DOCSLIB.ORG

Sixteen New Lung Function Signals Identified Through 1000 Genomes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sixteen New Lung Function Signals Identified Through 1000 Genomes ARTICLE Received 5 Feb 2015 | Accepted 17 Sep 2015 | Published 4 Dec 2015 DOI: 10.1038/ncomms9658 OPEN Sixteen new lung function signals identified through 1000 Genomes Project reference panel imputation Marı´a Soler Artigas et al.# Lung function measures are used in the diagnosis of chronic obstructive pulmonary disease. In 38,199 European ancestry individuals, we studied genome-wide association of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC) and FEV1/FVC with 1000 Genomes Project (phase 1)-imputed genotypes and followed up top associations in 54,550 Europeans. We identify 14 novel loci (Po5 Â 10 À 8) in or near ENSA, RNU5F-1, KCNS3, AK097794, ASTN2, LHX3, CCDC91, TBX3, TRIP11, RIN3, TEKT5, LTBP4, MN1 and AP1S2, and two novel signals at known loci NPNT and GPR126, providing a basis for new understanding of the genetic determinants of these traits and pulmonary diseases in which they are altered. Correspondence and requests for materials should be addressed to I.P.H. (email: [email protected]) or to M.D.T. (email: [email protected]). #A full list of authors and their affiliations appears at the end of the paper. NATURE COMMUNICATIONS | 6:8658 | DOI: 10.1038/ncomms9658 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9658 ung function, as measured by spirometry, predicts morbidity STAGE 1 (genome-wide association studies) and mortality1,2. Altered lung function is a key criterion for n=38,199 Lthe diagnosis of chronic obstructive pulmonary disease B58C (n=5,934) (COPD), a leading cause of death worldwide3,4. The ratio of BHS1&2 (n=4,355) CROATIA-Korcula (n=826) STAGE 2 (follow-up studies) forced expiratory volume in 1 s (FEV1) over forced vital capacity (FVC) defines patients with airflow obstruction, while FEV is CROATIA-Split (n=493) n=54,550 1 CROATIA-Vis (n=925) used to assess the severity of the obstruction. Reduced FVC values 5 EPIC population based (n=2,339) ECRHS (n=1,747) are seen in restrictive lung diseases such as pulmonary fibrosis . GS:SFHS (n=8,093) PIVUS (n=837) While environmental risk factors, such as tobacco smoking or air H2000 (n=821) TwinsUK (n=3,023) 6,7 pollution, play a significant role in determining lung function , KORA F4 (n=1,474) UK BiLEVE (n=48,943) genetic factors are also important contributors, with estimates of KORA S3 (n=1,147) heritability ranging between 39 and 54% (refs 8,9). LBC1936 (n=991) NFBC1966 (n=4,563) Genome-wide association studies (GWAS) of around 2.5 NSPHS (n=871) million common (minor allele frequency (MAF)45%) single- ORCADES (n=1,802) nucleotide polymorphisms (SNPs) in Europeans have identified SAPALDIA (n=1,378) 32 loci associated with lung function at genome-wide significance SHIP (n=1,768) level (Po5 Â 10 À 8)10–14. However, as for other complex YFS (n=419) traits15,16, these loci only explain a limited proportion of the Figure 1 | Study design for autosomal chromosome analyses. The heritability11,13. Among explanations for the ‘missing heritability’ are a large number of, as yet, undetected common variants discovery stage (stage 1) included 17 studies and 38,199 individuals. Fifty- five variants were followed up in stage 2, which comprised four studies and with modest effect sizes, in addition to low-frequency 54,550 individuals. (1%oMAFr5%) and rare (MAFr1%) variants with larger effect sizes16,17. Of particular relevance to low-frequency variants, phase 1 of the 1000 Genomes Project18 sequenced 1,092 individuals from 14 populations, providing an imputation across X chromosome variants was 1.04 for FEV1 and 1.00 for B reference panel of 38 million SNPs and 1.4 million indels, FEV1/FVC and FVC. Quantile–quantile plots are presented in including autosomal and X chromosome variants. Supplementary Fig. 2a. Variants with effective sample sizes (N The aim of the current study, undertaken within the SpiroMeta effective, product of sample size and imputation quality summed consortium, was to improve coverage of low-frequency variants across studies) o70% were filtered out, and a total of 8,694,268 and detect novel loci associated with lung function by under- variants were included in this genome-wide study. taking imputation of GWAS data to the 1000 Genomes Project18 Forty-eight SNPs and seven indels in independent autosomal Phase-1 reference panel in 38,199 individuals of European chromosome regions (±500 kb either side of sentinel variant) ancestry. We meta-analysed GWAS results across 17 studies with stage 1 Po5 Â 10 À 6 were followed up in stage 2 using in and followed up the most significant associations with in silico silico data from four studies comprising 54,550 individuals (Fig. 1; data in up to 54,550 Europeans. We identify 14 new loci Supplementary Table 2). One SNP on the X chromosome also associated with lung function at genome-wide significance level, met these criteria and was followed up in a subset of three studies and novel distinct signals at two previously reported loci. These comprising 52,359 individuals (Supplementary Fig. 1; include two low-frequency variant association signals, which Supplementary Table 2). Characteristics of follow-up (stage 2) seem to be explained by non-synonymous SNPs. The results of cohort participants, genotyping and imputation are shown in these analyses implicate both previously considered and novel Supplementary Table 1. Stage-2 studies adjusted the traits for age, mechanisms influencing lung function. age2, sex, height and principal components to account for population structure and ever-smoking status, and also undertook association testing on the inverse normally transformed residuals Results assuming additive genetic effects. Stage-2 estimates were We undertook a meta-analysis of 17 GWAS imputed using the combined across studies, and then with stage-1 estimates, using 1000 Genomes Project18 Phase-1 reference panel in a study of inverse variance-weighted fixed-effects meta-analysis. Thirteen 38,199 individuals of European ancestry in stage 1 (Fig. 1), of SNPs and three indels, each representing new signals of which 19,532 were individuals not included in the discovery stage association, met a genome-wide significance threshold corrected of previous meta-analyses of lung GWAS10–13. Characteristics of for multiple testing (Po5 Â 10 À 8) after combining stage-1 and cohort participants, genotyping and imputation are shown in stage-2 results (Table 1; Fig. 2), of which 10 SNPs and three indels Supplementary Table 1. Each study adjusted FEV1, FEV1/FVC achieved independent replication meeting a Bonferroni-corrected and FVC, for age, age2, sex, height and principal components for threshold for 56 tests (Po8.93 Â 10 À 4) in stage 2 alone. population structure, separately for never and ever smokers. Fourteen studies additionally undertook analyses for X chromosome variants (33,009 individuals, Supplementary Fig. 1 Sixteen novel association signals for FEV1,FEV1/FVC and FVC. and Methods). Inverse normally transformed residuals were then Of the 16 novel signals reaching genome-wide significance, two used for association testing within each smoking stratum, represent distinct new signals for FEV1/FVC in previously reported assuming an additive genetic effect. Within each study, we loci10,12 (stage-1 P value conditioned on previously reported combined smoking strata association summary statistics using variant o5 Â 10 À 6). Among the remaining 14, five new loci were inverse variance-weighted fixed-effects meta-analysis, and applied identified for FEV1, six new loci for FEV1/FVC and three new loci genomic control19 to account for residual population structure for FVC (Table 1). The sentinel variants at the 16 loci were in or not accounted for by principal components. We subsequently near the following genes: MCL1-ENSA (1q21.3), LYPLAL1- combined study-specific estimates across studies using inverse RNU5F-1 (1q41), KCNS3-NT5C1B (2p24.2), AK097794 (3q25.32), variance weighing, and applied genomic control19 after fixed- NPNT (4q24), GPR126-LOC153910 (6q24.1), ASTN2 (9q33.1), effects meta-analysis. The genomic inflation factor across LHX3 (9q33.1), PTHLH-CCDC91 (12p11.22), TBX3 (12q24.21), autosomal variants was 1.03 for each of the three traits, and TRIP11 (14q32.12), RIN3 (14q32.12), EMP2-TEKT5 (16p13.13), 2 NATURE COMMUNICATIONS | 6:8658 | DOI: 10.1038/ncomms9658 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9658 ARTICLE Table 1 | Variants associated with FEV1, FEV1/FVC or FVC. rs number Gene (function) eQTL Coded Measure Stage 1 Stage 2 Meta-analysis (chr:position) gene allele/ other allele Coded N Beta P Coded N Beta (s.e.) P Beta (s.e.) P allele (s.e.) allele freq. freq. À 7 À 3 À 9 rs6681426 MCL1 ARNT G/A FEV1 0.36 37,944 0.042 1.07 Â 10 0.35 5,4301 0.021 1.13 Â 10 0.029 4.35 Â 10 (chr1:150586971) (dist. ¼ 34,757), (0.008) (0.006) (0.005) ENSA (dist. ¼ 7,628) À 6 À 5 À 10 rs201204531 LYPLAL1 — A/ATG FEV1/FVC 0.41 34,866 À 0.038 1.98 Â 10 0.38 53,760 À 0.027 1.77 Â 10 À 0.031 2.68 Â 10 (chr1:219963090) (dist. ¼ 576,883), (0.008) (0.006) (0.005) RNU5F-1 (dist. ¼ 83,529) À 8 À 9 À 15 rs61067109 KCNS3 — G/A FEV1/FVC 0.77 37,416 À 0.050 3.09 Â 10 0.77 54,341 À 0.042 6.56 Â 10 À 0.045 1.40 Â 10 (chr2:18292452) (dist. ¼ 178,227), (0.009) (0.007) (0.006) NT5C1B (dist.
Load more

Recommended publications
  • Estimation of DNA Contamination and Its Sources in Genotyped Samples
    Gregory Zajac ORCID iD: 0000-0001-6411-9666 Estimation of DNA contamination and its sources in genotyped samples Gregory J. M. Zajac1; Lars G. Fritsche1; Joshua S. Weinstock1; Susan L. Dagenais2; Robert H. Lyons2; Chad M. Brummett3; Gonçalo. R. Abecasis1 1) Center for Statistical Genetics, Department of Biostatistics, University of Michigan School of Public Health, Ann Arbor, MI; MI; 2) Department of Biological Chemistry and DNA Sequencing Core, University of Michigan, Ann Arbor, MI; 3) Department of Anesthesiology, Division of Pain Medicine, University of Michigan Medical School, Ann Arbor, MI. Corresponding author: Gregory JM Zajac 734-763-5315 [email protected] University of Michigan School of Public Health - Department of Biostatistics 1415 Washington Heights Ann Arbor, MI 48109-2029 Grant Numbers: HG007022 Author Manuscript This is the author manuscript accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/gepi.22257. This article is protected by copyright. All rights reserved. Abstract Array genotyping is a cost-effective and widely used tool that enables assessment of up to millions of genetic markers in hundreds of thousands of individuals. Genotyping array data are typically highly accurate but sensitive to mixing of DNA samples from multiple individuals prior to or during genotyping. Contaminated samples can lead to genotyping errors and consequently cause false positive signals or reduce power of association analyses. Here, we propose a new method to identify contaminated samples and the sources of contamination within a genotyping batch.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name epithelial membrane protein 2 Gene Symbol Emp2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.21730 Ensembl Gene ID ENSRNOG00000002664 Entrez Gene ID 360468 Assay Information Unique Assay ID qRnoCIP0024746 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000003615 Amplicon Context Sequence CCTGCTGCCTTCGCTGCCCTGTGAACATGTTGGTGATTCTTGCCTTCATCATCGT CTTCCACATCGTGTCTACGGCACTCTTGTTCATTTCAACCATTGACAATGCCTGG TGGGTAGGAGATGGCTTCTCAGCT Amplicon Length (bp) 104 Chromosome Location 10:4276703-4281842 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9989 cDNA Cq 20.98 cDNA Tm (Celsius) 82.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Emp2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Fifty Years of Genetic Epidemiology, with Special Reference to Japan
    J Hum Genet (2006) 51:269–277 DOI 10.1007/s10038-006-0366-9 MINIREVIEW Newton E. Morton Fifty years of genetic epidemiology, with special reference to Japan Received: 13 December 2005 / Accepted: 18 December 2005 / Published online: 15 February 2006 Ó The Japan Society of Human Genetics and Springer-Verlag 2006 Abstract Genetic epidemiology deals with etiology, dis- Introduction tribution, and control of disease in groups of relatives and with inherited causes of disease in populations. It The Japan Society of Human Genetics (JSHG) was took its first steps before its recognition as a discipline, established at a time when the science it represented was and did not reach its present scope until the Human growing so explosively that Carlson (2004) signalised the Genome Project succeeded. The intimate relationship death of classical genetics. Compared to their predeces- between genetics and epidemiology was discussed by sors, geneticists in 1956 were more distrustful of eugenics Neel and Schull (1954), just a year after Watson and and more committed to cytogenetics, biochemistry, and Crick reported the DNA double helix, and 2 years be- medical genetics, but not yet prepared for the genomic fore human cytogenetics and the Japan Society of Hu- revolution that the double helix would ultimately bring man Genetics were founded. It is convenient to divide (Yanase 1997). Population genetics was beginning to the next half-century into three phases. The first of these split into two major branches, one concerned with events (1956–1979) was before DNA polymorphisms were that took place in the past under poorly known forces of typed, and so the focus was on segregation and linkage systematic pressure and chance (evolutionary genetics), of major genes, cytogenetics, population studies, and the other dealing with etiology, distribution, and control biochemical genetics.
    [Show full text]
  • Manual for Conducting a Large-Scale GWAS and Whole Genome
    (COVNET) NIH Lead Investigator: Stephen Chanock, M.D. ([email protected]) Director, Division of Cancer Epidemiology and Genetics, NCI NIH Investigators: Sharon Savage, M.D. ([email protected]) Lisa Mirabello, Ph.D. ([email protected]) Meredith Yeager, Ph.D. ([email protected]) Mitchell Machiela, Sc.D. ([email protected]) Joshua Sampson, Ph.D. ([email protected]) Amy Hutchinson, M.S. ([email protected]) Belynda Hicks, M.S. ([email protected]) Division of Cancer Epidemiology and Genetics, NCI Mary Carrington, Ph.D. ([email protected]) Center for Cancer Research, NCI Leslie Biesecker, M.D. ([email protected]) Teri Manolio, M.D., Ph.D. ([email protected]) National Human Genome Research Institute Steven Holland, M.D. ([email protected]) National Institute of Allergy and Infectious Diseases Project Manager Vibha Vij, M.S., MPH ([email protected]) Division of Cancer Epidemiology and Genetics, NCI Website: https://dceg.cancer.gov/research/how-we-study/genomic-studies/covnet Table of Contents Sections 1.0 Background and Rationale for a Large Crowdsourced GWAS of COVID19 Infection ...... 2 2.0 Biospecimens: genomic DNA, blood/blood products, buccal cells/saliva .......................... 6 3.0 Patient Phenotypes ............................................................................................................. 10 4.0 Genotyping and Imputation ............................................................................................... 10 5.0 Analysis Plan ....................................................................................................................
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
    Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice
    Mechanisms of synaptic plasticity mediated by Clathrin Adaptor-protein complexes 1 and 2 in mice Dissertation for the award of the degree “Doctor rerum naturalium” at the Georg-August-University Göttingen within the doctoral program “Molecular Biology of Cells” of the Georg-August University School of Science (GAUSS) Submitted by Ratnakar Mishra Born in Birpur, Bihar, India Göttingen, Germany 2019 1 Members of the Thesis Committee Prof. Dr. Peter Schu Institute for Cellular Biochemistry, (Supervisor and first referee) University Medical Center Göttingen, Germany Dr. Hans Dieter Schmitt Neurobiology, Max Planck Institute (Second referee) for Biophysical Chemistry, Göttingen, Germany Prof. Dr. med. Thomas A. Bayer Division of Molecular Psychiatry, University Medical Center, Göttingen, Germany Additional Members of the Examination Board Prof. Dr. Silvio O. Rizzoli Department of Neuro-and Sensory Physiology, University Medical Center Göttingen, Germany Dr. Roland Dosch Institute of Developmental Biochemistry, University Medical Center Göttingen, Germany Prof. Dr. med. Martin Oppermann Institute of Cellular and Molecular Immunology, University Medical Center, Göttingen, Germany Date of oral examination: 14th may 2019 2 Table of Contents List of abbreviations ................................................................................. 5 Abstract ................................................................................................... 7 Chapter 1: Introduction ............................................................................
    [Show full text]
  • Neuromuscular Disorders Neurology in Practice: Series Editors: Robert A
    Neuromuscular Disorders neurology in practice: series editors: robert a. gross, department of neurology, university of rochester medical center, rochester, ny, usa jonathan w. mink, department of neurology, university of rochester medical center,rochester, ny, usa Neuromuscular Disorders edited by Rabi N. Tawil, MD Professor of Neurology University of Rochester Medical Center Rochester, NY, USA Shannon Venance, MD, PhD, FRCPCP Associate Professor of Neurology The University of Western Ontario London, Ontario, Canada A John Wiley & Sons, Ltd., Publication This edition fi rst published 2011, ® 2011 by Blackwell Publishing Ltd Blackwell Publishing was acquired by John Wiley & Sons in February 2007. Blackwell’s publishing program has been merged with Wiley’s global Scientifi c, Technical and Medical business to form Wiley-Blackwell. Registered offi ce: John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK Editorial offi ces: 9600 Garsington Road, Oxford, OX4 2DQ, UK The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK 111 River Street, Hoboken, NJ 07030-5774, USA For details of our global editorial offi ces, for customer services and for information about how to apply for permission to reuse the copyright material in this book please see our website at www.wiley.com/wiley-blackwell The right of the author to be identifi ed as the author of this work has been asserted in accordance with the UK Copyright, Designs and Patents Act 1988. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by the UK Copyright, Designs and Patents Act 1988, without the prior permission of the publisher.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • PDF Output of CLIC (Clustering by Inferred Co-Expression)
    PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 14 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 14. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Cpsf3l Polr2b Ints3 Ints7 Ints1 Ints4 Ints9 Ints2
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]