by the nematodes during embryonic development, larval hibernation stage, and under harsh conditions (Mullaney and Ashrafi 2009; Watts 2009). C. elegans strains carrying mutations in fatty acid desaturation genes are instrumental in PUFA metabolism research as they provide a tool to study either genetic variability or diet. fat-3 mutation effects the gene that encodes Δ6-desaturase (Figure 4.3) and leaves nematode deficient in long chain fatty acids (C20) PUFAs. It makes the worm metabolically more similar to humans. fat-3 mutants are characterized by various morphologic and physiologic aberrations, including neuromuscular defects, slowed growth, cuticle abnormalities, reduced body size and brood size as well as altered biological rhythms (Watts and Browse 2002; Watts et al. 2003). Studies showed that unsaturated fatty acids may play a role in determining the metabolic rate of membrane- associated processes such as oxygen uptake, based on the ‘membrane pacemaker’ theory of metabolism proposing that there is a correlation between the level of membrane fatty acid unsaturation in membrane bilayers and the metabolic rate of a species (Hulbert 2003). In mammals, lower metabolic rates are related to larger species and longer life spans whereas higher metabolic rates are associated with smaller species and shorter life spans (Hulbert et al. 2002; Hulbert 2003; Hillyard and German 2009).

161

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.3: De novo synthesis of polyunsaturated fatty acid (PUFAs) in C. elegans. Linoleic acid (LA) is generated from Acetyl-CoA via a set of subsequent desaturation and elongation reactions. ω-3 and ω-6 PUFAs are produced from LA by C. elegans enzymatic machinery. ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; FAT- 1, omega-3 desaturase; FAT-2, Δ12 desaturase; FAT-3, Δ6 desaturase; FAT-4, Δ5 desaturase; FAT-5 and FAT-6/FAT-7, Δ9 desaturase; ELO, fatty acid elongase; FAT, fatty acid desaturase. This figure is adapted from (Bouyanfif et al. 2019).

Figure 4.4 shows the % survival of WT and fat-3 mutant strain. The mean lifespan for the total population of fat-3 worms cultured on microfluidics is 13.3 ± 0.3 (median of 12.5 ± 0.3 days) (Table 4.2). fat-3 mutants lifespan is decreased by 5% compared to the WT control (MLS = 14.0 ± 0.7). fat-3 worms had a maximum lifespan of 21 days whereas WT lived a maximum lifespan of 20 days. Interestingly, fat-3 mutants mean lifespan value found in this study is remarkably lower than the mean lifespan value of fat-3(wa22) worms grown on NGM plates (20.1 ± 4.9 days) previously found (Reisner et al. 2011) and higher than the average lifespan value found in the Hillyard and German study which is 10.9 ± 4.2 (Hillyard and German 2009).

162

Texas Tech University, Amal Bouyanfif, August 2019

Furthermore, Watts group revealed that one extra day was required for the development of fat-3 mutants from embryos to productive adults compared to WT and their overall lifespan was very similar (Watts et al. 2003). In addition, based on the ratio of the product/substrate of the desaturase activity, Ayyadevara’s group revealed that Δ6 desaturase levels display a moderate inverse correlation to lifespan (Shmookler Reis et al. 2011). This result is inconsistent with what we found in the present study on the effect of the mutation in fat-3 strain that lacks activity of Δ6 desaturase. In this study, we assessed lifespan using a liquid media in micro-devices. Due to their perfect dimension with the size of worms and the flexible operation of precise stimuli, this technique supports the long-term single-worm culture with sufficient nutrient exchange and facilitates the assay in a controllable manner thus circumvents multiple factors that affect lifespan assays in traditional methods.

Figure 4.4: Microfluidic culture lifespan assay was used to determine nematode survival curve for wild type N2 and fat-3 mutant strains. The worms were fed daily with E. coli suspension as described in the appendix C.

163

Texas Tech University, Amal Bouyanfif, August 2019

Table 4.2: Mean lifespan and Median of C. elegans WT and fat-3 at 20°C. All lifespan data are presented as mean lifespan ± standard error (SE), and the median ± SE at 50% of total survival. N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals. Data shown represent 4 different biological experiments. Data related to each replication is presented in Table 3- Appendix C.

Strains MLS (days) ± SE Median ± SE N (D/C)

WTfat-3 14.0 ± 0.7 13.5 ± 0.6 71 (61/10) fat-3 13.3 ± 0.3 12.5 ± 0.3 100 (78/22)

4.4.2. Strain-Dependent Effects of EPA on C. elegans lifespan Next, we tested how supplementing worm diet with EPA affects C. elegans lifespan in WT (N2), tub-1, and fat-3 strains under conditions of microfluidics culture. Figure 4.5 shows the % survival of WT and WT supplemented with EPA. The mean lifespan (MLS) for WT nematodes (N=108) supplemented with EPA was 13.1 ± 0.3 days (Figure 4.5) while in the control group it was 14.1 ± 0.4 days. However, both with and without supplementation, WT worms lived a maximum of 20 days. Supplementing diet with 100 µM EPA reduced the WT longevity by 7% compared to animals without supplementation but not significantly (Table 4.3). Our results are in agreement with previously published studies. Shmookler Reis et al. showed that the lifespan of WT(N2) was significantly reduced by 40 µM EPA (Shmookler Reis et al. 2011). Sugawara et al. demonstrated that high fish oil dose (2 mg/plate) shortened significantly the longevity of WT(N2), revealing that lipid peroxidation is involved in the reduction of nematode lifespan (Sugawara et al. 2013). In addition, it was reported that ingestion of fish oil can promote lipid peroxidation in different model animals, including C. elegans, and humans (Kaasgaard et al. 1992; Tsuduki et al. 2011; Sugawara et al. 2013; Harats et al. 1991; Meydani et al. 1991; Miret et al. 2003; Jia et al. 2011). We believe that the reduction of lifespan by EPA may be attributed to the oxidative stress caused by the exposure of the worms to higher amounts of exogenous EPA in addition to regular physiological levels of endogenously synthesized fatty acid required for C. elegans metabolism. 164

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.5: Microfluidic culture lifespan assay was used to determine nematode survival curve for WT(N2) and tub-1 mutant strains. The worms were fed daily with E. coli suspension with or without EPA supplementation as described in the appendix C.

Figure 4.5 shows the % survival of tub-1 and tub-1 supplemented with EPA. Our results showed that mutation in tub-1 results in lifespan extension. The MLS of tub- 1 with EPA supplementation is 15.4 ± 0.2 days. Supplementation with EPA did not alter their longevity. Other studies also reported that these mutants grown on agar plates exhibit a prolonged lifespan and increased triglyceride accumulation (Mukhopadhyay et al. 2005; Ashrafi 2007). tub-1 mutants are defective in AWC (Amphid Wing C cells) and AWA (Amphid Wing A cells) neurons that mediate olfactory chemotaxis (Mukhopadhyay et al. 2005). It may have impeded obtaining the food supply from the environment by the animals. Furthermore, since tub-1 mutant nematodes are still capable of producing physiologic long chain PUFA amounts de novo, the excessive EPA provided with the diet may be a cause for a subtle oxidative stress and associated tissue damage.

165

Texas Tech University, Amal Bouyanfif, August 2019

Table 4.3: Mean lifespan and Median of C. elegans WT(N2) and tub-1 at 20°C. All lifespan data are presented as mean lifespan ± standard error (SE), and the median ± SE at 50% of total survival. N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals. Data shown represent 4 different biological experiments. Data related to each replication is presented in Table 2-Appendix C. Strains Treatment MLS (days) ± SE Median± SE N (D/C)

WTtub-1 Control 14.1 ± 0.4 13.3 ± 0.3 108 (81/27) EPA 13.1 ± 0.3 12.6 ± 0.2 108 (89/19) tub-1 Control 15.5 ± 0.4 15.1 ± 0.3 108 (90/18) EPA 15.4* ± 0.2 14.8 ± 0.3 108 (96/12) * indicates p-value < 0.05.

We found that fat-3 mutation decreases moderately the worm lifespan (Figure 4.6. and Table 4.4). An interesting finding in this study was that fat-3 worms grown on NGM Lite liquid media in micro-devices exposed to a continuously EPA concentration did not display significant changes in neither their MLS nor their maximum lifespans. In our studies, fat-3 nematodes displayed unimpaired fertility and viability. However, they grow slowly; exhibit less spontaneous movement; have an altered body shape, and they produce fewer progeny compared to wild type worms. This indicates that long- chain PUFAs are not critical for C. elegans reproduction but is important for their development and probably, for other essential functions. Watts et al. suggested that functional defects, resulting from the lack of FAT-3/delta-6 desaturase enzymatic activity in C. elegans may be compensated by long-chained PUFAs supplemented with diet (Watts et al. 2003). However, in their experiments, EPA effect on fat-3 worms aging was not significant. In our study, EPA supplementation was started at the L4 larvae stage and was continuously provided during the whole nematodes life. There may be a potent role of EPA that is necessary during the development for just certain age that ameliorates the functional defects of these mutants as Watts’s group demonstrated (Watts et al. 2003). It is also may be a case that the EPA dose should be further optimized to restore the fat-3 strain lifespan to WT level.

166

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.6: Microfluidic culture lifespan assay was used to determine nematode survival curve for WT(N2) and fat-3 mutant strains. The worms were fed daily with E. coli suspension with or without EPA supplementation as described in the appendix C

Table 4.4: Mean lifespan and Median of C. elegans WT(N2) and fat-3 at 20°C. All lifespan data are presented as mean lifespan ± standard error (SE), and the median ± SE at 50% of total survival. N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals. Data shown represent 4 different biological experiments. Data related to each replication is presented in Table 3-Appendix C. Strains Treatment MLS (days) ± SE Median± SE N (D/C)

WTfat-3 Control 14.0 ± 0.7 13.5 ± 0.6 71 (61/10) EPA 13.3 ± 0.5 13.3± 0.6 101 (86/15) fat-3 Control 13.3 ± 0.3 12.5 ± 0.3 100 (78/22) EPA 13.7 ± 0.4 13.2 ± 0.5 100 (74/26)

4.4.3. Gene expression To better understand the effect of EPA on C. elegans lifespan, we determined how the expression of a set of genes, associated with fat metabolism, oxidative stress responses and longivity, is affected by EPA supplement. We quantified gene expression in worms after culturing several subsequent nematode generations on CeMM liquid media.

167

Texas Tech University, Amal Bouyanfif, August 2019

In this study, the effects of dietary EPA supplementation was evaluated on adiposity, oxidative stress, and on longevity markers in C. elegans cultured under specific conditions. We hypothesized that this long chain ω-3 fatty acid reduces oxidative stress in the mutant strains (especially fat 3), and enhances longevity genes. Figure 4.7 summarizes our proposed model of the mode of action of EPA on C. elegans.

Figure 4.7: The hypothetical model for alterations in gene expression by EPA for genes regulating the adiposity, oxidative stress and aging-related pathways in C. elegans. Genes in colored rectangles represent suggested principal modulators of investigated pathways. EPA modulates oxidative stress resistance and enhances longevity by direct and indirect mechanisms such as promoting AAK-2/DAF-16 pathway, inhibiting TOR signaling and inhibiting lipogenesis. Expression of a set of genes involved in C. elegans aging and fat metabolism was evaluated in all three strains used in this study (Table 4-Appendix C). Worm cultures, containing the nematodes on mixed stages of development, were grown in axenic CeMM liquid medium, providing all necessary nutrients (Table 1-Appendix C) but not supplemented with bacteria as food source. These conditions are different compared to growing the worms on monoxenic agar solid media, where the main source of nutrients, including lipids, is E. coli. C. elegans fat metabolism fasn-1 gene is a homolog of human FASN gene coding for fatty acid synthase (FAS), the key enzyme involved in de novo synthesis of long-chain fatty acids. It was shown that fasn-1 168

Texas Tech University, Amal Bouyanfif, August 2019 transcription is moderately expressed in L1/ L2 larva starved for 12 hours but is not activated in later larva or adult worms (D'Erchia et al. 2006). sbp-1 gene, an ortholog of human SREBP1c, codes for sterol regulatory element binding protein which determines adult lifespan and positively regulates lipid storage. TOR (let-363), is an ortholog of human MTOR, which is involved in TOR signaling, determination of adult lifespan, nematode larval development and positive regulation of translation (Sheaffer et al. 2008). aak-2 gene, 5'-AMP-activated protein kinase catalytic subunit alpha-2, functions downstream of environmental stressors, cell energy level sensing signals (AMP:ATP ratio), and daf-2-mediated insulin signaling. aak-2 activity results in extending the C. elegans lifespan (Apfeld et al. 2004b). daf-16 gene, forkhead box protein O, functions as a transcription factor that mediates the insulin/IGF-1 (IIS) signaling pathway thus being involved in regulating the dauer larvae formation, longevity, fat metabolism, stress response, and innate immunity. In C. elegans, daf-12 gene (nuclear hormone receptor family member) encodes a nuclear hormone receptor, engaged in the regulation of embryonic and larval development, the formation of dauer larvae, and adult longevity (Henderson and Johnson 2001). daf-2 also regulates fat storage, salt chemotaxis learning, and stress resistance, including response to high temperature, oxidative stress, and bacterial infection (see chapter 3) (Henderson and Johnson 2001; Hsu et al. 2003). daf-9, the cytochrome P450 gene, is a fatty acid hydroxylase which reveals its activity downstream of the DAF-2/insulin/IGF receptor and the DAF-7/TGFbeta ligand signaling (Gerisch et al. 2001). sod-3 gene encodes iron/manganese superoxide dismutase, involved in oxidative stress responses (Yanase et al. 2002). Finally, oxidative stress-related genes, mcp-1 and oxi-1, while oxi-1 which is an ortholog of human UBE3B; has ligase and ubiquitin-protein transferase activities, mcp-1 which is GDP-D- glucose phosphorylase 1, displays GDP-D-glucose phosphorylase activity.

4.4.3.1. Gene expression in tub-1 strain Figure 4.8 shows that the expression of fasn-1 gene in tub-1 was lower than in WT worms cultured on control media not supplemented with EPA. However, no significance was shown. Whereas, in EPA-treated nematodes fasn-1 levels displayed a

169

Texas Tech University, Amal Bouyanfif, August 2019 high expression. WT supplemented with exogenous EPA shows no difference in fasn-1 expression compared to the control. EPA caused an increase in fasn-1 expression in tub- 1, which was not a case in WT. sbp-1 and aak-2 expression was not effected by mutation or EPA .daf-2 gene expression is stimulated by EPA in both WT and tub-1 worms, and no differences were observed between strains. Expression of daf-16 is not affected by tub-1 deficiency or by EPA. In mammals, mTOR gene expression is positively regulated by the kinase cascade through insulin signaling (Birsoy et al. 2013). We observed a trend for elevated daf-9 expression in the tub-1 strain, and EPA had no effects on this gene in both WT and tub-1. daf-9 gene encodes a cytochrome P450. Increased daf-9 expression in the tub-1 mutant shed light on the nature of lifespan extension in these mutants. daf-9 is expressed in nematode head cells at all developmental stages (Gerisch et al. 2001) and encodes a cytochrome P450 that metabolizes steroids as ligand for DAF- 12. Upon binding to sterol hormones, the transcription factor DAF-12 is stimulated and acts in parallel with DAF-16 and downstream of the DAF-2/IGF receptor to enhance longevity (Gerisch et al. 2007). Even if EPA does not affect daf-9 and daf-16 expression in WT and tub-1, the expression of both daf-2 and TOR genes shows a distinct increase in both strains. Evaluating the effects of EPA on oxidative stress related gene expression was one of our goals. The oxi-1 gene levels displayed an increase by EPA supplementation in both WT and tub-1 strains but not statistically significant. sod-3 expression demonstrated a trend for increase in WT but not in tub-1 worms. Interestingly, in nematodes not treated with EPA. A trend for higher sod-3 expression in the tub-1 strain was also observed. A trend for higher expression in worms supplemented with EPA was also obsrerved for the mcp-1 gene in WT and the tub-1 strains. Genotype and EPA did not impact the expression of aak-2 gene (Figure 4.8). It was demonstrated that aak-2 acts in parallel with daf-16 to extend lifespan (Apfeld et al. 2004a). However, our data does not indicate any correlating activity between daf-16 and aak-2 genes.

170

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.8: Genotype effect on gene expression. Different nematode generations were grown on C. elegans maintenance media (CeMM) supplemented or not supplemented with EPA (100 μM). Mixed age worm populations were used for analysis. Gene expression was quantified by RT-PCR (QuantStudio 3, Applied Biosystems). Target gene expressions are normalized to act-1or 18S housekeeping genes and are presented as ratios to the N2 control. Graphs represent the data from 4 independent experiments. Data is expressed as mean ± Standard Error. Values not followed by the same letter are statistically different at α= 5% according to Newman-Keuls test. 4.4.3.2. Gene expression in fat-3 strain Similarly to mammals, fat-3 C. elegans mutants have severely reduced PUFAs production. In EPA-treated fat-3 worms, expression of fasn-1 and sbp-1 fat biosynthesis genes tend to decrease compared to regular culture conditions (Figures 4.8A and 4.8B).

171

Texas Tech University, Amal Bouyanfif, August 2019

Both these gene’s expression was not affected by EPA in WT nematodes. But while fasn-1 expression in WT was similar to the one observed in fat-3 animals treated with EPA, expression of sbp-1 tends to be reduced further compared to EPA-treated fat-3. Expression of aak-2, another fat biosynthesis gene, was not affected by EPA in WT, neither in fat-3 nematodes, but tends to increase in fat-3 mutants. Consistently with this, in fat-3 nematodes, supplementing the media with EPA did not have an impact on the expression of the TOR gene, regulated by the aak-2 gene. This is consistent with previous mammalian studies demonstrating that the activation of AMPK plays a major role in the inhibition of mTOR (Inoki et al. 2003). Expression of oxidative stress responses oxi-1 gene did not depend on worm genotype on regular media, but it showed a trend to decrease in EPA-fed fat-3 mutants. In contrast, the expression of another oxidative stress-related gene, mcp-1, was not affected by EPA in fat-3 nematodes, but was elevated compared to WT worms cultured on regular media and rather similar in its expression in EPA-treated WT. Consistently with our lifespan study findings, the expression of the daf-2 gene, associated with longevity regulation in C. elegans, showed a tendancy to increase in fat-3 compared to WT. Interestingly, supplementing worms with EPA caused the opposite effects on daf-2 expression in two strains: a trend to increase in WT and to suppression – in fat-3. daf-16 expression was not affected by genotype, neither EPA in both strains. daf-9 gene showed a low expression in fat-3 mutant controls compared to WT but there is no effect of EPA supplementation. daf-9 expression did not show genotype - or EPA - related effects. According to previous studies (Gerisch et al. 2007), daf-9 activates the expression of the daf-12, a gene that encodes the DAF-12 transcription. That means that the DAF-16 required the activation of DAF-9. We can explain this by the fact that the concentration used in this study is lower than the required dose to rescue these mutants. In these mutants, the lack of C20 PUFAs, which become components of the membranes and precursors for eicosanoids, may be the cause of high expression of inflammation and oxidative stress genes. However, no significant changes were observed in the expression of these selected genes due to the high variability reported in this study.

172

Texas Tech University, Amal Bouyanfif, August 2019

In C. elegans, the CYP-33E2 subfamily of CYP (cytochrome P450) enzymes converts omega-3 fatty acids, specifically EPA, into eicosanoid-like molecule epoxyeicosatetraenoic acid (17, 18-EEQ) (Zhou et al. 2015). Along with a set of arachidonic acid-derived eicosanoids, epoxyeicosatetraenoic acid contributes to conducting cell signaling of serotonin and other neuro-hormones thus taking part in the regulation of pharyngeal pumping and food uptake (Zhou et al. 2015). However, in the present study, expression of daf-9 gene, which encodes a cytochrome P450, showed a slight trend to decrease in fat-3 mutants. Table 4.5 indicates aging, fat metabolism and oxidative stress-related genes levels in mixed age worms that were grown in axenic liquid media (CeMM) with and without supplementation. The high variability seen in mRNA levels among strains or treatments may be due to the worms mixed ages in this study. Table 4.5: Effect of EPA on gene expression in wild-type, tub-1 and fat-3 C. elegans strains. Different nematode generations were grown on C. elegans maintenance media (CeMM) supplemented or not supplemented with EPA (100 μM). Mixed age worm populations were used for analysis. Table represents the data from 4 independent experiments. Data are relative to WT and are expressed as mean ± SE (standard error). NS – not significant. Statistical analysis was performed using two way ANOVA. Means in a row with superscripts without a common letter differ. Difference between groups is considered significant for p < 0.05. WT tub-1 fat-3 P value EPA Control EPA Control EPA Geno Diet Geno X diet 0.66 ± 0.32± 0.87± 1.49 ± 0.68 ± 0.02277 NS NS fasn-1 0.19ab 0.12b 0.24 ab 0.38a 0.13ab 0.80 ± 1.21 ± 0.79 ± 5.88 ± 2.33 ± NS NS NS sbp-1 0.45 0.44 0.12 5.43 1.91 1.11 ± 0.50 ± 0.47 ± 1.71 ± 1.65 ± NS NS NS aak-2 0.23 0.26 0.32 0.72 0.69 TOR 1.51 ± 0.49 ± 3.46 ± 0.84 ± 0.75 ± NS NS NS 0.41 0.25 1.85 0.44 0.13 (let-363) 1.42 ± 0.81 ± 1.30 ± 1.60 ± 0.86 ± NS NS NS oxi-1 0.45 0.36 0.64 0.65 0.28 2.46 ± 2.79 ± 2.43 ± 1.86 ± 1.41 ± NS NS NS sod-3 0.96 0.73 0.95 0.53 0.29 1.56 ± 0.63 ± 1.84 ± 1.93 ± 1.78 ± NS NS NS mcp-1 0.52 0.10 0.78 0.56 0.63

173

Texas Tech University, Amal Bouyanfif, August 2019

Table 4.5. Continued.

1.78 ± 0.63 ± 2.58 ± 2.55 ± 1.26 ± NS NS NS daf-2 0.57 0.19 1.40 1.21 0.62 1.07 ± 2.43 ± 2.79 ± 0.64 ± 0.51 ± NS NS NS daf-9 0.24 1.83 2.10 0.22 0.11 0.94 ± 1.07 ± 1.48 ± 0.97 ± 0.88 ± NS NS NS daf-16 0.18 0.17 0.27 0.14 0.26

To test the influence of EPA supplementation on aging and adiposity in C. elegans using different food source and to determine whether the levels of selected genes display the same variability as in axenic media (CeMM), nematodes were grown in monoxenic media under standard conditions at 20°C wherein the agar media was supplemented with 100 µM EPA and the main food source of worms is E. coli bacteria. Quantitative PCR was performed to determine the expression of fasn-1, oxi-1 and mcp- 1 genes in tub-1 and fat-3 mutant strains, relative to WT (Figure 4.9). We found that similarly to worms grown in CeMM media, expression of fasn-1 gene in fat-3 mutants increased compared to WT. In contrast, in tub-1 mutants, the levels of fasn-1 exhibited a decrease compared to WT and fat-3 mutants. There was no statistically significant difference in this gene expression with EPA supplementation (Table 4.6). However, oxi-1 gene that is related to oxidative stress, its levels displayed a significant decrease (p< 0.05) in fat-3 mutants compared to WT. In contrast to tub-1 mutants, mcp-1 and oxi- 1 genes showed an increase in their levels in fat-3 mutants but no significance was shown. Interestingly, unlike in liquid media, EPA supplementation decreased significantly (p<0.05) the expression of oxi-1 gene in tub-1 mutants.

174

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.9: Genotype effect on gene expression. Gene expression changes in C. elegans tub-1 and fat-3 mutant strains compared to WT. Different nematode generations were grown on solid media (NGM) supplemented or not supplemented with EPA (100 μM). Gene expression was quantified using RT-PCR. Target gene expressions are normalized to act-1 or 18S housekeeping genes and are presented as ratios to the N2 control. Error bars represent standard error of 4 independent experiments. Two way ANOVA was performed between groups with and without supplementation. Data is expressed as mean ± Standard Error. Values not followed by the same letter are statistically different at α= 5% according to Newman-Keuls test.

Table 4.6: Effect of EPA on gene expression in wild-type, tub-1, and fat-3. Different nematode generations were grown on NGM with or without EPA (100 μM). Mixed age worm populations were used for analysis. Table represents the data from 4 independent experiments. Data are relative to WT and are expressed as mean ± SE (standard error). NS – not significant. Statistical analysis was conducted using two way ANOVA. Means in a row with superscripts without a common letter differ. Difference between groups is considered significant for p < 0.05.

WT tub-1 fat-3 P value

EPA Control EPA Control EPA Geno Diet Geno X diet 1.23 ± 0.45 ± 0.68 ± 1.95 ± 0.92 ± NS NS NS fasn-1 0.49 0.22 0.31 0.79 0.27 1.30 ± 0.18 ± 0.40 ± 0.15 ± 0.53 ± 0.0008 NS 0.0059 oxi-1 0.31a 0.23a 0.04bc 0.11c 0.15bc 1.73 ± 1.74 ± 4.58 ± 0.22 ± 1.36 ± NS NS NS mcp-1 0.65 0.66 3.39 0.16 0.61

In the present study, genetic analysis displayed a significant variability in mRNA levels of target genes among strains. No consistent trends were observed among 175

Texas Tech University, Amal Bouyanfif, August 2019 replications which may be explained by the use of the mixed age population of nematodes. It was reported that specific transcripts undergo a change in abundance over the nematode life cycle stages. Transcripts are expressed at different stages during the nematodes life cycle (Collins et al. 2008). Interestingly, it was demonstrated that in daf- 2 worms, the hsp (heat-shock protein) gene is highly expressed between one and ten days of age, but a reduction in expression of these genes is observed between one and six days in WT nematodes (Halaschek-Wiener et al. 2005). In addition, fasn- 1 transcription is moderately activated in L1 or L2 larvae; however it is not activated in later larva or adult stages (Van Gilst et al. 2005; D'Erchia et al. 2006). Thus, further investigation is needed using age synchronized animals. Despite the noted advantages of the use of C. elegans, the inability to isolate a high quality and amounts of RNA from small amount of worms is the main limitation in its use. Effectively, for the rupture of worm’s resilient cuticle and the release of cellular contents, extraction protocols require harsh denaturants. Hence, may a single step method of RNA isolation is needed to avoid the variability in gene expression. It was shown that a single adult worm typically contained about 35 ng total RNA (Ly et al. 2015) which is enough to generate cDNA and further perform qPCR. Moreover, C. elegans body wall transparency allows for easy visualization of the internal organs, age‐ related pathology, and fat accumulation. Thus, a knock-in transgenic expression of the green fluorescent protein (GFP)-coupled target genes may be determined and quantified in intact C. elegans body.

4.4.4. Fatty acids composition Effects of worm genotype and EPA supplementation on fatty acid composition in C. elegans were determined in mixed age cultures grown on CeMM medium. In cultures, not supplemented with EPA, tub-1 mutants which are capable of synthesize de novo a range of LC PUFAs, accumulate lower levels of Palmitic (C16:0), Stearic (C18:0), Oleic (C18:1) and Eicosapentaenoic (EPA, C20:5) acids compared to WT counterparts (Figure 4.10). Reduced levels of fatty acids in N2 worms fed with EPA was observed.

176

Texas Tech University, Amal Bouyanfif, August 2019

In C. elegans, the FAT-3/Δ6 desaturase (fat-3 gene product) converts the Linoleic acid (C18:2) into γ-Linoleic acid (C18:3) (Figure 4.3). It makes the biosynthesis of γ-Linoleic (C18:3) and Dihomo-γ-Linoleic (C20:3) ω-6 PUFAs, which is conducted downstream the FAT-3/Δ6 desaturase activity, dependent on this enzyme’s function. Consistent with this, a trend for reduced content of γ-Linoleic and Dihomo-γ- Linoleic acids was observed in fat-3 mutants. Supplementing the fat-3 nematodes with EPA (C20:5) resulted in a significant increase of EPA content in these animals (Figure 4.10). In our C. elegans longevity experiments, supplementing worms with EPA during their whole life cycle did not have a positive impact on nematode lifespan. Moreover, it was reported by other investigators, that similarly to humans in which the EPA deficiency can cause slowed growth as well as skin and hair abnormalities (Williard et al. 2001), the fat-3 worms have multiple developmental and physiologic defects (Watts et al. 2003). It suggests that, in spite of absence of lifespan-related effects, supplementing fat-3 mutants with EPA may still have a beneficial impact on worm physiology. In a previous study, it was shown that SBP-1 prevents saturated fats accumulation in C. elegans by regulating fatty acid desaturases such as ∆9 desaturase, resulting in nematodes protection from glucose-induced accelerated aging (Lee et al. 2015a). In wild type worms, supplementation with EPA resulted in a decrease in the overall fatty acids levels. A γ-Linoleic acid, product of FAT-3/Δ6 desaturase activity, is rapidly further elongated to Dihomo-γ-Linoleic acid. In turn, the ω-3 PUFA α-Linolenic acid (C18:3) is subsequently converted to Stearidonic (C18:4), Eicosatetraenoic (C20:4) and Eicosapentaenoic acids. In our studies, supplementing the WT worms with EPA decreased their longevity and we observed elevated expression of oxi-1 and mcp-1 oxidative stress genes. It suggests that PUFA composition alterations in EPA-fed nematodes may be attributed to either induced oxidative stress or to the effects of eicosanoids, produced EPA via cyclooxygenase and P450 monooxygenase enzymes (Watts et al. 2003).

177

Texas Tech University, Amal Bouyanfif, August 2019

Figure 4.10: Genotype effect on fatty acid (FA) composition. Different generations of mixed age nematodes were grown on C. elegans maintenance media (CeMM) supplemented or not supplemented with EPA (100 μM). Relative FA abundance is expressed as percentage of total fatty acid as determined by gas chromatography analysis. Nematodes were treated with EPA for 72 hours in two independent experiments and three independent experiments for those without treatment. Error bars indicate standard error of 2 independent experiments. Statistical analysis was performed using independent t-tests to evaluate the difference between groups with and without treatment for each fatty acid. No statistically significant difference was found.

178

Texas Tech University, Amal Bouyanfif, August 2019

The similar EPA content in WT and tub-1 worms, cultured on regular media, indicates that tub-1 mutants are capable of producing physiologic amounts of endogenous EPA. Relative abundance of Palmitic and Stearic acids was similar in WT and tub-1 worms, grown on regular media. In mammals, diets rich in unsaturated fatty acids decrease expression of SREBP-1 gene, which encodes for SCD1 (stearoyl-CoA desaturase) (Ntambi 1999). In C. elegans, the sbp-1 gene encodes the Δ9 desaturase, a homolog to mammalian SCD1. In our study, consistent with sbp-1 expression data, Palmitoleic (C16:1; product of FAT5 isoform of Δ9 desaturase) and Oleic (product of FAT6/FAT7 Δ9 isoforms) acids were found in similar amounts in WT and tub-1 worms grown on regular media. Culturing nematodes on EPA resulted in a non-significant decrease in accumulation of Palmitoleic acid in the WT animals, and reduced Oleic acid content in both WT and tub-1 strains (Figure 4.10).

4.5. Conclusions Changes in gene expression throughout the short lifespan of the C. elegans provides important insight into genetic changes related to aging. This study showed the suitability of C. elegans for evaluating the effects of EPA on aging. A long-term EPA consumption resulted in accelerated aging in WT worms. This may be due to an excessive EPA given to worms when taking into account endogenous production in addition to exogenous supplementation. fat 3 model humans best as we are unable to produce EPA. EPA supplementation to fat 3 mutants did not change or improved lifespan. Overall, just a few significant EPA effects on C. elegans gene expression were observed. Future experiments, using age-synchronized worm cultures, are required to elucidate the role of EPA in aging and life stage-dependent mechanisms of EPA. C. elegans shows age-associated characteristics like in humans including age- pigments lipofuscin, oxidative stress, and advanced glycosylation end products. Thus, it is a valuable model for identifying and evaluating different bioactive compounds that are beneficial to not only for lifespan extension but also for health span.

179

Texas Tech University, Amal Bouyanfif, August 2019

4.6. References Apfeld J, Kenyon C (1999) Regulation of lifespan by sensory perception in Caenorhabditis elegans. Nature 402 (6763):804-809. doi:10.1038/45544

Apfeld J, O'Connor G, McDonagh T, DiStefano PS, Curtis R (2004a) The AMP- activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C-elegans. Gene Dev 18 (24):3004-3009. doi:10.1101/gad.1255404

Apfeld J, O'Connor G, McDonagh T, DiStefano PS, Curtis R (2004b) The AMP- activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C. elegans. Genes Dev 18 (24):3004-3009. doi:10.1101/gad.1255404

Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Birsoy K, Festuccia WT, Laplante M (2013) A comparative perspective on lipid storage in animals. J Cell Sci 126 (Pt 7):1541-1552. doi:10.1242/jcs.104992

Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37 (8):911-917. doi:10.1139/o59-099

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of omega-3 Polyunsaturated Fatty Acids in Obesity. Adv Nutr 10 (1):165-178. doi:10.1093/advances/nmy059

Brock TJ, Browse J, Watts JL (2006) Genetic regulation of unsaturated fatty acid composition in C. elegans. PLoS Genet 2 (7):e108. doi:10.1371/journal.pgen.0020108

C. Gómez Candela LM, López B, Kohen VL (2011) Importance of a balanced omega 6/omega 3 ratio for the maintenance of health. Nutritional recommendations Nutr Hosp 26 (2):323-329. doi:10.3305/nh.2011.26.2.5117

Carroll K, Gomez C, Shapiro L (2004) Tubby proteins: the plot thickens. Nat Rev Mol Cell Biol 5 (1):55-63. doi:10.1038/nrm1278

Chung K, Rivet CA, Kemp ML, Lu H (2011) Imaging single-cell signaling dynamics with a deterministic high-density single-cell trap array. Anal Chem 83 (18):7044–7052. doi:10.1021/ac2011153 180

Texas Tech University, Amal Bouyanfif, August 2019

Coleman DL, Eicher EM (1990) Fat (fat) and tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse. J Hered 81 (6):424-427

Collins JJ, Huang C, Hughes S, Kornfeld K (2008) The measurement and analysis of age-related changes in Caenorhabditis elegans. WormBook:1-21. doi:10.1895/wormbook.1.137.1

D'Erchia AM, Tullo A, Lefkimmiatis K, Saccone C, Sbisa E (2006) The fatty acid synthase gene is a conserved p53 family target from worm to human. Cell Cycle 5 (7):750-758. doi:10.4161/cc.5.7.2622

Deline ML, Vrablik TL, Watts JL (2013) Dietary supplementation of polyunsaturated fatty acids in Caenorhabditis elegans. J Vis Exp (81). doi:10.3791/50879

Gems D, Riddle DL (2000) Defining wild-type life span in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 55 (5):B215-219

Gerisch B, Rottiers V, Li D, Motola DL, Cummins CL, Lehrach H, Mangelsdorf DJ, Antebi A (2007) A bile acid-like steroid modulates Caenorhabditis elegans lifespan through nuclear receptor signaling. Proc Natl Acad Sci U S A 104 (12):5014-5019. doi:10.1073/pnas.0700847104

Gerisch B, Weitzel C, Kober-Eisermann C, Rottiers V, Antebi A (2001) A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev Cell 1 (6):841-851

Gonzalez-Periz A, Horrillo R, Ferre N, Gronert K, Dong B, Moran-Salvador E, Titos E, Martinez-Clemente M, Lopez-Parra M, Arroyo V, Claria J (2009) Obesity- induced insulin resistance and hepatic steatosis are alleviated by omega-3 fatty acids: a role for resolvins and protectins. FASEB J 23 (6):1946-1957. doi:10.1096/fj.08-125674

Halaschek-Wiener J, Khattra JS, McKay S, Pouzyrev A, Stott JM, Yang GS, Holt RA, Jones SJ, Marra MA, Brooks-Wilson AR, Riddle DL (2005) Analysis of long- lived C. elegans daf-2 mutants using serial analysis of gene expression. Genome Res 15 (5):603-615. doi:10.1101/gr.3274805

Harats D, Dabach Y, Hollander G, Ben-Naim M, Schwartz R, Berry EM, Stein O, Stein Y (1991) Fish oil ingestion in smokers and nonsmokers enhances peroxidation of plasma lipoproteins. Atherosclerosis 90 (2-3):127-139 HeleneAnderssona, Berg Ad (2003) Microfluidic devices for cellomics: a review. Sensors and Actuators B: Chemical 92 (3):315-325. doi:org/10.1016/S0925- 4005(03)00266-1

181

Texas Tech University, Amal Bouyanfif, August 2019

Henderson ST, Johnson TE (2001) daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr Biol 11 (24):1975-1980

Hillyard SL, German JB (2009) Quantitative lipid analysis and life span of the fat-3 mutant of Caenorhabditis elegans. J Agric Food Chem 57 (8):3389-3396. doi:10.1021/jf8031414

Hsu AL, Murphy CT, Kenyon C (2003) Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science 300 (5622):1142-1145. doi:10.1126/science.1083701

Huang C, Xiong C, Kornfeld K (2004) Measurements of age-related changes of physiological processes that predict lifespan of Caenorhabditis elegans. Proc Natl Acad Sci U S A 101 (21):8084-8089. doi:10.1073/pnas.0400848101

Hulbert AJ (2003) Life, death and membrane bilayers. J Exp Biol 206 (Pt 14):2303- 2311

Hulbert AJ, Rana T, Couture P (2002) The acyl composition of mammalian phospholipids: an allometric analysis. Comp Biochem Physiol B Biochem Mol Biol 132 (3):515-527

Inoki K, Zhu T, Guan KL (2003) TSC2 mediates cellular energy response to control cell growth and survival. Cell 115 (5):577-590

Jia BQ, Zhou JP, Zhang LN (2011) Electrospun nano-fiber mats containing cationic cellulose derivatives and poly (vinyl alcohol) with antibacterial activity. Carbohyd Res 346 (11):1337-1341. doi:DOI 10.1016/j.carres.2011.04.040

Jolly CA, Muthukumar A, Avula CP, Troyer D, Fernandes G (2001) Life span is prolonged in food-restricted autoimmune-prone (NZB x NZW)F(1) mice fed a diet enriched with (n-3) fatty acids. J Nutr 131 (10):2753-2760. doi:10.1093/jn/131.10.2753

Kaasgaard SG, Holmer G, Hoy CE, Behrens WA, Beare-Rogers JL (1992) Effects of dietary linseed oil and marine oil on lipid peroxidation in monkey liver in vivo and in vitro. Lipids 27 (10):740-745

Kalupahana NS, Claycombe K, Newman SJ, Stewart T, Siriwardhana N, Matthan N, Lichtenstein AH, Moustaid-Moussa N (2010) Eicosapentaenoic acid prevents and reverses insulin resistance in high-fat diet-induced obese mice via modulation of adipose tissue inflammation. J Nutr 140 (11):1915-1922. doi:10.3945/jn.110.125732

182

Texas Tech University, Amal Bouyanfif, August 2019

Kniazeva M, Sieber M, McCauley S, Zhang K, Watts JL, Han M (2003) Suppression of the ELO-2 FA elongation activity results in alterations of the fatty acid composition and multiple physiological defects, including abnormal ultradian rhythms, in Caenorhabditis elegans. Genetics 163 (1):159-169

Kromhout D, Yasuda S, Geleijnse JM, Shimokawa H (2012) Fish oil and omega-3 fatty acids in cardiovascular disease: do they really work? Eur Heart J 33 (4):436- 443. doi:10.1093/eurheartj/ehr362

Kwanghun Chung, Yoosik Kim, Jitendra S.Kanodia, Emily Gong, Stanislav Y. Shvartsman, Hang Lu (2011) A microfluidic array for large-scale ordering and orientation of embryos. Nat Methods 8 (2):171-176. doi:10.1038/nmeth.1548

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ (2015a) SREBP and MDT-15 protect C. elegans from glucose- induced accelerated aging by preventing accumulation of saturated fat. Genes Dev 29 (23):2490-2503. doi:10.1101/gad.266304.115

Lee J, Kwon G, Lim YH (2015b) Elucidating the Mechanism of Weissella-dependent Lifespan Extension in Caenorhabditis elegans. Sci Rep 5:17128. doi:10.1038/srep17128

Leung MC, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN (2008) Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicol Sci 106 (1):5-28. doi:10.1093/toxsci/kfn121

Liu LX, Spoerke JM, Mulligan EL, Chen J, Reardon B, Westlund B, Sun L, Abel K, Armstrong B, Hardiman G, King J, McCague L, Basson M, Clover R, Johnson CD (1999) High-throughput isolation of Caenorhabditis elegans deletion mutants. Genome Res 9 (9):859-867

Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging. Cell 153 (6):1194-1217. doi:10.1016/j.cell.2013.05.039

Ly K, Reid SJ, Snell RG (2015) Rapid RNA analysis of individual Caenorhabditis elegans. Methodsx 2:59-63. doi:10.1016/j.mex.2015.02.002

Meydani M, Natiello F, Goldin B, Free N, Woods M, Schaefer E, Blumberg JB, Gorbach SL (1991) Effect of long-term fish oil supplementation on vitamin E status and lipid peroxidation in women. J Nutr 121 (4):484-491. doi:10.1093/jn/121.4.484

183

Texas Tech University, Amal Bouyanfif, August 2019

Miret S, Saiz MP, Mitjavila MT (2003) Effects of fish oil- and olive oil-rich diets on iron metabolism and oxidative stress in the rat. Br J Nutr 89 (1):11-18. doi:10.1079/BJN2002737

Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2005) C-elegans tubby regulates life span and fat storage by two independent mechanisms. Cell Metab 2 (1):35-42. doi:10.1016/j.cmet.2005.06.004

Mullaney BC, Ashrafi K (2009) C. elegans fat storage and metabolic regulation. Biochim Biophys Acta 1791 (6):474-478. doi:10.1016/j.bbalip.2008.12.013

Napier JA, Michaelson LV (2001) Genomic and functional characterization of polyunsaturated fatty acid biosynthesis in Caenorhabditis elegans. Lipids 36 (8):761-766

Noben-Trauth K, Naggert JK, North MA, Nishina PM (1996) A candidate gene for the mouse mutation tubby. Nature 380 (6574):534-538. doi:10.1038/380534a0

Ntambi JM (1999) Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol. J Lipid Res 40 (9):1549-1558

Ohlemiller KK, Hughes RM, Mosinger-Ogilvie J, Speck JD, Grosof DH, Silverman MS (1995) Cochlear and retinal degeneration in the tubby mouse. Neuroreport 6 (6):845-849

Puglisi MJ, Hasty AH, Saraswathi V (2011) The role of adipose tissue in mediating the beneficial effects of dietary fish oil. Journal of Nutritional Biochemistry 22 (2):101-108. doi:10.1016/j.jnutbio.2010.07.003

Rahman M, Hewitt JE, Van-Bussel F, Edwards H, Blawzdziewicz J, Szewczyk NJ, Driscoll M, Vanapalli SA (2018) NemaFlex: a microfluidics-based technology for standardized measurement of muscular strength of C. elegans. Lab Chip 18 (15):2187-2201. doi:10.1039/c8lc00103k

Reisner K, Lehtonen M, Storvik M, Jantson T, Lakso M, Callaway JC, Wong G (2011) Trans fat diet causes decreased brood size and shortened lifespan in Caenorhabditis elegans delta-6-desaturase mutant fat-3. J Biochem Mol Toxicol 25 (5):269-279. doi:10.1002/jbt.20386

Scholey JM (2003) Intraflagellar transport. Annu Rev Cell Dev Biol 19:423-443. doi:10.1146/annurev.cellbio.19.111401.091318

184

Texas Tech University, Amal Bouyanfif, August 2019

Sheaffer KL, Updike DL, Mango SE (2008) The Target of Rapamycin pathway antagonizes pha-4/FoxA to control development and aging. Curr Biol 18 (18):1355-1364. doi:10.1016/j.cub.2008.07.097

Shmookler Reis RJ, Xu L, Lee H, Chae M, Thaden JJ, Bharill P, Tazearslan C, Siegel E, Alla R, Zimniak P, Ayyadevara S (2011) Modulation of lipid biosynthesis contributes to stress resistance and longevity of C. elegans mutants. Aging (Albany NY) 3 (2):125-147. doi:10.18632/aging.100275

Simopoulos AP (2010) Genetic variants in the metabolism of omega-6 and omega-3 fatty acids: their role in the determination of nutritional requirements and chronic disease risk. Exp Biol Med 235 (7):785-795. doi:10.1258/ebm.2010.009298

Srinivasan S, Sadegh L, Elle IC, Christensen AG, Faergeman NJ, Ashrafi K (2008) Serotonin regulates C. elegans fat and feeding through independent molecular mechanisms. Cell Metab 7 (6):533-544. doi:10.1016/j.cmet.2008.04.012

Stiernagle T (2006) Maintenance of C. elegans. WormBook:1-11. doi:10.1895/wormbook.1.101.1

Strong R, Miller RA, Antebi A, Astle CM, Bogue M, Denzel MS, Fernandez E, Flurkey K, Hamilton KL, Lamming DW, Javors MA, de Magalhaes JP, Martinez PA, McCord JM, Miller BF, Muller M, Nelson JF, Ndukum J, Rainger GE, Richardson A, Sabatini DM, Salmon AB, Simpkins JW, Steegenga WT, Nadon NL, Harrison DE (2016) Longer lifespan in male mice treated with a weakly estrogenic agonist, an antioxidant, an alpha-glucosidase inhibitor or a Nrf2- inducer. Aging Cell 15 (5):872-884. doi:10.1111/acel.12496

Sugawara S, Honma T, Ito J, Kijima R, Tsuduki T (2013) Fish oil changes the lifespan of Caenorhabditis elegans via lipid peroxidation. J Clin Biochem Nutr 52 (2):139-145. doi:10.3164/jcbn.12-88

Szewczyk NJ, Udranszky IA, Kozak E, Sunga J, Kim SK, Jacobson LA, Conley CA (2006) Delayed development and lifespan extension as features of metabolic lifestyle alteration in C. elegans under dietary restriction. J Exp Biol 209 (Pt 20):4129-4139. doi:10.1242/jeb.02492

Tsuduki T, Honma T, Nakagawa K, Ikeda I, Miyazawa T (2011) Long-term intake of fish oil increases oxidative stress and decreases lifespan in senescence- accelerated mice. Nutrition 27 (3):334-337. doi:10.1016/j.nut.2010.05.017 Van Gilst MR, Hadjivassiliou H, Yamamoto KR (2005) A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49. Proc Natl Acad Sci U S A 102 (38):13496-13501. doi:10.1073/pnas.0506234102

185

Texas Tech University, Amal Bouyanfif, August 2019

Wallis JG, Watts JL, Browse J (2002) Polyunsaturated fatty acid synthesis: what will they think of next? Trends Biochem Sci 27 (9):467

Wang Y, Seburn K, Bechtel L, Lee BY, Szatkiewicz JP, Nishina PM, Naggert JK (2006) Defective carbohydrate metabolism in mice homozygous for the tubby mutation. Physiol Genomics 27 (2):131-140. doi:10.1152/physiolgenomics.00239.2005

Watts JL (2009) Fat synthesis and adiposity regulation in Caenorhabditis elegans. Trends Endocrinol Metab 20 (2):58-65. doi:10.1016/j.tem.2008.11.002

Watts JL, Browse J (2002) Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99 (9):5854-5859. doi:10.1073/pnas.092064799

Watts JL, Phillips E, Griffing KR, Browse J (2003) Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163 (2):581-589

Williard DE, Nwankwo JO, Kaduce TL, Harmon SD, Irons M, Moser HW, Raymond GV, Spector AA (2001) Identification of a fatty acid delta6-desaturase deficiency in human skin fibroblasts. J Lipid Res 42 (4):501-508

Yanase S, Yasuda K, Ishii N (2002) Adaptive responses to oxidative damage in three mutants of Caenorhabditis elegans (age-1, mev-1 and daf-16) that affect life span. Mech Ageing Dev 123 (12):1579-1587

Zhou Y, Falck JR, Rothe M, Schunck WH, Menzel R (2015) Role of CYP eicosanoids in the regulation of pharyngeal pumping and food uptake in Caenorhabditis elegans. J Lipid Res 56 (11):2110-2123. doi:10.1194/jlr.M061887

186

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 5

Fourier Transform Infrared microspectroscopy detects biochemical changes during C. elegans lifespan

A. Bouyanfif a,b,c, S. Liyanagea, E. Hequeta, N. Moustaid-Moussaa,b,c, N. Abidia,* a Fiber and Biopolymer Research Institute, Department of Plant and Science, Texas Tech University Lubbock, TX, USA b Department of Nutritional Sciences, Texas Tech University Lubbock, TX, USA c Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

Disclaimer: The work presented in this chapter in its entirety, has been published in Vibrational Spectroscopy 102 (2019) 71-78, with only minor modifications the printed publication is located in the Appendix D.

5.1. Abstract

This study reports on the use of Fourier Transform Infrared (FTIR) microspectroscopy imaging to investigate biochemical changes occurring during C. elegans lifespan. C. elegans wild-type (N2) and the tub-1 mutant strain were cultured in agar plates. FTIR imaging was performed on single worms in transmission mode at day 8, 11, and 15. Principal component analysis was then performed to analyze the spectra acquired during C. elegans lifespan. The FTIR spectra were clustered in three groups corresponding to the spectra acquired from the worms at day 8, 11, and 15. The results showed major changes in lipids (vibration 1744 cm-1 assigned to C=O stretching) and proteins (vibrations 1648 cm-1 assigned to C=O stretching of amide I and 1548 cm- 1 assigned to N-H bending and C-N stretching in amid II). The vibration assigned to glycogen around 1155 cm-1 was present in the spectra acquired at day 8 and 11 but the peak area decreased by 49.3% and 73.3% in the spectra acquired at day 15 respectively from WT(N2) and tub-1 mutant strain. Furthermore, PC-1 loadings as a function of wavenumbers show that the presence of the vibration 1698 cm-1, attributed to antiparallel β-sheet, could indicate the formation of lipofuscin. The results obtained demonstrate that FTIR imaging could be used as a tool to monitor biochemical changes during lifespan studies, which could bring additional information to our understanding of longevity. 187

Texas Tech University, Amal Bouyanfif, August 2019

Key words: FTIR imaging, C. elegans, lifespan, protein carbonyl, glycogen, lipofuscin

5.2. Introduction The aging process is a universal and complex process that manifests itself within an organism at the cellular, genetic, organ, and molecular levels (Kregel and Zhang 2007). Aging is defined as the progressive accumulation of deleterious changes within cells and tissues, which results in decreased ability to survive and increased risk of disease development and death (Kregel and Zhang 2007; Harman 2001). Harman reported that the aging cycle (growth, decline, and death) is a direct function of the metabolic rate that depends on animal or plant species (Harman 1956). Several theories have been formulated to explain the aging process (Hughes and Reynolds 2005; Medawar 1952; Harman 1956; Harman 2001). These theories are divided into evolutionary and mechanistic theories of aging. The evolutionary theories such as the mutation accumulation theory (Charlesworth 2001); antagonist pleiotropy theory (Charlesworth 2001) and disposable soma theory (Hughes and Reynolds 2005) represent a general model of aging based on different assumptions related to patterns of age-specific mutations (Hughes and Reynolds 2005). However, the main mechanistic theory of aging is based on the free radicals accumulation theory and addresses the causes of senescence at the molecular level (Hughes and Reynolds 2005; Harman 2001; Cui et al. 2012). Harman first proposed that aging is the result of the action of reactive oxygen species (ROS) which results in cellular damage (Harman 1962; Harman 1956). Other theories include the mitochondrial decline theory of aging (Sun et al. 2016; Peng et al. 2014; Harman 1972; Beckman and Ames 1998), and the decline theory of Ubiquitin proteasomal system (Peng et al. 2014; Lee et al. 2009), and genetic theory of aging (Peng et al. 2014). Despite, a large body of investigations during the last few decades, no single theory has successfully explained the aging phenomenon. However, the prevalent theory in the current literature is based on the “free radical theory or oxidative stress theory” postulated by Harman (Harman 1956; Harman 1972). This theory postulates that reactive oxygen species contribute to the accumulation of oxidative damage to cellular components resulting in pathological conditions and

188

Texas Tech University, Amal Bouyanfif, August 2019 functional alterations, and ultimately death (Kregel and Zhang 2007; Hagen 2003). In animals, ROS occur mainly in the mitochondria, where more than 90% of the oxygen used by the cells is consumed (Hughes and Reynolds 2005; Perez-Campo et al. 1998). ROS are generated as either metabolites of normal aerobic metabolism from oxygen molecules, under stress and pathological conditions, or taken up from the environment. • • - • - ROS can include unstable oxygen radicals (O ), superoxide anion ( O2 ), peroxide ( O2

2 • - ), hydroxyl radical ( OH), hydroxyl ion (OH ), and hydrogen peroxide (H2O2). Accordingly, the oxidative stress is an excessive bioavailability of ROS, resulting from an imbalance between production and destruction of these reactive species which leads to progressive accumulation of oxidative damage with age, then progressive deterioration of several cellular functions (Kregel and Zhang 2007). Kregel and Zhang reported that lipids are highly sensitive to ROS oxidation because of the bis-allylic structures of polyunsaturated fatty acids (Kregel and Zhang 2007). As a result of the lipid peroxidation, an accumulation of many end-products such as malondialdehyde, 4-hydroxy-2-non-enol, and F2-isoprostanes occur in biological systems (Kregel and Zhang 2007). It results in functional changes such as alteration of the cellular membrane permeability (Schafer and Buettner 2000). Additionally, other macromolecules including proteins and nucleic acids (nuclear and mitochondrial) are prone to oxidative damage by ROS that leads to various oxidized residues affecting normal cellular functions and stimulating gene expression alterations (Kregel and Zhang 2007; Finkel 2001; van der Horst et al. 2004). These modifications can have a significant physiological impact on cell survival, senescence, and death pathways (Blumberg 2004; Kregel and Zhang 2007; Evans et al. 2004). C. elegans nematode has been successfully used in aging research because of its sufficient homology with mammals at molecular and genomic levels (Zhu et al. 2016). Because of its several unique features including simplicity and cost-effectiveness of maintenance in laboratory conditions, genetic manipulation, body transparency, well- characterized genome, short life cycle as well as small body size, C. elegans provides a versatile and suitable platform to dissect genetic and molecular mechanisms underlying aging (Bouyanfif et al. 2019). In addition, these characteristics are comparable to many 189

Texas Tech University, Amal Bouyanfif, August 2019 other model systems. This organism contains particularly numerous key components related to metabolism such as insulin-signaling pathway as well as oxidative stress network that make it a relevant system to improve our understanding of complex phenomena such as aging (Zhu et al. 2016). Although mammalian and nematode physiologies are significantly different, several signal transduction pathways are conserved in both C. elegans and humans (Leung et al. 2008). In this work, we report on the feasibility of using Fourier Transform Infrared microspectroscopy imaging to investigate biochemical changes occurring during the lifespan of C. elegans wild-type (N2) and mutant strain tub-1. FTIR imaging has been successfully used to study nematodes such as C. elegans and changes in biochemical composition when worms were subjected to different diets (Bouyanfif et al. 2018; Bouyanfif et al. 2017; Ami et al. 2004; Sheng et al. 2016). However, to the best of our knowledge, using FTIR imaging to investigate biochemical changes during C. elegans lifespan has not been reported.

5.3. Experimental

5.3.1. Materials

C. elegans wild-type (N2) and the mutant strain tub-1 (nr2044) were acquired from the Caenorhabditis Genetics Center (CGC, University of Minnesota, Minneapolis, MN, USA). Nematodes were initially cultured on nematode growth media (NGM) plates seeded with E. coli OP50 following the standard protocol procedure (Stiernagle 2006a, b).

5.3.2. Lifespan Assay in NGM plates

To perform C. elegans lifespan assay, it is important to have an age- synchronized population of worms, standard NGM plates, and 5-fluorodeoxyuridine (FUDR)-containing plates. To avoid transferring worms from plates to plates every few days to separate adult worms from growing larva, the chemotherapy drug FUDR that reduces egg production, prevents eggs from hatching and induces complete sterility was used (Mitchell et al. 1979). All materials coming in contact with worms were sterilized. 190

Texas Tech University, Amal Bouyanfif, August 2019

Plates were incubated at 20°C unless otherwise noted and were seeded with 200 µL of 100 mg/ml concentrated feeding E. coli (OP50) bacteria. Several agar chunks were transferred using sterilized metal spatula from plates containing gravid worm strains onto a fresh NGM plate without FUDR to allow worms to propagate and feed through all of the bacterial feed, then incubated for 48 hours at 20°C (Figure 5.1). After 2 days, approximately 20 reproductively active adult worms were picked and transferred to freshly seeded NGM plates without FUDR. Plates were incubated at 20°C for 3 to 6 hours to allow worms to lay eggs. In general, for wild type C. elegans this takes 3 to 4 hours while for the mutant strain tub-1 it takes 5 to 6 hours. Once adult worms were removed from the plates, to begin a synchronous population, plates were placed at 20°C for about 72 hours until eggs have hatched and worms have developed to the L4 larval stage. Lifespan is defined as the time spanned between the day of egg laying (time t = 0) and the day when the worms are scored as dead. On the third day, 10 adult worms were picked onto each seeded NGM/FUDR plates and 10 to 15 plates for each strain or condition being tested. To make FUDR-containing plates, 33 µL of 150 mM FUDR was added per 100 ml of normal NGM media. NGM/FUDR plates were kept at room temperature in the dark for 2 days before adding bacteria as previously described (Sutphin and Kaeberlein 2009). Seeded plates were kept on the bench overnight to allow bacteria culture to dry on the solid NGM before transferring worms. Animals were cultured at the desired temperature (20°C) and alive worms were collected every 3 days subsequently for lifespan study (will be published elsewhere). For this FTIR study, worms were collected at day 8, 11, and 15.

191

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.1: Study design of lifespan assay on solid media.

5.3.3. FTIR microspectroscopy analysis

Worms at different stages of growth were washed with distilled water five times and individual worms were mounted on BaF2 slides (PerkinElmer, MA, USA). BaF2 slides are transparent to IR radiation and will not absorb in the mid-IR. Worms on BaF2 slides were dried in a vacuum desiccator for 1 hour. FTIR Spotlight 400 equipped with a liquid nitrogen cooled 128x128 Mercury-Cadmium-Telluride (MCT) Focal Plane Array detector (Spotlight, PerkinElmer, MA, USA) was used to acquire IR images in transmittance mode. From each pixel (6.25 x 6.25 µm), 128 co-added spectra were recorded between 4000-1000 cm-1 with a 16 cm-1 (8 cm-1 data point interval) spectral resolution. Before acquiring spectra from the worm, a background spectrum was collected from an empty and clean area of the BaF2 slide and was automatically subtracted from each spectra. Point mode FTIR microspectroscopy was used with an aperture size set to 25 x 25 µm. Figure 5.2 shows the setup used to acquire the FTIR images from worms along their length (3 to 5 worms). Worms were approximately 1000 µm long and the acquisition time of a typical point mode images for a worm was around 20 min. Four to six data points were acquired from each worm along the length (separated by 50 µm).

192

Texas Tech University, Amal Bouyanfif, August 2019

BaF2 slides were cleaned with water, acetone, and dried after each experiment. Individual spectra acquired from WT(N2) and mutant strain tub-1 were subjected to baseline correction and normalization with respect to the total absorbance over the entire range from 4000 to 1000 cm-1 using Spectrum 10™ software (PerkinElmer, MA, USA). Principal component analysis and Hierarchical analysis were performed using Unscrambler® X 9.6 software (CAMO Software AS, Norway). Each spectrum (each data point in principal component analysis) represents 128 co-added spectra.

Figure 5.2: Image showing the location from which spectra were acquired.

5.4. Results and Discussion

Oxidative stress has been recognized as one of the major cause of aging (Kregel and Zhang 2007). ROS cause damage to biomacromolecules such as lipids, nucleic acids, and proteins (Kregel and Zhang 2007; Blumberg 2004). Lipids are the most sensitive to oxidation by ROS because of the bis-allylic structures of polyunsaturated fatty acids (Kregel and Zhang 2007). Lifespan studies using C. elegans have been mainly focused on scoring live animals as a function of time followed by determining the % survival and mean lifespan. In this study, we are interested in exploring the feasibility of using FTIR microspectroscopy to investigate the biochemical changes occurring during the lifespan of C. elegans WT(N2) and mutant strain tub-1 mutant strain. In this feasibility study, the FTIR spectra were acquired in transmission mode from the worms at day 8, 11, and 15. Figures 5.3 and 5.4 show representative spectra

193

Texas Tech University, Amal Bouyanfif, August 2019 collected from WT(N2) and tub-1 mutant strain at day 8, 11, and 15. Some differences exist between these spectra, which indicate that biochemical changes occur during C. elegans lifespan.

Figure 5.3: Representative FTIR spectra acquired in transmission mode from WT(N2) at day 8, 11, and 15.

Figure 5.4: Representative FTIR spectra acquired in transmission mode from tub-1 mutant strain at day 8, 11, and 15.

Region 3100-2800 cm-1: The vibrations observed in this region originate from the C-H bond stretching vibrations of lipids, fatty acids, and cholesterol esters (Holman et al. 2008; Bouyanfif et al. 2017). The vibration 3008 cm-1 is assigned to =C-H olefinic 194

Texas Tech University, Amal Bouyanfif, August 2019 stretch. The vibrations 2928 and 2848 cm-1 are assigned to asymmetric stretching and symmetric stretching respectively of the acyl –CH2 groups (Holman et al. 2008; Bouyanfif et al. 2017). Finally, the vibrations 2962 and 2874 cm-1 are assigned to C-H antisymmetric and symmetric stretching of methyl groups (Hobro and Lendl 2011). The intensity of the vibration 3008 cm-1 is relatively high in the spectrum of the WT(N2) at day 8 but decreases in the spectrum at day 11 and disappears from the spectrum at day 15. However, for the tub-1 mutant strain this vibration exists only as a small shoulder in the spectrum acquired from the worm at day 8 but is absent in the spectra acquired from worms at day 11 and 15. The absence of the vibration 3008 cm-1 could be attributed to potential peroxidation of the unsaturation of fatty acids as the worm ages. It was reported that the more polyunsaturated the fatty acid is the greater is its peroxidation susceptibility (Hulbert 2011). Shmookler et al. used gas chromatography/mass spectroscopy to analyze the fatty acid composition across ten C. elegans strains to investigate the contribution of lipid biosynthesis to stress resistance and longevity (Shmookler Reis et al. 2011). They reported that fatty acid chain length and susceptibility to oxidation both decreased sharply in the longest-lived mutants. When comparing fatty acids composition in the shortest-lived to the longest-lived strains, the results showed that the total monounsaturates increased from 34% to 48% while the total polyunsaturates decreased from 37% to 26% (Hulbert 2011; Shmookler Reis et al. 2011). Furthermore, it was reported that in polyunsaturated fatty acids, the carbons located between double bonds are vulnerable to peroxidation while saturated and monostaurated chains are several hundredfold less susceptible (Shmookler Reis et al. 2011).

Region 1800-1700 cm-1: The vibration 1744 cm-1 is assigned to C=O stretching, which could originate either from fatty acid triglycerides, phospholipids, or cholesterol esters (Bouyanfif et al. 2017). The intensity of this vibration is very high in the spectrum of WT(N2) as compared to the tub-1 mutant strain (Figure 5.4). A decrease is observed in the intensity of this vibration at day 11 and 15 for both WT(N2) and tub-1. The area of the peak 1744 cm-1 was calculated for both strains (Figure 5.5). The results showed that

195

Texas Tech University, Amal Bouyanfif, August 2019 for WT(N2) the area of the peak decreased by 44.5% and 42.33% in the spectra acquired at day 11 and 15 while for tub-1 the area increased by 35.7% at day 11 and decreased by 65.5% in the spectra acquired at day 15. The decrease in the intensity of 1744 cm-1 indicates the occurrence of oxidative decomposition of fatty acids, which can, in turn, initiates a chain reaction leading to the formation of a variety of carbonyl species (Suzuki et al. 2010).

Figure 5.5: Area of the vibration 1744 cm-1 in the spectra acquired in transmission mode from WT(N2) and tub-1 at day 8, 11 and 15. Values show the mean and the vertical bars denote 0.95 confidence intervals. Values not followed by the same letter are significantly different with α=5% (according to Newman-Keuls tests).

Region 1700-1000 cm-1: The vibration 1648 cm-1 is assigned to C=O stretching of amide I in proteins (mainly α-helix components of proteins) (Hobro and Lendl 2011; Bouyanfif et al. 2017). For WT(N2), the intensity of this vibration increases between day 8 and day 11 (by 59.7%) but decreases at day 15 (Figure 5.6). However, for the tub-1 mutant, the intensity increases by 32.1% from day 8 to day 15. Therefore, the increase in the intensity of this vibration could indicate an increase in protein carbonyl groups, which are the results of protein oxidation caused by ROS (Suzuki et al. 2010). Dalle-Donne et al. reviewed the relationships between high level of protein C=O groups and oxidative stress (Dalle-Donne et al. 2003). Carbonyl groups are created on the 196

Texas Tech University, Amal Bouyanfif, August 2019 proteins side chains or generated within the structure of the macromolecules via oxidative cleavage of the proteins (Dalle-Donne et al. 2003). C=O groups could also be introduced into the structures of proteins through nucleophilic side chains of Cysteine, Histidine, and Lysine residues with aldehydes (4-hydroxy-2-nonenal, malondialdheyde, 2-propenal [acrolein]) generated during peroxidation of lipids (Dalle-Donne et al. 2003). Yasuda et al. measured the accumulation of protein carbonyl in daf-2, daf-2;daf- 12, and daf-2;daf-16 mutants (Yasuda et al. 1999). It was indicated that protein carbonyl represents a good indicator of oxidative damage during aging (Yasuda et al. 1999; Adachi et al. 1998). Indeed, it was found that because of the oxidative stress, the accumulation of protein carbonyl in wild-type increased with age (Yasuda et al. 1999; Adachi et al. 1998). Furthermore, short-lived mev-1 mutant was reported to accumulate protein carbonyl at a faster rate while long-lived age-1 mutant accumulated protein carbonyl at a much slower rate compared to the wild-type (Adachi et al. 1998). Therefore, this vibration could be used to monitor protein carbonyl accumulation and oxidative stress in future studies. The vibration 1648 cm-1 is accompanied by the vibration around 1632 cm-1 (which is assigned to the carbonyl stretching in amid I – β- pleated sheet components of proteins) (Hobro and Lendl 2011). This vibration appears as a shoulder in the spectra of WT(N2) and tub-1.

197

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.6: Area of the vibration 1648 cm-1 in the spectra acquired in transmission mode from WT(N2) and tub-1at day 8, 11 and 15. Values show the mean and the vertical bars denote 0.95 confidence intervals. Values not followed by the same letter are significantly different with α=5% (according to Newman-Keuls tests).

The vibration around 1548 cm-1 is assigned to amid II (N-H bending and C-N stretching of protein amid groups). The intensity of this vibration increases by 105.3% from day 8 to day 11 in the spectra of WT(N2) while in the spectra of tub-1 it increases by 29.1% at day 11 and by 77.2% at day 15 (Figure 5.7).

Figure 5.7: Area of the vibration 1548 cm-1 in the spectra acquired in transmission mode from WT(N2) tub-1 at day 8, 11 and 15. Values show the mean and the vertical bars denote 0.95 confidence intervals. Values not followed by the same letter are significantly different with α=5% (according to Newman-Keuls tests). 198

Texas Tech University, Amal Bouyanfif, August 2019

-1 The vibration around 1456 cm is assigned to CH2 bending and deformation of methylene and could originate from lipids, proteins or cholesterol esters. For both strains, the areas of the peak decrease from day 8 to 15. The vibration 1392 cm-1 is assigned to COO- stretching of carbohydrates, fatty acids, or amino acid side chains. A decrease is observed from day 11 to 15. The vibration around 1232 cm-1 is assigned to - -1 PO2 antisymmetric stretching of phosphodiesters while the vibration ~1084 cm is - assigned to PO2 symmetric stretching of phosphodiesters. The intensities of both vibrations decrease from day 8 to 15, which may indicate a possible impact on DNA as well. The vibration ~1155 cm-1 is assigned to C-O stretching mode and could originate from glycogen (Vongsvivut et al. 2013). It is important to point out that this vibration exists as a sharp peak in the spectra acquired from worms at day 8, decreases in the spectra at day 11 and is present only as a small shoulder in the spectra acquired at day 15 (Figure 5.8). The area of the peak decreased by 47.8% and 55.4% in the spectra acquired from WT(N2) and tub-1 at day 15 respectively. Glycogen is generally produced as a result of glucose surplus (Gusarov et al. 2017). The fact that the intensity of 1155 cm-1 decreases to only a small peak at day 15 may indicate that the glycogen that was stored at day 8 for future use is consumed as early as day 11. It would be interesting to investigate the changes in this vibration if the worms were raised with a high glucose diet. We anticipate that the intensity would increase with increasing amount of glucose.

199

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.8: Area of the vibrations 1155 cm-1 in the spectra acquired from WT(N2) and mutant strain tub-1 at day 8, 11 and 15. Values show the mean and the vertical bars denote 0.95 confidence intervals. Values not followed by the same letter are significantly different with α=5% (according to Newman-Keuls tests).

Figure 5.9 shows the principal component analysis of the FTIR spectra acquired from WT(N2) at day 8, 11, and 15. The FTIR spectra are clearly separated into 3 groups corresponding to day 8, 11 and 15. PC-1 accounts for 64% of the observed variation while PC-2 accounts for 21%, and PC-3 for 6%. The separation of the FTIR spectra into three groups associated with day 8, 11, and 15 indicates that some biochemical changes are occurring during the lifespan of WT(N2).

200

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.9: Principal component analysis scores of the FTIR spectra acquired from WT(N2) at day 8, 11, and 15 separate the spectra into 3 groups. Each data point represents a spectrum obatined from 128-co-added spectra.

PC scores could be interpreted in terms of differences in chemical composition when plotted as function of wavenumbers. PC-1 loadings plotted in Figure 5.10 show peaks at 3008, 2883, 2855, 1744, 1698, 1594, and 1495 cm-1. PC-2 loadings plot shows peaks at 3008, 2944, 2883, 1744, 1654, 1594, 1542, 1478, 1432, 1362, and 1155 cm-1. PC-3 loadings plot shows peaks at 3008, 2915, 2855, 1744, 1478, and 1155 cm-1.

Figure 5.10: PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for WT(N2). 201

Texas Tech University, Amal Bouyanfif, August 2019

Hierarchical cluster analysis (HCA) was performed using a combination of squared Euclidean distance measure criterion and Ward’s algorithm with three clusters (Figure 5.11). The dendrogram reveals that the spectra acquired from WT(N2) are clustered into 3 groups corresponding to spectra acquired at day 8, 11, and 15. Similar to PCA, HCA confirms that biochemical differences occur during different stages of the worm lifespan and those changes are detected by FTIR as discussed above.

Figure 5.11: Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the FTIR spectra acquired from WT(N2) at day 8, 11, and 15.

Figure 5.12 shows the PCA scores of the FTIR spectra acquired from the mutant strain tub-1 at day 8, 11 and 15. Similar to the results obtained on WT(N2), the FTIR spectra are separated into 3 groups: the first group of spectra acquired at day 8, the second group of spectra acquired at day 11, and the third group of spectra acquired at day 15. PC-1 accounts for 75% of variance while PC-2 and PC-3 account for 13% and 4% respectively.

202

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.12: Principal component analysis scores of the FTIR spectra acquired from tub-1 mutant strain at day 8, 11, and 15. Each data point represents a spectrum obatined from 128-co-added spectra.

The plots of PC-1, PC-2, and PC-3 loadings as a function of wavenumbers (Figure 5.13) show major peaks which originate from fatty acids and lipids (peaks at 2928, 2854, and 1744 cm-1), proteins (peaks at 1692, 1592, 1466 cm-1), and glycogen (peak at 1155 cm-1). A small contribution is noticed at 3008 cm-1, which is assigned to olefinic groups of unsaturated fatty acids. It should be pointed out that the contribution of 3008 cm-1 in the spectra acquired from the tub-1 mutant strain is very small compared to that in the spectra acquired from WT(N2) (Figure 7). This confirms that lipids in WT(N2) are rich in unsaturated fatty acids compared to those in tub-1.

203

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.13: PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for mutant strain tub-1.

Figure 5.14 shows the HCA dendrogram of the FTIR spectra. Again, three clusters of FTIR spectra are observed corresponding to the spectra acquired at day 8, 11, and 15, confirming the PCA results. We can conclude that biochemical changes are occurring during different stages of C. elegans lifespan, which lead to aging and ultimately to death.

204

Texas Tech University, Amal Bouyanfif, August 2019

Figure 5.14: Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the FTIR spectra acquired from tub-1 mutant strain at day 8, 11, and 15.

PC loadings as function of wavenumbers indicate that the major changes in chemical composition during the lifespan (8 to 15 days) of WT(N2) and tub-1 reside in unsaturated fatty acids, lipids, proteins, and glycogen. It is important to notice the PC-1 loadings at 1698 cm-1. The vibration 1698 cm-1 has been attributed to antiparallel β- sheet/aggregated strands (Cai et al. 2016; Vongsvivut et al. 2013). The antiparallel β- sheets have been observed in many amyloid fibril samples (Zandomeneghi et al. 2004; Shivu et al. 2013). Amyloid deposits are common in several amyloid diseases (Alzheimer, Parkinson, and Huntington diseases) (Shivu et al. 2013). Furthermore, Cai et al. reported that lipofuscin, formed during lipid peroxidation and sugar glycosylation by carbonyl-amino crosslinks with biomacromolecules, is rich in amyloidogenic β-sheet with antiparallel structure (Cai et al. 2016). Therefore, the vibration 1698 cm-1 could indicate the formation of lipofuscin during aging of C. elegans. This could be extremely interesting to use in future studies as a fingerprint to screen bioactive compounds, which could prevent the conversion of β-sheet from parallel to antiparallel structure. Cai et al. used FTIR to investigate the effects of green tea polyphenol epigallocatechin gallate 205

Texas Tech University, Amal Bouyanfif, August 2019

(EGCG) on lipofuscin formation (Cai et al. 2016). EGCG has been reported to inhibit the formation of lipofuscin by neutralizing the carbonyl-amino crosslinking reactions (Cai et al. 2011). The authors showed that the major components in the spectrum of Human Serum Albumin sample and the artificial lipofuscin treated with EGCG was centered around 1658 cm-1 (assigned to α-helix). However, in the artificial lipofuscin sample the major components were centered around 1625-1640 cm-1 assigned to β-sheet parallel structure and around 1675-1695 cm-1 (assigned to antiparallel β- sheet/aggregated strands structure) (Cai et al. 2016). Another explanation of the vibration 1698 cm-1 could be related to the work of Vongsvivut et al. (Vongsvivut et al. 2013). The authors reported on the use of FTIR for rapid screening and monitoring of polyunsaturated fatty acid production in marine yeast and protists (Vongsvivut et al. 2013). The authors noted with interest a sharp peak around 1695 cm-1 in the spectra of thraustochytrids. The authors indicated that, because thraustochytrium cells are rich in polyunsaturated fatty acids, this vibration is likely due to C=O stretching modes of isoprostanes as well as α,β-unsaturated aldehydes and ketones, which are the end products of spontaneous lipid peroxidation through a free radical mechanism. Whether this vibration is due to β-sheet in antiparallel structure or to the products of fatty acids peroxidation, its presence indicates that biochemical changes occur, which can further lead to damage to cells and other tissues and organs. The vibration 1495 cm-1 has been assigned to asymmetric bending of the N- methyl group (N-CH3), which has been assigned to choline (Oleszko et al. 2015). The presence of this vibration may indicate that lipids in C. elegans have undergone a peroxidation during their lifespan. Indeed, Oleszko et al. used FTIR to determine the extent of lipid peroxidation in plasma during Haemodialysis (Oleszko et al. 2015). The authors indicated that lipids and proteins contained in plasma are exposed to ROS leading to their peroxidation. The FTIR spectrum of extracted plasma lipids showed a vibration at 1495 cm-1. This initial investigation opens the doors for further studies to demonstrate the usefulness of FTIR microspectroscopy as a tool to complement the already established

206

Texas Tech University, Amal Bouyanfif, August 2019 arsenal of techniques to advance our understanding of the aging process. Furthermore, when combining C. elegans model and FTIR imaging important investigations on intact worms can be easily carried out with no sample preparation.

5.5. Conclusions

C. elegans, a millimeter-long transparent round-worm, is being used as a model organism for various studies including lipid storage and metabolism, inflammation, drug discovery, and obesity research. Furthermore, it has been reported that C. elegans is an important model microorganism for conducting aging research not only because of its short lifespan (3 to 4 weeks) but also growing conditions and mutations have been reported to significantly alter its lifespan. Aging is defined as the consequence of accumulation of changes (such as biochemical changes) in cells and tissues with advancing age leading to higher risk of diseases and ultimately death. In this study, we attempted to use Fourier Infrared microspectroscopy imaging to investigate biochemical changes during C. elegans lifespan. FTIR imaging has been used to detect biochemical changes in C. elegans when the diet was modified, but to the best of our knowledge, it has not been used to monitor biochemical changes in C. elegans during its lifespan. The results showed that lipids and proteins are affected to varying degrees. The results obtained tend to demonstrate that FTIR imaging could be used as a nondestructive technique to advance our understanding of the biochemical mechanisms that control aging. This study will be conducted during the lifespan of the worms from the L4 stage all the way to the time when the worms are scored dead and will be complemented by other studies such as gene expression and chromatographic analysis.

Conflicts of interest There are no conflicts to declare.

Acknowledgements The authors would like to thank Dr. S.A. Vanapalli group for supplying C. elegans strains, which were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440) and

207

Texas Tech University, Amal Bouyanfif, August 2019 for their help in performing lifespan study. The research was supported by the Fiber and Biopolymer Research Institute.

208

Texas Tech University, Amal Bouyanfif, August 2019

5.6. References Adachi H, Fujiwara Y, Ishii N (1998) Effects of oxygen on protein carbonyl and aging in Caenorhabditis elegans mutants with long (age-1) and short (mev-1) life spans. J Gerontol a-Biol 53 (4):B240-B244. doi:DOI 10.1093/gerona/53A.4.B240

Ami D, Natalello A, Zullini A, Doglia SM (2004) Fourier transform infrared microspectroscopy as a new tool for nematode studies. FEBS Lett 576 (3):297- 300. doi:10.1016/j.febslet.2004.09.022

Beckman KB, Ames BN (1998) Mitochondrial aging: open questions. Ann N Y Acad Sci 854:118-127

Blumberg J (2004) Use of biomarkers of oxidative stress in research studies. J Nutr 134 (11):3188S-3189S. doi:10.1093/jn/134.11.3188S

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of omega-3 Polyunsaturated Fatty Acids in Obesity. Adv Nutr 10 (1):165-178. doi:10.1093/advances/nmy059

Bouyanfif A, Liyanage S, Hequet E, Moustaid-Moussa N, Abidi N (2018) Review of FTIR microspectroscopy applications to investigate biochemical changes in C. elegans. Vib Spectrosc 96:74-82. doi:10.1016/j.vibspec.2018.03.001

Bouyanfif A, Liyanage S, Hewitt JE, Vanapalli SA, Moustaid-Moussa N, Hequet E, Abidi N (2017) FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains. Analyst 142 (24):4727-4736. doi:10.1039/c7an01432e

Cai SX, Huang JA, Wang LL, Dong XR, Gong YS, Li J, Li Q, Liu ZH, Luo GA (2011) Inhibiting effects of epigallocatechin gallate (EGCG) on the formation of age pigment in vitro and in vivo. J Med Plants Res 5 (23):5470-5478

Cai SX, Yang H, Zeng KW, Zhang J, Zhong N, Wang YZ, Ye J, Tu PF, Liu ZH (2016) EGCG Inhibited Lipofuscin Formation Based on Intercepting Amyloidogenic beta-Sheet-Rich Structure Conversion. Plos One 11 (3). doi:ARTN e0152064 10.1371/journal.pone.0152064

Charlesworth B (2001) Patterns of age-specific means and genetic variances of mortality rates predicted by the mutation-accumulation theory of ageing. J Theor Biol 210 (1):47-65. doi:10.1006/jtbi.2001.2296

209

Texas Tech University, Amal Bouyanfif, August 2019

Cui H, Kong Y, Zhang H (2012) Oxidative stress, mitochondrial dysfunction, and aging. J Signal Transduct 2012:646354. doi:10.1155/2012/646354

Dalle-Donne I, Rossi R, Giustarini D, Milzani A, Colombo R (2003) Protein carbonyl groups as biomarkers of oxidative stress. Clin Chim Acta 329 (1-2):23-38

Evans MD, Dizdaroglu M, Cooke MS (2004) Oxidative DNA damage and disease: induction, repair and significance. Mutat Res 567 (1):1-61. doi:10.1016/j.mrrev.2003.11.001

Finkel T (2001) Reactive oxygen species and signal transduction. IUBMB Life 52 (1- 2):3-6. doi:10.1080/15216540252774694

Gusarov I, Pani B, Gautier L, Smolentseva O, Eremina S, Shamovsky I, Katkova- Zhukotskaya O, Mironov A, Nudler E (2017) Glycogen controls Caenorhabditis elegans lifespan and resistance to oxidative stress. Nature Communications 8. doi:ARTN 15868 10.1038/ncomms15868

Hagen TM (2003) Oxidative stress, redox imbalance, and the aging process. Antioxid Redox Signal 5 (5):503-506. doi:10.1089/152308603770310149

Harman D (1956) Aging: a theory based on free radical and radiation chemistry. Gerontol 11,:298‐300

Harman D (1962) Role of free radicals in mutation, cancer, aging, and the maintenance of life. Radiat Res 16:753-763

Harman D (1972) Free radical theory of aging: dietary implications. Am J Clin Nutr 25 (8):839-843. doi:10.1093/ajcn/25.8.839

Harman D (2001) Aging: overview. Ann N Y Acad Sci 928:1-21

Hobro AJ, Lendl B (2011) Fourier-transform mid-infrared FPA imaging of a complex multicellular nematode. Vib Spectrosc 57 (2):213-219

Holman HY, Bjornstad KA, Martin MC, McKinney WR, Blakely EA, Blankenberg FG (2008) Mid-infrared reflectivity of experimental atheromas. J Biomed Opt 13 (3):030503. doi:10.1117/1.2937469

Hughes KA, Reynolds RM (2005) Evolutionary and mechanistic theories of aging. Annu Rev Entomol 50:421-445. doi:10.1146/annurev.ento.50.071803.130409

Hulbert AJ (2011) Longevity, lipids and C. elegans. Aging-Us 3 (2):81-82. doi:DOI 10.18632/aging.100288

210

Texas Tech University, Amal Bouyanfif, August 2019

Kregel KC, Zhang HJ (2007) An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am J Physiol Regul Integr Comp Physiol 292 (1):R18-36. doi:10.1152/ajpregu.00327.2006

Lee SJ, Murphy CT, Kenyon C (2009) Glucose Shortens the Life Span of C. elegans by Downregulating DAF-16/FOXO Activity and Aquaporin Gene Expression. Cell Metabolism 10 (5):379-391. doi:10.1016/j.cmet.2009.10.003

Leung MC, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN (2008) Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicol Sci 106 (1):5-28. doi:10.1093/toxsci/kfn121

Medawar PB (1952) An unsolved problem of biology: an inaugural lecture delivered at University College, London, 6 December, 1951. HK Lewis and Co, London

Mitchell DH, Stiles JW, Santelli J, Rao SD (1979) Synchronous Growth and Aging of Caenorhabditis-Elegans in the Presence of Fluorodeoxyuridine. Journals of Gerontology 34 (1):28-36. doi:DOI 10.1093/geronj/34.1.28

Oleszko A, Olsztynska-Janus S, Walski T, Grzeszczuk-Kuc K, Bujok J, Galecka K, Czerski A, Witkiewicz W, Komorowska M (2015) Application of FTIR-ATR Spectroscopy to Determine the Extent of Lipid Peroxidation in Plasma during Haemodialysis. Biomed Res Int 2015:245607. doi:10.1155/2015/245607

Peng Y, Yu S, Li H, Xiang H, Peng J, Jiang S (2014) MicroRNAs: emerging roles in adipogenesis and obesity. Cell Signal 26 (9):1888-1896. doi:10.1016/j.cellsig.2014.05.006

Perez-Campo R, Lopez-Torres M, Cadenas S, Rojas C, Barja G (1998) The rate of free radical production as a determinant of the rate of aging: evidence from the comparative approach. J Comp Physiol B 168 (3):149-158

Schafer FQ, Buettner GR (2000) Acidic pH amplifies iron-mediated lipid peroxidation in cells. Free Radic Biol Med 28 (8):1175-1181

Sheng M, Gorzsas A, Tuck S (2016) Fourier transform infrared microspectroscopy for the analysis of the biochemical composition of C. elegans worms. Worm 5 (1):e1132978. doi:10.1080/21624054.2015.1132978

Shivu B, Seshadri S, Li J, Oberg KA, Uversky VN, Fink AL (2013) Distinct beta-Sheet Structure in Protein Aggregates Determined by ATR-FTIR Spectroscopy. Biochemistry 52 (31):5176-5183. doi:10.1021/bi400625v

211

Texas Tech University, Amal Bouyanfif, August 2019

Shmookler Reis RJ, Xu L, Lee H, Chae M, Thaden JJ, Bharill P, Tazearslan C, Siegel E, Alla R, Zimniak P, Ayyadevara S (2011) Modulation of lipid biosynthesis contributes to stress resistance and longevity of C. elegans mutants. Aging (Albany NY) 3 (2):125-147. doi:10.18632/aging.100275

Stiernagle T (2006a) Maintenance of C. elegans. WormBook:1-11. doi:10.1895/wormbook.1.101.1

Stiernagle T (2006b) Maintenance of C. elegans. WormMethods 51–67. doi:/10.1895/wormbook.1.101.1

Sun N, Youle RJ, Finkel T (2016) The Mitochondrial Basis of Aging. Mol Cell 61 (5):654-666. doi:10.1016/j.molcel.2016.01.028

Sutphin GL, Kaeberlein M (2009) Measuring Caenorhabditis elegans life span on solid media. J Vis Exp (27). doi:10.3791/1152

Suzuki YJ, Carini M, Butterfield DA (2010) Protein carbonylation. Antioxid Redox Signal 12 (3):323-325. doi:10.1089/ars.2009.2887 van der Horst A, Tertoolen LG, de Vries-Smits LM, Frye RA, Medema RH, Burgering BM (2004) FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 279 (28):28873-28879. doi:10.1074/jbc.M401138200

Vongsvivut J, Heraud P, Gupta A, Puri M, McNaughton D, Barrow CJ (2013) FTIR microspectroscopy for rapid screening and monitoring of polyunsaturated fatty acid production in commercially valuable marine yeasts and protists. Analyst 138 (20):6016-6031. doi:10.1039/c3an00485f

Yasuda K, Adachi H, Fujiwara Y, Ishii N (1999) Protein carbonyl accumulation in aging Dauer formation-defective (daf) mutants of Caenorhabditis elegans. J Gerontol a-Biol 54 (2):B47-B51. doi:DOI 10.1093/gerona/54.2.B47

Zandomeneghi G, Krebs MRH, Mccammon MG, Fandrich M (2004) FTIR reveals structural differences between native beta-sheet proteins and amyloid fibrils. Protein Sci 13 (12):3314-3321. doi:10.1110/ps.041024904

Zhu G, Yin F, Wang L, Wei W, Jiang L, Qin J (2016) Modeling type 2 diabetes-like hyperglycemia in C. elegans on a microdevice. Integr Biol (Camb) 8 (1):30-38. doi:10.1039/c5ib00243e

212

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 6

FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains

A. Bouyanfif,a,b,c S. Liyanage,a,c J.E. Hewitt,c,d S.A. Vanapalli,c,d N. Moustaid- Moussa,a,b,c E. Hequet,a N. Abidi*a,c a. Department of Plant and Soil Science, Fiber and Biopolymer Research Inst. b. Department of Nutritional Sciences c. Obesity Research Cluster d. Department of Chemical Engineering

Disclaimer: The work presented in this chapter in its entirety, has been published in Analyst 142 (2017) 4727-4736, with only minor modifications. The printed publication is located in the Appendix E.

6.1. Abstract

This study focuses on the use of Fourier Transform Infrared (FTIR) microspectroscopy to determine chemical changes induced in the nematode Caenorhabditis elegans by supplementation of C. elegans maintenance media (CeMM) by Eicosapentaenoic acid (EPA). Wild-type C. elegans (N2) and mutant strains (tub-1 and fat-3) were grown in CeMM alone, and CeMM supplemented with EPA at 25 or 100 µM. Feeding was performed for 72 hrs. FTIR imaging was performed in transmission mode on individual worms. The FTIR imaging analysis of wild-type animals revealed the presence of vibrations assigned to unsaturated fatty acids, specifically bands at 3008 cm-1 (=C-H, olefinic stretch) and 1744 cm-1 (C=O, unsaturated fatty acids). It confirmed previously reported synthesis of unsaturated fatty acids in wild-type C. elegans. For the FTIR spectra of mutant strains, these vibrations were absent or present only as very small shoulder, which indicates that tub-1 and fat-3 synthesize essentially saturated fatty acids as indicated by the presence of -CH2 and C=O vibrations. These results are in agreement with previous studies which reported that these mutants have altered lipid compositions. Principal component analysis showed differences in chemical composition between wild-type and mutant strains as well as between mutant strains cultured in normal CeMM and those cultured in CeMM

213

Texas Tech University, Amal Bouyanfif, August 2019 supplemented with EPA. This study demonstrated the usefulness of FTIR microspectroscopy to investigate fat metabolism in C. elegans.

6.2. Introduction

Obesity is a disease of multifactorial etiology (Ashrafi 2007). Its pathogenesis is influenced by diet, physical activity, age, environmental, and genetic factors. Due to an imbalance between pro-inflammatory vs. anti-inflammatory signaling and free radical production vs. antioxidant factors produced, obesity is associated with chronic low-grade inflammation and oxidative stress. It has been reported that omega-3 polyunsaturated fatty acids (ω-3 PUFAs) reduce obesity-associated inflammation and dyslipidemia. When supplemented with diet, ω-3 PUFA eicosapentaenoic acid (EPA) prevented and reversed hepatic steatosis, glucose intolerance, insulin resistance, and reduced adipose and systemic markers of inflammation and oxidative stress in mice fed a high-fat diet (Kalupahana et al. 2010). Omega-3 fatty acids are also potent anti- inflammatory dietary compounds. Omega-3 fatty acids or n-3 fatty acids are a key family of polyunsaturated fatty acids with a double bond at the third carbon atom from the methyl moiety of the carbon chain (Watts 2016). Also known as essential fatty acids (EFAs), omega-3 fatty acids are needed by the body for a number of functions and are important for normal metabolism and good health. However, mammals, including humans, are unable to synthesize omega-3 fatty acids de novo because of the lack of endogenous enzymes delta-12 desaturase and delta-15 desaturase for ω-3 unsaturation. Therefore, mammals must get these fatty acids from the diet (Simopoulos 2010). Studies of effects of omega-3 fatty acids in mammals, especially in humans, present several challenges including difficulty to manipulate and/or control intake of these fatty acids from the diet. The nematode Caenorhabditis elegans is an excellent model for such studies, as the wild-type (WT) naturally makes these long chain fatty acids. Furthermore, various mutant strains lacking specific PUFA synthesis enzymes are already available. Moreover, due to easy culturing of this organism, varying amounts and types of PUFAs can be added to the diets and compared to the WT strain, which synthesizes very long chain PUFAs such as EPA.

214

Texas Tech University, Amal Bouyanfif, August 2019

The possibility of using C. elegans as a model organism for evaluating lipid metabolism, inflammation, and oxidative stress in obesity-related studies has created the need for analytical techniques that can be used to determine the chemical composition on small and intact samples. Fourier Transform Infrared (FTIR) microspectroscopy is a non-destructive technique for the study of various materials including biological samples (Baker et al. 2014; Dorling and Baker 2013; Miller et al. 2013). It provides information on the presence of chemical species as well as their distribution within a sample. The IR spectrum of a material is made of absorption peaks, which represent frequencies of vibrations between bonds of the molecules making up the material. Because different materials have a unique combination of molecules, they exhibit different IR signatures. Thus, the IR spectra provide a unique chemical fingerprint of the samples. FTIR microspectroscopy imaging has been used previously as a tool to study C. elegans and their chemical composition (Ami et al. 2012; Ami et al. 2004; Diomede et al. 2010; Sheng et al. 2016). The absorption of infrared radiation and its interaction with the vibrational modes of the atoms and chemical bonds led to useful information related to the chemical composition of the microorganism. Ami et al. reported on the use of FTIR microspectroscopy to study dried but intact C. elegans nematode (Ami et al. 2004). It was the first reported FTIR investigation on a complex whole nematode. The use of the IR microscope allowed the authors to acquire IR spectra from different areas of a single worm: pharynx, intestine, and tail areas. It was reported that because of the difference in the FTIR spectra between the pharynx, intestinal, and tail regions, the absorption spectra from the pharyngeal areas could be used to distinguish between different nematode species. According to the authors, amide I and amide II protein bands, assigned to the vibrational modes of the backbone amine bonds, were of particular interest because, as reported previously, the stretching mode of the C=O is sensitive to the protein secondary structures (Tamm and Tatulian 1997). The analysis of amide I indicated that different regions of the worms are composed of different proteins. Furthermore, it was concluded that collagen was the principal component of the tail (Ami et al. 2004). 215

Texas Tech University, Amal Bouyanfif, August 2019

Recently, Sheng et al. reported on the use of FTIR microspectroscopy for the analysis of the biochemical composition of C. elegans worms (Sheng et al. 2016). The authors’ justification for the use of this technique was that the traditional biochemical techniques for chemical composition analysis require relatively large amounts of materials. The authors demonstrated that FTIR could be used to detect changes in the relative levels of carbohydrates, proteins, and lipids on one single worm (Sheng et al. 2016). The IR results indicated that the relative intensities of the lipid-associated bands (2800-3000 cm-1) were higher for the daf-2 mutant intestines compared to those of the WT. The authors indicated that the results obtained from IR imaging are consistent with gas-liquid chromatography and that the daf-2 mutant contains higher levels of triglycerides than WT. Furthermore, vibrations in the range 1140-1180 cm-1, assigned to polysaccharides, showed high intensities in daf-2 mutant compared to N2 WT (Sheng et al. 2016). The authors attributed this to the rate at which polysaccharides are synthesized from sugars or the rate at which polysaccharides are broken down. FTIR was also used to investigate the role of trehalose sugar to preserve native membrane lipid packing during extreme desiccation followed by rehydration of dauer larva of C. elegans (Erkut et al. 2011). The results showed that desiccation and rehydration led to changes in the FTIR spectra. The authors concluded that the major effect of trehalose on membranes during desiccation is to preserve the native packing of lipids (Erkut et al. 2011). These previous works using FTIR analysis on C. elegans have laid the foundation for further analyses on chemical composition of C. elegans under different conditions. In this work, we report on the use of FTIR microspectroscopy to investigate the chemical composition of wild-type (N2) C. elegans and mutant strains (tub-1 and fat-3) when cultured in bacteria-free C. elegans maintenance media (CeMM) both without supplementation and supplemented with EPA at different concentrations. FTIR images were acquired in transmission mode on single worms. Through this work we have demonstrated that FTIR microspectroscopy can be used as a tool to study the effects of diets on the chemical composition of intact worms.

216

Texas Tech University, Amal Bouyanfif, August 2019

6.3. Experimental

6.3.1. Materials

Hermaphrodite adult WT(N2) and mutant strains, tub-1(nr2044) and fat- 3(wa22), were acquired from the Caenorhabditis Genetics Center (CGC, University of Minnesota, Minneapolis, MN, USA). Worms were initially cultured on NGM (nematode growth media) plates seeded with E. coli OP50 following standard protocols. Plates containing a large quantity of eggs and gravid adults were then bleached, and eggs were left overnight to hatch in sterile M9 Buffer. Starved L1 animals were then transferred the following day to CeMM (Cell Guidance Systems, Babraham, Cambridge, UK) containing 20 µg/mL kanamycin sulfate (Fisher Scientific) and 200 µg/mL streptomycin sulfate (Fisher Scientific), as reported previously (Szewczyk et al. 2006). All C. elegans strains were then cultured at 20◦C in axenic CeMM for multiple generations to allow the worms to adapt to the media before use in experiments (Szewczyk et al. 2003). Eicosapentaenoic acid (EPA) was purchased from Nu-Check Prep (Elysian, MN, USA). It was supplied as omega-3 ethyl esters. The mass spectroscopy analysis showed that it was composed of 91.9% of EPA and 2.1% of DHA (Docosahexanoic acid), and other fatty acids accounting for the remaining composition. Because EPA is sensitive to heat, light, and oxygen, care was taken to minimize exposure to these sources to prevent degradation by storing it at -80oC. EPA solutions in ethanol with different concentrations were prepared. CeMM was supplemented with these EPA solutions at final concentrations of 25 and 100 µM, and feeding was performed for 72 hours on worm cultures of mixed ages.

6.3.2. FTIR microspectroscopy

C. elegans were washed with distilled water five times and individual

Hermaphrodite adult worms were mounted on BaF2 slides (PerkinElmer, MA, USA), which are transparent to IR radiation. Samples were then dried in a vacuum desiccator for 1 h. Images were collected using an FTIR microspectroscope equipped with a liquid

217

Texas Tech University, Amal Bouyanfif, August 2019 nitrogen cooled 128x128 Mercury-Cadmium-Telluride (MCT) Focal Plane Array detector (Spotlight, PerkinElmer, MA, USA) in transmittance mode. One hundred twenty eight co-added spectra between 4000-1000 cm-1 were collected from each pixel (6.25 x 6.25 µm) with a spectral resolution of 16 cm-1 (8 cm-1 data point interval). The acquisition time of a typical image for a worm was around 3 h (worms were approximately 1000 µm long). A background spectrum, which is automatically subtracted from spectral data, was collected from an empty area of the slide. BaF2 slides were systematically cleaned with water followed by acetone after collecting images. In order to acquire a large number of spectra and perform principal component analysis, point mode FTIR microspectroscopy was used (Line scans). In this case, the aperture size was set to 15 x 15 µm. Line scan images were collected from the middle part of worms along their length (8 worms from each treatment). The acquisition time of typical line scan images was around 20 min. Six to eight data points were acquired from each worm (separated by 50 µm) (Figure 6.1). This generated between 48 and 64 FTIR spectra. It should be pointed out that the spectra extracted from images acquired using imaging mode are exactly similar to those acquired using point mode (data not shown). This indicates that using point mode to speed up image acquisition did not result in loss of information.

Figure 6.1: Visual image showing the location form which spectra were acquired.

6.3.3. Spectroscopic data analysis

After acquiring IR images of the whole worms, individual spectra were extracted from the images of WT(N2), tub-1, and fat-3 worms specifically from three different areas of the worms: head, middle, and tail. All spectra were baseline corrected and normalized using Spectrum 10™ software (PerkinElmer, MA, USA). Each infrared 218

Texas Tech University, Amal Bouyanfif, August 2019 vibration in the spectra was assigned to a chemical functional group. Spectra were extracted also from each line scan images using the Spectrum Image software. The spectra were baseline corrected and normalized (with respect to the total absorbance over the entire range from 4000 to 650 cm-1). Then principal component analysis was performed using Unscrambler® X 9.6 software (CAMO Software AS, Norway).

6.4. Results and Discussion

6.4.1. Wild-type cultured in CeMM without supplementation

WT C. elegans were cultured in CeMM without supplementation and FTIR images were collected from the region of interest (ROI). The acquired IR spectra contain information on the chemical composition from the ROI, which in our case was either the head, middle, or tail region of the worms. Figures 6.2 a-b shows a visual image of a WT worm and the corresponding IR image acquired in transmission mode. The extracted IR spectra from the head, middle, and tail regions indicated by the squares on the IR map are shown in Figure 6c. Table S1 summarizes the main vibrations along with their functional group assignments.

219

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.2: FTIR detects differences in functional groups distribution in different regions of WT C. elegans: (a) visual image. (b) corresponding IR image. The red color indicates higher concentration of functional groups while the purple color indicates low concentration. The distribution of colors indicates changes in the distribution of the chemical composition. (c) extracted IR spectra from head, middle, and tail regions of WT C. elegans showing that FTIR can detect differences in chemical composition in different regions of the worm.

220

Texas Tech University, Amal Bouyanfif, August 2019

The FTIR spectra extracted from the head, middle, and tail regions of WT animals indicate differences in functional group distribution. The major differences are in the vibrations 3008 cm-1 (assigned to –CH=CH- stretching), 2928 and 2848 cm-1 (asymmetric and symmetric C-H stretching respectively), and 1744 cm-1 (C=O stretching). The integrated intensities of these vibrations were calculated (Figures 6.3- 6.5), and the integrated intensity of 3008 cm-1 is 340% higher in the middle region compared to the tail and head regions. This clearly indicates that unsaturated fatty acyl groups are present mainly in the middle region. Furthermore, the integrated intensity of both 2928 and 2848 cm-1 is 136% higher and that of 1744 cm-1 is 218% higher in the middle region than in the head and tail regions. These results indicate that saturated acyl groups are stored mainly in the intestine regions along with unsaturated fatty acids. It has been reported that C. elegans stores fat mainly in droplets within the hypodermal and intestinal cells (Ashrafi 2007; O'Rourke et al. 2009). In these studies, fat storage in C. elegans has been quantified by measuring the intensity of staining by lipid-binding dyes (such as Nile Red, Oil Red O, and Sudan Black) (Ashrafi et al. 2003; Yen et al. 2010) or by microscopy techniques such as Coherent Anti-Stokes Raman Scattering (CARS) and Stimulated Raman Scattering (SRS) (Zheng and Greenway 2012).

221

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.3: Integrated intensity of the vibration 3008 cm-1 associated with unsaturated fatty acids present in the head, middle, and tail regions of WT(N2) (variance ratio (2, 9)=11.883, p=0.00298, vertical bars denote 0.95 confidence intervals).

Figure 6.4: Integrated intensity of the vibrations 2928 and 2855 cm-1 associated with lipids present in the head, middle, and tail regions of WT(N2) (variance ratio (2, 9)=12.875, p=0.00229, vertical bars denote 0.95 confidence intervals).

222

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.5: Integrated intensity of the vibration 1744 cm-1 associated with fatty acids, triglycerides, phospholipids, or esters present in the head, middle, and tail regions of WT(N2) (variance ratio (2, 9)=3.2760, p=0.08532, vertical bars denote 0.95 confidence intervals).

6.4.2. WT, tub-1, and fat-3 cultured in CeMM without supplementation

The above results confirmed previous studies which reported that the middle region is the main storage region for lipids and fats in wild-type animals. Because the objective of this study is to investigate the application of FTIR microspectroscopy to study fat storage in wild-type and mutant strains C. elegans, we focused on the middle part of the worm (which contains the intestines). We then proceeded with looking at the FTIR spectra of mutant strains tub-1 and fat-3 in addition to wild type (Figure 6.6).

223

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.6: FTIR spectra of WT, tub-1, and fat-3 C. elegans acquired from the middle region. Worms were cultured in CeMM without supplementation.

Vibration 3280 cm-1: this vibration, assigned to N-H stretching in amide A, originates from proteins (San-Blas et al. 2011). The intensity of this vibration is high in mutant strains, which indicates that high ratio of proteins/fats is present in mutant strains compared to WT. Vibration 3008 cm-1: the presence in the spectra of WT of an additional vibration at 3008 cm-1 (which is assigned to =CH- stretch of olefin (Holman et al. 2008)) is very important to distinguish between WT and mutant strains tub-1 and fat-3. This vibration originates from unsaturated fatty acids contained in the middle region of WT. This vibration is absent from the spectra of the mutant strains, indicating that mutant strains have lipid distribution different from those of wild type. Vibrations 2928 and 2848 cm-1: the C-H bonds absorb IR between 2800 and 3000 cm- 1 -1 . Two vibrations are noticed, 2928 cm is assigned to asymmetric -CH2 stretching -1 while the vibration 2848 cm is assigned to symmetric -CH2 stretching.

224

Texas Tech University, Amal Bouyanfif, August 2019

Vibration 1744 cm-1: the vibration 1744 cm-1 (C=O stretch) originates from fatty acids triglycerides, phospholipids, or cholesterol esters. The integrated intensity of this vibration was calculated from the spectra of the worms. The results show relatively higher triglycerides content in fat-3 as compared to WT and tub-1. Vibration 1648 cm-1: this vibration (mainly from C=O stretching) is assigned to amide I in proteins (α-helix components of proteins (Barth 2007)). It is interesting to notice that in fat-3, the intensity of this vibration is low compared to WT and tub-1. This could indicate that the relative amounts of all proteins is lower since there is more lipids in fat-3. Vibration 1536 cm-1: this vibration originates from amide II (N-H bending and C-N stretching of proteins amide groups (Hobro and Lendl 2011)). It was reported also that amino acid side chains (such as arginine, aspartate, glutamate, and tyrosine) or N-H groups from nucleotides could contribute to this vibration (Hobro and Lendl 2011). The intensity of this vibration is low in the case of fat-3. -1 Vibration 1456 cm : this vibration, assigned to -CH2 bending and deformation, could originate from lipids, proteins, or cholesterol esters. Vibration 1392 cm-1: this vibration is attributed to COO- symmetric stretching and could originate from carbohydrates, fatty acids, and amino acid side chains. -1 - Vibration 1232 cm : this vibration is assigned to PO2 antisymmetric stretching of phospholipids, nucleic acids, or phosphorylated proteins. Vibration 1152 cm-1: this vibration is assigned to C-O stretching. It could originate from glycogen or mucin. It is interesting to notice that this vibration is only present as very small shoulder in the IR spectra of WT while it is an intense band in the spectra of mutant strains tub-1 and fat-3. -1 - Vibration 1088 cm : this vibration is assigned to PO2 symmetric stretching of phosphodiesters. It could originate from nucleic acid (DNA and RNA), phospholipids, and glycolipids. Several research groups have reported the biochemical composition of the fat content in C. elegans (Ashrafi 2007; Kniazeva et al. 2003; Satouchi et al. 1993; Watts and Browse 2002). Column chromatography, thin-layer chromatography, and gas 225

Texas Tech University, Amal Bouyanfif, August 2019 chromatography/mass spectroscopy were used in some of these studies. Ashrafi reported that triacylglyceride fats make up about 40 to 55 % of total lipids (Ashrafi 2006), and phospholipids are composed of about 55% ethanolamine glycerophospholipid, 32% choline glycerophospholipid, and 8% sphingomyelin (Ashrafi 2007). We collected several spectra from the middle of each worm and several worms from each strain. All spectra were normalized and baseline corrected according to the established procedure. Principal Component Analysis (PCA) was performed on the FTIR spectra in order to identify distinct groups of spectra (Abidi et al. 2014). This technique is widely used to reduce the dimensionality of the data from thousands of variables (wavenumbers) in the original spectra to a fewer number of dimensions. The variability in each spectrum relative to the mean of the population can be represented as a smaller set of values (axes) termed principal components (PCs). The effect of this process is to concentrate the sources of variability in the data into the first 2 or 3 PCs (PC-1, PC-2, and PC-3). Plots of PC-1 against PC-2 can reveal clustering in the FTIR spectra. Figures 6.7-6.9 shows the PCA of FTIR spectra of WT vs. tub-1, WT vs. fat-3, and tub-1 vs. fat-3. For WT vs. tub-1, PC-1 accounts for 76% of the variance, and it clearly separates the FTIR spectra into two groups: one for WT and one for tub-1 (Figure 6.7). A larger variability is noticed in the IR spectra of the tub-1 mutant strain compared to WT. For WT vs. fat-3, PC-1 accounts for 81% of the variance, and it separates the FTIR spectra into two groups: one group of WT and one group of fat-3 (Figure 6.8). Again, a larger variability is noticed in the IR spectra of the fat-3 mutant strain compared to WT. The discrimination between WT and the mutant strains indicates that differences in chemical composition between WT and mutant strains do exist. For tub-1 vs. fat-3, only few spectra of fat-3 can be separated from tub-1. Overall, IR spectra of tub-1 are similar to those of fat-3 (Figure 6.9).

226

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.7: Principal Component Analysis of FTIR spectra separates WT from mutant strain tub-1.

Figure 6.8: Principal Component Analysis of FTIR spectra separates WT from mutant strain fat-3.

227

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.9: Principal Component Analysis of FTIR spectra of mutant strains tub-1 vs. fat-3. The discrimination between the IR spectra of WT and the mutant strains tub-1 and fat-3 may be due to differences in the chemical composition in the worm middle region. We attempted to interpret each PC scores in terms of differences in chemical composition. For tub-1, PC-1 scores show peaks at 3280, 2928, 1744, 1648, 1536, 1456, 1232, and 1152 cm-1, which are characteristic of wavenumbers corresponding to proteins, lipids, phosphorylated lipids, and mucin (glycogen). PC-2 scores show peaks at 2928, 2848, 1696, 1616, 1520 and 1392 cm-1, which correspond to lipids and proteins. PC-3 scores (which explains 4% of variability) show also peaks characteristic of fatty acids (bands 3008, 2960, 2928, and 2884 cm-1) and lipids (band 1744 cm-1). A small peak is noticed at 3008 cm-1, which corresponds to =CH- of unsaturated fatty acids. Other peaks are also noticed at 1664, 1472, 1392, 1232, and 1120 cm-1. For fat-3, PC-1 scores show peaks at 3280 cm-1 (vibration assigned to proteins), 3008 cm-1 (vibration assigned to unsaturated fatty acids), 2928 and 2855 cm-1 (vibrations assigned to lipids), 1744 cm-1 (vibration assigned to triglycerides, phospholipids, and fatty acids), 1648 cm-1 and 1536 cm-1 (vibrations assigned to proteins), and 1456 cm-1 (vibration assigned to lipids and proteins). PC-2 scores show also peaks at vibrations characteristic of lipids and proteins. PC-3 scores show important peaks at characteristic vibrations of unsaturated fatty acids and lipids.

228

Texas Tech University, Amal Bouyanfif, August 2019

To obtain additional information on the spectral differences between WT and mutant strains, we performed digital subtraction of the mutant strains spectra from WT spectra (Figures 6.10 and 6.11). The major vibrations in the difference spectra are attributed to unsaturated fatty acids, lipids, and proteins (bands 3008, 2928, 2848, 1744, and 1648 cm-1). It is worth pointing out that the intensity of the vibration 3008 cm-1 is high in the difference spectrum between WT and tub-1, while it is only a very small shoulder in the difference spectrum between WT and fat-3. Furthermore, the vibration 1648 cm-1 exists only as a small shoulder in the difference spectrum between WT and tub-1 while it is a sharp band in the difference spectrum between WT and fat-3.

Figure 6.10: Difference spectrum obtained by digital subtraction of tub-1 spectrum from the WT spectrum.

Figure 6.11: Difference spectrum obtained by digital subtraction of fat-3 spectrum from the WT spectrum. 229

Texas Tech University, Amal Bouyanfif, August 2019

The above IR results indicate that the major difference between WT and mutant strains tub-1 (Figure 6.8) and fat-3 (Figure 6.8) are unsaturated and saturated lipids. Previous research reported that WT C. elegans can synthesize a wide range of saturated, monosaturated, and polysaturated fatty acids (including arachidonic acid (20:4 n-6), eicosapentaenoic acid (20:5n-3), and monoethyl branched chain fatty acids) (Satouchi et al. 1993; Watts and Browse 2002). However, the mutant strain tub-1 is reported to exhibit increased fat accumulation (Ashrafi 2007), while fat-3 mutants were reported to lack ∆6 fatty acids and are deficient in C20 fatty acids (fatty acids C20:4n6, C20:4n3, and C20:5n3 are not detectable but high levels of 18:1n7, 18:2n6, and C8:3n3 are present) (Watts and Browse 2002).

6.4.3. Worms cultured in CeMM supplemented with EPA

CeMM was supplemented with different concentrations of EPA (25 or 100 µM). FTIR was performed as described above. The objective was to investigate the chemical changes and relative levels of carbohydrates, proteins, and lipids induced by supplementing the growth media with unsaturated fatty acids using FTIR microspectroscopy. We believe that FTIR can be a valuable tool to add to the current techniques used for metabolic research of C. elegans. The FTIR spectra were collected from several individuals (8 worms and 6 to 8 spectra from each worm) from the middle region of the worms. All spectra were normalized and baseline corrected. It was followed by principal component analysis. Wild type (N2): Figure 6.12 shows the PCA of the spectra of WT cultured in CeMM without supplementation and WT cultured in media supplemented with EPA at 25 or 100 µM. PC-1 accounts for 57% of the variance and clearly separates the FTIR spectra into two groups: one group for WT and one group for WT when cultured in media supplemented with fatty acids. PC-2 accounts for 22% of the variance and PC-3 for 6% (data not shown). A larger variability is observed in the IR spectra of WT cultured in the fatty acids supplemented media. The separation of IR spectra into two distinct groups indicates that supplementing the media with fatty acids induced 230

Texas Tech University, Amal Bouyanfif, August 2019 biochemical changes. Although we discriminate between WT cultured in CeMM without supplementation and WT cultured in media supplemented with EPA, there is no difference between supplementing with 25 or 100 µM. PC-1, PC-2 and PC-3 scores as function of wavenumbers show peaks at vibrations corresponding to lipids and proteins.

Figure 6.12: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. WT cultured in CeMM supplemented with 25 or 100 µM of EPA.

Mutant strain tub-1: Figure 6.13 shows the PCA of FTIR spectra of the mutant strain tub-1 cultured in CeMM without supplementation and in CeMM supplemented with 25 or 100 µM of EPA. PC-1 accounts for 63%, PC-2 accounts for 17%, and PC-3 accounts for 6% of the variance (data not shown). The FTIR spectra are clearly separated into three groups: one group for tub-1 cultured in CeMM without supplementation, one group for tub-1 cultured in CeMM supplemented with fatty acids at 25 µM, and one group for tub-1 cultured in CeMM supplemented with 100 µM of EPA. It is of interest to note that both PC-1 and PC-2 are needed to separate the treatments into three groups.

231

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.13: Principal Component Analysis of FTIR spectra: tub-1 cultured in CeMM without supplementation vs. tub-1 cultured in CeMM supplemented with 25 or 100 µM of EPA.

Figure 6.14 shows the PCA of the FTIR spectra of WT cultured in CeMM without supplementation and the mutant strain tub-1 cultured in CeMM supplemented with 25 or 100 µM EPA. PC-1 accounts for 76% of the variance and separates the FTIR spectra into two groups: one group of spectra for tub-1 cultured in CeMM supplemented with 25 µM of EPA and the second group is composed of the spectra of WT cultured in CeMM (no supplementation) and tub-1 cultured in CeMM supplemented with 100 µM of EPA. It is interesting to notice that the spectra of tub-1 with 100 µM are similar to the spectra of WT. These results indicate that supplementing the media with 100 µM of PUFAs makes the mutant strains tub-1 (which lack Tubby-1 protein activity) behave as the wild type (which is able to make PUFAs).

232

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.14: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. tub-1 cultured in CeMM supplemented with 25 or 100 µM of EPA.

Mutant strain fat-3: Figure 6.15 shows the PCA of the FTIR spectra of fat-3 cultured in CeMM with and without EPA supplementation. The spectra of fat-3 cultured in CeMM supplemented with 25 or 100 µM EPA can be separated from those of the same mutant strain cultured in CeMM without supplementation. There is no separation in the spectra when supplementing with 25 or 100 µM.

Figure 6.15: Principal Component Analysis of FTIR spectra: fat-3 cultured in CeMM without supplementation vs. fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA.

233

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.16 shows the PCA spectra of WT cultured in CeMM without supplementation and the mutant strain fat-3 cultured in CeMM supplemented with 25 or 100 µM. PC-1 accounts for 79% of the variance and separates the spectra of WT from the spectra of fat-3 cultured in CeMM supplemented with EPA. We can observe that supplementing the media with 25 or 100 µM leads to similar spectra. We can discriminate between WT and the mutant strain fat-3 but not between the mutant strain subjected to different feedings. Contrary to the results obtained on tub-1, it appears that supplementing the media with 100 µM of PUFAs does not make the mutant strain fat-3 behave as the WT.

Figure 6.16: Principal Component Analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA.

As shown in Figure 6.17, the PCA of the FTIR spectra of mutant strains tub-1 and fat-3 cultured in CeMM supplemented with 25 µM or 100 µM indicates that PC-1 (69% of the variance) separates the IR spectra of tub-1 cultured in CeMM supplemented with 100 µM EPA from tub-1 cultured in media supplemented with 25 µM and fat-3 animals cultured in media supplemented with 25 µM or 100 µM EPA.

234

Texas Tech University, Amal Bouyanfif, August 2019

Figure 6.17: Principal Component Analysis of FTIR spectra of mutant strains tub-1 and fat-3 cultured in CeMM supplemented with 25 or 100 µM of EPA.

6.5. Conclusions

The FTIR microspectroscopy imaging analysis of WT revealed the presence of vibrations assigned to unsaturated fatty acids specifically the bands at 3008 cm-1 (assigned to =C-H from olefinic stretch) and 1744 cm-1 (assigned C=O from unsaturated fatty acids). This confirmed previous studies which reported the presence of unsaturated fatty acids in the wild-type of C. elegans. However, the IR spectra of the mutant strains (tub-1 and fat-3) did not show the presence of the vibration 3008 cm-1 or it appeared as only a small shoulder. The major contribution came from saturated fatty acids as indicated by the -CH2 and C=O vibrations. This confirmed that tub-1 and fat-3 do not synthesize considerable amount of PUFAs. Principal component analysis clearly discriminated between wild-type and mutant strains cultured in CeMM with or without supplementation with EPA. PC-1, PC-2, and PC-3 scores as a function of wavenumbers showed peaks that are characteristics of unsaturated fatty acids, lipids, and proteins. Furthermore, digital subtraction of mutant strains spectra from WT spectra showed that the major vibrations in the difference spectra are attributed to unsaturated fatty acids, lipids, and proteins (bands 3008, 2928, 2848, 1744, and 1648 cm-1). This study further demonstrates the usefulness of Fourier Transform Infrared microspectroscopy to study

235

Texas Tech University, Amal Bouyanfif, August 2019 differences in chemical composition between wild-type and mutant C. elegans strains as well as to investigate fat metabolism and the impact of fatty acids when used as supplement in worms feeding media. The results obtained could be complemented by other studies such as targeted gene expression and biochemical analyses.

Conflicts of interest There are no conflicts to declare.

Acknowledgements Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). The research was supported in part by NASA Grant # NNX15AL16G (SV), USDA NIFA AFRI #2015-67030-23452 (NMM, SV), the Obesity Research Cluster (NA, NMM), Texas Tech Transdisciplinary Research Academy (NMM, SV), and the Fiber and Biopolymer Research Institute (NA, EH).

236

Texas Tech University, Amal Bouyanfif, August 2019

6.6. References Abidi N, Cabrales L, Haigler CH (2014) Changes in the cell wall and cellulose content of developing cotton fibers investigated by FTIR spectroscopy. Carbohyd Polym 100:9-16. doi:10.1016/j.carbpol.2013.01.074

Ami D, Natalello A, Doglia SM (2012) Fourier transform infrared microspectroscopy of complex biological systems: from intact cells to whole organisms. Methods Mol Biol 895:85-100. doi:10.1007/978-1-61779-927-3_7

Ami D, Natalello A, Zullini A, Doglia SM (2004) Fourier transform infrared microspectroscopy as a new tool for nematode studies. FEBS Lett 576 (3):297- 300. doi:10.1016/j.febslet.2004.09.022

Ashrafi K (2006) Mapping out starvation responses. Elsevier Inc 3 (4):235–236. doi:http://dx.doi.org/10.1016/j.cmet.2006.03.002

Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Baker MJ, Trevisan J, Bassan P, Bhargava R, Butler HJ, Dorling KM, Fielden PR, Fogarty SW, Fullwood NJ, Heys KA, Hughes C, Lasch P, Martin-Hirsch PL, Obinaju B, Sockalingum GD, Sule-Suso J, Strong RJ, Walsh MJ, Wood BR, Gardner P, Martin FL (2014) Using Fourier transform IR spectroscopy to analyze biological materials. Nat Protoc 9 (8):1771-1791. doi:10.1038/nprot.2014.110

Barth A (2007) Infrared spectroscopy of proteins. Biochim Biophys Acta 1767 (9):1073-1101. doi:10.1016/j.bbabio.2007.06.004

Diomede L, Cassata G, Fiordaliso F, Salio M, Ami D, Natalello A, Doglia SM, De Luigi A, Salmona M (2010) Tetracycline and its analogues protect Caenorhabditis elegans from beta amyloid-induced toxicity by targeting oligomers. Neurobiol Dis 40 (2):424-431. doi:10.1016/j.nbd.2010.07.002

Dorling KM, Baker MJ (2013) Rapid FTIR chemical imaging: highlighting FPA detectors. Trends Biotechnol 31 (8):437-438. doi:10.1016/j.tibtech.2013.05.008

Erkut C, Penkov S, Khesbak H, Vorkel D, Verbavatz JM, Fahmy K, Kurzchalia TV (2011) Trehalose renders the dauer larva of Caenorhabditis elegans resistant to

237

Texas Tech University, Amal Bouyanfif, August 2019

extreme desiccation. Curr Biol 21 (15):1331-1336. doi:10.1016/j.cub.2011.06.064

Hobro AJ, Lendl B (2011) Fourier-transform mid-infrared FPA imaging of a complex multicellular nematode. Vib Spectrosc 57 (2):213-219

Holman HY, Bjornstad KA, Martin MC, McKinney WR, Blakely EA, Blankenberg FG (2008) Mid-infrared reflectivity of experimental atheromas. J Biomed Opt 13 (3):030503. doi:10.1117/1.2937469

Kalupahana NS, Claycombe K, Newman SJ, Stewart T, Siriwardhana N, Matthan N, Lichtenstein AH, Moustaid-Moussa N (2010) Eicosapentaenoic Acid Prevents and Reverses Insulin Resistance in High-Fat Diet-Induced Obese Mice via Modulation of Adipose Tissue Inflammation. Journal of Nutrition 140 (11):1915-1922. doi:10.3945/jn.110.125732

Kniazeva M, Sieber M, McCauley S, Zhang K, Watts JL, Han M (2003) Suppression of the ELO-2 FA elongation activity results in alterations of the fatty acid composition and multiple physiological defects, including abnormal ultradian rhythms, in Caenorhabditis elegans. Genetics 163 (1):159–169

Miller LM, Bourassa MW, Smith RJ (2013) FTIR spectroscopic imaging of protein aggregation in living cells. Bba-Biomembranes 1828 (10):2339-2346. doi:10.1016/j.bbamem.2013.01.014

O'Rourke EJ, Soukas AA, Carr CE, Ruvkun G (2009) C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab 10 (5):430- 435. doi:10.1016/j.cmet.2009.10.002

San-Blas E, Guerra M, Portillo E, Esteves I, Cubillan N, Alvarado Y (2011) ATR/FTIR characterization of Steinernema glaseri and Heterorhabditis indica. Vib Spectrosc 57 (2):220-228. doi:10.1016/j.vibspec.2011.07.008

Satouchi K, Hirano K, Sakaguchi M, Takehara H, Matsuura F (1993) Phospholipids from the free-living nematode Caenorhabditis elegans. Lipids 28 (9):837-840

Sheng M, Gorzsas A, Tuck S (2016) Fourier transform infrared microspectroscopy for the analysis of the biochemical composition of C. elegans worms. Worm 5 (1):e1132978. doi:10.1080/21624054.2015.1132978

Simopoulos AP (2010) Genetic variants in the metabolism of omega-6 and omega-3 fatty acids: their role in the determination of nutritional requirements and chronic disease risk. Exp Biol Med 235 (7):785-795. doi:10.1258/ebm.2010.009298

238

Texas Tech University, Amal Bouyanfif, August 2019

Szewczyk NJ, Kozak E, Conley CA (2003) Chemically defined medium and Caenorhabditis elegans. BMC Biotechnol 3:19. doi:10.1186/1472-6750-3-19

Szewczyk NJ, Udranszky IA, Kozak E, Sunga J, Kim SK, Jacobson LA, Conley CA (2006) Delayed development and lifespan extension as features of metabolic lifestyle alteration in C. elegans under dietary restriction. J Exp Biol 209 (Pt 20):4129-4139. doi:10.1242/jeb.02492

Tamm LK, Tatulian SA (1997) Infrared spectroscopy of proteins and peptides in lipid bilayers. Q Rev Biophys 30 (4):365-429. doi:Doi 10.1017/S0033583597003375

Watts JL (2016) Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids. J Clin Med 5 (2). doi:10.3390/jcm5020019

Watts JL, Browse J (2002) Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99 (9):5854-5859. doi:10.1073/pnas.092064799

Yen K, Le TT, Bansal A, Narasimhan SD, Cheng JX, Tissenbaum HA (2010) A comparative study of fat storage quantitation in nematode Caenorhabditis elegans using label and label-free methods. PLoS One 5 (9). doi:10.1371/journal.pone.0012810

Zheng J, Greenway FL (2012) Caenorhabditis elegans as a model for obesity research. Int J Obes (Lond) 36 (2):186-194. doi:10.1038/ijo.2011.93

239

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 7

FTIR microspectroscopy reveals fatty acid-induced biochemical changes in C. elegans

A. Bouyanfif a,b,c, S. Liyanagea, E. Hequeta, N. Moustaid-Moussaa,b,c, N. Abidia,c* a Fiber and Biopolymer Research Institute, Texas Tech University Lubbock, TX, USA b Department of Nutritional Sciences, Texas Tech University Lubbock, TX, USA c Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

Disclaimer: The work presented in this chapter in its entirety, has been published in Vibrational Spectroscopy 102 (2019) 8-15, with only minor modifications. The printed publication is located in the Appendix F.

7.1. Abstract Fourier transform infrared microspectroscopy (FTIR) was used to monitor biochemical changes in C. elegans nematodes cultured in nematode maintenance media (CeMM) without supplementation and with supplementation with either a long chain polyunsatured omega 3 fatty acid, eicosapentaenoic acid (EPA) or a saturated fatty acid, palmitic acid (PA). EPA is an omega 3 fatty acid with documented health benefits while

PA is generally consumed in diets. Worms were placed on BaF2 slides, and FTIR spectra were collected from single worms in transmission mode using a focal plane array detector. Principal component analysis grouped the FTIR spectra into three clusters corresponding to spectra of worms cultured with no supplementation, worms cultured with supplementation with EPA, and worms cultured with supplementation with PA. The major differences between the FTIR spectra reside in the vibrations corresponding to unsaturated fatty acids (3008 cm-1), lipids (2928, 2848, and 1744 cm-1), and proteins (1680, 1648, and 1515 cm-1). Furthermore, supplementing mutant strains (tub-1 and fat- 3) CeMM with PA resulted in a new vibration at 1632 cm-1, which is assigned to the amide I of β-pleated sheet component of proteins, in the spectra of tub-1 and fat-3 mutant strains. The results illustrated the potential use of FTIR alongside other techniques such as gas chromatography and staining techniques to investigate lipid metabolism and fat accumulation as well as induced changes in protein structures.

240

Texas Tech University, Amal Bouyanfif, August 2019

Keywords: FTIR microspectroscopy, imaging, olefinic, palmitic acid, C. elegans, eicosapentaenoic acid

7.2. Introduction Caenorhabditis elegans (C. elegans) has attracted increasing attention and has become a major model organism in different research fields, such as biology (Witting and Schmitt-Kopplin 2016), obesity, fat metabolism (Zheng and Greenway 2012; Ashrafi 2007; Ashrafi et al. 2003), drug discovery (O'Reilly et al. 2014; Artal-Sanz et al. 2006), biomedical toxicology, environmental toxicology (Leung et al. 2008), and nanoparticle toxicity (Gonzalez-Moragas et al. 2017; Gonzalez-Moragas et al. 2015; Meyer et al. 2010). The interest in using this nematode as a model organism instead of rodent models (e.g., mice) is attributed to several advantages, such as small size, short lifespan, quick turnover, reduced experimental timeline, complete genetic information, easy culture conditions, easy maintenance in the laboratory, low cost, possibility of long-term storage as a frozen stock, no prior approval is required compared to studies on rodents and higher order animals (Bouyanfif et al. 2019). C. elegans has been used to investigate mechanisms that regulate lipid storage and metabolism (Watts 2009; Watts and Browse 2002; Hellerer et al. 2007; Folick et al. 2011; Ashrafi 2007; Witting and Schmitt-Kopplin 2016; Chen et al. 2016). In mammals, lipids are primarily stored as triglycerides in adipose tissue. In C. elegans, lipids are also stored primarily as triacylglycerols but in the gut granules and hypodermal cells (Ashrafi 2007; Ashrafi et al. 2003). The fat content in C. elegans has been determined by extracting total lipids from the whole worms, fractionating phospholipids and neutral lipid moieties, and then performing gas chromatography/mass spectrometry analyses (Ashrafi 2007; Kniazeva et al. 2003; Satouchi et al. 1993; Watts and Browse 2002). The triacylglyceride content in the nematode is 40 to 55% of the total lipids, while phospholipids are composed of ~55% ethanolamine glycerophospholipid, ~32% choline glycerophospholipid, and approximately 8% sphingomyelin (Ashrafi 2006). Polyunsaturated fatty acids (PUFAs) play an important role, not only as structural

241

Texas Tech University, Amal Bouyanfif, August 2019 components of membranes, but also as precursors to critical signaling molecules and lipid mediators (Kaja Reisner 2011; Watts and Browse 2002; Watts et al. 2003). Lipid metabolism pathways in C. elegans resemble those in mammals. However, a few exceptions exist. (1) unlike mammals, C. elegans possesses the fatty acid enzymes required to generate essential fatty acids, (2) C. elegans is not able to produce PUFAs longer than C20. Therefore, the ω-6 and ω-3 PUFAs biosynthesis pathways end with arachidonic acid (20:4n6) and eicosapentaenoic acid (20:5n3), respectively (Watts and Browse 2002). As indicated above, C. elegans stores fat primarily as droplets in their intestinal and skin-like epidermal cells (Ashrafi 2007). Lipid staining techniques using Nile Red, Sudan Black, Oil Red O, and fluorescently labeled fatty acids are commonly used to assess changes in fat storage due to mutations or RNAi-mediated inactivation of genes encoding various lipid biosynthesis pathways (Ashrafi et al. 2003; Mukhopadhyay et al. 2005). This technique has some limitations, such as variability in dye labeling specificity and efficiency, which may lead to inconsistencies in lipid quantification (O'Rourke et al. 2009; Watts 2009; Soukas et al. 2009). Other tools used to visualize lipids include coherent anti-stokes Raman scattering, which allows visualization of lipids stored in both C. elegans epidermal and gut granules without the use of invasive methods (Hellerer et al. 2007). Tserevelakis et al. utilized label-free imaging using third-harmonic generation microscopy to study lipid deposition in C. elegans (Tserevelakis et al. 2014). Folick et al. combined anti-stokes Raman scattering and simulated Raman scattering microscopy to develop new methods to visualize the localization and regulation of lipids in C. elegans (Folick et al. 2011). Fourier transform infrared microspectroscopy (FTIR) is a powerful analytical technique to investigate the chemical composition of a sample. When combined with a microscope and focal plane array detectors (FPA), this technique allows imaging of a relatively large sample area, providing both spectroscopic information (chemical identification) and distribution of functional groups in the sample. Recently, we reviewed applications of FTIR to study the biochemical changes in C. elegans (Bouyanfif et al. 2018). FTIR imaging could be used to investigate intact nematodes. These applications include nematode identification (Ami et al. 2004; Ami et al. 2012), 242

Texas Tech University, Amal Bouyanfif, August 2019 biochemical composition (Sheng et al. 2016; Bouyanfif et al. 2017), and toxicity assessment of nanoparticles and drugs (Zanni et al. 2012; Diomede et al. 2010). We used FTIR imaging to illustrate changes in intact C. elegans (wild-type (N2) and mutant strains fat-3 and tub-1) when C. elegans maintenance media (CeMM) was supplemented with a polyunsaturated fatty acid, eicosapentaenoic acid (EPA) (Bouyanfif et al. 2017). We used principal component analysis to discriminate WT from mutant strains (tub-1 and fat-3) cultured with or without EPA supplementation. This discrimination was mainly due to differences in unsaturated fatty acids, lipids, and protein profiles (Bouyanfif et al. 2017). These conclusions were further supported by performing digital subtraction of the FTIR spectra of mutant strains from those of WT. These studies validated the FTIR technique as an important tool to detect changes in biochemical compositions and lipid metabolism (Bouyanfif et al. 2017). This work has laid the foundation to explore further the use of FTIR imaging to dissect biochemical changes in C. elegans WT and mutant strains (tub-1 and fat-3) cultured in CeMM supplemented with EPA or palmitic acid (PA). We compared these two fatty acids as one of them, EPA is an omega 3 fatty acid with documented health benefits including metabolic diseases; while PA is a saturated fatty acid commonly consumed in the diet and also endogenously produced. In this study, FTIR spectra were acquired in transmission mode on a single intact worm with no special preparation. This stain-free analytical technique is able to provide information related to chemical functional groups that provide insight into biochemical changes in C. elegans fed saturated or unsaturated fatty acids.

7.3. Materials and Methods 7.3.1. C. elegans strains, culture, and maintenance Hermaphrodite adult WT and mutant strains tub-1 (nr2044) and fat-3 (wa22) were acquired from the Caenorhabditis Genetics Center (CGC, University of Minnesota, Minneapolis, MN, USA). WT (N2) is able to synthetize 20:4n6 and 20:5n3 using saturated and monounsaturated fatty acids from bacteria as precursors (Watts et al. 2003; Hutzell and Krusberg 1982). By contrast, the mutant strain fat-3 lacks ∆6

243

Texas Tech University, Amal Bouyanfif, August 2019 desaturase activity and fails to produce any of the common C20 PUFAs that are essential in regulating membrane structure, dynamics, and permeability (Watts et al. 2003). In the mutant strain tub-1, the functional loss of tubby ortholog called tub-1/F10B5.5 in C. elegans leads to the accumulation of triglycerides, the major form of stored fat (Ashrafi et al. 2003; Mukhopadhyay et al. 2005; Mak et al. 2006). Nematodes were first cultured in the nematode growth media (NGM) plates seeded with E. coli OP50 as the main food source (Stiernagle 2006b, a). Plates containing a large quantity of eggs and gravid adults were bleached, and eggs were left in sterile M9 Buffer to hatch overnight. The following day, starved L1 animals were transferred to CeMM (Cell Guidance Systems, Babraham, Cambridge, UK) containing 20 µg/mL of kanamycin sulfate (Fisher Scientific, Pittsburgh, PA, USA) and 200 µg/mL of streptomycin sulfate (Fisher Scientific, Pittsburgh, PA, USA) (Szewczyk et al. 2003). C. elegans strains were cultured in CeMM at 20°C for multiple generations to adapt to the media before being used in the experiments.

7.3.2. Fatty acids Eicosapentaenoic acid (EPA) and palmitic acid (PA) were acquired from Nu- Check Prep (Elysian, MN, USA). EPA was supplied as a pure ω-3 ethyl esters. It was stored at -80°C, and exposure to heat, light, and oxygen was minimized to prevent oxidative degradation. PA was supplied as pure palmitic acid. EPA and PA solutions in ethanol were prepared and CeMM was supplemented at a final concentration of 100 µM; feeding was performed for 72 h on worm cultures of mixed ages.

7.3.3. FTIR microspectroscopy Individual hermaphrodite adult nematodes were washed with distilled water and deposited on FTIR transparent BaF2 slides (PerkinElmer, MA, USA). Slides containing worms were then dried in a vacuum desiccator for 1 h. FTIR spectra were collected in the transmission mode between 4000 and 1000 cm-1 using a Spectrum 400 FTIR equipped with a Spotlight 400 microscope (PerkinElmer, MA, USA) accessory with a liquid nitrogen cooled 128x128 Mercury-Cadmium-Telluride (MCT) focal plane array detector. To improve the signal-to-noise ratio, 128 co-added spectra were collected from 244

Texas Tech University, Amal Bouyanfif, August 2019 each pixel (6.25 x 6.25 µm) with a spectral resolution of 16 cm-1. Prior to sample measurements, a background spectrum from an empty area of the BaF2 slide was automatically subtracted from the spectra of the sample. The BaF2 slide does not show any absorption in the range of 4000 – 1000 cm-1. A visual image was first acquired from the sample (Figure 7.1). Point mode imaging was used in this study, which allowed us to acquire a large number of spectra in a short period of time (approximately 20 min). Spectra were acquired from a single worm along the length (4 to 6 worms for each treatment) with an aperture size of 15 x 15 µm. Four to eight data points were acquired from each worm (separated by approximately 50 µm), and all the spectra were the result of 128 co-added scans. The acquired spectra were baseline corrected and normalized with respect to the total absorbance over the entire range from 4000 to 1000 cm-1 using the Spectrum 10™ software (PerkinElmer, MA, USA). Principal component analysis was performed using the Unscrambler® X 10.3 software (CAMO Software AS, Norway).

Figure 7.1: Image of the whole intact C. elegans illustrating the location from which spectra were recorded.

7.4. Results and Discussion In previous work, we investigated the use of FTIR imaging to illustrate changes occurring in WT (N2), tub-1, and fat-3 C. elegans cultured with and without EPA supplementation at 25 or 100 µM (Bouyanfif et al. 2017). The results indicated that mutant strains have altered lipid compositions and that the major component of the middle part of the worms are fatty acyl groups. In this study, we investigated the chemical changes induced when the C. elegans diet was supplemented with and without

245

Texas Tech University, Amal Bouyanfif, August 2019

EPA and PA at 100 µM. Representative spectra acquired from WT (N2) cultured in CeMM alone and from WT (N2) cultured in CeMM either with EPA or PA supplementation at 100 µM are exhibited in Figure 7.2. It is interesting to note that the only difference between these spectra resides in the intensities of the vibrations at 2928 -1 -1 cm (asymmetric –CH2 stretch), at 2848 cm (symmetric –CH2 stretch), and at 1744 cm-1 (C=O stretch). These vibrations are associated with the presence of lipids, fatty acids, triglycerides, and phospholipids (Bouyanfif et al. 2017). Supplementing CeMM with PA resulted in a high intensity of these vibrations but did not affect other vibrations in the 1700 – 1000 cm-1 region. In this region, the vibration at 1648 cm-1 was assigned to the C=O stretch of amide I, mainly the α-helix components of proteins (Bouyanfif et al. 2017; Hobro and Lendl 2011). The vibration at 1548 cm-1 was attributed to amide II, which could originate from N-H bending and C-N stretching of the protein amide group. -1 The vibration at 1456 cm was assigned to CH2 bending and deformation of methylene of lipids, proteins, or cholesterol esters. The vibration at 1392 cm-1 was assigned to the COO- stretch of carbohydrates, fatty acids, or amino acid side chains. The vibrations at -1 - 1232 and 1084 cm originated from PO2 antisymmetric and symmetric stretching of phosphodiesters, respectively. The vibration at approximately 1155 cm-1 was assigned to C-O stretching and possibly originated from glycogen (Vongsvivut et al. 2013). It is important to note the presence of the vibration at 3008 cm-1, which is attributed to -HC=CH- stretching (San-Blas et al. 2011; Holman et al. 2008). This vibration is due to unsaturated fatty acids and exists in the spectra acquired from WT (N2) with no supplementation. This vibration represents a very important feature in the FTIR spectra of WT (N2) C. elegans compared to the spectra acquired from tub-1 and fat-3 mutant strains. This result confirms previously reported results that indicated that WT (N2) C. elegans is capable of synthesizing a wide range of saturated, monounsaturated, and polyunsaturated fatty acids (Kniazeva et al. 2003; Kniazeva et al. 2004; Satouchi et al. 1993; Watts and Browse 2002; Hutzell and Krusberg 1982). Previous fatty acid analyses of C. elegans and C. briggsae reported that lipids accounted for 19.1% of the dry weight of C. elegans (Hutzell and Krusberg 1982). The authors indicated that the major portion of the fatty acids contained 18 or 20 carbons, with 246

Texas Tech University, Amal Bouyanfif, August 2019 unsaturated fatty acids making 70% of the total fatty acids (the principal fatty acid fraction was 18:1) (Hutzell and Krusberg 1982). Supplementation with EPA did not result in an increased intensity of the vibration at 3008 cm-1 (slightly reduced intensity was noticed).

Figure 7.2: Representative FTIR spectra acquired from WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 µM.

Several FTIR spectra were acquired, and principal component analysis (PCA) was performed to identify distinct groups of spectra that exhibit spectral similarities. PCA is a widely adopted multivariate statistical analysis used to reduce the dimensionality from a large number of interconnected variables (wavenumbers in the case of FTIR) to a few uncorrelated variables (Kemsley 1996; Chen et al. 1998). The reduction in dimensionality is achieved by means of a linear transformation to a new set of variables termed principal component scores. Thus, the sources of variability in the data are concentrated into the first 2 or 3 principal components. Plots of PC-1 against PC-2 or PC-3 revealed clustering in the FTIR spectra. Figure 7.3 shows PC-1 and PC- 2 scores of the FTIR spectra acquired from WT (N2) cultured with no supplementation and either with EPA or PA supplementation at 100 µM. Three groups of spectra can be distinguished as follows: the first group corresponds to WT (N2) with no supplementation, the second group corresponds to WT (N2) with supplementation with EPA at 100 µM, and the third group corresponds to WT (N2) with supplementation with

247

Texas Tech University, Amal Bouyanfif, August 2019

PA at 100 µM. It is worth pointing out the large variability in the spectra of WT (N2) cultured in CeMM with EPA or PA supplementation compared to the spectra acquired from WT (N2) cultured only in CeMM with no supplementation. The separation of the FTIR spectra into different groups indicates that biochemical changes are induced in worms when their diet is supplemented with saturated and unsaturated fatty acids.

Figure 7.3: PCA of the FTIR spectra acquired from WT (N2) cultured without and with either EPA or PA supplementation at 100 µM. Each data point represents a spectrum obtained with 128 co-added scans.

The analysis of loading variables (or factors) as a function of wavenumbers can help identify the functional groups that are behind the grouping of the original spectra (Alonso-Simon et al. 2004). Plots of the first three component loadings as a function of wavenumbers are shown in Figure 7.4. PC-1, PC-2 and PC-3 account for 46%, 33% and 8% of the spectral variation, respectively. The PC-1 loading plot shows major peaks at 1744 cm-1 (C=O stretching of esters), 1632 cm-1 (amide I band of the β-pleated sheet component of proteins, collagen proline residues (Hobro and Lendl 2011)). The PC-2 loading plot shows major peaks at the following vibrations: 2928 and 2848 cm-1 -1 (assigned to asymmetric and symmetric stretching of the acyl –CH2 groups), 1744 cm and 1680 cm-1 (assigned to amide I band component originating from anti-parallel pleated sheets and β-turns of proteins), and approximately 1550 cm-1 (assigned to amide II, N-H bending and C-N stretching of protein amide groups with some contribution

248

Texas Tech University, Amal Bouyanfif, August 2019 from amino acid side chains such as arginine, aspartate, glutamate and tyrosine (Hobro and Lendl 2011)). The PC-3 loading plot shows major peaks at 2928 cm-1, 2848 cm-1, -1 -1 -1 -1 - 1680 cm , 1632 cm , 1515 cm (assigned to tyrosine ring vibration), ~1232 cm (PO2 antisymmetric stretching of phosphodiesters (Hobro and Lendl 2011)), and 1084 cm-1 - (PO2 symmetric stretching of the phosphodiester backbone of nucleic acids and phospholipids).

Figure 7.4: Loadings corresponding to PCA presented in Figure 3 as a function of wavenumbers for WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 µM.

Representative spectra acquired from mutant strain tub-1 are shown in Figure 7.5. As reported in our previous work, the vibration at 3008 cm-1 (=CH– olefinic stretching), which generally arises from the presence of unsaturated fatty acids, is present only as a very small shoulder in the FTIR spectra of tub-1 cultured with no supplementation (Bouyanfif et al. 2017). The vibrations associated with triglycerides (2928, 2848, and 1744 cm-1) are present with high intensities. For this mutant strain, it was reported that the deletion of tubby ortholog (tub-1) leads to an accumulation of triglycerides, which are the major form of stored fat in C. elegans (Ashrafi et al. 2003; Mukhopadhyay et al. 2005). Supplementation of CeMM with 100 µM EPA leads to the appearance of the vibration at 3008 cm-1 with only a minor increase in the intensity of

249

Texas Tech University, Amal Bouyanfif, August 2019 the vibration at 1744 cm-1 (triglycerides, phospholipids, cholesterol esters, or fatty acids). Supplementing the growth media with palmitic acid (saturated fatty acid) not only resulted in the appearance of the vibration at 3008 cm-1 but also in a significant increase in the intensity of the vibration at 1744 cm-1. Palmitic acid can be integrated into triacylglycerides or phospholipids or can be modified by fatty acid elongases and desaturases to form a variety of long-chain polyunsaturated fatty acids (Watts 2009; Watts and Browse 2002). Furthermore, it is of particular interest to note the appearance of the vibration at 1632 cm-1, assigned to the carbonyl stretching in amide I of the β- pleated sheet component of proteins (Hobro and Lendl 2011). Supplementing the worm diet with saturated palmitic acid resulted in the shift from the vibration at 1648 cm-1 assigned to amide I of the α-helix component to 1632 cm-1 assigned to amide I of the β-sheet components. However, this was not the case for the WT (N2) strain. Furthermore, supplementation with EPA and PA resulted in the appearance of a vibration at approximately 1520 cm-1, which has been assigned to the parallel mode of α-helices (Vongsvivut et al. 2013).

Figure 7.5: Representative FTIR spectra acquired from tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM.

250

Texas Tech University, Amal Bouyanfif, August 2019

Figure 7.6 shows the PCA of the FTIR spectra of the tub-1 C. elegans strain cultured without supplementation and with supplementation either with EPA or PA at 100 µM. PC-1 and PC-2 account for 72% and 9% of the variance respectively and separate the FTIR spectra into 3 groups corresponding to tub-1 C. elegans cultured with no supplementation, tub-1 C. elegans cultured with EPA supplementation, and tub-1 C. elegans cultured with PA supplementation.

Figure 7.6: PCA of the FTIR spectra of tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM. Each data point represents a spectrum obtained with 128 co-added scans.

The PC score plots as a function of wavenumbers show that the major difference between the spectra come from lipids (2928, 2848, and 1744 cm-1) and proteins (1680, 1648, and 1515 cm-1) (Figure 7.7). A small contribution from unsaturated fatty acids (vibration at 3008 cm-1) was also observed.

251

Texas Tech University, Amal Bouyanfif, August 2019

Figure 7.7: Loadings corresponding to PCA presented in Figure 6 as a function of wavenumbers for tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 µM (PC-1: 72%, PC-2: 9%, and PC-3: 8%).

Representative spectra acquired from the fat-3 C. elegans strain cultured without or with EPA or PA at 100 µM are shown in Figure 7.8. The major differences between these spectra are the vibrations at 3008, 2928, 2848, and 1744 cm-1. The vibration at 3008 cm-1 is present only as a very small shoulder in the spectra of fat-3 C. elegans cultured with no supplementation. As mentioned previously, this vibration represents a fingerprint of –HC=CH-. The C. elegans mutant strain fat-3 exhibits a deficiency in the synthesis of PUFAs due to the dysfunction of the desaturases, which can cause defects in lipid regulation and reproduction (Chen et al. 2016). Watts et al. reported that fat-3 mutants lack ∆6 desaturase activity and fail to produce any of the common C20 PUFAs (Watts et al. 2003). Because of this deficiency, the growth and behavior of the worm are compromised along with neuromuscular defects, cuticle abnormalities, reduced brood size, and altered biological rhythms (Watts et al. 2003; Kaja Reisner 2011). Supplementation of the CeMM growth media with 100 µM of EPA leads to the appearance of the vibration at 3008 cm-1 (Figure 7.8). Watts et al. indicated that although fat-3 mutants fail to produce any of the common C20 PUFAs, the resulting growth abnormalities could be biochemically complemented by dietary

252

Texas Tech University, Amal Bouyanfif, August 2019 supplementation of various C20 PUFAs, such as eicosapentaenoic acid (Watts et al. 2003). Supplementing CeMM with EPA resulted in an increase in the intensity of the vibration at 1744 cm-1 (assigned to C=O stretching). The supplementation of the CeMM growth media with 100 µM of PA is accompanied by the appearance of the vibration at 3008 cm-1 and an increase of the intensity of the vibrations at 2928, 2848, and 1744 cm-1. This result indicates that saturated palmitic acid is converted to unsaturated fatty acids. The results of gas chromatography analysis did not show EPA but showed a significant increase in the amount of linoleic acid (from approximately 6.9% in fat-3 C. elegans with no supplementation to approximately 15.7% with supplementation with PA) (result not shown). This result indicated that the vibration assigned to –CH=CH- observed in the spectra of fat-3 supplemented with PA likely originates from linoleic acid C18:2. It was reported that C. elegans synthesizes 7% of its palmitic acid (16:0) through acetyl Co-A carboxylase (ACC) and fatty acid synthase (FAS), and the rest is absorbed from bacterial diets (Zheng and Greenway 2012). Elongases and desaturases can then integrate palmitic acid into triglycerides or convert it to long-chain polyunsaturated fatty acids (Zheng and Greenway 2012). In contrast to nematode growth media agar plates with E. Coli (NGM), CeMM does not contain palmitic acid. The FTIR results illustrated the ability of C. elegans to convert saturated fatty acids to unsaturated fatty acids. Because mutant strain fat-3 lacks ∆-6-desaturase, it is likely that the conversion of palmitic acid results in the production of linoleic acid 18:2n6, which was detected by FTIR.

253

Texas Tech University, Amal Bouyanfif, August 2019

Figure 7.8: Representative FTIR spectra acquired from fat-3 C. elegans strain cultured without or with either EPA or PA supplementation at 100 µM.

PCA of the FTIR spectra of mutant strain fat-3 is shown in Figure 7.9. Similar to the other strains, three groups of spectra could be identified, depending on the diet. The first three components explained 90% of the variance. The major differences between the spectra reside in lipids, proteins, and unsaturated fatty acids.

Figure 7.9: PCA of the FTIR spectra: fat-3 strain cultured without or with either EPA or PA at 100 µM. Each data point represents spectra obtained with 128 co-added scans.

254

Texas Tech University, Amal Bouyanfif, August 2019

Loadings of PC-1, PC-2, and PC-3 as a function of wavenumbers are shown in Figure 7.10. Similar to the results presented above, the plots show peaks corresponding to unsaturated fatty acids (3008 cm-1), lipids (2928, 2848, 1744 cm-1), and proteins (1680, 1648, 1632, 1568, and 1515 cm-1).

Figure 7.10: Loadings corresponding to PCA presented in Figure 9 as a function of wavenumbers for fat-3 C. elegans cultured without or with EPA or PA supplementation at 100 µM (PC-1: 70%, PC-2: 12%, PC-3: 8%).

FTIR analysis of the spectra acquired from single worms cultured with or without EPA or PA supplementation illustrates the occurrence of biochemical changes in the worms. These changes are essentially related to lipids, proteins, and unsaturated fatty acids. This study showed that FTIR could be used alongside gas chromatography and staining techniques to investigate lipid metabolism and fat accumulation as well as changes induced in the protein structure. When comparing the wild-type to mutant strains, relative quantification could be used by calculating the area under the peak or the peak intensity.

7.5. Conclusions In C. elegans, lipid storage and dynamics have been studied using staining with Nile Red or Oil Red O followed by fluorescence microscopy imaging. Other studies monitored lipid storage using coherent anti-stokes Raman and stimulated Raman scattering microscopy. Here, we used FTIR microspectroscopy to investigate the effect 255

Texas Tech University, Amal Bouyanfif, August 2019 of C. elegans diet supplementation with a saturated and an unsaturated fatty acid on the changes in the biochemical composition. The FTIR spectra were acquired on intact worms in transmission mode. The principal component analysis of the FTIR spectra grouped the spectra into three groups corresponding to the spectra acquired from worms cultured with no supplementation, worms cultured with supplementation with eicosapentaenoic acid, and worms cultured in CeMM supplemented with palmitic acid. The major differences between the spectra resided in the vibrations corresponding to unsaturated fatty acids, lipids, and proteins.

Conflicts of interest There are no conflicts to declare.

Acknowledgments The authors would like to thank Dr. S.A. Vanapalli group for supplying C. elegans strains, he obtained from the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). The research was supported by the Fiber and Biopolymer Research Institute and startup funds from the College of Human Sciences, Texas Tech University.

256

Texas Tech University, Amal Bouyanfif, August 2019

7.6. References Alonso-Simon A, Encina AE, Garcia-Angulo P, Alvarez JM, Acebes JL (2004) FTIR spectroscopy monitoring of cell wall modifications during th ehabituation of bean (Phaseolus vugaris L.) callus cultures to dichlobenil. Plant Sci 167 (6):1273-1281

Ami D, Natalello A, Doglia SM (2012) Fourier transform infrared microspectroscopy of complex biological systems: from intact cells to whole organisms. Methods Mol Biol 895:85-100. doi:10.1007/978-1-61779-927-3_7

Ami D, Natalello A, Zullini A, Doglia SM (2004) Fourier transform infrared microspectroscopy as a new tool for nematode studies. FEBS Lett 576 (3):297- 300. doi:10.1016/j.febslet.2004.09.022

Artal-Sanz M, de Jong L, Tavernarakis N (2006) Caenorhabditis elegans: a versatile platform for drug discovery. Biotechnol J 1 (12):1405-1418. doi:10.1002/biot.200600176

Ashrafi K (2006) Mapping out starvation responses. Elsevier Inc 3 (4):235–236. doi:http://dx.doi.org/10.1016/j.cmet.2006.03.002

Ashrafi K (2007) Obesity and the regulation of fat metabolism. WormBook:1-20. doi:10.1895/wormbook.1.130.1

Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421 (6920):268-272. doi:10.1038/nature01279

Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of omega-3 Polyunsaturated Fatty Acids in Obesity. Adv Nutr 10 (1):165-178. doi:10.1093/advances/nmy059

Bouyanfif A, Liyanage S, Hequet E, Moustaid-Moussa N, Abidi N (2018) Review of FTIR microspectroscopy applications to investigate biochemical changes in C. elegans. Vib Spectrosc 96:74-82. doi:10.1016/j.vibspec.2018.03.001

Bouyanfif A, Liyanage S, Hewitt JE, Vanapalli SA, Moustaid-Moussa N, Hequet E, Abidi N (2017) FTIR imaging detects diet and genotype-dependent chemical composition changes in wild type and mutant C. elegans strains. Analyst 142 (24):4727-4736. doi:10.1039/c7an01432e

257

Texas Tech University, Amal Bouyanfif, August 2019

Chen L, Carpita NC, Reiter WD, Wilson RH, Jeffries C, McCann MC (1998) A rapid method to screen for cell-wall mutants using discriminant analysis of Fourier transform infrared spectra. Plant J 16 (3):385-392

Chen W-W, Yi Y-H, Chien C-H, Hsiung K-C, Ma T-H, Lin Y-C, Lo SJ, Chang aT-C (2016) Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging. Scientific RepoRts. doi:10.1038/srep32021

Diomede L, Cassata G, Fiordaliso F, Salio M, Ami D, Natalello A, Doglia SM, De Luigi A, Salmona M (2010) Tetracycline and its analogues protect Caenorhabditis elegans from beta amyloid-induced toxicity by targeting oligomers. Neurobiol Dis 40 (2):424-431. doi:10.1016/j.nbd.2010.07.002

Folick A, Min W, Wang MC (2011) Label-free imaging of lipid dynamics using Coherent Anti-stokes Raman Scattering (CARS) and Stimulated Raman Scattering (SRS) microscopy. Curr Opin Genet Dev 21 (5):585-590. doi:10.1016/j.gde.2011.09.003

Gonzalez-Moragas L, Berto P, Vilches C, Quidant R, Kolovou A, Santarella-Mellwig R, Schwab Y, Sturzenbaum S, Roig A, Laromaine A (2017) In vivo testing of gold nanoparticles using the Caenorhabditis elegans model organism. Acta Biomater 53:598-609. doi:10.1016/j.actbio.2017.01.080

Gonzalez-Moragas L, Roig A, Laromaine A (2015) C-elegans as a tool for in vivo nanoparticle assessment. Advances in Colloid and Interface Science 219:10-26. doi:10.1016/j.cis.2015.02.001

Hellerer T, Axang C, Brackmann C, Hillertz P, Pilon M, Enejder A (2007) Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proc Natl Acad Sci U S A 104 (37):14658- 14663. doi:10.1073/pnas.0703594104

Hobro AJ, Lendl B (2011) Fourier-transform mid-infrared FPA imaging of a complex multicellular nematode. Vib Spectrosc 57 (2):213-219

Holman HY, Bjornstad KA, Martin MC, McKinney WR, Blakely EA, Blankenberg FG (2008) Mid-infrared reflectivity of experimental atheromas. J Biomed Opt 13 (3):030503. doi:10.1117/1.2937469

Hutzell PA, Krusberg LR (1982) Fatty-Acid Compositions of Caenorhabditis-Elegans and Caenorhabditis-Briggsae. Comp Biochem Phys B 73 (3):517-520. doi:Doi 10.1016/0305-0491(82)90068-2

258

Texas Tech University, Amal Bouyanfif, August 2019

Kaja Reisner ML, Markus Storvik, Tanel Jantson, Merja Lakso, J. C. Callaway,and Garry Wong (2011) Trans Fat Diet Causes Decreased Brood Size and Shortened Lifespan in Caenorhabditis elegans delta-6-desaturase Mutant fat-3. J BIOCHEM MOLECULAR TOXICOLOGY 25:269-279. doi:10:1002/jbt

Kemsley EK (1996) Discriminant analysis of high-dimmensional data: A comparaison of principal compoenent analysis and partial least square data reduction medthods. Chemometr Intell Lab 33 (1):47-61

Kniazeva M, Crawford QT, Seiber M, Wang CY, Han M (2004) Monomethyl branched- chain fatty acids play an essential role in Caenorhabditis elegans development. PLoS Biol 2 (9):E257. doi:10.1371/journal.pbio.0020257

Kniazeva M, Sieber M, McCauley S, Zhang K, Watts JL, Han M (2003) Suppression of the ELO-2 FA elongation activity results in alterations of the fatty acid composition and multiple physiological defects, including abnormal ultradian rhythms, in Caenorhabditis elegans. Genetics 163 (1):159–169

Leung MC, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN (2008) Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology. Toxicol Sci 106 (1):5-28. doi:10.1093/toxsci/kfn121

Mak HY, Nelson LS, Basson M, Johnson CD, Ruvkun G (2006) Polygenic control of Caenorhabditis elegans fat storage. Nat Genet 38 (3):363-368. doi:10.1038/ng1739

Meyer JN, Lord CA, Yang XYY, Turner EA, Badireddy AR, Marinakos SM, Chilkoti A, Wiesner MR, Auffan M (2010) Intracellular uptake and associated toxicity of silver nanoparticles in Caenorhabditis elegans. Aquat Toxicol 100 (2):140- 150. doi:10.1016/j.aquatox.2010.07.016

Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2005) C-elegans tubby regulates life span and fat storage by two independent mechanisms. Cell Metab 2 (1):35-42. doi:10.1016/j.cmet.2005.06.004

O'Reilly LP, Luke CJ, Perlmutter DH, Silverman GA, Pak SC (2014) C. elegans in high- throughput drug discovery. Adv Drug Deliver Rev 69:247-253. doi:10.1016/j.addr.2013.12.001

O'Rourke EJ, Soukas AA, Carr CE, Ruvkun G (2009) C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab 10 (5):430- 435. doi:10.1016/j.cmet.2009.10.002

259

Texas Tech University, Amal Bouyanfif, August 2019

San-Blas E, Guerra M, Portillo E, Esteves I, Cubillan N, Alvarado Y (2011) ATR/FTIR characterization of Steinernema glaseri and Heterorhabditis indica. Vib Spectrosc 57 (2):220-228. doi:10.1016/j.vibspec.2011.07.008

Satouchi K, Hirano K, Sakaguchi M, Takehara H, Matsuura F (1993) Phospholipids from the free-living nematode Caenorhabditis elegans. Lipids 28 (9):837-840

Sheng M, Gorzsas A, Tuck S (2016) Fourier transform infrared microspectroscopy for the analysis of the biochemical composition of C. elegans worms. Worm 5 (1):e1132978. doi:10.1080/21624054.2015.1132978

Soukas AA, Kane EA, Carr CE, Melo JA, Ruvkun G (2009) Rictor/TORC2 regulates fat metabolism, feeding, growth, and life span in Caenorhabditis elegans. Genes Dev 23 (4):496-511. doi:10.1101/gad.1775409

Stiernagle T (2006a) Maintenance of C. elegans. WormMethods 51–67. doi:/10.1895/wormbook.1.101.1

Stiernagle T (2006b) Maintenance of C. elegans. WormBook:1-11. doi:10.1895/wormbook.1.101.1

Szewczyk NJ, Kozak E, Conley CA (2003) Chemically defined medium and Caenorhabditis elegans. BMC Biotechnol 3:19. doi:10.1186/1472-6750-3-19

Tserevelakis GJ, Megalou EV, Filippidis G, Petanidou B, Fotakis C, Tavernarakis N (2014) Label-free imaging of lipid depositions in C. elegans using third- harmonic generation microscopy. PLoS One 9 (1):e84431. doi:10.1371/journal.pone.0084431

Vongsvivut J, Heraud P, Gupta A, Puri M, McNaughton D, Barrow CJ (2013) FTIR microspectroscopy for rapid screening and monitoring of polyunsaturated fatty acid production in commercially valuable marine yeasts and protists. Analyst 138 (20):6016-6031. doi:10.1039/c3an00485f

Watts JL (2009) Fat synthesis and adiposity regulation in Caenorhabditis elegans. NIH Public Access 2:58–65. doi:10.1016/j.tem.2008.11.002

Watts JL, Browse J (2002) Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99 (9):5854-5859. doi:10.1073/pnas.092064799

Watts JL, Phillips E, Griffing KR, Browse J (2003) Deficiencies in C20 polyunsaturated fatty acids cause behavioral and developmental defects in Caenorhabditis elegans fat-3 mutants. Genetics 163 (2):581-589

260

Texas Tech University, Amal Bouyanfif, August 2019

Witting M, Schmitt-Kopplin P (2016) The Caenorhabditis elegans lipidome: A primer for lipid analysis in Caenorhabditis elegans. Arch Biochem Biophys 589:27-37. doi:10.1016/j.abb.2015.06.003

Zanni E, De Bellis G, Bracciale MP, Broggi A, Santarelli ML, Sarto MS, Palleschi C, Uccelletti D (2012) Graphite nanoplatelets and Caenorhabditis elegans: insights from an in vivo model. Nano Lett 12 (6):2740-2744. doi:10.1021/nl204388p

Zheng J, Greenway FL (2012) Caenorhabditis elegans as a model for obesity research. Int J Obes (Lond) 36 (2):186-194. doi:10.1038/ijo.2011.93

261

Texas Tech University, Amal Bouyanfif, August 2019

Chapter 8

Summary, Conclusions, Perspectives, and Limitations 8.1. Summary and Conclusions We successfully used C. elegans nematode to determine the effects of supplementing the worm diet with fatty acids on worm life span, expression of genes involved in fat synthesis, oxidative stress and longevity, and parallel changes in biochemical composition of the worms both during development and with fatty acid treatments. In this study, we used three C. elegans strains: wild type (N2 Bristol) (WT) and mutant strains tub-1 and fat-3. WT nematodes unlike most other animals, possess the genes for the protein products mediating the endogenous biosynthesis of long chain ω- 3 PUFAs, including ∆12 encoded by fat-2 gene, ∆5 encoded by fat-4 gene, ∆6 encoded by fat-3 gene, and ω-3 desaturase encoded by fat-1 gene. In mutant strain tub-1 (nr2044), the functional loss of tubby ortholog called tub-1/F10B5.5 gene leads to excessive accumulation of triglycerides which are the major form of stored fat. However, mutant strain fat-3 lacks Δ6 desaturase eliminating their ability to produce common C20 PUFAs, which are essential for regulating membrane structure, dynamics, and permeability. Our results showed that supplementing diet with EPA reduced the WT longevity compared to animals without supplementation but not significantly. We observed also that supplementing these worms with EPA resulted in an elevated expression of oxidative stress genes. As well as stress response related gene. Thus, we believe that this reduction of lifespan may be attributed to oxidative stress caused by exposure of worms to excessive amounts of exogenous EPA in addition to regular physiologic levels of endogenously synthesized EPA required for C. elegans metabolism. However, the dose of EPA used may not be sufficient to alter significantly their lifespan. Lifespan experiments over WT, tub-1 and fat-3 nematodes were performed using microfluidics cultures. Our results showed that mutation in tub-1 results in lifespan extension under conditions used, however, we found that fat-3 mutation decreases moderately the worm

262

Texas Tech University, Amal Bouyanfif, August 2019 lifespan but not significantly. Interestingly, supplementation of both tub-1 and fat-3 mutants with EPA did not alter their longevity. In addition, the effects of dietary EPA supplementation on adiposity, oxidative stress, and on longevity markers in nematodes, cultured under different conditions, were evaluated. Gene expression analysis in the axenic culture (CeMM) revealed no significant changes in the levels of the selected genes related to oxidative stress, fat metabolism and longevity in response of the EPA supplementation due to the high variability reported in this study. However, in the monoxenic culture (NGM), oxidative stress related gene, oxi-1, showed a significant decrease in tub-1 mutants with the supplementation with EPA. Moreover, in fat-3 mutants that, similarly to mammals, have severely reduced PUFAs production, expression of the oxidative stress associated gene, oxi-1, was suppressed significantly compared to WT worms and expression of the fatty acids synthesis related gene, fasn- 1, was enhanced significantly compared to tub-1 mutants. The WT and tub-1 worms were used to examine the feasibility of Fourier Transform Infrared microspectroscopy for investigating the carbohydrate, lipid and protein nematode body composition on critical stages of C. elegans ontogenesis (day 8, 11, and 15). We observed major changes in lipids (vibration 1744 cm-1 assigned to C=O stretching) and proteins (vibrations 1648 cm-1 assigned to C=O stretching of amide I and 1548 cm-1 assigned to N-H bending and C-N stretching in amid II). The vibration assigned to glycogen around 1155 cm-1 was present in the spectra acquired at day 8 and 11 but the peak area decreased by 49.3% and 73.3% in the spectra acquired at day 15 respectively from WT and tub-1 strains. Furthermore, PC-1 loadings as a function of wavenumbers show that the presence of the vibration 1698 cm-1, attributed to antiparallel β-sheet, could indicate the formation of lipofuscin. The results obtained demonstrate that FTIR imaging could be used as a tool to monitor the worm body composition changes in lifespan studies, which can bring additional information to our understanding of longevity. For biochemical composition analyses above, worms were cultured in bacteria- free CeMM both with and without supplementation with different EPA concentrations (25 or 100 µM). FTIR images were acquired in transmission mode on single worms. 263

Texas Tech University, Amal Bouyanfif, August 2019

The results showed that FTIR micro spectroscopy can be used as tool to investigate the effects of diets on biochemical composition on intact worms (no extraction is needed allowing other experiments to be performed).

To compare the effects of polyunsaturated and saturated FAs on C. elegans, the worms were grown on media, supplemented with 100 µM palmitic acid (PA). The major difference between the FTIR spectra acquired from worms, cultured on EPA- or PA- supplemented media, resides in the content of unsaturated fatty acids, lipids, and proteins. Supplementation the media with PA resulted in significant increase in palmitoleic acid in WT and tub-1 nematodes and in significant increase in linoleic acid in fat-3 animals. Furthermore, supplementing CeMM with PA resulted in the appearance of the vibration 1632 cm-1 assigned to amide I-β-pleated sheet component of proteins in the spectra of tub-1 and fat-3 mutant worm. The main findings from this research are summarized below: 1. C. elegans is a suitable model organism, which can be used to investigate the effects of fatty acids on aging, and gene expression. 2. Gene expression analysis using quantitative RT-PCR in C. elegans did not show significant effect of EPA supplementation. This was attributed to mixed ages of nematode compared to other model animal studies. 3. The long-term consumption of EPA resulted in accelerated aging in wild type C. elegans. 4. Long-term consumption of EPA does not alter the lifespan of tub-1 and fat-3. 5. FTIR was used to investigate the usefulness of this technique to study biochemical changes during C. elegans lifespan. Although this study was limited to only wild-type and tub-1 at day 8, 11, and 15, the results indicated that the major biochemical changes occur in lipids and proteins. There was also a major decrease in the intensity of the vibration assigned to glycogen. Furthermore, the presence of the vibration at 1698 cm-1, attributed to antiparallel β-sheet, could indicate the formation of lipofuscin.

264

Texas Tech University, Amal Bouyanfif, August 2019

6. FTIR showed also that supplementing C. elegans diet with either EPA or PA can result in a major biochemical changes in unsaturated fatty acids, lipids, and proteins.

8.2. Perspectives In this research, we demonstrated that C. elegans can be easily cultured and maintained in laboratory and can serve as a platform for nutrition and obesity-related studies, such as evaluating the effects of dietary fats on lipid, protein and carbohydrate metabolism. Furthermore, many species of EPA-derived epoxides, diols formed via CYP enzyme, and eicosanoids that are known as pro-longevity factors can be tested using different transgenic worms and different target genes related to fatty acid synthesis, aging and age-related disorders. Future studies, using the worms of different genotypes and synchronized C. elegans cultures, are needed to determine the effects of ω-3 LC-PUFAs and other bioactive foods on physiology and gene expression in nematodes in relation to worm life stage. In addition, since C. elegans body wall transparency allows for easy visualization of the internal organs, age‐related pathology, and fat accumulation. Thus, a knock-in transgenic expression of the green fluorescent protein (GFP)-coupled target genes may be a better model to use to determine and quantify changes in intact C. elegans body. We showed that FTIR microspectroscopy can be used a non-destructive technique to ascertain the genotype-related and diet-caused alterations in worm body composition. In combination with gene expression and gas chromatography data, FTIR imaging analyses, conducted at different worm development phase, and with different fatty acid or other bioactive compound treatments can be further used to advance our understanding of the molecular mechanisms underlying the aging process and effects of nutrition and other factors on this process.

265

Texas Tech University, Amal Bouyanfif, August 2019

8.3. Limitations Due to its short life cycle, unique fatty acid metabolism, and availability and ease of generation of mutants with targeted deletions of long chain fatty acid metabolizing genes, C. elegans represents a highly relevant time-sparing model organism, for biomedical and nutritional investigations. However, in spite of all its excellent features, there are also numerous drawbacks for this nematode as a model organism. The long evolutionary distance between C. elegans and humans, including the fact that the simple body of C. elegans lacks essential human physiology tissues and organs as blood, brain, defined fat cells and is subjected to significantly different mechanisms of central regulation. This raises a question whether the data generated using this worm can be directly extrapolated on humans. Most likely, the lipid metabolism data, generated using C. elegans, will require further validation using a mouse or other model organism, more closely related to humans. In addition, the small size of the C. elegans, can be an issue when comparatively high amounts of tissues or cells are required for biochemical and/or molecular analyses.

266

Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX A Advances in Nutrition 10 (2019) 165-178

267

REVIEW Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

The Nematode Caenorhabditis elegans as a Model Organism to Study Metabolic Effects of ω-3 Polyunsaturated Fatty Acids in Obesity

Amal Bouyanfif,1,2 Shasika Jayarathne,2,3 Iurii Koboziev,2,3 and Naima Moustaid-Moussa1,2,3 Departments of 1Plant and Soil Science and 2Nutritional Sciences and 3Obesity Research Cluster, Texas Tech University, Lubbock, TX

ABSTRACT Obesity is a complex disease that is influenced by several factors, such as diet, physical activity, developmental stage, age, genes, and their interactions with the environment. Obesity develops as a result of expansion of fat mass when the intake of energy, stored as triglycerides, exceeds its expenditure. Approximately 40% of the US population suffers from obesity, which represents a worldwide public health problem associated with chronic low-grade adipose tissue and systemic inflammation (sterile inflammation), in part due to adipose tissue expansion. In patients with obesity, energy homeostasis is further impaired by inflammation, oxidative stress, dyslipidemia, and metabolic syndrome. These pathologic conditions increase the risk of developing other chronic diseases including diabetes, hypertension, coronary artery disease, and certain forms of cancer. It iswell documented that several bioactive compounds such as omega-3 polyunsaturated fatty acids (ω-3 PUFAs) are able to reduce adipose and systemic inflammation and blood triglycerides and, in some cases, improve glucose intolerance and insulin resistance in vertebrate animal models of obesity. A promising model organism that is gaining tremendous interest for studies of lipid and energy metabolism is the nematode Caenorhabditis elegans. This roundworm stores fats as droplets within its hypodermal and intestinal cells. The nematode’s transparent skin enables fat droplet visualization and quantification with the use of dyes that have affinity to lipids. This article provides a review of major research over the past several years on the use of C. elegans to study the effects of ω-3 PUFAs on lipid metabolism and energy homeostasis relative to metabolic diseases. Adv Nutr 2019;10:165–178.

Keywords: C. elegans,obesity,ω-3 fatty acids, metabolism, inflammation, microRNA, gene regulation

Introduction to the Limitations of Current affects ∼40% of the adult population and ∼19% of the youth Omega-3 Fatty Acid Research Due to Imperfect population, and close to 70.2% of US adults are categorized Model Organisms as affected by obesity or overweight (3, 4). The number of During the last few decades, the prevalence of obesity Americans suffering from obesity has progressively increased has increased in many countries across the world with since 1960. In 2013, the American Medical Association >600 million adults reported as obese and >1.9 billion recognized obesity as a disease, emphasizing its importance as overweight. This complex disease has attained epidemic to public health (5). The estimated annual medical cost proportions projected to reach, by 2015, 700 million adults in the United States was $147 billion in 2008, and the with obesity and 2.3 billion overweight adults (1). The annual medical costs for those suffering from obesity were United States is among the countries with the highest obesity $1429 higher than those of normal weight (6). Clearly, novel incidence and prevalence (2). Obesity in the United States and creative public health population-based strategies for preventing and treating obesity are needed and represent an urgent health care challenge (7). Supported in part by the USDA Agriculture and Food Research Initiative (AFRI) National Institute of Food and Agriculture (NIFA) exploratory award 2014-07216 (to NM-M) and the A hallmark of obesity is the expansion of fat mass, Texas Tech University Obesity Research Cluster (to NM-M). primarily in what is referred to as white adipose tissue Author disclosures: AB, SJ, IK, and NM-M, no conflicts of interest. (WAT). By contrast, brown adipose tissue (BAT) is primar- Address correspondence to NM-M (e-mail: [email protected]). Abbreviations used: AA, arachidonic acid; AGO, argonaute; ALA, α-linolenic acid; BAT, brown ily responsible for thermogenesis and energy expenditure. adipose tissue; daf, dauer larva formation abnormal; DR, dietary restriction; elo,fattyacid WATistheprincipaladiposetissuetypeassociatedwith fat elongation; , fatty acid desaturase; GPR, G protein–coupled receptor; HFD, high-fat diet; IR, metabolic complications of obesity. This tissue functions as insulin resistance; LA, linoleic acid; let, larval-lethal; lin, lineage abnormal; MaR, maresin; miRNA, microRNA; NF-κB, nuclear factor kappa-B; NHR, nuclear hormone receptor; OA, oleic acid; OS, an endocrine organ; it produces various bioactive metabolites oxidative stress; RV, resolvin; SA, stearic acid; WAT, white adipose tissue. and substances such as free fatty acids and adipose cytokines

© 2019 American Society for Nutrition. All rights reserved. Adv Nutr 2019;10:165–178; doi: https://doi.org/10.1093/advances/nmy059. 165 Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 1 Major adipokines and adipose-derived soluble factors in regulating energy homeostasis and immune status. A wide variety of WAT-produced molecules contribute to regulation of lipid and carbohydrate metabolism in health and disease. In obese white adipose tissue (WAT), activation of energy deposition pathways is coupled with elevated proinflammatory signaling, causing obesity-associated chronic inflammation. GLUT4, glucose transporter type 4 protein; MCP-1, monocyte chemoattractant protein-1; PAI-1, plasminogen activator inhibitor-1; IL, interleukin; TNF-α, tumor necrosis factor-α.

(adipokines) (8). In particular, increased production of benefits in metabolic disorders16 ( ), limited information adipose tissue–derived proinflammatory adipokines, such as exists about specific mechanisms mediating the effects of Tumor necrosis factor alpha (TNF-α), monocyte chemo- (ω-3) PUFAs on metabolic inflammation, energy balance, tactic protein (MCP-1), plasminogen activator inhibitor-1 and cell signaling pathways. (PAI-1), Interleukins IL-1, IL-6, and IL-18; the hormones Long-chain ω-3 PUFAs are potent dietary anti- resistin and leptin; along with reduced secretion of the inflammatory compounds. Importantly, they represent anti-inflammatory and insulin-sensitizing adipokines, such an essential fatty acid type. Mammals and, in particular, as IL-10 and adiponectin, have been reported to par- human organisms are not capable of synthesizing them de tially cause obesity-related insulin resistance (IR) (9–12). novo due to the lack of -12 desaturase and -15 desaturase Increased adipokine levels in obesity stimulate the pro- endogenous enzymes, required for ω-3 desaturation (17, 18). duction of reactive species of oxygen and nitrogen by For this reason, supplementing these PUFAs with the diet is resident myeloid cells. Elevated reactive species of oxygen necessary. The short-chain fatty acid α-linolenic acid (ALA; and nitrogen levels are accountable for increasing the process 18:3ω-3) serves as a metabolic precursor for longer-chain of oxidative stress (OS) (13). Figure 1 summarizes the ω-3 fatty acids. The most critically important for human major adipocyte-derived factors that are engaged in energy diet and health of all the long-chain ω-3 PUFAs are DHA homeostasis. (22:6ω-3) and EPA (20:5ω-3) due to their ability to modify Several approaches are used to alleviate inflammation the cellular membrane composition and to modulate gene and OS in obesity and metabolic disorders. These include transcription and cellular signaling, thus exerting numerous dietary and pharmacologic interventions, such as caloric and versatile biological effects (19). restriction and antiobesity drugs, which ameliorate some Certain amounts of DHA and EPA can be synthesized of the metabolic dysfunctions in obesity (14, 15). In ad- by mammals via elongation of ALA supplemented with diet, dition,severalbioactivecompoundsfoundinfoodsand but the capacity of this function is limited. These long-chain botanicals possess anti-inflammatory properties and are ω-3 fatty acids have important therapeutic and nutritional attractive means to treat and/or prevent obesity-related benefits in humans. inflammation. Other diet-based treatment strategies use Linoleic acid (LA; 18:2ω-6) is the most common ω-6 bioactive food components, such as polyphenols and long- fattyacidinthehumandiet(20). LA is an essential dietary chain ω-3 PUFAs, namely EPA (eicosapentaenoic acid) and component. All long-chain ω-3 fatty acids in human cells are DHA (docosahexaenoic acid). These fatty acids possess well- synthesized from ALA and all long-chain ω-6 fatty acids are documented anti-inflammatory properties, but although a synthesized from LA. As summarized in Figure 2, the dietary body of data exists about their potential anti-inflammatory essential PUFAs ALA (ω-3) and LA (ω-6) are metabolized

166 Bouyanfif et al. Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 2 Metabolism of ω-3 and ω-6 PUFAs in humans. ω-3 Fatty acids are synthesized from the ALA precursor and ω-6 fatty acids are synthesized from the LA precursor. LA is converted to AA. Eicosanoids derived from AA have proinflammatory properties. ALA is subsequently converted to EPA and DHA. The metabolites of EPA and DHA have anti-inflammatory properties. AA, arachidonic acid; ALA, α-linolenic acid; Cox, cyclooxygenase; LA, linoleic acid; Lox, lipoxygenase; LTB4, leukotriene B4; LTB5, leukotriene B5; MaR, maresin; NPD1, neuroprotectin D1; PD1, protectin D1; PGE2, prostaglandin E2; PGE3, prostaglandin E3; RvD, resolvin D; RvE, resolvin E; TXA2, thromboxane A2; TXA3, thromboxane A3.

to become longer carbon chains (a range of 20- and 22- adipose, cardiac, and liver tissues (34). This is consistent carbon ω-6 and ω-3fattyacids)withhigherdouble-bond withreducedadipogenesisbyDHAandEPAandincreased numbers by successive reactions catalyzed by the same set of mitochondrial carnitine palmitoyl transferase 1 enzyme desaturase and elongase enzymes. Many of these are further (CPT1), which controls fat oxidation in adipocytes, skeletal metabolized into other lipid mediators such as prostanoids muscle,andcardiaccells.Thesecataboliceffectsaremediated for ω-6 PUFA metabolites and resolvins (RVs), protectins, or in part by activation of PPAR-γ and AMP-activated protein maresins (MaRs) for ω-3 PUFA metabolites (21). kinase, the energy-sensing enzyme. This activation results The biosynthesis of lipid mediators occurs at sites of in the inhibition of malonyl-CoA decarboxylase, a key lipid inflammation and tissue injury. MaRs’ biosynthesis is ini- metabolism enzyme implicated in fatty acid biosynthesis tiated in macrophages by lipoxygenation of DHA, whereas (35). On the other hand, as ligands for PPAR-α and PPAR-γ , protectinsandRVsareformedbyawiderangeofcells DHAandEPAstimulatetheexpressionoflipoproteinlipase and tissues (22, 23). Overall, PUFAs generate proresolving and adipose triacylglycerol lipase, the lipolysis-mediating lipid mediators, including arachidonic acid (AA)–derived enzymes, essential for lipid utilization, further enhancing lipoxins, n–3 EPA–derived RVs of the E-series, DHA-derived their antiadipogenesis effects (36). RVs of the D-series, protectins, and MaRs, during the Long-chain ω-3 PUFAs exert a wide spectrum of antiobe- resolution phase of acute inflammation. These endogenous sity effects involving numerous molecular pathways. These hormone-like bioactive compounds are contributory factors include stimulating a unique fat oxidation pathway that of the regulation of pathologic inflammation and various results in generating heat instead of ATP biosynthesis. This physiologic activities in humans and animals (17, 24, 25). heat-generating pathway is specifically associated with BAT, These effects have been extensively studied and reviewed in which has physiologic functions different from those of WAT, mammals (17, 26–31). We will only provide a summary of the which serves the energy storage of the organism. ω-3 PUFAs major mechanisms in mammals. The rest of this review will modulate the expression of uncoupling protein-1 (UCP-1), focus on applications of the nematode model Caenorhabditis which mediates the thermogenesis function. Activating this elegans to ω-3 fatty acid studies. pathway is associated with adipose tissue mass reduction Numerous hypotheses have been proposed regarding (37, 38).Moreover,DHAandEPAsuppressfatsynthesis antiobesity and anti-inflammatory protective effects of and increase metabolism in adipose tissue via suppression of ω-3 PUFAs (Figure 3)(32, 33). These fatty acids modulate sterol regulatory element-binding protein-1 (SREBP-1) (39). the expression of genes associated with lipid oxidation in Long-chain ω-3 PUFAs ameliorate obesity-induced IR and

PUFA metabolic functions in mammals and nematodes 167 Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 3 Molecular mediators of the effects of long-chain ω-3 PUFAs. In adipocytes, ω-3 PUFAs modulate gene expression and promote biosynthesis of regulatory proteins, which enhance the utilization of carbohydrates and fats, reduce adipogenesis, increase insulin sensitivity, and ameliorate inflammation. AMPK, 5’AMP-activated protein kinase; CPT-1, carnitine palmitoyl transferase-1; FFAR4, free fatty acid receptor 4; GPR, G-protein–coupled receptor; IRS, insulin substrate receptor; NF-κB, nuclear factor kappa-B; SREBP-1, sterol regulatory element-binding protein-1. metabolicsyndromebyactivatingtheAMP-activatedprotein diabetes in vivo by repressing macrophage-induced tissue kinase pathway and enhancing the expression of adiponectin, inflammation43 ( ). an insulin-sensitizing adipokine (40). Both IR and obesity- Clinical data regarding the beneficial effects ω-3 PUFAs associated inflammation are further improved by DHA and are consistent with numerous animal studies demonstrating EPA via generation of the protective lipid mediators. Their that enriching a mouse high-fat diet (HFD) with ω-3 mechanistic roles appear interestingly more potent than their PUFAs, particularly EPA, prevents and even reverses the ω-3 PUFA precursors (40). development of fatty liver, glucose intolerance, and IR; Some of the anti-inflammatory effects of ω-3 fatty reduces adiposity and OS; lowers serum and tissue lipids; acids are receptor mediated. Polymorphonuclear leukocytes, and reduces the blood levels of such systemic inflammation monocytes and macrophages, and blood vessel endothelium markersasTNF-α, IL-6, and C-reactive protein (CRP) (40, all have been implicated in the systemic anti-inflammatory 44). The anti-OS protective effects of ω-3 fatty acids were effects triggered by ω-3 PUFAs (16). Given the potent previously reviewed in an article by Puglisi et al. (44). These andstereo-selectiveactionsofthespecificlipidmediators studies reported that consumption of ω-3–rich fish oil results generated from ω-3 fatty acids, they act via specific high- in a significant reduction in2 F -isoprostanes, a gold-standard affinity receptors, G protein–coupled receptors (GPRs), marker of systemic OS levels in adipose tissue. present in the membranes of the relevant cell types, including Overall, dietary intake of DHA and EPA has been GPR32, lipoxin A4 receptor/formyl peptide receptor 2, proven to be directly associated with human health and chemokine-like receptor 1, leukotriene B4 receptor type development. 1, and cannabinoid receptor 2 (22, 41). Activation of All of this suggests that science-based dietary interven- these receptors directly affects different anti-inflammatory tions, using ω-3 PUFAs or their combinations, represent a pathways that can further mediate the timely resolution of promising soft therapeutic approach to prevention and treat- inflammation in mammals27 ( , 42). The receptors GPR40 ment of diet-induced obesity and its associated comorbidities and GPR120 (43)alsomediatesomeoftheeffectsofω-3 fatty and provide insight into the mechanisms of ω-3 fatty acids acids. Oh and Walenta (30) found that anti-inflammatory and their actions (27). Dissecting molecular and physiologic effectsexertedbyDHAandEPAaremediatedbyintracellular mechanisms mediating the biological effects of ω-3 PUFAs signaling transmitted through the GPR120 receptor [also as well as the mechanisms regulating their metabolism named free fatty acid receptor 4 (FFAR4)], highly expressed has become a hot topic in biomedical research. The next in mature adipocytes and proinflammatory macrophages. section will focus on the C. elegans nematode as a novel Upon binding its ligand, GPR120 couples to β-arrestin 2, and exciting model organism for ω-3 PUFA–related studies. thus providing the inhibition of both the Toll-like receptor- Unlike most other animals, C. elegans is capable of de novo 4 (TLR4) and TNF-α proinflammatory signaling pathways synthesis of long-chain PUFAs. This model may yield new associated with NF-κB(43). The NF-κBpathwayisalso insights for the nutritional scientist interested in evaluating inhibited via activation of PPARs (26). The activation of the therapeutic potential of ω-3 PUFAs and using them GPR120 by supplementing the diet with ω-3 PUFAs increases for developing science-based diets for prevention and/or cell sensitivity to insulin and reduces the incidence of treatment of obesity and its associated metabolic disorders.

168 Bouyanfif et al. Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 4 Caenorhabditis elegans life cycle at 20°C. The life cycle of this nematode is ∼3.5 d. Under standard laboratory conditions, reproductive adult worms survive for ∼3 wk. The regular ontogenesis includes embryonic stage, 4 larval stages (L1–L4; separated by molts), and adulthood. Under stress conditions (starvation, crowding, high temperature), the roundworm can enter an alternative L3 stage called the Dauer state, which can last for several months. The Dauer larva develops from a pre-Dauer L2 (L2d). Numbers in red underneath the arrows show the time span that the worm stays at the indicated stage.

Furthermore, a decade ago, an emerging hot topic of these bacteria include their ability to form a thin layer interest for research that had been found to be involved after multiplying that allows for optimal visualization of the in a wide range of biological processes was the microRNA worms’ development. (miRNA) field. Originally, these molecules were discovered Another important advantage of C. elegans as a model in C. elegans and the first 2 known miRNAs are lineage organism is its short life span. As illustrated in Figure 4, abnormal (lin-4) and larval-lethal (let-7) (45). They are found aneggdevelopstoanadultwithin∼3.5 d at 20°C. As with in most eukaryotes including humans. C. elegans has proven other nematodes, C. elegans develops through 4 larval stages to be the ideal organism for miRNA research. Currently, (L1–L4), separated by molts (53, 54)(Figure 4). The whole there is evidence that miRNAs play a potent role in the life span is ∼3 wk. The period required for generating adult regulation of gene expression, controlling diverse cellular nematodes capable of producing progeny is as short as 3.5 d, and metabolic pathways including lipid metabolism and which is ∼15-fold shorter than in mice and 3-fold shorter adipocyte differentiation processes, which are both related to than in Drosophila melanogaster fruit flies or Danio rerio obesity (46). Thus, these fascinating molecules can be used as (zebrafish). C. elegans can be easily and cheaply cultivated in promising biomarkers via the dysfunction and dysregulation large numbers, i.e., ∼10,000 worms/plate in the laboratory of several proteins (47). (300–350 progenies/nematode). There are 2 sexual forms As discussed previously, given the prevalence of obesity, of the worm: a self-fertilizing hermaphrodite and a male understanding its pathogenesis is becoming critical in order thatissmallerinsizeandrare.Themalecanberecognized to develop better dietary and pharmacologic therapies. by its fan-shaped tail. The adult hermaphrodite, which is Hence, ω-3 fatty acids, especially EPA, may reduce or the first higher organism that had its genome completely prevent complications linked to obesity by regulating specific sequenced, harbors ∼17,800 distinct genes, 65% of which miRNAs (48, 49). are associated with human diseases (55). Despite the genetic homology between humans and C. elegans being lower than Review of C. elegans as a Model Organism that between humans and the mouse, D. melanogaster,or and Its Advantages zebrafish, C. elegans still represents a physiologically relevant In 1963, the South African biologist Sydney Brenner in- model for studying lipid metabolism due to its completely troduced Caenorhabditis elegans (Caeno,recent;rhabditis, sequenced genome and ease of genetic manipulation and rod; elegans,nice),commonlynamedC. elegans,asamodel screening for mutants having necessary metabolic deviations. organism to pursue research in developmental biology and For instance, genetic defects in fatty acid desaturation and neurology (50, 51). C. elegans is a free-living, nonparasitic, elongation provide a set of mutant worm strains ( fatty acid nonhazardous, noninfectious, and nonpathogenic soil nema- desaturase (fat)-1, fat-2, fat-3, fat-4, fatty acid elongation tode that has been widely used in laboratories worldwide. (elo)-1) incapable of PUFA synthesis, which makes the This roundworm is transparent throughout its life cycle and lipid metabolism in these strains similar to that of humans is ∼1 mm in length at adulthood. In different regions of (56). Interestingly, C. elegans has only 959 somatic cells, the world, C. elegans lives in the soil, mainly in rotting of which 302 are neurons and 95 are muscle cells (57). vegetation, where it can feed on bacteria. Under laboratory Last but not least, no ethics constraints are associated with conditions, it is routinely cultured in an agar petri dish culturing C. elegans. It reduces significantly the “indirect seeded with Escherichia coli as a food source providing workload” related to getting quick answers for emerging carbohydrates, proteins, SFAs, and MUFAs derived from research questions related to human or animal health. The digestion of bacterial membranes (52). Advantages of using same is true for D. melanogaster and zebrafish, but these

PUFA metabolic functions in mammals and nematodes 169 otherwise simple model species are not as easily manageable be conducted via biochemical assays, measuring fat uptake and convenient for housing and reproduction purposes. and fat oxidation, and via other methods appropriate for Tables 1 and 2 provide comparisons between C. elegans and most model organisms (55). But, in addition, due to the other model organisms as well as differences and similarities transparency of the C. elegans body, its fat depositions can in lipid metabolism between C. elegans and mammals. be easily visualized in the intact nematode with the use of Taken together, these unique characteristics make C. lipid-specific dyes, such as Nile Red, Oil Red O, or Sudan

elegans an effective model and an attractive pool of resources Black, which do not affect the C. elegans brood size, growth Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 for scientists to use in a variety of biomedical research areas. rate, or life span (60). The quantification of visualized fats Key C. elegans advantages as a model organism include the can be performed simply by measuring the intensity of the following (50, 58): accumulated dye (61, 62). Like in mammals, and as discussed already, a wide range • its small size and transparent body that enable nonin- of SFAs, MUFAs, and PUFAs such as ω-6 AA (20:4ω-6) and vasive imaging and scaled screening of the effects of ω-3 EPA (20:5ω-3), as well as monomethyl branched-chain treatments through the use of microscopy techniques; fatty acids, are present in C. elegans (60, 63). • constant cell numbers and position between individual Triglycerides in C. elegans represent ∼40–55% of total worms; body lipids depending on diet and growth stage (60, 64). The • rapid growth, quick turnover, and large brood sizes, principal phospholipids are ethanolamine (∼55%), choline which reduce the experimental timeline compared with (32%), and sphingomyelin (8%). Cardiolipin, inositol, and rodent and other animal studies; lyso-choline account for the remaining 5% of phospholipids • simple nervous system, which dissects neural circuits (65, 66). that govern metabolism, nutrient perception, and food- In addition to mammals, ࢞-12 and ࢞-15 desaturases have related behaviors; been identified in some plantsArabidopsis ( thaliana), lower • C. elegans culture can be placed in long-term storage eukaryotes, and animals such as nematodes. These enzymes as frozen stock and avoid the expenses associated with introduce a double bond at the 12th and 15th carbon-carbon long-term colony maintenance; positions in fatty acid molecules (17). Figure 6 indicates • because C. elegans is a nematode, its use does not the synthetic pathways of ω-3 and ω-6 PUFAs from their require research ethics approval unlike with rodents common precursors stearic and oleic acids (stearic acid (SA) and higher animals, further facilitating research on this and oleic acid (OA)) to 20-carbon fatty acids in C. elegans.Itis organism; noteworthy that, unlike other animals including humans, the • the small size of its well-annotated genome, which C. elegans organism contains both -12 and -15 enzymes facilitates genetic analyses as well as producing genet- (57, 67). For this reason, C. elegans does not require essential ically modified roundworm strains. The mutations can fatty acids supplemented with the diet. be easily introduced into the C. elegans genome by Excluding the nematodes, all other mammals including a variety of mutagens. Thus, many highly affordable humans lack ω-3 desaturase genes that convert ω-6 fatty genetically modified strains, such as dumpy, small, acids to ω-3 fatty acids. Among nematodes, the roundworm and long mutated worms are available for biomedical C. elegans, unlike most other animals, possesses the genes for research from the Caenorhabditis Genetics Center the protein products mediating the endogenous biosynthesis (Minnesota). This center is funded by the NIH— of long-chain ω-3 PUFAs including the fat-1 gene, coding National Center for Research Resources. the ω-3 desaturase (-15 desaturase) required for converting Current studies report the use of C. elegans as a model or- the ω-6 fatty acids 18-carbon LA and γ -linolenic acid into ganism for exploring a variety of biological processes includ- ω-3 ALA and stearidonic acid, respectively (68). Another ing apoptosis, insulin signaling, gene regulation, metabolism, unique fatty acid metabolism gene carried by C. elegans is aging, and satiety. Importantly, in obesity, C. elegans has fat-2,codingthe-12 enzyme, which mediates the synthesis been used for unraveling the mechanisms of dyslipidemia, of 18-carbon ω-6 LA from its precursor, 18-carbon ω-9, the for ascertaining endocrine regulation deviations, as well as MUFA OA (69, 70). The other 2 enzymes, -6 desaturase for evaluating the effects of dietary interventions and other encoded by the fat-3 gene and -5 desaturase encoded by obesity therapies (55). Table 3,basedontheNationalCenter the fat-4 gene, are involved in the biosynthesis of 20-carbon for Biotechnology Information (59), summarizes some key PUFAs (Figure 6). However, as in mammals, C. elegans’ C. elegans metabolic genes. -9 fatty acid desaturases, encoded by the fat-5 and fat- 6/fat-7 genes,areregulatedbythetranscriptionalregulator sterol response element binding protein (SREBP) and nuclear Related Research on ω-3 Fatty Acid Metabolism hormone receptors (NHRs). ࢞-9 Fatty acid desaturases That Has Been Conducted in C. elegans and convert SFAs into MUFAs. However, C. elegans lacks Knowledge Gained the specific enzyme required for fatty acid elongation to Wild-type C. elegans nematode stores fat mainly in droplets 22-carbon PUFAs (60). Similar to mammals, C. elegans within its hypodermal and intestinal cells (Figure 5). The possesses key enzymes (e.g., acetyl CoA carboxylase and fatty quantification of fats accumulated in the C. elegans body may acid synthase) for fatty acid biosynthesis (60, 67).

170 Bouyanfif et al. TABLE 1 Comparisons between Caenorhabditis elegans and other model organisms Organism Advantages Drawbacks Nematode (Caenorhabditis elegans) - Small size/959 somatic cells - Only 65% of worm genes homologous to human genes -Simpleanatomy - Lacking some organs and tissues: blood, brain, and - Transparent body internal organs - Short life span: 2–3 wk - Cultures may be subject to contamination - Short generation time: 2–3 d - Inexpensive and easy to grow Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 - Cultures can be frozen - Genome is sequenced and annotated Fruit fly (Drosophila melanogaster) - Small size - Only 50–80% of fly genes homologous to human - Short generation time: 10 d genes - Inexpensive and easy to grow - Lack of physiologic similarity with humans - Genome is sequenced and annotated - Cultures cannot be frozen Zebrafish (Danio rerio) - Small size - Long generation time: 2–4 mo - Transparent embryos - Isogenic strains are not available - Draft genome is available Pufferfish (Fugu rubripes) - Genome is sequenced and annotated - Produces lethal toxin - Very small genome for a vertebrate - No transgenic technology exists Mouse (Mus musculus) - Strong genetic, physiologic overlap with - Comparatively expensive humans - Comparatively long life span - Genome is sequenced and annotated - Comparatively long generation time: 2–3 mo - Ethical concerns Chimpanzee (Pan troglodytes) - Genome is sequenced and annotated - Long life span - Most closely related to humans - Long generation time - Very expensive and labor-consuming housing - Ethical concerns

Thepresenceofacompletesetoffattyacidmetabolism body adiposity, growth retardation, reproductive defects, genes that code all enzymes, found in plants and animals, changes in physiologic rhythms, slowed movement, reduced required for desaturating and elongating fatty acid molecules, adult life span, as well as defects in sensory signaling and makes C. elegans a unique model organism for lipid neurotransmission (71–77). metabolism studies. In addition, core fat and sugar metabolic Mutant C. elegans strains, lacking the activity of certain pathways in C. elegans are similar to their mammalian desaturases, were used as a model organism in research analogs. devoted to the anti-inflammatory effects of PUFAs in repro- Genetic alterations of metabolic enzymes affect fat deposi- duction, neurobiological studies, as well as in experiments tion in C. elegans. Inactivation of specific proteins belonging onthenematodelifespanandontogenesis(67). Importantly, to the desaturase and elongase families (encoded by fat C. elegans does not express such mediators of inflammation and elo genes, respectively) results in lipid metabolism as TNF-α and NF-κB, extensively used for evaluating the deviations (60), which may mimic different aspects of dys- severity of inflammation in other vertebrate animal models lipidemia in humans. In worms, inactivation of these genes and humans. Because C. elegans’ body does not have blood is associated with metabolic, physiologic, and behavioral vessels, the roles of PUFAs can be studied independently of nematode phenotypes, such as reduced body size, deviated their inflammatory functions67 ( ). Furthermore, the impacts

TABLE 2 Differences and similarities in lipid homeostasis between Caenorhabditis elegans and mammals1 Lipid metabolism regulators C. elegans Mammals -9 Desaturase Fatty acid synthesis Fatty acid synthesis -12 Desaturase Fatty acid synthesis Not available ω-3 Fatty acyl desaturase Fatty acid synthesis Not available Insulin-like pathway Lipid metabolism Lipid metabolism AMP-activated protein kinase Fat storage and use Fat storage and use Serotonin signaling Fat metabolism and feeding behavior Fat metabolism and feeding behavior SREBP Fat storage Fat storage TUB-1 protein Peripheral lipid storage Peripheral lipid storage Leptin Not available Food intake and energy balance LDL family receptors Fatty acid transport Fatty acid transport 1SREBP, sterol response element binding protein; TUB-1, Tubby protein homolog 1.

PUFA metabolic functions in mammals and nematodes 171 TABLE 3 Genes related to nutrition and obesity research in Caenorhabditis elegans mutants, strain: Bristol N2 C. elegans gene name Description Location daf-2 (Dauer Insulin-like growth factor receptor subunit β Chromosome III, NC_003281.10 (2995919..3028702, complement) formation-2) daf-7 (Dauer Dauer larva development regulatory growth factor daf-7 Chromosome III, NC_003281.10 (811938..813275) formation-7) daf-16 Forkhead box protein O Chromosome I, NC_003279.8 (10750498..10775050) _ daf-18 Hypothetical protein Chromosome IV, NC 003282.8 (420426..425148, complement) Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 tub-1 Tubby protein homolog 1 Chromosome II, NC_003280.10 (8154771..8156937, complement) tph-1 Tryptophan hydroxylase Chromosome II, NC_003280.10 (7549358..7551777) egl-30 Hypothetical protein Chromosome I, NC_003279.8 (1835936..1840888) fat-1 ω-3 Fatty acid desaturase fat-1 Chromosome IV, NC_003282.8 (13315646..13318606) fat-2 (12)-Fatty-acid desaturase fat-2 Chromosome IV, NC_003282.8 (13323880..13326278) fat-3 (6)-Fatty-acid desaturase fat-3 Chromosome IV, NC_003282.8 (9803063..9805999) fat-5 (9)-Fatty-acid desaturase fat-5 Chromosome V, NC_003283.11 (17725005..17726717) fat-6 (9)-Fatty-acid desaturase fat-6 Chromosome IV, NC_003282.8 (11913819..11915668, complement) fat-7 (9)-Fatty-acid desaturase fat-7 Chromosome V, NC_003283.11 (7151447..7153131, complement) acdh-11 Acyl-CoA dehydrogenase family member 11 Chromosome III, NC_003281.10 (10566286..10571549) eat-2 Neuronal acetylcholine receptor subunit eat-2 Chromosome II, NC_003280.10 (14166888..14171484, complement) act-5 Actin Chromosome III, NC_003281.10 (13604554..13606066, complement) nhr-49 Nuclear hormone receptor family Chromosome I, NC_003279.8 (9869718..9874124) acs-2 Fatty acid CoA synthetase family Chromosome V, NC_003283.11 (15567408..15569685) mai-2 ATPase inhibitor mai-2, mitochondrial Chromosome IV, NC_003282.8 (3385911..3386765) mdt-15 Mediator of RNA polymerase II transcription subunit 15 Chromosome III, NC_003281.10 (5830222..5833337, complement) SCD-1 (stearoyl-CoA Suppressor of constitutive Dauer formation Chromosome X, NC_003284.9 (12504620..12509217, complement) desaturase) SCD-2 (stearoyl-CoA ALK tyrosine kinase receptor homolog scd-2 Chromosome V, NC_003283.11 (6633269..6639420) desaturase) kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Chromosome II, NC_003280.10 (7073815..7075409) SBP-1 Sterol regulatory element binding protein Chromosome III, NC_003281.10 (11428418..11442565, complement) let-767 Very-long-chain 3-oxooacyl-coA reductase let-767 Chromosome III, NC_003281.10 (6338598..6339955, complement)

of specific fatty acids on life span and aging processes high sugar content leads to excessive lipid accumulation in C. elegans were recently evaluated (78, 79). Previous and eventually causes obesity, diabetes, and heart disease studies have demonstrated that synthesis of PUFA-derived (84, 85). Supplementing the C. elegans diet with OA mediators (F-series prostaglandins) in this worm is mediated (ω-9, monounsaturated), AA (ω-6, polyunsaturated), and by insulin signaling in the intestine and TGF-β signaling EPA (ω-3, polyunsaturated) influences both the reproduc- in sensory neurons to ensure the process of reproduction tion and longevity of these animals (86). Regarding the (67, 80). Furthermore, dietary supplementation of dihomo- neural function of C. elegans,Watts(67) reported that 20- γ -linolenic acid (DGLA; 20:3ω-6)resultedinsterilityas- carbon PUFAs are required for synaptic vesicle formation sociated with germ cell death due to apoptosis, caused by and accumulation, and both ω-6 and ω-3 PUFAs perform production of specific epoxy- and hydroxyl-toxic metabolites therequiredcellularfunctionsbuttheyhavedifferentrolesin through the activity of CYP-33E2, one of the major isoforms neurologic processes; ω-3 fatty acids are specifically required of the cytochrome-P450 protein family, involved in the for maintaining neuroplasticity. In particular, they are capa- production of long-chain fatty acid metabolites (81). On the ble of compensating the effects of alcohol intoxication in this contrary, high amounts of EPA-rich fish oil intake did not model (87). affect C. elegans’fertility(71). However, it led to a shorter Clinical and animal model studies are very valuable in life span due to OS caused by accumulation of reactive understanding the mechanisms mediating the effects of lipid peroxidation products, damaging cell proteins and bioactivefoodcompoundssuchasω-3 fatty acids. However, nucleic acids. A recent study reported that OA derivatives, these are both expensive and time consuming, and are ethanolamide and oleoylethanolamide, accumulate in C. often limited for research studies, due to ethical concerns. elegans, over expressing lysosomal acid lipase 4 (LIPL-4) and Therefore, there is a critical need for affordable and efficient lacking the germline. LIPL-4 triggered nuclear translocation animal models for scaled screening of various bioactive of LPB-8 (lysosomal lipid chaperone), thereby increasing compounds or pharmacologic agents in various diseases longevity by activating NHR-49 and NHR-80 and regulating including obesity. In this review, we focused on the C. elegans ࢞-9 desaturase expression (82). nematode as an affordable, convenient, and metabolically Moreover, adding low amounts of glucose to C. elegans’ relevant model organism to understand the mechanisms diet shortens the life span of the worm by inhibiting the mediating the effects of ω-3 PUFAs in obesity and inflam- DAF-16 and HSF-1 transcription factors (83). In humans, mation. C. elegans can be further expanded and applied

172 Bouyanfif et al. Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 5 Visualization of intestinal fat droplets in the Caenorhabditis elegans body. (A) Oil Red O staining in N2 wild-type and fat-3 mutant worms. (B) Nile Red staining in N2 wild-type nematode. Because of the transparency of C. elegans’body, lipid droplets, intestine, and embryos are easily visualized through the use of conventional staining protocols. fat-3 mutants lack delta 6 desaturase. to other metabolic studies that use dietary compounds a pri-miRNA, is cleaved by the protein complex, which, in and botanicals. However, despite all the excellent features C. elegans, includes DRSH-1 RNase (Drosha in mammals) discussed so far, there are also numerous drawbacks for and PASH-1 (Partner of Drosha; Pasha in mammals) (90), to this nematode as a model organism. The long evolutionary produce the 60- to 70-nucleotides–long intermediate called distance between C. elegans and humans, including the pre-miRNA (91). After its transport to the cytoplasm, the fact that the simple body of C. elegans lacks such essential pre-miRNA is converted to functional miRNA by additional tissues and organs for human physiology as blood, brain, and cleavage performed by Dicer endoribonuclease as well as defined fat cells, and is subjected to significantly different ALG-1 and ALG-2 proteins (92, 93), which belong to the mechanisms of central regulation, poses a question: whether argonaute (AGO) RNase family and are the only 2 AGOs the data generated through the use of this worm can in C. elegans,reportedtotakepartinmiRNAbiosynthesis. be directly extrapolated to humans. Most likely, the lipid Other 24 AGO proteins, described for the worm, participate metabolism data generated through the use of C. elegans in gene regulation processes, mediated by other small RNAs will require further validation via a mouse or another model (94). In the cytoplasm, mature miRNA is complexed with organism more closely related to humans. Also, the small ALG-1/ALG-2, AIN-1/AIN-2 (GW-182 in mammals), and size of C. elegans canbeanissuewhencomparativelyhigh poly(A)-binding protein (PABP) molecules to create an amounts of tissues or cells are required for biochemical RNA-induced silencing complex (RISC), which binds the 3- and/or molecular analyses. untranslated region of target mRNA and prevents protein biosynthesis on this molecule by interfering with the process Role of miRNAs in Mediating Nutritional and of translation on its initiation and/or elongation phases or Obesity-Related Effects in C. elegans and in by destabilizing the target mRNA itself (95). Importantly, Other Animal Models miRNAs are multipurpose molecules: a typical miRNA is miRNAs are a group of small noncoding RNAs that function capable of regulating the translation of ∼200 target mRNAs as specific post-transcriptional inhibitors of target gene (96). expression (88). miRNAs are ubiquitous in both animal C. elegans was the first model where miRNAs were and plant genomes and are highly conserved between discovered. Several C. elegans strains as well as a few related species. By their ability to quench gene expression, other Caenorhabditis specieswereusedbyLeeetal.(97) miRNAs are similar to small interfering RNAs, another to report the first miRNA molecule in their pioneering class of regulatory noncoding RNA molecules, but miRNA study published in 1993. They demonstrated that a small biogenesis from maternal DNA sequences is quite different RNA product, produced from the nonprotein encoding from small interfering RNA synthesis (89). While still in the lin-4 genetic locus, directly inhibits the translation of the nucleus, the primary long transcript of the miRNA gene, lin-14 C. elegans gene, coding for the transcription factor

PUFA metabolic functions in mammals and nematodes 173 Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019

FIGURE 6 Metabolism of ω-3 and ω-6 PUFAs in Caenorhabditis elegans. Unlike humans, C. elegans is capable of producing ω-3 PUFAs via the enzymatic conversion of various ω-6 PUFAs, biosynthesized from the short-chain stearic and oleic acid precursors. 5D, -5 desaturase (encoded by the fat-4 gene); 6D, -6 desaturase (encoded by the fat-3 gene); 9D, -9 desaturase; 12D, -12 desaturase (encoded by the fat-2 gene); ω3D, ω-3 desaturase (encoded by the fat-1 gene). fat encodes fatty acid desaturase genes. involved in larva development regulation. Numerous other regarding the role of miRNAs in obesity and inflammation miRNAs regulating a wide variety of genes and biological in rodent models. To our knowledge, studies of protective processes were discovered for C. elegans and other species antiobesity or anti-inflammatory miRNA-mediated effects of (98–100). For humans, >2600 miRNAs have been described ω-3 PUFAs or other bioactive food components that use C. to date (101),andthepredictednumberofmiRNAsencoded elegans are absent from the literature. by the human genome is >6000 (102). The fact that, among We now briefly review the published animal studies in miRNA genes harbored by the human genome, about one- this area. Zheng et al. (106)werefirsttousetheinvivorat half have analogs in C. elegans (103)makesthisroundworm model of diet-induced chronic inflammation to investigate a fit model for studies of the role of miRNAs in regulating the alterations in the miRNA transcriptome caused by gene activity and physiologic functions in health and disease. supplementing the rat diet with ω-3EPAandDHAPUFAs Moreover, unlike when studying a specific gene, which may compared with ω-6 LA. The authors found that after 16 wk only relate to one or very few pathways, studying miRNAs of the respective diets, the expression of 54 miRNA genes was provides a more comprehensive understanding of biological different in animals fed the EPA and DHA (1.5:1) mix than systems and functions, because they can target numerous and those whose diet was enriched with ω-6 PUFAs. Feeding rats distinct metabolic genes across diverse biological processes. withEPAandDHAwasassociatedwithincreasednumbers Therefore, identifying miRNAs that mediate responses to ofbloodregulatoryTcellsaswellaslevelsofIL-6and PUFAs or other nutrients can provide a better understanding TNF-α cytokine markers of inflammation. The list of pro- of whole-tissue and possibly whole-body responses to dietary and anti-inflammatory pathways, presumably affected by interventions. these miRNAs, included, in particular, pattern recognition Despite the wealth of resources related to C. elegans and receptors, the nucleotide-binding oligomerization domain miRNA research in this organism, very few studies have used (NOD)-like and Toll-like receptors, and TGF-β.Inthestudy, C. elegans as a model organism for dissecting the role of miR- which used a mouse model of HFD-induced obesity to NAs in the regulation of diet-induced metabolic genes and investigate the effects of ω-3 compared with ω-6 PUFAs pathways related to obesity or metabolic diseases. To date, on brown adipogenesis (107), upregulation of miR-30b rodents and cell systems remain a principal animal model and miR-378 miRNAs in BAT after 12 wk of the diet for such studies. Numerous published studies have reported was reported for the HFD-fed animals whose diet was mechanisms of miRNA-mediated regulation of metabolism enriched with EPA but not ω-6 OA or LA. The observed and other vital functions in C. elegans (reviewed in references increase was mediated by stimulation of FFAR4/GRP120, the 104, 105).Further,anumberofstudieswerepublished ω-3 PUFA receptor expressed by adipocytes, and associated

174 Bouyanfif et al. TABLE 4 miRNAs in Caenorhabditis elegans related to longevity and immunity1 Factor, modulating Molecular miRNA expression targets Biological function regulated References miR-48 Bacterial infection SKN-1 Resistance to infection (110) miR-71 Diet restriction PHA-4, SKN-1 Longevity (108) miR-80 Ad libitum feeding CBP-1 Longevity (106) miR-84 Bacterial infection SKN-1 Longevity, resistance to infection (110) Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 miR-228 Diet restriction PHA-4 Longevity (108) miR-241 Bacterial infection SKN-1 Longevity, resistance to infection (110) 1 CBP-1, cytochrome B mRNA processing; miRNA, microRNA; PHA-4, defective PHArynx development 4; SKN-1, skinhead-1. with elevation of cellular cAMP levels. Moreover, silencing the let-7-Fam family. In particular, in wild-type nematodes the activity of the 2 aforementioned miRNAs in vitro by exposed to P. ae r ug ino s a at early ontogenesis stages, miR- respective antisense inhibitors resulted in compromising the 241 levels are decreased ∼2-fold, indicating its negative regular BAT gene expression pattern. The expression of association with the mechanisms of antibacterial defense. UCP-1 (thermogenin), a key mitochondrial transmembrane Moreover,2mutantC. elegans strains devoid of miR-84 or protein mediating heat generation in brown, but not white, miR-241 demonstrated improved survival levels in response adipocytes was significantly reduced when these miRNAs to challenge by P. ae r ug ino s a or, to a lesser extent, by were inhibited. other microbial pathogens. These data are corroborated by Whereas limited studies have addressed effects of dietary reports that the let-7 family of miRNAs are downregulated in components in C. elegans, this model was used to unravel the mammalsinresponsetobacterialandprotozoaninfections role of miRNAs in mediating the protective effects of dietary (114–116). The expression of these miRNAs in C. elegans is restriction (DR). Expression of miR-80 is upregulated in well- modulatedviathep38MAPKpathway,whichalsoregulates fed worms and is reduced in conditions of food deprivation. the roundworm’s developmental timing (113). Consistent Genetic deficiency of this miRNA mimics constitutively the with these effects of miRNAs on the worm’s immunity, conditions of DR and is associated with a life span extension deficiency in the aforementioned Dicer protein, a crucial reg- in C. elegans (108). Consistently, when miR-80 is absent, C. el- ulator of miRNA biosynthesis, is associated with significant egans becomes hypersensitive to metformin, the antidiabetic alterations in the expression of genes involved in C. elegans’ drug that also induces a DR-like state in these nematodes immune responses (117). (108, 109). The study authors hypothesized that miR-80 Taken together, the aforementioned experiments suggest switches C. elegans’metabolismtoDRmodebyinactivating that C. elegans has emerged as a convenient and highly the mRNA of CBP-1 transcription factor, the C. elegans relevant research tool for elucidating the cellular and molec- homolog of the mammalian cAMP response element binding ular mechanisms of the effects of ω-3 fatty acids on animal protein (CREBP)/p300 family (Table 4). More transcription and human health. However, further research is needed to factors, involved in mediating the DR-induced longevity by understand the role of miRNAs in metabolic responses to diet miRNAs in C. elegans, were identified by network analysis and diseases such as obesity and for potential translation of of aging-associated miRNAs conducted by Smith-Vikos findings from C. elegans to humans. et al. (111). Defective PHArynx development 4 (PHA-4), previously described as C. elegans’ embryonic development regulator and a homolog of mammalian hepatocyte nuclear Conclusions and Future Directions of the Field factor 3 (HNF3) (110), is downregulated by miR-71 and Scientific evidence is accumulating that bioactive food com- miR-228. In addition, miR-71 inhibits SKN-1 (skinhead-1), ponents, including ω-3 PUFAs discussed here, modulate the the C. elegans homolog of Nuclear factor-erythroid–related expression of genes involved in lipid metabolism, energy bal- factor (Nrf), the family of transcription factors regulating ance, and homeostasis. Including these fatty acids into diets the metabolism and stress response in mammals (112). may provide both antiobesity and anti-inflammatory benefits Expression of both these miRNAs is enhanced in DR. in metabolic diseases. C. elegans has emerged as a valuable Interestingly, 2 targeted transcription factors exert different model organism and tool for obesity and nutrition studies. feedback regulation effects on inhibiting miRNAs. PHA-4 Due to its short life cycle, unique fatty acid metabolism, stimulates miR-228 expression. SKN-1 downregulates miR- availability and ease of generation of mutants with targeted 228 and promotes miR-71. These findings suggest that a set deletions of long-chain fatty acid metabolizing genes, and of miRNAs, induced by DR, acts as a coordinated network simple genetics relevant to humans, C. elegans represents a with a complicated system of feedback loops. highly relevant time-sparing model organism for biomedical AstudybyLiuetal.(113) illustrated that regulation of and nutritional investigations. It can be conveniently used to innate immunity in C. elegans is also mediated by miRNAs. further dissect mechanisms mediating metabolic effects of ω- TheresistanceofinfectedwormsagainstPseudomonas 3PUFAsandotherbioactivecompounds,aswellasinfuture aeruginosa,anopportunistichumanpathogenprovidedas mechanistic studies of the role of miRNAs in mediating a food, is inhibited by the group of miRNAs that belong to dietary regulations and in health and disease.

PUFA metabolic functions in mammals and nematodes 175 Acknowledgments 18. Zhou X-R, Green AG, Singh SP. Caenorhabditis elegans 12- All authors contributed to this manuscript and read and desaturase FAT-2 is a bifunctional desaturase able to desaturate a   approved the final manuscript. diverse range of fatty acid substrates at the 12 and 15 positions. J Biol Chem 2011;286(51):43644–50. 19. Massey KA, Nicolaou A. Lipidomics of polyunsaturated-fatty- References acid-derived oxygenated metabolites. Biochem Soc Trans 2011; 1. Malik VS, Willett WC, Hu FB. Global obesity: trends, risk factors and 39(5):1240–6. 20. Harris WS, Mozaffarian D, Rimm E, Kris-Etherton P, Rudel policy implications. Nat Rev Endocrinol 2013;9(1):13–27. Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 2. Obesity Update 2017. Organization for Economic Co-operation LL, Appel LJ, Engler MM, Engler MB, Sacks F. Omega-6 fatty and Development (OECD). Available from: http://www. acids and risk for cardiovascular disease: a science advisory from oecd.org/els/health-systems/Obesity-Update-2017.pdf. the American Heart Association Nutrition Subcommittee of the 3. Hales CM, Carroll MD, Fryar CD, Ogden CL. Prevalence of Obesity Council on Nutrition, Physical Activity, and Metabolism; Council Among Adults and Youth: United States, 2015–2016. NCHS Data on Cardiovascular Nursing; and Council on Epidemiology and Brief No. 288; October 2017. Centers for Disease Control and Prevention. Circulation 2009;119(6):902–7. Prevention, National Center for Health Statistics (NCHS). Available 21. Demarquoy J, Le Borgne F. Biosynthesis, metabolism and function of from: https://www.cdc.gov/nchs/data/databriefs/db288.pdf. protectins and resolvins. Clin Lipidol 2014;9(6):683–93. 4. The National Institutes of Health; the National Institute of Diabetes 22. Serhan CN, Petasis NA. Resolvins and protectins in inflammation and Digestive and Kidney Diseases Health Information Center. resolution. Chem Rev 2011;111(10):5922–43. [Internet]. 2017. Available from: https://www.niddk.nih.gov/health- 23. Kohli P, Levy BD. Resolvins and protectins: mediating solutions to information/health-statistics/overweight-obesity. inflammation. Br J Pharmacol 2009;158(4):960–71. 5. Action of the American Medical Association (AMA) House of 24. Meesapyodsuk D, Qiu X. The front-end desaturase: structure, Delegates 2013 Annual Meeting: Recommendations in Report function, evolution and biotechnological use. Lipids 2012;47(3):227– 3 of the Council on Science and Public Health Report. 2013. 37. Available from: https://www.ama-assn.org/sites/default/files/media- 25. Barden AE, Mas E, Mori TA. n-3 Fatty acid supplementation browser/public/about-ama/councils/Council%20Reports/council-on- and proresolving mediators of inflammation. Curr Opin Lipidol science-public-health/a13csaph3.pdf. 2016;27(1):26–32. 6. Finkelstein EA, Trogdon JG, Cohen JW, Dietz W. Annual medical 26. Kromhout D, Yasuda S, Geleijnse JM, Shimokawa H. Fish oil and spending attributable to obesity: payer-and service-specific estimates. omega-3 fatty acids in cardiovascular disease: do they really work? Eur Health Affairs 2009;28(5). Bending The Cost Curve. Heart J 2012;33(4):436–43. 7. Institute of Medicine (US) Committee on an Evidence Framework for 27. Campbell SC, Bello NT. Omega-3 fatty acids and obesity. J Food Nutr Obesity Prevention Decision Making; Kumanyika SK, Parker Disord 2012;1(2):105. L, Sim LJ. editors. Bridging the Evidence Gap in Obesity 28. Leaf A. Prevention of sudden cardiac death by n-3 polyunsaturated Prevention: A Framework to Inform Decision Making. Washington fatty acids. J Cardiovasc Med (Hagerstown) 2007;8(Suppl 1):S27–9. (DC): National Academies Press (US), 2010; 2, Obesity 29.WangJ,ShiY,ZhangL,ZhangF,HuX,ZhangW,LeakRK,GaoY, Prevention Strategies in Concept and Practice. Available from: Chen L, Chen J. Omega-3 polyunsaturated fatty acids enhance cerebral https://www.ncbi.nlm.nih.gov/books/NBK220174/. angiogenesis and provide long-term protection after stroke. Neurobiol 8. Jung UJ, Choi MS. Obesity and its metabolic complications: the role of Dis 2014;68:91–103. adipokines and the relationship between obesity, inflammation, insulin 30. Oh DY, Walenta E. Omega-3 fatty acids and FFAR4. Front Endocrinol resistance, dyslipidemia and nonalcoholic fatty liver disease. Int J Mol 2014;5:115. Sci 2014;15(4):6184–223. 31. Aben A, Danckaerts M. [Omega-3 and omega-6 fatty acids in the 9. Kalupahana NS, Claycombe KJ, Moustaid-Moussa N. (n-3) Fatty treatment of children and adolescents with ADHD]. Tijdschr Psychiatr acids alleviate adipose tissue inflammation and insulin resistance: 2010;52(2):89–97. mechanistic insights. Adv Nutr 2011;2(4):304–16. 32. Jayarathne S, Koboziev I, Park OH, Wilna OT, Shen CL, Moustaid- 10. Calder PC. n-3 Fatty acids, inflammation and immunity: new Moussa N. Anti-inflammatory and anti-obesity properties of food mechanisms to explain old actions. Proc Nutr Soc 2013;72(3):326–36. bioactive components: effects on adipose tissue. Prev Nutr Food Sci 11. Borthwick LA. The IL-1 cytokine family and its role in inflammation 2017;22(4):251–62. and fibrosis in the lung. Semin Immunopathol 2016;38(4):517–34. 33. Murumalla RK, Gunasekaran MK, Padhan JK, Bencharif K, Gence L, 12.CarboneS,LeePJ,MauroAG,MezzaromaE,BuzzettiR,VanTassell FestyF,CésariM,RocheR,HoareauL.Fattyacidsdonotpaythe B, Abbate A, Toldo S. Interleukin-18 mediates cardiac dysfunction toll:effectofSFAandPUFAonhumanadiposetissueandmature induced by western diet independent of obesity and hyperglycemia in adipocytes inflammation. Lipids Health Dis 2012;11:175. Available the mouse. Nutr Diabetes 2017;7(4):e258. from: http://www.lipidworld.com/content/11/1/175. 13. Fernandez-Sanchez A, Madrigal-Santillan E, Bautista M, Esquivel- 34. Buckley JD, Howe PRC. Long-chain omega-3 polyunsaturated fatty Soto J, Morales-Gonzalez A, Esquivel-Chirino C, Durante- acids may be beneficial for reducing obesity—a review. Nutrients Montiel I, Sanchez-Rivera G, Valadez-Vega C, Morales-Gonzalez 2010;2(12):1212–30. JA. Inflammation, oxidative stress, and obesity. Int J Mol Sci 35. Flachs P, Horakova O, Brauner P, Rossmeisl M, Pecina P, Franssen- 2011;12(5):3117–32. van Hal N, Ruzickova J, Sponarova J, Drahota Z, Vlcek C, et al. 14. Fasipe O. Recent advances and current trend in the pharmacotherapy Polyunsaturated fatty acids of marine origin upregulate mitochondrial of obesity. Arch Med Health Sci 2018;6(1):99–116. biogenesis and induce beta-oxidation in white fat. Diabetologia 15. Johansson K, Neovius M, Hemmingsson E. Effects of anti-obesity 2005;48(11):2365–75. drugs, diet, and exercise on weight-loss maintenance after a very- 36. Grygiel-Górniak B. Peroxisome proliferator-activated receptors and low-calorie diet or low-calorie diet: a systematic review and meta- their ligands: nutritional and clinical implications—a review. Nutr J analysis of randomized controlled trials. Am J Clin Nutr 2014;99(1): 2014;13:17. 14–23. 37. Reddy JK, Mannaerts GP. Peroxisomal lipid metabolism. Annu Rev 16. Calder PC. Omega-3 fatty acids and inflammatory processes. Nutrients Nutr 1994;14:343–70. 2010;2:355–74. 38. Takahashi Y, Ide T. Dietary n-3 fatty acids affect mRNA level of 17. Lee JM, Lee H, Kang S, Park WJ. Fatty acid desaturases, brown adipose tissue uncoupling protein 1, and white adipose tissue polyunsaturated fatty acid regulation, and biotechnological advances. leptin and glucose transporter 4 in the rat. Br J Nutr 2000;84: Nutrients 2016;8(1):23. 175–84.

176 Bouyanfif et al. 39. Todorceviˇ c´ M, Hodson L. The effect of marine derived n-3 fatty acids 62.YenK,LeTT,BansalA,NarasimhanSD,ChengJX,Tissenbaum on adipose tissue metabolism and function. J Clin Med 2016;5(1):3. HA. A comparative study of fat storage quantitation in nematode 40. Gonzalez-Periz A, Horrillo R, Ferre N, Gronert K, Dong B, Moran- Caenorhabditis elegans using label and label-free methods. PLoS One Salvador E, Titos E, Martinez-Clemente M, Lopez-Parra M, Arroyo 2010;5(9):0012810. V, et al. Obesity-induced insulin resistance and hepatic steatosis are 63. Kniazeva M, Crawford QT, Seiber M, Wang C-Y, Han M. Monomethyl alleviated by omega-3 fatty acids: a role for resolvins and protectins. branched-chain fatty acids play an essential role in Caenorhabditis FASEB J 2009;23(6):1946–57. elegans development. PLoS Biology 2004:0020257. 41. Freire MO, Van Dyke TE. Natural resolution of inflammation. 64. O’Rourke EJ, Soukas AA, Carr CE, Ruvkun G. C. elegans major fats are Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 Periodontol 2000 2013;63(1):149–64. stored in vesicles distinct from lysosome-related organelles. Cell Metab 42. Kohli P, Levy BD. Resolvins and protectins: mediating solutions to 2009;10:430–35. inflammation. Br J Pharmacol 2009;158(4):960–71. 65. Satouchi K, Hirano K, Sakaguchi M, Takehara H, Matsuura F. 43.OhDY,TalukdarS,BaeEJ,ImamuraT,MorinagaH,FanWQ,LiPP, Phospholipids from the free-living nematode Caenorhabditis elegans. Lu WJ, Watkins SM, Olefsky JM. GPR120 is an omega-3 fatty acid Lipids 1993;28(9):837–40. receptor mediating potent anti-inflammatory and insulin-sensitizing 66.TanakaT,IkitaK,AshidaT,MotoyamaY,YamaguchiY,SatouchiK. effects. Cell 2010;142(5):687–98. Effects of growth temperature on the fatty acid composition of the free- 44. Puglisi MJ, Hasty AH, Saraswathi V. The role of adipose tissue in living nematode Caenorhabditis elegans. Lipids 1996;31(11):1173–8. mediating the beneficial effects of dietary fish oil. J Nutr Biochem 67. Watts JL. Using Caenorhabditis elegans to uncover conserved 2011;22(2):101–8. functions of omega-3 and omega-6 fatty acids. J Clin Med 2016;5(2):19. 45. Vella MC, Slack FJ. C. elegans microRNAs. WormBook 2005:1–9. 68. Spychalla JP, Kinney AJ, Browse J. Identification of an animal omega-3 46. Esau C, Davis S, Murray SF, Yu XX, Pandey SK, Pear M, Watts fatty acid desaturase by heterologous expression in Arabidopsis. Proc L,BootenSL,GrahamM,McKayR,etal.miR-122regulationof Natl Acad Sci U S A 1997;94(4):1142–7. lipid metabolism revealed by in vivo antisense targeting. Cell Metab 69. Wang M, Chen H, Gu Z, Zhang H, Chen W, Chen YQ. ω-3 fatty acid 2006;3(2):87–98. desaturases from microorganisms: structure, function, evolution, and 47. Peng Y, Yu S, Li H, Xiang H, Peng J, Jiang S. MicroRNAs: emerging biotechnological use. Appl Microbiol Biotechnol 2013;97(24):10255– roles in adipogenesis and obesity. Cell Signal 2014;26(9):1888–96. 62. 48. Kalupahana NS, Claycombe K, Newman SJ, Stewart T, 70. Zhou XR, Green AG, Singh SP. Caenorhabditis elegans 12- Siriwardhana N, Matthan N, Lichtenstein AH, Moustaid-Moussa Desaturase FAT-2 is a bifunctional desaturase able to desaturate a N. Eicosapentaenoic acid prevents and reverses insulin resistance in diverse range of fatty acid substrates at the 12 and 15 positions. high-fat diet-induced obese mice via modulation of adipose tissue J Biol Chem 2011;286(51):43644–50. inflammation. J Nutr 2010;140(11):1915–22. 71. Watts JL, Browse J. Dietary manipulation implicates lipid signaling 49. Kalupahana NS, Moustaid-Moussa N, Claycombe KJ. Immunity as in the regulation of germ cell maintenance in C-elegans. Dev Biol a link between obesity and insulin resistance. Mol Aspects Med 2006;292(2):381–92. 2012;33(1):26–34. 72. Lesa GM, Palfreyman M, Hall DH, Clandinin MT, Rudolph C, 50. Riddle DL, Blumenthal T, Meyer BJ, Priess JR. Introduction to C. Jorgensen EM, Schiavo G. Long chain polyunsaturated fatty acids are elegans. In: DL Riddle, T Blumenthal, BJ Meyer, JR Priess, editors. required for efficient neurotransmission in C. elegans. Cell Science C elegans II. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor 2003;116:4965–75. Laboratory Press; 1997. 73. Kahn-Kirby AH, Dantzker JL, Apicella AJ, Schafer WR, Browse J, 51. Nigon VM, Félix MA. History of research on C. elegans and other Bargmann CI, Watts JL. Specific polyunsaturated fatty acids drive free-living nematodes as model organisms. WormBook, editor. The TRPV-dependent sensory signaling in vivo. Cell Metab 2004;119:889– C. elegans Research Community, WormBook; 2017. Available from: 900. http://www.wormbook.org. 74. Kniazeva M, Sieber M, McCauley S, Zhang K, Watts JL, Han M. 52. Brooks KK, Liang B, Watts JL. The influence of bacterial diet on fat Suppression of the ELO-2 FA elongation activity results in alterations storage in C. elegans. PLoS One 2009;4(10):e7545. of the fatty acid composition and multiple physiological defects, 53. Cassada RC, Russell RL. The dauerlarva, a post-embryonic including abnormal ultradian rhythms, in Caenorhabditis elegans. developmental variant of the nematode Caenorhabditis elegans. Genetics 2003;163(1):159–69. Dev Biol 1975;46(2):326–42. 75. Van Gilst MR, Hadjivassiliou H, Jolly A, Yamamoto KR. Nuclear 54. Murgatroyd C, Spengler D. Histone tales: echoes from the past, hormone receptor NHR-49 controls fat consumption and fatty acid prospects for the future. Genome Biol 2010;11(2):105. composition in C. elegans. PLoS Biology 2005;3(2):e53. 55. Zheng J, Greenway FL. Caenorhabditis elegans as a model for obesity 76. Brock TJ, Browse J, Watts JL. Genetic regulation of unsaturated fatty research. Int J Obes (Lond) 2012;36(2):186–94. acid composition in C. elegans. PLoS Genet 2006;2(7):108. 56. Watts JL, Browse J. Genetic dissection of polyunsaturated fatty acid 77. Watts JL, Phillips E, Griffing KR, Browse J. Deficiencies inC20 synthesis in Caenorhabditis elegans. Proc Natl Acad Sci U S A polyunsaturated fatty acids cause behavioral and developmental 2002;99(9):5854–9. defects in Caenorhabditis elegans fat-3 mutants. Genetics 57. Imanikia S, Stürzenbaum SR. Invertebrates in obesity research: a 2003;163:581–9. worm’s perspective. In: Animal models for the study of human disease. 78. Schroeder EA, Brunet A. Lipid profiles and signals for long life. Trends MP Conn, editor. Dordrecht, Netherlands: Elsevier Academic Press; Endocrinol Metab 2015;26(11):589–92. 2013. 79. Amrit FRG, Ratnappan R, Keith SA, Ghazi A. The C. elegans lifespan 58. Jones KT, Ashrafi K. Caenorhabditis elegans as an emerging model assay toolkit. Methods 2014;68(3):465–75. for studying the basic biology of obesity. Dis Models Mech 2009;2(5– 80. Edmonds JW, Prasain JK, Dorand D, Yang Y, Hoang HD, Vibbert J, 6):224–9. Kubagawa HM, Miller MA. Insulin/FOXO signaling regulates ovarian 59. National Center for Biotechnology Information, US National Library prostaglandins critical for reproduction. Dev Cell 2010;19(6):858–71. of Medicine. Gene [Internet]. Available from: https://www.ncbi. 81. Deline M, Keller J, Rothe M, Schunck WH, Menzel R, Watts JL. nlm.nih.gov/gene. Epoxides derived from dietary dihomo-gamma-linolenic acid induce 60. Ashrafi K. Obesity and the regulation of fat metabolism. In: germ cell death in C. elegans. Sci Rep 2015;5:15417. WormBook, editor. The C. elegans Research Community, WormBook; 82.FolickA,OakleyHD,YuY,ArmstrongEH,KumariM,Sanor 2007:1-20. Available from: http://www.wormbook.org. L, Wang MC. Lysosomal signaling molecules regulate longevity in 61. Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, Caenorhabditis elegans. Science 2015;347(6217):83–6. Ruvkun G. Genome-wide RNAi analysis of Caenorhabditis elegans fat 83.LeeSJ,MurphyCT,KenyonC.Glucoseshortensthelife regulatory genes. Nature 2003;421(6920):268–72. span of C. elegans by downregulating DAF-16/FOXO activity

PUFA metabolic functions in mammals and nematodes 177 and aquaporin gene expression. Cell Metab 2009;10(5):379– evidence for the expression of numerous novel primate- and tissue- 91. specific microRNAs. Proc Natl Acad Sci U S A 2015;112(10):E1106– 84. DiNicolantonio JJ, Lucan SC, O’Keefe JH. The evidence for saturated 15. fatandforsugarrelatedtocoronaryheartdisease.ProgCardiovascDis 103. Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T. New 2016;58(5):464–72. microRNAs from mouse and human. RNA 2003;9(2):175–9. 85. Kolderup A, Svihus B. Fructose metabolism and relation to 104. Chandra S, Vimal D, Sharma D, Rai V, Gupta SC, Chowdhuri DK. atherosclerosis, type 2 diabetes, and obesity. J Nutr Metab 2015: Role of miRNAs in development and disease: lessons learnt from small 823081. organisms. Life Sci 2017;185:8–14. Downloaded from https://academic.oup.com/advances/article-abstract/10/1/165/5299945 by Texas Tech University Libraries user on 20 February 2019 86. Lynn DA, Dalton HM, Sowa JN, Wang MC, Soukas AA, Curran SP. 105. Zhu Z, Zhang D, Lee H, Jin Y. Caenorhabditis elegans: an important Omega-3 and -6 fatty acids allocate somatic and germline lipids to tool for dissecting microRNA functions. Biomed Genet Genom ensure fitness during nutrient and oxidative stress in Caenorhabditis 2016;1(2):34–6. elegans. Proc Natl Acad Sci USA 2015;112(50):15378–83. 106. Zheng Z, Ge Y, Zhang J, Xue M, Li Q, Lin D, Ma W. PUFA diets alter 87. Raabe RC, Mathies LD, Davies AG, Bettinger JC. The omega-3 fatty the microRNA expression profiles in an inflammation rat model. Mol acid eicosapentaenoic acid is required for normal alcohol response Med Rep 2015;11(6):4149–57. behaviors in C. elegans. PLoS One 2014;9(8):e105999. 107. Kim J, Okla M, Erickson A, Carr T, Natarajan SK, Chung S. 88. HaM,KimVN.RegulationofmicroRNAbiogenesis.NatRevMolCell Eicosapentaenoic acid potentiates brown thermogenesis through Biol 2014;15(8):509–24. FFAR4-dependent up-regulation of miR-30b and miR-378. J Biol 89. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and Chem 2016;291(39):20551–62. function. Cell 2004;116(2):281–97. 108. Vora M, Shah M, Ostafi S, Onken B, Xue J, Ni JZ, Gu S, Driscoll M. 90. Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ. Processing Deletion of microRNA-80 activates dietary restriction to extend C. of primary microRNAs by the Microprocessor complex. Nature elegans healthspan and lifespan. PLoS Genet 2013;9(8):e1003737. 2004;432(7014):231–5. 109. Onken B, Driscoll M. Metformin induces a dietary restriction-like 91. Lima SA, Pasquinelli AE. Identification of miRNAs and their targets in state and the oxidative stress response to extend C. elegans healthspan C. elegans. Adv Exp Med Biol 2014;825:431–50. via AMPK, LKB1, and SKN-1. PLoS One 2010;5(1):e8758. 92. Bouasker S, Simard MJ. The slicing activity of miRNA-specific 110. Horner MA, Quintin S, Domeier ME, Kimble J, Labouesse M, Mango Argonautes is essential for the miRNA pathway in C. elegans. Nucleic SE. pha-4, an HNF-3 homolog, specifies pharyngeal organ identity in Acids Res 2012;40(20):10452–62. Caenorhabditis elegans. Genes Dev 1998;12(13):1947–52. 93. Hutvagner G, Simard MJ, Mello CC, Zamore PD. Sequence-specific 111. Smith-Vikos T, de Lencastre A, Inukai S, Shlomchik M, Holtrup B, inhibition of small RNA function. PLoS Biol 2004;2(4):E98. Slack FJ. MicroRNAs mediate dietary-restriction-induced longevity 94. Grishok A. Biology and mechanisms of short RNAs in Caenorhabditis through PHA-4/FOXA and SKN-1/Nrf transcription factors. Curr Biol elegans. Adv Genet 2013;83:1–69. 2014;24(19):2238–46. 95. Li Z, Rana TM. Therapeutic targeting of microRNAs: current status 112. Blackwell TK, Steinbaugh MJ, Hourihan JM, Ewald CY, Isik M. SKN- and future challenges. Nat Rev Drug Discov 2014;13(8):622–38. 1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free 96. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein Radic Biol Med 2015;88(Pt B):290–301. EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M, 113. Liu F, He CX, Luo LJ, Zou QL, Zhao YX, Saini R, Han SF, Knolker et al. Combinatorial microRNA target predictions. Nat Genet HJ, Wang LS, Ge BX. Nuclear hormone receptor regulation of 2005;37(5):495–500. microRNAs controls innate immune responses in C. elegans. PLoS 97. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene Pathog 2013;9(8):e1003545. lin-4 encodes small RNAs with antisense complementarity to lin-14. 114. Chen XM, Splinter PL, O’Hara SP, LaRusso NF. A cellular micro- Cell 1993;75(5):843–54. RNA, let-7i, regulates Toll-like receptor 4 expression and contributes 98. Gesellchen V, Boutros M. Managing the genome: microRNAs in to cholangiocyte immune responses against Cryptosporidium parvum Drosophila. Differentiation 2004;72(2–3):74–80. infection. J Biol Chem 2007;282(39):28929–38. 99. Lehrbach NJ, Miska EA. Functional genomic, computational and 115. Hu G, Zhou R, Liu J, Gong AY, Eischeid AN, Dittman JW, Chen XM. proteomic analysis of C. elegans microRNAs. Brief Funct Genomic MicroRNA-98 and let-7 confer cholangiocyte expression of cytokine- Proteomic 2008;7(3):228–35. inducible Src homology 2-containing protein in response to microbial 100. Lewis MA, Steel KP. MicroRNAs in mouse development and disease. challenge. J Immunol 2009;183(3):1617–24. Semin Cell Dev Biol 2010;21(7):774–80. 116. Schulte LN, Eulalio A, Mollenkopf HJ, Reinhardt R, Vogel J. Analysis 101. Kozomara A, Griffiths-Jones S. miRBase: annotating high confidence of the host microRNA response to Salmonella uncovers the control of microRNAs using deep sequencing data. Nucleic Acids Res major cytokines by the let-7 family. EMBO J 2011;30(10):1977–89. 2014;42(Database issue):D68–73. 117. Welker NC, Habig JW, Bass BL. Genes misregulated in C. elegans 102. Londin E, Loher P, Telonis AG, Quann K, Clark P, Jing Y, Hatzimichael deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity E, Kirino Y, Honda S, Lally M, et al. Analysis of 13 cell types reveals genes. RNA 2007;13(7):1090–102.

178 Bouyanfif et al. Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX B Vibrational Spectroscopy 96 (2018) 74-82

268

Vibrational Spectroscopy 96 (2018) 74–82

Contents lists available at ScienceDirect

Vibrational Spectroscopy

journal homepage: www.elsevier.com/locate/vibspec

Review of FTIR microspectroscopy applications to investigate

biochemical changes in C. elegans

a,b,c a a a,b,c

Amal Bouyanfif , Sumedha Liyanage , Eric Hequet , Naima Moustaid-Moussa , a,

Noureddine Abidi *

a

Fiber and Biopolymer Research Institute, Texas Tech University, Lubbock, TX, USA

b

Department of Nutritional Sciences, Texas Tech University, Lubbock, TX, USA

c

Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

A R T I C L E I N F O A B S T R A C T

Article history:

Received 21 December 2017 Caenorhabditis elegans nematode has emerged as a model organism paving the ways for multidisciplinary

Received in revised form 1 February 2018 research in biomedical, environmental toxicology, aging, metabolism, obesity, and drug discovery. The

Accepted 2 March 2018 wide range of applications of this model organism are attributed to C. elegans’ unique features: C. elegans

Available online 8 March 2018

are inexpensive, easy to grow and maintain in a laboratory, has a short lifespan, and has a small body size.

With this increased interest, the need for analytical techniques to assess the biochemical information on

Keywords:

intact worms continues to grow. Fourier Transform Infrared (FTIR) microspectroscopy is considered as a

C. elegans

powerful technique that can be used to determine the chemical structure and composition of various

FTIR imaging

materials, including biological samples. Furthermore, the development of focal plane array detectors has

Microspectroscopy

made this technique attractive to study complex biological systems such as whole nematodes. This

Nematodes

review focuses on the use of FTIR microspectroscopy to study C. elegans. The first published work on the

use of FTIR microspectroscopy to study a complex whole animal was reported in 2004. Since then, very

few other studies were carried out. The objective of this review is to summarize work conducted to date

using FTIR microspectroscopy to study nematodes and to discuss the information that can be gained by

using this technique. This could allow scientists to add this technique to the arsenal of techniques already

in use for C. elegans studies.

© 2018 Elsevier B.V. All rights reserved.

Contents

1. Introduction ...... 75

2. FTIR applications for nematode research ...... 75

2.1. FTIR FPA imaging of whole nematode ...... 75

2.2. Nematode identification ...... 76

2.3. Diet and genotype-dependent changes in chemical composition ...... 77

2.4. Biochemical composition ...... 79

2.5. Toxicity assessment ...... 81

3. Conclusions and perspectives ...... 81

Funding ...... 81

References ...... 74

Abbreviations: ATR, Attenuated Total Reflectance; CARS, Coherent Anti-Stokes Raman Scattering; CeMM, C. elegans maintenance media; EPA, eicosapentaenoic acid; FPA,

focal plane array; FTIR, Fourier Transform Infrared; GNPs, graphite nanoplatelets; HCA, hierarchical cluster analysis; NGM, nematode growth medium; PCA, principal

component analysis; KBr, potassium bromide; SRS, Stimulated Raman Scattering; v-3 PUFA, omega-3 polyunsaturated fatty acids; RH, relative humidity; MIP, mid-infrared

photothermal; C. elegans, Caenorhabditis elegans.

* Corresponding author at: 1001, East Loop 289, Lubbock, TX 79403, USA.

E-mail address: [email protected] (N. Abidi).

https://doi.org/10.1016/j.vibspec.2018.03.001

0924-2031/© 2018 Elsevier B.V. All rights reserved.

A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82 75

1. Introduction computer controlled motorized stage. The use of FPA detector

allows consecutive measurements on an array of points on the

Caenorhabditis elegans is a millimeter-long, transparent round- sample, which generates a chemical image of the sample. The

worm that is currently used as a model organism for several original average absorbance image is represented using a false-

investigations such as: obesity research [1], chemical and colour scheme, where similar colours are used to cluster pixels

biological research [2,3], drug discovery [4,5], lipid storage and with similar level of infrared absorbance. This image can be further

metabolism [6–11], and nanoparticle effects assessment [12–17]. processed to obtain distributions of different chemical functional

This nematode has gained popularity as a model for various studies groups.

because it is easy and inexpensive to grow and maintain in a

laboratory, has a simple anatomy, short life-span (3 weeks) [18], 2. FTIR applications for nematode research

and reproductive cycles of 3 days. In addition, the development of

C. elegans has been well studied and, therefore, induced changes 2.1. FTIR FPA imaging of whole nematode

can be easily detected. Furthermore, it does not require the

approval of the animal care committee to conduct experiments. Hobro and Lendl used FPA-FTIR imaging to study complex

The possibility of adopting C. elegans as a model organism for multicellular nematodes S. feltiae and H. heliothidis [30]. Dried

various studies has created the need for analytical techniques that nematodes were added to distilled water, mixed, centrifuged, and

can be used to determine the chemical composition on intact then the supernatant was removed. The authors re-suspended the

worms. Fourier Transform Infrared (FTIR) microspectroscopy has pellet in water and repeated the process twice to make sure that

emerged as a powerful and non-destructive technique to study the media was completely removed. Nematodes were then

various materials, including intact nematodes [19–21]. This deposited on ZnSe slide and dried at room temperature and

technique provides not only information on the presence of spectra were collected in transmission mode. IR images of

chemical species in the sample but is also able to provide their nematodes were acquired using an FPA detector with 64 64 pix-

spatial distribution in the area of interest within the sample. els. The authors used Hierarchical Cluster Analysis (HCA) of the

FTIR microspectroscopy has been established as a powerful tool acquired IR image. This technique measures the dissimilarity

for the study of plant [22], nematodes [23,24], biological macro- between the IR spectra in the image, so that the most similar

molecules [25–27] and complex biological systems [28,29]. FTIR spectra are combined to form one cluster. The number of clusters

spectroscopy deals with the measurement of infrared (IR) radiation indicates different chemical compounds in the sample. When

absorbed by the sample allowing the study of the molecular analysing H. heliothidis nematode, the HCA of the IR image showed

structure. When IR radiation is absorbed by molecules in the different clusters depicted in different colours: dark-blue, light-

sample, transitions between vibrational energy states of the blue, grey, and green. The dark-blue region was attributed to the

chemical bonds occur. Since these vibrational energies are specific digestive tract of the nematode, which represents the methylene

1

to the chemical bonds, the spectra contain information about the stretching group in fatty acids (vibrations at 2920 and 2850 cm )

functional groups and the chemical structure of the compounds in [30]. The light-blue cluster was associated with the head/pharynx,

the sample. Traditional IR measurements were performed using lower body, and tail region, while the grey cluster was associated

Potassium bromide (KBr) technique. In this technique, a small with the main part of the body on either side of the digestive tract

amount of the sample (powder) is dispersed in KBr, a pellet is [30]. The authors indicated that both clusters (light-blue and grey

made, and then spectra are acquired in transmission mode. Diffuse clusters) have high a-helical protein components and low amount

reflectance can be performed directly on powdered samples. These of lipids compared to the cluster depicted in dark-blue colour. The

techniques are destructive, limiting further analysis to be cluster depicted in green colour represented the edge of the

performed on the same sample. nematode and was essentially associated with C¼O stretching of

Technological advances in FTIR instrumentation resulted in the esters, amide II, and tyrosine vibrations. These results

development of Universal Attenuated Total Reflectance and demonstrated that HCA of IR images could illustrate biochemical

microscopes for imaging experiments (Fig. 1). Furthermore, the differences in different part of the nematode (digestive tract,

development of Focal Plane Array (FPA) detectors allows rapid cuticle, and different protein constituent in the body cavity).

imaging of a sample (with no special preparation), which opens Furthermore, the authors used HCA to compare seven different

new horizons for FTIR microspectroscopy. FTIR images of a sample nematode species (two S. feltiae and five H. heliothidis). The

can be obtained by mapping using microscope aperture and a results showed that the clusters can be associated specifically to a

particular species, demonstrating the potential of IR

microspectroscopy to discriminate between nematode species

and to provide biochemical composition within each individual

worm [30].

FPA-FTIR and Raman spectroscopy imaging were used as non-

destructive in-situ biochemical analysis of Steinernema Kraussei

nematode worms [31]. S. kraussei is approximately 20 mm in

diameter and 80–100 mm in length. The preparation of the worm

for FTIR imaging is described in detail in [31]. The IR images were

recorded in transmission mode using a Bruker Hyperion 3000 IR

microscope (Bruker, USA) equipped with an FPA detector (64 64

pixels, covering an area of 170 mm 170 mm). The results showed

that different anatomical regions of the nematode can be

distinguished based on the IR spectral variation. The authors

indicated that the use of the HCA to analyse the spectra acquired

from the S. kraussei worm led to biochemical information related to

Fig. 1. Fourier Transform Infrared microspectroscopy Spotlight coupled to

the digestive tract and the body cavity [31]. The authors selected

Spectrum 400 (PerkinElmer, MA, USA), equipped with liquid nitrogen cooled

five clusters (Fig. 2). The blue cluster represented the head and tail

128 128 Mercury-Cadmium-Telluride Focal Plane Array detector (FPA). UATR:

universal attenuated total reflectance. and exhibited a low total lipids (absence of C¼O, CH2, and CH3

76 A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82

Fig. 2. (A) Light microscopy image of S. Kraussei nematode, (B) False colour image resulting from HCA performed on IR spectra, showing five clusters, (C) Average IR spectra of

the clusters resolved in the HCA (B). Reprinted from [31] with permission from Elsevier.

vibrations) but high protein content (prominent vibrations assigned to C¼O), lipids, and carbohydrates exist between different

assigned to amide I and amide II) [31]. The grey cluster, along species. Furthermore, the authors indicated that the IR region

1

the length of the nematode, showed high protein content but low between 1300 and 800 cm is of particular interest to differentiate

lipid levels. The cyan cluster contains significant contribution of between nematode species, because this region has been reported

1

proteins (vibrations 1652 and 1547 cm assigned to amide I and as a fingerprint region of other organisms [32,33].

amid II). The red and green clusters showed intense vibrations at

1

2927 and 2855 cm (assigned to asymmetric CH2 and symmetric 2.2. Nematode identification

CH3 of methylene group in fatty acids), indicating a region rich in

lipids. The red cluster was associated with a relative increase in To study the chemical composition of C. elegans, FTIR micro-

1

proteins and carbohydrates (vibration 1162 cm assigned to spectroscopy imaging was used [23,34–36]. The interaction of the

CO). It was suggested that the red cluster reflected the contents infrared radiation with the chemical bonds of biomolecules in C.

of the digestive tract [31]. elegans led to useful information related to the chemical

Attenuated Total Reflectance (ATR) FTIR was used to characterize composition of the microorganism. The first reported FTIR study

entomopathogenic nematodes (Steinernema glaseri and Heterorhab- on a complex whole and dried C. elegans was performed by Ami

ditis indica) and to assess the differences between these nematodes et al. [23]. The authors investigated four soil free-living nematode

and C. elegans N2 wild strain [32]. The spectra were collected in species (Caenorhabditis elegans, Pristionchus lheritieri, Panagrolai-

reflectance mode using a Shimadzu IR Prestige-21 FTIR with a mus rigidus, Geomonhystera sp.). Single worms were washed twice

Deuterated Lanthanum Triglycine Sulfate (DLATGS) detector with distilled water, placed on ZnSe window, and then dried at

coupled to a 6 mm 3-refelction diamond-ZnSe crystal ATR plate room temperature for 30 min. Using an IR infrared microscope

MIRacle (Pike technologies). The ATR-FTIR spectra showed some (UMA 500, Digilab-USA) coupled to a spectrometer (FTS 40A,

similarities between S. glaseri, H. indica, and C. elegans (Fig. 3). Digilab-USA), the authors were able to acquire IR spectra in

However, some major important differences were observed at transmission mode from different regions of a single worm:

1 1

1745 cm and between 1200 and 900 cm . These results indicated pharynx, intestine, and tail regions. The authors indicated that

1

that biochemical differences in triglycerides (vibration 1745 cm infrared spectroscopy combined with multivariate analysis such as

A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82 77

Fig. 3. Attenuated Total Reflectance Fourier Transform Infrared average spectra of Heterorhabditis indica, Steinernema glaseri, and Caenorhabditis elegans. Reprinted from [32]

with permission from Elsevier.

principal component analysis (PCA) can be used to illustrate acid (EPA) at 25 or 100 mM. Wild-type (N2) naturally makes

biochemical events at the molecular level by identifying metabolic omega-3 polyunsaturated fatty acids (v-3 PUFAs) including EPA,

fingerprints [23]. Due to differences in the FTIR spectra from while the mutant strain fat-3 lacks specific PUFA synthesis

selected parts in the worm, the spectra from the pharynx areas enzymes and mutation in tub-1 leads to increased fat deposition

could be used to distinguish between nematode species [23]. The and lifespan extension [38,39]. This research documented the

authors indicated that amide I and amide II protein bands (which ability of supplementing the growth media with varying amounts

are assigned to vibrational modes of backbone amide bonds) were of PUFAs. In this study, worms were rinsed with distilled water, and

of particular interest. Indeed, it has been reported that the individual hermaphrodite adult worms were mounted on BaF2

stretching mode of the C¼O is sensitive to the protein secondary slides and dried in a vacuum desiccator for 1 h. IR spectra were

structures [37]. The use of the second derivative of the spectra acquired in transmission mode using N2-cooled Mercury-Cadmi-

acquired from pharynx, intestine, and tail areas in the amide I um-Telluride FPA detector (128 128). Fig. 4 shows the visible

region allowed to identify b-structures, a-helices, and collagen. image of an individual worm along with the corresponding average

The results indicated that different proteins are present in different absorbance IR image. The red colour in the IR image indicates

regions of the worm based on the analysis of the amide I band. higher IR absorbance while the purple colour indicates lower IR

Furthermore, it was concluded that the principal chemical absorbance. Information on the distribution of functional groups

component in the tail was collagen. Ami et al. concluded that within individual worms could be obtained by developing

FTIR microspectroscopy could be used as a new tool for nematode functional group distribution images. Each pixel in the IR image

identification [23]. Four nematode species with clear phylogenetic (6.25 6.25 mm) is associated with an IR spectrum, which is

relationships were selected to explore the usefulness of FTIR developed by co-adding 128 spectra collected from the same pixel

1

imaging: Caenorhabditis elegans, Pristionchus lheritieri, Panagrolai- between 4000 and 1000 cm . These spectra are further analysed

mus rigidus, and Geomonhystera sp. The results showed that the to get biochemical information in individual worms.

1

region 1700–1500 cm , which contains amide I and amide II The analysis of the FTIR spectra acquired from different

bands, could be used to identify nematode species because band anatomical regions of wild-type C. elegans (head, middle, and tail)

components vary among the different nematode taxa [23]. indicated that the major differences are in unsaturated fatty acyl

1

groups (vibration 3008 cm assigned to CH¼CH stretching),

1

2.3. Diet and genotype-dependent changes in chemical composition saturated acyl groups (vibrations 2928 and 2848 cm assigned to

asymmetric CH2 and symmetric CH2 stretching respectively),

Recently, Bouyanfif et al. used FTIR imaging to detect diet and and fatty acids, triglycerides, phospholipids, or cholesterol esters

1

genotype-dependent changes in chemical composition in wild- (vibration 1744 cm assigned to C¼O stretching). The results

type (N2) C. elegans and mutant strains tub-1 and fat-3 [24]. The indicated that saturated acyl groups and unsaturated fatty acids are

objective of the work was to investigate changes in chemical stored primarily in the intestines. These results confirmed previous

composition when wild-type and mutant strains tub-1 and fat-3 studies, which reported that C. elegans nematodes store fats mainly

were grown in bacteria-free C. elegans maintenance media (CeMM) as droplets within the hydrothermal and intestinal cells [40,41]. Fat

alone, and in CeMM media supplemented with eicosapentaenoic storage quantification was performed by measuring the intensity of

78 A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82

Fig. 4. Visual image of wild-type (N2) C. elegans, corresponding average absorbance FTIR image, and spectra extracted from selected areas of the IR image.

staining of C. elegans by lipid-binding dyes (Nile Red, Oil Red O, or In addition to PCA, a cluster analysis can be performed using

Sudan Black) [42,43] or by using Coherent Anti-Stokes Raman squared Euclidean distance. The result is presented as a tree

Scattering (CARS) and Stimulated Raman Scattering (SRS) [1,6]. diagram that is frequently used to illustrate the arrangement of

Bouyanfif et al. used PCA to illustrate the differences in chemical the clusters produced by hierarchical clustering. Depending on

composition between worms raised in CeMM media without the selected numbers of clusters, the sample name is displayed

supplementation with EPA and when supplemented with EPA at by cluster colour. The clusters are separated based on the

25 mM and 100 mM [24]. PCA of FTIR spectra acquired from worms distance between the clusters. Figs. 5 and 6 show the

raised in CeMM alone separated wild-type (N2) from mutant dendrogram obtained by hierarchical cluster analysis of FTIR

strains tub-1 and fat-3 [24]. However, the spectra of tub-1 could not spectra acquired from wild-type and mutant strains tub-1 and

be separated from those of fat-3. This indicated that differences in fat-3 raised on normal CeMM. Two clusters are identified: one

chemical composition exist between wild-type and mutant strains. cluster for wild-type and another cluster for mutant strains tub-1

The difference spectra obtained by digital subtraction of mutant and fat-3.

strains’ spectra (tub-1 and fat-3) from these of wild-type indicated Interestingly, IR data of tub-1 showed that supplementing the

that the major difference between the wild-type and mutant CeMM with 100 mM EPA resulted in spectra similar to those of wild-

strains was in unsaturated and saturated lipids. When worms were type with no supplementation (Fig. 7). However, the spectra

cultured in CeMM supplemented with EPA, PCA separated the extracted from mutant fat-3 worms grown on the media

spectra of worms raised on CeMM without supplementation from supplemented with 25 or 100 mM EPA are not similar to those

those raised on CeMM supplemented with EPA. extracted from wild-type (Fig. 8). Further studies are needed with

A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82 79

Fig. 5. Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain tub-1.

Fig. 6. Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type and mutant strain fat-3.

increased concentrations of EPA to determine the effects of EPA microspectroscopy have been developed to overcome the above

concentration on fat-3 mutants. mentioned difficulty [19,44,45]. In their experiments, the authors

used Bristol N2 as a wild-type along with mutant strains LG I:

2.4. Biochemical composition VB2485, aex-5 (sv75); LG III: CB1370, daf-2(e1370); VB0027, ncl-1

(e1865). Hermaphrodite worms were washed in M9 buffer and

Sheng et al. reported on the use of FTIR microspectroscopy to placed on CaF2 slides and dried in a desiccator for at least 48 h [36].

investigate the biochemical composition of C. elegans [36]. The The FTIR spectra were acquired in transmission mode using Bruker

authors indicated that traditional biochemical analysis techniques Tensor 27 spectrometer equipped with Hyperion 3000 microscope

require relatively large amounts of materials for compositional (Bruker Optik GmbH). The spectra were normalized over the entire

analysis. In addition, these techniques may be inefficient due to spectral range, which enabled the authors to compare the relative

difficulty in isolating the desired cell type from tissues or amount of a particular chemical compound in different pixels. The

insufficient material can be extracted for biochemical analysis results demonstrated that changes in the relative levels of

[36]. Several analytical techniques that are based on vibrational carbohydrates, proteins and lipids in a single worm could be

80 A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82

Fig. 7. Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation and mutant strain tub-1 grown on

CeMM supplemented with 25 mM and 100 mM eicosapentaenoic acid (EPA).

Fig. 8. Dendrogram obtained by hierarchical cluster analysis of FTIR spectra acquired from wild-type grown with no supplementation and mutant strain grown on CeMM

supplemented with 25 mM and 100 mM eicosapentaenoic acid (EPA).

determined using FTIR microspectroscopy. Specifically, the IR FTIR microspectroscopy was also used to investigate the

results indicated that the relative intensities of the lipid-associated molecular mechanisms of anydrobiosis and to illustrate the role

1

bands between 2800 and 3000 cm were higher in daf-2 mutant of trehalose to preserve native membrane lipid packing during

intestines compared to those of the wild-type. The authors extreme desiccation followed by rehydration of Dauer Larva of C.

indicated that the results obtained from IR imaging are in elegans [46]. Worm strains used were: C. elegans wild-type (N2),

agreement with results obtained from gas-liquid chromatography daf-2(e1370), daf-7(e1372), tps-1(ok373), tps-2(ok526) and crossed

and that the daf-2 mutant contains higher levels of triglycerides. strains (tps-2(ok526);daf-2(e1370);tps-1(ok373) (daf-2;DDtps), and

The high polysaccharide intensities (vibrations in the range 1140– tps-2(ok526);tps-1(ok373) (DDtps). A controlled desiccation assay

1

1180 cm ) in daf-2 mutant compared to wild-type (N2) were was developed to allow accurate quantification of the survival rate

attributed either to the rate at which polysaccharides are under definite relative humidity (RH). Worms were precondi-

synthesized from sugars or to the rate at which polysaccharides tioned on the surface of a diamond attenuated-total-reflectance

are broken down. cell for 4 days at 98% RH and then desiccated for 1 day at 45% RH

A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82 81

and subsequently rehydrated at 97% RH. Preconditioning of worms region to monitor the aggregation kinetics of amyloid beta (Ab)

increased the levels of trehalose by 5-fold, which indicated that peptide (muscle specific gene Ab1-42) in CL4176 worms [35]. To

nematodes were able to respond to humidity changes by identify the secondary structure and the response of protein

synthesizing trehalose. Therefore, the authors investigated the aggregates, the authors calculated the second derivative of the IR

1

role of trehalose using mutant strain (DDtps) which lacks the spectra between 1700 and 1600 cm (amide I region). The results

enzyme catalysing trehalose biosynthesis (trehalose 6-phosphate showed that the induction of Ab1-42 expression resulted in a time-

1

synthase). The results showed that desiccation followed by dependent shift of the 1636 cm vibration towards lower energy

1

rehydration led to changes in the FTIR absorption spectra. The and in a new component around 1623 cm which was assigned to

1

focus was on the frequency region between 2800 and 3000 cm the intermolecular b-sheet structure of protein aggregates [35,54].

(representing CH stretching vibrations of acyl chain methylene), The authors found that when the majority of worms were

1

which indicates lipid-packing changes [47,48]. The intensities of paralyzed, the intensity of the vibration 1623 cm increases [35].

1

the vibrations 2916 and 2849 cm decreased upon drying of both The IR results were instrumental to indicate that administrating

strains. However, during desiccation the vibrations assigned to tetracyclines to worms, significantly reduced the intensity of the

1

lipids increased only in mutant strain daf-2; DDtps. The rehydra- vibration 1623 cm , which indicated that these drugs disas-

tion of daf-2 resulted in IR spectra that are mirror images of those sembled Ab oligomeric and fibrillary b-sheet assemblies, restor-

acquired upon drying, indicating a reversible process. However, the ing their non-amyloidogenic structures [35].

desiccation of mutant strain daf-2; DDtps led to irreversible Zanni et al. used C. elegans to study the toxicity of graphite

changes in the FTIR spectra. The authors concluded that native nanoplatelets (GNPs) [55]. Synchronized hermaphrodites wild-

packing of lipids are preserved during desiccation due to the effect type (N2) were incubated with GNPs at 16 C at different

of trehalose on cell membranes [46]. concentrations for 24 h, extensively washed with deionised water,

Abusharkh et al. investigated the role of phospholipid and then transferred onto bacteria-seeded NGM plates. After

headgroup composition and trehalose in the desiccation toler- treatments, worms were washed several times with deionised

ance of C. elegans [49]. The authors used time-resolved FTIR water to remove external GNPs, deposited on ZnSe window, and

difference spectroscopy to monitor fast hydration-induced struc- then dried at room temperature. Micro-Attenuated Total Reflec-

tural changes in the phospholipids film prepared from precondi- tance FTIR (mATR-FTIR) was used to investigate the efficiency of

tioned and non-preconditioned Dauer Larvae. The analysis of the GNPs intake as well as their distribution inside the worms. The

1 1

FTIR data indicated that the vibrations at 1260 cm (assigned to authors used the vibration 865 cm (assigned to CC lattice

1

PO2-), 1740 cm (assigned to C¼O), and vibrations between 3000 mode [56]) to illustrate the spatial distribution of GNPs [55]. The

1

and 2800 cm (assigned to CH2) were affected directly by results showed that the spectra of untreated worms did not

hydration-induced H-bonding. CH2 stretching responded to exhibit any vibrations assigned to CC. However, mapping of

changes in acyl chain free volume. The authors concluded that treated worms showed that GNPs were distributed along the

IR signatures provided a view on the extent of H-bonding at worm body. Furthermore, the same vibration was observed in the

different sites in the phospholipids headgroups and on the acyl embryos laid by the adult worm on the ZnSe window. The authors

chain order [49]. concluded that observing a vibration assigned to CC (originat-

Recently, Zhang et al. reported on the use of the mid- ing from GNPs) in the embryos was strong evidence that GNPs

infrared photothermal imaging (MIP) to study living cells and could transition from the intestines to gonads [55]. The outcomes

organisms [50]. In their study, the authors placed live C. elegans of this study confirmed the usefulness of the FTIR micro-

(with liquid media mixed with 200 mM sodium azide for spectroscopy to study the distribution of carbon nanomaterials

anesthesia) in a calcium-fluoride glass bottom dish for MIP in C. elegans.

imaging. FTIR spectra were acquired in reflectance mode. The

authors were able to perform in-vivo MIP imaging of lipid and 3. Conclusions and perspectives

protein in C. elegans [50]. The lipid distribution of the worm body

1

was assessed at 1750 cm (C¼O band), while the protein Due to its unique characteristics, C. elegans nematode has

1

distribution in the same area was assessed at 1655 cm (amid I attracted tremendous interests for varieties of studies. This

band) [50]. The authors concluded that MIP technology is increase has created a need for tools to study intact whole

promising approach for broad applications ranging from investi- nematodes. FTIR microspectroscopy has been widely adopted to

gating metabolic activities to high-resolution mapping of drug determine vibrational characteristics of chemical bonds in various

molecules in living cells [50]. compounds, thus, allowing the determination of the molecular

structure as well as the chemical composition. In biological

2.5. Toxicity assessment samples (such as C. elegans), the FTIR spectra are composed of

vibrations assigned to carbon-hydrogen bonds, amide bonds,

In addition to its use as model in biology for varieties of hydroxyl bonds, carbonyl bonds, and sugar rings. These vibrations

studies, C. elegans has been used in chemistry [3,51], materials originate from the major biomolecules found in cells (such as

science and medicine [2], as a tool for in-vivo assessment of polypeptides, carbohydrates, and compounds containing long-

nanoparticles toxicity [14,15,52,53], and as a versatile platform for chain fatty acyl moieties such as triglycerides and phospholipids).

drug discovery [5]. Diomede et al. reported that tetracycline and Therefore, any change in the biochemical composition of C.

its analogues protect C. elegans from b amyloid-induced toxicity by elegans will translate into changes in the FTIR spectra. Further-

targeting oligomer [35]. The authors seeded the Nematode Growth more, the development of FPA detectors coupled with a

Medium (NGM) plates with tetracycline-resistant E. coli for 54 h at microscope allow visualization of the sample as well as quickly

16 C then the temperature was raised to 24 C to induce the generate an IR image from a sample, which provides a spatial

transgene expression. Paralysis was scored at 2 h intervals until distribution of the chemical functional groups of the sample being

worms were paralyzed [35]. FTIR measurements were performed investigated. The major goal for this review is to stimulate the

on single intact worms taken directly from the agar plate. Worms application of the FTIR microspectroscopy to study C. elegans and

were washed with distilled water, deposited on BaF2 IR window doing so will provide a useful addition to the already available

and dried at room temperature for 30 min. The IR spectra were techniques for various investigations using C. elegans as an

acquired in transmission mode at different times from the pharynx experimental model.

82 A. Bouyanfif et al. / Vibrational Spectroscopy 96 (2018) 74–82

Funding [27] D. Ami, L. Bonecchi, S. Cali, G. Orsini, G. Tonon, S.M. Doglia, FT-IR study of

heterologous protein expression in recombinant Escherichia coli strains,

Biochim. Biophys. Acta 1624 (2003) 6–10.

This research did not receive any specific grant from funding

[28] M. Jackson, M.G. Sowa, H.H. Mantsch, Infrared spectroscopy: a new frontier in

fi

agencies in the public, commercial, or not-pro t sectors. medicine, Biophys. Chem. 68 (1997) 109–125.

[29] M. Diem, S. Boydston-White, L. Chiriboga, Infrared spectroscopy of cells and

tissues: Shining light onto a novel subject, Appl. Spectrosc. 53 (1999) 148a–

References 161a.

[30] A.J. Hobro, B. Lendl, Fourier-transform mid-infrared FPA imaging of a complex

[1] J. Zheng, F.L. Greenway, Caenorhabditis elegans as a model for obesity research, multicellular nematode, Vib. Spectrosc. 57 (2011) 213–219.

–

Int. J. Obes. 36 (2012) 186 194. [31] K. Lau, A. Hobro, T. Smith, T. Thurston, B. Lendl, Label-free non-destructive in

[2] M.C.K. Leung, P.L. Williams, A. Benedetto, C. Au, K.J. Helmcke, M. Aschner, J.N. situ biochemical analysis of nematode Steinernema kraussei using FPA-FTIR

Meyer, Caenorhabditis elegans: an emerging model in biomedical and and Raman spectroscopic imaging, Vib. Spectrosc. 60 (2012) 34–42.

–

environmental toxicology, Toxicol. Sci. 106 (2008) 5 28. [32] E. San-Blas, M. Guerra, E. Portillo, I. Esteves, N. Cubillan, Y. Alvarado, ATR/FTIR

[3] S.E. Hulme, G.M. Whitesides, Chemistry and the worm: Caenorhabditis elegans characterization of Steinernema glaseri and Heterorhabditis indica, Vib.

as a platform for integrating chemical and biological research, Angew. Chem. Spectrosc. 57 (2011) 220–228.

–

Int. Ed. 50 (2011) 4774 4807. [33] M. Essendoubi, D. Toubas, M. Bouzaggou, J.M. Pinon, M. Manfait, G.D.

’

[4] L.P. O Reilly, C.J. Luke, D.H. Perlmutter, G.A. Silverman, S.C. Pak, C. elegans in Sockalingum, Rapid identification of Candida species by FT-IR

– –

high-throughput drug discovery, Adv. Drug Deliv. Rev. 69 70 (2014) 247 253. microspectroscopy, Biochim. Biophys. Acta 1724 (2005) 239–247.

[5] M. Artal-Sanz, L. de Jong, N. Tavernarakis, Caenorhabditis elegans: a versatile [34] D. Ami, A. Natalello, S.M. Doglia, Fourier transform infrared microspectroscopy

–

platform for drug discovery, Biotechnol. J. 1 (2006) 1405 1418. of complex biological systems: from intact cells to whole organisms, Methods

[6] A. Folick, W. Min, M.C. Wang, Label-free imaging of lipid dynamics using Mol. Biol. 895 (2012) 85–100.

Coherent Anti-Stokes Raman Scattering (CARS) and Stimulated Raman [35] L. Diomede, G. Cassata, F. Fiordaliso, M. Salio, D. Ami, A. Natalello, S.M. Doglia,

–

Scattering (SRS) microscopy, Curr. Opin. Genet. Dev. 21 (2011) 585 590. A. De Luigi, M. Salmona, Tetracycline and its analogues protect Caenorhabditis

[7] G.J. Tserevelakis, E.V. Megalou, G. Filippidis, B. Petanidou, C. Fotakis, N. elegans from beta amyloid-induced toxicity by targeting oligomers, Neurobiol.

Tavernarakis, Label-free imaging of lipid depositions in C. elegans using third- Dis. 40 (2010) 424–431.

harmonic generation microscopy, PLoS One 9 (2014) e84431. [36] M. Sheng, A. Gorzsas, S. Tuck, Fourier transform infrared microspectroscopy

[8] T. Hellerer, C. Axang, C. Brackmann, P. Hillertz, M. Pilon, A. Enejder, Monitoring for the analysis of the biochemical composition of C. elegans worms, Worm 5

of lipid storage in Caenorhabditis elegans using Coherent Anti-Stokes Raman (2016) e1132978.

–

Scattering (CARS) microscopy, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 14658 [37] L.K. Tamm, S.A. Tatulian, Infrared spectroscopy of proteins and peptides in lipid

14663. bilayers, Q. Rev. Biophys. 30 (1997) 365–429.

[9] W.W. Chen, Y.H. Yi, C.H. Chien, K.C. Hsiung, T.H. Ma, Y.C. Lin, S.J. Lo, T.C. Chang, [38] A. Mukhopadhyay, B. Deplancke, A.J.M. Walhout, H.A. Tissenbaum, C. elegans

fi

Speci c polyunsaturated fatty acids modulate lipid delivery and oocyte tubby regulates life span and fat storage by two independent mechanisms,

development in C-elegans revealed by molecular-selective label-free imaging, Cell. Metab. 2 (2005) 35–42.

—

Sci. Rep. UK 6 (2016). [39] J.L. Watts, E. Phillips, K.R. Griffing, J. Browse, Deficiencies in C20

[10] D.A. Wharton, L. Petrone, A. Duncan, A.J. McQuillan, A surface lipid may control polyunsaturated fatty acids cause behavioral and developmental defects in

the permeability slump associated with entry into anhydrobiosis in the plant Caenorhabditis elegans fat-3 mutants, Genetics 163 (2003) 581–589.

–

parasitic nematode Ditylenchus dipsaci, J. Exp. Biol. 211 (2008) 2901 2908. [40] K. Ashrafi, Obesity and the Regulation of Fat Metabolism, WormBook, 2007, pp.

[11] P. Wang, B. Liu, D.L. Zhang, M.Y. Belew, H.A. Tissenbaum, J.X. Cheng, Imaging 1–20.

fi

lipid metabolism in live Caenorhabditis elegans using ngerprint vibrations, [41] E.J. O’Rourke, A.A. Soukas, C.E. Carr, G. Ruvkun, C. elegans major fats are stored

–

Angew. Chem. Int. Ed. 53 (2014) 11787 11792. in vesicles distinct from lysosome-related organelles, Cell. Metab. 10 (2009)

[12] N. Mohan, C.S. Chen, H.H. Hsieh, Y.C. Wu, H.C. Chang, In vivo imaging and 430–435.

fl

toxicity assessments of uorescent nanodiamonds in Caenorhabditis elegans, [42] K. Ashrafi, F.Y. Chang, J.L. Watts, A.G. Fraser, R.S. Kamath, J. Ahringer, G. Ruvkun,

–

Nano Lett. 10 (2010) 3692 3699. Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes,

[13] C.M. Goodwin, G.G. Lewis, A. Fiorella, M.D. Ellison, R. Kohn, Synthesis and Nature 421 (2003) 268–272.

toxicity testing of cysteine-functionalized single-walled carbon nanotubes [43] K. Yen, T.T. Le, A. Bansal, D. Narasimhan, J.X. Cheng, H.A. Tissenbaum, A

–

with Caenorhabditis elegans, RSC Adv. 4 (2014) 5893 5900. comparative study of fat storage quantitation in nematode Caenorhabditis

[14] L. Gonzalez-Moragas, P. Berto, C. Vilches, R. Quidant, A. Kolovou, R. Santarella- elegans using label and label-free methods, PLos One 5 (2010) e12810.

Mellwig, Y. Schwab, S. Sturzenbaum, A. Roig, A. Laromaine, In vivo testing of [44] C.L. Evans, X.S. Xie, Coherent anti-stokes Raman scattering microscopy:

gold nanoparticles using the Caenorhabditis elegans model organism, Acta chemical imaging for biology and medicine, Annu. Rev. Anal. Chem. (Palo Alto

–

Biomater. 53 (2017) 598 609. Calif) 1 (2008) 883–909.

[15] L. Gonzalez-Moragas, A. Roig, A. Laromaine, C. elegans as a tool for in vivo [45] C.W. Freudiger, W. Min, B.G. Saar, S. Lu, G.R. Holtom, C. He, J.C. Tsai, J.X. Kang, X.

–

nanoparticle assessment, Adv. Colloid Interface Sci. 219 (2015) 10 26. S. Xie, Label-free biomedical imaging with high sensitivity by stimulated

[16] A. Barman, A. Chaturbedi, K. Subramaniam, S. Verma, Imaging C. elegans with Raman scattering microscopy, Science 322 (2008) 1857–1861.

fl

thiolated tryptophan-based NIR uorescent gold nanoclusters, J. Nanopart Res. [46] C. Erkut, S. Penkov, H. Khesbak, D. Vorkel, J.M. Verbavatz, K. Fahmy, T.V.

(2013) 15. Kurzchalia, Trehalose renders the Dauer Larva of Caenorhabditis elegans

[17] J.N. Meyer, C.A. Lord, X.Y.Y. Yang, E.A. Turner, A.R. Badireddy, S.M. Marinakos, A. resistant to extreme desiccation, Curr. Biol. 21 (2011) 1331–1336.

Chilkoti, M.R. Wiesner, M. Auffan, Intracellular uptake and associated toxicity [47] A. Barth, Infrared spectroscopy of proteins, BBA—Bioenergetics 1767 (2007)

of silver nanoparticles in Caenorhabditis elegans, Aquat. Toxicol. 100 (2010) 1073–1101.

–

140 150. [48] E. Goormaghtigh, V. Raussens, J.M. Ruysschaert, Attenuated total reflection

[18] J.L. Watts, Using Caenorhabditis elegans to uncover conserved functions of infrared spectroscopy of proteins and lipids in biological membranes, BBA—

omega-3 and omega-6 fatty acids, J. Clin. Med. 5 (2016), doi:http://dx.doi.org/ Rev. Biomembr. 1422 (1999) 105–185.

10.3390/jmc5020019. [49] S.E. Abusharkh, C. Erkut, J. Oertel, T.V. Kurzchalia, K. Fahmy, The role of

[19] M.J. Baker, J. Trevisan, P. Bassan, R. Bhargava, H.J. Butler, K.M. Dorling, P.R. phospholipid headgroup composition and trehalose in the desiccation

Fielden, S.W. Fogarty, N.J. Fullwood, K.A. Heys, C. Hughes, P. Lasch, P.L. Martin- tolerance of Caenorhabditis elegans, Langmuir 30 (2014) 12897–12906.

Hirsch, B. Obinaju, G.D. Sockalingum, J. Sule-Suso, R.J. Strong, M.J. Walsh, B.R. [50] D. Zhang, C. Li, C. Zhang, M.N. Slipchenko, G. Eakins, J.X. Cheng, Depth-resolved

Wood, P. Gardner, F.L. Martin, Using Fourier transform IR spectroscopy to mid-infrared photothermal imaging of living cells and organisms with

–

analyze biological materials, Nat. Protoc. 9 (2014) 1771 1791. submicrometer spatial resolution, Sci. Adv. 2 (2016) e1600521.

[20] K.M. Dorling, M.J. Baker, Rapid FTIR chemical imaging: highlighting FPA [51] A.K. Corsi, A biochemist’s guide to Caenorhabditis elegans, Anal. Biochem. 359

–

detectors, Trends Biotechnol. 31 (2013) 437 438. (2006) 1–17.

[21] L.M. Miller, M.W. Bourassa, R.J. Smith, FTIR spectroscopic imaging of protein [52] L. Gonzalez-Moragas, L.L. Maurer, V.M. Harms, J.N. Meyer, A. Laromaine, A.

–

aggregation in living cells, Biochim. Biophys. Acta 2013 (1828) 2339 2346. Roig, Materials and toxicological approaches to study metal and metal-oxide

[22] N. Abidi, L. Cabrales, C.H. Haigler, Changes in the cell wall and cellulose content nanoparticles in the model organism Caenorhabditis elegans, Mater. Horiz. 4

fi

of developing cotton bers investigated by FTIR spectroscopy, Carbohydr. (2017) 719–746.

–

Polym. 100 (2014) 9 16. [53] L. Gonzalez-Moragas, S.M. Yu, N. Benseny-Cases, S. Sturzenbaum, A. Roig, A.

[23] D. Ami, A. Natalello, A. Zullini, S.M. Doglia, Fourier transform infrared micro Laromaine, Toxicogenomics of iron oxide nanoparticles in the nematode C-

–

spectroscopy as a new tool for nematode studies, FEBS Lett. 576 (2004) 297 300. elegans, Nanotoxicology 11 (2017) 647–657.

fi

[24] A. Bouyan f, S. Liyanage, J.E. Hewitt, S.A. Vanapalli, N. Moustaid-Moussa, E. [54] J. Kneipp, L.M. Miller, M. Joncic, M. Kittel, P. Lasch, M. Beekes, D. Naumann, In

Hequet, N. Abidi, FTIR imaging detects diet and genotype-dependent chemical situ identification of protein structural changes in prion-infected tissue, BBA—

composition changes in wild type and mutant C. elegans strains, Analyst 142 Mol. Basis Dis. 1639 (2003) 152–158.

–

(2017) 4727 4737. [55] E. Zanni, G. De Bellis, M.P. Bracciale, A. Broggi, M.L. Santarelli, M.S. Sarto, C.

[25] F. Siebert, Infrared-spectroscopy applied to biochemical and biological Palleschi, D. Uccelletti, Graphite nanoplatelets and Caenorhabditis elegans:

–

problems, Method Enzymol. 246 (1995) 501 526. insights from an in vivo model, Nano Lett. 12 (2012) 2740–2744.

[26] F. Orsini, D. Ami, A.M. Villa, G. Sala, M.G. Bellotti, S.M. Doglia, FT-IR [56] R.J. Nemanich, G. Lucovsky, S.A. Solin, Ir active optical vibrations of graphite/

microspectroscopy for microbiological studies, J. Microbiol. Methods 42 Phite, Solid State Commun. 23 (1977) 117–120.

(2000) 17–27. Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX C Chapter 4 Supplemental information

1. C. elegans maintenance C. elegans is a small free-living soil roundworm (Figure 1) of about 1 mm in length, with a life cycle of 3.5 days and a lifespan of about 3 weeks under standard laboratory conditions (20°C) (Bouyanfif et al. 2019). C. elegans develops on four larval stages, L1 to L4, followed by adulthood in favorable conditions (Cho and Bandyopadhyay 2012). At the end of each larval stage, worms undergo molting which inactivates the lethargus period (Altun and Hall 2005). After embryogenesis, in which the development occurs from fertilization to hatching, the worm reaches the L1 larva stage, in which the nervous, reproductive, and digestive systems start to develop (Cho and Bandyopadhyay 2012). Whereas, under harsh environmental conditions, such as high temperature, crowding and lack of food, C. elegans develops to an alternative larval stage in which the L1 larva enters a pre-dauer L2 (L2d) to develop to a dauer larva. In this stage, worms deposit fats and have their gonad development arrested. It results in extending the effective lifespan that can reach several months (Cassada and Russell 1975). Worms exit the dauer stage and develop into the normal L4 stage then to reproductive adults with normal lifespans upon exposure to improved environments (Cassada and Russell 1975). C. elegans is a poikilotherm animal that cannot regulate its body temperature. For this reason, its life cycle and lifespan are considerably influenced by the environmental temperature (Klass 1977; Lionaki and Tavernarakis 2013). Moreover, this worm is a cholesterol auxotroph which needs to obtain cholesterol from its diet (Mullaney and Ashrafi 2009).

Figure 1: Anatomic structure of C. elegans roundworm.

C. elegans is easily and inexpensively maintained in laboratories on solid or liquid culture media (Lionaki and Tavernarakis 2013). Its body wall transparency allows for easy visualization of the internal organs, age‐related pathology, and fat accumulation. Moreover, a knock-in transgenic expression of the green fluorescent protein (GFP)- coupled genes may be determined and quantified in intact C. elegans body. Other

269

Texas Tech University, Amal Bouyanfif, August 2019 established genetic manipulation protocols include RNA interference, and gene knock out technologies.

1.1. Culturing C. elegans in monoxenic solid media: Nematode Growth Media (NGM)

Nematode NGM agar media has been aseptically poured into medium size petri dishes (60 mm) which are useful for general strain maintenance.

To prepare 100 ml, dry ingredients (1.7 g of Agar powder 0.3 g of NaCl and 0.25 g Bacteriological Peptone) were mixed in a 100 ml flask with 100 ml DI water. 100 µl CaCl2, 100 µl MgSO4, and 2500 µl KPO4 Buffer. Medium pH was 6.0. Upon autoclaving, the medium was cooled down to 55°C, and 100 µl of cholesterol was added under sterile conditions. 20 mL NGM per 60 mm plate was distributed. Plates, containing solidified medium, were incubated at room temperature overnight. The next day, 400 µl OP50 strain E. coli culture (OD600 of 0.6-0.7 after 24h) was added to the plates. Plates were left for another 24 hours at room temperature (RT) to allow the growth of bacterial lawn. Plates were stored at RT for later use (Stiernagle 2006). Expanding the worm culture was conducted using the “agar chunking" method. After two weeks of culture, a chunk of agar, containing several worms, was transferred using sterile scalpel to a new plate seeded with bacteria, and the worms migrated from the chunk towards the food. When needed, individual nematodes were transferred to new plates using a sterile self-made platinum wire worm picker. Using a dissecting stereomicroscope, the worm was swiped gently by the picker tip and was allowed to move from the picker to the new plate agar surface. The plates were sealed with Parafilm and incubated at 20°C.

1.2. Growth of C. elegans in axenic liquid medium: C. elegans Maintenance Medium (CeMM)

A chemically defined CeMM medium is designed for growing comparatively high amounts of worm biomass (Table 1) (Szewczyk et al. 2003; Szewczyk et al. 2006). Of note, the worms cultured in liquid media are mostly longer and thinner than those grown on agar plates. Moreover, the axenic growth conditions slow the worm culture growth.

Before seeding the liquid CeMM with worms, worm culture bleaching was conducted to prevent contamination by bacteria. Using standard methods (Stiernagle 2006), 2-4 NGM stock plates were seeded with OP50 containing plenty of gravid nematodes. Worms’s suspension was collected in 15 ml Cole-Parmer conical tubes (Fisher Scientific/Part number: 339651) and centrifuged at 2000 rpm for 2 min. Supernatant was discarded. 5 mL digestive solution (see buffers and solutions section) was added to pellets. The tubes were vortexed vigorously for 5-10 min to complete the worm lysis. The tubes were checked under a microscope to track the destruction of worm tissues.

270

Texas Tech University, Amal Bouyanfif, August 2019

The bleaching process is stopped by bringing the suspension volume to 10 ml by adding M9 buffer. The suspension was centrifuged at 2500 rpm for 3 min. Supernatant was discarded. Pellets were resuspended in 10 mL M9 buffer and centrifuged at the same regime one more time. In all, three washes in M9 buffer were performed to guarantee the bleach removal (Lionaki and Tavernarakis 2013). Washed pellets were resuspended in 5-10 mL M9 buffer and incubated overnight at 20˚C to allow hatching. Larvae development was arrested by starvation at the L1 stage. The hatched larvae were collected by centrifugation at 2500 rpm for 3 min. Supernatants were removed. 3 mL CeMM was poured into an empty petri dish using a sterile pipette. Approximately 100 ml of worm’s suspension (worms and M9 buffer) was dispersed into CeMM medium. Plates were sealed with Parafilm and wrapped in aluminum foil to prevent the CeMM exposure to light. Fresh cultures were incubated at 20˚C. After 3-4 weeks, 100-200 µl of worm culture CeMM suspension containing mixed population was transferred to a fresh 3 mL culture using sterile technique. The worm cultures were monitored every 3 days and extra CeMM media was added when needed.

Table 1: C. elegans maintenance medium (CeMM) composition.

Components Glycine/ L-Alanine/ L-Arginine/ L-Aspartic acid/ L-Cysteine HCl, monohydrate/ L-Glutamic Acid, monosodium salt, monohydrate/ L-Glutamine/ Amino acids L-Histidine/ L-Isoleucine/ L-Leucine/ L-Lysine hydrochloride/ L-Methionine/ L-Phenylalanine/ L-Proline/ L-Serine/ L-Threonine/ L-Tryptophan/ L-Tyrosine/ L-Valine Biotin/D-Pantethine/D-Calcium pantothenate (hemicalcium salt)/Folic Acid/i- Inositol/Niacin/Niacinamide-Nicotinamide/Pyridoxal 5′-phosphate Vitamins hydrate/Pyridoxamine dihydrochloride/Pyridoxine hydrochloride/Riboflavin 5′- monophosphate sodium salt dehydrate/Thiamine hydrochloride-Vitamin B1/Vitamin B12-Cyanocobalamin Ammonium Iron(II) Sulfate hexahydrate Calcium Chloride dihydrate/Citric Acid monohydrate-Copper(II) Chloride dihydrate/Magnesium Inorganic salts hydroxide/Manganous Chloride tetrahydrate/Potassium Citrate tribasic monohydrate/Potassium Phosphate monobasic/Zinc Chloride Nucleic acid Adenosine 5′-monophosphate monohydrate/Cytidine 5′- substituents monophosphate/Guanosine-3’(2’)-phosphoric acidPO4(Na)2 monohydrate/Uridine 5′-monophosphate/Thymine β-sitosterol (≥70%)/Choline Dihydrogen Citrate/Cytochrome C from bovine Other heart/D-Glucose (Dextrose)/Glutathione (reduced)/Lipoic Acid/N-Acetyl-D- components glucosamine/PABA (4-Aminobenzoic acid)

1.3. Culture cryopreservation To freeze C. elegans using a Soft Agar Freezing Solution (SAFS), content of 2-4 60mm NGM plates of L1-L2 starving larvae was used. Plates were washed with 1 ml of S Buffer for each vial. The suspension is collected in a sterile tube and incubated on ice for 15 min. An equal volume of a melted Soft Agar Freezing Solution is added to the tube then mixed well. Aliquots of 1 ml of mixture are placed into cryotube vials then

271

Texas Tech University, Amal Bouyanfif, August 2019 stored in a -80°C freezer. To start new culture from frozen larvae, a small portion of suspension was scooped from frozen SAFS aliquot using a sterile spatula and transferred on an NGM plate seeded with E. coli. The remaining portion of the frozen aliquot was returned to storage for later use. To freeze C. elegans using a Liquid Freezing Solution, 2 to 4 medium (60 mm) NGM plates containing starved L1-L2 animals are used. Larvae were collected by washing the plates with 1 mL S Buffer. Worm suspension was transferred in a sterile 15 ml polypropylene Centrifuge tube. Equal volume of 30% glycerol was added, and the suspensions were mixed vigorously. 1 mL aliquots of suspension were distributed to 2mL cryovials (Fisher Scientific/ Part number: 09-761-71) incubated at −80°C overnight and transferred into liquid nitrogen for storage. To start new culture from frozen larvae, the vial was completely thawed at RT. The vial content was transferred onto large NGM plate seeded with E. coli OP50 lawn. After 2–3 days, the cultures were expanded using the “agar chunking” protocol. Refreezing of thawed aliquots was not allowed for larvae cryopreserved in Liquid Freezing solution. 1.4. Synchronizing worm cultures Egg laying and culture bleaching were two protocols used to synchronize C. elegans cultures. To synchronize worms, cultured in CeMM, 3 mL of a dense mixed age culture, containing all different worms’ stages, was transferred to a 15 mL polystyrene tube. The plate was additionally rinsed with 4 mL M9 buffer. The nematodes were collected by centrifugation at 2000 rpm for 2 min. The supernatant was disposed of. 10 mL digestive solution was added to the tube and vortexed for 10 min to allow complete lysis of worm tissues. Lysates were centrifuged at 2500 rpm for 3 min. The supernatant was removed, the pellet was washed with 10 mL M9 buffer and centrifuged again at the same regime. The washing step was repeated 4 times. The pellet was incubated overnight at 20˚C in 5 mL M9 buffer to allow for hatching. The culture was synchronized at the starved L1 stage. The day after, new hatched worms were added to fresh 3 ml CeMM cultures using a sterile pipette. For age synchronization in NGM cultures, the bleaching protocol described for NGM culturing was used (see Methods section). After bleaching, the eggs were transferred back to unseeded a NGM plate (200 µL per 60 mm NGM plate), incubated overnight and then transferred to a plate seeded with bacteria the next day. An alternative age synchronization protocol used, was the egg laying method, in which gravid nematodes are allowed to lay eggs for a few hours. Worms were cultured in 60 mm NGM plates freshly seeded with E. coli and incubated for 48 to 72 h at 20°C until they reach the L4 stage. Approximately 20 gravid hermaphrodites were then transferred to new agar plates using a worm picker. After laying eggs (3 to 7 h depending on the genotypes used in the assay), adult worms were removed from plates by picking. Age synchronized eggs were incubated for 72 h at 20˚C until the hatched worms reach adulthood. 2. Survival assay A simple microfluidic device is made with soft lithography replica molding of flexible polydimethylsiloxane (PDMS). The design of each device is extremely dependent on

272

Texas Tech University, Amal Bouyanfif, August 2019 the objective of the experiment to be performed. The majority of these devices are PDMS chips with channels, chambers, or pillars. It is optically transparent, non-toxic, gas permeable, and compatible with aqueous solutions, making it suitable for biological experimentation and microscopic observation (San-Miguel and Lu 2013). These devices have small components ranging from 1 to 100 µm and usually single-use. In these devices, nematodes are allowed to swim in the individual microchambers or to crawl in the deformable micro-pillar array. The chamber diameter just exceeds the adult worm length (Rahman et al. 2018). Before the lifespan study, age synchronization by bleaching with hypochlorite was conducted as described above. Three-day old synchronized worms were collected by washing with 2 mL NGM Lite. Collected worms suspension was first placed into petri-dish using a sterile syringe, then transferred individually into the microfluidic chambers (20-30 nematodes/device). The chambers were washed daily from eggs and progeny. Upon washing, the nematodes were fed by freshly prepared bacterial Escherichia coli (E. coli, OP50) concentrated suspension. The suspension provided for the EPA-treatment groups, contained 100 µM EPA. Nematode survival status was assessed on a daily basis. Worms showing internal egg hatching signs (newly hatched worms spotted moving inside the parental body) were excluded from analysis (censored). Worms killed by experimental mishandling or accidents were also excluded. The percent alive average (% survival), Mean Life Span (MLS), and median were calculated using the following formulas:

Median = Time interval at which 50% of the population was scored dead. The Mean Lifespan (MLS) was calculated using the following equation (Lee et al. 2015): 1 =

𝑗𝑗 𝑗𝑗 𝑀𝑀𝑀𝑀𝑀𝑀 � 𝑥𝑥 𝑑𝑑 𝑁𝑁 𝑗𝑗 Where j is the age (day), dj is the number of worms that died at age j, and N is the total number of dead worms.

The standard error of mean (SE) of the estimated MLS was calculated using the following equation (GraphPad Prism):

1 = ( 1) 2 𝑗𝑗 𝑗𝑗 𝑆𝑆𝑆𝑆 � ��𝑀𝑀𝑀𝑀𝑀𝑀 − 𝑥𝑥 � 𝑑𝑑 𝑁𝑁 𝑁𝑁 − 𝑗𝑗

273

Texas Tech University, Amal Bouyanfif, August 2019

Table 2: Mean lifespan and Median of C. elegans WT(N2) and tub-1 at 20°C. Lifespan data are presented as mean lifespan ± standard error (SE), and median ± SE at 50% of total survival. N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals.

Nematode Trial No. Total worms MLS ± SE p-value (Dead/Censored) (days) WT 1 30 (22/8) 13.5 ± 0.1 ------2 20 (16/4) 13.4 ± 0.1 ------3 29 (21/8) 15.0 ± 0.2 ------4 29 (22/7) 14.4 ± 0.1 ------Total 108 (81/27) 14.1 ± 0.4 ------

**** WT +EPA 1 27 (19/8) 12.6 ± 0.1 0.000707 2 23 (18/5) 12.9 ± 0.2 0.082737 3 29 (28/1) 13.0 ± 0.1 0.000544*** 4 29 (24/5) 14.0 ± 0.1 0.030020* Total 108 (89/19) 13.1 ± 0.3 0.096159

tub-1 1 25 (25/0) 16.1 ± 0.1 0.000002**** 2 25 (16/9) 14.6 ± 0.2 0.004389** 3 29 (27/2) 15.1 ± 0.1 0.675809 4 29 (22/7) 16.2 ± 0.1 0.000014**** Total 108 (90/18) 15.5 ± 0.4 0.048139*

tub-1+EPA 1 27 (24/3) 14.8 ± 0.1 0.000093**** 2 23 (22/1) 15.5 ± 0.2 0.000443*** 3 29 (27/2) 15.6 ± 0.1 0.078141 4 29 (23/7) 15.6 ± 0.1 0.000147*** Total 108 (96/12) 15.4 ± 0.2 0.038926*

274

Texas Tech University, Amal Bouyanfif, August 2019

Table 3: Mean lifespan and Median of C. elegans WT(N2) and fat-3 at 20°C. Lifespan data are presented as mean lifespan ± standard error (SE), and median ± SE at 50% of total survival. N is the total number of animals scored; D is the total number of dead animals; C is the total number of censored animals.

Nematode Trial No. Total worms MLS ± SE p-value (Dead/Censored) (days)

WT 1 ------2 21 (18/3) 14.5 ± 0.2 ------3 27 (15/12) 12.3 ± 0.1 ------4 23 (16/7) 15.1 ± 0.1 ------Total 71 (49/22) 14.0 ± 0.7 ------

WT +EPA 1 21 (19/2) 13.5 ± 0.2 ------2 30 (24/6) 13.6 ± 0.2 0.000707*** 3 27 (24/3) 12.0 ± 0.1 0.078141 4 23 (19/4) 14.2 ± 0.1 0.000707*** Total 101 (86/15) 13.3 ± 0.5 0.450002

fat-3 1 30 (21/9) 13.9 ± 0.1 ------2 20 (13/7) 12.8 ± 0.4 0.003200** 3 29 (26/3) 12.7 ± 0.1 0.004389** 4 21 (18/3) 13.9 ± 0.2 0.004389** Total 100 (78/22) 13.3 ± 0.3 0.409242

fat-3+EPA 1 28 (20/8) 12.6 ± 0.2 ------2 22 (18/4) 14.3 ± 0.2 0.008085** 3 29 (25/4) 13.7 ± 0.1 0.000061**** 4 21 (11/10) 14.2 ± 0.3 0.051717 Total 100 (74/26) 13.7 ± 0.4 0.725769

3. Gel electrophoresis To evaluate the RNA quality, the RNA samples were analyzed using agarose gel electrophoresis (see buffers and solutions section) (Figure 2). The 2:1 and higher 28S/18S ratio was used as high RNA quality criterion (Patrick S. Aranda et al. 2012 ). Samples with the signs of RNA degradation or contamination were additionally treated with RNeasy Cleanup using RNeasy MinElute Cleanup Kit (QIAGEN). To prepare 1% agarose gel, 2 g agarose and 1.5 ml household bleach (8% sodium hypochlorite) were added to 200 ml 1x Tris-Acetate-EDTA (TAE) buffer. The mixture was mixed gently, incubated for a few minutes at RT. After melting the agarose in a microwave oven, the gel was allowed to cool down at RT for 15 min. Then 1 µl/10 ml Gel Red stain was added. The gel was mixed vigorously, poured to the gel chamber and

275

Texas Tech University, Amal Bouyanfif, August 2019 allowed to solidify at RT. The gel was placed into the electrophoresis apparatus which contained 1× TAE buffer. 2 μg RNA per well was applied. Electrophoresis was conducted for 60 min at 100 V. RNA quality was evaluated using UV trans-illuminator.

Figure 2. RNA quality evaluation by Gel Red stained agarose gel electrophoresis. 28S and 18S bands correspond to 28S and 18S eukaryotic ribosomal RNA respectively.

4. Quantitative PCR analysis

Primer sequences for the target and housekeeping genes, used for normalization, were designed using the OligoArchitect software at Sigma-Aldrich.com. The primer sequences used are listed in Table 2.

276

Texas Tech University, Amal Bouyanfif, August 2019

Table 4. Selected genes for qPCR analysis. Genes Proteins Name Description Primers sequences (5'to3') fasn-1 Fatty Acid SyNthase Encodes a fatty acid synthase, (F) orthologous to human FASN CCAGAACAATACTCCAACAACAC (R) TTCCTCCGTCAGCATATCCA Oxi-1 OXidative stress Ortholog of human UBE3B Induced (ubiquitin protein ligase (F) AGTGTGGTTCGTGGATTCTTG E3B), it has ubiquitin-protein (R) transferase activity, based on GAGCAGCAGTGACTTCTTATTGTA protein domain information mcp-1 Metabolite Control Ortholog of human GDPGP1 (F) ACTCACCTTCTGCGTCTTCT Phosphorylase and involved in glucose (R) TCTCGTCCGATTGATGACTTCT (GDP-D-glucose metabolic process phosphorylase 1) sod-3 Superoxide Encodes an iron/manganese dismutase [Mn] 2, superoxide dismutase that (F) ATTGCGGTTCAAGGCTCTG mitochondrial might defend against (R) CACAGGTGGCGATCTTCAAG oxidative stress and promote normal lifespan Sterol regulatory Encodes a transcription factor (F) AGAGATGGCAGGCGTAGG sbp-1 element Binding homologous to the (R) Protein mammalian Sterol Regulatory AGAAGAAGTCGTCGTTGTTGTG Element Binding Proteins (SREBPs) and it is required for normal lipid metabolism TOR Target of rapamycin Ortholog of human Mtor (F) ACCAGAAGAAGCAGCAACAG (let-363) homolog (mechanistic target of (R) rapamycin) ATCTCATCACGAACCGAATCATT aak-2 5'-AMP-activated Homologous of the catalytic (F) protein kinase alpha subunit of AMP- CGGAGGACGATAGACATAAGGAA catalytic subunit activated protein kinases (R) CACAGCGAAGACAACGAGAG alpha-2 (AMPKs) daf-2 Insulin-like receptor Encodes a receptor tyrosine (F) ATGTGGCGTGAGAATGAA subunit beta; kinase that is the C. elegans (R) AGCCGAACACGAACAACA Receptor protein- insulin/IGF receptor ortholog; tyrosine kinase; hypothetical protein daf-9 Cytochrome P450 Encodes a cytochrome P450 (F) ACGGCGATGGAGTTATTCTTG daf-9 of the CYP2 subfamily that (R) CAGCGAGTGTGATGAAGCA functions as a steroidogenic or fatty acid hydroxylase daf-16 Forkhead box protein Acts in the insulin/IGF-1 (F) CGTTTCCTTCGGATTTCA O pathway that regulates dauer (R) ATTCCTTCCTGGCTTTGC formation, longevity, and fat metabolism 18S 18S ribosomal RNA Represents the portion of one (F) rDNA repeat which encodes a CGTTCTTAGTTGGTGGAGTGAT 18S rRNA (R) CTCAATCTCGTGCGGCTAA act-1 Actin-1 Required for proper body (F) ACGACGAGTCCGGCCCATCC wall muscle, pharyngeal (R) muscle structures and the GAAAGCTGGTGGTGACGATGGTT motility of animals 277

Texas Tech University, Amal Bouyanfif, August 2019

5. Buffers and solutions 5.1. 1M Potassium Phosphate Buffer

68 g of monobasic KH2PO4 were dissolved in 300 mL water, and the solution volume was brought to 500 ml. 34.8g dibasic K2HPO4 were dissolved in 150 ml water and the solution volume was brought to 200 ml. Two solutions (2:5) were mixed to produce 1M dibasic buffer, pH 6.0. The buffer was autoclaved and stored at room temperature (RT). 5.2. M9 buffer

3 g K2HPO4, 6g Na2HPO4, 5g NaCl and 1 mL MgSO4 (1M) were dissolved in Deionized water (DI) and volume was brought to 1L. The buffer was autoclaved and stored at RT. 5.3. S Buffer

5.85 g NaCl, 1.123 g K2HPO4, and 5.926 g KH2PO4 were dissolved in Deionized (DI) water and volume was brought to 1L. The buffer was autoclaved and stored at RT. 5.4. Bleaching buffer: digestive solution 0.2 g NaOH pellets were added to 7.5 mL DI water in 15 ml tube. The tube was vortexed until the NaOH pellets were completely dissolved. Household bleach (8% hypochlorite) was added to the tube to reach a total volume of 10 ml. The tube was inverted for few seconds and stored at RT for later use. 5.5. Cholesterol mixture 5 mg cholesterol (Sigma Aldrich Inc/C3045-5G) was mixed with 1 ml absolute ethanol. Solution was stored at RT. 5.6. Soft Agar Medium

To prepare the soft agar medium, 0.58 g NaCl, 0.68 g KH2PO4, 0.4 g agar (Sigma Aldrich Inc/A5306-1KG), 30 g glycerol, and 0.56 mL of 1M NaOH were mixed in DI water. Solution volume was brought to 100 ml. After sterilization by autoclaving, the solution was placed on a 55°C water bath for 20 min. Then added to worms in cryotube vials to store in a -80°C freezer 5.7. Liquid Cryopreservation Medium

129 mL K2HPO4 (0.05M), 871 mL KH2PO4 (0.05M), 5.85g NaCl, and 30% glycerol (v/v). The medium was autoclaved and stored at RT. 5.8. NGM Lite Medium

2.5 g Peptone, 3 g NaCl, 1 mL CaCl2 1(1M), 1 mL MgSO4 (1M), and 25 ml of Potassium Phosphate buffer (pH 6.0; 1M) were mixed with 1 L DI water in 1L Duran Erlenmeyer Flask and then autoclaved for 30 min. After cooling the flask on a 55°C water bath for 20 min, 1 ml of Cholesterol solution (see above) was added. The medium was mixed well and stored at RT for later use. 5.9. CeMM Medium

278

Texas Tech University, Amal Bouyanfif, August 2019

Before use, the CeMM was supplemented with 200 µg/ml streptomycin and 20 µg/ml kanamycin. Streptomycin stock solution (100 mg/ml): 500 mg streptomycin were dissolved in 5 ml autoclaved DI water. Kanamycin stock solution (10 mg/ml): 100 mg kanamycin were dissolved in 10 ml autoclaved DI water. The working stocks were stored at -4°C. References Altun, Hall (2005) C. elegans Background Information. Worm Classroom Bouyanfif A, Jayarathne S, Koboziev I, Moustaid-Moussa N (2019) The Nematode C.elegans as a Model Organism to Study Metabolic Effects of ω-3 Polyunsaturated Fatty Acids in Obesit. AdvNutr 0:1-14. doi:https://doi.org/10.1093/advances/nmy059. Cassada RC, Russell RL (1975) The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans. Dev Biol 46 (2):326-342 Cho JH, Bandyopadhyay J (2012) Animal Models for Salmonella Pathogenesis: Studies on the Virulence Properties Using Caenorhabditis elegans as a Model Host. . doi:0.5772/31058 Klass MR (1977) Aging in the nematode Caenorhabditis elegans: major biological and environmental factors influencing life span. Mech Ageing Dev 6 (6):413-429 Lee J, Kwon G, Lim YH (2015) Elucidating the Mechanism of Weissella-dependent Lifespan Extension in Caenorhabditis elegans. Sci Rep 5:17128. doi:10.1038/srep17128 Lionaki E, Tavernarakis N (2013) Assessing aging and senescent decline in Caenorhabditis elegans: cohort survival analysis. Methods Mol Biol 965:473- 484. doi:10.1007/978-1-62703-239-1_31 Mullaney BC, Ashrafi K (2009) C. elegans fat storage and metabolic regulation. Biochim Biophys Acta 1791 (6):474-478. doi:10.1016/j.bbalip.2008.12.013 Patrick S. Aranda, Dollie M. LaJoie, Jorcyk CL ( 2012 ) Bleach Gel: A Simple Agarose Gel for Analyzing RNA Quality. Electrophoresis:366–369. doi:10.1002/elps.201100335. Rahman M, Hewitt JE, Van-Bussel F, Edwards H, Blawzdziewicz J, Szewczyk NJ, Driscoll M, Vanapalli SA (2018) NemaFlex: a microfluidics-based technology for standardized measurement of muscular strength of C. elegans. Lab Chip 18 (15):2187-2201. doi:10.1039/c8lc00103k Stiernagle T (2006) Maintenance of C. elegans. WormBook:1-11. doi:10.1895/wormbook.1.101.1 Szewczyk NJ, Kozak E, Conley CA (2003) Chemically defined medium and Caenorhabditis elegans. BMC Biotechnol 3:19. doi:10.1186/1472-6750-3-19 Szewczyk NJ, Udranszky IA, Kozak E, Sunga J, Kim SK, Jacobson LA, Conley CA (2006) Delayed development and lifespan extension as features of metabolic lifestyle alteration in C. elegans under dietary restriction. J Exp Biol 209 (Pt 20):4129-4139. doi:10.1242/jeb.02492

279

Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX D Vibrational Spectroscopy 102 (2019) 71-78

280

Vibrational Spectroscopy 102 (2019) 71–78

Contents lists available at ScienceDirect

Vibrational Spectroscopy

journal homepage: www.elsevier.com/locate/vibspec

Fourier transform infrared microspectroscopy detects biochemical changes during C. elegans lifespan T

Amal Bouyanfifa,b, Sumedha Liyanagea, Eric Hequeta, Naima Moustaid-Moussaa,b,c, ⁎ Noureddine Abidia, a Fiber and Biopolymer Research Institute, Department of Plant and Science, Texas Tech University Lubbock, TX, USA b Department of Nutritional Sciences, Texas Tech University Lubbock, TX, USA c Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

ARTICLE INFO ABSTRACT

Keywords: This study reports on the use of Fourier transform infrared (FTIR) microspectroscopy imaging to investigate FTIR imaging biochemical changes occurring during C. elegans lifespan. C. elegans wild-type (N2) and the tub-1 mutant strain C. elegans were cultured in agar plates. FTIR imaging was performed on single worms in transmission mode at day 8, 11, Lifespan and 15. Principal component analysis was then performed to analyze the spectra acquired during C. elegans Protein carbonyl lifespan. The FTIR spectra were clustered in three groups corresponding to the spectra acquired from the worms Glycogen − at day 8, 11, and 15. The results showed major changes in lipids (vibration 1744 cm 1 assigned to C]O Lipofuscin − − stretching) and proteins (vibrations 1648 cm 1 assigned to C]O stretching of amide I and 1548 cm 1 assigned − to NeH bending and C–N stretching in amid II). The vibration assigned to glycogen around 1155 cm 1 was present in the spectra acquired at day 8 and 11 but the peak area decreased by 49.3% and 73.3% in the spectra acquired at day 15 respectively from WT(N2) and tub-1 mutant strain. Furthermore, PC-1 loadings as a function − of wavenumbers show that the presence of the vibration 1698 cm 1, attributed to antiparallel β-sheet, could indicate the formation of lipofuscin. The results obtained demonstrate that FTIR imaging could be used as a tool to monitor biochemical changes during lifespan studies, which could bring additional information to our un- derstanding of longevity.

1. Introduction aging is the result of the action of reactive oxygen species (ROS) which results in cellular damage [3,8]. Other theories include the mitochon- The aging process is a universal and complex process that manifests drial decline theory of aging [9–12], and the decline theory of Ubiquitin itself within an organism at the cellular, genetic, organ, and molecular proteasomal system [10,13], and genetic theory of aging [10]. Despite, levels [1]. Aging is defined as the progressive accumulation of dele- a large body of investigations during the last few decades, no single terious changes within cells and tissues, which results in decreased theory has successfully explained the aging phenomenon. However, the ability to survive and increased risk of disease development and death prevalent theory in the current literature is based on the “free radical [1,2]. Harman reported that the aging cycle (growth, decline, and theory or oxidative stress theory” postulated by Harman [2,3,11]. This death) is a direct function of the metabolic rate that depends on animal theory postulates that reactive oxygen species contribute to the accu- or plant species [3]. Several theories have been formulated to explain mulation of oxidative damage to cellular components resulting in pa- the aging process [2–5]. These theories are divided into evolutionary thological conditions and functional alterations, and ultimately death and mechanistic theories of aging. The evolutionary theories such as the [1,14]. In animals, ROS occur mainly in the mitochondria, where more mutation accumulation theory [6], antagonist pleiotropy theory [6], than 90% of the oxygen used by the cells is consumed [4,15]. ROS are and disposable soma theory [4] represent a general model of aging generated as either metabolites of normal aerobic metabolism from based on different assumptions related to patterns of age-specific mu- oxygen molecules, under stress and pathological conditions, or taken up % tations [4]. However, the main mechanistic theory of aging is based on from the environment. ROS can include unstable oxygen radicals (O ), % − % -2 % the free radicals accumulation theory and addresses the causes of se- superoxide anion ( O2 ), peroxide ( O2 ), hydroxyl radical ( OH), − nescence at the molecular level [2,4,7]. Harman first proposed that hydroxyl ion (OH ), and hydrogen peroxide (H2O2). Accordingly, the

⁎ Corresponding author at: 1001 East Loop 289, Lubbock, TX, 79403, USA. E-mail address: [email protected] (N. Abidi). https://doi.org/10.1016/j.vibspec.2019.04.005 Received 27 March 2019; Received in revised form 23 April 2019; Accepted 26 April 2019 Available online 26 April 2019 0924-2031/ © 2019 Elsevier B.V. All rights reserved. fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

Fig. 1. Study design of lifespan assay on solid media. Eight to 10 worms were collected for FTIR analysis. oxidative stress is an excessive bioavailability of ROS, resulting from an 2. Experimental imbalance between production and destruction of these reactive species which leads to progressive accumulation of oxidative damage with age, 2.1. Materials then progressive deterioration of several cellular functions [1]. Kregel and Zhang reported that lipids are highly sensitive to ROS C. elegans wild-type (N2) and the mutant strain tub-1 (nr2044) were oxidation because of the bis-allylic structures of polyunsaturated fatty acquired from the Caenorhabditis Genetics Center (CGC, University of acids [1]. As a result of the lipid peroxidation, an accumulation of many Minnesota, Minneapolis, MN, USA). Nematodes were initially cultured end-products such as malondialdehyde, 4-hydroxy-2-non-enol, and F2- on nematode growth media (NGM) plates seeded with E. coli OP50 isoprostanes occur in biological systems [1]. It results in functional following the standard protocol procedure [26]. changes such as alteration of the cellular membrane permeability [16]. Additionally, other macromolecules including proteins and nucleic acids (nuclear and mitochondrial) are prone to oxidative damage by 2.2. Lifespan assay in NGM plates ROS that leads to various oxidized residues affecting normal cellular functions and stimulating gene expression alterations [1,17,18]. These To perform C. elegans lifespan assay, it is important to have an age- modifications can have a significant physiological impact on cell sur- synchronized population of worms, standard NGM plates, and 5-fluor- vival, senescence, and death pathways [1,19,20]. odeoxyuridine (FUDR)-containing plates. To avoid transferring worms Caenorhabditis elegans (C. elegans) nematode has been successfully from plates to plates every few days to separate adult worms from used as a model organism at the molecular and genomic levels [21]. growing larva, the chemotherapy drug FUDR that reduces egg pro- Because of its several unique features including simplicity and cost-ef- duction, prevents eggs from hatching and induces complete sterility fectiveness of maintenance in laboratory conditions, genetic manip- was used [27]. All materials coming in contact with worms were ster- ulation, body transparency, well-characterized genome, short life cycle ilized. Plates were incubated at 20 °C unless otherwise noted and were as well as small body size, C. elegans provides a versatile and suitable seeded with 200 μL of 100 mg/ml concentrated feeding E. coli (OP50) platform to dissect genetic and molecular mechanisms underlying aging bacteria (OD600 = 0.6). [22]. In addition, these characteristics are comparable to many other Several agar chunks were transferred using sterilized metal spatula model systems. This organism contains particularly numerous key from plates containing gravid worm strains onto a fresh NGM plate components related to metabolism such as insulin-signaling pathway as without FUDR to allow worms to propagate and feed through all of the well as oxidative stress network that make it a relevant system to im- bacterial feed, then incubated for 48 h at 20 °C (Fig. 1). After 2 days, prove our understanding of complex phenomena such as aging [21]. approximately 20 reproductively active adult worms were picked and Although mammalian and nematode physiologies are significantly dif- transferred to freshly seeded NGM plates without FUDR. Plates were ferent, several signal transduction pathways are conserved in both C. incubated at 20 °C for 3 to 6 h to allow worms to lay eggs. In general, for elegans and humans [23]. wild type C. elegans this takes 3 to 4 h while for the mutant strain tub-1 In this work, we report on the feasibility of using Fourier transform it takes 5 to 6 h. Once adult worms were removed from the plates, to infrared (FTIR) microspectroscopy imaging to investigate biochemical begin a synchronous population, plates were placed at 20 °C for about changes occurring during the lifespan of C. elegans wild-type (N2) and 72 h until eggs have hatched and worms have developed to the L4 larval mutant strain tub-1. Wild-type (WT(N2)) synthesizes long chain omega- stage. Lifespan is defined as the time spanned between the day of egg 3 fatty acids from saturated and monounsaturated fatty acids using laying (time t = 0) and the day when the worms are scored as dead. On bacteria as a food source. Mutant strain tub-1 accumulates triglycerides the third day, 10 adult worms were picked onto each seeded NGM/ because of the functional loss of tubby ortholog tub-1/F10B5.5. FTIR FUDR plates and 10 to 15 plates for each strain or condition being imaging has been successfully used to study nematodes such as C. ele- tested. To make FUDR-containing plates, 33 μL of 150 mM FUDR was gans and changes in biochemical composition when worms were sub- added per 100 ml of normal NGM media. NGM/FUDR plates were kept jected to different diets [24,25]. However, to the best of our knowledge, at room temperature in the dark for 2 days before adding bacteria as using FTIR imaging to investigate biochemical changes during C. ele- previously described [28]. Seeded plates were kept on the bench gans lifespan has not been reported. overnight to allow bacteria culture to dry on the solid NGM before transferring worms. Animals were cultured at the desired temperature (20 °C) and 8 to 10 alive worms were collected at day 8, 11, and 15 for FTIR analysis.

72 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

Fig. 2. Image showing regions of interests from which spectra were acquired. From each pixel (6.25 μm × 6.25 μm) of the ROIs, 128 co-added spectra were acquired.

2.3. FTIR microspectroscopy analysis

Worms at different stages of growth (day 8, 11, and 15) were wa- shed with distilled water five times and individual worms were mounted on BaF2 slides (PerkinElmer, MA, USA). Barium Fluoride (BaF2) slides are transparent to IR radiation and will not absorb in the mid-IR. Worms on BaF2 slides were dried in a vacuum desiccator for 1 h. FTIR Spotlight 400 equipped with a liquid nitrogen cooled 128 × 128 Mercury-Cadmium-Telluride (MCT) Focal Plane Array de- tector (Spotlight, PerkinElmer, MA, USA) was used to acquire IR images in transmittance mode. From each pixel (6.25 x 6.25 μm) of the regions of interests (ROIs), 128 co-added spectra were recorded between 4000- − − − 1000 cm 1 with a 16 cm 1 (8 cm 1 data point interval) spectral re- solution. Before acquiring spectral images from the worm, a back- ground spectral image was collected from an empty and clean area of Fig. 3. Representative ROI spectra acquired in transmission mode from WT(N2) the BaF slide and was automatically subtracted from each spectra. 2 at day 8, 11, and 15. Point mode FTIR microspectroscopy was used with an aperture size set to 25 x 25 μm. Fig. 2 shows the setup used to acquire ROIs of the FTIR images from worms along their length (3 to 5 worms). Worms were approximately 1000 μm long and the acquisition time of a typical point mode images for a worm was around 20 min. Four to six data points were acquired from each worm along the length (separated by 50

μm). BaF2 slides were cleaned with water, acetone, and dried after each experiment. Individual spectra acquired from WT(N2) and mutant strain tub-1 were subjected to baseline correction and normalization with respect to the total absorbance over the entire range from 4000 to − 1000 cm 1 using Spectrum 10™ software (PerkinElmer, MA, USA). Principal component analysis and Hierarchical analysis (Ward’s algo- rithm and Squared Euclidean Distance) were performed using Un- scrambler® X 9.6 software (CAMO Software AS, Norway). Each spec- trum (each data point in principal component analysis) represents 128 co-added spectra. Fig. 4. Representative ROI spectra acquired in transmission mode from tub-1 mutant strain at day 8, 11, and 15. 3. Results and discussion − groups [24,29,30]. Finally, the vibrations 2962 and 2874 cm 1 are Oxidative stress has been recognized as one of the major cause of assigned to CeH antisymmetric and symmetric stretching of methyl aging [1]. ROS cause damage to biomacromolecules such as lipids, groups [31]. − nucleic acids, and proteins [1,19]. Lipids are the most sensitive to The intensity of the vibration 3008 cm 1 in the ROI spectrum of the oxidation by ROS because of the bis-allylic structures of poly- WT(N2) is comparable at day 8 and 11 and decreases in the ROI unsaturated fatty acids [1]. In this study, we are interested in exploring spectrum at day 15. However, for the tub-1 mutant strain this vibration the feasibility of using FTIR microspectroscopy to investigate the bio- exists only as a small shoulder in the ROI spectrum acquired from the chemical changes occurring during the lifespan of C. elegans WT(N2) worm at day 8 but is absent in the ROI spectra acquired from worms at − and tub-1 mutant strain. In this feasibility study, the FTIR spectra were day 11 and 15. The absence of the vibration 3008 cm 1 could be at- acquired in transmission mode from the ROIs of worms at day 8, 11, tributed to potential peroxidation of the unsaturation of fatty acids as and 15. Figs. 3 and 4 show representative spectra collected from the worm ages. It was reported that the more polyunsaturated the fatty WT(N2) and tub-1 mutant strain at day 8, 11, and 15. Some differences acid is the greater is its peroxidation susceptibility [32]. Shmookler exist between these spectra, which indicate that biochemical changes et al. used gas chromatography/mass spectroscopy to analyze the fatty occur during C. elegans lifespan. acid composition across ten C. elegans strains to investigate the con- tribution of lipid biosynthesis to stress resistance and longevity [33]. − 3.1. Region 3100–2800 cm 1 They reported that fatty acid chain length and susceptibility to oxida- tion both decreased sharply in the longest-lived mutants. When com- The vibrations observed in this region originate from the CeH bond paring fatty acids composition in the shortest-lived to the longest-lived stretching vibrations of lipids, fatty acids, and cholesterol esters strains, the results showed that the total monounsaturates increased − [24,29]. The vibration 3008 cm 1 is assigned to ]CeH olefinic stretch. from 34% to 48% while the total polyunsaturates decreased from 37% − The vibrations 2928 and 2848 cm 1 are assigned to asymmetric to 26% [32,33]. Furthermore, it was reported that in polyunsaturated fatty acids, the carbons located between double bonds are vulnerable to stretching and symmetric stretching respectively of the acyl eCH2

73 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

− − Fig. 5. Area of the vibration 1744 cm 1 in the ROI spectra acquired in trans- Fig. 6. Area of the vibration 1648 cm 1 in the ROI spectra acquired in trans- mission mode from WT(N2) and tub-1 mutant strain at day 8, 11 and 15. Values mission mode from WT(N2) and tub-1 mutant strain at day 8, 11 and 15. Values not followed by the same letter (a, b, and c) are significantly different with not followed by the same letter (a, b, and c) are significantly different with α = 5% (according to the Newman-Keuls Test). α = 5% (according to the Newman-Keuls Test). peroxidation while saturated and monostaurated chains are several mutant accumulated protein carbonyl at a much slower rate compared hundredfold less susceptible [33]. to the wild-type [37]. Therefore, this vibration could be used to monitor protein carbonyl accumulation and oxidative stress in future studies. − − 3.2. Region 1800–1700 cm 1 The vibration 1648 cm 1 is accompanied by the vibration around − 1632 cm 1 (which is assigned to the carbonyl stretching in amid I – β- − The vibration 1744 cm 1 is assigned to C]O stretching, which pleated sheet components of proteins) [31]. This vibration appears as a could originate either from fatty acid triglycerides, phospholipids, or shoulder in the spectra of WT(N2) and tub-1. − cholesterol esters [24]. The intensity of this vibration is very high in the The vibration around 1548 cm 1 is assigned to amid II (NeH ROI spectrum of WT(N2) as compared to the tub-1 mutant strain bending and CeN stretching of protein amid groups). At day 15, the (Fig. 4). A decrease is observed in the intensity of this vibration at day intensity of this vibration increases by 64.5% and 77.2% in the spectra − 11 and 15 for both WT(N2) and tub-1. The area of the peak 1744 cm 1 acquired from WT(N2) and tub-1 respectively (Fig. 7). −1 was calculated for both strains (Fig. 5). The results showed that for The vibration around 1456 cm is assigned to CH2 bending and WT(N2), the area of the peak decreased by 44.5% and 42.9% in the ROI deformation of methylene and could originate from lipids, proteins or spectra acquired at day 11 and 15 while for tub-1 the area increased by cholesterol esters. For both strains, the areas of the peak decrease from − − 35.7% at day 11 and decreased by 65.5% in the ROI spectra acquired at day 8 to 15. The vibration 1392 cm 1 is assigned to COO stretching of − day 15. The decrease in the intensity of 1744 cm 1 indicates the oc- carbohydrates, fatty acids, or amino acid side chains. A decrease is − currence of oxidative decomposition of fatty acids, which can, in turn, observed from day 11 to 15. The vibration around 1232 cm 1 is as- − initiates a chain reaction leading to the formation of a variety of car- signed to PO2 antisymmetric stretching of phosphodiesters while the −1 − bonyl species [34]. vibration ˜1084 cm is assigned to PO2 symmetric stretching of phosphodiesters. The intensities of both vibrations decrease from day 8 − 3.3. Region 1700–1000 cm 1 to 15, which may indicate a possible impact on DNA as well. − The vibration around 1155 cm 1 is assigned to CeO stretching − The vibration 1648 cm 1 is assigned to C]O stretching of amide I mode and could originate from glycogen [38]. It is important to point in proteins (mainly α-helix components of proteins) [24,31]. For out that this vibration exists as a sharp peak in the ROI spectra acquired WT(N2), the intensity of this vibration increases between day 8 and day 11 (by 59.7%) but decreases at day 15 (Fig. 6). However, for tub-1 mutant starin, the intensity increases from day 8 to 15 by 32.1% (Fig. 6). The increase in the intensity of this vibration could indicate an increase in protein carbonyl groups, which are the results of protein oxidation caused by ROS [34]. Dalle-Donne et al. reviewed the re- lationships between high level of protein C]O groups and oxidative stress [35]. Carbonyl groups are created on the proteins side chains or generated within the structure of the macromolecules via oxidative cleavage of the proteins [35]. C]O groups could also be introduced into the structures of proteins through nucleophilic side chains of Cy- steine, Histidine, and Lysine residues with aldehydes (4-hydroxy-2- nonenal, malondialdheyde, 2-propenal [acrolein]) generated during peroxidation of lipids [35]. Yasuda et al. measured the accumulation of protein carbonyl in daf- 2, daf-2;daf-12, and daf-2;daf-16 mutants [36]. It was indicated that protein carbonyl represents a good indicator of oxidative damage − during aging [36,37]. Indeed, it was found that because of the oxidative Fig. 7. Area of the vibration 1548 cm 1 in the ROI spectra acquired in trans- stress, the accumulation of protein carbonyl in wild-type increased with mission mode from WT(N2) and tub-1 mutant strain at day 8, 11 and 15. Values age [36,37]. Furthermore, short-lived mev-1 mutant was reported to not followed by the same letter (a, b, and c) are significantly different with α accumulate protein carbonyl at a faster rate while long-lived age-1 = 5% (according to the Newman-Keuls Test).

74 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

− 1155 cm 1. Hierarchical cluster analysis (HCA) was performed using a combi- nation of squared Euclidean distance measure criterion and Ward’s al- gorithm with three clusters (Fig. 11). The dendrogram reveals that the spectra acquired from WT(N2) are clustered into 3 groups corre- sponding to ROI spectra acquired at day 8, 11, and 15. Similar to PCA, HCA confirms that biochemical differences occur during different stages of the worm lifespan and those changes are detected by FTIR as dis- cussed above. Fig. 12 shows the PCA scores of the ROI spectra acquired from the mutant strain tub-1 at day 8, 11 and 15. Similar to the results obtain on WT(N2), the ROI spectra are separated into 3 groups: the first group of spectra acquired at day 8, the second group of spectra acquired at day 11, and the third group of spectra acquired at day 15. PC-1 accounts for 75% of variance while PC-2 and PC-3 (results not shown) account for 13% and 4% respectively. −1 Fig. 8. Area of the vibration 1155 cm in the ROI spectra acquired from The plots of PC-1, PC-2, and PC-3 loadings as a function of wave- WT(N2) and mutant strain tub-1 at day 8, 11 and 15. Values not followed by the numbers (Fig. 13) show major peaks which originate from fatty acids same letter (a, b, and c) are significantly different with α = 5% (according to − and lipids (peaks at 2928, 2854, and 1744 cm 1), proteins (peaks at the Newman-Keuls Test). − − 1692, 1592, 1466 cm 1), and glycogen (peak at 1155 cm 1). A small − contribution is noticed at 3008 cm 1, which is assigned to olefinic from worms at day 8, decreases in the ROI spectra at day 11, and is groups of unsaturated fatty acids. It should be pointed out that the − present only as a small shoulder in the ROI spectra acquired at day 15 contribution of 3008 cm 1 in the ROI spectra acquired from the tub-1 (Fig. 8). The area of the peak decreased by 47.8% and 55.4% in the mutant strain is very small compared to that in the ROI spectra acquired spectra acquired from WT(N2) and tub-1 at day 15 respectively. Gly- from WT(N2) (Fig. 3). This confirms that lipids in WT(N2) are rich in cogen is generally produced as a result of glucose surplus [39]. The fact unsaturated fatty acids compared to those in tub-1. −1 that the intensity of 1155 cm decreases to only a small peak at day 15 Fig. 14 shows the HCA dendrogram of the ROI spectra. Again, three may indicate that the glycogen that was stored at day 8 for future use is clusters of FTIR spectra are observed corresponding to the ROI spectra consumed as early as day 11. It would be interesting to investigate the acquired at day 8, 11, and 15, confirming the PCA results. We can changes in this vibration if the worms were raised with a high glucose conclude that biochemical changes are occurring during different stages diet. We anticipate that the intensity would increase with increasing of C. elegans lifespan, which lead to aging and ultimately to death. amount of glucose. PC loadings as function of wavenumbers indicate that the major Fig. 9 shows the principal component analysis of the FTIR spectra changes in chemical composition during the lifespan (day 8 to day 15) acquired from WT(N2) at day 8, 11, and 15. The FTIR spectra are of WT(N2) and tub-1 reside in unsaturated fatty acids, lipids, proteins, clearly separated into 3 groups corresponding to day 8, 11 and 15. PC-1 and glycogen. It is important to notice the PC-1 loadings around − − accounts for 64% of the observed variation while PC-2 accounts for 1698 cm 1. The vibration 1698 cm 1 has been attributed to anti- 21%, and PC-3 for 6% (results not shown). The separation of the FTIR parallel β-sheet/aggregated strands [38,40]. The antiparallel β-sheets spectra into three groups associated with day 8, 11, and 15 indicates have been observed in many amyloid fibril samples [41,42]. Amyloid that some biochemical changes are occurring during the lifespan of deposits are common in several amyloid diseases (Alzheimer, Par- WT(N2). kinson, and Huntington diseases) [42]. Furthermore, Cai et al. reported PC scores could be interpreted in terms of differences in chemical that lipofuscin, formed during lipid peroxidation and sugar glycosyla- composition when plotted as function of wavenumbers. PC-1 loadings tion by carbonyl-amino crosslinks with biomacromolecules, is rich in plotted in Fig. 10 show peaks at 3008, 2883, 2855, 1744, 1698, 1594, amyloidogenic β-sheet with antiparallel structure [40]. Therefore, the −1 − and 1495 cm . PC-2 loadings plot shows peaks at 3008, 2944, 2883, vibration 1698 cm 1 could indicate the formation of lipofuscin during −1 1744, 1654, 1594, 1542, 1478, 1432, 1362, and 1155 cm . PC-3 aging of C. elegans. This could be extremely interesting to use in future loadings plot shows peaks at 3008, 2915, 2855, 1744, 1478, and studies as a fingerprint to screen bioactive compounds, which could prevent the conversion of β-sheet from parallel to antiparallel structure. Cai et al. used FTIR to investigate the effects of green tea polyphenol epigallocatechin gallate (EGCG) on lipofuscin formation [40]. EGCG has been reported to inhibit the formation of lipofuscin by neutralizing the carbonyl-amino crosslinking reactions [43]. The authors showed that the major components in the spectrum of Human Serum Albumin sample and the artificial lipofuscin treated with EGCG was centered − around 1658 cm 1 (assigned to α-helix). However, in the artificial li- pofuscin sample the major components were centered around 1625- − 1640 cm 1 assigned to β-sheet parallel structure and around 1675- − 1695 cm 1 (assigned to antiparallel β-sheet/aggregated strands struc- ture) [40]. − Another explanation of the vibration 1698 cm 1 could be related to the work of Vongsvivut et al. [38]. The authors reported on the use of FTIR for rapid screening and monitoring of polyunsaturated fatty acid production in marine yeast and protists [38]. The authors noted with Fig. 9. Principal component analysis scores of the ROI spectra acquired from interest a sharp peak around 1695 cm-1 in the spectra of thraustochy- WT(N2) at day 8, 11, and 15 separate the spectra into 3 groups. Each data point trids. The authors indicated that, because thraustochytrium cells are represents a spectrum obtained from 128-co-added spectra from a ROI of 6.25 rich in polyunsaturated fatty acids, this vibration is likely due to C]O μ μ m × 6.25 m. stretching modes of isoprostanes as well as α,β-unsaturated aldehydes

75 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

Fig. 10. PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for WT(N2).

Fig. 11. Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the ROI spectra acquired from WT(N2) at day 8, 11, and 15.

organs. − The vibration 1495 cm 1 has been assigned to asymmetric bending

of the N-methyl group (NeCH3), which has been assigned to choline [44]. The presence of this vibration may indicate that lipids in C. elegans have undergone a peroxidation during their lifespan. Indeed, Oleszko et al. used FTIR to determine the extent of lipid peroxidation in plasma during Haemodialysis [44]. The authors indicated that lipids and pro- teins contained in plasma are exposed to ROS leading to their perox- idation. The FTIR spectrum of extracted plasma lipids showed a vi- − bration at 1495 cm 1. This initial investigation opens the doors for further studies to de- monstrate the usefulness of FTIR microspectroscopy as a tool to com- plement the already established arsenal of techniques to advance our Fig. 12. Principal component analysis scores of the ROI spectra acquired from understanding of the aging process. Furthermore, when combining C. tub-1 mutant strain at day 8, 11, and 15. Each data point represents a spectrum elegans model and FTIR imaging important investigations on intact obtained from 128-co-added spectra from a ROI of 6.25μm × 6.25 μm. worms can be easily carried out with no sample preparation. and ketones, which are the end products of spontaneous lipid perox- 4. Conclusions idation through a free radical mechanism [38]. Whether this vibration is due to β-sheet in antiparallel structure or to the products of fatty C. elegans, a millimeter-long transparent round-worm, is being used acids peroxidation, its presence indicates that biochemical changes as a model organism for various studies including lipid storage and occur, which can further lead to damage to cells and other tissues and metabolism, inflammation, drug discovery, and obesity research. Furthermore, it has been reported that C. elegans is an important model

76 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

Fig. 13. PC-1, PC-2, and PC-3 loadings as a function of wavenumbers for mutant strain tub-1.

Fig. 14. Hierarchical Cluster Analysis dendrogram obtained by Ward’s algorithm and squared Euclidean distance measure criterion of the ROI spectra acquired from tub-1 mutant strain at day 8, 11, and 15. microorganism for conducting aging research not only because of its supplying C. elegans strains, he obtained from the Caenorhabditis short lifespan (3 to 4 weeks) but also growing conditions and mutations Genetics Center (CGC), which is funded by the NIH Office of Research have been reported to significantly alter its lifespan. Aging is defined as Infrastructure Programs (P40 OD010440). the consequence of accumulation of changes (such as biochemical changes) in cells and tissues with advancing age leading to higher risk References of diseases and ultimately death. In this study, we attempted to use Fourier Infrared microspectroscopy imaging to investigate biochemical [1] K.C. Kregel, H.J. Zhang, An integrated view of oxidative stress in aging: basic changes during C. elegans lifespan. FTIR imaging has been used to de- mechanisms, functional effects, and pathological considerations, Am. J. Physiol. – fi Regul. Integr. Comp. Physiol. 292 (1) (2007) R18 36. tect biochemical changes in C. elegans when the diet was modi ed, but [2] D. Harman, Aging: overview, Ann. N. Y. Acad. Sci. 928 (2001) 1–21. to the best of our knowledge, it has not been used to monitor bio- [3] D. Harman, Aging: a theory based on free radical and radiation chemistry, chemical changes in C. elegans during its lifespan. The results showed Gerontology 11 (1956) 298–300. ff [4] K.A. Hughes, R.M. Reynolds, Evolutionary and mechanistic theories of aging, Annu. that lipids and proteins are a ected to varying degrees. The results Rev. Entomol. 50 (2005) 421–445. obtained tend to demonstrate that FTIR imaging could be used as a [5] P.B. Medawar, An Unsolved Problem of Biology: An Inaugural Lecture Delivered at nondestructive technique to advance our understanding of the bio- University College, London, 6 December, 1951 H.K. Lewis and Co., London, 1952. fi chemical mechanisms that control aging. This study will be conducted [6] B. Charlesworth, Patterns of age-speci c means and genetic variances of mortality rates predicted by the mutation-accumulation theory of ageing, J. Theor. Biol. 210 during the lifespan of the worms from the L4 stage all the way to the (1) (2001) 47–65. time when the worms are scored dead and will be complemented by [7] H. Cui, Y. Kong, H. Zhang, Oxidative stress, mitochondrial dysfunction, and aging, other studies such as gene expression and chromatographic analysis. J. Signal Transduct. 2012 (2012) p. 646354. [8] D. Harman, Role of free radicals in mutation, cancer, aging, and the maintenance of life, Radiat. Res. 16 (1962) 753–763. [9] N. Sun, R.J. Youle, T. Finkel, The mitochondrial basis of aging, Mol. Cell 61 (5) Acknowledgments (2016) 654–666. [10] C. Peng, et al., Biology of ageing and role of dietary antioxidants, Biomed Res. Int. 2014 (2014) p. 831841. The authors would like to thank Dr. S.A. Vanapalli group for

77 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 71–78

[11] D. Harman, Free radical theory of aging: dietary implications, Am. J. Clin. Nutr. 25 media, J. Vis. Exp. (27) (2009). (8) (1972) 839–843. [29] H.Y. Holman, et al., Mid-infrared reflectivity of experimental atheromas, J. Biomed. [12] K.B. Beckman, B.N. Ames, Mitochondrial aging: open questions, Ann. N. Y. Acad. Opt. 13 (3) (2008) p. 030503. Sci. 854 (1998) 118–127. [30] E. San-Blas, et al., ATR/FTIR characterization of Steinernema glaseri and [13] F.K. Lee, et al., The role of ubiquitin linkages on alpha-synuclein induced-toxicity in Heterorhabditis indica, Vib. Spectrosc. 57 (2) (2011) 220–228. a Drosophila model of Parkinson’s disease, J. Neurochem. 110 (1) (2009) 208–219. [31] A.J. Hobro, B. Lendl, Fourier-transform mid-infrared FPA imaging of a complex [14] T.M. Hagen, Oxidative stress, redox imbalance, and the aging process, Antioxid. multicellular nematode, Vib. Spectrosc. 57 (2) (2011) 213–219. Redox Signal. 5 (5) (2003) 503–506. [32] A.J. Hulbert, Longevity, lipids and C. elegans, Aging-Us 3 (2) (2011) 81–82. [15] R. Perez-Campo, et al., The rate of free radical production as a determinant of the [33] R.J. Shmookler Reis, et al., Modulation of lipid biosynthesis contributes to stress rate of aging: evidence from the comparative approach, J. Comp. Physiol. B 168 (3) resistance and longevity of C. elegans mutants, Aging (Albany NY) 3 (2) (2011) (1998) 149–158. 125–147. [16] F.Q. Schafer, G.R. Buettner, Acidic pH amplifies iron-mediated lipid peroxidation in [34] Y.J. Suzuki, M. Carini, D.A. Butterfield, Protein carbonylation, Antioxid. Redox cells, Free Radic. Biol. Med. 28 (8) (2000) 1175–1181. Signal. 12 (3) (2010) 323–325. [17] T. Finkel, Reactive oxygen species and signal transduction, IUBMB Life 52 (1-2) [35] I. Dalle-Donne, et al., Protein carbonyl groups as biomarkers of oxidative stress, (2001) 3–6. Clin. Chim. Acta 329 (1-2) (2003) 23–38. [18] A. van der Horst, et al., FOXO4 is acetylated upon peroxide stress and deacetylated [36] K. Yasuda, et al., Protein carbonyl accumulation in aging Dauer formation-defective by the longevity protein hSir2(SIRT1), J. Biol. Chem. 279 (28) (2004) (daf) mutants of Caenorhabditis elegans, J. Gerontol. Ser. A Biol. Sci. Med. Sci. 54 28873–28879. (2) (1999) B47–B51. [19] J. Blumberg, Use of biomarkers of oxidative stress in research studies, J. Nutr. 134 [37] H. Adachi, Y. Fujiwara, N. Ishii, Effects of oxygen on protein carbonyl and aging in (11) (2004) 3188S–3189S. Caenorhabditis elegans mutants with long (age-1) and short (mev-1) life spans, J. [20] M.D. Evans, M. Dizdaroglu, M.S. Cooke, Oxidative DNA damage and disease: in- Gerontol. Ser. A Biol. Sci. Med. Sci. 53 (4) (1998) B240–B244. duction, repair and significance, Mutat. Res. 567 (1) (2004) 1–61. [38] J. Vongsvivut, et al., FTIR microspectroscopy for rapid screening and monitoring of [21] G. Zhu, et al., Modeling type 2 diabetes-like hyperglycemia in C. elegans on a mi- polyunsaturated fatty acid production in commercially valuable marine yeasts and crodevice, Integr. Biol. (Camb.) 8 (1) (2016) 30–38. protists, Analyst 138 (20) (2013) 6016–6031. [22] A. Bouyanfif, et al., The nematode caenorhabditis elegans as a model organism to [39] I. Gusarov, et al., Glycogen controls Caenorhabditis elegans lifespan and resistance study metabolic effects of omega-3 polyunsaturated fatty acids in obesity, Adv. to oxidative stress, Nat. Commun. 8 (2017). Nutr. 10 (1) (2019) 165–178. [40] S.X. Cai, et al., EGCG inhibited lipofuscin formation based on intercepting amy- [23] M.C. Leung, et al., Caenorhabditis elegans: an emerging model in biomedical and loidogenic beta-sheet-rich structure conversion, PLoS One 11 (3) (2016). environmental toxicology, Toxicol. Sci. 106 (1) (2008) 5–28. [41] G. Zandomeneghi, et al., FTIR reveals structural differences between native beta- [24] A. Bouyanfif, et al., FTIR imaging detects diet and genotype-dependent chemical sheet proteins and amyloid fibrils, Protein Sci. 13 (12) (2004) 3314–3321. composition changes in wild type and mutant C. elegans strains, Analyst 142 (24) [42] B. Shivu, et al., Distinct beta-sheet structure in protein aggregates determined by (2017) 4727–4736. ATR-FTIR spectroscopy, Biochemistry 52 (31) (2013) 5176–5183. [25] A. Bouyan fif, et al., Review of FTIR microspectroscopy applications to investigate [43] S.X. Cai, et al., Inhibiting effects of epigallocatechin gallate (EGCG) on the forma- biochemical changes in C. elegans, Vib. Spectrosc. 96 (2018) 74–82. tion of age pigment in vitro and in vivo, J. Med. Plants Res. 5 (23) (2011) [26] T. Stiernagle, Maintenance of C. elegans. WormBook, (2006), pp. 1–11. 5470–5478. [27] D.H. Mitchell, et al., Synchronous growth and aging of caenorhabditis-elegans in [44] A. Oleszko, et al., Application of FTIR-ATR Spectroscopy to Determine the Extent of the presence of fluorodeoxyuridine, J. Gerontol. 34 (1) (1979) 28–36. Lipid Peroxidation in Plasma during Haemodialysis, Biomed Res. Int. 2015 (2015) [28] G.L. Sutphin, M. Kaeberlein, Measuring Caenorhabditis elegans life span on solid p. 245607.

78 Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX E Analyst 142 (2017) 4727-4736

281

Analyst

PAPER

FTIR imaging detects diet and genotype- dependent chemical composition changes in wild Cite this: Analyst, 2017, 142, 4727 type and mutant C. elegans strains†

A. Bouyanfif, a,b,c S. Liyanage, a,c J. E. Hewitt, c,d S. A. Vanapalli, c,d N. Moustaid-Moussa, a,b,c E. Hequet a and N. Abidi *a,c

This study focuses on the use of Fourier Transform Infrared (FTIR) microspectroscopy to determine chemical changes induced in the nematode Caenorhabditis elegans by supplementation of C. elegans maintenance media (CeMM) by Eicosapentaenoic acid (EPA). Wild-type C. elegans (N2) and mutant strains (tub-1 and fat-3) were grown in CeMM alone, and CeMM supplemented with EPA at 25 or 100 µM. Feeding was performed for 72 h. FTIR imaging was performed in transmission mode on individual worms. The FTIR imaging analysis of wild-type animals revealed the presence of vibrations assigned to unsatu- rated fatty acids, specifically bands at 3008 cm−1 (vC–H, olefinic stretch) and 1744 cm−1 (CvO, unsatu- rated fatty acids). It confirmed previously reported synthesis of unsaturated fatty acids in wild-type C. elegans. For the FTIR spectra of mutant strains, these vibrations were absent or present only as very small shoulder, which indicates that tub-1 and fat-3 synthesize essentially saturated fatty acids as indicated

by the presence of –CH2 and CvO vibrations. These results are in agreement with previous studies which Received 29th August 2017, reported that these mutants have altered lipid compositions. Principal component analysis showed differ- Accepted 8th November 2017 ences in chemical composition between wild-type and mutant strains as well as between mutant strains DOI: 10.1039/c7an01432e cultured in normal CeMM and those cultured in CeMM supplemented with EPA. This study demonstrated rsc.li/analyst the usefulness of FTIR microspectroscopy to investigate fat metabolism in C. elegans.

Introduction mice fed a high-fat diet.2 Omega-3 fatty acids are also potent anti-inflammatory dietary compounds. Omega-3 fatty acids or Obesity is a disease of multifactorial etiology.1 Its pathogenesis n-3 fatty acids are a key family of polyunsaturated fatty acids is influenced by diet, physical activity, age, environmental, and with a double bond at the third carbon atom from the methyl genetic factors. Due to an imbalance between pro-inflamma- moiety of the carbon chain.3 Also known as essential fatty tory vs. anti-inflammatory signaling and free radical pro- acids (EFAs), omega-3 fatty acids are needed by the body for a duction vs. antioxidant factors produced, obesity is associated number of functions and are important for normal metab- with chronic low-grade inflammation and oxidative stress. It olism and good health. However, mammals, including has been reported that omega-3 polyunsaturated fatty acids humans, are unable to synthesize omega-3 fatty acids de novo (ω-3 PUFAs) reduce obesity-associated inflammation and dysli- because of the lack of endogenous enzymes delta-12 desatur- pidemia. When supplemented with diet, ω-3 PUFA eicosapen- ase and delta-15 desaturase for ω-3 desaturation. Therefore, taenoic acid (EPA) prevented and reversed hepatic steatosis, mammals must get these fatty acids from the diet.4 Studies of glucose intolerance, insulin resistance, and reduced adipose effects of omega-3 fatty acids in mammals, especially in and systemic markers of inflammation and oxidative stress in humans, present several challenges including difficulty to manipulate and/or control intake of these fatty acids from the diet. The nematode Caenorhabditis elegans is an excellent aDepartment of Plant and Soil Science, Fiber and Biopolymer Research Inst, USA. model for such studies, as the wild-type (WT) naturally makes E-mail: [email protected] these long chain fatty acids. Furthermore, various mutant bDepartment of Nutritional Sciences, USA strains lacking specific PUFA synthesis enzymes are already c Obesity Research Cluster, USA available. Moreover, due to easy culturing of this organism, dDepartment of Chemical Engineering, USA varying amounts and types of PUFAs can be added to the diets †Electronic supplementary information (ESI) available: Infrared vibration assign- ments and principal components as function of wavenumbers. See DOI: and compared to the WT strain, which synthesizes very long 10.1039/c7an01432e chain PUFAs such as EPA.

This journal is © The Royal Society of Chemistry 2017 Analyst,2017,142,4727–4736 | 4727 Paper Analyst

The possibility of using C. elegans as a model organism for FTIR was also used to investigate the role of trehalose sugar evaluating lipid metabolism, inflammation, and oxidative to preserve native membrane lipid packing during extreme stress in obesity-related studies has created the need for desiccation followed by rehydration of dauer larva of analytical techniques that can be used to determine the chemi- C. elegans.13 The results showed that desiccation and rehydra- cal composition on small and intact samples. tion led to changes in the FTIR spectra. The authors concluded Fourier Transform Infrared (FTIR) microspectroscopy is a that the major effect of trehalose on membranes during desic- non-destructive technique for the study of various materials cation is to preserve the native packing of lipids.13 – including biological samples.5 7 It provides information on These previous works using FTIR analysis on C. elegans the presence of chemical species as well as their distribution have laid the foundation for further analyses on chemical com- within a sample. The IR spectrum of a material is made of position of C. elegans under different conditions. In this work, absorption peaks, which represent frequencies of vibrations we report on the use of FTIR microspectroscopy to investigate between bonds of the molecules making up the material. the chemical composition of wild-type (N2) C. elegans and Because different materials have a unique combination of mutant strains (tub-1 and fat-3) when cultured in bacteria-free molecules, they exhibit different IR signatures. Thus, the IR C. elegans maintenance media (CeMM) both without sup- spectra provide a unique chemical fingerprint of the samples. plementation and supplemented with EPA at different concen- FTIR microspectroscopy imaging has been used previously trations. FTIR images were acquired in transmission mode on – as a tool to study C. elegans and their chemical composition.8 11 single worms. Through this work we have demonstrated that The absorption of infrared radiation and its interaction with FTIR microspectroscopy can be used as a tool to study the the vibrational modes of the atoms and chemical bonds led to effects of diets on the chemical composition of intact worms. useful information related to the chemical composition of the microorganism. Ami et al. reported on the use of FTIR micro- spectroscopy to study dried but intact C. elegans nematode.9 It Experimental was the first reported FTIR investigation on a complex whole Materials nematode. The use of the IR microscope allowed the authors to acquire IR spectra from different areas of a single worm: Hermaphrodite adult WT(N2) and mutant strains, tub-1 pharynx, intestine, and tail areas. It was reported that because (nr2044)andfat-3(wa22), were acquired from the of the difference in the FTIR spectra between the pharynx, Caenorhabditis Genetics Center (CGC, University of intestinal, and tail regions, the absorption spectra from the Minnesota, Minneapolis, MN, USA). Worms were initially cul- pharyngeal areas could be used to distinguish between tured on NGM (nematode growth media) plates seeded with different nematode species. According to the authors, amide I E. coli OP50 following standard protocols. Plates containing and amide II protein bands, assigned to the vibrational modes a large quantity of eggs and gravid adults were then of the backbone amine bonds, were of particular interest bleached, and eggs were left overnight to hatch in sterile M9 because, as reported previously, the stretching mode of the Buffer. Starved L1 animals were then transferred the follow- CvO is sensitive to the protein secondary structures.12 The ana- ing day to CeMM (Cell Guidance Systems, Babraham, −1 lysis of amide I indicated that different regions of the worms Cambridge, UK) containing 20 µg mL kanamycin sulfate −1 are composed of different proteins. Furthermore, it was con- (Fisher Scientific) and 200 µg mL streptomycin sulfate 14 cluded that collagen was the principal component of the tail.9 (Fisher Scientific), as reported previously. All C. elegans Recently, Sheng et al. reported on the use of FTIR micro- strains were then cultured at 20 °C in axenic CeMM for mul- spectroscopy for the analysis of the biochemical composition tiple generations to allow the worms to adapt to the media 15 of C. elegans worms.11 The authors’ justification for the use of before use in experiments. this technique was that the traditional biochemical techniques Eicosapentaenoic acid (EPA) was purchased from Nu-Check for chemical composition analysis require relatively large Prep (Elysian, MN, USA). It was supplied as omega-3 ethyl amounts of materials. The authors demonstrated that FTIR esters. The mass spectroscopy analysis showed that it was com- could be used to detect changes in the relative levels of carbo- posed of 91.9% of EPA and 2.1% of DHA (docosahexanoic hydrates, proteins, and lipids in one single worm.11 The IR acid), and other fatty acids accounting for the remaining com- results indicated that the relative intensities of the lipid-associ- position. Because EPA is sensitive to heat, light, and oxygen, − ated bands (2800–3000 cm 1) were higher for the daf-2 mutant care was taken to minimize exposure to these sources to intestines compared to those of the WT. The authors indicated prevent degradation by storing it at −80 °C. EPA solutions in that the results obtained from IR imaging are consistent with ethanol with different concentrations were prepared. CeMM gas–liquid chromatography and that the daf-2 mutant contains was supplemented with these EPA solutions at final concen- higher levels of triglycerides than WT. Furthermore, vibrations trations of 25 and 100 μM, and feeding was performed for − in the range 1140–1180 cm 1, assigned to polysaccharides, 72 hours on worm cultures of mixed ages. showed high intensities in daf-2 mutant compared to N2 WT.11 FTIR microspectroscopy The authors attributed this to the rate at which polysacchar- ides are synthesized from sugars or the rate at which polysac- C. elegans were washed with distilled water five times and charides are broken down. individual Hermaphrodite adult worms were mounted on

4728 | Analyst,2017,142,4727–4736 This journal is © The Royal Society of Chemistry 2017 Analyst Paper

Results and discussion Wild-type cultured in CeMM without supplementation

WT C. elegans were cultured in CeMM without supplemen- tation and FTIR images were collected from the region of inter- Fig. 1 Visual image showing the location from which spectra were est (ROI). The acquired IR spectra contain information on the acquired. chemical composition from the ROI, which in our case was either the head, middle, or tail region of the worms. Fig. 2a and b shows a visual image of a WT worm and the corres- ponding IR image acquired in transmission mode. The BaF slides (PerkinElmer, MA, USA), which are transparent 2 extracted IR spectra from the head, middle, and tail regions to IR radiation. Samples were then dried in a vacuum indicated by the squares on the IR map are shown in Fig. 2c. desiccator for 1 h. Images were collected using an FTIR Table S1† summarizes the main vibrations along with their microspectroscope equipped with a liquid nitrogen cooled functional group assignments. 128 × 128 Mercury–Cadmium–Telluride (MCT) Focal Plane The FTIR spectra extracted from the head, middle, and tail Array detector (Spotlight, PerkinElmer, MA, USA) in trans- regions of WT animals indicate differences in functional group mittance mode. One hundred twenty eight co-added spectra ff – −1 distribution. The major di erences are in the vibrations between 4000 1000 cm were collected from each pixel −1 – v – −1 3008 cm (assigned to CH CH stretching), 2928 and (6.25 × 6.25 µm) with a spectral resolution of 16 cm −1 – −1 2848 cm (asymmetric and symmetric C H stretching respect- (8 cm data point interval). The acquisition time of a − ively), and 1744 cm 1 (CvO stretching). The integrated inten- typical image for a worm was around 3 h (worms were sities of these vibrations were calculated (Fig. 3–5), and the approximately 1000 µm long). A background spectrum, − integrated intensity of 3008 cm 1 is 340% higher in the which is automatically subtracted from spectral data, was middle region compared to the tail and head regions. This collected from an empty area of the slide. BaF slides were 2 clearly indicates that unsaturated fatty acyl groups are present systematically cleaned with water followed by acetone after mainly in the middle region. Furthermore, the integrated collecting images. In order to acquire a large number of spectra and perform principal component analysis, point mode FTIR microspectro- scopy was used (line scans). In this case, the aperture size was set to 15 × 15 µm. Line scan images were collected from the middle part of worms along their length (8 worms from each treatment). The acquisition time of typical line scan images was around 20 min. Six to eight data points were acquired from each worm (separated by 50 μm) (Fig. 1). This generated between 48 and 64 FTIR spectra. It should be pointed out that the spectra extracted from images acquired using imaging mode are exactly similar to those acquired using point mode (data not shown). This indicates that using point mode to speed up image acquisition did not result in loss of information.

Spectroscopic data analysis

After acquiring IR images of the whole worms, individual spectra were extracted from the images of WT(N2), tub-1, and fat-3 worms specifically from three different areas of the worms: head, middle, and tail. All spectra were baseline cor- rected and normalized using Spectrum 10™ software (PerkinElmer, MA, USA). Each infrared vibration in the spectra was assigned to a chemical functional group. Spectra were Fig. 2 FTIR detects differences in functional groups distribution in extracted also from each line scan images using the Spectrum different regions of WT C. elegans: (a) Visual image. (b) Corresponding Image software. The spectra were baseline corrected and nor- IR image. The red color indicates higher concentration of functional malized (with respect to the total absorbance over the entire groups while the purple color indicates low concentration. The distri- −1 bution of colors indicates changes in the distribution of the chemical range from 4000 to 1000 cm ). Then principal component composition. (c) Extracted IR spectra from head, middle, and tail regions analysis was performed using Unscrambler® X 9.6 software of WT C. elegans showing that FTIR can detect differences in chemical (CAMO Software AS, Norway). composition in different regions of the worm.

This journal is © The Royal Society of Chemistry 2017 Analyst,2017,142,4727–4736 | 4729 Paper Analyst

− Fig. 3 Integrated intensity of the vibration 3008 cm−1 associated with Fig. 5 Integrated intensity of the vibration 1744 cm 1 associated with unsaturated fatty acids present in the head, middle, and tail regions of fatty acids, triglycerides, phospholipids, or esters present in the head, WT(N2) (variance ratio (2, 9) = 11.883, p = 0.00298, vertical bars denote middle, and tail regions of WT(N2) (variance ratio (2, 9) = 3.2760, p = 0.95 confidence intervals). 0.08532, vertical bars denote 0.95 confidence intervals).

WT, tub-1, and fat-3 cultured in CeMM without supplementation

The above results confirmed previous studies which reported that the middle region is the main storage region for lipids and fats in wild-type animals. Because the objective of this study is to investigate the application of FTIR microspectro- scopy to study fat storage in wild-type and mutant strains C. elegans, we focused on the middle part of the worm (which contains the intestines). We then proceeded with looking at the FTIR spectra of mutant strains tub-1 and fat-3 in addition to wild-type (Fig. 6). Different vibrations are identified and their assignments are summarized in Table S1.† −1 Vibration 3280 cm : This vibration, assigned to N–H stretching in amide A, originates from proteins.21 The intensity of this vibration is high in mutant strains, which indicates that Fig. 4 Integrated intensity of the vibrations 2928 and 2848 cm−1 associated with lipids present in the head, middle, and tail regions of WT (N2) (variance ratio (2, 9) = 12.875, p = 0.00229, vertical bars denote 0.95 confidence intervals).

− intensity of both 2928 and 2848 cm 1 is 136% higher and that − of 1744 cm 1 is 218% higher in the middle region than in the head and tail regions. These results indicate that saturated acyl groups are stored mainly in the intestine regions along with unsaturated fatty acids. It has been reported that C. elegans stores fat mainly in droplets within the hypodermal and intestinal cells.1,16 In these studies, fat storage in C. elegans has been quantified by measuring the intensity of staining by lipid-binding dyes (such as Nile Red, Oil Red O, 17,18 and Sudan Black) or by microscopy techniques such as Fig. 6 FTIR spectra of WT, tub-1, and fat-3 C. elegans acquired from Coherent Anti-Stokes Raman Scattering (CARS) and Stimulated the middle region. Worms were cultured in CeMM without Raman Scattering (SRS).19,20 supplementation.

4730 | Analyst,2017,142,4727–4736 This journal is © The Royal Society of Chemistry 2017 Analyst Paper high ratio of proteins/fats is present in mutant strains com- 55% of total lipids,28 and phospholipids are composed of pared to WT. about 55% ethanolamine glycerophospholipid, 32% choline −1 Vibration 3008 cm : The presence in the spectra of WT of glycerophospholipid, and 8% sphingomyelin.1 − an additional vibration at 3008 cm 1 (which is assigned to We collected several spectra from the middle of each worm vCH– stretch of olefin21,22) is very important to distinguish and several worms from each strain. All spectra were normal- between WT and mutant strains tub-1 and fat-3. This vibration ized and baseline corrected according to the established pro- originates from unsaturated fatty acids contained in the cedure. Principal Component Analysis (PCA) was performed on middle region of WT. This vibration is absent from the spectra the FTIR spectra in order to identify distinct groups of of the mutant strains, indicating that mutant strains have lipid spectra.29 This technique is widely used to reduce the dimen- distribution different from those of wild type. sionality of the data from thousands of variables (wavenum- −1 Vibrations 2928 and 2848 cm : The C–H bonds absorb IR bers) in the original spectra to a fewer number of dimensions. − between 2800 and 3000 cm 1. Two vibrations are noticed, The variability in each spectrum relative to the mean of the −1 2928 cm is assigned to asymmetric –CH2 stretching while population can be represented as a smaller set of values (axes) −1 – ff the vibration 2848 cm is assigned to symmetric CH2 termed principal components (PCs). The e ect of this process stretching. is to concentrate the sources of variability in the data into the −1 − Vibration 1744 cm : The vibration 1744 cm 1 (CvO first 2 or 3 PCs (PC-1, PC-2, and PC-3). Plots of PC-1 against stretch) originates from fatty acids triglycerides, phospholi- PC-2 can reveal clustering in the FTIR spectra. pids, or cholesterol esters. The integrated intensity of this Fig. 7–9 shows the PCA of FTIR spectra of WT vs. tub-1,WT vibration was calculated from the spectra of the worms. The vs. fat-3, and tub-1 vs. fat-3. For WT vs. tub-1, PC-1 accounts for results show relatively higher triglycerides content in fat-3 as 76% of the variance, and it clearly separates the FTIR spectra compared to WT and tub-1. into two groups: one for WT and one for tub-1 (Fig. 7). A larger −1 Vibration 1648 cm : This vibration (mainly from CvO variability is noticed in the IR spectra of the tub-1 mutant stretching) is assigned to amide I in proteins (α-helix com- strain compared to WT. For WT vs. fat-3, PC-1 accounts for ponents of proteins).23 It is interesting to notice that in fat-3, 81% of the variance, and it separates the FTIR spectra into two the intensity of this vibration is low compared to WT and tub- groups: one group of WT and one group of fat-3 (Fig. 8). Again, 1. This could indicate that the relative amounts of all proteins a larger variability is noticed in the IR spectra of the fat-3 is lower since there is more lipids in fat-3. mutant strain compared to WT. The discrimination between −1 Vibration 1536 cm : This vibration originates from amide WT and the mutant strains indicates that differences in chemi- II (N–H bending and C–N stretching of proteins amide cal composition between WT and mutant strains do exist. For groups).24 It was reported also that amino acid side chains tub-1 vs. fat-3, only few spectra of fat-3 can be separated from (such as arginine, aspartate, glutamate, and tyrosine) or N–H tub-1. Overall, IR spectra of tub-1 are similar to those of fat-3 groups from nucleotides could contribute to this vibration.24 (Fig. 9). The intensity of this vibration is low in the case of fat-3. The discrimination between the IR spectra of WT and the −1 Vibration 1456 cm : This vibration, assigned to –CH2 mutant strains tub-1 and fat-3 may be due to differences in the bending and deformation, could originate from lipids, pro- chemical composition in the worm middle region. We teins, or cholesterol esters. attempted to interpret each PC scores in terms of differences −1 − Vibration 1392 cm : This vibration is attributed to COO in chemical composition. PC-1, PC-2, and PC-3 scores were symmetric stretching and could originate from carbohydrates, plotted as function of wavenumbers (Fig. S1–S6, ESI†). fatty acids, and amino acid side chains. −1 − Vibration 1232 cm : This vibration is assigned to PO2 antisymmetric stretching of phospholipids, nucleic acids, or phosphorylated proteins. −1 Vibration 1152 cm : This vibration is assigned to C–O stretching. It could originate from glycogen or mucin. It is interesting to notice that this vibration is only present as very small shoulder in the IR spectra of WT while it is an intense band in the spectra of mutant strains tub-1 and fat-3. −1 − Vibration 1088 cm : This vibration is assigned to PO2 symmetric stretching of phosphodiesters. It could originate from nucleic acid (DNA and RNA), phospholipids, and glycolipids. Several research groups have reported the biochemical com- – position of the fat content in C. elegans.1,25 27 Column chrom- atography, thin-layer chromatography, and gas chromato- graphy/mass spectroscopy were used in some of these studies. Fig. 7 Principal component analysis of FTIR spectra separates WT from Ashrafi reported that triacylglyceride fats make up about 40 to mutant strain tub-1.

This journal is © The Royal Society of Chemistry 2017 Analyst,2017,142,4727–4736 | 4731 Paper Analyst

Fig. 10 Difference spectrum obtained by digital subtraction of tub-1 Fig. 8 Principal component analysis of FTIR spectra separates WT from spectrum from the WT spectrum. mutant strain fat-3.

PC-2 scores show also peaks at vibrations characteristic of lipids and proteins (Fig. S5†). PC-3 scores show important peaks at characteristic vibrations of unsaturated fatty acids and lipids (Fig. S6†). To obtain additional information on the spectral differ- ences between WT and mutant strains, we performed digital subtraction of the mutant strains spectra from WT spectra (Fig. 10 and 11). The major vibrations in the difference spectra are attributed to unsaturated fatty acids, lipids, and proteins − (bands 3008, 2928, 2848, 1744, and 1648 cm 1). It is worth − pointing out that the intensity of the vibration 3008 cm 1 is high in the difference spectrum between WT and tub-1, while it is only a very small shoulder in the difference spectrum − between WT and fat-3. Furthermore, the vibration 1648 cm 1 exists only as small shoulder in the difference spectrum between WT and tub-1 while it is a sharp band in the differ- Fig. 9 Principal component analysis of FTIR spectra of mutant strains tub-1 vs. fat-3. ence spectrum between WT and fat-3. The above IR results in Fig. 10 and 11 indicate that the major difference between WT and mutant strains tub-1 (Fig. 10) and fat-3 (Fig. 11) are unsaturated and saturated For tub-1, PC-1 scores presented in Fig. S1† show peaks at lipids. Previous research reported that WT C. elegans can syn- − 3280, 2928, 1744, 1648, 1536, 1456, 1232, and 1152 cm 1, which are characteristic of wavenumbers corresponding to pro- teins, lipids, phosphorylated lipids, and mucin (glycogen). PC-2 scores (Fig. S2†) show peaks at 2928, 2848, 1696, 1616, − 1520 and 1392 cm 1, which correspond to lipids and proteins. PC-3 scores (which explains 4% of variability) show also peaks characteristic of fatty acids (bands 3008, 2960, 2928, and − − 2884 cm 1) and lipids (band 1744 cm 1). A small peak is − noticed at 3008 cm 1, which corresponds to vCH– of unsatu- rated fatty acids. Other peaks are also noticed at 1664, 1472, − 1392, 1232, and 1120 cm 1. For fat-3, PC-1 scores presented in Fig. S4† show peaks at − − 3280 cm 1 (vibration assigned to proteins), 3008 cm 1 (vibration assigned to unsaturated fatty acids), 2928 and − − 2855 cm 1 (vibrations assigned to lipids), 1744 cm 1 (vibration assigned to triglycerides, phospholipids, and fatty acids), −1 −1 1648 cm and 1536 cm (vibrations assigned to proteins), Fig. 11 Difference spectrum obtained by digital subtraction of fat-3 − and 1456 cm 1 (vibration assigned to lipids and proteins). spectrum from the WT spectrum.

4732 | Analyst,2017,142,4727–4736 This journal is © The Royal Society of Chemistry 2017 Analyst Paper thesize a wide range of saturated, monosaturated, and poly- saturated fatty acids (including arachidonic acid (20:4n-6), eicosapentaenoic acid (20:5n-3), and monoethyl branched chain fatty acids).25,26,27,29,30 However, the mutant strain tub-1 is reported to exhibit increased fat accumulation,1 while fat-3 mutants were reported to lack Δ6 fatty acids and are deficient in C20 fatty acids (fatty acids C20:4n6, C20:4n3, and C20:5n3 are not detectable but high levels of 18:1n7, 18:2n6, and C8:3n3 are present).27

Worms cultured in CeMM supplemented with EPA

CeMM was supplemented with different concentrations of EPA (25 or 100 μM). FTIR was performed as described above. The objective was to investigate the chemical changes and relative levels of carbohydrates, proteins, and lipids induced by supple- Fig. 13 Principal component analysis of FTIR spectra: tub-1 cultured in CeMM without supplementation vs. tub-1 cultured in CeMM sup- menting the growth media with unsaturated fatty acids using plemented with 25 or 100 μMofEPA. FTIR microspectroscopy. We believe that FTIR can be a valu- able tool to add to the current techniques used for metabolic research of C. elegans. The FTIR spectra were collected from supplementing with 25 or 100 μM. PC-1, PC-2 and PC-3 scores several individuals (8 worms and 6 to 8 spectra from each as function of wavenumbers (Fig. S10–S12†) show peaks at worm) from the middle region of the worms. All spectra were vibrations corresponding to lipids and proteins. normalized and baseline corrected. It was followed by princi- Mutant strain tub-1: Fig. 13 shows the PCA of FTIR spectra pal component analysis. of the mutant strain tub-1 cultured in CeMM without sup- Wild-type (N2): Fig. 12 shows the PCA of the spectra of WT plementation and in CeMM supplemented with 25 or 100 μM cultured in CeMM without supplementation and WT cultured of EPA. PC-1 accounts for 63%, PC-2 accounts for 17%, and in media supplemented with EPA at 25 or 100 μM. PC-1 PC-3 accounts for 6% of the variance (data not shown). The accounts for 57% of the variance and clearly separates the FTIR spectra are clearly separated into three groups: one group FTIR spectra into two groups: one group for WT and one for tub-1 cultured in CeMM without supplementation, one group for WT when cultured in media supplemented with fatty group for tub-1 cultured in CeMM supplemented with fatty acids. PC-2 accounts for 22% of the variance and PC-3 for 6% acids at 25 μM, and one group for tub-1 cultured in CeMM sup- (data not shown). A larger variability is observed in the IR plemented with 100 μM of EPA. It is of interest to note that spectra of WT cultured in the fatty acids supplemented media. both PC-1 and PC-2 are needed to separate the treatments into The separation of IR spectra into two distinct groups indicates three groups (PC-1, PC-2 and PC-3 scores as function of wave- that supplementing the media with fatty acids induced bio- numbers are shown in Fig. S13–S15†). chemical changes. Although we discriminate between WT cul- Fig. 14 shows the PCA of the FTIR spectra of WT cultured in tured in CeMM without supplementation and WT cultured in CeMM without supplementation and the mutant strain tub-1 media supplemented with EPA, there is no difference between cultured in CeMM supplemented with 25 or 100 μM EPA. PC-1

Fig. 12 Principal component analysis of FTIR spectra: WT cultured in Fig. 14 Principal component analysis of FTIR spectra: WT cultured in CeMM without supplementation vs. WT cultured in CeMM sup- CeMM without supplementation vs. tub-1 cultured in CeMM sup- plemented with 25 or 100 μMofEPA. plemented with 25 or 100 μMofEPA.

This journal is © The Royal Society of Chemistry 2017 Analyst,2017,142,4727–4736 | 4733 Paper Analyst accounts for 76% of the variance and separates the FTIR spectra into two groups: one group of spectra for tub-1 cultured in CeMM supplemented with 25 μM of EPA and the second group is composed of the spectra of WT cultured in CeMM (no supplementation) and tub-1 cultured in CeMM supplemented with 100 μM of EPA. It is interesting to notice that the spectra of tub-1 with 100 μM are similar to the spectra of WT. These results indicate that supplementing the media with 100 μMof PUFAs makes the mutant strains tub-1 (which lack the fatty acid synthase gene) behave as the wild-type (which is able to make PUFAs). PC-1, PC-2 and PC-3 scores as function of wave- numbers are shown in Fig. S16–S18.† Mutant strain fat-3: Fig. 15 shows the PCA of the FTIR spectra of fat-3 cultured in CeMM with and without EPA sup- plementation. The spectra of fat-3 cultured in CeMM sup- μ Fig. 17 Principal component analysis of FTIR spectra of mutant strains plemented with 25 or 100 M EPA can be separated from those tub-1 and fat-3 cultured in CeMM supplemented with 25 or 100 μMof of the same mutant strain cultured in CeMM without sup- EPA. plementation. There is no separation in the spectra when sup- plementing with 25 or 100 μM (PC-1, PC-2 and PC-3 scores as function of wavenumbers are shown in Fig. S19–S21†). Fig. 16 shows the PCA spectra of WT cultured in CeMM without supplementation and the mutant strain fat-3 cultured in CeMM supplemented with 25 or 100 μM. PC-1 accounts for 79% of the variance and separates the spectra of WT from the spectra of fat-3 cultured in CeMM supplemented with EPA (PC-1, PC-2 and PC-3 scores as function of wavenumbers are shown in Fig. S22–S24†). We can observe that supplementing the media with 25 or 100 μM leads to similar spectra. We can discriminate between WT and the mutant strain fat-3 but not between the mutant strain subjected to different feedings. Contrary to the results obtained on tub-1, it appears that sup- plementing the media with 100 μM of PUFAs does not make the mutant strain fat-3 behave as the WT. As shown in Fig. 17, the PCA of the FTIR spectra of mutant strains tub-1 and fat-3 cultured in CeMM supplemented with 25 μM or 100 μM indicates that PC-1 (69% of the variance) sep- Fig. 15 Principal component analysis of FTIR spectra: fat-3 cultured in arates the IR spectra of tub-1 cultured in CeMM supplemented CeMM without supplementation vs. fat-3 cultured in CeMM sup- with 100 μM EPA from tub-1 cultured in media supplemented μ plemented with 25 or 100 MofEPA. with 25 μM and fat-3 animals cultured in media supplemented with 25 μM or 100 μM EPA. PC-1, PC-2 and PC-3 scores as func- tion of wavenumbers are shown in Fig. S25–S27.†

Conclusions

The FTIR microspectroscopy imaging analysis of WT revealed the presence of vibrations assigned to unsaturated fatty acids − specifically the bands at 3008 cm 1 (assigned to vC–Hfrom − olefinic stretch) and 1744 cm 1 (assigned CvO from unsatu- rated fatty acids). This confirmed previous studies which reported the presence of unsaturated fatty acids in the wild- type of C. elegans. However, the IR spectra of the mutant strains (tub-1 and fat-3) did not show the presence of the − vibration 3008 cm 1 or it appeared as only a small shoulder.

Fig. 16 Principal component analysis of FTIR spectra: WT cultured in The major contribution came from saturated fatty acids as v CeMM without supplementation vs. fat-3 cultured in CeMM sup- indicated by the -CH2 and C O vibrations. This confirmed plemented with 25 or 100 μMofEPA. that tub-1 and fat-3 do not synthesize considerable amount of

4734 | Analyst,2017,142,4727–4736 This journal is © The Royal Society of Chemistry 2017 Analyst Paper

PUFAs. Principal component analysis clearly discriminated M. J. Walsh, B. R. Wood, P. Gardner and F. L. Martin, Using between wild-type and mutant strains cultured in CeMM with Fourier transform IR spectroscopy to analyze biological or without supplementation with EPA. PC-1, PC-2, and PC-3 materials, Nat. Protoc., 2014, 9(8), 1771–1791. scores as a function of wavenumbers showed peaks that are 6 K. M. Dorling and M. J. Baker, Rapid FTIR chemical characteristics of unsaturated fatty acids, lipids, and proteins. imaging: highlighting FPA detectors, Trends Biotechnol., Furthermore, digital subtraction of mutant strains spectra 2013, 31(8), 437–438. from WT spectra showed that the major vibrations in the 7 L. M. Miller, M. W. Bourassa and R. J. Smith, FTIR spectro- difference spectra are attributed to unsaturated fatty acids, scopic imaging of protein aggregation in living cells, lipids, and proteins (bands 3008, 2928, 2848, 1744, and Biochim. Biophys. Acta, 2013, 1828(10), 2339–2346. − 1648 cm 1). This study further demonstrates the usefulness of 8 D. Ami, A. Natalello and S. M. Doglia, Fourier transform Fourier Transform Infrared microspectroscopy to study differ- infrared microspectroscopy of complex biological systems: ences in chemical composition between wild-type and mutant from intact cells to whole organisms, Methods Mol. Biol., C. elegans strains as well as to investigate fat metabolism and 2012, 895,85–100. the impact of fatty acids when used as supplement in worms 9 D. Ami, A. Natalello, A. Zullini and S. M. Doglia, feeding media. The results obtained could be complemented Fourier transform infrared micro spectroscopy as a new by other studies such as targeted gene expression and bio- tool for nematode studies, FEBS Lett., 2004, 576(3), 297– chemical analyses. 300. 10 L. Diomede, G. Cassata, F. Fiordaliso, M. Salio, D. Ami, A. Natalello, S. M. Doglia, A. De Luigi and M. Salmona, Conflicts of interest Tetracycline and its analogues protect Caenorhabditis elegans from beta amyloid-induced toxicity by targeting There are no conflicts to declare. oligomers, Neurobiol. Dis., 2010, 40(2), 424–431. 11 M. Sheng, A. Gorzsas and S. Tuck, Fourier transform infra- red microspectroscopy for the analysis of the biochemical Acknowledgements composition of C. elegans worms, Worm, 2016, 5(1), Some strains used in this study were provided by the e1132978. Caenorhabditis Genetics Center (CGC), which is funded by the 12 L. K. Tamm and S. A. Tatulian, Infrared spectroscopy of NIH Office of Research Infrastructure Programs (P40 proteins and peptides in lipid bilayers, Q. Rev. Biophys., 30 – OD010440). The research was supported in part by NASA Grant 1997, (4), 365 429. # NNX15AL16G (SV), USDA NIFA AFRI #2015-67030-23452 13 C. Erkut, S. Penkov, H. Khesbak, D. Vorkel, J. M. Verbavatz, (NMM, SV), the Obesity Research Cluster (NA, NMM), Texas K. Fahmy and T. V. Kurzchalia, Trehalose Renders the Tech Transdisciplinary Research Academy (NMM, SV), and the Dauer Larva of Caenorhabditis elegans Resistant to 21 – Fiber and Biopolymer Research Institute (NA, EH). Extreme Desiccation, Curr. Biol., 2011, (15), 1331 1336. 14 N. J. Szewczyk, I. A. Udranszky, E. Kozak, J. Sunga, S. K. Kim, L. A. Jacobson and C. A. Conley, Delayed develop- References ment and lifespan extension as features of metabolic life- style alteration in C-elegans under dietary restriction, 1 K. Ashrafi, Obesity and the regulation of fat metabolism, J. Exp. Biol., 2006, 209(20), 4129–4139. WormBook, 2007, 1–20. 15 N. J. Szewczyk, E. Kozak and C. A. Conley, Chemically 2 N. S. Kalupahana, K. Claycombe, S. J. Newman, T. Stewart, defined medium and Caenorhabditis elegans, BMC N. Siriwardhana, N. Matthan, A. H. Lichtenstein and Biotechnol., 2003, 3, 19. N. Moustaid-Moussa, Eicosapentaenoic acid prevents and 16 E. J. O’Rourke, A. A. Soukas, C. E. Carr and G. Ruvkun, reverses insulin resistance in high-fat diet-induced obese C. elegans Major Fats Are Stored in Vesicles Distinct from mice via modulation of adipose tissue inflammation, Lysosome-Related Organelles, Cell Metab., 2009, 10(5), 430– J. Nutr., 2010, 140(11), 1915–1922. 435. 3 J. L. Watts, Using Caenorhabditis elegans to Uncover 17 K. Ashrafi, F. Y. Chang, J. L. Watts, A. G. Fraser, Conserved Functions of Omega-3 and Omega-6 Fatty Acids, R. S. Kamath, J. Ahringer and G. Ruvkun, Genome-wide J. Clin. Med., 2016, 5(2), DOI: 10.3390/jcm5020019. RNAi analysis of Caenorhabditis elegans fat regulatory 4 A. P. Simopoulos, Genetic variants in the metabolism of genes, Nature, 2003, 421(6920), 268–272. omega-6 and omega-3 fatty acids: their role in the determi- 18 K. Yen, T. T. Le, A. Bansal, D. Narasimhan, J. X. Cheng and nation of nutritional requirements and chronic disease H. A. Tissenbaum, A Comparative Study of Fat Storage risk, Exp. Biol. Med., 2010, 235(7), 785–795. Quantitation in Nematode Caenorhabditis elegans Using 5 M. J. Baker, J. Trevisan, P. Bassan, R. Bhargava, H. J. Butler, Label and Label-Free Methods, PLoS One,2010,5(9), e12810. K. M. Dorling, P. R. Fielden, S. W. Fogarty, N. J. Fullwood, 19 J. Zheng and F. L. Greenway, Caenorhabditis elegans as a K. A. Heys, C. Hughes, P. Lasch, P. L. Martin-Hirsch, model for obesity research, Int. J. Obes., 2012, 36(2), 186– B. Obinaju, G. D. Sockalingum, J. Sule-Suso, R. J. Strong, 194.

This journal is © The Royal Society of Chemistry 2017 Analyst,2017,142,4727–4736 | 4735 Paper Analyst

20 A. Folick, W. Min and M. C. Wang, Label-free imaging of and multiple physiological defects, including abnormal lipid dynamics using Coherent Anti-stokes Raman ultradian rhythms, in Caenorhabditis elegans, Genetics, Scattering (CARS) and Stimulated Raman Scattering (SRS) 2003, 163(1), 159–169. microscopy, Curr. Opin. Genet. Dev., 2011, 21(5), 585–590. 26 K. Satouchi, K. Hirano, M. Sakaguchi, H. Takehara and 21 E. San-Blas, M. Guerra, E. Portillo, I. Esteves, N. Cubillan F. Matsuura, Phospholipids from the Free-Living and Y. Alvarado, ATR/FTIR characterization of Steinernema Nematode Caenorhabditis-Elegans, Lipids, 1993, 28(9), glaseri and Heterorhabditis indica, Vib. Spectrosc., 2011, 837–840. 57(2), 220–228. 27 J. L. Watts and J. Browse, Genetic dissection of polyun- 22 H. Y. N. Holman, K. A. Bjornstad, M. C. Martin, saturated fatty acid synthesis in Caenorhabditis elegans, W. R. Mckinney, E. A. Blakely and F. G. Blankenberg, Proc. Natl. Acad. Sci. U. S. A., 2002, 99(9), 5854–5859. Mid-infrared reflectivity of experimental atheromas, 28 K. Ashrafi, Mapping out starvation responses, Cell Metab., J. Biomed. Opt., 2008, 13(3), 030503. 2006, 3(4), 235–236. 23 A. Barth, Infrared spectroscopy of proteins, Biochim. 29 N. Abidi, L. Cabrales and C. H. Haigler, Changes in the cell Biophys. Acta, Bioenerg., 2007, 1767(9), 1073–1101. wall and cellulose content of developing cotton fibers 24 A. J. Hobro and B. Lendl, Fourier-transform mid-infrared investigated by FTIR spectroscopy, Carbohydr. Polym., 2014, FPA imaging of a complex multicellular nematode, Vib. 100,9–16. Spectrosc., 2011, 57(2), 213–219. 30 M. Kniazeva, Q. T. Crawford, M. Seiber, C. Y. Wang and 25 M. Kniazeva, M. Sieber, S. McCauley, K. Zhang, J. L. Watts M. Han, Monomethyl branched-chain fatty acids play an and M. Han, Suppression of the ELO-2 FA elongation essential role in Caenorhabditis elegans development, PLos activity results in alterations of the fatty acid composition Biol., 2004, 2(9), 1446–1459.

4736 | Analyst,2017,142,4727–4736 This journal is © The Royal Society of Chemistry 2017 Texas Tech University, Amal Bouyanfif, August 2019

APPENDIX F Vibrational Spectroscopy 102 (2019) 8-15

282

Vibrational Spectroscopy 102 (2019) 8–15

Contents lists available at ScienceDirect

Vibrational Spectroscopy

journal homepage: www.elsevier.com/locate/vibspec

FTIR microspectroscopy reveals fatty acid-induced biochemical changes in C. elegans T

Amal Bouyanfifa,b,c, Sumedha Liyanagea, Eric Hequeta, Naima Moustaid-Moussaa,b,c, ⁎ Noureddine Abidia,c, a Fiber and Biopolymer Research Institute, Texas Tech University, Lubbock, TX, USA b Department of Nutritional Sciences, Texas Tech University, Lubbock, TX, USA c Obesity Research Cluster, Texas Tech University, Lubbock, TX, USA

ARTICLE INFO ABSTRACT

Keywords: Fourier transform infrared microspectroscopy (FTIR) is a promising method for the analysis of biological sam- FTIR microspectroscopy ples. Recent studies reported that FTIR imaging allows determination of the distribution of several biomolecules Imaging in a sample with no staining or extraction. In this study, FTIR was used to monitor biochemical changes in C. fi Ole nic elegans nematodes cultured in nematode maintenance media (CeMM) without supplementation and with sup- Palmitic acid plementation with either a long chain polyunsatured omega 3 fatty acid, eicosapentaenoic acid (EPA) or a C. elegans saturated fatty acid, palmitic acid (PA) at 100 μM. EPA is an omega 3 fatty acid with documented health benefits Eicosapentaenoic acid while PA is generally consumed in diets. Worms were placed on BaF2 slides, and FTIR spectra were collected from single worms in transmission mode using a focal plane array detector. Principal component analysis grouped the FTIR spectra into three clusters corresponding to spectra of worms cultured with no supple- mentation, worms cultured with supplementation with EPA, and worms cultured with supplementation with PA. The major differences between the FTIR spectra reside in the vibrations corresponding to unsaturated fatty acids − − − (3008 cm 1), lipids (2928, 2848, and 1744 cm 1), and proteins (1680, 1648, and 1515 cm 1). This indicates that supplementation with EPA or PA leads to biochemical alterations related to unsaturated fatty acids, lipids, and proteins. Furthermore, supplementing mutant strains (tub-1 and fat-3) CeMM with PA resulted in the ap- − − pearance of the vibration 3008 cm 1, an increase in the intensity of the vibration 1744 cm 1, and a new vi- − bration at 1632 cm 1, which is assigned to the amide I of β-pleated sheet component of proteins, in the spectra of tub-1 and fat-3 mutant strains. The results illustrated the potential use of FTIR alongside other techniques such as gas chromatography and staining techniques to investigate lipid metabolism and fat accumulation as well as induced changes in protein structures.

1. Introduction possibility of long-term storage as a frozen stock, no prior approval is required compared to studies on rodents and higher order animals [11]. Caenorhabditis elegans (C. elegans) has attracted increasing attention C. elegans has been used to investigate mechanisms that regulate and has become a major model organism in different research fields, lipid storage and metabolism [1,3,12–16]. In mammals, lipids are pri- such as biology [1], obesity, fat metabolism [2–4], drug discovery marily stored as triglycerides in adipose tissue. In C. elegans, lipids are [5,6], biomedical toxicology, environmental toxicology [7], and na- also stored primarily as triacylglycerols but in the gut granules and noparticle toxicity [8–10]. The interest in using this nematode as a hypodermal cells [3,4]. The fat content in C. elegans has been de- model organism instead of rodent models (e.g., mice) is attributed to termined by extracting total lipids from the whole worms, fractionating several advantages, such as small size, short lifespan, quick turnover, phospholipids and neutral lipid moieties, and then performing gas reduced experimental timeline, complete genetic information, easy chromatography/mass spectrometry analyses [3,13,17,18]. The tria- culture conditions, easy maintenance in the laboratory, low cost, cylglyceride content in the nematode is 40 to 55% of the total lipids,

Abbreviations: CeMM, C. elegans maintenance media; EPA, eicosapentaenoic acid; PA, palmitic acid; FPA, focal plane array; FTIR, Fourier transform infrared; NGM, nematode growth medium; PCA, principal component analysis; ω-3 PUFA, omega-3 polyunsaturated fatty acids; WT, wild-type; CGC, Caenorhabditis Genetics Center ⁎ Corresponding author at: 1001 East Loop 289, Lubbock, TX, 79403, USA. E-mail address: [email protected] (N. Abidi). https://doi.org/10.1016/j.vibspec.2019.03.002 Received 15 January 2019; Received in revised form 4 March 2019; Accepted 22 March 2019 Available online 23 March 2019 0924-2031/ © 2019 Elsevier B.V. All rights reserved. fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15 while phospholipids are composed of about 55% ethanolamine gly- 2. Materials and methods cerophospholipid, about 32% choline glycerophospholipid, and ap- proximately 8% sphingomyelin [19]. Polyunsaturated fatty acids 2.1. C. elegans strains, culture, and maintenance (PUFAs) play an important role, not only as structural components of membranes, but also as precursors to critical signaling molecules and Hermaphrodite adult WT and mutant strains tub-1 (nr2044) and fat- lipid mediators [20,13,21]. 3 (wa22) were acquired from the Caenorhabditis Genetics Center (CGC, Lipid metabolism pathways in C. elegans resemble those in mam- University of Minnesota, Minneapolis, MN, USA). WT (N2) is able to mals. However, a few exceptions exist. (1) unlike mammals, C. elegans synthetize 20:4n6 and 20:5n3 using saturated and monounsaturated possesses the fatty acid enzymes required to generate essential fatty fatty acids from bacteria as precursors [21,33]. By contrast, the mutant acids, (2) C. elegans is not able to produce PUFAs longer than C20. strain fat-3 lacks Δ6 desaturase activity and fails to produce any of the Therefore, the ω-6 and ω-3 PUFAs biosynthesis pathways end with common C20 PUFAs that are essential in regulating membrane struc- arachidonic acid (20:4n6) and eicosapentaenoic acid (20:5n3), respec- ture, dynamics, and permeability [21]. In the mutant strain tub-1, the tively [13]. As indicated above, C. elegans stores fat primarily as dro- functional loss of tubby ortholog called tub-1/F10B5.5 in C. elegans leads plets in their intestinal and skin-like epidermal cells [3]. Lipid staining to the accumulation of triglycerides, the major form of stored fat techniques using Nile Red, Sudan Black, Oil Red O, and fluorescently [4,22,34]. labeled fatty acids are commonly used to assess changes in fat storage Nematodes were first cultured in the nematode growth media due to mutations or RNAi-mediated inactivation of genes encoding (NGM) plates seeded with E. coli OP50 as the main food source [35,36]. various lipid biosynthesis pathways [4,22]. This technique has some Plates containing a large quantity of eggs and gravid adults were limitations, such as variability in dye labeling specificity and efficiency, bleached, and eggs were left in sterile M9 Buffer to hatch overnight. The which may lead to inconsistencies in lipid quantification [23,12,24]. following day, starved L1 animals were transferred to CeMM (Cell Other tools used to visualize lipids include coherent anti-stokes Raman Guidance Systems, Babraham, Cambridge, UK) containing 20 μg/mL of scattering, which allows visualization of lipids stored in both C. elegans kanamycin sulfate (Fisher Scientific, Pittsburgh, PA, USA) and 200 μg/ epidermal and gut granules without the use of invasive methods [14]. mL of streptomycin sulfate (Fisher Scientific, Pittsburgh, PA, USA) [37]. Tserevelakis et al. utilized label-free imaging using third-harmonic C. elegans strains were cultured in CeMM at 20 °C for multiple genera- generation microscopy to study lipid deposition in C. elegans [25]. Fo- tions to adapt to the media before being used in the experiments. lick et al. combined anti-stokes Raman scattering and simulated Raman scattering microscopy to develop new methods to visualize the locali- 2.2. Fatty acids zation and regulation of lipids in C. elegans [15]. We believe that me- tabolism of saturated and unsaturated fatty acids by C. elegans could Eicosapentaenoic acid (EPA) and palmitic acid (PA) were acquired result in biochemical changes that could be detected in intact worms from Nu-Check Prep (Elysian, MN, USA). EPA was supplied as a pure ω- (no chemical extraction and no chemical staining) using Fourier 3 ethyl esters. It was stored at −80 °C, and exposure to heat, light, and transform infrared microspectroscopy (FTIR). oxygen was minimized to prevent oxidative degradation. PA was sup- FTIR is a powerful analytical technique to investigate the chemical plied as pure palmitic acid. EPA and PA solutions in ethanol were composition of a sample. When combined with a microscope and focal prepared and CeMM was supplemented at a final concentration of 100 plane array detectors (FPA), this;1; technique allows imaging of a re- μM; feeding was performed for 72 h on worm cultures of mixed ages. latively large sample area, providing both spectroscopic information (chemical identification) and distribution of functional groups in the 2.3. FTIR microspectroscopy sample. Recently, we reviewed the applications of FTIR to study the biochemical changes in C. elegans [26]. FTIR imaging could be used to Individual hermaphrodite adult nematodes were washed with dis- investigate intact nematodes. These applications include nematode tilled water and deposited on FTIR transparent BaF2 slides identi[fication 27,28], biochemical composition [29,30], and toxicity (PerkinElmer, MA, USA). Slides containing worms were then dried in a assessment of nanoparticles and drugs [31,32]. We used FTIR imaging vacuum desiccator for 1 h. FTIR spectra were collected in the trans- − to illustrate changes in intact C. elegans (wild-type (N2) and mutant mission mode between 4000 and 1000 cm 1 using a Spectrum 400 strains fat-3 and tub-1) when C. elegans maintenance media (CeMM) was FTIR equipped with a Spotlight 400 microscope (PerkinElmer, MA, supplemented with a polyunsaturated fatty acid, eicosapentaenoic acid USA) accessory with a liquid nitrogen cooled 128 × 128 Mercury- (EPA) [30]. We used principal component analysis to discriminate WT Cadmium-Telluride (MCT) focal plane array detector. To improve the from mutant strains (tub-1 and fat-3) cultured with or without EPA signal-to-noise ratio, 128 co-added spectra were collected from each − supplementation. This discrimination was mainly due to differences in pixel (6.25 x 6.25 μm) with a spectral resolution of 16 cm 1. Prior to unsaturated fatty acids, lipids, and protein profiles [30]. These con- sample measurements, a background spectrum from an empty area of clusions were further supported by performing digital subtraction of the the BaF2 slide was automatically subtracted from the spectra of the FTIR spectra of mutant strains from those of WT. These studies vali- sample. The BaF2 slide does not show any absorption in the range of − dated the FTIR technique as an important tool to detect changes in 4000–1000 cm 1. biochemical compositions and lipid metabolism [30]. This work has A visual image was first acquired from the sample (Fig. 1A). Figs. 1B laid the foundation to explore further the use of FTIR imaging to dissect and C show FTIR image and the corresponding spectra extracted from biochemical changes in C. elegans WT and mutant strains (tub-1 and fat- the positions marked in the image. Point mode imaging was used in this 3) cultured in CeMM supplemented with EPA or palmitic acid (PA). We study, which allowed us to acquire a large number of spectra in a short compared these two fatty acids as one of them, EPA is an omega 3 fatty period of time (approximately 20 min). Spectra were acquired from a acid with documented health benefits including metabolic diseases; single worm along the length (4 to 6 worms for each treatment) with an while PA is a saturated fatty acid commonly consumed in the diet and aperture size of 15 x 15 μm. Four to eight data points were acquired also endogenously produced. In this study, FTIR spectra were acquired from each worm (separated by approximately 50 μm), and all the in transmission mode on a single intact worm with no special pre- spectra were the result of 128 co-added scans. The acquired spectra paration. This stain-free analytical technique is able to provide in- were baseline corrected and normalized with respect to the total ab- − formation related to chemical functional groups that provide insight sorbance over the entire range from 4000 to 1000 cm 1 using the into biochemical changes in C. elegans fed saturated or unsaturated fatty Spectrum 10™ software (PerkinElmer, MA, USA). Principal component ® acids. analysis was performed using the Unscrambler X 10.3 software (CAMO Software AS, Norway).

9 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

Fig. 1. Image of the whole intact C. elegans illustrating the location from which spectra were recorded.

− 3. Results and discussion [30,38]. The vibration at 1548 cm 1 was attributed to amide II, which could originate from NeH bending and CeN stretching of the protein −1 In previous work, we investigated the use of FTIR imaging to il- amide group. The vibration at 1456 cm was assigned to CH2 bending lustrate changes occurring in WT (N2), tub-1, and fat-3 C. elegans cul- and deformation of methylene of lipids, proteins, or cholesterol esters. − − tured with and without EPA supplementation at 25 or 100 μM[30]. The The vibration at 1392 cm 1 was assigned to the COO stretch of car- results indicated that mutant strains have altered lipid compositions bohydrates, fatty acids, or amino acid side chains. The vibrations at −1 − and that the major component of the middle part of the worms are fatty 1232 and 1084 cm originated from PO2 antisymmetric and sym- acyl groups. In this study, we investigated the chemical changes in- metric stretching of phosphodiesters, respectively. The vibration at − duced when the C. elegans diet was supplemented with and without EPA approximately 1155 cm 1 was assigned to CeO stretching and possibly and PA at 100 μM. Representative spectra acquired from WT (N2) originated from glycogen [39]. − cultured in CeMM alone and from WT (N2) cultured in CeMM either It is important to note the presence of the vibration at 3008 cm 1, with EPA or PA supplementation at 100 μM are exhibited in Fig. 2.Itis which is attributed to HC]CH- stretching [40,41]. This vibration is due interesting to note that the only difference between these spectra re- to unsaturated fatty acids and exists in the spectra acquired from WT − sides in the intensities of the vibrations at 2928 cm 1 (asymme- (N2) with no supplementation. This vibration represents a very im- −1 triceCH2 stretch), at 2848 cm (symmetriceCH2 stretch), and at portant feature in the FTIR spectra of WT (N2) C. elegans compared to − 1744 cm 1 (C]O stretch). These vibrations are associated with the the spectra acquired from tub-1 and fat-3 mutant strains. This result presence of lipids, fatty acids, triglycerides, and phospholipids [30]. confirms previously reported results that indicated that WT (N2) C. Supplementing CeMM with PA resulted in a high intensity of these vi- elegans is capable of synthesizing a wide range of saturated, mono- − brations but did not affect other vibrations in the 1700–1000 cm 1 unsaturated, and polyunsaturated fatty acids [13,17,18,33,42]. Pre- − region. In this region, the vibration at 1648 cm 1 was assigned to the vious fatty acid analyses of C. elegans and C. briggsae reported that lipids C]O stretch of amide I, mainly the α-helix components of proteins accounted for 19.1% of the dry weight of C. elegans [33]. The authors

10 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

Fig. 2. Representative FTIR spectra acquired from WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 μM. indicated that the major portion of the fatty acids contained 18 or 20 WT (N2) cultured in CeMM with EPA or PA supplementation compared carbons, with unsaturated fatty acids making 70% of the total fatty to the spectra acquired from WT (N2) cultured only in CeMM with no acids (the principal fatty acid fraction was 18:1) [33]. Supplementation supplementation. The separation of the FTIR spectra into different with EPA did not result in an increased intensity of the vibration at groups indicates that biochemical changes are induced in worms when − 3008 cm 1 (slightly reduced intensity was noticed). their diet is supplemented with saturated and unsaturated fatty acids. Several FTIR spectra were acquired, and principal component ana- The analysis of loading variables (or factors) as a function of wa- lysis (PCA) was performed to identify distinct groups of spectra that venumbers can help identify the functional groups that are behind the exhibit spectral similarities. PCA is a widely adopted multivariate sta- grouping of the original spectra [45]. Plots of the first three component tistical analysis used to reduce the dimensionality from a large number loadings as a function of wavenumbers are shown in Fig. 4. PC-1, PC-2 of interconnected variables (wavenumbers in the case of FTIR) to a few and PC-3 account for 46%, 33% and 8% of the spectral variation, re- − uncorrelated variables [43,44]. The reduction in dimensionality is spectively. The PC-1 loading plot shows major peaks at 1744 cm 1 (C] − achieved by means of a linear transformation to a new set of variables O stretching of esters), 1632 cm 1 (amide I band of the β-pleated sheet termed principal component scores. Thus, the sources of variability in component of proteins, collagen proline residues [38]). The PC-2 the data are concentrated into the first 2 or 3 principal components. loading plot shows major peaks at the following vibrations: 2928 and − Plots of PC-1 against PC-2 or PC-3 revealed clustering in the FTIR 2848 cm 1 (assigned to asymmetric and symmetric stretching of the −1 −1 spectra. We used PCA to analyze the FTIR spectra acquired from C. acyleCH2 groups), 1744 cm and 1680 cm (assigned to amide I elegans WT and mutant strains tub-1 and fat-3 to detect diet and geno- band component originating from anti-parallel pleated sheets and β- − type-dependent biochemical changes with and without EPA supple- turns of proteins), and approximately 1550 cm 1 (assigned to amide II, mentation at 25 and 100 μM[30]. Fig. 3 shows PC-1 and PC-2 scores of NeH bending and CeN stretching of protein amide groups with some the FTIR spectra acquired from WT (N2) cultured with no supple- contribution from amino acid side chains such as arginine, aspartate, mentation and either with EPA or PA supplementation at 100 μM. Three glutamate and tyrosine [38]). The PC-3 loading plot shows major peaks − − − − − groups of spectra can be distinguished as follows: the first group cor- at 2928 cm 1, 2848 cm 1, 1680 cm 1, 1632 cm 1, 1515 cm 1 (as- −1 − responds to WT (N2) with no supplementation, the second group cor- signed to tyrosine ring vibration), 1232 cm (PO2 antisymmetric −1 − responds to WT (N2) with supplementation with EPA at 100 μM, and stretching of phosphodiesters [38]), and 1084 cm (PO2 symmetric the third group corresponds to WT (N2) with supplementation with PA stretching of the phosphodiester backbone of nucleic acids and phos- at 100 μM. It is worth pointing out the large variability in the spectra of pholipids). Representative spectra acquired from mutant strain tub-1 are shown − in Fig. 5. As reported in our previous work, the vibration at 3008 cm 1 (]CH– olefinic stretching), which generally arises from the presence of unsaturated fatty acids, is present only as a very small shoulder in the FTIR spectra of tub-1 cultured with no supplementation [30]. The vi- − brations associated with triglycerides (2928, 2848, and 1744 cm 1) are present with high intensities. For this mutant strain, it was reported that the deletion of tubby ortholog (tub-1) leads to an accumulation of tri- glycerides, which are the major form of stored fat in C. elegans [4,22]. Supplementation of CeMM with 100 μM EPA leads to the appearance of − the vibration at 3008 cm 1 with only a minor increase in the intensity − of the vibration at 1744 cm 1 (triglycerides, phospholipids, cholesterol esters, or fatty acids). Supplementing the growth media with palmitic acid (saturated fatty − acid) not only resulted in the appearance of the vibration at 3008 cm 1 but also in a significant increase in the intensity of the vibration at − 1744 cm 1. Palmitic acid can be integrated into triacylglycerides or Fig. 3. PCA of the FTIR spectra acquired from WT (N2) cultured without and phospholipids or can be modified by fatty acid elongases and desa- with either EPA or PA supplementation at 100 μM. Each data point represents a turases to form a variety of long-chain polyunsaturated fatty acids spectrum obtained with 128 co-added scans.

11 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

Fig. 4. Loadings corresponding to PCA presented in Fig. 3 as a function of wavenumbers for WT (N2) C. elegans cultured without and with either EPA or PA supplementation at 100 μM.

[12,13]. Furthermore, it is of particular interest to note the appearance − of the vibration at 1632 cm 1, assigned to the carbonyl stretching in amide I of the β-pleated sheet component of proteins [38]. Supple- menting the worm diet with saturated palmitic acid resulted in the shift − from the vibration at 1648 cm 1 assigned to amide I of the α-helix − component to 1632 cm 1 assigned to amide I of the β-sheet compo- nents. However, this was not the case for the WT (N2) strain. Fur- thermore, supplementation with EPA and PA resulted in the appearance − of a vibration at approximately 1520 cm 1, which has been assigned to the parallel mode of α-helices [39]. Fig. 6 shows the PCA of the FTIR spectra of the tub-1 C. elegans strain cultured without supplementation and with supplementation either with EPA or PA at 100 μM. PC-1 and PC-2 account for 72% and 9% of the variance respectively and separate the FTIR spectra into 3 groups corresponding to tub-1 C. elegans cultured with no supplementation, tub- 1 C. elegans cultured with EPA supplementation, and tub-1 C. elegans Fig. 6. PCA of the FTIR spectra of tub-1 C. elegans cultured without and with cultured with PA supplementation. either EPA or PA supplementation at 100 μM. Each data point represents a The PC score plots as a function of wavenumbers show that the spectrum obtained with 128 co-added scans. major difference between the spectra come from lipids (2928, 2848, − − and 1744 cm 1) and proteins (1680, 1648, and 1515 cm 1)(Fig. 7). A

Fig. 5. Representative FTIR spectra acquired from tub-1 C. elegans cultured without and with either EPA or PA supplementation at 100 μM.

12 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

Fig. 7. Loadings corresponding to PCA presented in Fig. 6 as a function of wavenumbers for tub-1 C. elegans cultured without and with either EPA or PA supple- mentation at 100 μM (PC-1: 72%, PC-2: 9%, and PC-3: 8%).

− small contribution from unsaturated fatty acids (vibration at to the appearance of the vibration at 3008 cm 1 (Fig. 8). Watts et al. − 3008 cm 1) was also observed. indicated that although fat-3 mutants fail to produce any of the Representative spectra acquired from the fat-3 C. elegans strain common C20 PUFAs, the resulting growth abnormalities could be bio- cultured without or with EPA or PA at 100μM are shown in Fig. 8. The chemically complemented by dietary supplementation of various C20 major differences between these spectra are the vibrations at 3008, PUFAs, such as eicosapentaenoic acid [21]. Supplementing CeMM with − − 2928, 2848, and 1744 cm 1. The vibration at 3008 cm 1 is present EPA resulted in an increase in the intensity of the vibration at 1744 cm-1 only as a very small shoulder in the spectra of fat-3 C. elegans cultured (assigned to C]O stretching). with no supplementation. As mentioned previously, this vibration re- The supplementation of the CeMM growth media with 100 μMofPA − presents a fingerprint of –HC]CH-. The C. elegans mutant strain fat-3 is accompanied by the appearance of the vibration at 3008 cm 1 and an exhibits a deficiency in the synthesis of PUFAs due to the dysfunction of increase of the intensity of the vibrations at 2928, 2848, and − the desaturases, which can cause defects in lipid regulation and re- 1744 cm 1. This result indicates that saturated palmitic acid is con- production [16]. Watts et al. reported that fat-3 mutants lack Δ6 de- verted to unsaturated fatty acids. The results of gas chromatography saturase activity and fail to produce any of the common C20 PUFAs analysis did not show EPA but showed a significant increase in the [21]. Because of this deficiency, the growth and behavior of the worm amount of linoleic acid (from approximately 6.9% in fat-3 C. elegans are compromised along with neuromuscular defects, cuticle abnorm- with no supplementation to approximately 15.7% with supplementa- alities, reduced brood size, and altered biological rhythms [21,20]. tion with PA) (result not shown). This result indicated that the vibration Supplementation of the CeMM growth media with 100μM of EPA leads assigned to –CH]CH- observed in the spectra of fat-3 supplemented

Fig. 8. Representative FTIR spectra acquired from fat-3 C. elegans strain cultured without or with either EPA or PA supplementation at 100 μM.

13 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

of biochemical changes in the worms. These changes are essentially related to lipids, proteins, and unsaturated fatty acids. This study showed that FTIR could be used alongside gas chromatography and staining techniques to investigate lipid metabolism and fat accumula- tion as well as changes induced in the protein structure. When com- paring the wild-type to mutant strains, relative quantification could be used by calculating the area under the peak or the peak intensity.

4. Conclusions

In C. elegans, lipid storage and dynamics have been studied using staining with Nile Red or Oil Red O followed by fluorescence micro- scopy imaging. Other studies monitored lipid storage using coherent anti-stokes Raman and stimulated Raman scattering microscopy. Here, we used FTIR microspectroscopy to investigate the effect of C. elegans Fig. 9. PCA of the FTIR spectra of fat-3 strain cultured without or with either diet supplementation with a saturated and an unsaturated fatty acid on μ EPA or PA at 100 M. Each data point represents spectra obtained with 128 co- the changes in the biochemical composition. The FTIR spectra were added scans. acquired on intact worms in transmission mode. The principal com- ponent analysis of the FTIR spectra grouped the spectra into three with PA likely originates from linoleic acid C18:2. It was reported that groups corresponding to the spectra acquired from worms cultured with C. elegans synthesizes 7% of its palmitic acid (16:0) through acetyl Co-A no supplementation, worms cultured with supplementation with eico- carboxylase (ACC) and fatty acid synthase (FAS), and the rest is ab- sapentaenoic acid, and worms cultured in CeMM supplemented with sorbed from bacterial diets [2]. Elongases and desaturases can then palmitic acid. The major differences between the spectra resided in the integrate palmitic acid into triglycerides or convert it to long-chain vibrations corresponding to unsaturated fatty acids, lipids, and pro- polyunsaturated fatty acids [2]. In contrast to nematode growth media teins. Furthermore, relative quantification of the biochemical changes agar plates with E. Coli (NGM), CeMM does not contain palmitic acid. is possible by calculating the area under the peak of interest or its The FTIR results illustrated the ability of C. elegans to convert saturated height. Comparison between two spectra could allow us to conclude fatty acids to unsaturated fatty acids. Because mutant strain fat-3 lacks about the relative changes of the functional groups and, thus, the cor- Δ-6-desaturase, it is likely that the conversion of palmitic acid results in responding biochemical compounds. the production of linoleic acid 18:2n6, which was detected by FTIR. PCA of the FTIR spectra of mutant strain fat-3 is shown in Fig. 9. Conflicts of interest Similar to the other strains, three groups of spectra could be identified, fi depending on the diet. The rst three components explained 90% of the There are no conflicts to declare. variance. The major differences between the spectra reside in lipids, proteins, and unsaturated fatty acids. Acknowledgments Loadings of PC-1, PC-2, and PC-3 as a function of wavenumbers are shown in Fig. 10. Similar to the results presented above, the plots show − The authors would like to thank Dr. S.A. Vanapalli group for sup- peaks corresponding to unsaturated fatty acids (3008 cm 1), lipids − plying C. elegans strains, he obtained from the Caenorhabditis Genetics (2928, 2848, 1744 cm 1), and proteins (1680, 1648, 1632, 1568, and − Center (CGC), which is funded by the NIH Office of Research 1515 cm 1). Infrastructure Programs (P40 OD010440). The research was supported FTIR analysis of the spectra acquired from single worms cultured by the Fiber and Biopolymer Research Institute and startup funds from with or without EPA or PA supplementation illustrates the occurrence the College of Human Sciences, Texas Tech University, USA.

Fig. 10. Loadings corresponding to PCA presented in Fig. 9 as a function of wavenumbers for fat-3 C. elegans cultured without or with EPA or PA supplementation at 100 μM (PC-1: 70%, PC-2: 12%, PC-3: 8%).

14 fi A. Bouyan f, et al. Vibrational Spectroscopy 102 (2019) 8–15

References vesicles distinct from lysosome-related organelles, Cell Metab. 10 (5) (2009) 430–435, https://doi.org/10.1016/j.cmet.2009.10.002. [24] A.A. Soukas, E.A. Kane, C.E. Carr, J.A. Melo, G. Ruvkun, Rictor/TORC2 regulates fat [1] M. Witting, P. Schmitt-Kopplin, The Caenorhabditis elegans lipidome: a primer for metabolism, feeding, growth, and life span in Caenorhabditis elegans, Genes Dev. lipid analysis in Caenorhabditis elegans, Arch. Biochem. Biophys. 589 (2016) 23 (4) (2009) 496–511, https://doi.org/10.1101/gad.1775409. – 27 37, https://doi.org/10.1016/j.abb.2015.06.003. [25] G.J. Tserevelakis, E.V. Megalou, G. Filippidis, B. Petanidou, C. Fotakis, [2] J. Zheng, F.L. Greenway, Caenorhabditis elegans as a model for obesity research, N. Tavernarakis, Label-free imaging of lipid depositions in C. Elegans using third- – Int. J. Obes. (Lond) 36 (2) (2012) 186 194, https://doi.org/10.1038/ijo.2011.93. harmonic generation microscopy, PLoS One 9 (1) (2014) e84431, , https://doi.org/ fi [3] K. Ashra , Obesity and the Regulation of Fat Metabolism. WormBook, (2007), pp. 10.1371/journal.pone.0084431. – 1 20, https://doi.org/10.1895/wormbook.1.130.1. [26] A. Bouyanfif, S. Liyanage, E. Hequet, N. Moustaid-Moussa, N. Abidi, Review of FTIR fi [4] K. Ashra , F.Y. Chang, J.L. Watts, A.G. Fraser, R.S. Kamath, J. Ahringer, G. Ruvkun, microspectroscopy applications to investigate biochemical changes in C. Elegans, Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes, Nature Vib. Spectrosc. 96 (2018) 74–82, https://doi.org/10.1016/j.vibspec.2018.03.001. – 421 (6920) (2003) 268 272, https://doi.org/10.1038/nature01279. [27] D. Ami, A. Natalello, A. Zullini, S.M. Doglia, Fourier transform infrared micro- ’ [5] L.P. O Reilly, C.J. Luke, D.H. Perlmutter, G.A. Silverman, S.C. Pak, C. elegans in spectroscopy as a new tool for nematode studies, FEBS Lett. 576 (3) (2004) – high-throughput drug discovery, Adv. Drug Deliv. Rev. 69 (2014) 247 253, https:// 297–300, https://doi.org/10.1016/j.febslet.2004.09.022. doi.org/10.1016/j.addr.2013.12.001. [28] D. Ami, A. Natalello, S.M. Doglia, Fourier transform infrared microspectroscopy of [6] M. Artal-Sanz, L. de Jong, N. Tavernarakis, Caenorhabditis elegans: a versatile complex biological systems: from intact cells to whole organisms, Methods Mol. – platform for drug discovery, Biotechnol. J. 1 (12) (2006) 1405 1418, https://doi. Biol. 895 (2012) 85–100, https://doi.org/10.1007/978-1-61779-927-3_7. org/10.1002/biot.200600176. [29] M. Sheng, A. Gorzsas, S. Tuck, Fourier transform infrared microspectroscopy for the [7] M.C. Leung, P.L. Williams, A. Benedetto, C. Au, K.J. Helmcke, M. Aschner, analysis of the biochemical composition of C. Elegans worms, Worm 5 (1) (2016) J.N. Meyer, Caenorhabditis elegans: an emerging model in biomedical and en- e1132978, , https://doi.org/10.1080/21624054.2015.1132978. – vironmental toxicology, Toxicol. Sci. 106 (1) (2008) 5 28, https://doi.org/10. [30] A. Bouyanfif, S. Liyanage, J.E. Hewitt, S.A. Vanapalli, N. Moustaid-Moussa, 1093/toxsci/kfn121. E. Hequet, N. Abidi, FTIR imaging detects diet and genotype-dependent chemical [8] L. Gonzalez-Moragas, P. Berto, C. Vilches, R. Quidant, A. Kolovou, R. Santarella- composition changes in wild type and mutant C. Elegans strains, Analyst 142 (24) Mellwig, Y. Schwab, S. Sturzenbaum, A. Roig, A. Laromaine, In vivo testing of gold (2017) 4727–4736, https://doi.org/10.1039/c7an01432e. nanoparticles using the Caenorhabditis elegans model organism, Acta Biomater. 53 [31] E. Zanni, G. De Bellis, M.P. Bracciale, A. Broggi, M.L. Santarelli, M.S. Sarto, – (2017) 598 609, https://doi.org/10.1016/j.actbio.2017.01.080. C. Palleschi, D. Uccelletti, Graphite nanoplatelets and Caenorhabditis elegans: in- [9] L. Gonzalez-Moragas, A. Roig, A. Laromaine, C-elegans as a tool for in vivo nano- sights from an in vivo model, Nano Lett. 12 (6) (2012) 2740–2744, https://doi.org/ – particle assessment, Adv. Colloid Interfac. 219 (2015) 10 26, https://doi.org/10. 10.1021/nl204388p. 1016/j.cis.2015.02.001. [32] L. Diomede, G. Cassata, F. Fiordaliso, M. Salio, D. Ami, A. Natalello, S.M. Doglia, [10] J.N. Meyer, C.A. Lord, X.Y.Y. Yang, E.A. Turner, A.R. Badireddy, S.M. Marinakos, A. De Luigi, M. Salmona, Tetracycline and its analogues protect Caenorhabditis ff A. Chilkoti, M.R. Wiesner, M. Au an, Intracellular uptake and associated toxicity of elegans from beta amyloid-induced toxicity by targeting oligomers, Neurobiol. Dis. silver nanoparticles in Caenorhabditis elegans, Aquat. Toxicol. 100 (2) (2010) 40 (2) (2010) 424–431, https://doi.org/10.1016/j.nbd.2010.07.002. – 140 150, https://doi.org/10.1016/j.aquatox.2010.07.016. [33] P.A. Hutzell, L.R. Krusberg, Fatty-acid compositions of caenorhabditis-elegans and fi [11] A. Bouyan f, S. Jayarathne, I. Koboziev, N. Moustaid-Moussa, The nematode cae- caenorhabditis-briggsae, Comp. Biochem. Phys. B 73 (3) (1982) 517–520, https:// ff norhabditis elegans as a model organism to study metabolic e ects of w-3 poly- doi.org/10.1016/0305-0491(82)90068-2. – unsaturated Fatty Acuds in Obesity, Adv. Nutr. 10 (1) (2019) 165 178. [34] H.Y. Mak, L.S. Nelson, M. Basson, C.D. Johnson, G. Ruvkun, Polygenic control of [12] J.L. Watts, Fat synthesis and adiposity regulation in Caenorhabditis elegans, NIH Caenorhabditis elegans fat storage, Nat. Genet. 38 (3) (2006) 363–368, https://doi. – Public Access 2 (2009) 58 65, https://doi.org/10.1016/j.tem.2008.11.002. org/10.1038/ng1739. [13] J.L. Watts, J. Browse, Genetic dissection of polyunsaturated fatty acid synthesis in [35] T. Stiernagle, Maintenance of C. Elegans, Worm Methods (2006) 51–67, https://doi. – Caenorhabditis elegans, Proc. Natl. Acad. Sci. U. S. A. 99 (9) (2002) 5854 5859, org/10.1895/wormbook.1.101.1. https://doi.org/10.1073/pnas.092064799. [36] T. Stiernagle, Maintenance of C. Elegans, WormBook (2006) 1–11, https://doi.org/ [14] T. Hellerer, C. Axang, C. Brackmann, P. Hillertz, M. Pilon, A. Enejder, Monitoring of 10.1895/wormbook.1.101.1. lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering [37] N.J. Szewczyk, E. Kozak, C.A. Conley, Chemically defined medium and – (CARS) microscopy, Proc. Natl. Acad. Sci. U. S. A. 104 (37) (2007) 14658 14663, Caenorhabditis elegans, BMC Biotechnol. 3 (2003) 19, https://doi.org/10.1186/ https://doi.org/10.1073/pnas.0703594104. 1472-6750-3-19. [15] A. Folick, W. Min, M.C. Wang, Label-free imaging of lipid dynamics using coherent [38] A.J. Hobro, B. Lendl, Fourier-transform mid-infrared FPA imaging of a complex anti-stokes raman scattering (CARS) and stimulated raman scattering (SRS) mi- multicellular nematode, Vib. Spectrosc. 57 (2) (2011) 213–219. – croscopy, Curr. Opin. Genet. Dev. 21 (5) (2011) 585 590, https://doi.org/10.1016/ [39] J. Vongsvivut, P. Heraud, A. Gupta, M. Puri, D. McNaughton, C.J. Barrow, FTIR j.gde.2011.09.003. microspectroscopy for rapid screening and monitoring of polyunsaturated fatty acid [16] W.-W. Chen, Y.-H. Yi, C.-H. Chien, K.-C. Hsiung, T.-H. Ma, Y.-C. Lin, S.J. Lo, a T.- production in commercially valuable marine yeasts and protists, Analyst 138 (20) fi C. Chang, Speci c polyunsaturated fatty acids modulate lipid delivery and oocyte (2013) 6016–6031, https://doi.org/10.1039/c3an00485f. development in C. Elegans revealed by molecular-selective label-free imaging, Sci. [40] E. San-Blas, M. Guerra, E. Portillo, I. Esteves, N. Cubillan, Y. Alvarado, ATR/FTIR Rep. (2016), https://doi.org/10.1038/srep32021. characterization of steinernema glaseri and heterorhabditis indica, Vib. Spectrosc. [17] M. Kniazeva, M. Sieber, S. McCauley, K. Zhang, J.L. Watts, M. Han, Suppression of 57 (2) (2011) 220–228, https://doi.org/10.1016/j.vibspec.2011.07.008. the ELO-2 FA elongation activity results in alterations of the fatty acid composition [41] H.Y. Holman, K.A. Bjornstad, M.C. Martin, W.R. McKinney, E.A. Blakely, and multiple physiological defects, including abnormal ultradian rhythms, in F.G. Blankenberg, Mid-infrared reflectivity of experimental atheromas, J. Biomed. – Caenorhabditis elegans, Genetics 163 (1) (2003) 159 169. Opt. 13 (3) (2008) 030503, , https://doi.org/10.1117/1.2937469. [18] K. Satouchi, K. Hirano, M. Sakaguchi, H. Takehara, F. Matsuura, Phospholipids from [42] M. Kniazeva, Q.T. Crawford, M. Seiber, C.Y. Wang, M. Han, Monomethyl branched- – the free-living nematode Caenorhabditis elegans, Lipids 28 (9) (1993) 837 840. chain fatty acids play an essential role in Caenorhabditis elegans development, PLoS fi [19] K. Ashra , Mapping out starvation responses, Cell Metab. Elsevier Inc. 3 (4) (2006) Biol. 2 (9) (2004) E257, https://doi.org/10.1371/journal.pbio.0020257. – 235 236, https://doi.org/10.1016/j.cmet.2006.03.002. [43] E.K. Kemsley, Discriminant analysis of high-dimmensional data: a comparaison of [20] K. Reisner, M. Lehtonen, M. Storvik, Tanel Jantson, Merja Lakso, J.C. Callaway, principal compoenent analysis and partial least square data reduction medthods, Garry Wong, Trans Fat Diet Causes Decreased Brood Size and Shortened Lifespan in Chemom. Intell. Lab. 33 (1) (1996) 47–61. Caenorhabditis elegans delta-6-desaturase Mutant fat-3, J. Biochem. Mol. Toxicol [44] L. Chen, N.C. Carpita, W.D. Reiter, R.H. Wilson, C. Jeffries, M.C. McCann, A rapid – 25 (2011) 269 279. method to screen for cell-wall mutants using discriminant analysis of Fourier ffi fi [21] J.L. Watts, E. Phillips, K.R. Gri ng, J. Browse, De ciencies in C20 polyunsaturated transform infrared spectra, Plant J. 16 (3) (1998) 385–392. fatty acids cause behavioral and developmental defects in Caenorhabditis elegans [45] A. Alonso-Simon, A.E. Encina, P. Garcia-Angulo, J.M. Alvarez, J.L. Acebes, FTIR – fat-3 mutants, Genetics 163 (2) (2003) 581 589. spectroscopy monitoring of cell wall modifications during th ehabituation of bean [22] A. Mukhopadhyay, B. Deplancke, A.J.M. Walhout, H.A. Tissenbaum, C-elegans (Phaseolus vugaris L.) callus cultures to dichlobenil, Plant Sci. 167 (6) (2004) tubby regulates life span and fat storage by two independent mechanisms, Cell 1273–1281. Metab. 2 (1) (2005) 35–42, https://doi.org/10.1016/j.cmet.2005.06.004. [23] E.J. O’Rourke, A.A. Soukas, C.E. Carr, G. Ruvkun, C. Elegans major fats are stored in

15