Posted on Authorea 11 Feb 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158144990.03784908 | This a preprint and has not been peer reviewed. Data may be preliminary. 96.Oeseicfaueo -ybot sterc-hlgn ihtehs Ce,L,&Asy 1999; 2000). Aksoy, Gross, & & Li, Holldobler, P-symbionts, (Chen, studied Gadau, host most Stackebrandt, the the (Moran, Sauer, with bias of co-phylogeny 2000; AT two their Wernegreen, strong example, is & a For P-symbionts with Baumann, of indispensable reduced Moran, feature significantly are called Clark, organs are specific they host’s genomes One (since specialized inhabiting their features rule stages. 1996). and a several evolutionary as 2005), by individuals, various (Baumann, all recognized in in bacteriomes readily present bacteria universally are are symbiotic they P-symbionts richness several In mutualists): form, on contain typical depending However, usually bacteria. their 1989). microbiomes symbiotic In pathogens, (Douglas, the symbionts beneficial various metabolism primary dynamics, of of host’s called mutualists and the sources composed maternally-transmitted to natural specialized, communities, contribute highly which as microbial to (P-symbionts), rise serve These give microbiomes can they insect-associated insects contaminants, 2013). some of random diversity Moran, high and & and commensals Engel, ubiquity demonstrate 2015; studies (Douglas, of number increasing An Introduction the iiglk hrceitc,adsm r upsdt eteitreit tgso vlto oad obligate towards evolution free- of stages more glossinidius intermediate retain Sodalis the modified, be be less can to host are and/or supposed the indicating symbionts. latter coexist are of lineages, may some The some P-symbionts host’s and in (S-symbionts). different characteristics, the several symbionts lost living-like of symbiont insects, secondary ancient some some various an In to by of restricted accompanied 2013). remnants Moran, are or & symbionts (Chen P-symbionts phylogeny (Bennett acquired Other entire lineages recently their 2000). either mirror are al., strictly they et and that diversification Clark hosts’ 1999, their al., of et beginning the at acquired were degenerated more and older presumably a replacing be to seems have the they and contrast, that In populations, indicate microbiomes symbiont. host’s lice obligate several within across status and present In distributions universally respective history. their and genera, functions lice different both several in across similar screening symbiont highly amplicon are of and history metagenomics complex ( combining a genera and By experienced louse have evolution. two lice their of that during populations suggests replacement lice and sucking loss, in acquisition, bacteria symbiotic of diversity Phylogenetic Abstract 2020 5, May 2 1 Novakova lice sucking in Jana microbiomes diverse and dynamic the from to arises related lineage symbiotic new A ioek nvriavCsyhBudejovicich Ceskych Science v of Univerzita Faculty Jihoceska Bohemia South of University Neisseria Snodgrassella R´ıhov´a ˇ 1 rltdbceimc-curn nyi oesmlsadwt uhlwrabundance. lower much with and samples some in only co-occurring bacterium -related Wigglesworthia n V´aclav Hypˇsa and , 1 n hwisidpnetoii ihndnmclc irboe.Wietegnmso hs symbionts these of genomes the While microbiomes. lice dynamic within origin independent its show and , imir Batani Giampiero , and Wolbachia ersnsatpcleapeo hsa ti fe copne yteS-symbionts the by accompanied often is it as this of example typical a represents Polyplax olper acanthopus Hoplopleura Polyplax Asy 00.Tecmlxt fsmitcascain sovosydue obviously is associations symbiotic of complexity The 2000). (Aksoy, 1 and 1 irboe r oiae yteolgt symbiont obligate the by dominated are microbiomes oi Rodr´ıguez-Ruano Sonia , Hoplopleura the , edsrb oe os ybotlnaerltdto related lineage symbiont louse novel a describe we ) Buchnera 1 Neisseria Neisseria rltdbceimi oiatolgt symbiont obligate dominant a is bacterium -related nahd and aphids in 1 aaMartinu Jana , and Wigglesworthia Snodgrassella einlapolyplacis Legionella 2 Eva , ntes flies, tsetse in Neisseria with , Posted on Authorea 11 Feb 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158144990.03784908 | This a preprint and has not been peer reviewed. Data may be preliminary. ult rmigwspromduigteBtospcae(https://jgi.doe.gov/data-and-tools/bbtools). package BBtools the using performed was trimming quality 2 using Germany) the kit. sequenced sensitivity We High Qubit assembly was with quality and measured DNA sequencing concentration protocol. Genome its’ manufacturer and to electrophoresis according Germany) gel Hilden, by -20 (Qiagen, assessed at Kit Micro ethanol DNA 96% QIAamp in stored ( were 2011. voles samples during common (Baiersbronn) from Germany obtained and were (Struzna) Republic Czech in serrata Polyplax preparation template insects. DNA sucking dynamic blood the these Methods underlying in and possibly replacement level, Materials microbiome and population the loss, host of acquisition, the intra- diversity symbiont at phylogeny-dependent their of changes prove the microbiome processes we on rapid and Based suggest genera, we bacteriocytes. louse profiles, host’s two in the with localization independently cellular relationships this symbiotic across In approaches their symbionts. amplicon established insect and of genera genomic this replacement combining the genera al., that by to louse and indicate et the processes thus loss, (Boyd of these lice endosymbiont populations acquisition, of several sucking background extinct dynamic the in now particularly analyze symbionts and we interpret known undergoing study, ancient authors the been more the of has which a distribution result 50%, group of and content a replacement diversity GC as recent The and species of 2016). Mbp, host related evidence 2 them four exceeding possible to of genome as two larger three in significantly the four; found lineage, a for been fourth possesses available has The to only lineages processes. likely these co-phylogenetic are therefore of of data each is genomic Correspondingly, lineages of 1). lineages, symbiotic P-symbionts: fraction ble known of of small currently signatures number a the clear actual only showing Of The acquisition/loss/replacement groups, higher. investigated. of phytophagous much rate been high screened be has a louse extensively diversity hence universal the lice and a to lineage sucking is each compared for of them Moreover, phylogenies origin of recent processes. gene-based like none relatively the rRNA (e.g. However, a et are order 16S Fukatsu suggests lineages. whole onts 2010), 2016; the symbiotic the al., interpretation, Reed, independent across et on 5-6 distributed & Boyd symbiont Depending (Allen, suggest 2014; Durden, bacteria 2007). taxa Reed, Allen, symbiotic Cr´ecy-Lagard, available Krizek, & of de Smith, the & diversity Allen, Hypsa (Light, high Boyd, 2009; a lice 2016; al., spp. possess sucking Reed, they 500 & Accordingly, blood, Light, than group. vertebrate Burleigh, more diversified on and with exclusively ancient Anoplura, most live order which the 2017). 2015; insects al., of Simon, (blood-feeding) et & Meseguer Mieuzet, hematophagous in 2017; Outreman, even Amongst Latorre, Gauthier, composition, & 2017; microbiome Horn, al., into Simon, recently et insight Szabo, approaches (Doudoumis our Manzano-Marin, amplicon systems improve of model significantly introduction studied can The studies extensively diversity. method of reconstructions, microbiome phylogenetic this majority of and of that The information complexity part demonstrated metagenomic the today. substantial on available to relies a symbionts information relate missing S- little dynamics and likely symbiont. very and P- another diversity is their by too and microbiome there insects accompanied) the becomes groups, on (or how insect bacterium see replaced different symbiotic to be in theoretical the interesting symbiosis to The time, be has would coevolutionary 2015). it it of and Moran, While amount inadequate, & certain functionally bacteria- (Bennett and a several background degenerated from after theoretical known that well-developed well postulates a is work has which acquisition/loss/replacement, and symbiont models of insect process ongoing an to Neisseria ie(=5 eecletdfo elwnce odmc ( mice wood yellow-necked from collected were (n=25) lice × Polyplax 0 ardedras edqaiywscekduigFsQ Ades 00 and 2010) (Andrews, FastQC using checked was quality Read reads. paired-end 100 and Snodgrassella iepoe apeo n aeo luiaHSq00(eeoe Heidelberg, (GeneCore, HiSeq2000 Illumina of lane one on sample pooled lice irtsarvalis) Microtus Polyplax Riesia telte en yboto es.W hwta hs bacteria these that show We bees). of symbiont a being latter (the ° .TtlDAwsetatdfo hl os boesusing abdomens louse whole from extracted was DNA Total C. and spp., Hoplopleura Sodalis uhel pedicinophila Puchtella 2 rpe nCehRpbi Hiso uig21.All 2014. during (Hlinsko) Republic Czech in trapped Buchnera lk ybotfrom symbiont -like nahd) h itiuino os symbi- louse of distribution The aphids). in erva e yboi ieg related lineage symbiotic new a reveal We . olper acanthopus Hoplopleura pdmsflavicollis) Apodemus and , rehnptiu fluctus Proechinophthirus Legionellapolyplacis ie(n=40) lice captured (Ta- , Posted on Authorea 11 Feb 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158144990.03784908 | This a preprint and has not been peer reviewed. Data may be preliminary. eaiecnrl eedsaddadhgl bnat oetal yboi,OU eeietfid Details identified. units) were in OTUs found taxonomic symbiotic, contaminants (operational potentially putative abundant, OTUs v9.0.1001 All highly into USEARCH scripts. and using clustered v9.0.1001 discarded trimmed and USEARCH were controls implementing and processed negative workflow 2010) further sets. the (Andrews, data were to FastQC independent reads according two in The as checked processed 2013). quality were (Edgar, were designs, data library raw different two The from htt- originating amplicons at amplicons, gene available The rRNA are 16S merged) of and analyses and filtered Processing quality description (demultiplexed, Detailed SupplementaryInformation/SupplementaryText. genera. microbiomes in louse lice provided the the ps://www.ebi.ac.uk/ena/data/view/PRJEB35541. is of sequencing for each MiSeq data for and Amplicon built independent designs were Two library Germany). libraries the Hilden, amplicon (Qiagen, of gene Kit Micro rRNA were DNA lo- 16S templates QIAamp sampling DNA multiplexed using SupplementaryData2. the in individual including provided each origin, are from species, sample extracted host on rodent Details and 2014-2018. coordinates, from GPS cations, populations and species rodent different 190 bacteria. of other Samples our for sequencing 2016) two and Tanabe, the preparation Nakabachi & library for and Furumichi, Amplicon McCutcheon annotation Kawashima, Moran, Sato, RAST by (Kanehisa, the published database on genes KEGG based of the metabolic was selection selected comparison the of followed The which comparison (2008). on 2017) a work Hypsa, provide previous To & our SupplementaryData1. from nik, analysis in the detail extended more we pathways, in explored are closed regions complete The from 2010). symbiont Perna, -related & Mau, the (Darling, of ProgressiveMauve genome using based analyzed was origin synteny putative Genome its categorised and SupplementaryInformation/SupplementaryText). database comparison see nr Genome details the (for against hits gene returned each the blasted on we genes, from symbiont individual the of of of genome genome (draft (closed WNLJ00000000 CP046107 and SupplementaryInformati- numbers ) accession see the under details GenBank in both (for them of data genomes tools annotated Nanopore NanoPack using We using and performed checked was Illumina was filtering the reads quality combining on/SupplementaryText). Nanopore and approach 2018) of hybrid the Broeckhoven, quality as assemble Van a The filtering To & 194. Illumina (https://github.com/rrwick/Filtlong). and Cruts, 653 of Schultz, checking Filtlong 1 runs D’Hert, quality was four Coster, for reads in (De procedure of it same number sequenced 5 the total and from used individuals DNA weight We 35 lar chemistry. of the cycle DNA for 500 total described the V2 construc- from using We technology. library MiSeq USA) Illinois, Illumina Urbana, the of below. (University ted specified Oxford-Nanopore as and and Germany) genes Neisseriales Heidelberg, individual to complete of assigned a analyses putatively sequence blast were To by which confirmed contigs further 39 al., retrieved was et procedure origin This (Carattoli bytheir contigs 2012). PlasmidFinder bacterial al., identified the We et 60%). (Kearse to and 85%, contigs) (95%, thresholds 985 different blasting (124 three 2012) to assembly al., bacterial set et sensitivity for complete check with (Bankevich To 2014) the 3.10 corrections. mismatch assembler submitted SPAdes enabling we and used options We plasmid(s) careful reads. implementing assembly, 186 the 892 build 309 to contained dataset resulting The ndrsel alvi Snodgrassella Neisseria oylxserrata Polyplax Polyplax .serrata P. olper acanthopus Hoplopleura .acanthopus H. rltdsmin from symbiont -related k2gnm gis h sebyuigcso ls ntepormGeneious program the in blast custom using assembly the against genome wkB2 aast h eutn ubro ed a 44608 eue ihmolecu- high used We 078. 406 34 was reads of number resulting The set. data 14 , Neisseria ilig2 oal olna lcs(iue1.Tersligsynteny resulting The 1). (Figure Blocks Collinear Locally 27 yielding , olper acanthopus, Hoplopleura oylxserrata Polyplax satmlt o xodNnpr eunigo rdOx.The GridIONx5. on sequencing Oxford-Nanopore for template a as rltdsminsuigRS Ai ta. 08 n deposited and 2008) al., et (Aziz RAST using symbionts -related .acanthopus H. iemtgnm,w mlydIlmn ie (GeneCore, MiSeq Illumina employed we metagenome, lice 3 yboti 9cnis.T sespyoeei origin phylogenetic assess To contigs). 39 in symbiont n 2 and einlapolyplacis Legionella a lge ote3 otg fthe of contigs 39 the to aligned was .acanthopus H. olper edentula Hoplopleura Neisseria eaeoe eemployed we metagenome, Rhv,Nvkv,Hus- Novakova, (Rihova, rltdsmins and symbionts, -related eecletdfrom collected were .acanthopus H. Neisseria Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. 0mn l nuain eecridotwt non hkn t30rm ete lcdlc nmicroscope on lice placed then We rpm. 300 at shaking ongoing with out carried were incubations All min. 10 oa,21) epeeautdterqie tignyo h yrdzto conditions with hybridization twice the specimens washed of we hybridization, stringency Following Moy, required 2011). (Martinson, (6-Fam)-labelled400 the Noguera, Neisseriaceae 6-carboxyfluorescein & pre-evaluated Parnerkar, We and family (Yilmaz, mathFISH 1990) the 2012). Stahl, targeting Moran, & -3’), & Krumholz, TTAACCGTCTGCGCTCGCTT (Amann, and (5’- USA) bacteria beta-572 Missouri, all Louis, targeting (St. ng Sigma-Aldrich -3’), 2.5 from of obtained concentration a were at 46 probes used fluorescent at All formamide) 46 probes. 30% containing at autofluorescence. and buffer tissue SDS, hybridization quench to sulfate, of days dodecyl 400 10 for with sodium solution 0.01% specimens ethanol peroxide washed 4 hydrogen then 6% at We and days kept 3 for and solution transferred were insects as reconstructed fixed were We diversity, microbiome symbionts the of for analysis background generations Localization a 000 as 000 used SupplementaryInformation/SupplementaryText. 10 in hosts, for described chains the four of running described. trees previously Phylogenetic model in was substitution performed as performed +G+I convergence were was 2.1.10 GTR analysis for replicates v. BI checked using bootstrap model. jModelTest2 and 3.2.5, evolutionary 100 using +G+I v. TN93 and (AIC) MrBayes fitting selected analysis using in criterion best and 2003) ML information Gascuel, models 2012). matrix” & Akaike evolutionary Posada, “multigene (Guidon the PhyML The our & to as Doallo, (BI). according Taboada, procedure inference selected (Darriba, same Bayesian were the and with dataset (ML) prepared to likelihood was maximum matrix by The analyzed outgroups. as retrieved used were were sequences gene rRNA betaproteobacteria 16S and Two for The (SupplementaryData3). bacteria 09 marker. generations. GenBank the available including the only 000 by the from context 1 is blastn phylogenetic sequence by wider to gene obtain rRNA set to 2018). 16S aim Suchard, frequency the the & with which sampling designed Baele, was with al., Xie, matrix” generations et Drummond, “16S The 000 (Rambaut, (Ronquist the v1.6.0. 000 model replicates Tracer of evolutionary 20 in bootstrap inference +G+I for checked Bayesian 100 LG was run matrix”. Convergence using with were “multigene v3.2.5 2010) chains MrBayes concatenated Four al., in the 2012). et conducted for (Guindon was also model v3.0 matrix” and smart “multigene server alignment reconstructi- using PhyML phylogenetic single-gene (AIC) online Maximum-likelihood each criterion 2017). using for information Gascuel, was Akaike performed +G+I & by were LG Longueville, matrices ons The (Lefort, all 2000). PhyML for (Castresana, aligned of Ambiguously model 091b selection 2002). v. fitting Miyata, Gblocks best & using as Kuma, discarded Misawa, determined were (Katoh, blocks divergent setting and E-INS-i the positions using v7.450 MAFFT in 1 Philadelphia str. leguminosarum pneumophila subsp. pneumophila Sup- betaproteobacteria in Two Legionella povided Burkholderiales, genomes. arbi- are order categories selected both the the genes in to of (the “multigene assignement present Neisseriales the the were within on HGT, detailes origin which to “Neisseriales”; plementaryInformation/SupplementaryText) supported due category reliably artefact blast with the possible genes from a 10 trarily avoid of To matrix”. composed was “16S the matrix” and matrix” “multigene catenated the data, of raw analysis the Phylogenetic to links accession the including Phylogeny filtering, SupplementaryInformation/SupplementaryText. OTU the and in provided decontamination are processing, read the on μ fpewre ahbffr(0m rsHl MET,00%SSad12m al t48 at NaCl) mM 112 and SDS 0.01% EDTA, mM 5 Tris-HCl, mM (20 buffer wash pre-warmed of l deel kashmirensis Advenella .acanthopus H. eeue sotrus(upeetrDt3.Frec ee h eune eealigned were sequences the gene, each For (SupplementaryData3). outgroups as used were , ise yicbto n4 aaomleyeslto t4 at solution paraformaldehyde 4% in incubation by tissues ukodracepacia Burkholderia Neisseria ° o ,adhbiie t46 at hybridized and h, 1 for C t.c4 n n alphaproteobacterium, one and cv4, str. μ l -1 o ynn C5-aeldEB3 5-GCTGCCTCCCGTAGGAGT (5’- EUB338 (Cy5)-labelled 5 Cyanine for μ rltdsminswspromdo w ieetmtie,tecon- the matrices, different two on performed was symbionts -related fhbiiainbffr(0 MNC,2 MTi-C H7.4, pH Tris-HCl mM 20 NaCl, mM (900 buffer hybridization of l ° nCro’ ouinfr2 ,2 yrgnprxd ethanol peroxide hydrogen 2% h, 27 for solution Carnoy’s in C and 4 Acidovorax ° o ih400 with h 3 for C n n alphaproteobacterium, one and , ° o 0mn r-yrdzdwt 200 with pre-hybridized min, 10 for C p K12 n gammaproteobacterium, one KKS102, sp. hzbu capsici Rhizobium alrlaequigenitalis Taylorella ° μ o 9h Subsequently, h. 39 for C fhbiiainbuffer hybridization of l t.IMCC34666, str. nsilico in Rhizobium t.09- str. ° using for C μ l Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. rmtesagrdcmuiis eindfrtsigsqecn estvt n C is ofimdthat confirmed bias, PCR data and The sensitivity abundances. sequencing comparable testing in for taxa designed the bacterial in communities, 10 included staggered all communities recovered the mock sequencing from even the the For Methods), average). (see of controls on numbers 201 Similar individual 20, across data. retrieved and amplicon were 205 quality sequences high bacterial produced rRNA libraries 16S gene merged rRNA 16S multiplexed of Sequencing data of screening based lack Amplicon to due of matrix” pair the with “multigene as placed revealed described matrix” the available, Neisseriaceae “16S been In is the into have of matrix”, spectrum them included base support. taxonomic of the All be broader nodal at a 1). “ not high which Figure offshoot could with for in isolated detail gene, which Neisseriales an (SupplementaryInformation/SupplementaryFigure1; rRNA relatives within as 16S close firmly branches of pair placed analysis additional two The the branch, the analysis 1). common multigene) multigene (Figure long the robust a and more on gene the taxa rRNA 16S sister (the as phylogenies both blocks In longest the Blocks, Collinear When 1). Locally (Figure (SupplementaryData1). Phylogeny 27 genes synteny into hundred of placed and degree were kb considerable syntenies 100 a the extending software two display Mauve even the with other, and both aligned each genes in in to is their genes compared This of when the SupplementaryData1). proportion However, and of search. Methods proportion blast (see hits the large best a to the contrast within database, remarkable Neisseriales nr yield NCBI not did the symbionts against blasted identified When we from assembly, symbiont ( the this symbionts and lice In , make other To to the comparison unclear. 34.0%. of in remains content symbionts, fragmentation number recategorise the their GC and we to the of assembled Due intelligible, (symbiont reliably with not text (SupplementaryData1). rRNA of were bp, genes following 16S genes draft tRNA 042 the rRNA the 37 the genome 839 while and contigs, proximity, 1 The in genes close genome to encoding DNA. in protein placed sum of Baumann, 789 are which stretches 1 (Munson, protein genes contigs manner P-symbionts long rRNA 421 unlinked 39 other 5 by 1 an including of and contains separated in rRNA rRNA 2019), It arranged is 23S 9 al., are The The gene content. et they (Brewer GC 1993). (SupplementaryData1). but bacteria Baumann, 33.4% tRNAs operons, & other coding with gene many genes rRNA long from 39 16S-23S-5S bp known and complete 498 rRNAs, 3 607 represent coding 1 genes genes is 9 data, genes, Illumina encoding and obligate the Nanopore of of genome closed complete The symbionts Neisseria-related Eliceiri, the & of Rasband, Genomes Schneider, 2012; al., 400x et Results 100x, (Schindelin at images Fiji slice) Resultant distribution 2 optical specimens. to ImageJ replicate 1 per the 2012) three from scans the resolution with 30 of a processed each Japan). to and from were bit Tokio, (up regions 24 multiple stacks GmbH, (Olympus, of investigating confocal FV3000 by depth Europe fluorochrome) Olympus color three (Kuraray a microscope least magnifications, medium confocal at 630x scanning anti-fading and acquired laser We Mowiol a in with Japan). signals Tokio, slides fluorescent mounted the captured and We min, ˜50 10 in for them incubated slides, nutrdbacterium Uncultured Snodgrassella Hoploplera . rmhmnadisc ape Oe ta. 04.I otatt h “multigene the to contrast In 2014). al., et (Oteo samples insect and human from ” einlapolyplacis Legionella and ) Proechinophthirus “Neisseria”-P μ f4,-imdn--hnlnoe(AI ouin( ng (1 solution (DAPI) 4’,6-diamidino-2-phenylindole of l ), Neisseria olper acanthopus Hoplopleura smin of (symbiont o hc 63 ftegnswr sindto assigned were genes the of 96.3% which for , Snodgrassella Neisseria Riesia 5 rltdsminsit oohltccutrtogether cluster monophyletic a into symbionts -related spp., rltdsminswt h terms the with symbionts -related Polyplax and uhel pedicinophila Puchtella Neisseria Neisseria .Gnm ieadcneto hs two these of content and size Genome ). ybot bandwt combination a with obtained symbiont, Polyplax oylxserrata Polyplax Neisseria r umrzdi al 1. Table in summarized are , rltdsminssaeahigh a share symbionts -related μ Hoplopleura e ie dpnigo the on (depending pixel per m and rltdsminscluster symbionts -related Hoplopleura , einlapolyplacis Legionella ybotconsisted symbiont Neisseria irr spositive as library μ l -1 “Neisseria”-H Legionella ntedark the in ) ape (21, samples -related by Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. oeo h te oiattx r lsl eae oteohrkonolgt ybot niscs(the insects dy- in suggests symbionts picture obligate complex which known This in other P-symbionts). 3), the ancient & to disappearing 2 related be (Figures diversity closely even microbiomes may are rich ones taxa a their degenerated dominant of highlighted most other part analysis the are FISH of they SupplementaryInformation/SupplementaryFigure4), view, that some & in- showed this in 4 symbiosis screening with bacteria (Figure amplicon their Consistent are and bacteriocytes established lice. they putative which of that within symbiosis, Krizek, genera hypothesize character- localization obligate & different we genomic towards two Hypsa populations, their evolution within 2009; lice Considering dependently of al., the et stage symbionts. across Fukatsu early/intermediate louse distribution 2014; an of their al., with span et positive together phylogenetic Boyd bac- a known istics 2016; symbiotic illustrate al., the of et diversity extending here, Boyd high lineage, present two 2016; observed we The al., the which et and 2007). analyses (Allen microbiomes lice amplicon louse in of and teria dynamics genomic the combined between the relationship in of abdomen results of The part posterior within the bacteria chromophores. in different distinct Discussion found two chemically 4). by of also produced (Figure presence were (SupplementaryInformation/SupplementaryFigure4). intensity to patterns bacteria lice signal due overlapping intracellular male in is entirely containing difference difference the provide bacteriocytes within this to not Many due whether located did or decide bacteria probes bacteriocytes to the two to difficult The hybridized is it probes However, ampullae. bacterial ovarial universal above found the (˜20-30 and cells Neisseriaceae DAPI-stained specific the phylogenetic Both precise than symbionts rather lice affiliations the like approximate of genomes Localization as derived interpreted highly to be and taxonomic compared should taxon a particularly and the Neisseriaceae with position, sequence taxa, OTUs short e.g. other a of associations, the on symbiotic distribution For early The very symbionts. Arsenophonus or 3). coevolving contamination (Figure environmental obligate represent level putative content family indicates GC and thus or assignment and genus host the i.e. the to content, assigned GC OTUs taxa low these dominant of 9 distribution the ) 49.3%), and 43.9% For of content taxonomically (GC two and characteristic the definition) among sequence for the methods Besides to (see content. pro- addition taxa GC amplicons dominant and gene as assignment to rRNA identified taxonomical assigned 16S OTUs, information: partial more of bacteria, two kinds other Neisseriaceae, independent) com- For entirely a (not host. with two the vide taxa within bacterial distribution several and bacteria, by characteristics these dominated of are two lice For from the pattern. of distribution species/lineages plex tested the of Microbiomes taxa average bacterial used the were dominant DNA, amplicons of total gene Distribution rRNA the 16S of of 44.78% analyses comprises study. quantitative among i.e. taxon no this Therefore, this reads taxa, in did where dominating the 70.12%. samples template equaled two of mock abundance mock of 0.01% three read the one and the to of of 0.02% Compared amplification composition average 12228). preferential staggered on the a comprised However, in template, communities. result DNA mock mock sequenced three original the sequences the particular, of In 0.04% taxa. in abundant low including profiles, microbiome of complete reveal can approach our idbceimaoecni (ATCC15703) adolescentis Bifidobacterium oylxserrata Polyplax Hoplopleura Blochmania .Hwvr ti motn ont httetxnmclasgmn fteOU r based are OTUs the of assignment taxonomical the that note to important is it However, 1. Hoplopleura Neisseria ie hi yboi auecudb lal eosrtdbsdo h opeegenome complete the on based demonstrated clearly be could nature symbiotic their lice, opeesv ouainwd mlcnsreigrvae (besides revealed screening amplicon population-wide comprehensive a Buchnera and rltdsmins hc r h rmr ou fti td,rpeetanovel a represent study, this of focus primary the are which symbionts, -related pce and species μ > Arsenophonus ) nfmls hs uaiebceictsfre ekyahrn clusters adherent weakly formed bacteriocytes putative these females, In m). 0 wt h xeto of exception the (with 50% 4.%G)and GC) (45.1% .acanthopus H. eea eeascae with associated were genera, and enccu aidrn AC BAA-816) (ATCC radiodurans Deinococcus Arsenophonus 6 einlapolyplacis Legionella ouain onst hi yboi nature. symbiotic their to points populations Cloacibacterium Buchnera 4.%G) eet h eelg of genealogy the reflects GC), (49.4% 2 tpyoocsepidermidis Staphylococcus Hoplopleura and niae httebcei may bacteria the that indicates ) from Blochmannia Polyplax ape Fgr ) In 2). (Figure samples n Neisseriaceae and . ohpresent both , .polyplacis L. (ATCC Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. n h te w os ybot ead hi aaiyt ul h elwls iia othe to Similar walls. cell the build to capacity their regards symbionts louse and two other the and polyplacis atru wt h xeto ftoseiesfo n ouain iue2,btwr o on nthe in found not were but 2), Figure population; one (Figure from distribution specimens patchy two and of restricted exception the more (with show bacterium degeneration, in genome the Only P-symbionts, the established 3). of of degree examples intermediate documented an well two that of these sample shows to phylogenetic screening and amplicon geographic extensive presumption, this our with Moreover, correspondence In polyplacis host. the L. example, with For association intimate 1996). of degradation and the the (Moran, genome long between of coevolution relatively correlation degree host-symbiont high a a the of indicates symbiogenesis, lice, duration the sucking of of the symbionts phase the and among initial degradation the vertically-transmitted genome during obligate of least an becomes degree at bacterium expect, the should once starts we microbiomes degradation symbiont, lice genome of the process in the Since symbionts 4). the non-overlapping (Figure of the chromophores origin since used the and caution the of Distribution with of majority taken properties more the be different a should in reflect interpretation replaced may detected this recently signal indeed However, only was bacteria. P-symbiont it different the putative that two of a assume acquisition such could the we to below, acanthopus secretion prior evolution, discussed role and of As nutritional pili, state “ the symbiont. IV fulfilling features, early was genomic type an which described elements, P-symbiont, in the ancient mobile symbiont of lipid young as many for by a such both pathway suggested is transport, of as complete and/or If, genomes both a exchange (SupplementaryData1). the and contrast, systems DNA Finally, A In to class genes. connected protein coding genes lipopolysaccharide. binding rod-shape of penicillin the synthesis for lack for genes required the possess A, also they them, genomes “ two reduced the the in between the the pathway differences than of that example categories shows interesting various An pathways in metabolic repair genes and selected Recombination of of numbers comparison greater of The considerably retain genus 2016). symbionts GC the al., the et and (e.g. reduced (Boyd relatives metabolic recognizably their complete are to more genomes Snodgrassella compared consequently their when and hand, decreased genes), other content the of On number higher (SupplementaryData1). pathways times three (approximately “ genomes Both Neisseriales. two of the members and living” of supposedly “free genomes is to The and and for shift “ genome P-symbionts 2016). available large lice compositional various a al., currently strong to possesses et display are compared fourth (Boyd and genomes The acquisition reduced Full 1). recent (Table highly P-symbionts a symbionts. are many known Three for typical other symbionts. AT, towards with lice-associated comparisons of lineages on four view evolution this the of base stage We intermediate the an that suggest propose within We symbionts even Neisseria-related replacements the and of losses characteristics lineages. acquisitions, Genomic phylogenetic frequent young their and populations bacteria, louse symbiotic local the of turnover namic Neisseria .polyplacis L. Riesia .pediculicola R. Legionella and ieg a enfudi eea os pce ftodffrn genera, different two of species louse several in found been has lineage - ipa infiatywae eoedgnrto hntehgl reduced highly the than degeneration genome weaker significantly display ”-P irboe.As,teFS uvyidctdta h atroye ih eihbtdby inhabited be might bacteriocytes the that indicated survey FISH the Also, microbiomes. .acanthopus H. shse tlatb w os species, louse two by least at hosted is rt h rsmbyyoung presumably the to or ) .pediculicola R. By ta. 07 ioae l,21) hyhv ihrG otn,cnieal larger considerably content, GC higher have They 2017). al., et Rihova 2017; al., et (Boyd and Neisseria- the , Neisseria .pediculicola R. Neisseria aeoy(soeeape u loi eea mn cdboytei pathways. biosynthesis acid amino several in also but example) one (as category ”smin,etrl oti h oerdcd“ reduced more the in lost entirely symbiont, P” eete ossetypeet(h eseica T)a h otdominant most the as OTU) Neisseriaceae (the present consistently they were rltdsminsaei neryo nemdaesaeo yboi evolution. symbiosis of state intermediate or early an in are symbionts -related .Aohrcnpcosdffrnebtenthe between difference conspicuous Another ). rltdsminsrti h ahfrppiolcnsnhss u unlike but synthesis, peptidoglycan for path the retain symbionts -related Splmnayaa) hsdffrnei atclrysrn nthe in strong particularly is difference This (SupplementaryData1). .serrata P. Sodalis sadmnn atru Fgr ) hncompared When 3). (Figure bacterium dominant a as lk ybotfo h louse the from symbiont -like 7 .serrata P. Neisseria .polyplacis L. Neisseria rltdsminsi h opeehistidine complete the is symbionts -related and Neisseria Neisseria .spinulosa P. Neisseria scnitnl rsn nabroad a in present consistently is Neisseria rltdsminsrti various retain symbionts -related .pediculicola R. rltdsminscntu be thus can symbionts -related Neisseria- Neisseria u lotebesymbiont bee the also but , rltdsminsse to seem symbionts -related Pediculus rehnptiu fluctus Proechinophthirus Hpa&Kie,2007). Krizek, & (Hypsa rltdsmins with symbionts, -related ”(swl sin as well (as H” rltdsymbionts -related Riesia Neisseria Neisseria Neisseria and and Neisseria” Phthirus, .polyplacis L. .polyplacis L. , Puchtella, - and ”-H -related -related and -H H. L. Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. 21) ae ntedt vial o h e os eeaeaie ofr hi irboe oti both contain microbiomes their far, Raghavan so examined and genera Moses louse Gerhart, few by the for suggested available recently symbionts, data tick Fischer, was the the on Peacock, pathogen of Based Niebylski, one mammalian For 2017; (2016). from 1997). al., origin Kurtti, et the & Guizzo Munderloh, and bacterium, 2009; Noda, pathogens Munderloh, 1997; Schwan, Baimai, to vertebrate & Trinachartvanit, & (Ahantarig, Kurtti, the similar Porcella, ticks Felsheim, between that, in 2013; correlation reported note Grubhoffer, previously Phylogenetic & was to arthropods interesting pathogen. blood-feeding is vertebrate of symbionts well-known It a available. is currently and is flea information other louse-associated a polyplacis case the no from of documented relative which well described closest for the only phylogeny, bacterium gene The rRNA uncultured 16S the an insects. on with Based specific genus association 2013). of the Moran, symbiotic is tendency in symbiosis a found obligate and or of rarely lice- symbionts the only co-speciation to these are applied either be of (e.g. Neisseriaceae of can hosts explanations source insect consequences these specific of the usually with neither However, symbiosis symbiotic on are establish related frequently question the hosts closely to interesting lineages of in insect bacterial Co-occurrences origin an related symbiotic symbiogenesis. poses in common and This acquisition a bacteria their to underlying genus. due mechanisms is louse the lineages each lice in different two symbiosis Considering in symbiogenesis. two occurrence the of in their stage Hoplopleura modifications that early genome unlikely in of is degree processes low it and the lice conditions second and sucking patterns the this make distribution acquisitions/replacements studying of the symbionts for origin of model process the rapid interesting identify the an to and microbiomes able of not diversity were The “ we contigs, the bacterial from other apart bacterium. strong any symbiotic that may However, contain shows not they analysis did that host. replaced FISH assembly suggests and of the the amplicon, population bacteriocytes Interestingly, host’s in gene the the rRNA symbiont, function acquisitions. from 16S retreating recent and now the more symbionts, origin of ancient with phylogenetic bacteria, of content phylogenetic remains these real GC scattered their of than the the either represent about from rather on deduced content information hypothesize reliable reduction, GC to any genome low yield difficult the not is did the reflects data it taxonomy Both metagenomic blast-assigned our Since which interest. high 3), relationships. particular the & of and 2 insects, are within (Figure OTUs replacement and two loss, microbiomes, two acquisition, serrata symbiont louse the of content, of concept general GC dynamism the their to in respect In differences lineages. the different two and represent the divergence to symbionts, genetic seem that insect their known confirm the on suggest to analyses Based not affinity genomic show does species and certainly microbiomes louse phylogenetic but related fact the lineages, (in in host lineages distant symbiotic in independent symbiont Polyplax 3). two the (Figure OTU of of Neisseriaceae evolution presence the the of co-occurrence during occasional changes only of and split OTU, of presence abundant The ubiquitous most a the confirmed was results cases The lineages. genetic and populations genus the P-symbiont to with corresponded the affiliated was OTU search OTU Neisseriaceae blast the of the samples populations which Bulgarian other in in bacterium, background: present genetic only lice ( the with species correlated related apparently the of specimens examined two n the and - Legionella the , einlapolyplacis Legionella .polyplacis L. - Polyplax Blochmania Neisseria oeouincosstehs pce onaisadtesm yboti lopresent also is symbiont same the and boundaries species host the crosses co-evolution netr h otprioiu xlnto stu nidpnetoii fthe of origin independent an thus is explanation parsimonious most The ancestor. lk ybot rgnt rmabceillnaewihi aeyfudi insects in found rarely is which lineage bacterial a from originate symbionts -like notodffrn Tscreae otehs’ hlgn,rflcsevolutionary reflects phylogeny, host’s the to correlated OTUs different two into .spinulosa P. T from OTU .acanthopus H. Rhv ta. 07,w cendti os oeetnieyars several across extensively more louse this screened we 2017), al., et (Rihova Arsenophonus. Snodgrassella Blochmania .acanthopus H. Hpa&Kie,20) he diinlOU in OTUs additional Three 2007). Krizek, & (Hypsa ; abraohrbceim(iue4.Snetemetagenomic the Since 4). (Figure bacterium another harbor .acanthopus H. .edentula) H. on nsvrlseiso esadbmlbe Kog& (Kwong bumblebees and bees of species several in found rpyl hirsuta Oropsylla Since n ntetosmlsof samples two the in and , 8 emt ersn togydrvdsmitcgenomes symbiotic derived strongly represent to seem .serrata P. h vrl aiblt ftemcoimswas microbiomes the of variability overall The . Buchnera twsacmaidb nukonbacterium unknown an by accompanied was it Neisseria skont abrtetpclobligate typical the harbor to known is Jns comc,&Mri,2008), Martin, & McCormick, (Jones, T n two and OTU soito.Mmeso h family the of Members association. Neisseria- .edentula H. Arsenophonus .polyplacis L. Buchnera Arsenophonus Arsenophonus eae symbionts, related h nypresent only the Francisella hc nmost in which , Neisseria , T from OTU Wolbachia Neisseria .serrata P. Legionella OTUs. OTUs -like -H” P. is ). Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. od .M,Aln .M,Kg,R,Fktu . we,A . ono,K . ed .L (2016). L. D. Reed, & P., K. Johnson, D., A. Sweet, T., Un- Fukatsu, R., (2020). Koga, N. M., Fierer, J. genera, & bacterial Allen, P., Two M., E. B. Rocha, Boyd, H., archaea. and R. bacteria Kirkegaard, among A., widespread 10.1038/s41396-019-0552-3 Edwards, are genes M., rRNA Albertsen, linked evolutionary an- E., an of T. of perils Brewer, evolution and advantages and The 10.1073/pnas.1421388112 symbiosis: origins doi: Heritable The 10169-10176. (2015). A. smallest: N. hole. Moran, rabbit smaller, & M., Small, G. Bennett, (2013). insect. phloem-feeding A. a N. in 10.1093/gbe/evt118 Moran, symbioses & dual cient M., G. V. A. Bennett, insects. sap-sucking Pyshkin, plant of 59, endosymbionts Microbiology, . sequencing. . bacteriocyte-associated (2008). of . single-cell of Review F. S., to Biology A. applications Meyer, (2005). P. Kulikov, its Baumann, M., and . algorithm Dvorkin, . 19 . assembly A., Biology, genome A., A. Computational new Gurevich, R. of a D., Edwards, SPAdes: Antipov, T., S., (2012). Disz, technology. Nurk, M., A., subsystems Bankevich, DeJongh, using A., annotations A. rapid Best, 10.1186/1471-2164-9-75 Server: data. D., sequence RAST throughput Bartels, The high K., for R. tool control Aziz, quality a FastQC: (2010). S. Andrews, determi- for cells estimates microbiology. whole on 10.1128/jb.172.2.762-770.1990 in of sampling probing studies doi: Fluorescent-oligonucleotide rDNA environmental 16S (1990). and of D. phylogenetic, Effects Stahl, native, & (2016). L., lice. L. Krumholz, sucking D. R., in Reed, Amann, lineages & endosymbiont E., microorganisms. of J. number Light, for the G., haven J. of Burleigh, A M., J. - Allen, Tsetse bacterial their 10.1016/S0169-4758(99)01606-3 (2000). and ticks S. Hard Aksoy, (2013). L. Grubhoffer, pathogens). & 0222-1 be V., would Baimai, (or endosymbionts W., Trinachartvanit, A., Ahantarig, manuscript. Joel this thank we on References addition, corrections In language National his appreciated. the for greatly to Brown is Development, contributing Research, J. LM2015042), projects Large Illinois, (CESNET of and Urbana-Champaign, Infrastructures” “Projects parties Innovations We at programme by and the Illinois owned under V.H.). of provided facilities University to MetaCentrum storage Infrastructure Center, GA18-07711S and Grid Heidelberg, Keck (grant computing Heidelberg, W.M to Republic EMBL of Facility, Access Czech Core Services USA. Genomics the DNA of the of services and Agency sequencing Germany Grant the acknowledge the to by like would supported was these work the during of This processes significance the assess study to to and needed symbionts, Acknowledgments now nutritional of is source lice a sucking symbiogenesis. as of early bacteria of groups groups different ecological of two screening (e.g. throughput bacteria high insect-associated typical and pathogens vertebrate rceig fteNtoa cdm fSine fteUie ttso mrc,112 America, of States United the of Sciences of Academy National the of Proceedings Sodalis 5-8.di 10.1146/annurev.micro.59.030804.121041 doi: 155-189. and (5) , Rickettsia 5-7.di 10.1089/cmb.2012.0021 doi: 455-477. oi irbooia 58 Microbiologica, Folia soitdwt h ellouse seal the with associated , eoeBooyadEouin 5 Evolution, and Biology Genome 9 er,4, PeerJ, aaiooyTdy 16 Today, Parasitology Arsenophonus ora fBceilg,172 Bacteriology, of Journal h SEJunl 14 Journal, ISME The 28.di 10.7717/peerj.2187 doi: e2187. (5) , 1-2.di 10.1007/s12223-013- doi: 419-428. M eois 9 Genomics, BMC rehnptiu fluctus Proechinophthirus , Sodalis (9) (3) .Amr detailed more A ). , 2,5768 doi: 597-608. (2), , 6518.doi: 1675-1688. 1-1.doi: 114-118. (1) (2) , , 5 doi: 75. 762-770. Journal (Phthi- Annual (33) , Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. uas,T,Hskw,T,Kg,R,Nkh . ao . aaa .I,...&Tnk,I 20) Intestinal (2009). I. Tanaka, & . . louse . I., macaque S. the Hayama, of T., Kato, bacterium N., symbiotic Nikoh, R., endocellular Koga, T., Hosokawa, T., endosymbiont Fukatsu, the of sequence 10.1371/journal.pone.0008361 Genome doi: (2009). e8361. G. (12), U. Munderloh, function. & and J., peacockii structure T. Kurtti, in insects–diversity F., R. of Felsheim, microbiota reads. gut amplicon The (2013). microbial A. Reviews from N. Microbiology Moran, sequences & P., OTU Engel, accurate highly UPARSE: (2013). Methods microorganisms. C. resident R. of Edgar, function and diversity Entomology insects: insects. of Multiorganismal Review (2015). in E. A. symbiosis Douglas, Mycetocyte (1989). E. 10.1111/j.1469-185X.1989.tb00682.x A. (2017). G. A. Douglas, Parker, & populations. natural . . and . laboratory I., both Goodhead, in A., N. Dyer, A., the Augustinos, Challenging A., Saridaki, F., visualizing Blow, NanoPack: V., (2018). Doudoumis, C. Broeckhoven, Van & data. heuristics M., new sequencing Cruts, tics/bty149 models, T., long-read D. more processing Schultz, 2: S., and jModelTest D’Hert, (2012). W., D. Coster, De Posada, gene & with R., alignment computing. Doallo, genome parallel L., multiple and G. progressiveMauve: Taboada, (2010). D., T. Darriba, N. Perna, rearrangement. & and B., loss gain, Mau, E., A. endo- Darling, bacterial between Cospeciation (2000). J. J. Wernegreen, congruence. & P., Baumann, ( A., symbionts N. Moran, A., M. Clark, molecular species: insect host Evolution its Molecular with symbiont of a phylogenetic of evolution in Concordant genus (1999). of use S. phylogeny Aksoy, their & S., for Li, alignments X., Chen, multiple sequence from H. multilocus blocks Hasman, plasmid conserved & of and analysis. Selection PlasmidFinder . (2000). . using . J. plasmids L., Castresana, of Villa, typing O., L. and Lund, D. detection V., typing. Reed, silico M. & lice. Garc´ıa-Fern´andez, In Larsen, . hominid E., . (2014). A., . of Zankari, symbionts T., Warnow, the A., S., in Carattoli, evolution Z. genome Quicksall, Evolution P., and Vachaspati, and speciation P., Biology bacteria: N. lecular and Nguyen, lice M., Primates, J. (2017). Allen, of M., sequence B. en- Genome Boyd, acquired (2014). recently L. lice. of D. comparison chimpanzee Reed, genomic and 10.1534/g3.114.012567 and & human Cr´ecy-Lagard, lice, V., from chimpanzee de dosymbionts of M., endosymbiont J. pediculischaeffi, Allen, Riesia M., B. Boyd, 16 Anoplura). raptera: niirba gnsadCeohrp,58 Chemotherapy, and Agents Antimicrobial , oeua ilg n Evolution and Biology Molecular n oprsnwt virulent with comparison and 10 Buchnera Evolution 1) 9.di 10.1038/nmeth.2604 doi: 996. (10), Wigglesworthia Glossina ple n niomna irbooy 82 Microbiology, Environmental and Applied n eetrdaino pis( aphids of radiation recent a and ) , , , 37 , 54 60 aueMethods Nature 48 5,6975 o:10.1111/1574-6976.12025 doi: 699-735. (5), 2,5755 o:10.1111/j.0014-3820.2000.tb00054.x doi: 517-525. (2), n t atroeascae endosymbiont, bacteriome-associated its and 73.di 10.1146/annurev-ento-010814-020822 doi: 17-34. , 1,4-8 o:10.1007/PL00006444 doi: 49-58. (1), lSOe 5 One, PloS , 34 , Sodalis 7,14-77 o:doi.org/10.1093/molbev/msx117 doi: 1743-1757. (7), iktsarickettsii Rickettsia , , Wolbachia 9 (6) , cetfi Reports Scientific Bioinformatics 17 8,7272 o:10.1038/nmeth.2109 doi: 772-772. (8), , 117 o:10.1371/journal.pone.0011147 doi: e11147. 4,5052 o:10.1093/oxfordjournals.molbev.a026334 doi: 540-552. (4), 3 ee,Gnms Genetics Genomes, Genes, G3: 7,39-93 o:10.1128/AAC.02412-14 doi: 3895-3903. (7), 10 yboi om ntes flies: tsetse in dogma symbiosis eiiu obtusus Pedicinus Uroleucon dnicto fvrlnefactors. virulence of identification : , 34 ilgclReviews Biological , 7 1) 1539.di 10.1128/AEM.00282- doi: 3185-3197. (11), 1) 6626.di 10.1093/bioinforma- doi: 2666-2669. (15), 1,11.di 10.1038/s41598-017-04740-3 doi: 1-13. (1), n iflso etn o phylogenetic for testing of pitfalls and ) igewrhaglossinidia Wigglesworthia itntedsmin origins endosymbiont distinct : , , 4 64 Spiroplasma 1) 1929.doi: 2189-2195. (11), 4,4944 doi: 409-434. (4), lSOne PloS Candidatus Rickettsia spresent is . Journal Annual Nature FEMS Mo- , 4 Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. atno,V . o,J,&Mrn .A 21) salsmn fcaatrsi u atraduring bacteria gut characteristic of Establishment (2012). A. N. worker. Moran, honeybee 10.1128/AEM.07810-11 & the J., of Moy, development G., Lachninae V. subfa- within of Martinson, endosymbionts best secondary the co-obligate in Happens of (2017). replacements A. aphids. repeated mam- Latorre, and of & history establishment M., Evolutionary milies: Horn, (2010). C., J. L. Simon, D. Szab´o,Manzano-Mar´ın, G., Reed, A., & PhyML. A., in L. Durden, selection Anoplura). M., 2148-10-292 model J. (Phthiraptera: Allen, smart lice S., sucking SMS: V. malian Smith, (2017). E., J. O. Light, Gascuel, & Evolution E., and J. Biology Longueville, Gammaproteobacteria. V., the of Lefort, Microbiology ‘Enterobacteriales’ Evolutionary order and the Systematic to taxon of bees sister Journal honey a of nov., symbionts gut ord. and the Orbales of Betaproteobacteria, (2012). characterization the T. and of Cultivation of Thierer, description (2013). & analysis bees: A. bumble N. and and Moran, . organization . & . the K., for S., W. Kwong, platform Sturrock, software M., desktop Cheung, multiple extendable data. S., rapid and sequence Stones-Havas, integrated for of A., an method Wilson, novel Basic: R., Geneious a Moir, MAFFT: M., (2002). Kearse, transform. T. Fourier Miyata, fast & I., on 10.1093/nar/gkf436 K. based Kuma, alignment K., sequence resource reference Misawa, a K., as KEGG Katoh, (2016). annotation. M. Tanabe, protein & and M., Furumichi, gene M., for Kawashima, Y., Sato, M., Kanehisa, of communities Bacterial 10.1128/AEM.02090-07 (2008). patterns. P. doi: A. assembly Martin, of community & symbionts and F., diversity primary K. McCormick, A. the T., S. R. of Jones, Gonzales, origin & polyphyletic Anoplura). . for . (Phthiraptera, . lice evidence L., sucking Molecular Tirloni, Kˇr´ıˇzek, M., & (2007). R. Hypˇsa, V., Albano, J. R., Schama, D., R. Reports Nunes, F., A L. (2017). Parizi, G., 3.0. PhyML M. algorithms of New Guizzo, (2010). performance O. the Gascuel, assessing & phylogenies: W., Biology maximum-likelihood Hordijk, matic by estimate M., Anisimova, phylogenies to V., large methods Lefort, estimate and F., to J. algorithm Dufayard, accurate S., Guindon, and fast, simple, A (2003). likelihood. O. maximum Gascuel, & S., Guindon, A (2016). pathogen. R. mammalian Raghavan, a & from S., with evolved A. DNA. Moses, associated ribosomal G., communities 16S J. Bacterial of Gerhart, (2015). sequencing C. deep 10.1371/journal.pone.0120664 by J. doi: revealed Simon, e0120664. aphids & (3), pea L., of Mieuzet, populations Y., host-adapted Outreman, P., J. louse. Gauthier, monkey world old 10.1128/AEM.00226-09 the doi: and 3796-3799. lice primate anthropoid in niomna Microbiology Environmental , 7 Coxiella 1,11.di 10.1038/s41598-017-17309-x doi: 1-10. (1), , 59 Bioinformatics uuls yboti seta otedvlpetof development the to essential is symbiont mutualist 3,3731 o:10.1093/sysbio/syq010 doi: 307-321. (3), ytmtcBiology Systematic , 34 9,22-44 o:10.1093/molbev/msx149 doi: 2422-2424. (9), ndrsel alvi Snodgrassella ilael apicola Gilliamella uli cd Research Acids Nucleic , 28 , 19 cetfi Reports Scientific 1) 6714.di 10.1093/bioinformatics/bts199 doi: 1647-1649. (12), irba Ecology Microbial ple n niomna Microbiology Environmental and Applied , 1,3348 o:10.1111/1462-2920.13633 doi: 393-408. (1), 52 ple n niomna Microbiology Environmental and Applied 5,6674 o:10.1080/10635150390235520 doi: 696-704. (5), M vltoayBiology Evolutionary BMC e.nv,s.nv,amme ftefml Neisseriaceae family the of member a nov., sp. nov., gen. e.nv,s.nv,amme fObca a.nov., fam. Orbaceae of member a nov., sp. nov., gen. 11 , Francisella uli cd Research Acids Nucleic 63 , , , 6 44 54 6,20-08 o:10.1099/ijs.0.044875-0 doi: 2008-2018. (6), 37.di 10.1038/srep33670 doi: 33670. , ple niomna Microbiology Environmental Applied D) 47D6.di 10.1093/nar/gkv1070 doi: D457-D462. (D1), 2,2221 o:10.1007/s00248-006-9194-x doi: 242-251. (2), lk noyboti h ufCattick Coast Gulf the in endosymbiont -like hpcpau microplus Rhipicephalus , 10 1,22 o:10.1186/1471- doi: 292. (1), , , 30 Bartonella 78 1) 0936.doi: 3059-3066. (14), 8,23-80 doi: 2830-2840. (8), , 74 5,1667-1670. (5), lSOne PloS pstv fleas: -positive International . Molecular , Scientific 75 Syste- (11), , 10 Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. opcaino atra noybot n hi apne n otseis rpslo h e taxon new the of proposal species: host ant carpenter their and endosymbionts H Candidatus model bacterial J., large of Gadau, a across E., cospeciation H choice Stackebrandt, A., model C., Darling, and Sauer, inference L., phylogenetic D. Bayesian Ayres, efficient P., 3.2: space. Mark, MrBayes Der (2012). Van P. J. M., Teslenko, F., louse Ronquist, the 10.1093/gbe/evx217 in symbiont doi: of in 2946-2957. (11), genome summarization Posterior the shaping (2018). A. cesses M. Suchard, & (2017). R´ıhov´a, Hypˇsa, G., V. Nov´akov´a, & Baele, 1.7. J., Husn´ık, F., Tracer D., E., using Xie, phylogenetics J., Bayesian A. Drummond, ’ A., (2014). Rambaut, B. M. to Labruna, & relationship Ecuador. M., in their J. dogs Venzal, and J., Zavala-Castro, and ticks F., asemboensis’ Portero, of Rickettsia A., Endosymbionts Portillo, A., J. (1997). Oteo, J. T. Kurtti, & , G., U. Characterization Wolbachia Munderloh, (1997). G. H., T. Schwan, Noda, & F., ticks, S. Porcella, wood R., infecting . E. endosymbiont Fischer, determi- an G., sequence M. of gene: Peacock, L., rRNA-encoding M. 23S Niebylski, the analysis. to terminator unlinked and operon promoter rRNA and bacterial (1993). 16S nation, P. heritable putative Baumann, of a & contains evolution L., aphids) and Baumann, Genomics A., M. (2008). Munson, A. Nakabachi, & P., J. bacteria. symbionts. McCutcheon, endosymbiotic A., in N. rachet Moran, Muller’s Sciences and of evolution Academy Accelerated National Jousselin, the (1996). A. & N. M., Moran, hosts. Godefroid, aphid their L., of A. expansions Clamens, 10.1111/mec.13910 ecological the A., with D’Acier, associated Coeur (2017). Manzano-Mar´ın,A., E. S., A. Meseguer, in patterns , Coevolutionary populations: ectoparasite & Hypˇsa,V., Martin˚u, J., cidln . rad-arrs . rs,E,Kyi,V,Lnar . itsh . iee,J Y. J. Tinevez, & . . . analysis. T., biological-image Pietzsch, for M., platform Longair, V., open-source Kaynig, an E., Fiji: Frise, (2012). I., Arganda-Carreras, J., Schindelin, 10.1099/00207713-50-5-1877 doi: 1877-1886. (5), ahmtclmdl o nslc vlaino lgncetd rbsfrfloecnei iuhybridizati- situ image in fluorescence of for years probes 25 oligonucleotide ImageJ: thermodynamics-based of uses to evaluation that tool silico Image web a in on. NIH mathFISH, for (2011). (2012). R. models D. W. Noguera, mathematical & K. S., Parnerkar, S., Eliceiri, L. Yilmaz, & S., W. Rasband, analysis. A., C. Schneider, 10.1038/nmeth.2019 aaaccessibility Data ˇ 63 Microbiology Environmental and Applied 8 2) 00-02.di 10.1002/ece3.4424 doi: 10008-10022. (20), ple n niomna Microbiology Environmental and Applied 1) 9633.di 10.1128/AEM.63.10.3926-3932.1997 doi: 3926-3932. (10), ytmtcBiology Systematic aueMethods Nature p.adtc-on ahgn fhmn n animals. and humans of pathogens tick-borne and spp. Buchnera nulRve fGenetics of Review Annual lcmni e.nov. gen. Blochmannia aaie Vectors & Parasites a hne amt u h eetdrpaeeto oolgt ybot snot is symbionts co-obligate of replacement repeated the but flatmate changed has , , 9 61 tfa .(08.Hs pcfiiydiiggntcsrcueaddvriyin diversity and structure genetic driving specificity Host (2018). J. Stefka, ˇ Wolbachia 7,6165 o:10.1038/nmeth.2089 doi: 671-675. (7), 3,5952 o:10.1093/sysbio/sys029 doi: 539-542. (3), , nentoa ora fSseai n vltoayMicrobiology Evolutionary and Systematic of Journal International 93 , , 7,27-88 o:10.1073/pnas.93.7.2873 doi: 2873-2878. (7), 7 p.in spp. 42 ytmtcBiology Systematic 1,45 o:10.1186/s13071-014-0455-0 doi: 455. (1), ldbe,B,&Gos .(00.Sseai eainhp and relationships Systematic (2000). R. Gross, & B., ¨ olldobler, , emcno andersoni Dermacentor 6-9.di 10.1146/annurev.genet.41.110306.130119 doi: 165-190. , 63 , 77 Gene 1) 9334.di 10.1128/AEM.63.10.3933-3940.1997 doi: 3933-3940. (10), tncpaie felis Ctenocephalides 3,11-12 o:10.1128/AEM.01733-10 doi: 1118-1122. (3), 12 , oylxserrata Polyplax Apodemus 137 uheaaphidicola Buchnera 2,1118 o:10.1016/0378-1119(93)90003-L doi: 171-178. (2), Legionella , 67 oeua Ecology Molecular ieadterlice. their and mice 5,9194 o:10.1093/sysbio/syy032 doi: 901-904. (5), ple n niomna Microbiology Environmental and Applied samme ftegenus the of member a as , aueMethods Nature and eoigamtait dpiepro- Adaptive mutualist: a becoming . eoeBooyadEvolution and Biology Genome ue irritans Pulex apoaytcedsmin of endosymbiont prokaryotic (a ha . Huelsenbeck, & . . . S., ¨ ohna, , 26 clg n Evolution and Ecology , 9 8,26-38 doi: 2363-2378. (8), esrmvdfrom removed fleas 7,6662 doi: 676-682. (7), rceig of Proceedings Candidatus Francisella , , 50 9 Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. microbiomes-in-sucking-lice lineage-related-to-neisseria-and-snodgrassella-arises-from-the-dynamic-and-diverse- 1.docx Table the file (cyan), Hosted DAPI above 500 bacteriocytes for b) the (a, signals of localization the bars: Hybridization with the Scale also e) (f), defines image and color c shown merged panel d are the in ampullae. in (magenta) staining (c, ovarial combined EUB338 DAPI were e. probe and white. respectively, bacterial and appearing e, generic symbionts and d the the d and c, square for c, panel red (green) signal panel in dashed beta-572 Hybridization The in probe symbionts. (b) specific the shown arrow). of Neisseriaceae (white region localization egg the the shows developing (green) defines a beta-572 containing probe body specific Neisseriaceae louse the showing image The 4. sylvaticus. lineages. A. Figure and serrata accumulated flavicollis changes Polyplax flavicollis evolutionary A. of Apodemus reflecting from split to OTUs, lineage different the specific nonspecific two lineage after N= designate = sublinage), polyplacis S east Legionella agrarius, for = Apodemus study numbers E to the sublineage, specific in west lineage described = = structure A (W mtDNA [50]: SupplementaryInformati- SupplementaryInformati- on al. in based et provided Martinu is samples the by branches individual the of in of phylogeny Designation based on/SupplementaryFigure3. shown COI the simplifies are scheme netic hosts the 3. Figure of relationships - phylogenetic on/SupplementaryFigure2. H genes). symbionts; Detailed the two of the thopus. list between complete 2. synteny a strong Like- for Figure Maximum of SupplementaryData1 to the overview (see by symbionts “Neisseria”-P an obtained synteny: - Neisseria-related by supports P Mauve two “Neisseria”-H, PhyML. obtained probabilities/bootstrap the in posterior tree tree); show of analysis the complete nodes sup- lihood relationships of the the probabilities/bootstrap part showing at for matrix: numbers matrix posterior SupplementaryInformation/SupplementaryFigure1 the 16S (see show 16S PhyML. bacteria the nodes in Uncultured of the analysis several analysis at Likelihood Bayesian Maximum numbers the the the by matrix; obtained multigene ports the of analysis 1. Figure discussions in to participated 1. contributed authors Table authors All All draft. project. samples. Figures original whole the and the the Tables collected wrote supervised J.M. V.H. G.B. manuscript. and and the J.R. J.R. revised study. E.N., and the V.H., designed analyses. J.R. data and E.N. V.H., Contributions Author material. of numberssupplementary availa- samples accession are merged) and individual and tables, filtered for abundance quality (demultiplexed, OTU microbiomes https://www.ebi.ac.uk/ena/data/view/PRJEB35541. lice at the ble for data (closed Amplicon CP046107 contigs). numbers 39 accession in accession from the symbiont under the GenBank of genome from available are assemblies genome The oprsno angnmccaatrsis os ybot ihihe yge background. grey by highlighted symbionts Louse characteristics. genomic main of Comparison ihyaudn aafudi oylxsraasmlsfo itntppltos h phyloge- The populations. distinct from samples serrata Polyplax in found taxa abundant Highly ih n ofclmcocp faFS-tie female FISH-stained a of microscopy confocal and Light hlgntcrltosiso h w esei-eae ybot.Mlieemti:Bayesian matrix: Multigene symbionts. Neisseria-related two the of relationships Phylogenetic ihyaudn aafudi .eetl n ordffrn ouain fH acan- H. of populations different four and edentula H. in found taxa abundant Highly vial at available μ ,(,d n )20 f) and e d, (c, m, oylxserrata Polyplax https://authorea.com/users/297294/articles/426418-a-new-symbiotic- .acanthopus H. and n NJ0000(rf eoeof genome (draft WNLJ00000000 and ) μ m. Hoplopleura 13 p sqecso O ee)aeaalbein available are genes) COI of (sequences sp. .acanthopus H. oylxserrata Polyplax a ih microscopy Light (a) . Neisseria symbiont -related Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. Rhizobium leguminosarum Thorsellia Enterobacteriaceae Neisseriaceae Arsenophonus 2 Arsenophonus 1 Cloacibacterium Comamonas Buchnera Acinetobacter Legionella polyplacis Legionella polyplacis 0 255075100% 0 255075100% Arsenophonus Blochmania Neissseriaceae 16S rRN Multigene matrix Mauve synteny P H 0.79/60 0.91/74 1/99 A genematrix Uncultured NeisseriaceaebacteriumcloneSHAM004

Snodgrassella alviwkB12 Snodgrassella alviwkB2

1/86 1/100 Uncultured NeisseriaceaebacteriumcloneSHAM013 1/94 2 1 1/100 Uncultured bacteriumcloneOh_3137A7D “Neisseria“-H “Neisseria“-P 0.66/72 1/100 Hoplopleura Uncultured organismcloneELU0008-T58-S-NI_000219 Uncultured bacteriumcloneMA02H06 Uncultured NeisseriaceaebacteriumcloneNpFky1G6 Uncultured bacteriumcloneMB05B09 Uncultured bacteriumcloneMA04A10 edentula Uncultured bacteriumcloneMA03H08 Uncultured bacteriumcloneMA02G10 Uncultured bacteriumcloneMA02F10 A Litvinov population CR 1 0.04 W 1/100 Ceske Budejovicecolony 14 1/72 1/44 CR 1/45 Hoplopleura acanthopus S 1/100 Legionella pneumophilasubsp. 1/82 1/100 1/100 1/85 1/100 Laribacter hongkongensis 1/100 Jeongeupia sp.USM3 1/100 1/100 Iodobacter fluviatilis Hlinsko population 1/100 1/100 Vogesella indigofera 1/90 Chitiniphilus shinanonensis Chitinilyticum aquatile Aquitalea pelogenes 1/100 Chromobacterium amazonense Chromobacterium violaceum CR Pseudogulbenkiania ferrooxidans 1/100 E 1/100 1/91 1/71 Burkholderia cepacia 1/100 1/100 1/100 1/100 Stenoxybacter acetivorans Neisseria waeveri Neisseria wadsworthii Neisseria canis Snodgrassella alvi 0.99/82 1/100 Acidovorax sp.KKS102 Bergeriella denitrificans 1/87 Neisseria bacilliformis Morococcus cerebrosus Eikenella corrodens 1/94 1/100 Neisseria meningitidis Neisseria gonorrhoeae 0.2 Conchiformibius steedae Kingella kingae Kingella denitrificans “Neisseria Kingella oralis Simonsiella muelleri population Alysiella crassa Bulgaria Alysiella filiformis “Neisseria N “-P “-H 49.29 43.97 50.70 GC% GC% 54.9 56.9 51.8 49.4 53.8 45.5 56.1 45.1 51.0 47.8 47.1

Posted on Authorea 11 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158144990.03784908 — This a preprint and has not been peer reviewed. Data may be preliminary. b a e f d c 15