Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

Morphological investigation and analysis of ribosomal DNA phylogeny of two scale-worms (Polychaeta, ) from the Gulf of Thailand

For Review Only Journal: Songklanakarin Journal of Science and Technology

Manuscript ID SJST-2016-0474.R1

Manuscript Type: Original Article

Date Submitted by the Author: 07-Jun-2017

Complete List of Authors: Ngamniyom, Arin; srinakharinwirot university, environmental culture and ecotourism Koto, Rakchanok ; Srinakharinwirot University, Biology Wongroj, Weerawich ; Srinakharinwirot University, Prasarnmit Elementary Demonstration School Sriyapai, Thayat ; Srinakharinwirot University, Faculty of Environmental Culture and Eco-tourism Panyarachun, Busaba; Srinakharinwirot University Faculty of Medicine

Keyword: Capitulatinoe cf. cupisetis, cf. oerstedi, the western coast

For Proof Read only Page 1 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 Morphological investigation and analysis of ribosomal DNA phylogeny of two scale- 4 worms (Polychaeta, Polynoidae) from the Gulf of Thailand 5 6 Arin Ngamniyom 1*, Rakchanok Koto 2, Weerawich Wongroj 3, Thayat Sriyapai 1, Pichapack 7 Sriyapai 4 and Busaba Panyarachun 5 8 9 1 10 Faculty of Environmental Culture and Ecotourism, Srinakharinwirot University, Bangkok 11 10110, Thailand; email: [email protected] 12 13 2 Department of Biology, Faculty ofSciences, Srinakharinwirot University, Bangkok 10110, 14 Thailand. 15 16 3 Prasarnmit Elementary Demonstration School, Srinakharinwirot University, Bangkok 17 10110, Thailand. 18 For Review Only 19 4 20 Department of Microbiology, Faculty of Sciences, Srinakharinwirot University, Bangkok 21 10110, Thailand. 22 23 5 Department of Anatomy, Faculty of Medicine, Srinakharinwirot University, Bangkok 24 10110, Thailand. 25 26 * Corresponding author. 27 28 Email: [email protected] 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 1 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 2 of 23

1 2 3 Morphological investigation and analysis of ribosomal DNA phylogeny of two scale- 4 5 worms (Polychaeta, Polynoidae) from the Gulf of Thailand 6 7 8 9 Abstract 10 11 12 Scaleworms are of the family Polynoidae that are commonly distributed 13 14 in marine environments. This study aims to identify and introduce two scaleworms from the 15 16 western coast of the Gulf of Thailand as Capitulatinoe cf. cupisetis and Eunoe cf. oerstedi . 17 18 For Review Only 19 Using scanning electron microscopy of adult worms, the antennae, palps, prostomium, cirri, 20 21 setigers, parapodia, saetae and elytra are described. In addition, the phylogenetic relationships 22 23 of our specimens with other species were analysed based on partial sequences of 24 25 28S, 18S and 16S ribosomal DNA (rDNA) genes. The rDNA sequences identified C. cf. 26 27 cupisetis and E. cf. oerstedi which were respectively recovered within Arctonoinae and 28 29 30 Polynoinae in a monophyletic Polynoidae. The congruence or incongruence of the 31 32 morphological and molecular data is discussed in the text. These findings increase the 33 34 knowledge of polynoid polychaete worms in Thailand, although the precise identity of the 35 36 two scaleworm species remains to be identified. 37 38 39 40 Key words: Capitulatinoe cf. cupisetis , Eunoe cf. oerstedi , the western coast 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

57 58 2 59 60 For Proof Read only Page 3 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 4 5 6 1. Introduction 7 8 9 10 Scale worms are freeliving, carnivorous polychaetes belonging to the family 11 12 Polynoidae (suborder ) and were originally described by Kinberg (1856). They 13 14 are widespread, occurring primarily in marine regions in tropical and subtropical 15 16 environments, from shallow to deep seas (Fauchald, 1977). The family Polynoidae consists of 17 18 For Review Only 19 about fifteen subfamilies, with more than two hundred genera recognised worldwide 20 21 (Malmgren, 1867; Pettibone, 1969; Fauchald, 1977; Barnich et al ., 2012). Recent studies of 22 23 the family include SalazarVallejo et al . (2015) who reported the polynoid 24 25 loboi as a new species from Puerto Madryn, Argentina and De Assis et al . (2015) who 26 27 created the catalogue of the eighteen scale worms in the genus from South 28 29 30 America. 31 32 The genus Capitulatinoe Hanley and Burke, 1989 belongs to the subfamily 33 34 Arctonoinae and contains only one member, C. Cupisetis which is a commensal organism 35 36 inhabiting the ambulacral grooves of asteroids in Broome, Western Australia (Hanley & 37 38 39 Burke, 1989). 40 41 42 The genus Eunoe Malmgren, 1866 is a large genus belonging to the subfamily 43 44 Polynoinae. It is distributed in a wide range of marine environments and contains more than 45 46 fifty recognised species (Bellan, 2001); for example, E. assimilis from South Africa 47 48 49 (McIntosh, 1924); E. spinosa from Sagami Bay and Sagami Sea, Japan (Imajima, 1997); E. 50 51 hydroidopapillata from Kamchatka, Russia (Rzhavsky & Shabad, 1999); E. tuerkayi from the 52 53 Adriatic Sea (Barnich & Fiege, 2003); E. yedoensis from the Arabian Peninsula (Wehe, 2006) 54 55 and E. nodosa from the North Atlantic (Barnich & Fiege, 2010). E. oerstedi is one of the 56 57 58 3 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 4 of 23

1 2 3 members of the genus originally recorded by Malmgren (1866) and inhabits the Western 4 5 North Atlantic Ocean (Barnich & Fiege, 2010). 6 7 8 9 Ribosomal DNA (rDNA) sequences of the nucleus and mitochondria are commonly 10 11 used molecular taxonomic tools for identifying and defining large metazoan taxa (Canales 12 13 Aguirre et al., 2011; Machida & Knowlton, 2012). Moreover, Norlinder et al. (2012) 14 15 evaluated the phylogenetic relationships within the scaleworms of the Aphroditiformia based 16 17 on partial nucleotide sequences of nuclear genes and mitochondrial genes. Carr et al. (2011) 18 For Review Only 19 20 provided an important phylogeny of polychaetes including E. oerstedi by using mitochondrial 21 22 cytochrome c oxidase I (COI) from Canadian oceans, and 28S rDNA sequences of this 23 24 species that were already deposited into GenBank (http://www.ncbi.nlm.nih.gov). Recently, 25 26 the excellent study of Serpett et al. (2016) reported the phylogenetics of Eunoe spp. and other 27 28 29 polynoid species based on 18S, 28S, 16S rDNA and COI in the Southwest Indian Ocean 30 31 Ridge. 32 33 The aim of the present study was to report C. cf. cupisetis and E. cf. oerstedi from the 34 35 western coast of the Gulf of Thailand and to describe the surface morphology of both species 36 37 using scanning electron microscopy (SEM). In addition, the phylogenetic relationships of C. 38 39 40 cf. cupisetis and E. cf. oerstedi within the polynoid families were assessed using partial DNA 41 42 sequences of 28S, 18S and 16S rDNA. 43 44 45 2. Materials and Methods 46 47 48 2.1 Polynoid collections 49 50 Capitulatinoe scaleworms were found at two sites and E. cf. oerstedi at one site during a 51 52 survey of intertidal polychaete worms over six sampling sites in the Gulf of Thailand, 53 54 Prachuap Khiri Khan Province (Figure 1A). In the present study, polychaetes were surveyed 55 56 from July to December 2013. Capitulatinoe cf. cupisetis were collected from the ambulacral 57 58 4 59 60 For Proof Read only Page 5 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 grooves of Astropecten indica in areas of fine sand at 14 m depth, and E. cf. oerstedi were 4 5 sampled from marine mud inthe shells of dead Pinna sp. bivalves collected at 8 –12 m depth 6 7 using an Agassiz trawl (Figures 1B , and C). The sampled worms were placed in small aquaria 8 9 10 containing natural seawater that were equipped with air pumps, and the aquaria were then 11 12 transported to the laboratory. For subsequent specimen descriptions, the living worms were 13 14 anaesthetised with 7% MgCl 2 in cool seawater and their general morphologies observed for 15 16 species identification under a stereomicroscope. The specimens were then fixed in 4% 17 18 For Review Only 19 formaldehyde overnight and transferred into 70% ethanol for storage. 20 21 The scaleworms were identified according to a key by Hanley and Burke (1989) for 22 23 C. cupisetis and keys by Banse and Hobson (1974), Pollock (1998) and Barnich and Fiege 24 25 (2010) for E. oerstedi . The nomenclature used to describe the morphology of polychaetes 26 27 followed Rouse and Pleijel (2001). 28 29 30 2.2 SEM investigation 31 32 Adult individuals of each of C. cf. cupisetis and E. cf. oerstedi were fixed overnight in 33 34 2.5% glutaraldehyde fixative in 0.1 sodium cacodylate buffer, pH 7.4, at 4 °C. The worms 35 36 were then washed three times with 0.05 sodium cacodylate buffer and then postfixed in 1% 37 38 39 osmium tetroxide in 0.1 sodium cacodylate buffer, pH 7.4, at 4 °C for 1 h. They were then 40 41 washed three times with distilled water and dehydrated through a graded ethanol series. 42 43 After dehydration, the specimens were dried in a critical point drying machine (Hitachi HCP 44 45 2) using liquid carbon dioxide as a transitional medium. The specimens were mounted on 46 47 aluminium stubs, coated with gold in an ionsputtering apparatus (SPIModel sputter coater) 48 49 50 for 4 min and examined using a JEOL JSM5400 scanning electron microscope operating at 51 52 15 kV. 53 54 55 2.3 Molecular phylogenetic analysis 56 57 58 5 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 6 of 23

1 2 3 Polynoid genomic DNA from C. cf. cupisetis or E. cf. oerstedi was extracted from 4 5 fresh samples of each species using a DNeasy Tissue kit (Qiagen) according to the 6 7 manufacturer’s protocol. The nuclear and mitochondrial genes were amplified using Taq 8 9 10 DNA polymerase (Takara, Tokyo, Japan). The primer pairs for 28S rDNA amplification 11 12 were 5’ ACCCGCTGAATTTAAGCAT3’ and 5’TCCGTGTTTCAAGACGG3’ (~800 bp) 13 14 (Lê et al., 1993), for 18S rDNA they were 5’TACCTGGTTGAT CCTGCCAGTAG3’ and 15 16 5’GATCCTTCCGCAGGTTCACCTAC3’ (~1,750 bp) (Giribet et al., 1996) and for 16S 17 18 For Review Only 19 rDNA they were 5’CGCCTGTTTATCAAAAACAT3’ and 5’ 20 21 CCGGTCTGAACTCAGATCACGT3’ (~450 bp) (Ruta et al., 2007). Polymerase chain 22 23 reactions (PCR) were conducted at thermal cycling conditions involving an initial 24 25 denaturation step at 95 ºC for 3 min, followed by 30 cycles of denaturation at 94 ºC for 30 s, 26 27 annealing at 52 ºC for 30 s and extension at 72 ºC for 1 min. A final extension was performed 28 29 30 at 72 ºC for 10 min. The PCR products were electrophoresed on a 1% agarose gel, stained 31 32 with ethidium bromide, and viewed on a UV transilluminator. DNA fragments from the PCR 33 34 products were purified using the QIAquick Gel Extraction Kit (Qiagen) with spin columns 35 36 and stored at 4 ºC. 37 38 39 DNA sequencing was performed by Macrogen DNA Sequencing Service, Korea. The 40 41 partial sequences of the C. cf. cupisetis and E. cf. oerstedi genes were deposited into 42 43 GenBank (http://www.ncbi.nlm.nih.gov) under the accession numbers in Table 1. The DNA 44 45 sequencing results were analysed for regions of local similarity using the online program 46 47 Basic Local Alignment Search Tool (BLAST) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The 48 49 50 multiple sequence alignments were performed with the Clustal Omega multiple sequence 51 52 alignment program (McWilliam et al., 2013). For the phylogenetic examination of 53 54 polychaetes, the bootstrap method with neighbour joining was conducted using the software 55 56 package Molecular Evolutionary Genetics Analysis (MEGA) version 5.10 (Tamura et al., 57 58 6 59 60 For Proof Read only Page 7 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 2011) for Windows. 4 5 6 3. Results 7 8 9 10 3.1 General polynoid morphology 11 12 In C. cf. cupisetis , the body of specimens prolongs subcylindrically, with numerous 13 14 setigers covered by numerous pairs of elytra. The average body size is 16 mm long and 2 mm 15 16 wide (Figure 1B). Prostomium ishexagonal oval, undivided into two lobes, two pairs of eyes, 17 18 For Review Only 19 lacking cephalic peaks, three antennae, paired palps and paired tentacular cirri. Two lateral 20 21 antennae are smaller and shorter than the median antenna. Tentacular cirri are long and 22 23 present posterolateral to prostomium (Figure 2A). Parapodia are subbiramous with a larger 24 25 neuropodium and smaller notopodium. The notopodium is unsharpened, digitiform, lacking 26 27 notosetae and positioned on anterodorsal side of neuropodium. Neuropodium is bluntly 28 29 30 rounded with presetal lobe and bears rows of neurosetae on basal semilunar pocket. Aciculae 31 32 embedded within notopodium and neuropodium throughout, proximally to distally. 33 34 Notopodia and neuropodia bear dorsal and ventral cirri, respectively. Dorsal cirri are 35 36 typically longer than ventral cirri (Figure 2B). Neurosetae in the halfmoonshaped blades, 37 38 39 serrate, long, with conspicuously bidentate tips, wide subdistally, except neurosetae of first 40 41 parapodia are short (Figures 2C and D). Elytra are orbicular, large, soft, pellucid and without 42 43 tubercles (Figure 2E). 44 45 In E. cf. oerstedi , the body is oblong, with an average size of 10 mm long by 3.5 mm 46 47 wide, covered by fifteen pairs of elytra (Figure 1C). Prostomium bilobed with two pairs of 48 49 50 eyes, with cephalic peaks obvious, three antennae, paired palps, two paired tentacular cirri. 51 52 Two pairs of eyes occur dorsolaterally on prostomium. Median antenna is larger and longer 53 54 than paired lateral antennae. Two pairs of tentaculophore are approximately cylindrical on 55 56 anterolateral side of prostomium (Figure 2F). Paired elytrophores are cylindrical, short, wide 57 58 7 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 8 of 23

1 2 3 plates on tips at dorsal setigers. Parapodia are biramous with a notopodium smaller than the 4 5 neuropodium. Notopodium is rounded with short acicular lobe, and neuropodium is 6 7 subconical with long acicular lobe. Aciculae embedded within notopodium and neuropodium 8 9 10 project proximally to distally. Numerous welldeveloped setae on basal semilunar pocket of 11 12 notopodium and neuropodium (Figure 2G). Notosetae are stout, long, thick, with capillary 13 14 tips, adorned by rows of serrations. Neurosetae are similar to notosetae in aspect but are 15 16 longer (Figures 2H and I). Elytra are reniform, light brownish, translucent, with 17 18 For Review Only 19 macrotubercles on posterior margins (Figure 2J). Macrotubercles are digitiform, stout, 20 21 variable in size and with pronglike branching on tips (Figure 2K). 22 23 24 25 26 27 28 3.2 SEM investigation of polynoid surfaces 29 30 31 In dorsal view of C. cf. cupisetis , the surface of the prostomium is very bumpy, but 32 33 the surfaces of antennae, palps, tentacular cirrus, dorsal cirrus and parapodia are slightly 34 35 rough. Anterior parts of elytra are rougher than the posterior parts (Figure 3A). In ventral 36 37 view, the surface of buccal cirri is as rough as the surface of antennae and other regions. The 38 39 40 slightly roughened surface covers the ventral body, including around the mouth. However, 41 42 the surface is very bumpy on the anteromedial side (Figure 3B). Neurosetae of the first 43 44 parapodia are smooth with rows of serrations. One row of serrations on subdistal setae is 45 46 broad and surrounds the edge with multiple sawteeth. Four paired serrations on notched tip 47 48 49 of setae show the digitiform row of eleven sawteeth (Figures 3C and D). The surface of 50 51 neurosetae on the second parapodia and others is similar to the first parapodia. However, 52 53 there are differences in the number of serrations. The second parapodia and others consist of 54 55 six or seven paired serrations with six to eleven sawteeth (Figures 3E and F). 56 57 58 8 59 60 For Proof Read only Page 9 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 In dorsal view the surface of E. cf. oerstedi is irregular, wrinkled and supported by 4 5 transverse gracile folds. Narrow groove lines run longitudinally along the mediodorsal body. 6 7 Tentaculophore and cirrophore surfaces are slightly rough. Plate surfaces on tips of 8 9 10 elytrophores are almost smooth. Filamentlike structures are present on surfaces of tentacular 11 12 cirri. The prostomium surface is bumpy. Two pairs of anterior dorsal cirri present a setalike 13 14 structure (Figure 4A). Anterior dorsal cirri are stout, smooth, with blunt tips and bear rows of 15 16 serrations without sawteeth on edges. Three antennae are hidden by a cluster of filamentlike 17 18 For Review Only 19 structures. A high degree of corrugation is found on palp surfaces with short filaments 20 21 (Figure 4B). Cirrophores and pygidium are moderately rough, and posterodorsal surfaces are 22 23 wrinkled. Narrow groove line is not connected on posterodorsal surface (Figure 4C). In 24 25 ventral view, the surface of the mouth opening is slightly wrinkled. Buccal cirri are also 26 27 bumpy (Figure 4D). Notosetae and neurosetae with smooth surfaces are surrounded by 28 29 30 serrations approximately threefourths the width of setae. Each serration presents crenulations 31 32 on the margin (Figures 4E and F). The anterior and middle areas of the elytra are covered 33 34 with numerous coinshaped microtubercles. In contrast, no microtubercles or macrotubercles 35 36 are observed on proximolateral part. The posterior areas bear scattered macrotubercles and 37 38 39 are covered by a meshwork of microfilaments on surfaces. Macrotubercles are adorned with 40 41 small papillae and occur trifid to pentafid on tips (Figure 4H). 42 43 44 3.3 Molecular phylogenetic analysis of rDNA genes 45 46 47 The phylogenetic relationships of C. cf. cupisetis and E. cf. oerstedi with eighteen 48 49 50 other polychaete species and one cnidarian were analysed using the 28S, 18S and 16S rDNA 51 52 genes. The results indicated that species belonging to the Polynoidae and Sigalionidae share 53 54 recent common ancestry but that those of the Phyllodocidae, Hesionidae, Glycerdae and 55 56 do not. Capitulatinoe cf. cupisetis and E. cf. oerstedi were included the 57 58 9 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 10 of 23

1 2 3 Polynoidae which was the sister group to the Sigalionidae (Neoleantra tetragona ). In the 4 5 polynoid subfamily Arctonoinae, C. cf. cupisetis was closely related to Gastrolepidia 6 7 clavigera and together these formed the sister taxon to Paradyte crinoidicola . In the 8 9 10 Polynoinae, E. cf. oerstedi was the sister taxon the group containing H. oculinarium , H. 11 12 glabra and E. nodosa . Both subfamilies together formed the sister group of the 13 14 Lepidonotinae (Lepidonotus clava ). The rDNA sequences clearly distinguished polynoid 15 16 species from each of the two species of Hesionidae (Leocrates chinensis and Amphiduros 17 18 For Review Only 19 fuscescens ), Phyllodocidae (Chaetoparia nilssoni and Eulalia mustela ), and Nereididae 20 21 (Ceratocephale loveni and Nereis pelagica ), and the one species of Glycerdae (Glycera 22 23 tridactyla ). All worms were distantly related to the outgroup (Cnidaria: Liponema 24 25 brevicornis ) (Figure 5). 26 27 28 29 30 31 32 4. Discussion 33 34 Based on C. cf. cupisetis specimen found in the ambulacral grooves of thestarfish A. 35 36 indica from the Gulf of Thailand, we described the general and detailed morphology of adults 37 38 39 of the commensal species Capitulatinoe cf. cupisetis . The similar species of C. cupisetis was 40 41 originally found in the ambulacral grooves of the common starfish A. granulatus in Broome, 42 43 Western Australia (Hanley & Burke, 1989) and was used for comparison with the detailed 44 45 morphology of the studied scaleworms. The specimens in Thailand resemble the Australian 46 47 C. cupisetis : a similar structure was found in the antennae, palps, prostomium, cirri, setigers, 48 49 50 parapodia, saetae and elytra. 51 52 53 For E. cf. oerstedi , our morphological description corresponds with that of Banse and 54 55 Hobson (1974), in which E. oerstedi , with the unidentate character of its setae tips, was 56 57 58 10 59 60 For Proof Read only Page 11 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 distinguished from the fifteenscaled worm . The elytra of our specimens are 4 5 similar to those described previously by Pollock (1998) from specimens of eastern North 6 7 America, with branched macrotubercles on the elytrum surfaces. However, the worms in the 8 9 10 Gulf of Thailand seem to be shorter than those in eastern North America. 11 12 The surface morphology of C. cupisetis and E. oerstedi has been examined the present 13 14 study by SEM. The descriptions of the surfaces of the saetae and elytra are consistent with 15 16 observations made under stereomicroscopy by Hanley and Burke (1989) of C. cupisetis and 17 18 For Review Only 19 by Malmgren (1866) and subsequentauthors of E. oerstedi . In the present study, the results of 20 21 SEM provided detail of the worm surfaces beyond those available from microscopic 22 23 observations, including details of the epidermal, seta and elytrum surfaces in C. cf. cupisetis 24 25 and of the cirri, pulp, saetae, microtubercles and macrotubercles in E. cf. oerstedi . 26 27 28 29 Based on the 28, 18S and 16S rDNA analyses, C. cf. cupisetis and E. cf. oerstedi were 30 31 recovered in the Arctonoinae and Polynoinae, respectively, as expected, these two 32 33 subfamilies forming the sister group to the Lepidonotinae. These molecular data identified 34 35 the Arctonoinae and Polynoinae as monophyletic within the Polynoidae. These results are in 36 37 agreement with Norlinder et al. (2010) who classified the Polynoidae as monophyletic based 38 39 40 on the nuclear and mitochondrial sequences of 48 taxa of scaleworm polychaetes. Within the 41 42 Arctonoinae, the clade topology of the present study identifies C. cf. cupisetis as more closely 43 44 related to G. clavigera than to P. crinoidicola . This result appears congruent with SEM 45 46 observations of the setal morphology of G. clavigera and P. crinoidicola by Britayev et al. 47 48 49 (1999): neurosetae stout with subdistal swelling; rows of fine serrations present on the 50 51 neurosetae of G. clavigera but not P. crinoidicola . Therefore, the appearance of serrations 52 53 may be in accordance with the molecular relationships of these species. In the Polynoinae, E. 54 55 cf. oerstedi was not monophyletic with E. nodosa . However, to date, the elytrum tubercles 56 57 58 11 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 12 of 23

1 2 3 and other morphological characters of the latter species have been regarded as incongruent 4 5 with the molecular relationships of this subfamily. 6 7 8 9 To our knowledge, the present study provides the first report of C. cf. cupisetis and E. 10 11 cf. oerstedi in the Gulf of Thailand and provides morphological and molecular information on 12 13 both scale polychaetes; however, comparison with real specimens, additional and supporting 14 15 data are needed for their precise identification as C. cupisetis , E. oerstedi or cryptic species. 16 17 References 18 For Review Only 19 20 Banse, K., & Hobson, K. D. (1974). Benthic errantiate polychaetes of British Columbia and 21 22 23 Washington. Bulletin of the Fisheries Research Board of Canada , 185 , 1111. 24 25 Barnich, R., & Fiege, D. (2003). The Aphroditoidea (Annelida: Polychaeta) of the 26 27 Mediterranean Sea. Abhandlungen der Senckenbergischen Naturforschenden 28 29 Gesellschaft , 559 , 1167. 30 31 32 Barnich, R., & Fiege, D. (2010). On the distinction of Harmothoe globifera (G.O. Sars, 1873) 33 34 and some other easily confused polynoids in the NE Atlantic, with the description of a 35 36 new species of Norman in McIntosh, 1900 (Polychaeta, Polynoidae). 37 38 Zootaxa , 2525 , 118. 39 40 Barnich, R., Gambi, M. C., & Fiege D. (2012). Revision of the genus Polyeunoa McIntosh, 41 42 43 1885 (Polychaeta, Polynoidae), Zootaxa , 3523 , 2538. 44 45 Bellan, G. (2001). Polychaeta , pp. 214 –231 In: Costello M. J., Emblow C. & White R. J 46 47 (eds), European register of marine species: a check-list of the marine species in 48 49 Europe and a bibliography of guides to their identification , Collection Patrimoines 50 51 52 Naturels, Muséum national d'Histoire naturelle, Paris. 53 54 55 56 57 58 12 59 60 For Proof Read only Page 13 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 Britayev, T. A., Doignon, G., & Eeckhaut, I. (1999). Symbiotic polychaetes from Papua 4 5 New Guinea associated with echinoderms, with descriptions of three new species. 6 7 Cahiers de Biologie Marine , 40 , 359374. 8 9 10 CanalesAguirre, B., Rozbaczylo, N., & Hernández, C. E. (2011). Genetic identification of 11 12 benthic polychaetes in a biodiversity hotspot in the southeast Pacific. Revista de 13 14 Biología Marina y Oceanografía , 46 , 8994. 15 16 Carr, C. M., Hardy, S. M., Brown, T. M., Macdonald, T. A., & Hebert, P. D. (2011). A tri 17 18 For Review Only 19 oceanic perspective: DNA barcoding reveals geographic structure and cryptic 20 21 diversity in canadian polychaetes. PLoS ONE , 6, E22232. 22 23 Daly, M., Chaudhuri, A., Gusmao, L., & Rodriguez, E. (2008). Phylogenetic relationships 24 25 among sea anemones (Cnidaria: Anthozoa: Actiniaria). Molecular Phylogenetics and 26 27 Evolution , 48, 292301. 28 29 30 De Assis, J. E., de Brito, R. J., Christoffersen, M. L., & de Souza, J. R. (2015). A catalogue 31 32 of the scaleworm genus Lepidonotus (Polynoidae, Polychaeta) from South America, 33 34 with two new records for Brazilian waters. Zookeys , 9, 6398. 35 36 Eklof, J., Pleijel, F., & Sundberg, P. (2007). Phylogeny of benthic Phyllodocidae 37 38 39 (Polychaeta) based on morphological and molecular data. Molecular Phylogenetics 40 41 and Evolution , 45 , 261271. 42 43 Fauchald, K. (1977). The Polychaete worms. Definitions and keys to the orders, families and 44 45 genera. Natural History Museum of Los Angeles County. Science Series , 28 , 1188. 46 47 Gallardo, V. A. (1968). Polychaeta from the Bay of Nha Trang, South Viet Nam. Scripps 48 49 50 Institution of Oceanography NAGA Report , 4, 35279. 51 52 Giribet, G., Carranza S., Baguna, J., Riutort, M., & Ribera, C. (1996). First molecular 53 54 evidence for the existence of a Tardigrada + Arthropoda clade. Molecular 55 56 Phylogenetics and Evolution , 13 , 7684. 57 58 13 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 14 of 23

1 2 3 Hanley, J. R., & Burke, M. (1989). A new genus and species of commensal scaleworm 4 5 (Polychaeta, Polynoidae) from Broome, Western Australia. The Beagle Records of 6 7 the Northern Territory Museum of Arts and Sciences, 6, 97103. 8 9 10 Imajima, M. (1997). Polychaetous from Sagami Bay and Sagami Sea collected by 11 12 the Emperor Showa of Japan and deposited at the Showa Memorial Institute, National 13 14 Science Museum, Tokyo. Families Polynoidae and Acoetidae. National Science 15 16 Museum Monographs , 13 , 1131. 17 18 For Review Only 19 Lê, H. L. V., Lecointre, G., & Perasso, R. (1993). A 28S rRNA based phylogeny of the 20 21 gnathostomes: first steps in the analysis of conflict and congruence with 22 23 morphologically based cladograms. Molecular Phylogenetics and Evolution , 14 , 110. 24 25 Machida, R. J., & Knowlton, N. (2012). PCR primers for metazoan nuclear 18S and 28S 26 27 ribosomal DNA sequences. PLoS ONE , 7, e46180. 28 29 30 Malmgren, A. J. (1866). Nordiska HafsAnnulater. Öfversigt af Königlich 31 32 Vetenskapsakademiens förhandlingar, Stockholm , 22 (5), 355410. 33 34 Malmgren, A. J. (1867). Annulata Polychaeta Spetsbergiae, Groenlandiae, Islandiae et 35 36 Scandinaviae hactenus cognita. Ex Officina Frenckelliana, Helsingfors , (pp. 127). 37 38 39 McIntosh, W. C. (1924). Notes from the Gatty Marine Laboratory, St. Andrews. No. 46. 1. 40 41 On Mercierella . 2. Preliminary account of a second contribution to South African 42 43 polychaetes. Annals and Magazine of Natural History, Series 9, 14 , 152. 44 45 McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y. M., Buso, N., Cowley, A. P., & 46 47 Lopez, R. (2013). Analysis Tool Web Services from the EMBLEBI. Nucleic acids 48 49 50 research , 44 , W597600. 51 52 Norlinder, E., Nygren, A., Wiklund, H., & Pleijel, F. (2012). Phylogeny of scaleworms 53 54 (Aphroditiformia, Annelida), assessed from 18SrRNA, 28SrRNA, 16SrRNA 55 56 57 58 14 59 60 For Proof Read only Page 15 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 mitochondrial cytochrome c oxidase subunit Ι (COI), and morphology. Molecular 4 5 Phylogenetics and Evolution , 65 , 490500. 6 7 Paul, C., Halanych, K. M., Tiedemann, R., & Bleidorn, C. (2010). Molecules reject an 8 9 10 opheliid affinity for Travisia (Annelida). Systematics and Biodiversity , 8, 507512. 11 12 Pettibone, M. H. (1969). Review of some species referred to Scalisetosus McIntosh 13 14 (Polychaeta, Polynoidae). Proceedings of the Biological Society of Washington, 82 , 15 16 130. 17 18 For Review Only 19 Pollock, L. W. (1998). A Practical Guide to the Marine of Northeastern North 20 21 America. (pp. 367) Rutgers, NJ: Rutgers University Press. 22 23 Rouse, G. W., & Pleijel, F. (2001). Polychaetes . Oxford University Press. 24 25 Rousset, V., Pleijel, F., Rouse G. W., Erseus, C., & Siddall, M. E. (2007). A molecular 26 27 phylogeny of annelids. Cladistics , 23 , 4163. 28 29 30 Ruta ,C., Nygren, A., Rousset, V., Sundberg, P., Tillier, A., Wiklund, H., & Pleijel, F. (2007). 31 32 Phylogeny of Hesionidae (Aciculata, Polychaeta), assessed from morphology, 18S 33 34 rDNA, 28S rDNA, 16S rDNA and COI. Zoologica Scripta , 36 , 99107. 35 36 Rzhavsky, A. V., & Shabad, L. V. (1999). A new species of scaleworm, Eunoe 37 38 39 hydroidopapillata , collected off the eastern coast of Kamchatka (Polychaeta: 40 41 Polynoidae: Harmothoinae). Zoosystematica Rossica , 8(1), 1720. 42 43 SalazarVallejo, S. I., González, N. E., & SalazarSilva, P. (2015). Lepidasthenia loboi sp. n. 44 45 from Puerto Madryn, Argentina (Polychaeta, Polynoidae). Zookeys , 546 , 2137. 46 47 Serpetti, N., Taylor, M. L., Brennan, D., Green, D. H., Rogers, A. D., Paterson, G. L. J., & 48 49 50 Narayanaswamy, B. E. (2016). Ecological adaptations and commensal evolution of 51 52 the Polynoidae (Polychaeta) in the Southwest Indian Ocean Ridge: A phylogenetic 53 54 approach. Deep Sea Research Part II: Topical Studies in Oceanography , 137, 273 55 56 281. 57 58 15 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 16 of 23

1 2 3 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA5: 4 5 Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary 6 7 Distance, and Maximum Parsimony Methods. Molecular Phylogenetics and 8 9 10 Evolution , 28 , 27312739. 11 12 Wehe, T. (2006). Revision of scale worms (Polychaeta: Aphroditoidea) occurring in the seas 13 14 surrounding the Arabian Peninsula. Part I. Polynoidae. Fauna of Arabia , 22 , 23197. 15 16 Wiklund, H., Nygren, A., Pleijel, F., & Sundberg, P. (2005). Phylogeny of Aphroditiformia 17 18 For Review Only 19 (Polychaeta) based on molecular and morphological data. Molecular Phylogenetics 20 21 and Evolution , 37 , 494502. 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 16 59 60 For Proof Read only Page 17 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 4 5 Table 1 Lists of polynoids, other polychaetes and outgroup species with 6 accession numbers of 28S, 18S and16S rDNA sequences. 7 Accession 8 Species rDNA Reference 9 number 10 Ingroup 11 Amphiduros fuscescens 28S DQ442598 Ruta et al ., 2007 12 18S DQ442584 Ruta et al ., 2007 13 14 16S DQ442569 Ruta et al ., 2007 15 Capitulatinoe cf. cupisetis 28S KF919302 In this study 16 18S KF919301 In this study 17 16S KF919303 In this study 18 For Review Only 19 Ceratocephale loveni 28S DQ442618 Ruta et al ., 2007 20 18S DQ442616 Ruta et al ., 2007 21 16S DQ442614 Ruta et al ., 2007 22 23 Chaetoparia nilssoni 28S AY996108 Eklof et al ., 2007 24 18S AY996090 Eklof et al ., 2007 25 16S AY996069 Eklof et al ., 2007 26 Eunoe nodosa 28S JN852854 Norlinder et al ., 2012 27 28 18S JN852824 Norlinder et al ., 2012 29 16S JN852892 Norlinder et al ., 2012 30 E. cf. oerstedi 28S KF006981 In this study 31 18S KF006979 In this study 32 33 16S KF006980 In this study 34 Eulalia mustela 28S AY996105 Eklof et al ., 2007 35 18S AY996086 Eklof et al ., 2007 36 37 16S AY996065 Eklof et al ., 2007 38 Gastrolepidia clavigera 28S JN852855 Norlinder et al ., 2012 39 18S JN852825 Norlinder et al ., 2012 40 16S JN852893 Norlinder et al ., 2012 41 42 Glycera tridactyla 28S HM746739 Paul et al ., 2007 43 18S HM746726 Paul et al ., 2007 44 16S HM746711 Paul et al ., 2007 45 Harmothoe glabra 28S JN852858 Norlinder et al., 2012 46 47 18S JN852828 Norlinder et al ., 2012 48 16S JN852896 Norlinder et al ., 2012 49 H. impar 28S JN852859 Norlinder et al ., 2012 50 18S JN852829 Norlinder et al ., 2012 51 52 16S JN852897 Norlinder et al ., 2012 53 H. oculinarium 28S JN852860 Norlinder et al ., 2012 54 18S AY894299 Struck et al ., 2005 55 56 16S JN852898 Norlinder et al ., 2012 57 Leocrates chinensis 28S DQ442605 Ruta et al ., 2007 58 1 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 18 of 23

1 2 3 18S DQ442589 Ruta et al ., 2007 4 16S DQ442575 Ruta et al ., 2007 5 6 Lepidonotus clava 28S JN852864 Norlinder et al ., 2012 7 18S JN852833 Norlinder et al ., 2012 8 16S JN852902 Norlinder et al ., 2012 9 Neoleanira tetragona 28S JN852872 Norlinder et al ., 2012 10 11 18S AY839570 Wiklund et al ., 2005 12 16S JN852911 Norlinder et al ., 2012 13 Nereis pelagica 28S AY340407 Rousset et al ., 2007 14 15 18S AY340438 Rousset et al ., 2007 16 16S AY340470 Rousset et al ., 2007 17 Paradyte crinoidicola 28S JN852869 Norlinder et al ., 2012 18 For Review18S JN852837 Only Norlinder et al ., 2012 19

20 16S JN852907 Norlinder et al ., 2012 21 Outgroup 22 Liponema brevicornis 28S EU190827 Daly et al ., 2008 23 18S EU190866 Daly et al ., 2008 24 25 16S EU190784 Daly et al ., 2008 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 2 59 60 For Proof Read only Page 19 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Review Only 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 Figure 1. Study area including the sites of polychaete sampling from the western coast of the 44 45 Gulf of Thailand (A). Circles indicate the sample localities where C. cf. cupisetis (B) and E. 46 47 48 cf. oerstedi (C) were found. 49 50 51 52 53 54 55 56 57 58 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 20 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Review Only 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Figure 2. General morphology of C. cf. cupisetis : anterior part (A), of middle 49 50 segment (B), neurosetae of first parapodium (C), neurosetae of middle parapodium (D), 51 52 elytrum of middle segment (E). General morphology of E. cf. oerstedi : anterior part (F); 53 54 parapodium of middle segment (G), notosetae of middle parapodium (H), neurosetae of 55 56 57 middle parapodium (I), elytrum of middle segment (J), macrotubercle (K). 58 59 60 For Proof Read only Page 21 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Review Only 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 Figure 3. Surface topography of C. cf. cupisetis : dorsal view of anterior part (A), ventral 47 48 view of anterior part (B), neurosetae of first parapodium (C), a higher magnification of 49 50 51 outlined area in Figure C (D), neurosetae of middle parapodium (E), a higher magnification 52 53 of outlined area in Figure E (F). ant, anterior part; bc, buccal cirrus; dc, dorsal cirrus; e, 54 55 elytrum; mo, mouth; ne, neuropodium; no, notopodium; p, palp; pr, prostomium; se, setae; te, 56 57 tentacular cirrus; vc, ventral cirrus. 58 59 60 For Proof Read only Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom Page 22 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Review Only 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 Figure 4. Surface topography of E. cf. oerstedi ; dorsal view of anterior part (A), a higher 51 52 53 magnification of outlined area in Figure A (B), ventral view of anterior part (D), neurosetae 54 55 of middle parapodium (E), a higher magnification of outlined area in Figure E (F), elytrum of 56 57 middle segment (G), macrotubercle in a higher magnification of outlined area in Figure G 58 59 60 For Proof Read only Page 23 of 23 Songklanakarin Journal of Science and Technology SJST-2016-0474.R1 Ngamniyom

1 2 3 (H). ant, anterior part; ac, anterior cirrus; bc, buccal cirrus; ci, cirrophore; el, elytrophore; dc, 4 5 dorsal cirrus; e, elytrum; fi, filament; fo, fold; gr, groove; ma, macrotubercle; mi, 6 7 microfilament; mo, mouth; ne, neuropodium; no, notopodium; p, palp; pa, papillae; pen, 8 9 10 pentafid tip; po, posterior part; pr, prostomium; py, pygidium; se, setae; sf, short filament; te, 11 12 tentacular cirrus; ten, tentaculophore; tri, trifid; vc, ventral cirrus. 13 14 15 16 17 18 For Review Only 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Figure 5. Neighbour-joining tree with 1000 replications for selected polychaetes showing the 46 47 relationships of C. cf. cupisetis and E. cf. oerstedi with fifteen polychaetes and one outgroup 48 49 species using partial nucleotide sequences of 28S, 18S and 16S rDNA. 50 51

52 53 54 55 56 57 58 59 60 For Proof Read only