Snrk1-Eif4e Interaction in Translational Control and Antiviral

Home , ADK (gene), Curtovirus, Geminiviridae, Mastrevirus

SnRK1-eIF4E Interaction in Translational Control and

Antiviral Defense

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of

Philosophy in the Graduate School of The Ohio State University

Sizhun Li, B.S.

Graduate Program in Plant Cellular and Molecular Biology

The Ohio State University

2014

Dissertation Committee:

Dr. David M. Bisaro, Advisor

Dr. Biao Ding

Dr. David Mackey

Dr. Deborah Parris

Sizhun Li

2014 ABSTRACT

AMPK (animals), SNF1 (yeast), and SnRK1 (plants) belong to a highly conserved family of serine/threonine kinases that function in response to environmental changes that cause energy depletion. We previously demonstrated that SnRK1 conditions an innate antiviral defense effective against DNA and RNA viruses, including geminiviruses and Tobacco mosaic virus (TMV). We also showed that the geminivirus pathogenicity proteins AL2 and L2 interact with and inactive SnRK1 as a counterdefense. However, because SnRK1 has a multitude of targets, the mechanism by which SnRK1 interferes with viral infectivity was elusive. Here, we present evidence that the cap binding proteins and translation initiation factors eIF4E and eIF(iso)4E are novel SnRK1 substrates.

First, we confirmed the previous finding that the geminivirus pathogenicity factor AL2 inhibits SnRK1 in vitro. We showed that plant-expressed SnRK1 kinase domain

(SnRK1-KD) was inhibited by both Cabbage leaf curl virus (CaLCuV) and Tomato golden mosaic virus (TGMV) AL2. Moreover, SnRK1-KD phosphorylates CaLCuV AL2, but not TGMV AL2. In addition, amino acid substitutions at the SnRK1 phosphorylation site (S109G, S109D) did not affect interaction between AL2 and SnRK1, or AL2 and adenosine kinase (ADK). ii

We then showed that SnRK1 phosphorylates translation initiation factors eIF4E and eIFiso4E in vitro. We observed that Arabidopsis thaliana eIF4E/iso4E contain two consensus SnRK1 phosphorylation sites (S33 and T55) that are conserved among higher plants, invertebrates, and yeast, but are absent from vertebrate eIF4E. SnRK1 phosphorylates eIF4E/iso4E at these sites, and interacts with these initiation factors in the cytoplasm of plant cells. By contrast, AL2 and SnRK1 interact in the cytoplasm and the nucleus. To study the impact of eIF4E phosphorylation in vivo, we developed a complementation system using a yeast eIF4E deletion strain (cdc33). We found that while Arabidopsis eIF4E/iso4E can complement this strain, expression of the SnRK1 kinase domain (SnRK1-KD) inhibited growth of the complemented cells. Polysome profiling revealed that SnRK1-KD also repressed protein synthesis, as judged by a reduction in polysomes and accumulation of ribosomal subunits. By contrast, the growth of yeast cdc33 cells maintained by human eIF4E (which lacks SnRK1 phosphorylation sites) or by a non-phosphorylatable eIF4E VA mutant was not significantly impacted by

SnRK1-KD, and polyribosomes were largely unaffected. These findings indicate that eIF4E/iso4E phosphorylation by SnRK1 inhibits translation, and may represent an antiviral defense mechanism analogous to PKR phosphorylation of eIF2 in vertebrates.

iii

Dedication

Dedicated to my mother

ACKNOWLEDGMENTS

Foremost, I would like to express my deepest thanks to my advisor, Professor David M.

Bisaro, for his guidance, patience, encouragement, and financial support throughout my years in graduate school. Dave introduced me into the fantastic world of viruses. Dave is a great mentor who helps me to shape my critical thinking, scientific attitude, and the style of presentation and writing. I am truly thankful for his immense knowledge, steadfast integrity, and selﬂess dedication to my academic development. Besides science,

Dave is more like a father and a friend to me. I owe a great debt of gratitude to him.

I would like to express my very great appreciation to my supervisory committee members,

Prof. Biao Ding, Prof. David Mackey and Prof. Deborah Parris for their insightful comments and suggestions on my project.

I would also like to thank current and past members of the Bisaro lab. To begin with, I would like to thank Drs. Gireesha Mohannath and Linhui Hao for their work that my project is based on. I acknowledge Dr. Priya Raja, whom I worked with when I first joined the lab. Many thanks to other former lab members, Dr. Kenn Buckley, Dr. Jamie

Jackel, Dr. Youn Hyung Lee, Dr. Yan Xie, Dr. Yair Cardenas, Kirsten Schaffer and Isaac

Heard. I would like to offer my special thanks to Tami Coursey and Aaron Bruns, who v

carefully read my manuscript and suggested many important changes. I would like to thank Jeffery Ostler for ordering chemicals for the lab. I would also like to acknowledge the other current members, Jessica Storer, Archit Sahai, Ke Shang, and other undergraduate students.

I am extremely grateful to the Department of Molecular Genetics (MG) and the former

Plant Cellular and Molecular Biology program (PCMB) for providing me financial support throughout my Ph.D. years. I would like to thank all the MG faculty, postdocs and students for sharing ideas, equipment, protocols, plasmids, yeast strains and plant mutants. I am particularly grateful for the assistance given by Prof. Paul Herman, Prof.

Anita Hopper, Prof. Biao Ding, Prof. Iris Meier, Bo Zhang, Jingyan Wu, Dr. Ying Wang,

Dr. Xiao Zhou and Dr. Lei Wang. I would also like to thank the Center for Applied Plant

Sciences (CAPS) for holding the weekly Rightmire in-floor seminar every year. This has been a great opportunity for me to learn and improve my presentation skills. I acknowledge the assistance provided by all the staff of the Rightmire Hall.

I cannot have made this far without the support from my family. I owe a great debt of gratitude to my mother, for her unconditional love and support. Finally, special thanks to my former classmates of Bio42 of Tsinghua University. Because of you, I now have families all around the world.

VITA

2004 – 2008………………. B.S. Department of Biological Sciences and Biotechnology,

Tsinghua University, China

2008 – present……………... Graduate Teaching and Research Associate, Department of

Molecular Genetics, The Ohio State University

PUBLICATIONS

1. Raja, P., J. N. Jackel, S. Li, I. M. Heard and D. M. Bisaro (2014). "Arabidopsis double-stranded RNA binding protein DRB3 participates in methylation-mediated defense against geminiviruses." Journal of Virololgy 88(5): 2611-2622. 2. Xu, G.*, S. Li*, K. Xie*, Q. Zhang, Y. Wang, Y. Tang, D. Liu, Y. Hong, C. He and Y. Liu (2012). "Plant ERD2-like proteins function as endoplasmic reticulum luminal protein receptors and participate in programmed cell death during innate immunity." Plant Journal 72(1): 57-69. *co-first author 3. Yang, X., Y. Xie, P. Raja, S. Li, J. N. Wolf, Q. Shen, D. M. Bisaro and X. Zhou (2011). "Suppression of methylation-mediated transcriptional gene silencing by betaC1-SAHH protein interaction during geminivirus-betasatellite infection." PLoS Pathogen 7(10): e1002329.

FIELDS OF STUDY

Major Field: Plant Cellular and Molecular Biology

Field Specifications: Molecular Genetics

Plant Virology vii

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENTS ...... v

VITA ...... vii

TABLE OF CONTENTS ...... viii

LIST OF FIGURES ...... xiii

LIST OF TABLES ...... xv

1 CHAPTER 1: INTRODUCTION ...... 1

1.1 Overview of geminiviruses ...... 1

1.1.1 Geminiviruses, single-stranded DNA viruses ...... 1

1.1.2 Geminivirus classification ...... 3

1.1.3 Geminivirus genomes and proteins ...... 5

1.1.4 The function of TGMV AL2 and BCTV L2 during virus infection ...... 9

1.2 SnRK1 overview ...... 15

1.2.1 Structure and Regulation of AMPK/SNF1/SnRK1 kinases...... 15

1.2.2 The expanded Arabidopsis SnRK family ...... 19

1.2.3 The roles of SnRK1 in stress responses and metabolic regulation ...... 20

1.2.4 SnRK1 substrates ...... 21

1.2.5 SnRK1 regulates transcription of metabolism-related genes ...... 24

1.2.6 SnRK1 conditions plant innate immunity ...... 25

1.2.7 Viral regulation of SnRK1 ...... 26

1.3 Translational regulation and viral infection ...... 28

1.3.1 PKR-mediated antiviral defense ...... 28

1.3.2 The missing plant PKR ...... 30

1.4 Translation initiation factors eIF4E/iso4E ...... 33

viii

1.4.1 eIF4E is a cap binding protein ...... 33

1.4.2 Regulation of eIF4E activity ...... 35

1.4.3 Roles of eIF4E in plant antiviral defense ...... 39

1.5 Figures and tables ...... 42

2 CHAPTER 2: Arabidopsis SnRK1 Interacts with and phosphorylates translation initiation factors 4E and iso4E ...... 51

2.1 Introduction ...... 51

2.2 Results ...... 56

2.2.1 Arabidopsis eIF4E and eIF(iso)4E contain two SnRK1 consensus sites56

2.2.2 SnRK1-KD phosphorylates eIF(iso)4E in vitro ...... 57

2.2.3 SnRK1 phosphorylates eIF(iso)4E at S33 and T55 ...... 58

2.2.4 Arabidopsis eIF4E and eIF(iso)4E physically interact with SnRK1 in yeast two-hybrid assays ...... 59

2.2.5 SnRK1 co- immunoprecipitates with eIF(iso)4E ...... 60

2.2.6 SnRK1 interacts with eIF4E/iso4E in the cytoplasm of plant cells ...... 61

2.2.7 Arabidopsis eIF4E and iso4E complement a yeast null mutant ...... 62

2.2.8 At4E/iso4E phosphomimic mutants failed to complement ye strain 64

2.2.9 SnRK1-KD inhibits yeast growth ...... 66

2.2.10 SnRK1-KD represses polysome formation in an At4E/iso4E-dependent manner 69

2.3 Discussion ...... 72

2.3.1 SnRK1 phosphorylates eIF4E/iso4E...... 72

2.3.2 Role of Arabidopsis eIF4E/iso4E phosphorylation in regulating translation 75

2.3.3 Importance of eIF4E-mediated translational control ...... 78

2.4 Materials and Methods ...... 80

2.4.1 Gene cloning ...... 80

2.4.2 Preparation of SnRK1-KD and SnRK1-KDKR proteins ...... 81

2.4.3 Expression and purification of SnRK1 substrate proteins in E. coli cells82

2.4.4 Western blot ...... 84

2.4.5 SnRK1 kinase assay ...... 85

2.4.6 Site-directed mutagenesis for Arabidopsis eIF4E and iso4E ...... 85

2.4.7 Yeast two-hybrid analysis ...... 87

2.4.8 BiFC analysis of interactions ...... 87

2.4.9 Co-immunoprecipitation ...... 89

2.4.10 Yeast culture medium ...... 90

2.4.11 Yeast transformation ...... 91

2.4.12 Polysome profile assays ...... 92

2.5 Figures and Tables ...... 94

3 CHAPTER 3: TGMV and CaLCuV AL2 inhibit SnRK1 activity in vitro, while SnRK1 phosphorylates CaLCuV AL2 ...... 120

Preface ...... 120

3.1 Introduction ...... 120

3.2 Results ...... 127

3.2.1 TGMV AL2 inhibits SnRK1 transphosphorylation activity in vitro ... 127

3.2.2 CaLCuV AL2 inhibits SnRK1 activity in vitro ...... 130

3.2.3 Arabidopsis SnRK1 consensus site in various begomovirus AL2/L2/C2 proteins 131

3.2.4 SnRK1 phosphorylates CaLCuV AL2 at S109 ...... 133

3.2.5 CaLCuV AL2 S109G, S109D mutant proteins inhibit SnRK1 activity135

3.2.6 Phosphorylation of CaLCuV AL2 does not disrupt interaction with SnRK1 137

3.2.7 Phosphorylation of CaLCuV AL2 does not disrupt interaction with ADK 139

3.3 Discussion ...... 140

3.4 Materials and methods ...... 146

3.4.1 Gene cloning ...... 146

3.4.2 Preparation of SnRK1-KD and SnRK1-KDKR proteins ...... 147

3.4.3 Expression and purification of SnRK1 substrate proteins in E. coli cells148

3.4.4 SnRK1 kinase assay ...... 149

3.4.5 Yeast two-hybrid analysis ...... 150

3.4.6 BiFC analysis of interactions ...... 150

3.5 Figures and tables ...... 152

4 CHAPTER 4: Conclusions and Discussions ...... 166

4.1 Conclusions ...... 166

4.1.1 CaLCuV and TGMV AL2 inhibit SnRK1 activity in vitro ...... 166

4.1.2 SnRK1 phosphorylates CaLCuV AL2 at S109 ...... 167

4.1.3 SnRK1 interacts with eIF4E/iso4E and phosphorylates eIF(iso)4E in vitro 168

4.1.4 Arabidopsis eIF4E/iso4E phosphorylation leads to translational inhibition 169

4.2 Discussion ...... 170

4.2.1 A complex relationship between SnRK1 and CaLCuV AL2 ...... 170

4.2.2 The consequences of CaLCuV AL2 phosphorylation by SnRK1 ...... 172

4.2.3 SnRK1 phosphorylates eIF(iso)4E ...... 173

4.2.4 The importance of SnRK1 phosphorylation sites on eIF4E/iso4E ...... 176

4.2.5 SnRK1-meidated eIF4E/iso4E phosphorylation inhibits polysome formation ...... 177

4.3 Significance of the research ...... 179

4.3.1 First evidence for eIF4E/iso4E kinase in plants ...... 179

4.3.2 First evidence for eIF4E-mediated translational regulation in plants .. 179

4.3.3 First link of translational regulation to antiviral response in plants..... 180

4.3.4 The discovery of SnRK1-eIF4E/iso4E interaction provides potential applications in agriculture ...... 181

4.4 A model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counter defense interaction ...... 182

4.5 Figures and tables ...... 184

REFERENCES ...... 185

xii

LIST OF FIGURES

Figure 1.1 Geminivirus genomes...... 42

Figure 1.2 Geminivirus rolling-circle replication (RCR)...... 43

Figure 1.3 The methyl cycle is inhibited by geminivirus and beta satellite proteins. .. 45

Figure 1.4 The expanded SnRK family in Arabidopsis...... 46

Figure 1.5 Direct effects of SnRK1 on metabolic pathways...... 48

Figure 1.6 Eukaryotic translation initiation complex...... 49

Figure 2.1 SnRK1 sites in eIF4E/iso4E...... 95

Figure 2.2 SnRK1 phosphorylates eIF(iso)4E at S33 and T55...... 97

Figure 2.3 SnRK1 interacts with eIF4E/iso4E in yeast cells...... 98

Figure 2.4 SnKR1 co-immunoprecipitates with eIF(iso)4E...... 99

Figure 2.5 SnRK1 interacts with eIF4E/iso4E in the cytoplasm...... 100

Figure 2.6 Experimental outline of eIF4E phosphorylation in yeast cdc33 mutant.102

Figure 2.7 Arabidopsis eIF4E/iso4E complements yeast cdc33 mutant...... 103

Figure 2.8 At4E/iso4E mutants failed to complement yeast cdc33 strain...... 104

Figure 2.9 Arabidopsis eIF4E T67V mutant complements yeast cdc33 strain...... 105

Figure 2.10 Arabidopsis SnRK1-KD complements yeast snf1 mutant...... 106

Figure 2.11 5-FOA selection against yeast strains expressing URA3...... 107

xiii

Figure 2.12 SnRK1 inhibits yeast growth...... 108

Figure 2.13 SnRK1 inhibits At4E/iso4E-mediated polysome formation...... 109

Figure 2.14 SnRK1 does not inhibit polysome formation that is mediated by Arabidopsis

4E-VA or human 4E...... 110

Figure 2.15 Bar chart showing SnRK1 inhibits polysome formation...... 111

Figure 3.1 TGMV AL2 inhibits SnRK1 transphosphorylation activity...... 152

Figure 3.2 CaLCuV AL2 inhibits SnRK1-KD...... 153

Figure 3.3 Phylogenetic tree generated from AL2 sequences from 98 representative

begomoviruses...... 154

Figure 3.4 SnRK1 phosphorylates CaLCuV AL2 at S109...... 156

Figure 3.5 SnRK1 interacts with CaLCuV AL2 S109, S109G and S109D in yeast cells.

...... 157

Figure 3.6 CaLCuV AL2 S109, S109G and S109D interact with SnRK1 in N.

benthamiana leaf cells...... 158

Figure 3.7 CaLCuV AL2 S109, S109G and S109D interact with ADK in N. benthamiana

leaf cells...... 159

Figure 4.1 A model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counter defense

interaction...... 184

xiv

LIST OF TABLES

Table 1.1 eIF4E and eIF(iso)4E are key factors for recessive viral resistance ...... 50

Table 2.1 Yeast strains used in this study...... 112

Table 2.2 SnRK1 phosphorylates Arabidopsis eIF(iso)4E in vitro...... 113

Table 2.3 SnRK1 phosphorylates eIF(iso)4E at S33 and T55...... 114

Table 2.4 yeast complementation by Arabidopsis eIF4E/iso4E wild-type and mutants.115

Table 2.5 SnRK1 inhibits yeast growth...... 116

Table 2.6 SnRK1 inhibits polysome formation...... 117

Table 2.7 PCR program for the site-directed mutagenesis of eIF4E/iso4E...... 118

Table 2.8 Oligonucleotide primers design for site-directed mutagenesis PCR...... 119

Table 3.1 Summary of geminivirus infection in transgenic N. benthamiana plants. . 160

Table 3.2 TGMV AL2 inhibits SnRK1-KD activity...... 161

Table 3.3 CaLCuV AL2 inhibits SnRK1-KD transphosphorylation activity...... 163

Table 3.4 CaLCuV AL2 inhibits SnRK1-KD autophosphorylation activity ...... 164

Table 3.5 SnRK1 phosphorylates CaLCuV AL2 at S109...... 165

1 CHAPTER 1: INTRODUCTION

1.1 Overview of geminiviruses

1.1.1 Geminiviruses, single-stranded DNA viruses

Members of the family Geminiviridae are plant viruses that have circular single-stranded

DNA (ssDNA) genomes (for review, see (Jeske 2009)). Geminivirus virions are clearly distinguishable using electron microscopy because these non-enveloped particles display a unique twinned icosahedral morphology. The virus particles are 30 nm in length and

15–22 nm in width, and each particle encapsidates a single circular ssDNA molecule.

Geminiviruses have a worldwide distribution and infect both monocotyledonous and dicotyledonous plants, including many important crop species, vegetables and fruits (for review, see (Hanley-Bowdoin, et al. 2013, Mansoor, et al. 2003, Navas-Castillo, et al.

2011)). According to a survey generated from the responses of all authors, reviewers, editorial board members and senior editors of Molecular Plant Pathology, two geminiviruses, Tomato yellow leaf curl virus and African cassava mosaic virus, are among the top 10 plant viruses based on their economic and scientific importance

(Scholthof, et al. 2011). The study of geminiviruses will give us a better understanding of the mechanisms of virus infection and host antiviral defense, and suggest strategies to generate virus-resistant plants (Hanley-Bowdoin, et al. 2000).

Most plant viruses are positive-sense RNA viruses; Caulimoviridae, Geminiviridae and

Nanoviridae are the only three families with a DNA genome. Geminiviruses possess either one (monopartite) or two (bipartite) separately encapsidated genomic components.

Monopartite geminivirus genomes are between 2700 and 3000 nucleotides long containing 4-7 open reading frames (ORF). Some begomoviruses are bipartite viruses, whose genomes are composed of two circular ssDNA molecules of similar size, designated DNA-A (genome-A) and DNA-B (genome-B) respectively. Interestingly, some monopartite begomoviruses are associated with a satellite DNA that enhances virus infection and symptom development. The genome structure and encoded genes are described in detail in section 1.1.3. The ssDNA genomes are converted to replicative form (RF) double-stranded DNA intermediates in the host cell nucleus, and then new ssDNA molecules are synthesized by rolling circle DNA replication (RCR) (Figure 1.2), although recombination dependent replication (RDR) also occurs. The double-stranded

DNA intermediates associate with host histone proteins to form minichromosomes

(Gutierrez 1999, Pilartz, et al. 1992, Pilartz, et al. 2003). Finally, virions are assembled in

the nucleus of host plant cells.

1.1.2 Geminivirus classification

Based on genome organization, DNA similarities, host range and type of insect vector,

Geminiviruses are classified into four genera, Begomovirus, Curtovirus, Topocuvirus and

Mastrevirus (Fauquet, et al. 2008, Fauquet, et al. 2003). Viruses belonging to genera

Curtovirus, Topocuvirus and Mastrevirus have monopartite genomes, while

Begomoviruses may also have monopartite genomes, but many of them have bipartite genomes. Mastreviruses mainly infect monocotyledonous plants (Fauquet, et al. 2008), but some can infect dicotyledonous plants (Morris, et al. 1992, Liu, et al. 1999, Thomas, et al. 2010). These viruses are transmitted by leafhoppers (Cicadellidae). Maize streak virus (MSV) is the type species in this genus (Palmer, et al. 1998). Both Curtovirus and

Topocuvirus infect dicotyledonous plants. Curtoviruses rely on the beet leafhopper

(Circulifer tenellus), while Topocuviruses are vectored by treehoppers (Micrutalis malleifera). Beet curly top virus (BCTV) is the type species for Curtovirus. There is only one member in genus Topocuvirus, which is Tomato pseudo-curly top virus (TPCTV).

The largest genus is Begomovirus with more than 140 species and 600 isolates (Fauquet, et al. 2008). Begomoviruses have either monopartite or bipartite genomes and are transmitted to dicotyledonous plants by whiteflies (Bemisia tabaci). The type species of

begomoviruses is Bean golden mosaic virus (BGMV).

Begomoviruses are classified into two clusters, New World (NW) and Old World (OW) viruses, on the basis of geographic origin. OW viruses are isolated from the African and

Asian continent, while the NW viruses originate from North and South America.

Genomic analysis based on DNA-A sequences suggests this separation as well. With a few exceptions, viruses from NW or OW are clearly segregated into two groups on a phylogenetic tree constructed from an alignment of 212 DNA-A component sequences of begomoviruses (Briddon, et al. 2010). This implies that, beginning from the common ancestor, the OW and NW viruses follow independent evolutionary paths and that this evolutionary history is reflected in their genome sequences. Exceptions include two viruses isolated from Corchorus in Vietnam (also called Corchovirus), two groups of viruses isolated from Legumes in India and Southeast Asia (also called Legumovirus), and one set of viruses isolated from sweet potatoes in both America and Asia (also called

Sweepovirus). The two Corchoviruses are more closely related to the NW cluster in the phylogenetic tree despite being from Vietnam, while all the Sweepoviruses are grouped into NW cluster, no matter whether they are isolated from America or Asia.

Legumoviruses are placed between NW and OW, because their DNA-A sequences are apparently different from both NW and OW. It has been suggested the unusual

positioning of these viruses is related to the genetic isolation of their respective host species. Most of the OW and NW begomoviruses have bipartite genomes, but about a quarter of begomoviruses (~133 isolates) are monopartite. Interestingly, all the begomoviruses with monopartite genomes are native to the Old World.

Among more than 400 bipartite begomoviruses, Tomato golden mosaic virus (TGMV),

Cabbage leaf curl virus (CaLCuV), African cassava mosaic virus (ACMV), and Squash leaf curl virus (SqLCV) have been extensively studied. Relatively well-characterized monopartite begomoviruses include Tomato yellow leaf curl virus (TYLCV) and Tomato leaf curl virus (ToLCV). The geminiviruses studied in my thesis include TGMV and

CaLCuV, both of which are begomoviruses. Other geminiviruses mentioned in this thesis are BCTV (Curtovirus), Spinach curly top virus (SCTV, Curtovirus), ACMV

(Begomovirus), SqLCV (Begomovirus), Tomato yellow leaf curl China virus (TYLCCNV,

Begomovirus), Tomato mottle virus (ToMoV, Begomovirus), Pepper golden mosaic virus

(PepGMV, Begomovirus, also called Texas pepper geminivirus), and Watermelon chlorotic stunt virus (WmCSV, Begomovirus).

1.1.3 Geminivirus genomes and proteins

Geminivirus genes are oriented bidirectionally on circular genomes. The RNA

polymerase II promoters for transcription in opposite directions are located in a region called the intergenic region (IR), containing the origin of replication (ori) at the center of

IR. In general, the leftward genes are early genes related to DNA replication, transcription, and pathogenicity, while the rightward genes are late genes that are structural proteins or movement proteins. Viral genes are named on the basis of their orientation on the genome. Genes located on the right side of the genome (clockwise) are named R(X), and genes on the left side (counter clockwise) are named L(X), where X reprsents numbers. In bipartite begomoviruses, genes on sequence A are designated

A(R,L)(X), and B component genes are named B(R,L)(X). In another widely used nomenclature system, the synonymous names for R(X) and L(X) genes are V(X) and

C(X), where V stands for virion strand and C stands for complementary strand. For consistency, I will use the RL system throughout the text of this thesis.

Monopartite geminiviruses have 4-7 genes, while genome-A of bipartite begomoviruses has 5 (NW viruses) or 6 (OW viruses) genes and genome B has 2 genes. In this section, I will introduce 5 genes that have significant functions: AL1/L1 (replication-associated protein, Rep), AL3/L3 (replication enhancer, REn), AR1/R1 (coat protein, CP), BL1

(movement protein, MP), and BR1 (nuclear shuttle protein, NSP). The AL2 (transcription activator protein, TrAP) and L2 proteins will be discussed in the following section.

AL1/L1 is a highly conserved replication initiator protein. The Mastrevirus L1 gene product is called RepA, while the L1/AL1 protein of other geminiviruses is Rep.

Rep/RepA plays roles during the initiation and termination steps of DNA replication

(Gladfelter, et al. 1997). In the first step of viral DNA replication, the ssDNA viral genome (+ strand) serves as a template strand to synthesize the complementary strand (- strand), resulting in a double-stranded DNA intermediate. In the second step of DNA replication, which is called rolling circle replication (RCR), Rep recognizes the ori site and cleaves the (+) strand to initiate DNA synthesis (Gladfelter, et al. 1997, Choi, et al.

1995, Laufs, et al. 1995). After nicking the dsDNA, Rep covalently binds the free 5’ end of (+) strand, and then circularizes the newly synthesized DNA by joining the 5’end to the new 3’OH end (Figure 1.2). In summary, Rep/REpA has origin recognition activity,

DNA cleavage activity, and DNA ligation function.

Geminiviruses do not encode polymerases, and rely on host replication machinery for viral DNA replication. In differentiated plant tissue such as the phloem companion cells, cellular DNA replication activities are tightly controlled, and DNA replication enzymes are nearly absent. Thus, geminiviruses need to activate and redirect the host replication machinery for propagation of viral DNA. Rep/RepA and AL3/L3 gene product REn recruit some host factors to the origin of replication site. For example, Begomovirus Rep

protein binds the ori site and recruit several host replication factors, such as proliferating cell nuclear antigen (PCNA, DNA clamp), replication factor C (RFC, clamp loader) and replication protein A (RPA, ssDNA binding). In addition, Rep/RepA and REn bind to plant RB-related protein (RBR) to disrupt the RB-E2F pathway, which regulates transcription and the cell cycle (Xie et al., 1996; Xie, Suarez-Lopez, and Gutierrez, 1995).

This transitions infected cells to S-phase, triggering synthesis of replication proteins.

The AR1/R1 gene product is coat protein (CP). Coat proteins form the unique twin-icosahedral shells which enclose one genomic molecule of ssDNA in each capsid.

CP is a highly basic protein (pI 10) with strong DNA binding affinity in a sequence-nonspecific manner. The binding of CP to viral DNA stabilizes the viral particle structures. During viral transmission the CP displays some unique epitopes on the surface of the capsids that determine vector specificity. In monopartite geminiviruses it has been shown that CP also plays roles in systemic infection as well as nuclear import and export of viral DNA. However, bipartite begomoviruses mutants with disrupted CP gene are able to cause viral symptom in plants.

The two proteins encoded by begomovirus genome B are nuclear shuttle protein (NSP) and movement protein (MP). NSP and MP are necessary for bipartite begomovirus systemic infection. In bipartite begomoviruses only BL1 and BR1 are required for

cell-to-cell movement and systemic spread of the virus (Gardiner et al., 1988; Liu et al.,

1997; Qin et al., 1998). In addition, BL1 and BR1 interact with each other and it has been speculated that BR1 conveys viral genomes to BL1 for movement between cells (Rojas et al., 2005).

Some monopartite begomoviruses, such as Tomato leaf curl virus (ToLCV) and Ageratum yellow vein virus (AYVV), associate with a satellite DNA. There are two types of satellite

DNA: alpha satellite DNA and beta satellite DNA. Alpha satellite DNA is 1360 nucleotides long encoding a RCR initiator protein (alpha-Rep). The function of alpha-Rep is similar to begomoviruses Rep, thus alpha satellites can replicate independently. Beta satellite DNA is 1350 nucleotides long encoding one gene called C1.

C1 is a pathogenicity factor that helps the master virus for symptom induction, intracellular movement, and repression of host defenses (Cui, et al. 2004, Saunders, et al.

2004, Saeed, et al. 2005). The replication, intercellular transportation and systemic spread of beta satellites rely on the master virus.

1.1.4 The function of TGMV AL2 and BCTV L2 during virus infection

AL2 is a multifunctional protein with transactivation and pathogenicity activity. Bipartite begomovirus AL2 protein is required for the viral late gene expression encoded by the

virion sense strand, including AR1 and BR1. The AL2 transactivation activity is determined by a C-terminal acidic transcriptional activation domain (amino acids

115-129 of TGMV AL2). However the L2 of curtoviruses (e.g. BCTV), which shares low sequence homology with AL2, has no transcription activation activity. Consistent with this, BCTV L2 lacks a transcriptional activation domain.

The molecular role of AL2’s transactivation activity has not been fully characterized.

However, evidence to date indicates AL2 does not function like canonical transcription factors that stimulate transcription via direct DNA binding. Although it has been shown that AL2 bound ssDNA and dsDNA weakly, the binding was sequence-nonspecific. In addition, the transactivation activity of AL2 was not virus-specific. For example, TGMV

AL2 complemented an al2 mutation in other geminiviruses such as African cassava mosaic virus (ACMV), Texas pepper geminivirus (TPGV), and Squash leaf curl virus

(SqLCV). Inversely, various geminivirus AL2 complemented TGMV al2 mutants as well.

There was also evidence that the AL2-mediated transactivation was not specific to promoter sequence. For instance, the fusion protein of AL2 with a GAL4 DNA binding domain activated the transcription reporter genes driven by a minimal E1B promoter in a mouse fibroblasts system (Hartitz, Sunter, and Bisaro, 1999a). The same fusion protein activated the expression of lacZ gene driven by GAL1 promoter in yeast (Hartitz, Sunter,

and Bisaro, 1999a). Therefore, the current model suggests AL2 activation domain recruits some unidentified cellular factors to the transcription apparatus to enhance transcription.

This is analogous to the acidic activation domains of adenovirus E1A and herpesvirus

VP16.

Begomovirus AL2/L2 also contains an N-terminal nuclear localization signal (NLS) and a central zinc finger binding domain. Analysis of GFP labeled Tomato yellow leaf curl

China virus (TYLCCNV) L2 in N. benthamiana plants indicated that TYLCCNV L2 protein accumulated in the nucleus (van Wezel, Liu et al. 2001). However, immunofluorescence labeling of AL2 in TGMV infected N. benthamiana leaf tissue indicateed TGMV AL2 was present in both the cytoplasm and nucleus (Wang, Hao et al.

2003). Bimolecular fluorescence complementation assays (BiFC) testing interaction between TGMV AL2 and ADK showed that AL2 and ADK interact in both the nucleus and cytoplasm (see Chapter 2 for detail). In summary, begomovirus AL2/L2 protein is likely present in both the cytoplasm and nucleus.

Begomovirus AL2/L2 and curtovirus L2 share little sequence homology, however both of them contain a central zinc finger DNA binding motif (C-X1-C-X4-H-X4-HC). The binding of zinc ions through the zinc finger motif is essential for DNA binding by AL2 protein (Van Wezel, Liu et al. 2003). AL2, but not L2, is a self-interacting protein. The

disruption of AL2 self-interaction impairs its transactivation activity (Yang, Baliji et al.

2007). The cysteine and histidine residues in the zinc finger motif are critical for AL2 self-interaction.

In addition to the properties mentioned above, both begomovirus AL2/L2 and curtovirus

L2 function as pathogenicity factors that suppress multiple host defense responses.

Transgenic N. benthamiana plants expressing truncated TGMV AL2 or BCTV L2 transgenes show enhanced susceptibility (ES) to viruses(Sunter, et al. 2001). The truncated AL2 (AL2 1-100) lacks transactivation domain, thus the AL2-mediated enhanced susceptibility is independent of transactivation activity. The ES phenotype was characterized by a reduced latent period for symptom appearance and a decreased viral dosage for successful infection. Interestingly the transgenic N. benthamiana plants were more susceptible to a broad range of viruses, including various geminiviruses and the

RNA virus Tobacco mosaic virus (TMV). This result indicated some basal antiviral defense mechanisms of the host have been suppressed by AL2/L2. Indeed, evidence to date indicates at least two distinct defense mechanisms are antagonized by AL2 and L2.

In one mechanism, AL2/L2 counters a host adaptive defense by inhibiting RNA silencing pathways (Buchmann, et al. 2009, Raja, et al. 2008). RNA silencing is a dsRNA-triggered mechanism that acts to suppress gene expression at transcriptional and

post-transcriptional levels. Previous studies have established RNA silencing as an adaptive antiviral defense in plants. In plants there are three different silencing pathways, including post-transcriptional gene silencing (PTGS), transcription gene silencing (TGS) and miRNA pathways. Geminivirus AL2/L2 inhibits both PTGS and TGS pathways by interaction and inactivation of adenosine kinase (ADK) (Buchmann, et al. 2009, Wang, et al. 2005, Yang, et al. 2007, Wang, et al. 2003). ADK catalyzes synthesis of AMP by transferring a phosphate group from ATP to adenosine. In addition to its role in controlling adenosine monophosphate (AMP) concentration, ADK is important for maintaining the methyl cycle (Moffatt, et al. 2002). The methyl group in most transmethylation reactions is provided by S-adenosylmethionine (SAM), and this transmethylation reaction converts SAM to S-adenosylhomocysteine (SAH). SAH is hydrolyzed by SAH hydrolase (SAHH) into adenosine and homocysteine (Hcy). The equilibrium of this convertible hydrolyzation reaction lies in the direction of SAH synthesis. Thus, failure to efficiently remove adenosine or Hcy will accumulate SAH and inhibit the methyl cycle. The function of ADK in the methylation cycle is to remove adenosine by phosphorylating it into AMP, therefore preventing inhibition by SAH and promoting SAM regeneration. Because DNA methylation is a key reaction in TGS (Raja, et al. 2008), the enzymes in the methyl cycle are valuable targets for geminiviruses. For

example, TYLCCNV pathogenicity factor C1 suppresses DNA methylation by inhibiting SAHH (Yang, et al. 2011). Beet severe curly top virus (BSCTV) L2 protein inhibits 26S proteasome-mediated degradation of S-adenosyl-methionine decarboxylase 1

(SAMDC1), an enzyme generating a SAM inhibitor (decarboxylated SAM) (Zhang, et al.

2011). The inhibition of the methyl cycle by geminivirus and beta satellite proteins is summarized in Figure 1.3.

In the second mechanism AL2/L2 inhibits SnRK1, a conserved serine/threonine kinase that controls the balance of cellular energy and regulates multiple metabolic pathways

(Wang, et al. 2003). SnRK1 is a part of the host innate defense that inhibits viral infection and delays symptom appearance. However, the mechanism of SnRK1 in antiviral defense has not been characterized. In this thesis, we focus on this SnRK1-mediated defense.

Interestingly, there is evidence that the function of ADK and SnRK1 are related. AMP, a product of ADK catalyzed reaction, is a stimulator of SnRK1. This implies SnRK1 activity may be indirectly regulated by ADK in vivo. Recent data suggest SnRK1 and

ADK form a complex in the cytoplasm (Mohannath, et al. 2014). This complex may account for the stimulation of ADK by SnRK1, providing a linkage between the two kinases. It is important to note that although ADK and SnRK1 represent two critical targets of AL2/L2, further investigation could reveal more AL2/L2 targets.

1.2 SnRK1 overview

1.2.1 Structure and Regulation of AMPK/SNF1/SnRK1 kinases

SNF1 (yeast), AMPK (animals), and SnRK1 (plants) are members of a highly conserved family of serine/threonine kinases that function as sensors of cellular energy depletion

(for review, see (Hardie, et al. 1998, Halford, et al. 2009, Halford, et al. 2003, Halford, et al. 1998, Baena-Gonzalez, et al. 2008)). The AMPK/SNF1/SnRK1 family kinases function as trimeric protein complexes composed of a catalytic  subunit, and two regulatory subunits, β and γ (Polge, et al. 2007). AMPK  subunit has a highly conserved

N-terminal kinase domain (KD) and a more variable C-terminal regularly domain (RD) with binding activity to the -subunit. The AMPK β subunit functions as a scaffold protein that bridges the and  subunits. The AMPK γ subunit contains two pairs of cystathionine

-synthase (CBS) motifs to create two Bateman domains for AMP/ATP binding. Under physiological conditions the two Bateman domains of most AMPK molecules are occupied by ATP, and only a small proportion of AMPK molecules are AMP-bound. However, when the cellular AMP/ATP ratio elevates due to energy depletion, more AMP molecules are incorporated into the Bateman domains. The binding of AMP at the two Bateman domains changes the conformation of  subunit and releases the  subunit from the regulatory domain of  subunit. The upstream AMPK kinase LKB1 (liver kinase B1) then

phosphorylates AMPK  subunit at threonine 172 in the activation loop, activating AMPK.

Multiple autophosphorylation events occur subsequently at various sites, although the function of autophosphorylation is still unclear (Horman, et al. 2006, Hurley, et al. 2006).

In short, the activity of AMPK/SNF1/SnRK1 can be controlled by the binding of  subunit, post-translational modifications, various metabolites, and hormones (Crozet, et al. 2014).

Human AMPK -subunit and -subunit are each encoded by 2 genes (AMPKand

AMPK, while -subunit is encoded by 3 genes (AMPK). In S. cerevisiae, there is only one SNF1 gene in the yeast genome encoding the -subunit (Celenza, et al.

1986), while 3 genes (SIP1, SIP2 and GAL83) encode the -subunit, and one gene called

SNF4 encodes -subunit. The different combination of SNF1 subunits may contribute to the regulation in terms of substrate specificity and kinase activity. Arabidopsis SnRK1

-subunit was identified as an orthologue of AMPK/SNF1 because of its capability to complement a yeast snf1 mutant (Zhang, et al. 2003). The SnRK1 -subunit encoding genes include SnRK1.1 (AT3g01090, also called AKIN10) and SnRK1.2 (At3g29160, also called AKIN11), and SnRK1.3 (AT5g39440, not expressed) (Hrabak, et al. 2003).

The Arabidopsis SnRK1 -subunits are encoded by

SnRK1At5g21170SnRK1At4g16360and SnRK1At2g28060There are three genes encoding Arabidopsis SnRK1 -subunits: SnRK11 (At3g48530) and

SnRK12 (At1g69800) and SnRK1non-canonical -subunit, At1g09020

AMP activation of AMPK by allosteric binding to the  subunit provides a sophisticated mechanism for AMPK to sense the deficiency of energy, but the impact of AMP on yeast

SNF1 (Ludin, et al. 1998) and plant SnRK1 (Sugden, et al. 1999) has been shown to be indirect. However, AMP/ATP ratio correlates with SnRK1 activity by inhibiting phosphatases that are responsible for dephosphorylation of threonine 176 in the T-loop

(Sugden, et al. 1999).

In yeast, glucose plays a critical role in regulating SNF1 activity. SNF1 was first identified from a genetic study showing that yeast snf1 mutant could not grow on medium containing non-glucose carbon sources (Celenza, et al. 1986). SNF1 is required for the yeast to utilize the less-favored carbon sources, such as glycerol, sucrose, and galactose

(Hedbacker, et al. 2008). Cellular SNF1 responds to glucose concentration in liquid medium in a very sensitive and rapid manner (Wilson, et al. 1996). Low concentration of glucose in medium leads to SNF1 activation, while high concentration of glucose shuts off

SNF1 activity in seconds. SNF1 also responds to other environmental and nutritional stresses, such as nitrogen starvation, ion stress, alkaline pH or oxidative stress. Similar to animal AMPK, activation of SNF1 also requires phosphorylation of a T-loop threonine residue by upstream kinases, such as SAK1 (Snf1 activating kinase 1), ELM1 (elongated

morphology 1) and TOS3 (target of SBF 3) (Hong, et al. 2003).

For the SnRK1 kinases in plants, mechanisms that initiate SnRK1 activation remain unclear. Evidence to date has not determined the key regulator(s) responsible for SnRK1 activation. However, two SnRK1 upstream kinases named GRIK1 (Geminivirus Rep interacting kinase 1, also called SNAK2, SnRK1 activation kinase 2) and GRIK2 (also called SNAK1) have been uncovered (Baena-Gonzalez, et al. 2007, Hey, et al. 2007,

Shen, et al. 2009). Phosphorylation of SnRK1 by GRIK1/GRIK2 at threonine 176 in the

T-loop activates SnRK1, and triggers the subsequent autophosphorylation activity (Shen, et al. 2009). In contrast, many SnRK1 inhibitory mechanisms have been discovered. For example, some sugar metabolites, such as glucose 6-phosphate (G6P), have been shown to bind to SnRK1  subunit and inhibit SnRK1 activity in vitro (Nunes, et al. 2013, Toroser, et al. 2000). Trehalose 6-phosphate (T6P), another sugar signaling molecule, has also been shown to inhibit SnRK1 in vivo, even when T6P is at physiological concentration (Zhang, et al. 2009). SnRK1 activity is also associated with various energy-depleting stresses. For example, treatment of Arabidopsis cells with a glycolysis inhibitor 2-deoxyglucose leads to a quick depletion of cellular ATP and a rapid activation of SnRK1 (Harthill, et al. 2006).

1.2.2 The expanded Arabidopsis SnRK family

Plant SnRK1 was first identified for its ability to complement yeast snf1 mutant.

Arabidopsis expresses two SnRK1  subunits, SnRK1.1 and SnRK1.2, with highly similar amino acid sequences (82% identity). Both Arabidopsis SnRK1 proteins share 47% identity with AMPK and 46% identity with SNF1. The kinase domain is more conserved than regulatory domain, thus SnRK1-KD shares 61% identity with AMPK, and 56% identity with SNF1.

The SnRK gene family is greatly expanded in Arabidopsis. There are two additional subfamilies of protein kinases that share significant similarities with SnRK1 in both amino acid sequence and domain structure, therefore they are placed within the SnRK family and given the names SnRK2 and SnRK3 (Halford, et al. 2009). Arabidopsis encodes 10 SnRK2 -subunits and 25 SnRK3 -subunits, which together with SnRK1 make the large SnRK family of 37 members. SnRK2 and SnRK3 are unique to plants and they cannot complement yeast snf1 mutants (Hrabak, et al. 2003), which clearly distinguishes them from the AMPK/SNF1/SnRK1 subgroup (Halford, et al. 2009). The phylogenetic tree generated from ClustalW2 program categorizes family members into three clades, of which SnRK1, SNF1 and AMPK are in the same clade. The functions of

SnRK2 and SnRK3 are not fully understood. However, accumulating evidence suggests

that some SnRK2 subunits are involved in the regulation of abscisic acid (ABA) signaling pathways (Kobayashi, et al. 2005, Yoshida, et al. 2002, Yoshida, et al. 2006,

Ng, et al. 2011). SnRK2 member SnRK2C and SnRK3 member SOS2 have been shown to play roles in drought and salt tolerance, respectively (Liu, et al. 2000, Umezawa, et al.

2004).

1.2.3 The roles of SnRK1 in stress responses and metabolic regulation

Wild plants live in an environment in which the conditions constantly change. This means they are challenged by various stresses through their life span, such as extreme temperature (too cold or hot), limited water supply, high salt, limited nitrogen, pathogen infection, etc. In response to these stresses, signal transduction pathways are triggered, reprogramming gene expression and adjusting metabolic pathways. Stress responses consume extraordinary amount of energy while reducing photosynthesis, thus energy deprivation is often the consequence of stress responses. SnRK1 plays a pivotal role in sensing energy deficiency and controlling metabolism to maintain a balance between energy consumption and energy production. Specifically, SnRK1 inhibits anabolism

(energy consuming reactions), and stimulates catabolism (ATP generating reactions).

Previous studies have established the role of SnRK1 in stress responses and metabolic

regulation. In moss Physcomitrella patens, a SnRK1 knockout mutant cannot survive in a

normal day-night cycle, but requires continuous light to grow, suggesting the critical role

of SnRK1 for metabolic adaptation to dark conditions (Thelander, et al. 2004). In

Nicotiana attenuate, SnRK1 mediates sugar allocation to root tissue when plants are

attacked by Manduca sexta larvae (Schwachtje, et al. 2006). Allocation of sugar to root

allows the plant to save nutrients and increase herbivory tolerance. In Arabidopsis,

transgenic overexpression of SnRK1.1 promotes plant survival under low light conditions

and extends life span (Wingler, et al. 2009).

1.2.4 SnRK1 substrates

Like animal AMPK and yeast SNF1, plant SnRK1 can regulate important metabolic pathways through direct phosphorylation of many key metabolic enzymes. Evidence so far has revealed at least five metabolic enzymes as SnRK1 substrates (Sugden, et al. 1999,

Harthill, et al. 2006, Mackintosh, et al. 1992). SnRK1 phosphorylates

3-hydroxymethyl-3-methylglutaryl-CoA reductase (HMG-CoA reductase) (Mackintosh, et al. 1992, Beauchemin, et al. 2007), which catalyzes the NADH-dependent reduction of

3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) to mevalonic acid. HMG-CoA reductase is the rate-limiting enzyme of the mevalonate pathway that is responsible for the synthesis of steroids and other isoprenoids. Therefore, SnRK1-mediated phosphorylation

and inactivation of HMG-CoA reductase inhibits the production of steroids and isoprenoids. SnRK1 also phosphorylates sucrose phosphate synthase (SPS) (Sugden, et al.

1999). SPS catalyzes a step in the biosynthesis of sucrose 6-phosphate, in which

UDP-glucose and D-fructose 6-phosphate are converted to sucrose 6-phosphate. Nitrate reductase (NR) is another SnRK1 substrate. NR catalyzes the reduction of nitrate (NO3-) to nitrite (NO2-), which is the first step of nitrogen assimilation into amino acids.

Recently, additional enzymes involved in sugar signaling have been revealed as novel

SnRK1 substrates. For example, SnRK1 phosphorylates trehalose phosphate synthase 5

(TPS5), an enzyme in the synthetic pathway of trehalose-6-phosphate (T6P) (Harthill, et al.

2006, Glinski, et al. 2005). T6P is a signaling sugar that regulates plant metabolism and development (Paul, et al. 2008, Tsai, et al. 2014). SnRK1 also phosphorylates

6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (F2KP) in Arabidopsis (Kulma, et al. 2004). F2KP catalyzes a reversible reaction that converts ATP and fructose

6-phosphate (fru-6-P) to ADP and fructose 2,6-bisphosphate (fru-2,6-P) (Okar, et al. 2001).

Similar to T6P, fru-2,6-P is also a signaling metabolite that plays an important role in photosynthetic carbon partitioning. The enzymes directly phosphorylated by SnRK1 are summarized in Figure 1.5. It is important to note that inhibition of phosphorylated NR,

TPS5 and F2KP requires the binding of 14-3-3 proteins to the phosphorylated sites

(Bachmann, et al. 1996, Moorhead, et al. 1996, Ikeda, et al. 2000, Huber, et al. 2002).

14-3-3 proteins are important regulatory molecules that bind to phosphorylated serine or threonine residues of a wide range of signaling proteins, such as kinases, phosphatases, and transmembrane receptors (for review, see (de Boer, et al. 2013)). Interestingly, wheat

14-3-3 proteins specifically bind to autophosphorylated SnRK1, although the consequences of this interaction have not been determined (Ikeda, et al. 2000). In contrast, there is evidence that 14-3-3 proteins can be regulated by SnRKs. For example, a SnRK2 family member SnRK2.8 has been shown to phosphorylate three different proteins belonging to 14-3-3 family (Shin, et al. 2007). The evidence indicates SnRK1, associated with 14-3-3 proteins, regulates sugar signaling networks.

Heat shock protein 17 (HSP17) was discovered as a novel SnRK1 target in barley from a yeast two-hybrid screen, and has been shown to be phosphorylated in vitro by spinach

SnRK1 (Slocombe, et al. 2004). Barley HSP17 belongs to the family of small heat shock proteins (HSPs) that accumulate in the cytosol in response to stress and condition stress tolerance. The significance of HSP17 phosphorylation by SnRK1 remains to be determined.

A more recent study showed Arabidopsis SnRK1 phosphorylates two cyclin-dependent kinase inhibitor p27KIP1 homologs, Kip-related proteins 6 and 7 (KRP6/7) (Guerinier, et al.

2013). Arabidopsis KRP proteins are a family of intrinsically disordered proteins that

interact with and inactivate CDK/cyclin complexes, and thus regulate the cell cycle.

Phosphorylation of KRP6/7 by SnRK1 may inhibit the binding capability of KRP6/7 to cyclin complexes, suggesting SnRK1 may have a role in controlling cell proliferation.

1.2.5 SnRK1 regulates transcription of metabolism-related genes

In addition to direct phosphorylation of substrate enzymes, SnRK1 also regulates gene

expression. It has been shown that transcription of sucrose synthase and -amylase in

rice is controlled by SnRK1 in response to sugar starvation (Purcell, et al. 1998, Laurie,

et al. 2003). Recent evidence indicates that overexpression of SnRK1.1 (AKIN10) in

Arabidopsis triggers large-scale transcriptional reprograming, which involves increased

expression of a broad spectrum of catabolism-related genes, and repressed transcription

of anabolism-related genes (Baena-Gonzalez, et al. 2008, Baena-Gonzalez, et al. 2007).

SnRK1 expression leads to decreased expression of over 300 genes in pathways for the

synthesis of amino acids, lipids, nucleotides, sucrose, starch and proteins. SnRK1 also

suppresses transcription of genes in assembly of the cell wall and ribosomes. The

extensive changes in the transcriptome induced by Arabidopsis SnRK1 might be

associated with bZIP2 transcription factors (Baena-Gonzalez, et al. 2007).

1.2.6 SnRK1 conditions plant innate immunity

Although traditional views depict SnRK1 as a central regulator of metabolism and energy homeostasis, accumulating evidence also suggests SnRK1 plays an important role in innate immunity against geminiviruses and RNA viruses. In an early study, transgenic N. benthamiana plants expressing an antisense SnRK1 showed enhanced susceptibility to geminiviruses TGMV, BCTV, and the RNA virus TMV (Wang, et al. 2003). The infection of these transgenic N. benthamiana plants requires a lower inoculum dose, and the latent period is substantially reduced compared to wild-type plants. However, the same study showed that infected transgenic plants did not develop more severe disease symptoms than the infected wild-type plants, and transgenic plants did not accumulate significantly higher levels of viral genomes. Consistent with these results, transgenic N. benthamiana plants overexpressing SnRK1 display enhanced resistance, indicated by requirement of a higher viral dose for infection and a longer latent period for symptoms development.

SnRK1’s role in antiviral defense was confirmed by the study of TYLCCNV (Shen, et al.

2011). Infections of TYLCCNV in transgenic plants carrying antisense SnRK1 require a shorter latent period, and result in higher accumulation of viral DNAs. Conversely,

TYLCCNV infection of transgenic plants carrying a sense SnRK1 transgene requires a longer latent period, and results in lower accumulation of viral DNAs. All the evidence

indicates SnRK1 plays a role in antiviral defense.

1.2.7 Viral regulation of SnRK1

The antiviral activity of SnRK1 is counteracted by geminivirus pathogenicity factors.

TGMV AL2 and BCTV L2 were found to interact with Arabidopsis SnRK1 in a yeast two-hybrid system (Wang, et al. 2003). The interactions between geminivirus pathogenicity factors and SnRK1 were subsequently found in other systems. For instance,

Arabidopsis SnRK1 interacts with Spinach curly top virus (SCTV) C2 protein (Yang, et al. 2007), and tomato SnRK1 interacts with C1 protein from TYLCCNV (Yang, et al.

2011). Cabbage leaf curl virus (CaLCuV) AL1 protein interacts with two SnRK1 upstream kinases GRIK1 and GRIK2, suggesting geminiviruses may also regulate

SnRK1 activity through its upstream kinases (Kong, et al. 2002, Shen, et al. 2006).

The interactions between SnRK1 and TGMV AL2/ BCTV L2 lead to suppression of host defense. Direct evidence linking AL2-SnRK1 interaction with geminivirus infection is demonstrated in transgenic N. benthamiana plants overexpressing truncated TGMV AL2 fragments (Wang, et al. 2003). The first truncated AL2 fragment lacked the transcriptional activation domain (AL2 1-100), but was still able to bind SnRK1. The second truncated AL2 lacked both the transcriptional activation domain and

SnRK1-binding region (AL2 33-43 in a 1-114 background), so that AL2 33-43 only weakly bound to SnRK1. Transgenic plants expressing the AL2 1-100 showed enhanced susceptibility to TGMV or BCTV, however, transgenic plants expressing AL2

33-43 did not show enhanced susceptibility. This result indicated that AL2 repressed the plant defense system, and that AL2-SnRK1 binding was important for this process. An in vitro SnRK1 kinase assay showed SnRK1 kinase domain (KD) autophosphorylation activity is inhibited by AL2 or L2 in a dose-dependent manner (Wang, et al. 2003).

Arabidopsis SnRK1 complemented yeast SNF mutant, and the complementation was abolished by the expression of L2, indicating L2 inhibits SnRK1 in vivo (Wang, et al.

2003). This evidence indicated that SnRK1 activity was inhibited by AL2/L2.

The interaction between SnRK1 and C1 protein leads to the phosphorylation of C1. It has been shown that SnRK1 phosphorylates C1 protein rather than being inhibited by

C1 (Yang, et al. 2011). TYLCCNV carrying C1 phosphomimic mutations (aspartate substitution) showed reduced infectivity and lower viral DNA accumulation, while viruses carrying C1 nonphosphorylatable mutations (alanine substitution) resembled wild-type virus in regards to latent period and severity of symptoms, but accumulated a higher viral DNA level. This evidence indicateed SnRK1 phosphorylates C1 and that the phosphorylation of C1 may lead to reduced viral infectivity. As C1 significantly differs

from AL2/L2, and TYLCCNV encodes L2 as well, TYLCCNV may employ different strategies to optimize virus replication.

1.3 Translational regulation and viral infection

1.3.1 PKR-mediated antiviral defense

In animals, Protein kinase RNA-activated (PKR) is an important interferon-induced protein kinase which phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (eIF2) and thus inhibits protein synthesis (for review, see (Balachandran, et al.

2000)). Interferon (IFN) is a family of cell-secreted cytokines produced as part of innate immune response of vertebrates to viral infection (Goodbourn, et al. 2000, Sen 2001). IFNs bind to cell surface receptors, triggering intracellular signal transduction which leads to transcription of hundreds of genes. IFN-induced gene products establish an antiviral state primarily by suppressing gene expression at the transcriptional and translational levels

(Huang, et al. 1993, Ryman, et al. 2000, Stojdl, et al. 2000, Zhou, et al. 1999). Two critical

IFN-induced proteins that effectively inhibit gene expression are PKR and RNase L.

RNase L is a ribonuclease that degrades all types of RNA molecules in the cell, including both cellular and viral RNAs, thereby inhibiting global translation (Li, et al. 2000). PKR is a serine/threonine kinase comprised of two dsRNA-binding (dsRBD) motifs at the

N-terminus and a kinase domain at the C-terminus. In uninfected mammalian cells, transcription of PKR is at low levels, and PKR is inactive. In a rapid response to viral infection, IFN can induce a 5 to 10-fold increase in PKR transcription, and the binding of dsRNA to the two sdRBD motifs activates the kinase. The presence of dsRNA often indicates virus infection. PKR can also be activated through self-dimerization, an activating pathway independent of dsRNA. When PKR is activated, it phosphorylates many substrates, but the major substrate for translational inhibition is eIF2.

Eukaryotic eIF2 is a heterotrimeric complex composed of an  subunit, a  subunit, and a

 subunit. It forms a pre-initiation complex (43 S) with GTP, methionine initiator tRNA

(Met-tRNA), and the 40 S ribosomal subunit. The 43 S pre-initiation complex then binds to the 5' end of the mRNA to form the translation initiation complex. During translation initiation, the GTP molecule on eIF2 is hydrolyzed to GDP, causing a conformational change in eIF2 and releasing it from the 40S ribosomal subunit. To continue initiation, eIF2 needs to bind new GTP molecules. Since eIF2 has a high affinity for GDP, the recharging of GTP on eIF2 requires assistance from eIF2B, a guanine nucleotide exchange factor. However, phosphorylation of the  subunit of eIF2 at serine 51 (S51) results in an irreversible binding to eIF2B, preventing the recycling of eIF2B. When free eIF2B declines, the concentration of eIF2-GTP decreases and translation initiation is

inhibited. This eIF2-mediated translational inhibition has been shown to be a critical step in regulating translation in all eukaryotes with the major exception of plants. Several other mammalian and yeast eIF2 kinases have been discovered, including the PKR-like

ER-localized eIF2 kinase (PERK), heme-regulated inhibitor (HRI) (Chen, et al. 1995), and yeast general control non-derepressible-2 (GCN2) (Hinnebusch 1993).

Global inhibition of translation mediated by PKR and RNase L inhibits viral protein synthesis and slows down virus replication. As conterdefense response, viruses have developed at least five different strategies to prevent PKR from being activated or phosphorylating eIF2. For example, adenoviruses VA RNA 1 binds to PKR and blocks activation by dsRNA; vaccinia virus K3L protein is a pseudosubstrate; hepatitis C virus

NS5a and baculovirus PK2 proteins inhibit PKR dimerization; herpes simplex virus 34.5 binds to type 1 phosphatase and directs it to eIF2 for dephosphorylation; and influenza virus recruits a PKR inhibitor P58(IPK) to inhibit PKR dimerization. These viral strategies include inhibiting dsRNA binding, inhibiting PKR dimerization, producing

PKR inhibitors or PKR pseudosubstrates, and enhancing eIF2 dephosphorylation.

1.3.2 The missing plant PKR

Despite mammalian PKR’s critical role in antiviral defense, the existence of plant PKR

remains a mystery. Searches of Arabidopsis, rice, tomato and tobacco databases using mammalian PKR sequences does not reveal any sequences that show high homology with mammalian PKR, indicateing there are no PKR homologues in these plant systems.

However, a plant protein with dsRNA binding activity and eIF2 phosphorylation activity has been detected (Langland, et al. 1995, Langland, et al. 1996), but the amino acid sequence of this protein is unknown. This putative plant PKR (pPKR) also binds to a monoclonal antibody raised against human PKR, showing a 70 kDa band in Western blot analysis. Although some biochemical properties of pPKR match that of mammalian

PKR, the gene encoding pPKR has not been determined. Another line of indirect evidence for PKR pathways in plants is from the study of P58(IPK) (Bilgin, et al. 2003,

Langland, et al. 1997), a PKR inhibitor suppressing PKR dimerization activity.

Mammalian P58(IPK) plays a role in regulating innate immune responses by suppressing

PKR-mediated cell death. The orthologue of P58(IPK) has been identified in plants, and is involved in viral infection (Bilgin, et al. 2003). Virus induced gene silencing (VIGS) of

P58(IPK) in Arabidopsis and N. benthamiana plants led to host death upon infections with TMV and TEV, suggesting P58(IPK) functions to prevent virus-induced cell death and promote viral infection. However, the relationship between plant P58(IPK) and putative pPKR is still unknown.

In addition to PKR, animals and yeast possess three other eIF2 kinases, including HRI,

PERK and GCN2. In fact, GCN2 (AtGCN2, AT3G59410) is the only gene identified in the Arabidopsis genome that shows high homology with animal and yeast eIF2 kinases

(Lageix, et al. 2008). In yeast and mammals, GCN2 functions as a sensor of amino acid starvation through binding to uncharged tRNA. The function of Arabidopsis GCN2 has been characterized. In response to amino acid and purine starvation, and stress conditions such as UV, cold shock, wounding and herbicide treatment, AtGCN2 is activated and phosphorylates eIF2 (Lageix, et al. 2008). Arabidopsis GCN2 activation and eIF2 phosphorylation are also induced by three plant hormones, including jasmonic acid (JA), salicylic acid and 1-aminocyclopropane-1-carboxylic acid (ACC, ethylene precursor).

These plant hormones are key signaling molecules in response to tissue injury caused by insects and other herbivores (Lageix, et al. 2008). In response to an herbicide treatment that inhibits amino acid synthesis in Arabidopsis, eIF2α phosphorylation is increased only in wild-type plants, but not in the gcn2 null mutant (Zhang, et al. 2008). This

Arabidopsis gcn2 null mutant is also more sensitive to herbicides (Zhang, et al. 2008).

AtGCN2 also complements yeast gcn2 mutation, suggesting functional conservation

(Zhang, et al. 2003). Although it was suspected that AtGCN2 might play a role in antiviral defense, evidence to date suggests neither AtGCN2 nor AteIF2are involved.

There was no AteIF2 phosphorylation detected in Arabidopsis plants infected with

Turnip yellow mosaic virus (TYMV) or Turnip crinkle virus (TCV), suggesting AteIF2 phosphorylation is not a part of antiviral responses (Zhang, et al. 2008).

In summary, there is biochemical evidence that plants have an unidentified protein showing PKR-like activity, and they also have a PKR inhibitor P58(IPK). Nevertheless, the existence of plant PKR gene remains unproven. Plant GCN2 phosphorylates eIF2 and shows many similar properties with its yeast homologue, and it is involved in general stress responses such as amino acid and purine starvation, UV irradiation, cold shock and wounding. However, it is unlikely that GCN2 or eIF2 phosphorylation participates in plant responses to viral infection. We conclude that antiviral translational interference mechanism have not been described in plants. In my thesis, I propose and present evidence supporting a novel translational control mechanism that involves SnRK1 and eIF4E. This mechanism may be the key for SnRK1’s antiviral function in innate defense.

1.4 Translation initiation factors eIF4E/iso4E

1.4.1 eIF4E is a cap binding protein

Translation initiation factor eIF4E is an m7GpppN cap binding protein that facilitates the loading of 40 S ribosomal subunit onto mRNA, thus regulating the rate-limiting step for

protein synthesis. eIF4E associates with translation initiation factors eIF4G and eIF4A to

form an eIF4F complex. This complex recruits a ternary complex including a Met-tRNAi, the 40 S ribosomal subunit, eIF2 and GTP to mRNA, thus forming the 43 S preinitiation complex (Figure 1.6). According to the scanning model, when the mRNA is incorporated with 43S preinitiation complex, the preinitiation complex scans the first AUG codon by

matching Met-tRNAi with AUG (Kozak 1989). After reaching the AUG codon, translation initiation factors detach from the 40 S ribosomal subunit, allowing the 60 S ribosomal subunit to join the 40 S subunit to form an active ribosome. eIF4E is essential for translation. Yeast S. cerevisiae has only one eIF4E gene (CDC33) in its genome (Brenner, et al. 1988). Deletion of CDC33 results in cell death, while a specific single amino acid substitution (E72G) has been shown to cause a temperature sensitive phenotype. In addition to canonical eIF4F, flowering plants have an additional eIF4F complex called eIF(iso)4F, comprised of eIF(iso)4E and eIF(iso)4G (Allen, et al.

1992). The Arabidopsis genome has three eIF4E genes, eIF4E1 (At4g18940), eIF4E2

(At1g29590) and eIF4E3 (At1g29550), one eIF(iso)4E gene (At5g35620), and one gene coding for a novel cap binding protein (nCBP, AT5g18110). eIF4E2 and eIF4E3 have very low expression levels, thus eIF4E1 is the main form of eIF4E (Martinez-Silva, et al.

2012).

In Arabidopsis and N. tabacum, deletion of either eIF4E or iso4E does not show developmental defects under normal growth conditions (Duprat, et al. 2002, Combe, et al.

2005). This is likely because deletion of one form of eIF4E increases the expression of another form to compensate, and thus maintain translation initiation at physiological levels (Combe, et al. 2005). This observation suggests the general function of eIF4E and iso4E is similar. Arabidopsis eIF4E/iso4E share many functions, although evidence also suggests many differences between them. For example, Arabidopsis eIF4E/iso4E single gene deletion mutants differ in resistance to various potyviruses, indicating the selectivity of eIF4E/iso4E in antiviral defense (Duprat, et al. 2002). Although eIF4F and iso4F complexes have similar in vitro activities (Browning 1996), they show different recognition of cap analogues and unstructured mRNAs (Martinez-Silva, et al. 2012,

Gallie, et al. 2001). In Arabidopsis, eIF(iso)4E expression is more active in floral organs, roots, and tissues under development (Rodriguez, et al. 1998, Bush, et al. 2009). Both

Arabidopsis eIF4E and iso4E complement yeast cdc33 mutant, but eIF(iso)4E complemented yeast cells grow much slower, suggesting different activities of eIF4E/iso4E in yeast cells (Rodriguez, et al. 1998).

1.4.2 Regulation of eIF4E activity eIF4E is a low abundance translation initiation factor, making eIF4E activity an important

target for translational control (Duncan, et al. 1987, Hiremath, et al. 1985). One mechanism of regulating eIF4E is through eIF4E-binding proteins (4E-BP), which serve as translation initiation repressors (Pause, et al. 1994, Yanagiya, et al. 2012). 4E-BPs form inhibitory heterodimers with eIF4E, competing with eIF4G for a common binding site on eIF4E. The 4EBP-eIF4E affinity decreases when 4E-BP is phosphorylated by mammalian target of rapamycin (mTOR), leading to dissociation of the heterodimer, and allowing binding of eIF4G to eIF4E to form the functional eIF4F complex (Cencic, et al.

2011). The second mechanism of regulation is through eIF4E phosphorylation. For example, human eIF4E is phosphorylated by kinases MNK1/2 (MAP kinase-interacting serine/threonine-protein kinase 1/2) at serine 209 (S209) (Flynn, et al. 1995, Joshi, et al.

1995, Makkinje, et al. 1995, Fukunaga, et al. 1997, Waskiewicz, et al. 1997).

Interestingly, the phosphorylation of eIF4E by MNK1 requires the recruitment of MNK1 to the eIF4G C-terminal motif (Pyronnet, et al. 1999). Although human eIF4E phosphorylation correlates with higher translation rate, the molecular role of eIF4E phosphorylation is still under debate (Scheper, et al. 2002). Because S209 is located at the exit of mRNA binding cleft, while lysine 159 (K159) is on the opposite position of the cleft, the phosphate group on S109 may form a salt bridge with K159 and thus affect cap binding (Marcotrigiano, et al. 1997). The salt bridge would function as a “cleft

closure mechanism” to tighten the binding of the cap structure and therefore enhance translation. However, biochemical studies have reached contradictory results. While some papers had reported that phosphorylation of eIF4E at S209 resulted in tighter cap binding affinity (Minich, et al. 1994), more recent data has indicated that it actually decreases cap binding affinity (Scheper, et al. 2002). A refined crystal structure of eIF4E-mGpppA complex indicated the distance between S209 and K159 was too long to form a salt bridge (Tomoo, et al. 2002), suggesting the cleft closure mechanism may not exist. In addition to the disagreement over the molecular role of eIF4E phosphorylation, the biological significance of eIF4E phosphorylation is also under debate. The result of in vitro translation experiments suggested an alanine substitution at S209 (S209A) of eIF4E did not disrupt protein synthesis, and both this mutant and wild-type eIF4E complement yeast cdc33 mutant, suggesting S209 phosphorylation is not necessary for normal translation (McKendrick, et al. 2001). However, in Drosophila, transgenic expression of

S209A mutant in an eIF4E-deficient background resulted in reduced viability and developmental retardation, while expression S209D mutant or wild-type eIF4E rescued the Drosophila mutant (Lachance, et al. 2002). In summary, although animal eIF4E is phosphorylated by MNK1/2 at S209, the molecular role and biological significance of eIF4E phosphorylation has not been fully determined.

In plants, mechanisms regulating eIF4E are largely unknown. 4E-BP inhibits the binding of eIF4G to eIF4E in animals, but this mechanism has not been found in plants. There is no firm evidence that 4E-BP homologues exist in plant genomes, and 4E-BP activity has not been detected in plant cells. Instead, phosphorylation of eIF4E may play a role in regulating eIF4E function. To support this hypothesis, multiple phosphorylation states of eIF4E and iso4E have been detected in various plant species in vivo (Gallie, et al. 1997,

Manjunath, et al. 1999). Interestingly, phosphorylation of eIF4E in maize root was enhanced in response to oxygen deprivation (Manjunath, et al. 1999). However, the upstream kinases responsible for eIF4E phosphorylation in plants have yet to be discovered. Previous studies aiming to discover plant eIF4E kinases all failed. For example, protein kinase CK2 has been shown to phosphorylate many translation initiation factors in wheat germ, including eIF2, eIF2, eIF3c, eIF4B and eIF5, but CK2 does not phosphorylate Arabidopsis eIF4E or iso4E in vitro (Dennis, et al. 2009). Although eIF4E is a highly conserved protein, phosphorylation may play a different role in regulating plant eIF4E than in animal systems. First, the phosphorylation site S209 on mammalian eIF4E is absent from plant eIF4E/iso4E. Second, plants lack homologues of mammalian

MNK1/2. And third, plant eIF4G and eIF(iso)4G lack a C-terminal motif for MNK1 binding. Together these results suggest that unlike human eIF4E, plant eIF4E is

phosphorylated by different kinases at different sites, and may yield different consequences.

1.4.3 Roles of eIF4E in plant antiviral defense

Plant eIF4E has been shown to be an important recessive virus-resistance gene. Among

200 virus resistance genes, there are more recessive virus-resistance genes than dominant-resistance genes, which stands in stark contrast to resistance genes for fungal or bacterial pathogens (for review, see (Truniger, et al. 2009)). Most plant viruses have a relatively small genome, thus they encode very few proteins. Viruses need to recruit host machinery for synthesis of viral genetic material and proteins to complete their replication cycles. To be susceptible to viruses, host plants must cooperate with viruses to complete all steps of the infection cycle. Loss of key host genes required for viral replication leads to resistance. Previous studies have shown that all recessive resistance genes identified so far in crop species belong to eukaryotic translation initiation factors, including eIF4E, eIF(iso)4E and eIF(iso)4G.

Analysis of plant mutants that are resistant to RNA viruses has revealed eIF4E/iso4E as key factors for recessive resistance. For example, the pvr2 mutant for Capsicum annuum

(America Chili) resistance to Pepper veinal mottle virus (PVMV) (Caranta, et al. 1996,

Ruffel, et al. 2006), Potato virus Y (PVY) (Ruffel, et al. 2002) and Tobacco etch virus

(TEV) (Deom, et al. 1997, Charron, et al. 2008), the pvr1 mutant for Capsicum chinese resistance to Pepper mottle virus (PepMoV) (Deom, et al. 1997, Murphy, et al. 1995,

Murphy, et al. 1998), PVY (Boiteux, et al. 1996) and TEV (Deom, et al. 1997, Murphy, et al. 1995, Murphy, et al. 1998), the sbm1 mutant for pea resistance to Pea seed-borne mosaic virus (PSbMV) (Johansen, et al. 2001, Gao, et al. 2004, Keller, et al. 1998), the rym4 and rym5 mutants for barley resistance to Barley mild mosaic virus (BaMMV)

(Kanyuka, et al. 2004, Kanyuka, et al. 2005, Stein, et al. 2005) and Barley yellow mosaic virus (BaYMV) (Kanyuka, et al. 2005, Stein, et al. 2005, Kuhne, et al. 2003), and the pot1 gene for tomato resistance to PVY and TEV (Parrella, et al. 2002, Moury, et al.

2004, Ruffel, et al. 2005) all encode eIF4E. In Arabidopsis, the lsp1 was selected from an ethyl methane sulfonate (EMS)-induced mutation library that showed resistance to infection by TEV, Turnip mosaic virus (TuMV), and Lettuce mosaic virus (LMV)

(Beauchemin, et al. 2007, Lellis, et al. 2002, Wittmann, et al. 1997, Whitham, et al.

1999). The lsp1 allele encodes eIF(iso)4E. The different virus-resistant mutants are summarized in Table 1.1.

The Potyviridae (type member Potato virus Y) are a family of single-stranded, positive sense RNA viruses. Their genomes lack a typical 7-methylguanosine cap structure at the

5’ end, and instead viral translation is facilitated by a virus-encoded protein called genome-linked viral protein (VPg). All the viruses mentioned in the preceding paragraph utilize VPg. Physical interaction between eIF4E and VPg has been shown in several pathogen-host systems, such as TEV and tomato eIF4E (Schaad, et al. 2000), and TuMV and Arabidopsis eIF4E (Wittmann, et al. 1997). Although the mechanism of eIF4E-mediated recessive resistance to potyviruses is not fully understood, a leading hypothesis is that eIF4E bridges the interaction of VPg and polyA binding protein (PABP) to circularize the viral RNA. In this hypothesis eIF4E cooperates with VPg to mimic the typical translation complex. This hypothesis is supported by several lines of evidence.

For example, substitution of an aspartic acid residue in TuMV VPg abolished its interaction with Brassica perviridis (Japanese mustard) eIF(iso)4E, and this virus mutant became less infective (Leonard, et al. 2000). Further, Lettuce mosaic virus (LMV) VPg has been shown to form a heterotrimeric complex with the eIF4E and eIF4G (Michon, et al. 2006).

1.5 Figures and tables

Figure 1.1 Geminivirus genomes. Diagrams depict dsDNA replicative forms typical of

Curtoviruses (BCTV), monopartite begomoviruses (TYLCV) and bipartite begomovirus

(TGMV). Virus genes are indicated by solid arrows. The molecular weight of viral proteins is labeled in kilodaltons (kD). The viral origin of replication is indicated by an asterisk, and the common region (CR) is indicated by a hatched box within the intergenic region (IR). The CR is conserved between genome components of bipartite viruses.

Figure 1.1 Geminivirus genomes.

Figure 1.2 Geminivirus rolling-circle replication (RCR). Geminivirus DNA rolling-circle replication occurs in four stages. The ssDNA genome is converted into dsDNA replicative form (RF) (step 1). This intermediate RF dsDNA serves as template for rolling circle replication. The plus strand of dsDNA template is nicked by replication initiator protein

(Rep) at the origin of replication site (ori) (step2). After nicking, the free 3’ end of plus strand is extended by complementing the minus strand of template DNA (step 3). Rep again recognizes the newly synthesized ori site and circularizes the nascent plus strand by joining the 5’end and the new 3’OH end (step4). Parental DNA is blue, newly synthesized DNA is red.

Figure 1.2 Geminivirus rolling-circle replication (RCR).

Figure 1.3 The methyl cycle is inhibited by geminivirus and beta satellite proteins.

S-adenosyl methionine (SAM) is the methyl donor for most transmethylation reactions.

S-adenosyl homocysteine (SAH) is hydrolyzed by SAH hydrolase (SAHH) into adenosine and homocysteine (Hcy). SAH inhibits transmethylation by competing with SAM for methyltransferases (MTases). The equilibrium of this reversible hydrolyzation reaction lies in the direction of SAH synthesis. Thus failure to efficiently remove adenosine or Hcy will accumulate SAH and inhibit the methyl cycle. The function of ADK in the methyl cycle is to remove adenosine by phosphorylating it into AMP, therefore preventing inhibition by

SAH and promoting SAM regeneration. Because DNA methylation is a key reaction in

TGS, the enzymes in the methyl cycle are valuable targets for geminiviruses. CaLCuV

AL2 and BCTV L2 inhibit ADK. TYLCCNV betasatellite encoded protein C1 suppresses DNA methylation by inhibiting SAHH. BSCTV L2 protein inhibits 26S proteasome-mediated degradation of S-adenosyl-methionine decarboxylase 1 (SAMDC1), an enzyme generating a SAM inhibitor (decarboxylated SAM). THF: tetrahydrofolate, PPi: pyrophosphate; Pi: inorganic phosphate. From Yang X, et al., 2011. PLoS Pathogen 7(10): e1002329. doi:10.1371/journal.ppat.1002329

Continued

Figure 1.3

Figure 1.3 The methyl cycle is inhibited by geminivirus and beta satellite proteins.

Figure 1.4 The expanded SnRK family in Arabidopsis. Arabidopsis encodes 10

SnRK2 -subunits and 25 SnRK3 -subunits, which together with SnRK1 make the large SnRK family of 37 members. SnRK2 and SnRK3 are unique to plants and cannot complement yeast snf1 mutant, which clearly distinguishes them from the AMPK/SNF1/SnRK1/ subgroup. Arabidopsis encodes two SnRK1  subunits, SnRK1.1 and SnRK1.2. SnRK1.3 gene is not expressed. From Nigel G.

Halford and Sandra J. Hey (2009) Biochemical Journal. 419, 247-259.

Figure 1.4 The expanded SnRK family in Arabidopsis. 46

Figure 1.5 Direct effects of SnRK1 on metabolic pathways. The diagram depicts key metabolic enzymes that are phosphorylated by SnRK1. SnRK1 phosphorylates HMG-CoA reductase, which catalyzes the NADH-dependent reduction of HMG-CoA to mevalonic acid. HMG-CoA reductase is the rate-limiting enzyme of the mevalonate pathway that is responsible for the synthesis of steroids and other isoprenoid. SnRK1 also phosphorylates sucrose phosphate synthase (SPS). SPS catalyzes a step in the biosynthesis of sucrose

6-phosphate, in which UDP-glucose and D-fructose 6-phosphate are converted to sucrose

6-phosphate. Nitrate reductase (NR) is another SnRK1 substrate. NR catalyzes the reduction of nitrate (NO3-) to nitrite (NO2-), which is the first step of nitrogen assimilation into amino acids. SnRK1 phosphorylates trehalose phosphate synthase 5 (TPS5), an enzyme in the synthesis pathway of trehalose-6-phosphate (T6P). T6P is a signaling sugar that regulates plant metabolism and development. SnRK1 also phosphorylates Arabidopsis

6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (AtF2KP). F2KP catalyzes a reversible reaction that converts ATP and fructose 6-phosphate (fru-6-P) to ADP and fructose 2,6-bisphosphate (fru-2,6-P). Similar to T6P, fru-2,6-P is also a signaling metabolite that plays an important role in photosynthetic carbon partitioning. HMG-CoA reductase exists in fungi, plants and animals, but SPS, NR, F2KP and T6P are unique to plants. From Nigel G. Halford and Sandra J. Hey (2009) Biochemical Journal. Continued

Continued

Figure 1.5

Figure 1.5 Direct effects of SnRK1 on metabolic pathways.

Figure 1.6 Eukaryotic translation initiation complex. The eIF4E complex consists of the cap binding protein eIF4E and scaffold protein eIF4G (also eIF(iso)4E and eIF(iso)4G in plants). eIF4G also interacts with poly-A binding protein (PABP) to circularize mRNAs, with eIF4A helicase to remove secondary structure in mRNAs, and with eIF3, a multisubunit complex that binds the 40 S ribosomal subunit. From Rhoads, R. E. et al. Mechanism and regulation of translation in C. elegans, 2006, The C. elegans Research

Community, WormBook, doi/10.1895/wormbook.1.63.1.

Figure 1.6 Eukaryotic translation initiation complex.

Table 1.1 eIF4E and eIF(iso)4E are key factors for recessive viral resistance

Host Allele Gene Virus (Genus; Family) pvr2 eIF4E Pepper veinal mottle virus (PVMV, Potyvirus ) Capsicum annuum pvr2 eIF4E Potato virus Y (PVY, Potyvirus) pvr2 eIF4E Tobacco etch virus (TEV, Potyvirus ) pvr1 eIF4E Pepper mottle virus (PepMoV, Potyvirus ) Capsicum chinense pvr1 eIF4E Potato virus Y (PVY, Potyvirus ) pvr1 eIF4E Tobacco etch virus (TEV, Potyvirus ) Cucumis melo nsv eIF4E Melon necrotic spot virus (MNSV, Carmovirus) Hordeum vulgare rym 4, rym 5 eIF4E Barley mild mosaic virus (BaMMV, Bymovirus) rym 4, rym 5 eIF4E Barley yellow mosaic virus (BaYMV, Bymovirus) Pisum sativum sbm1 eIF4E Pea seed borne mosaic virus (PSbMV, Potyvirus ) sbm1 eIF4E Bean yellow mosaic virus (BYMV, Potyvirus ) Solanum hirsutum pot-1 eIF4E Potato virus Y (PVY, Potyvirus ) pot-1 eIF4E Tobacco etch virus (TEV, Potyvirus ) lsp1 eIF(iso)4E Tobacco etch virus (TEV, Potyvirus ) Arabidopsis thaliana lsp1 eIF(iso)4E Turnip mosaic virus (TuMV, Potyvirus) lsp1 eIF(iso)4E Lettuce mosaic virus (LMV, Potyvirus)

2 CHAPTER 2: Arabidopsis SnRK1 Interacts with and

phosphorylates translation initiation factors 4E and iso4E

2.1 Introduction

Plant SnRK1 (SNF1-related protein kinase) is a type of serine/threonine kinase that functions as a key cellular energy sensor to maintain energy homeostasis and regulate metabolism (for review, see (Bishop, et al. 2007)). Plant SnRK1 belongs to a conserved kinase family which also includes mammalian AMPK (AMP-activated protein kinase) and yeast SNF1 (sucrose non-fermenting 1). The AMPK/SNF1/SnRK1 kinases are heterotrimeric complexes in vivo, consisting of a catalytic -subunit, and  and  regulatory subunits. The -subunit contains a highly conserved N-terminal kinase domain

(KD) and a more variable C-terminal regulatory domain (RD). The AMPK/SNF1/SnRK1 family kinases are activated in response to deficiencies in cellular energy, although the activation mechanism differs between family members. Mammalian AMPK, for example, is allosterically activated by the binding of AMP, an indicator of low cellular energy status.

Yeast SNF1 is activated by glucose starvation, and activation of SNF1 is required for yeast cells to utilize other carbon sources (Celenza, et al. 1986). Current evidence indicates that

the activation of plant SnRK1 is more complicated, but unlike the animal and yeast orthologs, the key regulator that triggers SnRK1 activation has not yet been determined.

However, SnRK1 activity is maintained by AMP and antagonized by ATP. In addition,

AMP has been reported to prevent phosphatase-mediated inactivation of activated SnRK1.

Plant SnRK1 plays critical roles in regulating metabolism and integrating stress signals.

SnRK1 directly phosphorylates and inactivates key enzymes in multiple biosynthetic pathways, including HMG-CoA reductase (steroid and isoprenoid synthesis), sucrose phosphate synthase (sucrose synthesis), and nitrate reductase (nitrogen assimilation).

SnRK1 also phosphorylates trehalose-phosphate synthase (TPS) and

6-phosphofructo-2-kinase/fructose-2.6-bisphosphatase (F2KP), two enzymes involved in sugar signaling pathways. TPS catalyzes the synthesis reaction of trehalose-6-phosphate

(T6P), a signaling sugar that regulates plant metabolism and development. F2KP catalyzes a reversible reaction that converts ATP and fructose 6-phosphate (fru-6-P) to ADP and fructose 2,6-bisphosphate (fru-2,6-P). Similar to T6P, fru-2,6-P is also a signaling metabolite that plays an important role in photosynthetic carbon partitioning. SnRK1 phosphorylates TPS and F2KP suggests a role of SnRK1 in sugar signaling networks. In addition to direct phosphorylation, SnRK1 regulates metabolism by triggering large-scale transcriptional reprograming, which includes increased expression of a broad spectrum of

catabolism-related genes, and reduced transcription of anabolism-related genes.

Interestingly, SnRK1 has also been shown be a a component of innate antiviral defenses effective against both DNA and RNA viruses, including the geminiviruses TGMV, BCTV and TYLCCNV, and the RNA virus Tobacco mosaic virus (TMV). To antagonize this defense, geminivirus pathogenicity factors TGMV AL2 and BCTV L2 interact with and inactivate SnRK1. Although metabolic reprograming induced by SnRK1 is a possible cause of antiviral defense, the detailed mechanism has yet been determined. Despite the fact that SnRK1 has a plethora of targets, none of those described to date seem to be directly associated with the antiviral activity of SnRK1. In this chapter, using a reconstructed yeast system with Arabidopsis proteins, we describe a translational control mechanism mediated by SnRK1. This novel mechanism could be responsible for the antiviral activity of SnRK1.

Translation initiation factor eIF4E is an m7GpppN cap binding protein that facilitates the loading of 40S ribosomal subunit onto mRNA, thus regulating the rate-limiting step for protein synthesis. eIF4E associates with translation initiation factors eIF4G and eIF4A to form an eIF4F complex. This complex recruits a ternary complex including a Met-tRNA, the 40S ribosomal subunit, eIF2 and GTP to mRNA, thus forming the 43S pre-initiation complex. According to the scanning model, when the mRNA is incorporated with 43S

pre-initiation complex, the pre-initiation complex scans the first AUG codon by matching

Met-tRNA with AUG. After reaching the AUG codon, translation initiation factors detach from the 40S ribosome subunit, allowing the 60S ribosome subunit to join the 40S to form an active ribosome. eIF4E is essential for translation. In yeast, there is only one eIF4E gene called CDC33 in the genome. Deletion of CDC33 results in cell death, while a specific single amino acid substitution has been shown to cause temperature sensitive phenotype. In addition to eIF4F, flowering plants have an additional eIF4F complex called eIF(iso)F, which is composed of eIF(iso)4E and eIF(iso)4G (Allen, et al. 1992). The complementation of yeast cdc33 mutant by both Arabidopsis eIF4E and eIF(iso)4E suggests similar or overlapping functions for Arabidopsis eIF4E and eIF(iso)4E. eIF4E is a low abundance translation initiation factor, making eIF4E activity an important target for translational control. One mechanism of regulating mammalian eIF4E is through eIF4e-binding proteins (4E-BP) which serve as translation initiation repressors. 4E-BPs form inhibitory heterodimers with eIF4E, competing with eIF4G for a common binding site on eIF4E. The 4EBP-eIF4E affinity decreases when 4E-BP is phosphorylated by mammalian target of rapamycin (mTOR), leading to dissociation of the heterodimer allowing binding of eIF4G to eIF4E to form the functional eIF4F complex (Cencic, et al.

2011). A second mechanism of regulation is through eIF4E phosphorylation. For example, human eIF4E is phosphorylated by kinases MNK1/2 (MAP kinase-interacting serine/threonine-protein kinase 1/2) at serine 209 (S209), and this correlates with increased translation. Phosphorylation of eIF4E by MNK1 requires the recruitment of MNK1 to the eIF4G C-terminal motif (Pyronnet, et al. 1999).

In plants, mechanisms regulating eIF4E are largely unknown. 4E-BP inhibits the binding of eIF4G to eIF4E in animals, but this mechanism has not been found in plants. There is no firm evidence that 4E-BP homologues exist in plant genomes, and 4E-BP activity has not been detected in plant cells. Instead, phosphorylation of plant eIF4E may play a significant role in regulating eIF4E function. To support this hypothesis, multiple phosphorylation states of eIF4E and iso4E have been detected in various plant species in vivo (Gallie, et al.

1997, Manjunath, et al. 1999). Interestingly, phosphorylation of eIF4E in maize root was enhanced in response to oxygen deprivation (Manjunath, et al. 1999). Although eIF4E is a highly conserved protein, phosphorylation may play different roles in regulating plant eIF4E. First, the phosphorylation residue S209 on mammalian eIF4E is absent from plant eIF4E/iso4E (Figure 2.1). Second, plants lack homologues of mammalian MNK1/2. And third, plant eIF4G and iso4G lack a C-terminal motif for MNK1 binding. These results suggest that plant eIF4E must be phosphorylated by different kinases at different sites, and

possibly with different consequences. The kinases responsible for eIF4E phosphorylation in plants have yet to be discovered. However, it has been shown that protein kinase CK2 does not phosphorylate Arabidopsis eIF4E or iso4E in vitro (Dennis, et al. 2009).

In this chapter, we provide the first evidence for a translational control mechanism via eIF4E phosphorylation. We have evidence that Arabidopsis SnRK1 phosphorylates eIF4E/iso4E in vitro at two consensus sites. The phosphorylation of Arabidopsis eIF4E/iso4E leads to reduced polysome formation, indicating a repressed translation rate.

2.2 Results

2.2.1 Arabidopsis eIF4E and eIF(iso)4E contain two SnRK1 consensus sites

Sequence analysis of Arabidopsis eIF4E and iso4E amino acid sequence revealed two

potential conserved AMPK/SNF1/SnRK1 consensus sites. Because the consensus site of

AMPK/SNF1/SnRK1 family is evolutionarily conserved, the presence of two consensus

sites on eIF4E and iso4E suggests they may be SnRK1 substrates. Further, these two sites

are also highly conserved in eIF4E proteins of flowering plants, the moss Physcomitrella

patens, the green algae Chlamydomonas reinhardtii, yeast Saccharomyces cerevisiae and

many invertebrates including Drosophila melanogaster and C. elegans. Interestingly,

although high conservation of the consensus sequence was also found in human, mouse

and bird eIF4E, the amino acids at the corresponding phosphorylation sites are nonphosphorylatable (Figure 2.1A). The crystal structure of wheat eIF4E has been published (Baena-Gonzalez, et al. 2008), and there is a high degree of similarity between wheat and Arabidopsis eIF4E protein sequences. Therefore we used wheat eIF4E structure as a model to show the position of the two predicted phosphorylation sites. This model suggests both residues are on the surface of the protein, and therefore accessible to kinases (Figure 2.1B). These sequence studies suggested that Arabidopsis eIF4E and iso4E are novel SnRK1 substrates, thus we tested whether SnRK1 phosphorylates eIF4E and iso4E in vitro.

2.2.2 SnRK1-KD phosphorylates eIF(iso)4E in vitro

We then investigated the phosphorylation of recombinant eIF4E/iso4E proteins by

SnRK1. SnRK1 kinase domain (SnRK1-KD) and kinase-inactive mutant KD-K49R

(SnRK1-KDKR)，containing an arginine for lysine substitution in the ATP binding site, were expressed and in N benthamiana leaf cells from a TMV based TRBO vector to

generate N-terminal HA2His6-tagged recombinant proteins (Hao, et al. 2003, Lindbo

2007). Arabidopsis eIF(iso)4E was expressed in E. coli BL21 cells from a pRSET vector as an His6-Xpress fused protein. Both SnRK1-KD and eIF(iso)4E proteins were purified by Ni-NTA chromatography. Approximately 0.1 g of SnRK1-KD was incubated with

0.1 g of substrate protein and 5 Ci of γ32P-ATP at 30˚C for 30 min. Proteins were then fractionated on 15% SDS-PAGE gels and exposed to a phosphor screen to detect 32P incorporation. A SAMS peptide (HMRSAMSGLHLVKRR) fused to glutathione-S-transferase (GST) has been previously used as a substrate to measure kinase activity of the AMPK/SNF1/SnRK1 family (Mohannath, et al. 2014, Davies, et al.

1989, Kishimoto, et al. 2006), and was used as a positive control in this experiment.

Incubation of SnRK1-KD alone with γ32P-ATP showed only an auto-phosphorylation signal and suggested a clean background. Incubation of GST-SAMS with SnRK1-KD resulted in strong phosphorylation of GST-SAMS, indicating SnRK1-KD was active

(Figure 2.2A). Phosphorylation of GST-SAMS incubated with SnRK1-KDKR and

γ32P-ATP was not detectable, confirming SnRK1-KDKR lacks activity. 32P-labeled substrate protein was detected when SnRK1-KD was incubated with Arabidopsis eIF(iso)4E, but not with the control protein GST, suggesting phosphorylation of eIF(iso)4E by SnRK1-KD is specific (Figure 2.2A, B).

2.2.3 SnRK1 phosphorylates eIF(iso)4E at S33 and T55

In order to validate that SnRK1 phosphorylates eIF4E/iso4E at the two consensus sites, we tested whether mutations in the target serine/threonine residues affect phosphorylation.

These eIF4E/iso4E mutants include an alanine substitution at either one of the two

targeted residues (S33A and T55A in eIF(iso)4E), or substitutions at both residues (AA).

The in vitro SnRK1 kinase assay with these proteins showed decreased phosphorylation of S33A and T55A and a nearly complete reduction of AA mutant phosphorylation

(Figure 2.2C, D and Table 2.3), suggesting mutations at these targeted sites blocked in vitro phosphorylation by SnRK1.

Because human eIF4E has no phosphorylatable residues in the predicted SnRK1 consensus region, we predicted that SnRK1-KD cannot phosphorylate human eIF4E, and performed an in vitro kinase assay with SnRK1-KD and human eIF4E to test this hypothesis. As expected, incubation of SnRK1-KD and His6-Xpress-fused Arabidopsis eIFiso4E resulted in a radioactive labeled band at corresponding migration position.

However, His6-Xpress-fused human eIF4E was not radioactively labeled after incubation with SnRK1-KD, indicating SnRK1 does not phosphorylate human eIF4E in vitro (Figure

2.2A).

2.2.4 Arabidopsis eIF4E and eIF(iso)4E physically interact with SnRK1 in yeast

two-hybrid assays

We reasoned that since SnRK1 phosphorylates eIF4E/iso4E in vitro, a direct physical interaction between them might be detected by standard techniques for protein-protein binding, such as yeast two-hybrid assay, co-immunoprecipitation (co-IP) or bimolecular 59

fluorescence complementation assay (BiFC). We first tested the interaction in the yeast two-hybrid system. Interactions are indicated by robust growth of yeast cells on synthetic medium lacking leucine, tryptophan, histidine or adenine, when cells co-expressed full-length SnRK1 and eIF4E/iso4E from bait (pAS2, TRP1) and prey (pACT2, LEU2) constructs (Figure 2.3). SnRK1-AL2 served as a positive control (Wang, et al. 2003).

Cells expressing DCL4 and DRB4 were included as a positive interaction control

(Nakazawa, et al. 2007), and neither of these control proteins exhibited an interaction with SnRK1 or eIF4E/iso4E. These results indicate that Arabidopsis eIF4E/iso4E and

SnRK1 specifically interact in yeast cells (Figure 2.3).

2.2.5 SnRK1 co- immunoprecipitates with eIF(iso)4E

Protein interactions were confirmed by a co-immunoprecipitation (co-IP) experiment.

FLAG tagged SnRK1 and HA2-HIS6 tagged eIF(iso)4E were transiently co-expressed in

N. benthamiana leaf cells using the TRBO vector. Total proteins were released from leaf cells and homogenized in RIPA buffer, and extracts were incubated with -FLAG antibody and protein-G sepharose beads to bind immune complexes. Western blot analysis of immunoprecipitates showed that -FLAG precipitated FLAG-SnRK1, as

expected. A signal corresponding to HA2HIS6-iso4E was also detected by -HA antibody, indicating these proteins physically associate in plant cells (Figure 2.4). As a negative

control, protein extracts were also incubated with general rabbit IgG, and neither

FLAG-SnRK1 nor HA2HIS6-iso4E were detected by western blot, suggesting the

SnRK1-eIFiso4E interaction is specific.

2.2.6 SnRK1 interacts with eIF4E/iso4E in the cytoplasm of plant cells

Yeast two-hybrid assay and co-IP experiments suggested physical association between

SnRK1 and eIF4E/iso4E, however, these experiments did not indicate the location of the interaction. To answer this question, we performed BiFC assays. In this method, constructs expressing SnRK1, eIF4e/iso4E and control proteins AL2, DCL4 and DRB4, were each fused to the N- or C-terminal portions of yellow fluorescent protein (YFP) and introduced into N. benthamiana leaf cells by agroinfiltration (Mohannath, et al. 2014).

Cells expressing oppositely tagged proteins (YN and YC fusion proteins) were viewed under a confocal microscope 48 h later. Association of interacting partners reconstitutes

YFP, resulting in fluorescence which indicates interaction and reveals where the interacting proteins accumulate in the cell. Histone H2B fused to red fluorescent protein

(RFP-H2B) served as a nuclear marker (Mohannath, et al. 2014, Raja, et al. 2014). We observed that full-length SnRK1 forms complexes with eIF4E and iso4E in the cytoplasm, although a previous study suggested that SnRK1 and eIF4E/iso4E were both cytoplasmic and nuclear proteins. As expected, SnRK1 and AL2 interact in both the nucleus and the

cytoplasm (Figure 2.5). DCL4 and DRB4 also interact in the nucleus and cytoplasm, but

DCL4 does not interact with SnRK1 or eIF4E (Figure 2.5).

2.2.7 Arabidopsis eIF4E and iso4E complement a yeast null mutant

Because eIF4E is an essential gene for translation in yeast cells, deletion of the yeast eIF4E gene (CDC33) is lethal (Brenner, et al. 1988). Constitutive expression of

Arabidopsis eIF4E/iso4E and human eIF4E has been shown to complement yeast mutants with defective eIF4E, however At(iso)4E complemented cells grew slowly (Rodriguez, et al. 1998). In this experiment, Arabidopsis eIF4E/iso4E and human eIF4E were cloned into the yeast centromere plasmid pRS413 (His3 marker) with a constitutive promoter

(glyceraldehyde-3-phosphate dehydrogenase gene promoter, GPD promoter) and a PGK1 terminator. Yeast S. cerevieiae haploid strain Jo56 with a disrupted eIF4E gene (cdc33) was kindly provided by Dr. John McCarthy at University of Warwick, United Kingdom.

This Jo56 strain is an eIF4E null mutant and its survival is maintained by the plasmid pYCpTrp-hu4E, harboring a human eIF4E gene under the control of a GPD promoter

(Hughes, et al. 1999). The Jo56 strain is not ideal for a complementation test because human eIF4E expression cannot be switched on and off. To regenerate a yeast eIF4E null mutant strain for our study, plasmid YCpSupex-hu4E (URA3 marker) was introduced into Jo56, resulting in strain Jo55.5 (workflow is summarized in Figure 2.6). The

YCpSupex-hu4E plasmid harbors a human eIF4E gene under the control of a galactose inducible promoter. The strain Jo55.5 was then selected on Synthetic Drop-out (SD) media with 2.5 M 5-fluoroanthranilic acid (5-FAA) to eliminate the plasmid pYCpTrp-hu4E, resulting in strain Jo55 (German-Retana, et al. 2008). Expression of human eIF4E from plasmid YCpSupex-hu4E in Jo55 cells is induced by galactose and repressed by glucose. Therefore, Jo55 cells grow well in galactose media, but stop growing in glucose media unless translation is restored by another exogenous eIF4E.

To confirm yeast complementation by Arabidopsis eIF4E/iso4E, plasmid pRS413 containing Arabidopsis eIF4E (At4E), eIFiso4E (Atiso4E), or human eIF4E (hu4E) was transformed into Jo55, and transformants were selected on SD glucose medium lacking histidine and uracil (SD-His-Ura+Glucose). The growth of these transformants on selection plates indicates yeast complementation. After 3 days, yeast cells containing

At4E or hu4E developed colonies, while colonies of transformants with At(iso)4E were apparently visible after 5 days (Figure 2.7). This was consistent with previous reports, suggesting At4E/iso4E and hu4E complement yeast cdc33, although Atiso4E exhibited weaker complementation.

The complementation assays were also performed with a temperature sensitive (ts) yeast mutant, whose eIF4E gene contains a single amino acid substitution at glutamate 72

(E72G). This ts mutant grows normally at 29°C , but arrests growth in the G1-phase at non-permissive temperature (37°C ). Consistent with previous results, both At4E/iso4E and hu4E supported the ts mutant growth at 37°C (data not shown).

In summary, the complementation experiments suggested that AteIF4E and iso4E were functional in yeast cells. This will allow us to use the yeast model system to study

Arabidopsis eIF4E/iso4E, and results should have biological relevance.

2.2.8 At4E/iso4E phosphomimic mutants failed

strain

We hypothesize that phosphorylation of At4E/iso4E at S33/T55 has biological significance, thus mutations on these residues may have some impact on eIF4E function in regards to yeast complementation. To determine the consequences of eIF4E/iso4E phosphorylation, we tested wild-type At4E/iso4E, SnRK1-insensitive mutants (S/T-A or

S/T-V), and phosphorylation mimics created by replacing the target serine/threonine with aspartate (S/T-D). However, we could not clone the eIF4E double-aspartate mutant (DD), despite trying many different methods. An empty RS413 plasmid served as a negative control. As expected, wild-type At4E/iso4E maintained yeast cdc33growth (Figure 2.8, section 1), while empty vector did not complement (Figure 2.8, section 8). Phosphomimic mutant At4E T67D or iso4E S33D failed to complement yeast cdc33Figure 64

2.8section 3, indicating aspartate substitution at the first SnRK1 phosphorylation site

(4E T67 or iso4E S33) destroyed 4E function. Surprisingly, alanine substitution at the first SnRK1-phosphorylation site (At4E T67A or iso4E S33A) abolished yeast complementation as well (Figure 2.8, section 2). However, substitution of serine with valine (eIF4E S33V), which is also insensitive to SnRK1, allowed complementation of cdc33, in a manner similar to that of wild-type At4E (Figure 2.9). These results highlight the sensitivity of the first site to mutations. In contrast, substitution of the second threonine with aspartate or alanine (4E T55A/D, iso4E T91A/D) has no significant impact on complementation (Figure 2.8, section 4 and 5), suggesting the second SnRK1 phosphorylation site is not critical for 4E function. When substituting the first SnRK1 phosphorylation site with valine and the second site with alanine (At4E-VA), the At4E VA mutant still complement cdc33 strain (data not shown). In contrast, the double aspartate substitution (DD) abolished complementation (Figure 2.8, section 7).

To summarize the mutation analysis, aspartate substitution of the first SnRK1 phosphorylation site blocked complementation, while valine substitution did not disrupt complementation. Mutations at the second SnRK1 phosphorylation site of At4E/iso4E had little effect on yeast growth. The results are summarized in Table 2.4.

2.2.9 SnRK1-KD inhibits yeast growth

We showed SnRK1 interacts with At4E/iso4E and phosphorylates iso4E, and further that phosphomimic mutations at the first SnRK1 site of At4E/iso4E blocked yeast complementation. These observations suggest phosphorylation of At4E/iso4E by SnRK1 may be inhibitory to 4E function. Thus expression of SnRK1 in the yeast Jo55 cells maintained by At4E/iso4E (Jo55-At4E/iso4E-KD) may result in phosphorylation of

At4E/iso4E which may lead to translational inhibition and growth defects.

In an initial experiment, we assessed the activity of SnRK1-KD/KDKR in yeast cells by testing their ability to complement snf1 yeast. Because SNF1 is the key factor responsible for yeast cells to utilize non-glucose carbon source (such as sucrose, galactose or glycerol), the snf1strain cannot survive in non-glucose media unless SNF1 activity is restored. In this experiment, we tested complementation by Arabidopsis

SnRK1 on galactose plates. Arabidopsis SnRK1-KD/KDKR were cloned into centromere plasmid pRS414 under the control of the copper-inducible promoter CUP1

(pRS414CUP1-KD/KDKR, TRP1 marker). Yeast snf1 cells were transformed with plasmid pRS414CUP1-KD or pRS414CUP1-KDKR, and then selected on

SD-Trp+Glucose plates. The complementation assay was performed in medium

containing 2% galactose and 50 M CuSO4. On glucose plates (SD-Trp+Glucose+CuSO4)

snf1 cells grew equally well, whether they expressed SnRK1-KD or KDKR (Figure

2.10). However, only cells containing plasmid pRS414CUP1-KD grew on galactose

plates (SD-Trp+Galactose+CuSO4), suggesting SnRK1-KD and not KDKR complemented the snf1 mutant (Figure 2.10). This result suggested active SnRK1 kinase domain was synthesized in yeast cells from plasmid pRS414CUP1-KD in

presence of 50 M CuSO4. In a separate experiment, we also examined the activity of the

HA-tagged SnRK1-KD, and found that the HA-tagged SnRK1-KD also robustly complemented (data not shown).

To investigate the hypothesis that SnRK1 phosphorylation inhibits eIF4E/iso4E activity, we generated Jo55 variants co-expressing At4E/iso4E, or At4E-VA mutant, or human 4E with SnRK1-KD/KDKR, and tested the impact of SnRK1-KD expression on yeast growth. The cdc33 strain Jo55 was transformed with an integrative vector RS403 plasmid harboring GPD-driven Arabidopsis eIF4E or iso4E (pRS403GPD-At4E/iso4E,

HIS3 marker), or Arabidopsis eIF4E VA mutant (pRS403GPD-At4E-VA, HIS3 marker), or human eIF4E (pRS403GPD-hu4E, HIS3 marker). The transformants were negatively selected on SD-His media with 5-Fluoroorotic Acid (5-FOA) against plasmid

YCpSupex-hu4E (Figure 2.11). This step eliminated unnecessary plasmids in the yeast cells, thus reducing potential DNA recombination between plasmids. The resultant strains

were named Jo55-At4E, Jo55-iso4E, Jo55-At4E-VA and Jo55-hu4E, respectively. The yeast strains Jo55-At4E/iso4E, Jo55-At4E-VA and Jo55-hu4E were then transformed with pRS414CUP1-KD/KDKR. The transformants were selected on

SD-Trp-His+Glucose medium, and the presence of SnRK1-KD or KDKR was confirmed by colony PCR. The resultant strains are designated Jo55-At4E-KD/KR,

Jo55-iso4E-KD/KR, Jo55-At4E-VA -KD/KR and Jo55-hu4E-KD/KR, respectively. The yeast strains used in this chapter are summarized in Table 2.1.

We next tested the effect of SnRK1 on yeast growth. The strains Jo55-At4E-KD/KDKR,

Jo55-iso4E-KD/KDKR, and Jo55-hu4E-KD/KDKR were grown in SD-Trp+Galactose

medium. SnRK1-KD/KDKR expression was induced by 200 M CuSO4, and the cell

growth in medium containing CuSO4 or without CuSO4 were compared. As shown in

Figure 2.12, yeast strains Jo55-At4E-KD and Jo55-iso4E-KD grew much more slowly when SnRK1-KD expression was induced, while SnRK1-KDKR did not significantly inhibit yeast growth, suggesting growth inhibition requires SnRK1 kinase activity.

Surprisingly, growth of strain Jo55-hu4E-KD was also mildly inhibited when SnRK1-KD expression was induced, but measurement of doubling time indicates that this inhibition is probably weaker compared to the inhibition of strains Jo55-At4E-KD (Table 2.5).

These results indicate that expression of SnRK1-KD significantly inhibited growth of

yeast complemented by Arabidopsis eIF4E/iso4E, but less so with human eIF4E, which lacks SnRK1 sites.

Since high concentrations of copper are toxic to yeast, we further tested the potential effect of copper on growth. Jo55-At4E/iso4E and Jo55-hu4E strains were grown in

SD+Gal medium containing 200 M CuSO4 or without CuSO4. We found that the growth

rate of Jo55-At4E was not significantly inhibited by 200 M CuSO4, ruling out the

possibility that growth inhibition was caused by the toxicity of copper (data not shown).

2.2.10 SnRK1-KD represses polysome formation in an At4E/iso4E-dependent

manner

We showed SnRK1-KD, but not KDKR, strongly inhibited the growth of cdc33 cells complemented by At4E/iso4E. However, growth rate is affected by many different factors, and protein translation is a more direct indication of the effect of At4E/iso4E phosphorylation. To link SnRK1-At4E/iso4E interaction to translational inhibition, we compared the global translational activity in Jo55-At4E/iso4E-KD with

Jo55-At4E-VA-KD or Jo55-hu4E-KD cells. Because SnRK1 cannot phosphorylate

At4E-VA mutant or human 4E, we predict translational activity in Jo55-At4E-VA -KD and Jo55-hu4E-KD cells will not be affected when SnRK1-KD expression is induced.

To measure the global translation rate in yeast cells, polysome profiling experiments were employed to detect mRNA integration into ribosomes. Polysomes indicate the fraction of actively translating mRNA, while non-polysomes (80 S monosomes, 60 S and 40 S subunits) indicate the non-translating mRNA (for review, see (Arava, et al. 2003)).

Therefore the ratio of polyribosomes to non-polysomes (P:NP ratio) reflects cellular translational activity.

Yeast cells were cultured in glucose medium overnight, shifted to galactose medium, and allowed to grow to OD600 0.2-0.3. SnRK1-KD/KDKR expression was induced by 200

M CuSO4 for 8 hours, and cells were then collected for polysome profiling (OD600 ranges from 0.4 to 0.6). As shown in Figure 2.13, in absence of SnRK1-KD, the P:NP ratio in cells containing Jo55-At4E-KD and Jo55-iso4E-KD was 1.28:1 and 0.86:1, respectively. This ratio dropped to 0.56:1 (55.3% reduction) and 0.36:1 (57.6% reduction) after induction of SnRK1-KD (Figure 2.13, Figure 2.15 and Table 2.6). The decreased

P:NP ratio indicates that the ribosomes were shifted from the polysome fraction towards the non-polysomes fraction, suggesting translation initiation in these cells is greatly inhibited. In addition to the decreased P:NP ratio, polysome profiles clearly showed increased 60S/80S peaks. In contrast, P:NP ratio in cells containing Jo55-At4E-KDKR dropped from 1.22:1 to 0.94:1 (17.7% reduction), suggesting SnRK1-KDKR did not

significantly inhibit translation initiation (Figure 2.13 and Figure 2.15). Interestingly, induction of SnRK1-KD in Jo55-At4E-VA-KD cells causes only a 6.2% decrease in the

P:NP ratio (Figure 2.14 and Figure 2.15), which is considerably smaller than the reduction caused by KDKR in Jo55-At4E-KD cells, indicating At4E-VA is not sensitive to SnRK1-KD. Consistent with this observation, Jo55-hu4E-KD cells show only a 18.9% reduction of P/NP ratio (Figure 2.14 and Figure 2.15), indicating human 4E is resistant to

SnRK1-KD as well. The overall shape of polysome profiles of these two yeast strains indicates the 60S/80S peaks does not greatly accumulate, and polysome profile was not significantly altered.

In summary, polysome profiling assays showed that expression of SnRK1-KD inhibited polysome formation and increased 60S and 80S accumulation in cells maintained by

At4E or Atiso4E. However, polysome inhibition was not observed in cells complemented by At4E-VA or human eIF4E. The reduction of polysomes and accumulation of 60S and

80S subunits and monosomes indicated that translation initiation was defective. Because

SnRK1 phosphorylates Arabidopsis eIF4E/iso4E but not Arabidopsis eIF4E-VA or human eIF4E, SnRK1-induced polysome inhibition is dependent on Arabidopsis eIF4E/iso4E, suggesting a link between At4E/iso4E phosphorylation and polysome inhibition. Together, we conclude that SnRK1 suppresses polysome formation via

phosphorylation of Arabidopsis eIF4E/iso4E.

2.3 Discussion

2.3.1 SnRK1 phosphorylates eIF4E/iso4E

Translation initiation factor eIF4E interacts with the m7G cap structure of mRNA and translation initiation factor eIF4G to form the eIF4F complex. Because eIF4E is the least abundant translation initiation factor, processes involving eIF4E are considered a rate-limiting step for translation. In mammals, multiple regulatory mechanisms have been identified to control eIF4E activity. For example, phosphorylation of mammalian eIF4E at S209 by MnK1 positively correlates with translation rate, although the molecular role of eIF4E phosphorylation is still under debate. Animal eIF4E activity can also be regulated by 4E-BPs, however, to date no 4E-BPs have been discovered in plants.

Interestingly, it has been shown that plant eIF4E and the isoform eIF(iso)4E are present as multiply phosphorylated forms in vivo, and their phosphorylation state changes in response to developmental stages and stress conditions (Gallie, et al. 1997, Manjunath, et al. 1999). However, the kinases responsible for the plant eIF4E/iso4E phosphorylation are still unknown. In this study, we provide evidence that Arabidopsis SnRK1 phosphorylates eIF4E/iso4E and inhibits their activity.

The kinase domain of SnRK1 -subunit was transiently expressed from a virus-based vector in N. benthamiana leaves. This plant-expressed SnRK1-KD has robust kinase activity, as indicated by autophosphorylation activity and phosphorylation of a synthetic substrate GST-SAMS. The results of in vitro kinase assays showed that SnRK1-KD phosphorylates bacterially expressed Arabidopsis iso4E. We note that not all serine/threonine kinases phosphorylate eIF4E/iso4E. For example, a previous study showed Arabidopsis protein kinase CK2 (Casein Kinase II), which is also a member of a conserved serine/threonine kinase family, did not phosphorylate eIF4E or iso4E in vitro

(Dennis, et al. 2009). In addition, SnRK1 does not phosphorylate all translation initiation factors containing SnRK1 consensus sites. In our hands, SnRK1 did not phosphorylate eIF2 in vitro, although three SnRK1 consensus sites were predicted (data not shown).

The relationship between Arabidopsis SnRK1 and eIF4E/iso4E was further supported by protein-protein interaction assays. We showed that full-length SnRK1 interacts with eIF4E/iso4E in yeast two-hybrid assays, BiFC assays and co-IP experiments. The physical binding of SnRK1 to eIF4E/iso4E further suggests a functional relationship between these proteins. In addition, the BiFC assays showed that the SnRK1-eIF4E/iso4E complexes were formed in the cytoplasm of N. benthamiana leaf cells. Whether a stable physical interaction is required for SnRK1 to phosphorylate its substrates is not clear,

however, consistent with the result of in vitro kinase assays with eIF2, SnRK1 and eIF2 did not interact in yeast cells (data now shown).

We compared the SnRK1 recognition motif Hyd-X-Basic-X-X-Ser/Thr-X-X-X-Hyd with the sequence of Arabidopsis eIF4E and iso4E. Sequences around Thr91 on eIF4E

(LRPVFTFSTV), or Thr55 on eIF(iso)4E (LRKAYTFDTV), match the SnRK1 recognition motif. However, an eIF(iso)4E mutant that carries an alanine substitution at the Thr55 was still phosphorylated in the SnRK1 kinase assay, suggesting SnRK1 phosphorylates iso4E at other sites too. Sequence analysis revealed another sequence around Thr67 on eIF4E (LEHSWTFWF), or Ser33 on iso4E (LERKWSFWF), that resembles the SnRK1 recognition motif, except the last hydrophobic residue is at the P+3 position instead of P+4. To test which site(s) are true SnRK1 phosphorylation sites, the in vitro assays were performed with three eIF(iso)4E mutants: S33A, T55A, and

S33A/T55A (AA). The results suggested that although the S33A mutant showed reduced phosphorylation, the reduction of AA phosphorylation was even greater, indicating both sites are phosphorylated by SnRK1 in vitro. Sequence comparison of the two SnRK1 recognition motifs on eIF4E/iso4E from various plant species indicated these sequences are highly conserved, implying the two motifs may be critical for eIF4E function.

2.3.2 Role of Arabidopsis eIF4E/iso4E phosphorylation in regulating translation

We analyzed the function of SnRK1-catalyzed eIF4E/iso4E phosphorylation in yeast cells.

We selected yeast for this study because the yeast system has several advantages. The genetic background of yeast cells is relatively simple and has been extensively studied in the past decades. Instead of having 38 SnRK kinases and 3 different subtypes of cap-binding proteins, yeast has only one SNF1 gene and one eIF4E gene (CDC33). Plant

SnRK1 and eIF4E/iso4E complement their respective yeast null mutants, indicating plant

SnRK1 and eIF4E are functional in yeast cells. Thus, the results obtained from our reconstructed yeast system will likely be applicable to plants. Further, we showed that plant SnRK1 and eIF4E interact in yeast two-hybrid assays, indicating plant SnRK1 interacts with eIF4E and may phosphorylate it in yeast cells. Together, yeast provides a robust and convenient model to study the function of SnRK1-catalyzed eIF4E/iso4E phosphorylation.

To analyze the effect of mutations in the SnRK1 phosphorylation sites of eIF4E/iso4E, we tested complementation of a yeast cdc33 mutant with wild-type eIF4E/iso4E, nonphosphorylatable mutants (S/T-A, S/T-V) and phosphomimic mutants (S/T-D). Valine substitution at eIF4E T67 or iso4E S33 did not affect the 4E/iso4E function, while alanine or aspartate substitution at the same site abolished yeast complementation, suggesting

T67/S33 site is very sensitive to mutations and phosphorylation at T67/S33 may inhibit its activity.

We hypothesized that SnRK1-KD phosphorylates AteIF4E/iso4E and inhibits 4E/iso4E activity, leading to translational inhibition and growth defects. Although all the strains

grew more slowly when SnRK1-KD was induced by CuSO4, growth was not equally

inhibited. When SnRK1-KD expression was induced by CuSO4, the doubling time of

Jo55-At4E-KD cells (maintained by Arabidopsis eIF4E) increased 109%, from 4.27 hours to 8.93 hours. In contrast, the doubling time of Jo55-hu4E-KD cells (maintained by human eIF4E) increased only 62%, from 3.29 hours to 5.31 hours. Reduced inhibition of

Jo55-hu4E-KD cell growth by SnRK1 was likely because human eIF4E lacks phosphorylatable residues at the corresponding SnRK1 sites. However, since overexpression of SnRK1-KD still conferred some growth defect in Jo55-hu4E-KD cells, other mechanisms may also contribute. For example, in Arabidopsis, overexpression of

SnRK1 triggers global transcription reprogramming that affects more than 600 genes

(Baena-Gonzalez, et al. 2007). Particularly, SnRK1 inhibits expressions of a wide range of biosynthetic genes, including 30 genes for ribosomal protein synthesis. It is possible that overexpression of SnRK1 in yeast cells also regulates gene expression, thus indirectly inhibiting growth.

SnRK1-KD expression inhibited yeast growth in SD-Trp+Galactose medium, in which both Arabidopsis SnRK1 and yeast SNF1 were activated. In an attempt to avoid the potential crosstalk between endogenous SNF1 and Arabidopsis eIF4E/iso4E, we examined yeast growth in glucose medium (SD-Trp+Glucose), as yeast SNF1 is inactive under this condition. In a previous study by the Dr. Marian Carlson lab, both yeast SNF1 and SNF1-KD activity were rapidly suppressed by glucose, indicated by reduced T-loop phosphorylation and kinase activity (Ruiz, et al. 2012). However no evidence suggested plant SnRK1 or SnRK1-KD could be deactivated by glucose. Therefore, we hypothesize that SnRK1-KD inhibits yeast growth in glucose medium as well. Surprisingly, when

SnRK1-KD expression was induced in Jo55-At4E/iso4E-KD or Jo55-hu4E-KD cells grown in SD-Trp+Glucose medium, their growth rate was not significantly reduced (data not shown). Thus, Arabidopsis SnRK1-KD inhibited yeast growth in galactose but not glucose medium, suggesting that SNF1 and SnRK1 are similarly regulated in yeast with respect to carbon source.

We next showed SnRK1-KD inhibited polysome formation in Jo55-At4E-KD and

Jo55-iso4E-KD cells. Polysome profiles provide valuable insight into in vivo translational status. For example, translation initiation deficiency results in accumulation of 80S monosomes, while deficiency in translation elongation causes polysome accumulation. In

cells with active translation, the P:NP ratio is usually high. In this experiment, the P:NP ratio was greatly decreased upon SnRK1-KD expression in Jo55-At4E-KD and

Jo55-iso4E-KD cells, suggesting the global translation rate was inhibited by SnRK1-KD.

Further, both 60S subunits and 80S monosomes were accumulated in these cells, implying that translation initiation was defective. Expression of SnRK1-KDKR showed no significant inhibition to polysomes, suggesting SnRK1 kinase activity was required for this inhibitory effect. Because SnRK1 interacts with At4E/iso4E both in vitro and in vivo, and phosphorylates eIF(iso)4E in vitro, the SnRK1-induced translation inhibition may be caused by eIF4E/iso4E phosphorylation. To examine the relationship between translation inhibition and eIF4E phosphorylation, Arabidopsis eIF4E-VA and human eIF4E served negative controls to rule out the possibility that translation inhibition was caused by other

SnRK1 activities, since they are not SnRK1 substrates. Indeed, polysomes in

Jo55-At4E-VA-KD or Jo55-hu4E-KD cells were not significantly inhibited after overexpression of SnRK1-KD. These findings suggest that phosphorylation of

Arabidopsis eIF4E/iso4E by SnRK1 inhibits translation initiation.

2.3.3 Importance of eIF4E-mediated translational control

SnRK1 maintains energy homeostasis by inhibiting energy consuming pathways and stimulating energy generating pathways. We discovered Arabidopsis cap binding proteins

eIF4E and iso4E are novel SnRK1 substrates, and phosphorylation of eIF4E/iso4E inhibits translation initiation. Because protein synthesis requires a great amount of

ATP/GTP, shutting down global translation is an effective way to save energy. This novel mechanism is consistent with SnRK1’s role in saving cellular energy. In fact, animal

AMPK indirectly regulates protein synthesis by phosphorylation and inactivation of mammalian target of rapamycin (mTOR), a central regulator of growth and metabolism. mTOR, unlike AMPK, stimulates anabolism, including protein synthesis. One of the major mTOR substrates is 4E-BPs, which function as eIF4E inhibitors. However the lack of 4E-BPs in plants suggests SnRK1 may control translation independent of the mTOR pathway. Our findings provide the first evidence that SnRK1 directly controls protein synthesis by phosphorylating eIF4E/iso4E.

In addition to functioning as an energy sensor and metabolic regulator, SnRK1 is also a component of an innate antiviral defense effective against both DNA and RNA viruses, including the geminiviruses TGMV and BCTV, and the tobamovirus TMV. Further, the

TGMV AL2 protein, and BCTV L2, were shown to interact with and inactivate SnRK1 as a counterdefense. However, the mechanism of SnRK1’s role in antiviral defense is not known, although SnRK1 has a plethora of targets. Our discovery that phosphorylation of eIF4E/iso4E by SnRK1 inhibits translation provides a possibility that eIF4E-mediated

translational control represents a novel antiviral defense mechanism in plants.

2.4 Materials and Methods

2.4.1 Gene cloning

The SnRK1.2 cDNA was cloned as previously described. The cDNA of eIF4E and iso4E were ordered from Arabidopsis Biological Resource Center (ABRC, Columbus, Ohio).

The clone number for eIF4E and iso4E cDNA is U12635 and U16070, respectively. eIF4E was amplified by PCR using the forward primer 5'-

CTTAATTAACGCCATGGCGGTAGAAGACACT and the reverse primer 5'-

CGGCGCGCCCAGCGGTGTAAGCGTTCTTTGC. eIF(iso)4E was amplified by PCR using the forward primer 5'- CTTAATTAAGGCCATGGCGACCGATGATG and the reverse primer 5'- CGGCGCGCCCGACAGTGAACCGGCTTCTTC. The SnRK1.2 gene was amplified by PCR using the forward primer 5'-

CTTAATTAACATGGATCATTCATCAAATAG and the reverse primer

5'-CGGCGCGCCGATCACACGAAGCTCTGTAAG. In the primer sequences provided, recognition sequences for the restriction endonucleases Pac1 and Asc1 are underlined.

The PCR products were digested with PacI and AscI, and ligated into pUC18 plasmids.

These genes were then subcloned into other vectors, such as pRSET, TRBO vectors

pJL50, pJL51, and yeast expression vectors pRS413, pRS403 and pRS414 using Pac1 and Asc1.

2.4.2 Preparation of SnRK1-KD and SnRK1-KDKR proteins

SnRK1-KD and SnRK1-KDKR were cloned into pJL50 vector (TRBO vector), a

Tobacco Mosaic Virus (TMV) based overexpression vector to generate N-terminal double

hemagglutinin peptide-six histidine (HA2His6)-tagged proteins (Lindbo 2007, Lindbo

2007). The plasmids were transformed into A. tumefaciens C58C1, and cultures of these transformants were used to infiltrate N. benthamiana leaves as described (Mohannath, et al. 2014). Infiltrated leaf tissue was collected about 5 days post-infiltration and ~2 g of tissue was ground in liquid nitrogen. The powder was then homogenized in 10-20 ml of lysis buffer at 4°C for about 15 min. Lysis buffer contains 50 mM HEPES (pH 7.5), 0.1%

Triton X100, 10 mM MgCl2, 1 mM EGTA, 1 mM benzamidine, 10 M

MG132-proteasomal inhibitor (Sigma-Aldrich, C2211-5MG), plant protease inhibitor cocktail (Sigma-Aldrich, P9599), 5 mM β-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride (PMSF, Sigma-Aldrich, P7626), 50 mM NaF and 5 mM

Na3VO4 (Sigma-Aldrich, S6508). The powder could also be stored at -80°C for future use and kinase activity was not noticeably decreased for at least one month. The solution was then filtered through miracloth and centrifuged at 12,000 rpm for 20 min at 4°C.

Supernatant was then added to 0.5 ml of balanced nickel nitrilotriacetic acid agarose column (Ni-NTA agarose, Invitrogen, R90115) and incubated at 4°C on a rocker for 2 to

3 hours. Column was washed with 10 ml of wash buffer containing 50 mM NaH2PO4 (pH

8.0), 100 mM NaCl, 0.1% (v/v) Tween 20, 5 mM β-mercaptoethanol, 20 mM imidazole.

Proteins were eluted with 3 ml elution buffer containing 50 mM NaH2PO4 (pH 8.0), 100 mM NaCl, 0.1% (v/v) Tween 20, 1 mM DTT, 10% (v/v) glycerol, 250 mM imidazole at

4°C. Protein concentration was measured using the Bradford assay (Bio-Rad), and also be estimated in SDS-polyacrylamide (SDS-PAGE) gel followed by coomassie brilliant blue staining.

2.4.3 Expression and purification of SnRK1 substrate proteins in E. coli cells

Arabidopsis eIF4E, eIF(iso)4E, DRB3 and DRB4 genes were cloned into pRSET-B

vector (Invitrogen), a bacterial expression vector containing His6-Xpress tags. These plasmids were transformed into E. coli BL21 cells. Protein expression was induced for 4 hours at room temperature by 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG,

Gold Biotechnology, I2481C). Cells were collected and lysed by sonication in lysis buffer

(10 ml lysis buffer for 500 ml of cell culture; PBS, 200 mM NaCl, 5 mM EDTA (pH8.0),

1% NP40, 5 mM β-mercaptoethanol, 1 mM PMSF, 1 mg/ml lysozyme, 10 mM imidazole, protease inhibitors (Sigma-Aldrich)). DNA and RNA were digested by 1 g/ml DNaseI

and 1 g/ml RNaseA for 15 min at 4°C. Crude extract was centrifuged at 12000 rpm for

20 min at 4°C. Supernatant was incubated with 0.5 ml of Ni-NTA column (Invitrogen,

R901-15) for 1 hour at 4°C. Ni-NTA column was washed with 10 ml of wash buffer containing PBS, 200 mM NaCl, 5 mM EDTA, 20 mM imidazole and 1% NP40. Proteins were eluted with 2 ml of elution buffer containing 50 mM Tris (pH 8.0), 100 mM NaCl, 1 mM PMSF, 1 mM DTT, 10% (v/v) glycerol, and 250 mM imidazole at 4°C. Protein concentration was measured using the Bradford assay (Bio-Rad), and also estimated in

SDS-PAGE gel followed by coomassie brilliant blue staining.

Plasmids for GST and GST-SMAS expression were transformed into E. coli BL21 cells.

Expression of these proteins was induced by 0.5 mM IPTG at 37°C for 3 hours. Cells were collected from 500 ml of culture and lysed by sonication in 10 ml of lysis buffer containing PBS, 100 mM NaCl, 5 mM EDTA (pH8.0), 1% NP40, 1 mM PMSF, 10 mM

DTT, 1 mg/ml lysozyme, 10 mM imidazole, Sigma protease inhibitors. DNA and RNA were digested by 1 g/ml DNaseI and 1 g/ml RNaseA for 15 min at 4°C. Crude extract was centrifuged at 12000 rpm for 20 min at 4°C. Supernatant was incubated with 0.5 ml of glutathione agarose column (clontech, 635607) for 1 hour at 4 °C. Column was washed by 6 ml of wash buffer containing PBS, 100 mM NaCl, 5 mM EDTA, and 1% NP40.

Proteins were eluted with 2 ml of elution buffer (25 mM reduced glutathione, 50 mM

Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM PMSF, 1 mM DTT, 10% (v/v) glycerol) at 4°C.

2.4.4 Western blot

Protein extracts were separated by discontinuous SDS-PAGE gel (stacking gel contains

5% acrylamide buffered at pH 8.8; separation gel contains 10-15% acrylamide buffered at pH 6.8). Proteins were transferred to immunoblot PVDF membrane (Bio-Rad, 162-0177) at 400 mA for 0.5 hour. The PVDF membrane was incubated at room temperature with blocking solution containing 1X TBS, 1% Tween 20, 5% non-fat milk for 1 hour. The membrane was then incubated at room temperature for 1 hour, or at 4°C overnight, with blocking solution containing one of the following primary antibodies: anti-GST antibody produced in rabbit (Sigma-Aldrich, G7781) was used at 1:2000 dilution; anti-FLAG antibody produced in mouse (Sigma-Aldrich, F3185) was used at 1:2000 dilution; anti-Xpress antibody produced in mouse (Life technologies, R910-25) was used at 1:5000 dilution; anti-His antibody produced in mouse (Santa Cruz Biotechnology, sc-8036) was used at 1:100 dilution; anti-HA-HRP antibody (Sigma-Aldrich, H6533) was used at 1:5000 dilution. The PVDF membrane was washed three times with TBST buffer (TBS, 1%

Tween 20) for 5-10 min each. The PVDF membrane was then incubated with blocking buffers containing one of the following secondary antibodies: anti-rabbit IgG-HRP (Santa

Cruz Biotechnology, sc-2006) was used at 1:4000 dilution; anti-mouse IgG-HRP

(Sigma-Aldrich, A5906) at 1:5000 dilution. After incubation with secondary antibody for

45 min at room temperature, the PVDF membranes were washed three times with TBST buffer for 5-10 min each. Detection was performed using 0.6 ml of SuperSignal West Pico chemiluminescent substrate (Thermo Scientific, 34080).

2.4.5 SnRK1 kinase assay

10 to 15 ng of SnRK1-KD or SnRK1-KDKR, 3 µg of substrate proteins and 0.5 l of

-32P-ATP (3000 Ci/mmol, Perkin Elmer) were mixed in 20 l reaction buffer (50 mM

° Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM DTT, 1% Triton X-100) and incubated at 30 C for

30 min. -32P-ATP labeled proteins were separated by electrophoresis on SDS–PAGE gels and the radioactive signal was recorded using a phosphorimager (Bio-Rad). Radioactivity images were generated by a Bio-RAD Personal Molecular Imager System (PMI) or a GE

Typhoon 8600 System. Phosphorylation signal values (in arbitrary units) were obtained by measuring signal intensity of bands on the phosphor image using Bio-Rad Quantity

One software or GE Typhoon software.

2.4.6 Site-directed mutagenesis for Arabidopsis eIF4E and iso4E

The site-directed mutagenesis protocol was based on the method of Stratagene

QuickChange site-directed mutagenesis protocol (Agilent Technologies, 200518).

Arabidopsis eIF4E and eIF(iso)4E were cloned into a pUC18 plasmid. The mutagenic primers were synthesized by Eurofins Genomics (oligonucleotide sequence listed in

Table 2.8). The PCR reactions contain 5 l of 10X pfx reaction buffer, 100 ng of dsDNA

template, 2 l of MgSO4 (50 mM), 2 l of oligonucleotide primer F (20 mM), 2 l of oligonucleotide primer R (20 mM), 5 l of dNTP mix (10 mM) and 1 l of pfx polymerase (Platinum Pfx DNA polymerase, Life Technologies, 11708-013) in a total volume of 50 l. The eIF4E/iso4E sites were mutated by mutagenesis PCR following the cycling parameters outlined in Table 2.7. After PCR reaction, add 1 l of the Dpn1 restriction enzyme (10 U/l, NEB, R0176S) directly to each amplification sample, and digest the sample overnight at 37°C to remove the original template plasmids. The digested samples were then ethanol precipitated, and DNA was suspended in 20 l water.

Transform 1 l of Dpn1-treated plasmids into NEB DH10 E. coli competent cells using

1.7 kV electrical pulses. Resuspend the electrically shocked competent cells in 0.5 ml fresh LB medium. Allow the cells to recover in 37°C shaker for 30 min. Grow 20-200 l of the transformed bacteria on LB agar plates containing ampicillin. Plasmids from 8 colonies for each sample were purified and sequenced. The sequencing data suggests about 1/4 of the plasmids have been successfully mutated. The wild-type eIF4E/iso4E and their mutated genes were then subcloned into the yeast expression vectors for further

analysis.

2.4.7 Yeast two-hybrid analysis

The yeast two-hybrid assays were based on Clontech Matchmaker GAL4 Yeast two-hybrid system (Clontech, PT3062-1). The full-length SnRK1, eIF4E, iso4E and control genes were cloned into pAS2 (TRP1 marker) and pACT2 (LEU2 marker) vectors to generate fusion proteins with GAL4 DNA binding domain (BD, bait) or GAL4 activation domain (AD, prey). The pAS2 and pACT2 plasmids containing genes of interest were co-transformed into yeast strain PJ64-9a cells using Zymo Research

Frozen-EZ Yeast Transformation II Kit (T2001). The transformed cells were selected on synthetic dropout medium lacking leucine and tryptophan (SD-Leu-Trp) to ensure maintenance of both pAS2 and pACT2 plasmids. Protein interaction between bait and prey proteins was indicated by the growth on SD medium lacking leucine, tryptophan, histidine (SD-Leu-Trp-His) or SD medium lacking leucine, tryptophan, histidine and adenine (SD-Leu-Trp-His-Ade).

2.4.8 BiFC analysis of interactions

The bimolecular fluorescence complementation (BiFC) protocol was based on the method of Hu et al. (Hu, et al. 2002). The SnRK1, eIF4E, iso4E and control genes were cloned

into BiFC expression vectors pYN, pYC, p2YN and p2YC (kanamycin resistance)

(Mohannath, et al. 2014). The pYN1 and pYC1 vectors contain the N- or C-terminal portions of enhanced yellow fluorescent protein (YFP), with genes of interest cloned downstream of the half YFP. p2YN and p2YC also contain the N- or C-terminal portions of

YFP, with genes of interest cloned into the upstream of the half YFP. The BiFC plasmids were transformed into A. tumefaciens C58C1 cells (tetracycline resistance), and transformants were selected on LB agar plates containing kanamycin and tetracycline.

Agrobacterium cultures containing YN- or YC-based plasmids were grown in liquid LB medium (OD600 = 1). The agrobacterium cells were sedimented by centrifugation at 4000 rpm, and then incubated for 3 hours in infiltration buffer containing

morpholineethanesulfonic acid (MES), acetosyringone, and MgCl2. The final cell density in infiltration buffer was between OD600 0.1 to 0.2. The two types of agrobacterium cultures containing genes of interest were mixed 1:1 and infiltrated to N. benthamiana leaves using a blunt syringe. Histone 2b fused to red fluorescent protein (RFP-H2B) was used as a nuclear marker. Leaf tissue was analyzed by confocal microscopy ~48 hours post-infiltration using a Nikon PCM 2000 confocal laser scanning microscope equipped with argon and green helium neon lasers with excitation wavelengths of 488 nm and 544 nm, respectively. To record YFP fluorescence, a band-pass emission filter (EM515/30HQ)

with a 450 to 490 nm excitation wavelength and 515 nm emission wavelength was used. To record RFP fluorescence, a 565 nm long-pass filter (E565LP) was used. Images were captured using Simple PCI Software and compiled with Adobe Photoshop.

2.4.9 Co-immunoprecipitation

Co-immunoprecipitation (co-IP) experiments were performed to confirm that SnRK1 can physically associate with eIF(iso)4E. The Arabidopsis eIFiso4E was cloned into

TMV-based JL50 TRBO vector to generate N-terminal HA2His6-tagged fusions. The full-length SnRK1 was cloned into TMV-based JL51 TRBO vector to generate

N-terminal FLAG-tagged fusions. The JL50-eIFiso4E and JL51-SnRK1 plasmids were transformed into agrobacterium C58C1 respectively, and the agrobacterium cell cultures were mixed and inoculated N. benthamiana leaves as described previously (Mohannath, et al. 2014). Total protein extracts were prepared from ~0.5 g of these inoculated N. benthamiana leaf tissue 4 days post-inoculation. Immunoprecipitation was performed with monoclonal FLAG antibody (Sigma-Aldrich, F3165). General IgG antibody raised from rabbit was a negative control. Protein extracts were incubated with 10 μg of FLAG or IgG control antibodies and 50 l of protein G-agarose (Millipore) for 2 hours at 4°C.

Immune complexes were fractionated by 10% SDS–PAGE (acrylamide / bisacrylamide

ratio, 49:1) and analyzed by immunoblotting using 1:1000 dilutions of FLAG antibody, or monoclonal HA-peroxidase antibody (Sigma-Aldrich, H6533). Secondary antibodies included 1:4000 dilutions of horseradish peroxidase (HRP)-linked anti-mouse IgG for anti-FLAG. Enhanced detection was performed using SuperSignal West Pico chemiluminescent substrate.

2.4.10 Yeast culture medium

The yeast strains used in this study are listed in Table 1. Yeast YPD medium contains 1%

Bacto yeast extract, 2% Bacto peptone and 2% glucose. Synthetic dropout medium (SD) contains 0.67% yeast nitrogen base (YNB) without amino acids, 0.5% ammonium sulfate,

2% dextrose, and 0.2% of the appropriate amino acid drop-out supplement mixture (Bio

101). To prepare 100 ml medium containing 1 mg/ml 5-Fluoroorotic acid (FOA), 100 mg of FOA powder was dissolved in 1 ml of dimethyl sulfoxide (DMSO) by heating in

100°C water bath for 1 min, then added into autoclaved fresh medium. Similarly, to prepare 100 ml SD medium containing 2.5 mg/ml 5-fluoroanthranilic acid (FAA), 250 mg of FAA powder was dissolved in 1 ml of DMSO by heating in 100°C water bath for 5 min, then mixed into autoclaved fresh medium. SD medium with galactose (SD+galatose) contains 2% galactose and 0.5% raffinose. The 0.5% raffinose was supplemented to stimulate yeast cell growth. For solid plates, 2% agar (Fisher Scientific, BP1423-500)

was added to SD medium. Copper induction assays were carried out in minimal SD

medium containing 50-200 M CuSO4.

2.4.11 Yeast transformation

Yeast transformation assays were performed using Zymo Frozen-EZ Yeast

Transformation II Kit. To make competent cells, the yeast cells were grown in 5 ml of

YPD or SD liquid medium overnight, and then amplified in 20 ml of liquid medium for

3-5 hours till mid-log phase (OD600 = 0.8-1.0). The yeast cells were collected at 1000 rpm for 4 min and resuspended in 10 ml of EZ 1 solution (Tris, hydrochloric acid) for 5 min at room temperature. The cells were then precipitated and resuspended in 0.5-1 ml of

EZ 2 solution (sorbitol) at room temperature. At this point, the cells can be immediately used for transformation, or stored at -80°C for future use. It is important to note that Jo55 cells will not survive over one year storage in -80°C freezer, thus it is critical to refresh the clones on galactose plate every 3 months, and avoid the use of frozen competent cells if they are more than 3 months old. To transform competent cells with yeast centromeric plasmids (pRS413, pRS414), 1 g of purified plasmids and 50 l of competent cells were mixed with 0.5 ml of EZ 3 solution (DMSO, polyethyleneglycol 3350). The transformation mixture was incubated at 29°C for 1-2 hours, and applied vortex vigorously very 15 min during the incubation. After incubation, 50-200 ml of

transformation mixture was spread on selective plates. Transformation of yeast integrative plasmid pRS403 was almost the same as the procedures described above, except the plasmid was linearized by cutting with Nde1 (NEB, R0111S) before transformation.

2.4.12 Polysome profile assays

Yeast cells were grown in 100 ml of liquid medium to mid-log phase until OD600 reaches 0.4 to 0.6. Yeast cell culture was kept in ice for 5 min, and 1 ml of cycloheximide solution (10 mg/ml, Sigma-Aldrich, C7698) was added to the cell culture to a final concentration of 0.1 mg/ml. The yeast cells were immediately spun down at 6000 rpm for

4 min at 4°C . Cells were then washed twice in 1.5 ml of lysis buffer containing 20 mM

Tris HCl (pH 8.0), 140 mM KCl, 10 mM MgCl2, 0.5 mM DTT, 0.1 mg/ml cycloheximide and 1 mg/ml heparin (Sigma-Aldrich, H3393). After the last wash, cells were subsequently lysed in 0.7 ml of lysis buffer with 0.5 ml of chilled glass beads (0.45-0.55 mm in diameter) by vigorous vortex in cold room (4°C) for 5 min. Lysates were clarified by centrifugation at 4700 rpm for 4 min at 4°C. The concentration of total RNA in the clarified lysates was measured using NanoDrop Spectrophotometer (Thermo Scientific).

10 OD260 units of the lysates were then loaded on top of sucrose gradients (7%-47% sucrose gradients) in 12 ml size polycarbonate ultracentrifuge tubes (Beckman, 344059),

and then centrifuged at 35,000 rpm for 2.5 hours at 4°C in a SW41 rotor. The mRNA-ribosome suspension was fractionated using an UA-5 UV detector and model 185

ISCO gradient fractionator with the following setting: Pump speed 0.75 ml/min, Fraction time 1.2 min/fraction, Chart speed 60 cm/hour.

2.5 Figures and Tables

Figure 2.1 SnRK1 sites in eIF4E/iso4E. (A) Alignment of eIF4E/iso4E sites from selected flowering plants, lower plants, invertebrates and yeast share the two conserved targeted sites (red). Vertebrates lack target S or T residues despite conservation of surrounding sequences. (B) Structure of wheat eIF4E. The wheat eIF4E 3-D model was generated by

Cn3D structure viewer 4.3.1, based on the data published by Monzingo et al. 2007. A cap structure is shown in variegated color. The S33 equivalent residue is shown in light green, and adjacent T55 is shown in yellow.

Continued

Figure 2.1

Figure 2.1 SnRK1 sites in eIF4E/iso4E.

Figure 2.2 SnRK1 phosphorylates eIF(iso)4E at S33 and T55. Arabidopsis SnRK1-KD

and kinase inactive mutant SnRK1-KDKR were expressed as HA2His6 fusions in N. benthamiana. Arabidopsis eIF(iso)4E, S33A, T55A, S33A/T55A mutants and human eIF4E were expressed as His6 fusions in E. coli. GST-SAMS and GST was also expressed in E.coli. (A) Phosphorylation of GST-SAMS and eIF(iso)4E by SnRK1. (B)

The bar chart shows the relative substrate phosphorylation signal. (B) phosphorylation of eIF(iso)4E is diminished in single mutants and abolished in the S33/T55 double mutant.

(D) The bar chart shows the relative eIF(iso)4E phosphorylation signal.

Continued

Figure 2.2

Figure 2.2 SnRK1 phosphorylates eIF(iso)4E at S33 and T55.

Figure 2.3 SnRK1 interacts with eIF4E/iso4E in yeast cells. Yeast two hybrid assays were used to detect interactions, indicated by growth on media lacking His, or His and Ade.

Interactions were observed with all combinations of SnRK1-eIF4E/iso4E (sectors 1-4, upper panel). SnRK1 interacts with TGMV AL2 (sector 5, upper panel). Positive controls

DCL4-DRB4 interacted with each other but not SnRK1 (sectors 6 & 7, upper panel), or eIF4E/iso4E (sectors 1-4, lower panel).

Figure 2.3 SnRK1 interacts with eIF4E/iso4E in yeast cells.

Figure 2.4 SnKR1 co-immunoprecipitates with eIF(iso)4E. Co-immunoprecipitation was performed with anti-FLAG antibody and rabbit IgG control. Immunoblot analysis of

SnRK1-eIF(iso)4E complexes is shown. Anti-FLAG and anti-HA antibodies were used to detect SnRK1 and eIF(iso)4E, respectively.

Figure 2.4 SnKR1 co-immunoprecipitates with eIF(iso)4E.

Figure 2.5 SnRK1 interacts with eIF4E/iso4E in the cytoplasm. Representative confocal images of BiFC interactions, indicated by recovered YFP fluorescence in N. benthamiana leaf cells, are shown. RFP-H2B is a nuclear marker. SnRK1 interacts with eIF4E and eIFiso4E in the cytoplasm. SnRK1 and AL2 interact in the cytoplasm and nucleus. The DCL4 control interacts with DRB4 but not with

SnRK1 or eIF4E/iso4E.

Figure 2.5 SnRK1 interacts with eIF4E/iso4E in the cytoplasm.

100

Figure 2.6 Experimental outline of eIF4E phosphorylation in yeast cdc33 mutant. Yeast

S. cerevieiae haploid strain Jo56 and plasmid pYCpSupex-hu4E were provided by Dr.

John McCarthy at University of Warwick, United Kingdom. The endogenous eIF4E gene in Jo56 was disrupted by LEU2 insertion, and the survival of Jo56 is maintained by plasmid pYCpTrp-hu4E, which harbors a human eIF4E gene under the control of a GPD promoter. Jo56 was transformed with plasmid YCpSupex-hu4E (URA3 marker) harboring a human eIF4E gene under the control of a galactose inducible promoter, resulting in strain Jo55.5 (Step 1). Jo55.5 was then selected on a SD-Ura+Galactose plate containing

2.5 mg/ml 5-FAA to eliminate the plasmid pYCpTrp-hu4E, and the resultant strain is

Jo55 (Step 2). Next, Jo55 was transformed with plasmid pRS403GPD-At4E/iso4E/hu4E

(Step 3), and then the transformed cells (Jo55.5-At4E/iso4E/hu4E) were selected on

SD-His+Glucose plates containing 1 mg/ml 5-FOA to remove YCpSupex-hu4E (Step 4).

After step 4, the cells (Jo55-At4E/iso4E/hu4E) do not contain a plasmid because the plant eIF4E/iso4E or human eIF4E genes have been integrated into the yeast genome. To link eIF4E phosphorylation and SnRK1, the Jo55-At4E/iso4E/hu4E cells were transformed with plasmid pRS414CUP1-KD/KDKR to generate Jo55-At4E/iso4E/hu4E-KD/KDKR

(Step 5).

Continued

101

Continued

Figure 2.6

Figure 2.6 Experimental outline of eIF4E phosphorylation in yeast cdc33 mutant.

102

Figure 2.7 Arabidopsis eIF4E/iso4E complements yeast cdc33 mutant. Yeast cdc33 strain Jo55 is maintained by plasmid pYCpSupex-hu4E, which harbors a human eIF4E gene under the control of a galactose inducible promoter. The expression of human eIF4E is induced by galactose, but shut down by glucose. Thus, the survival of Jo55 in glucose media depends on Arabidopsis eIF4E (left column) or eIFiso4E (right column). Yeast colonies shown on galactose plates were 4 days old, and colonies shown on glucose plates were 5 days old.

Figure 2.7 Arabidopsis eIF4E/iso4E complements yeast cdc33 mutant. 103

Figure 2.8 At4E/iso4E mutants failed to complement yeast cdc33 strain. Yeast cdc33 strain Jo55 is maintained by plasmid pYCpSupex-hu4E, which harbors a human eIF4E gene under the control of a galactose inducible promoter (hu4E expression is induced by galactose, but shut down by glucose). The survival of Jo55 in glucose media depends on

Arabidopsis eIF4E (upper panel) or iso4E (lower panel). An empty vector serves as a negative control (section 8).

Figure 2.8 At4E/iso4E mutants failed to complement yeast cdc33 strain.

104

Figure 2.9 Arabidopsis eIF4E T67V mutant complements yeast cdc33 strain. Yeast Jo55 strain was transformed with plasmids expressing wild-type Arabidopsis eIF4E or mutants with substitution of the first SnRK1 phosphorylation site by valine (T67V), arginine

(T67R), or alanine (T67A). The complementation was tested on glucose plate. A series of increasing dilution of yeast culture (OD600 of 0.5, 0.05, 0.005, 0.0005, from left to right) were grown on SD-Trp+Glucose plates at 29°C for 3 days.

Figure 2.9 Arabidopsis eIF4E T67V mutant complements yeast cdc33 strain.

105

Figure 2.10 Arabidopsis SnRK1-KD complements yeast snf1 mutant. The snf1 strain was transformed with plasmids expressing SnRK1-KD

(pRS414CUP1-KD) or SnRK1-KD (pRS414CUP1-KDKR) from a copper inducible promoter. Yeast cells were grown on medium containing 50 M

CuSO4, with 2% glucose or galactose. Cells lacking SNF1 activity are unable to grow on carbon sources other than glucose.

Figure 2.10 Arabidopsis SnRK1-KD complements yeast snf1 mutant.

106

Figure 2.11 5-FOA selection against yeast strains expressing URA3. Jo55.5-At4E and

Jo55.5-iso4E cells contain both plasmids pYCpSupex-hu4E (URA3 marker) and pRS403GPD-At4E/iso4E (TRP1 marker). These yeast strains were grown on 5-FOA plates to select against cells expressing URA3 (to remove plasmid pYCpSupex-hu4E).

The colonies growing on 5-FOA plates were designated Jo55-At4E or Jo55-iso4E respectively. The growth of Jo55.5-At4E, Jo55.5-iso4E, Jo55-At4E or Jo55-iso4E on

SD-Trp (left) or SD-Ura (right) plates were grown. Jo55.5-At4E/iso4E cells grow on both plates, but Jo55-4E/iso4E cells grow only on SD-TRP plates, indicating pYCpSupex-hu4E was absent.

Figure 2.11 5-FOA selection against yeast strains expressing URA3.

107

Figure 2.12 SnRK1 inhibits yeast growth. Yeast cdc33∆ strain was complemented by Arabidopsis eIF4E/iso4E or human eIF4E. These plant eIF4E/iso4E or human eIF4E complemented cells were subsequently transformed with plasmids pRS414CUP1-KD or pRS414CUP1-KDKR. The expression of SnRK1-KD or KDKR was induced by 200 M CuSO4 (right column). A series of increasing dilution of yeast culture (OD600 of 0.5, 0.05,

0.005, 0.0005, from left to right) were grown on SD-Trp+Galactose plates at

29°C for 3 days (for At4E or hu4E complemented yeast), or 4 days (for iso4E complemented yeast).

Figure 2.12 SnRK1 inhibits yeast growth. 108

Figure 2.13 SnRK1 inhibits At4E/iso4E-mediated polysome formation. Yeast cells

Jo55-At4E/iso4E-KD/KDKR were generated as described previously. Yeast cells were grown in 100 ml SD-Trp+Galactose medium to OD600 of 0.4-0.6, and the expression of

SnRK1-KD/KDKR was induced by 200 M CuSO4 for 12 hours. Polysomes were extracted from these cells and separated by sucrose gradient ultracentrifugation (7% to 47% sucrose gradient, 35,000 rpm for 160 min in SW41 rotor). Sucrose gradient was then fractionated using ISCO collection system. To calculate the P:NP ratio, the area covered by polysomes was divided by the area covered by 40 S, 60 S, and 80 S.

Figure 2.13 SnRK1 inhibits At4E/iso4E-mediated polysome formation.

109

Figure 2.14 SnRK1 does not inhibit polysome formation that is mediated by Arabidopsis

4E-VA or human 4E. Polysome profiling assays were performed as described previously.

Yeast cells used in this test are Jo55-At4E-VA-KD and J055-hu4E-KD.

Figure 2.14 SnRK1 does not inhibit polysome formation that is mediated by Arabidopsis

4E-VA or human 4E.

110

Figure 2.15 Bar chart showing SnRK1 inhibits polysome formation. The P/NP ratio was calculated from the polysome profiles of at least two independent colonies. The error bars indicate standard deviation.

Figure 2.15 Bar chart showing SnRK1 inhibits polysome formation.

111

Table 2.1 Yeast strains used in this study.

Yeast Strain Genetic Background Plasmid 1 Plasmid 2

Jo56 cdc33: :LEU2 his3 ura3 trp1 ade2 pYCpTrp-hu4E, TRP1 n/a

Jo55.5 cdc33: :LEU2 his3 ura3 trp1 ade2 pYCpTrp-hu4E, TRP1 pYCpSupex-hu4E, URA3

Jo55 cdc33: :LEU2 his3 ura3 trp1 ade2 n/a pYCpSupex-hu4E, URA3

Jo55.5-At4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E, HIS3 pYCpSupex-hu4E, URA3

Jo55.5-iso4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-iso4E, HIS3 pYCpSupex-hu4E, URA3

Jo55.5-At4E-VA cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E-VA, HIS3 pYCpSupex-hu4E, URA3

Jo55.5-hu4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-hu4E, HIS3 pYCpSupex-hu4E, URA3

Jo55-At4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E,HIS3 n/a

Jo55-iso4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-iso4E, HIS3 n/a

Jo55-At4E-VA cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E-VA,HIS3 n/a

Jo55-hu4E cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-hu4E, HIS3 n/a

Jo55-At4E-KD cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E,HIS3 pRS414CUP1-KD, TRP1

Jo55-At4E-KDKR cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E,HIS3 pRS414CUP1-KDKR, TRP1

Jo55-iso4E-KD cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-iso4E, HIS3 pRS414CUP1-KD, TRP1

Jo55-iso4E-KDKR cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-iso4E, HIS3 pRS414CUP1-KDKR, TRP1

Jo55-At4E-VA-KD cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E-VA,HIS3 pRS414CUP1-KD, TRP1

Jo55-At4E-VA-KDKR cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-At4E-VA,HIS3 pRS414CUP1-KDKR, TRP1

Jo55-hu4E-KD cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-hu4E, HIS3 pRS414CUP1-KD, TRP1

Jo55-hu4E-KDKR cdc33: :LEU2 his3 ura3 trp1 ade2 pRS403GPD-hu4E, HIS3 pRS414CUP1-KDKR, TRP1

snf1 APY192 snf1::LEU2 ade2 can1 his3 leu2 n/a n/a trp1 ura3 cdc33-E72G (ts) his3 ura3 leu2 met1 n/a n/a

112

Table 2.2 SnRK1 phosphorylates Arabidopsis eIF(iso)4E in vitro.

Adjusted Relative SnRK1 Substrates SnRK1 Substrates substrates substrate signal signal signal# phosphorylation*

KD 17815 SAMS 21827 15028 100.00% KDKR 6824 SAMS 7315 516 3.43% KD 19590 eIFiso4E 17318 10519 69.99% KDKR 8608 eIFiso4E 5739 -1060 -7.05% KD 23523 GST 6799 0 0.00% KDKR 9074 GST 5036 -1763 -11.73% KD 22579 hu4E 6883 84 0.56% KDKR 5395 hu4E 4971 -1828 -12.16%

#Adjusted substrates signal represents the intensity of substrate phosphorylation signal higher than GST phosphorylation by SnRK1-KD. (Adjusted substrates signal = substrate signal - 6799) *Relative substrate phosphorylation represents the percentage of adjusted substrate phosphorylation compared to the phosphorylation of GST-SAMS by SnRK1-KD. (Relative substrate phosphorylation = Adjusted substrates signal / 15028)

Table 2.2 SnRK1 phosphorylates Arabidopsis eIF(iso)4E in vitro. Radioactivity of

32P-labeled bands was recorded by a phosphor screen, which was scanned by a Bio-Rad

PMI System to generate a phosphorylation image. Phosphorylation signal values (in arbitrary units) of SnRK1 autophosphorylation were obtained by measuring signal intensity of bands on the phosphor image using Bio-Rad Quantity One software.

113

Table 2.3 SnRK1 phosphorylates eIF(iso)4E at S33 and T55.

Adjusted Relative substrate Substrates Substrates SnRK1 SnRK1 signal substrates phosphorylation* (eIFiso4E) signal signal#

KD 24865665 WT 18344985 11848722 100.0% KDKR 9495274 WT 7028886 532623 4.5% KD 24728939 S33A 10232444 3736181 31.5% KDKR 8573787 S33A 6781244 284981 2.4% KD 20824622 T55A 12129159 5632896 47.5% KDKR 9941467 T55A 7912707 1416444 12.0% KD 21726512 S33A/T55A 6445435 -50828 -0.4% KDKR 7567674 S33A/T55A 6057709 -438554 -3.7% KD 25102148 GST 6496263 0 0.0%

#Adjusted substrates signal represents the intensity of eIF(iso)4E phosphorylation signal higher than GST phosphorylation. (Adjusted substrates signal = substrate signal - 6496263) *Relative substrate phosphorylation represents the percentage of eIF(iso)4E phosphorylation compared to the phosphorylation of eIF(iso)4E WT by SnRK1-KD. (Relative substrate phosphorylation = Adjusted substrates signal / 11848722)

Table 2.3 SnRK1 phosphorylates eIF(iso)4E at S33 and T55. Radioactivity of 32P-labeled bands was recorded by a phosphor screen, which was scanned by a GE Typhoon 8600

System to generate a phosphorylation image. Phosphorylation signal values (in arbitrary units) of SnRK1 autophosphorylation were obtained by measuring signal intensity of bands on the phosphor image.

114

Table 2.4 yeast complementation by Arabidopsis eIF4E/iso4E wild-type and mutants.

Gene Mutation Complementation iso4E S33V + iso4E S33A - iso4E S33D - iso4E T55A + iso4E T55D + iso4E S33V/T55A + (weak) iso4E S33A/T55A - iso4E S33D/T55D - 4E T67V + 4E T67A - 4E T67D - 4E T91A + 4E T91D + 4E T67V/T91A + 4E T67A/T91A - Table 2.4 yeast complementation by Arabidopsis eIF4E/iso4E wild-type and mutants.

This table shows the complementation of the yeast cdc33 mutant by eIF4E/iso4E wild-type, SnRK1-insensitive mutants (S/T-A/V), and phosphomimic mutants (S/T -D). +: complementation, -: no complementation.

115

Table 2.5 SnRK1 inhibits yeast growth.

Jo55-At4E-KD SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones doubling time (hr) doubling time (hr) clone#1 4.98 7.71 clone#2 4.16 9.08 clone#3 3.94 9.59 clone#4 4.01 9.32 average 4.27 8.925 standard deviation 0.48 0.84

Jo55-At4E-KDKR SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones doubling time (hr) doubling time (hr) clone#1 4.03 4.3 clone#2 4.08 4.14 clone#3 3.79 3.79 clone#4 3.86 3.9 average 3.94 4.03 standard deviation 0.14 0.23

Jo55-hu4E-KD SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones doubling time (hr) doubling time (hr) clone#1 3.29 5.29 clone#2 3.15 4.61 clone#3 3.2 5.5 clone#4 3.51 5.85 average 3.29 5.31 standard deviation 0.16 0.52 Table 2.5 SnRK1 inhibits yeast growth. The table shows the doubling time of yeast

Jo55-At4E/hu4E-KD/KDKR in medium without CuSO4 or containing 200 M CuSO4.

116

Table 2.6 SnRK1 inhibits polysome formation.

Jo55-At4E-KD SD-Trp+Gal Media no CuSO4 200 M CuSO4 Independent clones P:NP ratio P:NP ratio clone#1 1.28:1 0.56:1 clone#2 1.34:1 0.61:1 average 1.31:1 0.585:1 standard deviation 0.04:1 0.04:1

Jo55-At4E-KDKR SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones P:NP ratio P:NP ratio clone#1 1.22:1 0.94:1 clone#2 1.32:1 1.15:1 average 1.27:1 1.05:1 standard deviation 0.07:1 0.15:1

Jo55-iso4E-KD SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones P:NP ratio P:NP ratio Clone#1 0.85:1 0.36:1

Jo55-iso4E-KDKR SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones P:NP ratio P:NP ratio Clone#1 0.98:1 0.64:1

Jo55-hu4E-KD SD-Trp+Gal Media no CuSO4 200 M CuSO4 independent clones P:NP ratio P:NP ratio clone#1 1.78:1 1.34:1 clone#2 1.66:1 1.45:1 average 1.72:1 1.40:1 standard deviation 0.08:1 0.08:1 Jo55 -At4E-VA-KD SD -Trp+Gal Media no CuSO4 200 M CuSO4 independent clones P:NP ratio P:NP ratio clone#1 1.04:1 0.89:1 clone#2 0.90:1 0.92:1 average 0.97:1 0.91:1 standard deviation 0.06:1 0.06:1 117

Table 2.7 PCR program for the site-directed mutagenesis of eIF4E/iso4E.

Segment Cycles Temperature Time

1 1 95°C 2 min

95°C 30 seconds

2 20 55°C 30 seconds

68°C 5 min

3 1 4°C over night

118

Table 2.8 Oligonucleotide primers design for site-directed mutagenesis PCR.

Amino primer Gene Mutation Acid F/R oligonucleotide iso4E AG97GT S33V F GAAAGAAAGTGGGTTTTCTGGTTC R GAACCAGAAAACCCACTTTCTTTC iso4E AG97GC S33A F GAAAGAAAGTGGGCTTTCTGGTTC R GAACCAGAAAGCCCACTTTCTTTC iso4E AG97GA S33D F GAAAGAAAGTGGGATTTCTGGTTC R GAACCAGAAATCCCACTTTCTTTC iso4E A163G T55A F CGTAAAGCCTATGCTTTCGACACCGTCG R CGACGGTGTCGAAAGCATAGGCTTTACG iso4E AC163GA T55D F CGTAAAGCCTATGATTTCGACACCGTCG R CGACGGTGTCGAAATCATAGGCTTTACG 4E AC199GT T67V F AACATTCATGGGTTTTCTGGTTC R GAACCAGAAAACCCATGAATGTT 4E A199G T67A F AACATTCATGGGCTTTCTGGTTC R GAACCAGAAAGCCCATGAATGTT 4E AC199GA T67D F AACATTCATGGGATTTCTGGTTC R GAACCAGAAATCCCATGAATGTT 4E A271G T91A F CTTGCGACCCGTGTTTGCGTTTTCAACTGTTGAGG R CCTCAACAGTTGAAAACGCAAACACGGGTCGCAAG 4E ACG271GAC T91D F CTTGCGACCCGTGTTTGACTTTTCAACTGTTGAGG R CCTCAACAGTTGAAAAGTCAAACACGGGTCGCAAG

119

3 CHAPTER 3: TGMV and CaLCuV AL2 inhibit SnRK1 activity

in vitro, while SnRK1 phosphorylates CaLCuV AL2

Preface

This chapter describes some experiments, including results section 3.2.1 and 3.2.2, that are still in progress. Given the preliminary nature of the data these experiments need to be repeated and some details improved. I also propose some future experiments and directions to comprehensively understand the relationship between SnRK1 and

CaLCuV/TGMV AL2. This project will be continued by my colleague Aaron Bruns.

3.1 Introduction

Viruses are parasitic species that rely on host machinery to synthesize their proteins and genetic material. To counteract viral infections, hosts have developed various approaches to suppress viral replication at different infectious stages. For example, many hosts have evolved mechanisms to degrade viral mRNA, inhibit viral transcription through gene silencing pathways, and/or have mechanisms to shut down viral protein synthesis. Other antiviral mechanisms involve blocking viral entry, interfering with post-translational modification of viral proteins, etc. In response to these antiviral defenses, viruses have 120

evolved mechanisms to target and inactivate these defense pathways and thereby hijack and utilize host machinery for replication. Geminivirus infection and plant defense provides a good model to understand the evolutionary relationship between parasite and host.

Geminiviruses are diverse plant viruses with single-stranded DNA genomes. They infect a wide range of plant species, including many economically important crop plants such as maize, tomato, potato, pepper and soybean. Based on genome organization, host range, and insect vectors, the Geminiviridae is grouped into four genera, which are Begomovirus,

Curtovirus, Mastrevirus and Topocovirus. The viruses being studied in this chapter include Tomato golden mosaic virus (TGMV) and Cabbage leaf curl virus (CaLCuV), both belonging to the genus Begomovirus. Based on place of origin and evolutionary history, begomoviruses have been grouped into two clades: Old World viruses and New

World viruses. Old World viruses were originally discovered in the African and Asian continents, while New World viruses are mainly found in North and South America.

The genomes of TGMV and CaLCuV are composed of two circular, 3 kb DNA molecules

(genome A and B). Genome A encodes 5 proteins, which are AL1, AL2, AL3, AL4, and

AR1. Genome B encodes only two proteins, BL1 and BR1. This study focuses on the function of the viral protein AL2. AL2 is a transcriptional activator protein (TrAP) which

121

is required for the expression of late viral genes (Sunter, et al. 1992). AL2 is also a pathogenicity factor that antagonizes host defenses at both the innate and adaptive levels.

To counter the adaptive immune system, AL2 inhibits both transcriptional gene silencing

(TGS) and post-transcriptional gene silencing (PTGS) (for review, see (Bisaro 2006, Raja, et al. 2010)). The inhibition of TGS and PTGS by AL2 is achieved by interaction and inactivation of key enzymes in pathways leading to DNA methylation. To counter an innate defense response, AL2 inhibits SnRK1, a key kinase controlling the balance of energy and regulating many metabolic pathways (Wang, et al. 2003).

Plant SnRK1 belongs to an evolutionarily conserved SNF1/AMPK/SnRK1 kinase family.

This family of kinases includes AMPK (AMP-activated protein kinase) in animals, SNF1 kinase (Sucrose non-fermenting 1) in yeast, and SnRK1 (SNF1-related kinase 1) in plants.

These kinases act as energy sensors in the cell by detecting the ratio of cellular AMP: ATP, which is indicative of energy balance (for review, see (Halford, et al. 2009, Polge, et al.

2007, Hardie 2007, Ghillebert, et al. 2011, Robaglia, et al. 2012)). In plants, activated

SnRK1 inhibits energy consuming processes such as lipid biosynthesis, nitrogen assimilation and starch synthesis, while stimulating energy generating catabolic processes

(Halford, et al. 2009). In a previous study, we found that TGMV AL2 and BCTV L2 interact with Arabidopsis SnRK1 in a yeast two-hybrid system (Wang, et al. 2003). The

122

interactions between geminivirus pathogenicity factors and SnRK1 were subsequently found in other systems. For instance, Arabidopsis SnRK1 interacts with Spinach curly top virus (SCTV) C2/L2 protein (Yang, et al. 2007), tomato SnRK1 interacts with C1 protein encoded by the beta satellite of Tomato yellow leaf curl China virus (TYLCCNV)

(Yang, et al. 2011). Interestingly, it has also been reported that two SnRK1 upstream kinases, GRIK1 and GRIK2, interact with CaLCuV AL1 protein (Kong, et al. 2002, Shen, et al. 2006).

Multiple relationships between SnRK1 pathway and geminivirus pathogenicity factors have been described. The next important question is, what is the role of SnRK1 during geminivirus infection? In early research conducted in our lab, we showed expression of an antisense SnRK1 transgene in Nicotiana benthamiana plants causes enhanced susceptibility to TGMV and BCTV (Wang, et al. 2003). These transgenic N. benthamiana plants required a lower inoculum dose to infect, and the latent period in infected plants was substantially reduced compared to wild-type plants. These results suggested virus infectivity is enhanced in these transgenic plants. However, this research also revealed that infected transgenic plants did not exhibit more severe disease symptoms than infected wild-type plants, and transgenic plants did not accumulate significantly higher levels of viral DNA molecules. Because the severity of viral disease symptoms is indicative of

123

virulence, this result suggested infectivity, but not virulence, was affected by the AL2 transgenes. Consistent with these results, transgenic N. benthamiana plants overexpressing SnRK1 exhibited enhanced resistance, evidenced by a higher viral dose requirement for infection and longer latent periods for symptom development. These same observations were confirmed by the study of TYLCCNV (Shen, et al. 2011).

Infections of TYLCCNV in transgenic plants carrying antisense SnRK1 required shorter latent periods, but unlike TGMV and BCTV, resulted in higher accumulation of viral

DNAs. TYLCCNV infection of transgenic plants overexpressing SnRK1 had longer latent periods, and resulted in lower accumulation of viral DNAs. These findings are summarized in Table 3.1. Thus we conclude that SnRK1 plays a role in antiviral defense against various geminiviruses.

The next relevant question is how interactions between SnRK1 and viral pathogenicity factors (AL2, L2 or C1) affect viral infection. Direct evidence linking AL2-SnRK1 interaction with geminivirus infection was demonstrated in transgenic N. benthamiana plants overexpressing truncated TGMV AL2 (Wang, et al. 2003). The first truncated AL2 fragment lacked the transcriptional activation domain (AL2 1-100), but was still able to bind SnRK1. The second mutant AL2 lacked both the transcriptional activation domain and the SnRK1-binding region (AL2 33-43 in a 1-114 background), so that AL2 33-43

124

only weakly binds SnRK1. Transgenic plants expressing the AL2 1-100 showed enhanced susceptibility to TGMV or BCTV, however transgenic plants expressing AL2 33-43 did not show enhanced susceptibility. The phenomenon that AL2 overexpression enhanced susceptibility, but that overexpression of an AL2 mutant lacking SnRK1-binding region failed to do so, suggests AL2 repressed a plant defense system and that AL2-SnRK1 binding was important for this process. Although we know SnRK1-AL2 interaction plays a role during geminivirus infection, the exact relationship between them has not yet been fully determined. There are two alternative hypothesis to explain the possible effects of interactions between SnRK1 and pathogenicity factors, (1) SnRK1 is inhibited by pathogenicity factors or (2) SnRK1 inhibits the function of pathogenicity factors.

Evidence from the study of TGMV and BCTV in our lab support the first hypothesis. An in vitro SnRK1 kinase assay suggested SnRK1 kinase domain (KD) autophosphorylation activity is inhibited by AL2 or L2 in a dose-dependent manner (Wang, et al. 2003).

Arabidopsis SnRK1 complemented yeast SNF mutant, and the complementation was abolished by the expression of L2, indicating L2 inhibits SnRK1 in vivo. This evidence indicated SnRK1 activity was inhibited by AL2/L2. A different study supporting SnRK1 inhibition of pathogenicity factor function reported that SnRK1 phosphorylates DNA beta satellite encoded C1 protein rather than being inhibited by C1 (Yang, et al. 2011).

125

Co-infection of TYLCCNV with DNA- carrying C1 phosphomimic mutations

(aspartate substitution) showed reduced infectivity and lower viral DNA accumulation, while viruses carrying C1 non-phosphorylatable mutations (alanine substitution) resembled wild-type virus in regards to latent period and severity of symptoms, but accumulated higher viral DNA levels. This evidence suggested SnRK1 phosphorylates

C1 and that the phosphorylation of the C1 pathogenicity factor may lead to reduced viral infectivity. Because C1 shows very low homology with TGMV AL2 or BCTV L2

(no significant similarity), it is possible that TYLCCNV employs a different strategy to optimize virus replication and systemic spread. Recently the Hanley-Bowdoin lab proposed that SnRK1 phosphorylates CaLCuV AL2 and Tomato mottle virus (ToMoV)

AL2 in vitro (Shen, et al. 2014). In their experiments, SnRK1 was expressesd in E. coli cells and activated by phosphorylation with GRIK1 in vitro (Baena-Gonzalez, et al. 2007), while in our lab SnRK1 kinase domain was transiently expressed in N. benthamiana cells

(Mohannath, et al. 2014). Because plant cells have all the upstream kinases which phosphorylate and convert SnRK1 to its active form, the SnRK1 kinase domain directly extracted from N. benthamiana tissue is highly active (Mohannath, et al. 2014). Because

TGMV AL2 shows very high homology with CaLCuV AL2 (67% identity and 83% similarity) and ToMoV AL2 (67% identity and 81% similarity), we wanted to confirm

126

their results using our plant-expressed SnRK1 kinase system. Here we present several lines of evidence which demonstrate that SnRK1 activity is inhibited by both TGMV AL2 and CaLCuV AL2. We also show SnRK1 phosphorylates CaLCuV AL2 at S109. In addition, we explore the possible effect of CaLCuV AL2 phosphorylation.

3.2 Results

3.2.1 TGMV AL2 inhibits SnRK1 transphosphorylation activity in vitro

Our lab previously reported that TGMV AL2 and BCTV L2 proteins interact with

Arabidopsis SnRK1 and inhibit its autophosphorylation activity (Wang, et al. 2003). It was shown that at 2:1 molar ratio of AL2 to SnRK1-KD, autophosphorylation signal of

SnRK1-KD was greatly reduced in comparison to the signal in absence of AL2. Further, the SnRK1-KD autophosphorylation signal was barely detectable when the molar ratio of

AL2 to SnRK1-KD was increased to 2.5:1. We also showed physical interaction between

AL2 and SnRK1 was necessary for the inhibition. Yeast two-hybrid assay was performed to identify an AL2 mutant that failed to bind SnRK1. Finally, a truncated AL2 mutant

(33-43) was selected. The ability of the AL2 33-43 mutant to inhibit SnRK1 was much weaker compared to that of wild-type AL2, suggesting AL2-SnRK1 binding was required for inhibition. Based on these results, we concluded that TGMV AL2 protein inhibits

127

SnRK1 kinase activity in vitro. However, there are still two major concerns about the experiment. First, Arabidopsis SnRK1-KD was expressed from a baculovirus-based vector in insect cell line Sf9. Because plant activation of SnRK1-KD requires complicated post-translational modification, including phosphorylation at threonine 176 in the T-loop by upstream kinases, plant SnRK1-KD produced in insect cells may not be properly modified. To address this concern, we expressed SnRK1-KD in N. benthamiana leaf cells. Another concern was that, while AL2/L2 were shown to inhibit auto-phosphorylation of SnRK1-KD, phosphorylation of a substrate

(transphosphorylation) was not examined. Because the correlation between autophosphorylation and transphosphorylation activity of AMPK/SNF1/SnRK1 family kinases is not clear (Horman, et al. 2006, Hurley, et al. 2006), we asked whether plant-expressed SnRK1-KD transphosphorylation activity is inhibited by TGMV AL2.

SnRK1-KD was cloned into plasmid pJL50, a Tobacco mosaic virus (TMV)-based TRBO

vector, to generate a N-terminal HA2His6-tagged recombinant protein (Lindbo 2007).

Plasmid JL50-SnRK1-KD was transformed into agrobacteria C58C1, and selected on media containing the antibiotics tetracycline and kanamycin. Transformed agrobacteria were used to infiltrate N. benthamiana leaves for protein over-expression. TGMV AL2 was cloned into a pRSET vector to generate a His6-Xpress fusion protein. Both SnRK1

128

and AL2 were purified by Ni-NTA chromatography. A SAMS peptide

(HMRSAMSGLHLVKRR) fused to glutathione S-transferase (GST) tag is commonly used as a substrate in the measurement of kinase activity of the AMPK/SNF1/SnRK1 family (Mohannath, et al. 2014, Celenza, et al. 1989). In this experiment GST-SAMS phosphorylation was used to indicate SnRK1 trans-phosphorylation activity. GST-SAMS was expressed in E. coli BL21 cells and purified by glutathione agarose chromatography.

As shown in Figure 3.1, GST-SAMS was strongly phosphorylated by plant-expressed

SnRK1-KD, while in the same reaction SnRK1-KD phosphorylation was also observed, indicating that both auto- and trans-phosphorylation occurred. The GST-SAMS phosphorylation signal was reduced by ~5% when the molar ration of AL2 to SnRK1 reached 10:1 (Figure 3.1). GST-SAMS incorporation of P32 also showed approximately

50% reduction (Table 3.2). Surprisingly, SnRK1 autophosphorylation activity was not significantly inhibited in presence of a 10-fold molar excess of AL2 (Figure 3.1B and

Table 3.2).

The previous experiment simultaneously examined SnRK1 autophosphorylation and transphosphorylation reactions, which might affect each other. To simplify the experiment, SnRK1-KD was pre-incubated with non-radioactive ATP for 30 min to allow auto-phosphorylation reaction to occur. Non-radioactive ATP remaining in reaction

129

buffer was then removed by desalting columns before addition of GST-SAMS and labeled ATP. Incubation of GST-SAMS with pre-incubated SnRK1-KD resulted in only one γ32P labeled band at the position corresponding to GST-SAMS (Figure 3.1A), suggesting that autophosphorylation of SnRK1-KD was complete following pre-incubation. Nevertheless, similar results were obtained: GST-SAMS signal was reduced ~50% at a 10:1 molar ratio of AL2 to SnRK1 (Figure 3.1A). P32 incorporation into GST-SAMS also showed an approximately 50% reduction (Figure 3.1C and Table

3.1).

We conclude from these experiments that TGMV AL2 protein inhibits Arabidopsis

SnRK1 trans-phosphorylation activity, although it requires 10 fold molar excess of AL2 to cause significant inhibition.

3.2.2 CaLCuV AL2 inhibits SnRK1 activity in vitro

Although we showed TGMV AL2 and BCTV L2 inhibit SnRK1-KD activity, the impact of CaLCuV AL2 on SnRK1 activity remains unknown. Because AL2 protein sequences from TGMV and CaLCuV display 67% identity and 83% similarity, CaLCuV AL2 may share some common functions with BCTV AL2. In this study, we investigated whether

CaLCuV AL2 inhibits SnRK1 activity in vitro.

130

CaLCuV AL2 protein samples display two bands at about 28 KDa and 55 KDa on

SDS-PAGE gel stained by coomassie blue (Figure 3.4C). Previous studies in our lab showed that TGMV AL2 proteins self-interact and form stable dimers and higher-order multimers (Yang, et al. 2007). Given that CaLCuV AL2 and TGMV AL2 share high sequence similarity, the two bands detected on coomassie blue staining PAGE gel might

be homodimers and tetramers (calculated His6-Express-tagged CaLCuV AL2 molecular weight is 16.6 kDa). In SnRK1 kinase assay, translational initiation factor eIF(iso)4E was used as the substrate (see Chapter 2 for details). Kinase reactions contained 0.1 g

SnRK1-KD, about 0.5 g eIF(iso)4E and varying amounts of CaLCuV AL2 proteins in

25 l reaction buffer.

The eIF(iso)4E phosphorylation signal was reduced ~60% when 2:1 molar ratio of

CaLCuV AL2 to SnRK1 was added (Figure 3.2A, C and Table 3.3). Consistent with this result, SnRK1 autophosphorylation activity was also significantly inhibited in presence of a 2 fold molar excess of CaLCuV AL2 (Figure 3.2B).

3.2.3 Arabidopsis SnRK1 consensus site in various begomovirus AL2/L2/C2

proteins

It has been reported that SnRK1 phosphorylates several geminivirus pathogenicity factors, such as AL2 from CaLCuV and ToMoV (Shen, et al. 2014). A serine residue at positition 131

109 of CaLCuV AL2 was predicted as the SnRK1 phosphorylation site. To determine the extent of conservation of SnRK1 recognition sites on various geminivirus pathogenicity factors, the amino acid sequences of AL2/C2 from 98 well-studied begomoviruses were aligned by CLUSTAL-W algorithm (Figure 3.3). The phylogenetic tree of these viruses was generated based on AL2 sequences using the Neighbor-Joining method implemented in MEGA6. The AL2 protein sequence alignment indicates that SnRK1 recognition site is highly conserved in most begomoviruses. Although begomoviruses are identified and categorized mainly on the basis of genome A (Fauquet, et al. 2008), the phylogenetic tree generated from AL2 sequences subdivided 98 begomoviruses into two groups: Old World viruses (OW) and New World viruses (NW) (Figure 3.3). Interestingly, SnRK1 phosphorylation site also shows distinct characteristics between the OW and NW. In NW group, the SnRK1 phosphorylation site is either serine (37 out of 47 viruses, 78%) or glycine (10 out of 47 viruses, 22%). In contrast, in the OW group this site is occupied by methionine or valine (Figure 3.3). The only exception is Watermelon chlorotic stunt virus

(WmCSV), which is an OW virus but has a serine in the predicted SnRK1 phosphorylation site. Because neither glycine, valine, nor methionine residues are phosphorylatable, it is unlikely that SnRK1 phosphorylates AL2 proteins containing these residues. It is important to point out that TGMV AL2 contains a glycine at this site, while

132

CaLCuV contains a serine.

3.2.4 SnRK1 phosphorylates CaLCuV AL2 at S109

It has been reported that SnRK1 phosphorylates CaLCuV AL2 at S109 by full-length

SnRK1, which was made in E. coli cells and activated by GRIK1 (Geminivirus Rep

Interacting Kinase 1) (Shen, et al. 2014). GRIK1/2 were previously shown to be SnRK1 upstream activating kinases which phophorylate SnRK1 at threonine 176 in the T-loop. We then investigated whether CaLCuV AL2 is phosphorylated by plant-expressed recombinant SnRK1 kinase domain (SnRK1-KD). TGMV AL2, along with CaLCuV AL2 wild-type (S109) and a non-phosphorylatable mutant form S109G (glycine substitution) were cloned into a pRSET vector to generate His6-Xpress fused proteins. Protein expression and purification have been described previously.

Autophosphorylation was detected when SnRK1-KD was incubated alone with γ32P-ATP

(Figure 3.4A, lane 1). Incubation of GST-SAMS with SnRK1-KD resulted in strong phosphorylation of GST-SAMS, indicating SnRK1-KD was active (Figure 3.4A, lane 2).

This GST-SAMS phosphorylation signal in Figure 5A was 24757 (arbitrary units), while the GST-SAMS signal in Figure 3.4C was 46358 (arbitrary units, Table 3.5), mainly because Figure 3.4C was exposed longer. We extended the exposure time for the gel

133

containing SnRK1 and AL2 S109G samples to ensure that even a weak phosphorylation signal could be detected. In reactions containing SnRK1-KD and CaLCuV AL2 wild-type proteins, in addition to SnKR1-KD autophosphorylation signal, another 32P-labelled band at the position of about 20 kDa was detected, indicating that CaLCuV AL2 monomers could be phosphorylated by SnKR1-KD. However, CaLCuV AL2 phosphorylation was weak as the signal was ~8 fold less than GST-SAMS (Table 3.5). In contrast, when

CaLCuV AL2 S109G mutant was incubated with SnRK1-KD, no band corresponding to

CaLCuV AL2 S109G was observed even when the gel was monitored for 48 hours

(Figure 3.4C). When compared to the phosphorylation signal at the corresponding position of wild-type CaLCuV AL2 band in lanes containing no substrate (Figure 3.4C, lane 1), 0.1 g S109G (lane 3), or 0.05 g S109G (lane 4), no significant difference in 32P incorporation was observed, indicating phosphorylation of S109G is not higher than background. This result indicates glycine substitution at AL2 S109 blocked the

SnRK1-catalyzed phosphorylation reaction. From these results, we conclude that

SnRK1-KD weakly phosphorylates CaLCuV AL2 at S109.

Because TGMV AL2 contains a glycine residue at the predicted SnRK1 site, SnRK1 cannot phosphorylate TGMV AL2. A previous study also showed that SnRK1-KD, which is expressed in insect cells, does not phosphorylate TGMV AL2 in vitro (Wang, et

134

al. 2003). Here we confirmed the result using plant-expressed SnRK1-KD. As shown in

Figure 3.1A, incubation of SnRK1-KD with TGMV AL2 displayed only the SnRK1-KD auto-phosphorylation band, indicating that SnRK1-KD cannot phosphorylate TGMV

AL2.

3.2.5 CaLCuV AL2 S109G, S109D mutant proteins inhibit SnRK1 activity

In this study, we showed CaLCuV AL2-SnRK1 interaction results in two distinct, but not mutually exclusive effects. First, we showed CaLCuV AL2 wild-type protein inhibits

SnRK1 kinase activity in vitro, indicated by reduced SnRK1-KD autophosphorylation and eIF(iso)4E phosphorylation. And second, we also showed SnRK1 phosphorylates

CaLCuV AL2 at S109, and glycine substitution at S109 blocks AL2 phosphorylation.

These results indicate the impact of CaLCuV AL2-SnRK1 interaction is complicated.

Here we asked whether phosphorylation of AL2 by SnRK1 influences SnRK1 inhibition.

We took advantage of the two AL2 mutants: non-phosphorylatable mutant S109G and a phosphomimic mutant S109D (aspartate substitution), and tested whether these two mutants inhibit SnRK1 activity. Because CaLCuV AL2 wild-type protein significantly inhibited SnRK1 activity at a 4:1 molar ratio of AL2 to SnRK1-KD (55% reduction of

SnRK1 autophosphorylation and 73% reduction of eIF(iso)4E phosphorylation), in this test a 4:1 molar ratio of AL2 S109G or S109D to SnRK1-KD was incubated with

135

eIF(iso)4E, which serves as a substrate protein. The SnRK1-KD autophosphorylation and eIF(iso)4E phosphorylation in reactions containing AL2 S109G or S109D were compared with corresponding phosphorylation signals in the reaction without AL2 proteins.

SnRK1-KD autophosphorylation is greatly inhibited by CaLCuV AL2 S109G, and measurement of 32P incorporation of SnRK1-KD autophosphorylation indicates S109G inhibited 99.7% autophosphorylation activity (Figure 3.2B, Table 3.5). In contrast, wild-type AL2 inhibited 54.9% SnRK1 autophosphorylation activity, and S109D inhibited 51.5% autophosphorylation activity (Table 3.4). Thus, the inhibitory effect by

AL2 S109G is apparently much greater than that of wild-type AL2 or S109D. The reason for this is unknown.

SnRK1-KD transphosphorylation, which is indicated by eIF(iso)4E phosphorylation, is also reduced in presence of AL2 S109G or S109D. The inhibition level by AL2 wild-type,

S109G and S109D are 73.1%, 66.5%, and 80.9% respectively (Figure 3.2C, Table 3.4).

Thus all three proteins inhibit SnRK1-KD transphosphorylation.

In summary, we conclude that AL2 wild-type, S109G and S109D proteins all inhibit

SnRK1 autophosphorylation and transphosphorylation activity, while S109G showed particularly a strong inhibitory impact on SnRK1-KD autophosphorylation.

136

3.2.6 Phosphorylation of CaLCuV AL2 does not disrupt interaction with SnRK1

The geminivirus AL2 protein is pathogenicity factor that manipulates several cellular pathways to favor viral infection and replication. During this process, many host proteins, including SnRK1 and ADK are targeted by AL2 through direct protein-protein interaction.

Having shown that mutations at the SnRK1 phosphorylation site of CaLCuV AL2 do not affect SnRK1 inhibition, we further tested whether the AL2-SnRK1 interaction is influenced by mutations at S109 in a yeast two-hybrid assay.

To generate a bait protein, Arabidopsis SnRK1 was cloned into a pAS2 vector in which

SnRK1 is fused to GAL4 DNA binding domain (BD). The CaLCuV AL2 wild-type,

S109G and S109D genes were cloned into pACT2 vector to generate GAL4 activation domain (AD) fusion proteins (prey proteins). Bait and prey plasmids were co-transformed into yeast strain PJ64-9a, which has His3 and Ade2 reporter genes. After transformation, yeast cells were selected on synthetic medium lacking leucine and tryptophan, because pAS2 and pACT2 contain Trp1 and Leu2 markers respectively. Protein interaction was indicated by growth of cells on medium lacking leucine, tryptophan, histidine and adenine. Interaction between SnRK1 and TGMV AL2 served a positive control. The combination of SnRK1-DRB4, SnRK1-DCL4 and DRB4-CaLCuV AL2 (wild-type) were used as negative controls. First, all the yeast cells grew well on medium lacking leucine and tryptophan (Figure 3.5), indicating the presence of pAS2 and pACT2 plasmid in these cells. When tested on medium lacking leucine, tryptophan, histidine and adenine, robust cell growth was observed for cells co-expressing SnRK1 together with CaLCuV

137

AL2 wild-type, or S109G, or S109D (Figure 3.5). However, cells did not grow when

DRB4 or DCL4 was co-transformed with SnRK1. Because DRB4 and DCL4 have been shown to be a pair of binding partners (Nakazawa, et al. 2007), we used this combination to rule out the possibility that DRB4 or DCL4 were not expressed in yeast cells. Our results showed DRB4 and DCL4 interact in yeast cells. Altogether, the yeast two-hybrid results suggest CaLCuV AL2 wild-type, as well as S109G and S109D mutants interact with SnRK1 in a specific manner. We also confirmed the interaction between SnRK1 and

TGMV AL2.

The Yeast two-hybrid assay suggested that SnRK1 interacts with both wild-type and mutants form of CaLCuV AL2, however, it is possible that the subcellular location of

SnRK1-AL2 complexes may be impacted by AL2 mutations. To address this question, we then performed bimolecular fluorescence complementation (BiFC) assays to locate the subcellular SnRK1 and CaLCuV interaction in vivo. In this method, constructs expressing

SnRK1, CaLCuV AL2 and control proteins TGMV AL2, DCL4 and DRB4, were fused to the N- or C-terminal portions of yellow fluorescent protein (YFP) and introduced into N. benthamiana leaf cells by agroinfiltration. Association of interacting partners reconstitutes YFP, resulting in fluorescence. The location of this fluorescence reveals where the interacting protein complexes accumulate in the cell. Histone H2B fused to red fluorescent protein served as a nuclear marker. Cells expressing oppositely tagged

138

proteins and RFP-H2B were viewed under a confocal microscope 48 hours after agroinfiltration. As expected, SnRK1 and TGMV AL2 interact in both nucleus and cytoplasm (Figure 3.6). Interestingly, we observed that SnRK1 forms complexes with

CaLCuV AL2 wild-type exclusively in the nucleus (Figure 3.6). Furthermore, SnRK1 also interacts with CaLCuV AL2 S109G and S109D mutants in the nucleus. DCL4 and

DRB4 also interact in the nucleus and cytoplasm, but DCL4 does not interact with

SnRK1 (Figure 3.6).

Together, these experiments suggest CaLCuV AL2 interacts with SnRK1 in both yeast cells and N. benthamiana leaf epidermal cells, and the SnRK1-AL2 binding is not affected by AL2-S109G or S109D mutations. Although aspartate substitution at S109 may not function the same as phosphorylation, our data do not support the hypothesis that phosphorylation at S109 changes the AL2 interaction with SnRK1.

3.2.7 Phosphorylation of CaLCuV AL2 does not disrupt interaction with ADK

We have obtained strong evidence that CaLCuV AL2 proteins interact with SnRK1, and their interaction with SnRK1 is not disrupted by glycine or aspartate substitution at AL2

S109. To investigate the function of AL2 phosphorylation by SnRK1, one important approach is to test whether AL2 mutants S109G and S109D have different binding

139

activity to other host proteins. Because we also know from earlier studies that TGMV

AL2 interacts with and inactivates ADK (Wang, et al. 2003), we asked if CaLCuV

AL2-ADK interaction is affected by AL2 mutations at S109. To test this, we employed a

BiFC assay. Construction of BiFC vectors containing Arabidopsis ADK, CaLCuV AL2 and TGMV AL2 has been described earlier. ADK is a cytoplasmic protein, whereas geminivirus AL2 localizes to both the cytoplasm and the nucleus (Yang, et al. 2007,

Wang, et al. 2003). When oppositely tagged ADK and CaLCuV AL2 fusion proteins were tested, strong YFP fluorescence was observed both in the nucleus and the cytoplasm

(Figure 3.7), indicating that CaLCuV AL2 interacts with ADK in vivo. As expected,

TGMV AL2-ADK complexes were also observed in both nucleus and the cytoplasm

(Figure 3.7). For comparison, it is intriguing to observe robust interaction between

SnRK1 and CaLCuV AL2 S109G or S109D in the nucleus and the cytoplasm as well

(Figure 3.7). That DCL4 (negative control) did not interact with ADK indicates that

CaLCuV Al2-ADK binding is specific.

We concluded from this experiment that CaLCuV AL2 wild-type, S109G or S109D interact with ADK in the nucleus and the cytoplasm of N. benthamiana cells.

3.3 Discussion

Transgenic expression of TGMV AL2 or BCTV L2 conditions enhanced susceptibility to

140

infection by different geminiviruses and TMV, an RNA virus). The fact that AL2 and L2 cause the transgenic plants to be more vulnerable to both DNA and RNA viruses indicates that AL2 and L2 repress plant innate immunity. Evidence to date suggests SnRK1 is a key target that is responsible for the enhanced susceptibility phenotype. Previous studies illustrated that overexpression of SnRK1 in transgenic N. benthamiana plants delayed infection of TGMV/BCTV or CaLCuV, while knockdown of SnRK1 resulted in accelerated infection (see Table 3.1 for summary). It has also been shown that SnRK1 physically interacts with a number of geminivirus pathogenicity factors including AL2 from TGMV, L2 from BCTV and SCTV, and C1 from TYLCCNV. However, consequences of interaction between SnRK1 and these pathogenicity factors are not fully understood. In our study of TGMV/BCTV, SnRK1 was shown to be inhibited by AL2/L2 both in vitro and in vivo through direct protein-protein interaction. However, it has also been reported that SnRK1 phosphorylates TYLCCNV C1 protein and causes delayed symptom appearance. Because C1 is encoded by betasatellite DNA of monopartite begomoviruses, it does not exist in bipartite begomoviruses or curtoviruses. In addition, the amino acid sequences of C1 show no significant similarities with TGMV/CaLCuV

AL2 or BCTV L2. Although TYLCCNV also encodes AL2 protein by genome A, whether TYLCCNV AL2 interacts with SnRK1 is still unknown. SnRK1-mediated C1

141

phosphorylation could be a unique mechanism for TYLCCNV to gain better adaptation and possibly acquire some evolutionary advantages. CaLCuV AL2 was suspected to be a

SnRK1 substrate because it contains a SnRK1 consensus site. In this study, we reexamined the hypothesis that SnRK1 activity is inhibited by TGMV/CaLCuV AL2.

Our data demonstrated that SnRK1-KD activity was inhibited by both TGMV AL2 and

CaLCuV AL2. SnRK1-KD activity was evaluated by measuring both autophosphorylation and phosphorylation of substrate proteins (transphosphorylation).

HA2-HIS6 tagged SnRK1-KD transiently expressed in N. benthamiana cells has been shown highly active (Mohannath, et al. 2014), suggesting SnRK1-KD was activated by proper posttranslational modifications in plant tissue. In our hands, this plant-expressed

SnRK1-KD strongly phosphorylates GST-SAMS peptide or eIF(iso)4E. The in vitro

SnRK1 kinase assay suggested that SnRK1-KD transphosphorylation was substantially inhibited by TGMV AL2. Consistent with this result, we also found CaLCuV AL2 inhibited SnRK1-KD in regards to both autophosphorylation and transphosphorylation activity. In addition, no significant phosphorylation of TGMV AL2 was observed when incubated with SnRK1-KD, confirming that TGMV AL2 was not a SnRK1 substrate.

Presence of a SnRK1 consensus site on CaLCuV AL2 provides a possibility that SnRK1 can phosphorylate CaLCuV AL2. It was recently reported that CaLCuV AL2 was

142

phosphorylated in vitro using a full-length SnRK1 made in E. coli cells and activated in vitro by GRIK1 (Shen, et al. 2014). Our data suggested plant-expressed SnRK1-KD phosphorylates CaLCuV AL2 at low levels. Incorporation of 32P in 100 ng CaLCuV AL2 protein was only 8% of that in 10 ng GST-SAMS (Table 3.5). Surprisingly, incubation of

50 ng CaLCuV AL2 proteins resulted in stronger phosphorylation signal (8341, arbitrary units) than incubation of 100 ng AL2 (2051, arbitrary units). The SnRK1-CaLCuV AL2 interaction clearly shows a puzzling “dual effect”-SnRK1 phosphorylates CaLCuV AL2, but SnRK1 is inhibited by CaLCuV AL2. While our in vitro kinase studies did not provide a clear answer for the weak phosphorylation of CaLCuV AL2, we suspect the

“dual effect” of SnRK1-CaLCuV AL2 interaction may cause the limited AL2 phosphorylation. Stronger phosphorylation of a lesser amount of AL2 protein also confirmed the previous observation that SnRK1 activity was inhibited by AL2. This

SnRK1-CaLCuV AL2 relationship is also different from the typical negative feedback systems, in which the products of reaction inhibit the process. In contrast, in the SnRK1 activity test, the phosphomimic form of AL2 (S109D) shows similar SnRK1 inhibition with AL2 wild-type, suggesting both substrate and product are inhibitory. The fact that the analogue of phosphorylated AL2 (product of kinase reaction) does not enhance its capability to inhibit SnRK1 indicates inhibition of SnRK1 by AL2 is not a negative

143

feedback.

Interestingly, the nonphosphorylatable form of CaLCuV AL2 (S109G) shows apparently stronger inhibition of SnRK1 autophosphorylation activity than AL2 wild-type or S109D

(Figure 3.2). While the inhibition mechanism of SnRK1 by AL2 remains a mystery, there is a clue from the observation that AL2 S109G has greater inhibitory effect on SnRK1 autophosphorylation. Enzyme inhibition can be either reversible or irreversible.

Irreversible inhibition usually involves covalent modifications of enzymes that permanently damage enzyme activity. In the case of AL2-SnRK1 interaction, it is unlikely that AL2 covalently binds to SnRK1 or permanently destroys SnRK1 activity.

The first evidence is that the AL2-SnRK1 complex can be easily separated by SDS-PAGE, indicating no covalent bond is formed to link AL2 and SnRK1. And the second observation is that SnRK1 phosphorylates CaLCuV AL2, indicating binding of AL2 does not completely destroy SnRK1 function. Thus AL2 inhibition is more likely reversible.

There are two broad classes of reversible inhibition mechanisms: competitive and uncompetitive/noncompetitive. The result that S109G has greater inhibition on SnRK1 autophosphorylation activity leads us to suspect AL2 inhibition occurs by a competitive mechanism. In the case of competitive inhibition, inhibitors bind to the active site of the enzyme and compete with other substrates. Because AL2 S109G protein is

144

nonphosphorylatable, the binding of SnRK1 active site and S109G is likely more stable.

This stable binding prevents other substrates (including SnRK1 itself) from accessing the

SnRK1 active site, resulting in greater reduction of SnRK1 autophosphorylation.

However without more empirical data, we cannot draw any firm conclusions. A quantitative kinetic analysis would be necessary to test the hypothesis that AL2 inhibition follows a competitive mechanism.

Although SnRK1 phosphorylates CaLCuV AL2 at position S109, our experiments did not address the function of AL2 phosphorylation in regards to virus infectivity or AL2 pathogenicity. However, Shen et al. found that the AL2 S109G substitution delays symptoms by about 1 day relative to wild-type virus or virus S109G mutant (Shen, et al.

2014). Early symptoms (6-13 dpi) caused by AL2 S109D were slightly less severe than the symptoms caused by wild-type virus or S109G mutant. However, symptoms 14 days post-inoculation were almost the same for wild-type virus, S109G, or S109D mutants

(Shen, et al. 2014). AL2 is a multifunctional protein that interacts with at least two host proteins, and it is also a transcription activation factor that works along with host transcription machinery for the expression of late viral genes. It is possible that phosphorylation of AL2 may have some effects on these functions. Although the yeast two-hybrid experiments and BiFC assays described in this study suggested

145

phosphorylation of AL2 neither changed the interaction with SnRK1 in yeast or plant cells, nor disrupted the ADK-binding in plant cells, other AL2 activities may be impaired by phosphorylation.

In summary, this study confirmed the TGMV AL2 and CaLCuV AL2 inhibited SnRK1 activity in vitro. We also showed SnRK1 phosphorylates CaLCuV, but not TGMV AL2.

In addition, CaLCuV AL2 mutants that contain amino acid substitutions at the SnRK1 phosphorylation site (S109G, S109D) did not affect interactions between AL2 and

SnRK1, or AL2 and ADK.

3.4 Materials and methods

3.4.1 Gene cloning

The CaLCuV AL2 wild-type and S109D and S109G genes were provided by the Dr. Linda

Hanley-Bowdoin lab. The CaLCuV AL2 gene was amplified by PCR using the forward primer 5'- CTTAATTAACGCCATGGCGGTAGAAGACACT and the reverse primer 5'-

CGGCGCGCCCAGCGGTGTAAGCGTTCTTTGC. The SnRK1.2 gene was amplified by PCR using the forward primer 5'-

CTTAATTAACATGGATCATTCATCAAATAG and the reverse primer

5'-CGGCGCGCCGATCACACGAAGCTCTGTAAG. In the primer sequences provided,

146

recognition sequences for the restriction endonucleases Pac1 and Asc1 are underlined.

The PCR products were digested with Pac1 and Asc1, and ligated into pUC18 plasmids.

These genes were then subcloned into other vectors, such as pRSET, BiFC vectors pYC1, pYN1, p2YC, and p2YN and yeast two-hybrid vectors pACT2 and pAS2 using Pac1 and

Asc1.

3.4.2 Preparation of SnRK1-KD and SnRK1-KDKR proteins

SnRK1-KD and SnRK1-KDKR were cloned into pJL50 vector (TRBO vector), a

Tobacco mosaic virus (TMV) based overexpression vector to generate N-terminal

HA2His6-tagged proteins. The plasmids were transformed into A. tumefaciens C58C1, and cultures of these transformants were used to infiltrate N. benthamiana leaves as described.

Infiltrated leaf tissue was collected about 5 days post-infiltration and ~2 g of tissue was ground in liquid nitrogen. The powder was then homogenized in 10-20 ml of lysis

buffer containing 50 mM HEPES (pH 7.5), 0.1% Triton X100, 10 mM MgCl2, 1 mM

EGTA, 1 mM benzamidine, 10 M MG132-proteasomal inhibitor (Sigma-Aldrich,

C2211-5MG), plant protease inhibitor cocktail (Sigma-Aldrich, P9599-1ML), 5 mM

β-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride (PMSF, Sigma-Aldrich,

P7626-1G), 50 mM NaF and 5 mM Na3VO4 (Sigma-Aldrich, S6508) at 4°C for about 15 min. The powder could also be stored at -80°C for future use, and kinase activity was not

147

noticeably decreased for at least one month. The solution was then filtered through miracloth and centrifuged at 12,000 rpm for 20 min at 4°C. Supernatant was then added to 0.5 ml of balanced nickel nitrilotriacetic acid agarose columns (Ni-NTA agarose,

Invitrogen, R90115) and incubated at 4°C on a rocker for 2 to 3 hours. Columns were

washed with 10 ml of wash buffer containing 50 mM NaH2PO4 (pH 8.0), 100 mM NaCl,

0.1% (v/v) Tween 20, 5 mM β-mercaptoethanol, 20 mM imidazole. Proteins were

eluted with 3 ml elution buffer (50 mM NaH2PO4 (pH 8.0), 100 mM NaCl, 0.1% (v/v)

Tween 20, 1 mM DTT, 10% (v/v) glycerol, 250 mM imidazole) at 4°C. Protein concentration was measured using the Bradford assay (Bio-Rad), and also be estimated in

SDS-polyacrylamide (SDS-PAGE) gel followed by coomassie brilliant blue staining.

3.4.3 Expression and purification of SnRK1 substrate proteins in E. coli cells

CaLCuV AL2 and TGMV AL2 genes were cloned into pRSET-B vector (Invitrogen) to

create N-terminal His6-Xpress-tagged recombinant proteins. These plasmids were transformed into E. coli BL21 cells. Protein expression was induced for 4 hours at room temperature by 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Gold

Biotechnology, I2481C). Cells were collected and lysed by sonication in lysis buffer

(10 ml of lysis buffer for 500 ml of cell culture; PBS, 200 mM NaCl, 5 mM EDTA

(pH8.0), 1% NP40, 1 mM PMSF, 1 mg/ml lysozyme, 10 mM imidazole, protease

148

inhibitors). DNA and RNA were digested by 1 g/ml DNaseI and 1 g/ml RNaseA for

15 min at 4°C. Crude extract was centrifuged at 12000 rpm for 20 min at 4°C.

Supernatant was incubated with 0.5 ml of Ni-NTA column (Invitrogen, R901-15) for 1 hour at 4 °C. Columns were washed with 10 ml of wash buffer (PBS, 200 mM NaCl, 5 mM EDTA, 20 mM imidazole, 1% NP40). Proteins were eluted with 2 ml elution buffer

(250 mM imidazole, 50 mM Tris pH 8.0, 100 mM NaCl, 1 mM PMSF, 1 mM DTT, 10%

(v/v) glycerol) at 4°C. Protein concentration was measured using the Bradford assay

(Bio-Rad), and also estimated in SDS-PAGE gel followed by Coomassie brilliant blue staining.

3.4.4 SnRK1 kinase assay

10 to 15 ng of SnRK1-KD or SnRK1-KDKR, 3 µg of substrate proteins and 0.5 l of

-32P-ATP (3000 Ci/mmol; Perkin Elmer) were mixed in 20 l reaction buffer (50 mM

° Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM DTT, 1% Triton X-100) and incubated at 30 C for 30 min. -32P-ATP labeled proteins were separated by electrophoresis on SDS–PAGE gels and the radioactive signal was recorded and quantitated using a phosphorimager

(Bio-Rad). Images were generated by a Bio-RAD Personal Molecular Imager System

(PMI). Phosphorylation signal values (in arbitrary units) were obtained by measuring signal intensity of bands on the phosphor image using Bio-Rad Quantity One software.

149

3.4.5 Yeast two-hybrid analysis

The yeast two-hybrid assays were based on Clontech Matchmaker GAL4 Yeast

Two-Hybrid System (PT3062-1). The full-length SnRK1, CaLCuV AL2, TGMV AL2 and control genes were cloned into pAS2 and pACT2 vectors to generate fusion proteins with

GAL4 DNA binding domain (BD, bait) or GAL4 activation domain (AD, prey). The pAS2 and pACT2 plasmids containing genes of interest were co-transformed into yeast strain PJ64-9a cells using Zymo Research Frozen-EZ Yeast Transformation II Kit

(T2001). The transformed cells were selected on synthetic dropout medium lacking leucine and tryptophan (SD-Leu-Trp) to ensure maintenance of both pAS2 and pACT2 plasmids. Protein interaction between bait and prey proteins was indicated by the growth on SD medium lacking leucine, tryptophan, histidine (SD-Leu-Trp-His) or SD medium lacking leucine, tryptophan, histidine and adenine (SD-Leu-Trp-His-Ade).

3.4.6 BiFC analysis of interactions

The bimolecular fluorescence complementation (BiFC) protocol was based on the method of Hu et al. (Hu, et al. 2002). The SnRK1, CaLCuV AL2, TGMV AL2 and control genes were cloned into BiFC expression vectors pYN, pYC, p2YN and p2YC. The pYN1 and pYC1 vectors contain the N- or C-terminal portions of enhanced yellow fluorescent protein

150

(YFP), with genes of interest cloned as N-terminal fusions. The p2YN and p2YC vectors also contain the N- or C-terminal portions of YFP, with genes of interest cloned as

C-terminal fusions. The BiFC plasmids were transformed into A. tumefaciens C58C1 cells, and transformants were selected on LB agar plates containing kanamycin and tetracycline.

morpholineethanesulfonic acid (MES), acetosyringone, and MgCl2. The final cell density in infiltration buffer was between OD600 0.1 to 0.2. The two types of agrobacterium cultures containing genes of interest were mixed 1:1 and infiltrated to N. benthamiana leaves using a blunt syringe. Histone 2b fused to red fluorescent protein (RFP-H2B) was used as a nuclear marker. Leaf tissue was analyzed by confocal microscopy ~48 h post-infiltration using a Nikon PCM 2000 confocal laser scanning microscope equipped with argon and green helium neon lasers with excitation wavelengths of 488 nm and 544 nm, respectively. To record YFP fluorescence, a band-pass emission filter (EM515/30HQ) with a 450 to 490 nm excitation wavelength and 515 nm emission wavelength was used. To record RFP fluorescence, a 565 nm long-pass filter (E565LP) was used. Images were captured using Simple PCI Software and compiled with Adobe Photoshop.

151

3.5 Figures and tables

Figure 3.1 TGMV AL2 inhibits SnRK1 transphosphorylation activity. SnRK1-KD and GST-SAMS were incubated with varying molar ratios of TGMV AL2 (0, 5 and 10 fold excess of AL2). Transphosphorylation activity of SnRK1-KD was indicated by phosphorylation of GST-SAMS. (A) SnRK1 was incubated with TGMV AL2 at 1:1 ratio (lane 1). SnRK1 and GST-SAMS was incubated with varying amounts of TGMV AL2. SnRK1 pre-incubated with cold ATP was also mixed with GST-SAMS and varying amounts of TGMV AL2. (B) Graph showing relative GST-SAMS phosphorylation or SnRK1 autophosphorylation plotted against increasing TGMV AL2:SnRK1-KD molar ratios. (C) Graph showing relative GST-SAMS phosphorylation plotted against increasing TGMV AL2:pre-incubated SnRK1-KD molar ratios.

Figure 3.1 TGMV AL2 inhibits SnRK1 transphosphorylation activity.

152

Figure 3.2 CaLCuV AL2 inhibits SnRK1-KD. (A) SnRK1-KD and eIF(iso)4E were incubated with varying molar ratios of CaLCuV AL2 wild-type (0, 0.5, 1, 2 and 4 fold excess of AL2), or AL2 S109G and S109D at 4:1 ratio. Transphosphorylation activity of the SnRK1-KD was indicated by the phosphorylation of eIF(iso)4E. Bar charts showing relative (B) SnRK1 autophosphorylation or (C) eIF(iso)4E phosphorylation plotted against increasing CaLCuV AL2:SnRK1-KD molar ratios.

Figure 3.2 CaLCuV AL2 inhibits SnRK1-KD.

153

Figure 3.3 Phylogenetic tree generated from AL2 sequences from 98 representative begomoviruses. The phylogenetic tree was inferred using the Neighbor-Joining method

(Saitou, et al. 1987). The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site.

All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA6.

Figure 3.3 Phylogenetic tree generated from AL2 sequences from 98 representative begomoviruses.

154

Figure 3.4 SnRK1 phosphorylates CaLCuV AL2 at S109. (A) SnRK1-KD was incubated with 10 ng of GST-SAMS (29 kDa) and varying amounts of CaLCuV AL2 wild-type proteins (10-100 ng). (B) SnRK1-KD was incubated with 10 ng of GST-SAMS and varying amounts of CaLCuV AL2 S109G mutant (10-100 ng). (C) Coomassie blue-stained SDS-PAGE gel shows the purity of wild-type CaLCuV AL2 and S109G proteins. 20 ml of E. coli BL21 bacterial lysate containing over-expressed

HA2-His6-CaLCuV AL2 WT or S109G was applied to 0.5 ml of Ni-NTA resin and purified by the batch-bind method. W1 = The first 1 ml of wash solution; E1 = The first

0.5 ml of elution; E2 = The second 0.5 ml of elution. The molecular weight of monomeric CaLCuV AL2 WT or S109G is 16.6 kDa.

Continued

155

Continued

Figure 3.4

Figure 3.4 SnRK1 phosphorylates CaLCuV AL2 at S109.

156

Figure 3.5 SnRK1 interacts with CaLCuV AL2 S109, S109G and S109D in yeast cells.

The yeast two hybrid assays were used to detect interactions, indicated by growth on media lacking His and Ade. Interactions were observed with full-length SnRK1-CaLCuV

AL2 wild-type, SnRK1-AL2 S109G and SnRK1-AL2 S109D (sections 1-3). SnRK1 interacts with TGMV AL2 (section 4). Positive controls DCL4-DRB4 interacted with each other (section 8), but not with SnRK1 (sections 5 & 6). DRB4 does not interact with

CaLCuV AL2 wild-type (section 7).

Figure 3.5 SnRK1 interacts with CaLCuV AL2 S109, S109G and S109D in yeast cells.

157

Figure 3.6 CaLCuV AL2 S109, S109G and S109D interact with SnRK1 in N. benthamiana leaf cells. Confocal images of representative BiFC interactions in N. benthamiana leaf cells are shown. RFP-H2B is a marker of the nucleus. SnRK1 and CaLCuV AL2 wild-type, S109G, S109D interact in the nucleus (column 1-3, from left). SnRK1 interacts with TGMV AL2 in both the nucleus and the

cytoplasm (column 4). The DCL4 control interacts with DRB4 in both the nucleus and the cytoplasm (column 6), but not with SnRK1 (column 5).

Figure 3.6 CaLCuV AL2 S109, S109G and S109D interact with SnRK1 in N.

benthamiana leaf cells.

158

Figure 3.7 CaLCuV AL2 S109, S109G and S109D interact with ADK in N.

benthamiana leaf cells. BiFC interactions in N. benthamiana leaf cells are

shown. RFP-H2B is a marker of the nucleus. ADK and CaLCuV AL2 wild-type,

S109G, S109D interact in both the nucleus and the cytoplasm (column 1-3, from

left). ADK interacts with TGMV AL2 in both the nucleus and the cytoplasm

(column 4). The DCL4 control interacts with DRB4 in both the nucleus and the

cytoplasm (column 6), but not with ADK (column 5).

Figure 3.7 CaLCuV AL2 S109, S109G and S109D interact with ADK in N. benthamiana leaf cells.

159

Table 3.1 Summary of geminivirus infection in transgenic N. benthamiana plants.

Transgenic anti-sense SnRK1 (knockdown) N. benthamiana

viruses BCTV and TGMV TYLCCNV+DNA  Resistance to virus enhanced susceptibility enhanced susceptibility

Virus dose reduced virus dose n/a Latent period reduced latent period reduced latent period Disease symptoms similar symptoms similar symptoms Viral DNA accumulation similar viral DNA level higher viral DNA level

Transgenic sense SnRK1 (overexpression) N. benthamiana

viruses BCTV and TGMV TYLCCNV+DNA  Resistance to virus Enhanced resistance enhanced resistance

Virus dose increased virus dose n/a Latent period longer latent period longer latent period Disease symptoms similar symptoms similar symptoms Viral DNA accumulation similar viral DNA level lower viral DNA level

160

Table 3.2 TGMV AL2 inhibits SnRK1-KD activity.

SnRK1-KD without pre-incubation

phosphorylation Relative AL2: SnRK1 substrate signal phosphorylation* Inhibition# 0:1 GST-SAMS 4273 100% 0%

5:1 GST-SAMS 3301 77.3% 22.7%

10:1 GST-SAMS 2134 49.9% 50.1%

0:1 auto 559 100% 0%

5:1 auto 536 95.9% 4.1%

10:1 auto 513 91.8% 8.2%

Pre-incubated SnRK1-KD with unlabeled ATP

phosphorylation Relative AL2: SnRK1 substrate Inhibition# signal phosphorylation* 0:1 GST-SAMS 5791 100% 0%

5:1 GST-SAMS 5147 88.9% 11.1%

10:1 GST-SAMS 2921 50.4% 49.6%

*Relative phosphorylation represents the percentage of GST-SAMS phosphorylation or SnRK1-KD autophosphorylation compared to the phosphorylation in the reaction without AL2 (45269).

#Inhibition represents the reduction of GST-SAMS phosphorylation compared to GST-SAMS phosphorylation in the reaction without AL2 (Inhibition = 1 - Relative phosphorylation). Continued

161

Continued

Table 3.2 TGMV AL2 inhibits SnRK1-KD activity. SnRK1-KD (with or without pre-incubation with cold ATP) and GST-SAMS were incubated with varying molar ratios of TGMV AL2 (0, 5 and 10 fold excess of AL2). Radioactivity of 32P-labeled bands was recorded by a phosphor screen, which was scanned by a Bio-Rad Personal Molecular

Imager (PMI) System to generate a phosphorylation image. Phosphorylation signal values (in arbitrary units) were obtained by measuring signal intensity of bands on the phosphorylation image using Bio-Rad Quantity One software.

162

Table 3.3 CaLCuV AL2 inhibits SnRK1-KD transphosphorylation activity.

phosphorylation Relative Inhibition# AL2 AL2:SnRK1 substrate signal phosphorylation*

wt 0:1 eIF4E 45269 100% 0%

wt 0.5:1 eIF4E 37343 82.5% 17.5%

wt 1:1 eIF4E 31319 69.2% 30.8%

wt 2:1 eIF4E 14831 32.8% 67.2%

wt 4:1 eIF4E 12170 26.9% 73.1%

S109G 4:1 eIF4E 15165 33.5% 66.5%

S109D 4:1 eIF4E 8636 19.1% 80.9%

*Relative phosphorylation represents the percentage of eIF(iso)4E phosphorylation compared to eIF(iso)4E phosphorylation in the reaction without AL2 (45269). #Inhibition represents the reduction of eIF(iso)4E phosphorylation compared to eIF(iso)4E phosphorylation in the reaction without AL2 (Inhibition = 1 - Relative phosphorylation).

Table 3.3 CaLCuV AL2 inhibits SnRK1-KD transphosphorylation activity. SnRK1-KD and eIF(iso)4E were incubated with various molar ratios of CaLCuV AL2 wild-type (0,

0.5, 1, 2 and 4 fold excess of AL2), or AL2 S109G and S109D at 4:1 ratio. Radioactivity of 32P-labeled bands was recorded by a phosphor screen, which was scanned by a

Bio-Rad Personal Molecular Imager (PMI) System to generate a phosphorylation image.

Phosphorylation signal values (in arbitrary units) of eIF(iso)4E phosphorylation were obtained by measuring signal intensity of bands on the phosphorylation image using

Bio-Rad Quantity One software.

163

Table 3.4 CaLCuV AL2 inhibits SnRK1-KD autophosphorylation activity

phosphorylation Relative Inhibition# AL2 AL2:SnRK1 substrate signal phosphorylation*

wt 0:1 auto 265792 100% 0%

wt 0.5:1 auto 286934 107.9% 0%

wt 1:1 auto 239710 90.2% 9.8%

wt 2:1 auto 69473 26.1% 73.9%

wt 4:1 auto 120004 45.1% 54.9%

S109G 4:1 auto 919 0.3% 99.7%

S109D 4:1 auto 102404 38.5% 51.5%

*Relative phosphorylation represents the percentage of SnRK1 autophosphorylation compared to SnRK1 autophosphorylation in the reaction without AL2 (265792). #Inhibition represents the reduction of SnRK1 autophosphorylation compared to SnRK1 autophosphorylation in the reaction without AL2 (Inhibition = 1 - Relative phosphorylation). SnRK1-KD and eIF(iso)4E were incubated with various molar ratios of CaLCuV AL2 wild-type (0, 0.5, 1, 2 and 4 fold excess of AL2), or AL2 S109G and S109D at 4:1 ratio. Radioactivity of 32P-labeled bands was recorded by a phosphor screen, which was scanned by a Bio-Rad Personal Molecular Imager (PMI) System to generate a phosphorylation image. Phosphorylation signal values (in arbitrary units) of SnRK1 autophosphorylation were obtained by measuring signal intensity of bands on the phosphorylation image using Bio-Rad Quantity One software.

164

Table 3.5 SnRK1 phosphorylates CaLCuV AL2 at S109.

substrate phosphorylation signal

100 ng GST-SAMS (Figure 2B) 24757

100 ng CaLCuV AL2 (wt) 2051

50 ng CaLCuV AL2 (wt) 8340

20 ng CaLCuV AL2 (wt) 1488

10 ng CaLCuV AL2 (wt) 345

no substrate (Figure 2B) 333

100 ng GST-SAMS (Figure 2C) 46358

100 ng CaLCuV AL2 (S109G) 257

50 ng CaLCuV AL2 (S109G) 156

20 ng CaLCuV AL2 (S109G) 158

10 ng CaLCuV AL2 (S109G) 148

no substrate (Figure 2C) 248

Table 3.5 SnRK1 phosphorylates CaLCuV AL2 at S109. SnRK1-KD was incubated with

100ng of GST-SAMS and various amounts of CaLCuV AL2 wild-type or S109G proteins

(0-100 ng). Radioactivity of 32P-labeled bands was recorded by a phosphor screen, which was scanned by a Bio-Rad Personal Molecular Imager (PMI) System to generate a phosphorylation image. Phosphorylation signal values (in arbitrary units) of CaLCuV

AL2 or GST-SAMS phosphorylation were obtained by measuring signal intensity of bands on the phosphorylation image using Bio-Rad Quantity One software.

165

4 CHAPTER 4: Conclusions and Discussion

4.1 Conclusions

4.1.1 CaLCuV and TGMV AL2 inhibit SnRK1 activity in vitro

Previous findings suggested that TGMV AL2 and BCTV L2 inhibited the autophosphorylation activity of insect cell-expressed SnRK1 (Wang, et al. 2003).

However, whether AL2 proteins inhibit kinase activity of SnRK1 expressed in plant tissue is unclear. Therefore, we confirmed that the TGMV AL2 and CaLCuV AL2 inhibited SnRK1 activity in vitro as chronicled in Chapter 2. We transiently expressed

SnRK1-KD in N. benthamiana leaf cells and purified it using Ni-NTA chromatography.

This plant-expressed SnRK1-KD efficiently phosphorylated substrate proteins

GST-SAMS and AteIF(iso)4E, suggesting SnRK1-KD was highly active. Viral AL2 proteins from TGMV and CaLCuV were expressed and purified from E. coli BL21 cells.

We showed that both TGMV and CaLCuV AL2 inhibited transphosphorylation activity of

SnRK1-KD, indicated by reduced phosphorylation of GST-SAMS or AteIF(iso)4E.

Moreover, CaLCuV AL2 apparently inhibited the autophosphorylation activity of

166

SnRK1-KD. Taken together, we demonstrated that AL2 from TGMV and CaLCuV inhibited plant-expressed SnRK1-KD in vitro. This discovery is consistent with the previous finding that TGMV AL2 inhibited insect cells-expressed SnRK1. The inactivation of SnRK1 by TGMV and CaLCuV AL2 may represent a viral conterdefense mechanism.

4.1.2 SnRK1 phosphorylates CaLCuV AL2 at S109

The majority of New World begomoviruses, including CaLCuV, contain a conserved

SnRK1 recognition site on the C-terminus. The Hanley-Bowdoin lab recently reported that SnRK1 phosphorylated CaLCuV AL2 at the predicted SnRK1 site S109 (Shen, et al.

2014). In their lab, the full-length SnRK1 was expressed and purified from E. coli cells, and subsequently activated by a SnRK1 upstream kinase GRIK1. In Chapter 3, we performed an in vitro kinase assay to test the phosphorylation of CaLCuV AL2 by plant-expressed SnRK1. We showed that this plant-expressed SnRK1 phosphorylated

CaLCuV AL2, although phosphorylation signal is weak. We also showed glycine substitution at S109 blocks AL2 phosphorylation, suggesting the phosphorylation site of

CaLCuV AL2 is S109. In contrast, the similar in vitro kinase assay indicated SnRK1 could not phosphorylate TGMV AL2, which lacked a phosphorylatable residue at the corresponding consensus site. AL2 is multifunctional protein that binds and interferes

167

with at least two host proteins, however which AL2 activity is affected by the phosphorylation remains unclear. To address this question, we tested the impact of mutations of S109 on some AL2 activities. In these tests, AL2 mutants that contain nonphosphorylatable amino acid substitutions (S109G) or phosphorylation mimics

(S109D) did not disrupt the protein interaction between AL2 and SnRK1, or AL2 and

ADK. In addition, we showed AL2 wild-type, S109G and S109D all inhibited SnRK1 activity. Interestingly, S109G display extraordinary strong inhibition to SnRK1 autophosphorylation. In summary, our results suggested SnRK1 phosphorylated CaLCuV

AL2 at S109, while SnRK1 did not phosphorylate TGMV AL2. We also showed phosphorylation of CaLCuV AL2 do not disrupt its interaction with SnRK1 or ADK, or impair its ability to inhibit SnRK1. Nevertheless, the consequence of AL2 phosphorylation needs further investigation. The fact that SnRK1 phosphorylates

CaLCuV AL2, and CaLCuV AL2 inhibits SnRK1, suggests a complicated relationship between the two proteins.

4.1.3 SnRK1 interacts with eIF4E/iso4E and phosphorylates eIF(iso)4E in vitro

We previously demonstrated that SnRK1 conditions an innate antiviral defense effective against DNA and RNA viruses, including geminiviruses and TMV. We also showed that the geminivirus pathogenicity proteins AL2 and L2 interact with and inactive SnRK1 as a

168

counter-defense. However, because SnRK1 has a multitude of targets, the mechanism by which SnRK1 interferes with viral infectivity was elusive. Here, we present evidence that translation initiation factors eIF4E and eIF(iso)4E are novel SnRK1 substrates. First, we observed that Arabidopsis eIF4E/iso4E contain two consensus

SnRK1 phosphorylation sites (S33 and T55) that are conserved among higher plants, invertebrates, and yeast, but are absent from vertebrate eIF4E. We then showed that

SnRK1 phosphorylates eIF(iso)4E in vitro at these sites, and interacts with these initiation factors in the cytoplasm of plant cells. The protein-protein interaction between SnRK1 and eIF4E/iso4E was also detected by yeast two-hybrid assays and by co-IP. By contrast, AL2 and SnRK1 interact in the cytoplasm and the nucleus. To summarize, we provided evidence that Arabidopsis SnRK1 physically interacts with eIF4E/iso4E and phosphorylates eIF(iso)4E in vitro.

4.1.4 Arabidopsis eIF4E/iso4E phosphorylation leads to translational inhibition

To study the impact of eIF4E phosphorylation in vivo, we developed a reconstructed yeast system in which the yeast eIF4E deletion strain (cdc33) was complemented by

Arabidopsis eIF4E/iso4E or human eIF4E. We found that while Arabidopsis eIF4E/iso4E can complement this strain, expression of the SnRK1 kinase domain

(SnRK1-KD) inhibited growth of the complemented cells. Polysome profiling assays

169

revealed that SnRK1-KD also inhibited protein synthesis, as judged by a reduction in polysomes and accumulation of 60S ribosomal subunits and 80 S monosomes. By contrast, the growth of yeast cdc33 cells maintained by human eIF4E which lacks a

SnRK1 phosphorylation site was not significantly impacted by SnRK1-KD, and polyribosomes were largely unaffected. These findings suggest that Arabidopsis eIF4E/iso4E phosphorylation by SnRK1 inhibits translation, and may represent an antiviral defense mechanism analogous to PKR phosphorylation of eIF2 in vertebrates.

4.2 Discussion

4.2.1 A complex relationship between SnRK1 and CaLCuV AL2

Our data demonstrated that SnRK1-KD activity was inhibited by CaLCuV AL2, as judged by reduced autophosphorylation and transphosphorylation. We also showed that

SnRK1 phosphorylated CaLCuV AL2 at S109 in vitro at low levels. The presence of

SnRK1 consensus site on AL2 of many New World (NW) geminiviruses provides a possibility that SnRK1 can phosphorylate these AL2 proteins. However, the absence of the same SnRK1 site on AL2 of all Old World (OW) geminiviruses and about 1/5 NW geminiviruses ruled out the possibility that these AL2 proteins can be phosphorylated by

SnRK1 at this site. The SnRK1-CaLCuV AL2 interaction is a complicated relationship in

170

which SnRK1 phosphorylates CaLCuV AL2, while SnRK1 is simultaneously inhibited by CaLCuV AL2. This complicated relationship may account for the extensively weak phosphorylation of AL2. This SnRK1-CaLCuV AL2 relationship is also different from the typical negative feedback system, in which the products of reaction inhibit the process.

The kinase assay using the phosphomimic form of AL2 (S109D) with SnRK1-KD indicated that SnRK1 inhibition by S109D is not significantly stronger than that by AL2 wild-type. This evidence suggested that the substrate and product are equally inhibitory, thus the AL2 inhibition may not be a negative feedback. However, AL2 inhibition may follow a competitive mechanism. The nonphosphorylatable form of AL2 (S109G), rather than AL2 wild-type or S109D, shows substantially strong inhibition of SnRK1 autophosphorylation activity. The mechanism of SnRK1 inhibition by AL2 remains unknown, but the observation that S109G has greater inhibition on SnRK1 autophosphorylation activity lead us to suspect AL2 inhibition follows the competitive mechanism. In the case of competitive inhibition, inhibitors bind to the active site of the enzyme and compete with other substrates. Because AL2 S109G protein is nonphosphorylatable, the dissociation rate of SnRK1-AL2 S109G complexes could be lower than the rate of SnRK1-AL2 WT. The occupying of SnRK1 active site prevents the subsequent autophosphorylation, resulting in greater reduction of SnRK1

171

autophosphorylation. To confirm the hypothesis that AL2 inhibition follows competitive mechanism, a quantitative kinetic test would be necessary.

4.2.2 The consequences of CaLCuV AL2 phosphorylation by SnRK1

We have shown that SnRK1 phosphorylates CaLCuV AL2 at S109, but we do not fully understand for the consequences of AL2 phosphorylation in regards to virus infectivity or

AL2 function. The Hanley-Bowdoin lab showed disease symptoms caused by virus mutant with AL2 S109G are delayed 1 day relative to the symptoms caused by wild-type virus or the AL2 S109G mutant virus. Early symptoms (6-13 dpi) caused by AL2 S109D are slightly less severe than the symptoms caused by wild-type virus or S109G mutant

(Shen, et al. 2014). However, the symptoms 14 days post-inoculation are comparable for wild-type virus or S109G, S109D mutants. We tested protein interaction between AL2

(WT, S109D and S109G) and SnRK1, or AL2 and ADK by the yeast two-hybrid experiments and BiFC assays. The results showed AL2 WT, S109G and S109D all interact with SnRK1 and ADK, suggesting phosphorylation of AL2 at S109 may not affect its interaction with SnRK1 or ADK. AL2 is a multifunctional protein that interacts with many known and potential host proteins, and it is also a transcription activation factor that works along with host transcription machinery for the expression of late viral genes. To fully understand the function of AL2 phosphorylation at S109, we need to

172

further investigate the impact of the S109 mutation on these AL2 activities.

4.2.3 SnRK1 phosphorylates eIF(iso)4E

We showed Arabidopsis eIF4E/iso4E contain two consensus SnRK1 phosphorylation sites (T67 and T91 in eIF4E, S33 and T55 in eIF(iso)4E). These two sites are conserved among higher plants, invertebrates, and yeast, but are absent from vertebrate eIF4E. We then showed that SnRK1 phosphorylates eIF(iso)4E in vitro at these sites. However, for reasons that are not fully understood, a similar kinase assay has not generated eIF4E phosphorylation signal. In this experiment, both eIF4E and iso4E are expressed from a

pRSET vector to generate His6-Xpress tagged recombinant proteins in E. coli BL21 cells.

We also confirmed the nucleotide sequence of eIF4E in pRSET vector. The two proteins are purified with Ni-NTA chromatography following the same protocol. However, the migration of eIF4E protein suggests the eIF4E band is about 10 kDa larger than expected size. Although the same band can be specifically detected in Western blot with both

-His and -Xpress antibodies, it is possible that the protein that we purified is not eIF4E.

In the SnRK1 kinase assay, we use SnRK1 kinase domain instead of full-length protein, mainly because full-length SnRK1 expressed at very low levels in N. benthamiana leaves.

Therefore it is technically difficult to prepare enough full-length SnRK1 protein for the kinase assay. The protein interaction assays all suggest full-length SnRK1 interacts with

173

eIF4E/iso4E, however yeast two-hybrid experiment suggests SnRK1 kinase only weakly bind to eIF4E/iso4E. Thus we cannot rule out the possibility that the SnRK1 regulatory domain is required for a stronger SnRK1-eIF4E interaction, and this enhanced interaction may account for robust eIF4E phosphorylation. Moreover, the protein interaction data, as well as polysome profile assays in yeast, all support the idea that SnRK1 phosphorylates eIF4E. We will further confirm the hypothesis that SnRK1 phosphorylates eIF4E in vivo using mass spectrometry (MS) to determine the eIF4E phosphorylation states in both yeast and plant cells. We will discuss these experiments immediately below.

Future experiments: Analysis of eIF4E/iso4E phosphorylation in yeast and plant cells.

We have shown SnRK1 interacts with eIF4E/iso4E in vivo and phosphorylates eIF(iso)4E in vitro, which laid the foundation for the future experiments in vivo. In Arabidopsis eIF4E/iso4E-complemented cdc33 yeast, SnRK1 inhibited polysome formation, suggesting eIF4E/iso4E is phosphorylated in the yeast cells. Thus for initial experiments, we would like to analyze the phosphorylation status of eIF4E/iso4E in yeast cells. Mass spectrometry (MS) is the preferred method of phosphorylation analysis because MS is an accurate, sensitive technique for detection of both total and phosphorylated protein. The snf1 mutant will be co-transformed with plasmids pRS413GPD-At4E/iso4E and pRS414CUP1-KD/KDKR. As described in Chapter 3, the expression of wild-type and

174

nonphosphorylatable AA mutant of At4E/iso4E is under control of a constitutive promoter, while expression of KD/KDKR is controlled by a copper inducible promoter.

To recover eIF4E/iso4E proteins for MS analysis, the eIF4E/iso4E will be HA2-His6 tagged. Similar to the polysome profiling assays, the yeast cells will be grown in

galactose medium and SnRK1 expression will be induced by 200mM CuSO4 for several hours. The eIF4E/iso4E proteins will be extracted and purified with Ni-NTA chromatography and HA-IP, and then fractionated by PAGE. Proteins bands will be excised and prepared for MS.

The goal of the in vivo phosphorylation analysis is to determine whether SnRK1 phosphorylates eIF4E/iso4E in plant cells. We would like to analyze the phosphorylation status of eIF4E/iso4E in N. benthamiana cells. Because plants have an expanded SnRK family and each family member recognizes similar peptide patterns, this complicated SnRK background in plant cells may complicate data interpretation of the in vivo analysis. However, GST-SAMS phosphorylation with crude extract of N. benthamiana leaves suggests endogenous SnRK1/2/3 kinase activity is substantially lower than transiently expressed SnRK1-KD, thus transient expression of SnRK1-KD may generate significantly higher eIF4E/iso4E phosphorylation than the background.

HA2His6-tagged eIF4E/iso4E and SnRK1-KD/KDKR will be co-expressed in N.

175

benthamiana leaves. The eIF4E/iso4E proteins will be extensively purified as described previously, and their phosphorylation status will be analyzed by MS. We predict a fraction of eIF4E/iso4E proteins are phosphorylated at the two SnRK1 sites following expression of SnRK1-KD in N. benthamiana.

4.2.4 The importance of SnRK1 phosphorylation sites on eIF4E/iso4E

The yeast complementation assays with eIF4E/iso4E mutants provide some evidence of the importance of the two SnRK1 phosphorylation sites. Mutations in the first SnRK1 phosphorylation site (eIF4E T55, eIF(iso)4E S33) shows a dramatical impact on yeast complementation. Specifically, alanine and aspartate substitution block complementation, while a valine substitution show no significant effect to complementation. Both alanine and valine are small, nonpolar amino acids that cannot be phosphorylated, and their structures are similar to the structure of serine/threonine, thus they are widely used to generate nonphosphorylatable mutants. However, we cannot rule out the possibility that slight structure differences in amino acids will significantly change the protein structure and result in nonfunctional protein. The mechanisms, by which an alanine substitution damages eIF4E, while a valine substitution exhibits no effect to eIF4E function, are not fully understood. However, aspartate substitution causes eIF4E deficit implies that phosphorylation on S33/T55 is inhibitory to eIF4E. Interestingly, mutations in the second

176

SnRK1 phosphorylation site (eIF4E T67, eIFiso4E T91) have no effect on complementation. This suggests phosphorylation in the second site is not critical to eIF4E regulation. It is important to note that the two SnRK1 sites are in two adjacent -sheets, and both residues are located on the surface of the eIF4E/iso4E protein. It is not clear why one SnRK1 site is more critical than the other.

4.2.5 SnRK1-mediated eIF4E/iso4E phosphorylation inhibits polysome formation

We have shown expression of SnRK1-KD in yeast cdc33 cells complemented by

Arabidopsis eIF4E or iso4E inhibits cell growth. In these cells, polysome formation is substantially suppressed, as judged by accumulated 60 S and 80 S ribosomal subunits and reduced polyribosomes. The suppressed polysome profiles indicate reduced global translational activity in these cells. Human eIF4E serves as a negative control because it lacks a phosphorylatable residue at the SnRK1 sites, and it cannot be phosphorylated in vitro by SnRK1. The cell growth and polysomes in yeast complemented by human eIF4E shows much milder inhibition by SnRK1 than that in the cells complemented by

Arabidopsis eIF4E/iso4E. Taken together, these findings in the reconstructed yeast system link SnRK1–mediated eIF4E/iso4E phosphorylation to reduced polysome formation. However, we do not show whether eIF4e/iso4E phosphorylation inhibits protein synthesis in planta. To test the impact of eIF4E/iso4E phosphorylation on protein

177

synthesis in plant cells, we have designed two experiments as described immediately below. In addition, we are also interested in the molecular basis of eIF4E/iso4E-meidated translational inhibition.

Future experiments: Analysis of the impact of eIF4E/iso4E phosphorylation on protein synthesis in planta.

Polysome profiling assays in yeast cells suggest SnRK1 inhibits polysome formation and the inhibition is associated with Arabidopsis eIF4E/iso4E. We would like to validate the result in plant cells. We will transiently express FLAG-tagged SnRK1-KD/KDKR from

TRBO vectors in N. benthamiana leaves. Because protein expression from TRBO vectors is much higher than the endogenous levels, the eIF4E/iso4E phosphorylation caused by

SnRK1-KD will be greater than the endogenous SnRK family members. The impact of

SnRK1-KD/KDKR expression on protein synthesis will be evaluated by polysome profiling assays. We predict that expression of SnRK1-KD, but not KDKR, will cause significant inhibition of polysome formation.

Another direction that we would like to investigate is the molecular mechanisms of eIF4E/iso4E-mediated translational inhibition. Because eIF4E/iso4E is a translation initiation factor that binds to the mRNA cap structure and eIF4G, we suspect that eIF4E/iso4E phosphorylation may impair one of the two functions. We will test the 178

differences between eIF4E/iso4E wild-type and phosphomimic DD mutant in terms of cap binding or eIF4G interaction. We would also like to determine if SnRK1 phosphorylated eIF4E/iso4E differs from non-phosphorylated proteins in binding to cap structure or eIF4G.

4.3 Significance of the research

4.3.1 First evidence for eIF4E/iso4E kinase in plants

The findings in this thesis demonstrated that eIF4E and iso4E are the novel SnRK1 targets. Previous research has shown that plant eIF4E/iso4E exists in a multi-phosphorylated form in vivo, but eIF4E/iso4E kinase has not been identified.

Previous efforts trying to uncover the eIF4E kinases have been failed. We believe our study is the first to discover a plant eIF4E/iso4E kinase.

4.3.2 First evidence for eIF4E-mediated translational regulation in plants

We discovered that aspartate substitution at eIF4E S33 or eIF(iso)4E T55 blocks yeast complementation, while valine substitution has no effect. This result implies that phosphorylation of eIF4E/iso4E is inhibitory. SnRK1-KD expression in yeast cdc33 cells resulted in slow cell growth and reduced polyribosomes, and this inhibition is associated with Arabidopsis eIF4E/iso4E, but not human eIF4E. These findings indicate

179

Arabidopsis eIF4E/iso4E phosphorylation by SnRK1 inhibits polysome formation and translation rate. Although eIF4E and iso4E have been shown to be in multiple phosphorylated states in various plants, there are no reports about the function of these phosphorylation events in protein synthesis. Therefore, to our knowledge, this is the first evidence in plants that translation is regulated via eIF4E phosphorylation.

4.3.3 First link of translational regulation to antiviral response in plants

Previous studies established SnRK1’s role in basal antiviral responses. In this thesis, we provided evidence that the translational regulation by SnRK1-mediated eIF4E phosphorylation may account for the antiviral activity. Almost all viruses rely on host translation machinery to synthesize viral proteins, thus translation is a valuable target for the host to limit viral replication. This defense mechanism is commonly seen in animal system, in which PKR plays a key role in shutting down global translation. However, the translational regulation in plants during viral infection had not been discovered. Our study is the first case in plants showing that eIF4E-mediated translational control is the key mechanism for an antiviral response. Although previous research has shown SnRK1 inhibits the infection of several geminiviruses and RNA viruses, including TGMV, BCTV,

TYLLCCNV, ToMV and TMV, we believe that the SnRK1-eIF4E pathway is a basic antiviral pathway that functions against almost all plant viruses. In short, this study

180

provides the first linkage of translational regulation to antiviral response in plants.

4.3.4 The discovery of SnRK1-eIF4E/iso4E interaction provides potential

applications in agriculture

Because translation inhibition mediated by eIF4E/iso4E phosphorylation is a basal defense mechanism, temporally knock-down eIF4E/iso4E or overexpressing eIF4E/iso4E

DD mutant just prior to virus infection will enhance resistance in crops. This provides an opportunity to generate transgenic crops that are resistant to a wide range of viruses. To generate transgenic crops, an antisense eIF4E/iso4E gene or an eIF4E/iso4E DD mutant gene is under the control of an inducible promoter, such as geminivirus CP promoter, or other viral inducible promoters. Thus knock-down of eIF4E/iso4E or overexpression of

DD mutant only occurs upon virus infection. The temporally inhibition of eIF4E/iso4E will prevent or delay viral infection, while has minimum impact on plant growth. The advantage of this strategy is that transgenic plants will defend itself to a specific virus without any treatment. However, their resistance is limited to a narrow spectrum of viruses. The antisense eIF4E/iso4E gene or DD mutant gene can also be controlled by other inducible promoter, so that inhibition of eIF4E/iso4E can be induced by a specific treatment, corresponding to the type of inducible promoter. The value of these transgenic crops is their broad-spectrum viral resistance.

181

4.4 A model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counter defen

se interaction

Previous reports have suggested an important role of SnRK1 in innate antiviral defense in plants. SnRK1 overexpression leads to enhanced resistance to geminiviruses and RNA viruses, while inhibition of SnRK1 results in enhanced susceptibility to these viruses.

Furthermore, virus pathogenicity factors AL2 and L2 interact with and inactivate SnRK1, and this AL2/L2-SnRK1 interaction is a counter-defense mechanism. Although previous studies have illustrated many SnRK1 substrates, including key enzymes in biosynthesis pathways and sugar signaling responses, the substrates most relevant to antiviral defense were not immediately obvious. In this thesis, we have shown eIF4E and iso4E are novel

SnRK1 substrates. We have also shown eIF4E/iso4E phosphorylation at the two SnRK1 sites suppresses yeast complementation and inhibits polysome formation. Thus eIF4E/iso4E phosphorylation could be a mechanism of translational regulation.

Based on knowledge of SnRK1’s role in antiviral defense, SnRK1-AL2 interaction, and

SnRK1-eIF4E/iso4E interaction, we proposed a model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counterdefense interaction (Figure 4.1). SnRK1 is activated by upstream kinases GRIK1/2 by phosphorylating T176 at the T-loop. Geminivirus AL1 protein interacts with GRIK1/2, and may sequester or inhibit their activity. SnRK1

182

activity is indirectly activated by AMP levels, which prevents SnRK1 from dephosphorylation. Adenosine kinase (ADK) catalyzes the generation of AMP from ADP, thus may indirectly regulate SnRK1 activity. ADK and SnRK1 form cytoplasmic complexes, and their activities are linked in vivo, suggesting the ADK-SnRK1 complex may facilitate the cellular response to stresses that cause energy depletion, such as viral infections. SnRK1 phosphorylates eIF4E/iso4E, and this eIF4E/iso4E phosphorylation inhibits translation, thus hinders virus replication. To counteract the ADK and SnRK1 mediated defense, geminivirus pathogenicity factors AL2 and L2 interact with and inhibit both enzymes. This model emphasizes the pivotal role of SnRK1-eIF4E/iso4E interaction in inhibiting protein synthesis and limiting virus replication.

183

4.5 Figures and tables

Figure 4.1 A model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counter defense interaction. SnRK1 is activated by upstream kinases GRIK1/2. Geminivirus AL1 protein interacts with and inhibits GRIK1/2. ADK catalyzes the generation of AMP from ADP, thus may indirectly regulate SnRK1 activity. ADK and SnRK1 form cytoplasmic complexes and their activities are linked in vivo, suggesting the ADK and SnRK1 may act synergistically in response to viruses. Geminivirus pathogenicity factors AL2 and L2 inhibit both ADK and SnRK1. SnRK1 phosphorylates eIF4E/iso4E, and this eIF4E/iso4E phosphorylation inhibits translation, thus hinders virus replication.

Figure 4.1 A model SnRK1:eIF4E/iso4E:AL2/L2 interplay as a defense-counter defense

interaction.

184

REFERENCES 1. Jeske H (2009) Geminiviruses. Current topics in microbiology and immunology 331:185-226. 2. Hanley-Bowdoin L, Bejarano ER, Robertson D, & Mansoor S (2013) Geminiviruses: masters at redirecting and reprogramming plant processes. Nature reviews. Microbiology 11(11):777-788. 3. Mansoor S, Briddon RW, Zafar Y, & Stanley J (2003) Geminivirus disease complexes: an emerging threat. Trends in plant science 8(3):128-134. 4. Navas-Castillo J, Fiallo-Olive E, & Sanchez-Campos S (2011) Emerging virus diseases transmitted by whiteflies. Annual review of phytopathology 49:219-248. 5. Scholthof KB, et al. (2011) Top 10 plant viruses in molecular plant pathology. Molecular plant pathology 12(9):938-954. 6. Hanley-Bowdoin L, Settlage SB, Orozco BM, Nagar S, & Robertson D (2000) Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Critical reviews in biochemistry and molecular biology 35(2):105-140. 7. Gutierrez C (1999) Geminivirus DNA replication. Cellular and molecular life sciences : CMLS 56(3-4):313-329. 8. Pilartz M & Jeske H (1992) Abutilon mosaic geminivirus double-stranded DNA is packed into minichromosomes. Virology 189(2):800-802. 9. Pilartz M & Jeske H (2003) Mapping of abutilon mosaic geminivirus minichromosomes. Journal of virology 77(20):10808-10818. 10. Fauquet CM, et al. (2008) Geminivirus strain demarcation and nomenclature. Archives of virology 153(4):783-821. 11. Fauquet CM, et al. (2003) Revision of taxonomic criteria for species demarcation in the family Geminiviridae, and an updated list of begomovirus species. Archives of virology 148(2):405-421. 12. Morris BA, Richardson KA, Haley A, Zhan X, & Thomas JE (1992) The nucleotide sequence of the infectious cloned DNA component of tobacco yellow dwarf virus reveals features of geminiviruses infecting monocotyledonous plants. Virology 187(2):633-642. 13. Liu L, Saunders K, Thomas CL, Davies JW, & Stanley J (1999) Bean yellow dwarf virus RepA, but not rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif. Virology 256(2):270-279. 14. Thomas JE, Parry JN, Schwinghamer MW, & Dann EK (2010) Two novel mastreviruses from chickpea (Cicer arietinum) in Australia. Archives of virology 185

155(11):1777-1788. 15. Palmer KE & Rybicki EP (1998) The molecular biology of mastreviruses. Advances in virus research 50:183-234. 16. Briddon RW, Patil BL, Bagewadi B, Nawaz-ul-Rehman MS, & Fauquet CM (2010) Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses. BMC evolutionary biology 10:97. 17. Gladfelter HJ, Eagle PA, Fontes EP, Batts L, & Hanley-Bowdoin L (1997) Two domains of the AL1 protein mediate geminivirus origin recognition. Virology 239(1):186-197. 18. Choi IR & Stenger DC (1995) Strain-specific determinants of beet curly top geminivirus DNA replication. Virology 206(2):904-912. 19. Laufs J, Schumacher S, Geisler N, Jupin I, & Gronenborn B (1995) Identification of the nicking tyrosine of geminivirus Rep protein. FEBS letters 377(2):258-262. 20. Cui X, Tao X, Xie Y, Fauquet CM, & Zhou X (2004) A DNAbeta associated with Tomato yellow leaf curl China virus is required for symptom induction. Journal of virology 78(24):13966-13974. 21. Saunders K, Norman A, Gucciardo S, & Stanley J (2004) The DNA beta satellite component associated with ageratum yellow vein disease encodes an essential pathogenicity protein (betaC1). Virology 324(1):37-47. 22. Saeed M, et al. (2005) A single complementary-sense transcript of a geminiviral DNA beta satellite is determinant of pathogenicity. Molecular plant-microbe interactions : MPMI 18(1):7-14. 23. Sunter G, Sunter JL, & Bisaro DM (2001) Plants expressing tomato golden mosaic virus AL2 or beet curly top virus L2 transgenes show enhanced susceptibility to infection by DNA and RNA viruses. Virology 285(1):59-70. 24. Buchmann RC, Asad S, Wolf JN, Mohannath G, & Bisaro DM (2009) Geminivirus AL2 and L2 proteins suppress transcriptional gene silencing and cause genome-wide reductions in cytosine methylation. Journal of virology 83(10):5005-5013. 25. Raja P, Sanville BC, Buchmann RC, & Bisaro DM (2008) Viral genome methylation as an epigenetic defense against geminiviruses. Journal of virology 82(18):8997-9007. 26. Wang H, Buckley KJ, Yang X, Buchmann RC, & Bisaro DM (2005) Adenosine kinase inhibition and suppression of RNA silencing by geminivirus AL2 and L2 proteins. Journal of virology 79(12):7410-7418. 27. Yang X, et al. (2007) Functional modulation of the geminivirus AL2 transcription factor and silencing suppressor by self-interaction. Journal of virology 186

81(21):11972-11981. 28. Wang H, Hao L, Shung CY, Sunter G, & Bisaro DM (2003) Adenosine kinase is inactivated by geminivirus AL2 and L2 proteins. The Plant cell 15(12):3020-3032. 29. Moffatt BA, et al. (2002) Adenosine kinase deficiency is associated with developmental abnormalities and reduced transmethylation. Plant physiology 128(3):812-821. 30. Yang X, et al. (2011) Suppression of methylation-mediated transcriptional gene silencing by betaC1-SAHH protein interaction during geminivirus-betasatellite infection. PLoS pathogens 7(10):e1002329. 31. Zhang Z, et al. (2011) BSCTV C2 attenuates the degradation of SAMDC1 to suppress DNA methylation-mediated gene silencing in Arabidopsis. The Plant cell 23(1):273-288. 32. Mohannath G, et al. (2014) A complex containing SNF1-related kinase (SnRK1) and adenosine kinase in Arabidopsis. Plos One 9(1):e87592. 33. Hardie DG, Carling D, & Carlson M (1998) The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annual review of biochemistry 67:821-855. 34. Halford NG & Hey SJ (2009) Snf1-related protein kinases (SnRKs) act within an intricate network that links metabolic and stress signalling in plants. The Biochemical journal 419(2):247-259. 35. Halford NG, et al. (2003) Metabolic signalling and carbon partitioning: role of Snf1-related (SnRK1) protein kinase. Journal of experimental botany 54(382):467-475. 36. Halford NG & Hardie DG (1998) SNF1-related protein kinases: global regulators of carbon metabolism in plants? Plant molecular biology 37(5):735-748. 37. Baena-Gonzalez E & Sheen J (2008) Convergent energy and stress signaling. Trends in plant science 13(9):474-482. 38. Polge C & Thomas M (2007) SNF1/AMPK/SnRK1 kinases, global regulators at the heart of energy control? Trends in plant science 12(1):20-28. 39. Horman S, et al. (2006) Insulin antagonizes ischemia-induced Thr172 phosphorylation of AMP-activated protein kinase alpha-subunits in heart via hierarchical phosphorylation of Ser485/491. The Journal of biological chemistry 281(9):5335-5340. 40. Hurley RL, et al. (2006) Regulation of AMP-activated protein kinase by multisite phosphorylation in response to agents that elevate cellular cAMP. The Journal of biological chemistry 281(48):36662-36672. 187

41. Crozet P, et al. (2014) Mechanisms of regulation of SNF1/AMPK/SnRK1 protein kinases. Frontiers in plant science 5:190. 42. Celenza JL & Carlson M (1986) A Yeast Gene That Is Essential for Release from Glucose Repression Encodes a Protein-Kinase. Science 233(4769):1175-1180. 43. Zhang Y, Dickinson JR, Paul MJ, & Halford NG (2003) Molecular cloning of an arabidopsis homologue of GCN2, a protein kinase involved in co-ordinated response to amino acid starvation. Planta 217(4):668-675. 44. Hrabak EM, et al. (2003) The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant physiology 132(2):666-680. 45. Ludin K, Jiang R, & Carlson M (1998) Glucose-regulated interaction of a regulatory subunit of protein phosphatase 1 with the Snf1 protein kinase in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 95(11):6245-6250. 46. Sugden C, Donaghy PG, Halford NG, & Hardie DG (1999) Two SNF1-related protein kinases from spinach leaf phosphorylate and inactivate 3-hydroxy-3-methylglutaryl-coenzyme A reductase, nitrate reductase, and sucrose phosphate synthase in vitro. Plant physiology 120(1):257-274. 47. Sugden C, Crawford RM, Halford NG, & Hardie DG (1999) Regulation of spinach SNF1-related (SnRK1) kinases by protein kinases and phosphatases is associated with phosphorylation of the T loop and is regulated by 5 '-AMP. Plant Journal 19(4):433-439. 48. Hedbacker K & Carlson M (2008) SNF1/AMPK pathways in yeast. Front Biosci-Landmrk 13:2408-2420. 49. Wilson WA, Hawley SA, & Hardie DG (1996) Glucose repression/derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr Biol 6(11):1426-1434. 50. Hong SP, Leiper FC, Woods A, Carling D, & Carlson M (2003) Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases. Proceedings of the National Academy of Sciences of the United States of America 100(15):8839-8843. 51. Baena-Gonzalez E, Rolland F, Thevelein JM, & Sheen J (2007) A central integrator of transcription networks in plant stress and energy signalling. Nature 448(7156):938-942. 52. Hey S, Mayerhofer H, Halford NG, & Dickinson JR (2007) DNA sequences from Arabidopsis, which encode protein kinases and function as upstream regulators of Snf1 in yeast. The Journal of biological chemistry 282(14):10472-10479. 188

53. Shen W, Reyes MI, & Hanley-Bowdoin L (2009) Arabidopsis Protein Kinases GRIK1 and GRIK2 Specifically Activate SnRK1 by Phosphorylating Its Activation Loop. Plant physiology 150(2):996-1005. 54. Nunes C, et al. (2013) Inhibition of SnRK1 by metabolites: Tissue-dependent effects and cooperative inhibition by glucose 1-phosphate in combination with trehalose 6-phosphate. Plant Physiol Bioch 63:89-98. 55. Toroser D, Plaut Z, & Huber SC (2000) Regulation of a plant SNF1-related protein kinase by glucose-6-phosphate. Plant physiology 123(1):403-411. 56. Zhang YH, et al. (2009) Inhibition of SNF1-Related Protein Kinase1 Activity and Regulation of Metabolic Pathways by Trehalose-6-Phosphate. Plant physiology 149(4):1860-1871. 57. Harthill JE, et al. (2006) Phosphorylation and 14-3-3 binding of Arabidopsis trehalose-phosphate synthase 5 in response to 2-deoxyglucose. The Plant journal : for cell and molecular biology 47(2):211-223. 58. Kobayashi Y, et al. (2005) Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors. The Plant journal : for cell and molecular biology 44(6):939-949. 59. Yoshida R, et al. (2002) ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis. Plant & cell physiology 43(12):1473-1483. 60. Yoshida R, et al. (2006) The regulatory domain of SRK2E/OST1/SnRK2.6 interacts with ABI1 and integrates abscisic acid (ABA) and osmotic stress signals controlling stomatal closure in Arabidopsis. The Journal of biological chemistry 281(8):5310-5318. 61. Ng LM, et al. (2011) Structural basis for basal activity and autoactivation of abscisic acid (ABA) signaling SnRK2 kinases. Proceedings of the National Academy of Sciences of the United States of America 108(52):21259-21264. 62. Liu J, Ishitani M, Halfter U, Kim CS, & Zhu JK (2000) The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proceedings of the National Academy of Sciences of the United States of America 97(7):3730-3734. 63. Umezawa T, Yoshida R, Maruyama K, Yamaguchi-Shinozaki K, & Shinozaki K (2004) SRK2C, a SNF1-related protein kinase 2, improves drought tolerance by controlling stress-responsive gene expression in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America 101(49):17306-17311. 189

64. Thelander M, Olsson T, & Ronne H (2004) Snf1-related protein kinase 1 is needed for growth in a normal day-night light cycle. Embo J 23(8):1900-1910. 65. Schwachtje J, et al. (2006) SNF1-related kinases allow plants to tolerate herbivory by allocating carbon to roots. Proceedings of the National Academy of Sciences of the United States of America 103(34):12935-12940. 66. Wingler A, Masclaux-Daubresse C, & Fischer AM (2009) Sugars, senescence, and ageing in plants and heterotrophic organisms. Journal of experimental botany 60(4):1063-1066. 67. Mackintosh RW, et al. (1992) Evidence for a Protein-Kinase Cascade in Higher-Plants - 3-Hydroxy-3-Methylglutaryl-Coa Reductase Kinase. Eur J Biochem 209(3):923-931. 68. Beauchemin C, Boutet N, & Laliberte JF (2007) Visualization of the interaction between the precursors of VPg, the viral protein linked to the genome of Turnip mosaic virus, and the translation eukaryotic initiation factor iso 4E in planta. Journal of virology 81(2):775-782. 69. Glinski M & Weckwerth W (2005) Differential multisite phosphorylation of the trehalose-6-phosphate synthase gene family in Arabidopsis thaliana: a mass spectrometry-based process for multiparallel peptide library phosphorylation analysis. Molecular & cellular proteomics : MCP 4(10):1614-1625. 70. Paul MJ, Primavesi LF, Jhurreea D, & Zhang Y (2008) Trehalose metabolism and signaling. Annual review of plant biology 59:417-441. 71. Tsai AY & Gazzarrini S (2014) Trehalose-6-phosphate and SnRK1 kinases in plant development and signaling: the emerging picture. Frontiers in plant science 5:119. 72. Kulma A, et al. (2004) Phosphorylation and 14-3-3 binding of Arabidopsis 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. The Plant journal : for cell and molecular biology 37(5):654-667. 73. Okar DA, et al. (2001) PFK-2/FBPase-2: maker and breaker of the essential biofactor fructose-2,6-bisphosphate. Trends in biochemical sciences 26(1):30-35. 74. Bachmann M, et al. (1996) 14-3-3 proteins associate with the regulatory phosphorylation site of spinach leaf nitrate reductase in an isoform-specific manner and reduce dephosphorylation of Ser-543 by endogenous protein phosphatases. FEBS letters 398(1):26-30. 75. Moorhead G, et al. (1996) Phosphorylated nitrate reductase from spinach leaves is inhibited by 14-3-3 proteins and activated by fusicoccin. Curr Biol 6(9):1104-1113. 76. Ikeda Y, Koizumi N, Kusano T, & Sano H (2000) Specific binding of a 14-3-3 190

protein to autophosphorylated WPK4, an SNF1-related wheat protein kinase, and to WPK4-phosphorylated nitrate reductase. The Journal of biological chemistry 275(52):41528. 77. Huber SC, MacKintosh C, & Kaiser WM (2002) Metabolic enzymes as targets for 14-3-3 proteins. Plant molecular biology 50(6):1053-1063. 78. de Boer AH, van Kleeff PJM, & Gao J (2013) Plant 14-3-3 proteins as spiders in a web of phosphorylation. Protoplasma 250(2):425-440. 79. Shin R, Alvarez S, Burch AY, Jez JM, & Schachtman DP (2007) Phosphoproteomic identification of targets of the Arabidopsis sucrose nonfermenting-like kinase SnRK2.8 reveals a connection to metabolic processes. Proceedings of the National Academy of Sciences of the United States of America 104(15):6460-6465. 80. Slocombe SP, et al. (2004) SNF1-related protein kinase (snRK1) phosphorylates class I heat shock protein. Plant physiology and biochemistry : PPB / Societe francaise de physiologie vegetale 42(2):111-116. 81. Guerinier T, et al. (2013) Phosphorylation of p27(KIP1) homologs KRP6 and 7 by SNF1-related protein kinase-1 links plant energy homeostasis and cell proliferation. The Plant journal : for cell and molecular biology 75(3):515-525. 82. Purcell PC, Smith AM, & Halford NG (1998) Antisense expression of a sucrose non-fermenting-1-related protein kinase sequence in potato results in decreased expression of sucrose synthase in tubers and loss of sucrose-inducibility of sucrose synthase transcripts in leaves. Plant Journal 14(2):195-202. 83. Laurie S, McKibbin RS, & Halford NG (2003) Antisense SNF1-related (SnRK1) protein kinase gene represses transient activity of an alpha-amylase (alpha-Amy2) gene promoter in cultured wheat embryos. Journal of experimental botany 54(383):739-747. 84. Shen Q, et al. (2011) Tomato SlSnRK1 protein interacts with and phosphorylates betaC1, a pathogenesis protein encoded by a geminivirus beta-satellite. Plant physiology 157(3):1394-1406. 85. Kong LJ & Hanley-Bowdoin L (2002) A geminivirus replication protein interacts with a protein kinase and a motor protein that display different expression patterns during plant development and infection. The Plant cell 14(8):1817-1832. 86. Shen W & Hanley-Bowdoin L (2006) Geminivirus infection up-regulates the expression of two Arabidopsis protein kinases related to yeast SNF1- and mammalian AMPK-activating kinases. Plant physiology 142(4):1642-1655. 87. Balachandran S, et al. (2000) Essential role for the dsRNA-dependent protein kinase PKR in innate immunity to viral infection. Immunity 13(1):129-141. 191

88. Goodbourn S, Didcock L, & Randall RE (2000) Interferons: cell signalling, immune modulation, antiviral responses and virus countermeasures. J Gen Virol 81:2341-2364. 89. Sen GC (2001) Viruses and interferons. Annu Rev Microbiol 55:255-281. 90. Huang S, et al. (1993) Immune-Response in Mice That Lack the Interferon-Gamma Receptor. Science 259(5102):1742-1745. 91. Ryman KD, Klimstra WB, Nguyen KB, Biron CA, & Johnston RE (2000) Alpha/beta interferon protects adult mice from fatal Sindbis virus infection and is an important determinant of cell and tissue tropism. Journal of virology 74(7):3366-3378. 92. Stojdl DF, et al. (2000) The murine double-stranded RNA-dependent protein kinase PKR is required for resistance to vesicular stomatitis virus. Journal of virology 74(20):9580-9585. 93. Zhou AM, Paranjape JM, Der SD, Williams BRG, & Silverman RH (1999) Interferon action in triply deficient mice reveals the existence of alternative antiviral pathways. Virology 258(2):435-440. 94. Li XL, et al. (2000) RNase-L-dependent destabilization of interferon-induced mRNAs - A role for the 2-5A system in attenuation of the interferon response. Journal of Biological Chemistry 275(12):8880-8888. 95. Chen JJ & London IM (1995) Regulation of Protein-Synthesis by Heme-Regulated Eif-2-Alpha Kinase. Trends in biochemical sciences 20(3):105-108. 96. Hinnebusch AG (1993) Gene-Specific Translational Control of the Yeast Gcn4 Gene by Phosphorylation of Eukaryotic Initiation Factor-Ii. Mol Microbiol 10(2):215-223. 97. Langland JO, Jin S, Jacobs BL, & Roth DA (1995) Identification of a Plant-Encoded Analog of Pkr, the Mammalian Double-Stranded Rna-Dependent Protein-Kinase. Plant physiology 108(3):1259-1267. 98. Langland JO, Langland LA, Browning KS, & Roth DA (1996) Phosphorylation of plant eukaryotic initiation factor-2 by the plant-encoded double-stranded RNA-dependent protein kinase, pPKR, and inhibition of protein synthesis in vitro. The Journal of biological chemistry 271(8):4539-4544. 99. Bilgin DD, Liu Y, Schiff M, & Dinesh-Kumar SP (2003) P58(IPK), a plant ortholog of double-stranded RNA-dependent protein kinase PKR inhibitor, functions in viral pathogenesis. Developmental cell 4(5):651-661. 100. Langland JO, Langland L, Zeman C, Saha D, & Roth DA (1997) Developmental regulation of a plant encoded inhibitor of eukaryotic initiation factor 2 alpha 192

phosphorylation. The Plant journal : for cell and molecular biology 12(2):393-400. 101. Lageix S, et al. (2008) Arabidopsis eIF2alpha kinase GCN2 is essential for growth in stress conditions and is activated by wounding. BMC plant biology 8:134. 102. Zhang Y, et al. (2008) GCN2-dependent phosphorylation of eukaryotic translation initiation factor-2alpha in Arabidopsis. Journal of experimental botany 59(11):3131-3141. 103. Kozak M (1989) The scanning model for translation: an update. The Journal of cell biology 108(2):229-241. 104. Brenner C, et al. (1988) CDC33 encodes mRNA cap-binding protein eIF-4E of Saccharomyces cerevisiae. Molecular and cellular biology 8(8):3556-3559. 105. Allen ML, Metz AM, Timmer RT, Rhoads RE, & Browning KS (1992) Isolation and Sequence of the Cdnas Encoding the Subunits of the Isozyme Form of Wheat-Protein Synthesis Initiation Factor-4f. Journal of Biological Chemistry 267(32):23232-23236. 106. Martinez-Silva AV, Aguirre-Martinez C, Flores-Tinoco CE, Alejandri-Ramirez ND, & Dinkova TD (2012) Translation Initiation Factor AteIF(iso) 4E Is Involved in Selective mRNA Translation in Arabidopsis Thaliana Seedlings. Plos One 7(2). 107. Duprat A, et al. (2002) The Arabidopsis eukaryotic initiation factor (iso)4E is dispensable for plant growth but required for susceptibility to potyviruses. Plant Journal 32(6):927-934. 108. Combe JP, Petracek ME, van Eldik G, Meulewaeter F, & Twell D (2005) Translation initiation factors eIF4E and eIFiso4E are required for polysome formation and regulate plant growth in tobacco. Plant molecular biology 57(5):749-760. 109. Browning KS (1996) The plant translational apparatus. Plant molecular biology 32(1-2):107-144. 110. Gallie DR & Browning KS (2001) eIF4G functionally differs from eIFiso4G in promoting internal initiation, cap-independent translation, and translation of structured mRNAs. The Journal of biological chemistry 276(40):36951-36960. 111. Rodriguez CM, Freire MA, Camilleri C, & Robaglia C (1998) The Arabidopsis thaliana cDNAs coding for eIF4E and eIF(iso)4E are not functionally equivalent for yeast complementation and are differentially expressed during plant development. Plant Journal 13(4):465-473. 112. Bush MS, et al. (2009) Selective recruitment of proteins to 5' cap complexes during the growth cycle in Arabidopsis. Plant Journal 59(3):400-412. 193

113. Duncan R, Milburn SC, & Hershey JWB (1987) Regulated Phosphorylation and Low Abundance of Hela-Cell Initiation-Factor Eif-4f Suggest a Role in Translational Control - Heat-Shock Effects on Eif-4f. Journal of Biological Chemistry 262(1):380-388. 114. Hiremath LS, Webb NR, & Rhoads RE (1985) Immunological Detection of the Messenger-Rna Cap-Binding Protein. Journal of Biological Chemistry 260(13):7843-7849. 115. Pause A, et al. (1994) Insulin-Dependent Stimulation of Protein-Synthesis by Phosphorylation of a Regulator of 5'-Cap Function. Nature 371(6500):762-767. 116. Yanagiya A, et al. (2012) Translational Homeostasis via the mRNA Cap-Binding Protein, elF4E. Mol Cell 46(6):847-858. 117. Cencic R, et al. (2011) Blocking eIF4E-eIF4G interaction as a strategy to impair coronavirus replication. Journal of virology 85(13):6381-6389. 118. Flynn A & Proud CG (1995) Serine 209, not serine 53, is the major site of phosphorylation in initiation factor eIF-4E in serum-treated Chinese hamster ovary cells. The Journal of biological chemistry 270(37):21684-21688. 119. Joshi B, et al. (1995) Phosphorylation of eukaryotic protein synthesis initiation factor 4E at Ser-209. The Journal of biological chemistry 270(24):14597-14603. 120. Makkinje A, Xiong H, Li M, & Damuni Z (1995) Phosphorylation of eukaryotic protein synthesis initiation factor 4E by insulin-stimulated protamine kinase. The Journal of biological chemistry 270(24):14824-14828. 121. Fukunaga R & Hunter T (1997) MNK1, a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase substrates. Embo J 16(8):1921-1933. 122. Waskiewicz AJ, Flynn A, Proud CG, & Cooper JA (1997) Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. Embo J 16(8):1909-1920. 123. Pyronnet S, et al. (1999) Human eukaryotic translation initiation factor 4G (eIF4G) recruits mnk1 to phosphorylate eIF4E. Embo J 18(1):270-279. 124. Scheper GC & Proud CG (2002) Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? Eur J Biochem 269(22):5350-5359. 125. Marcotrigiano J, Gingras AC, Sonenberg N, & Burley SK (1997) Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP. Cell 89(6):951-961. 126. Minich WB, Balasta ML, Goss DJ, & Rhoads RE (1994) Chromatographic Resolution of in-Vivo Phosphorylated and Nonphosphorylated Eukaryotic Translation Initiation-Factor Eif-4e - Increased Cap Affinity of the 194

Phosphorylated Form. Proceedings of the National Academy of Sciences of the United States of America 91(16):7668-7672. 127. Scheper GC, et al. (2002) Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for capped mRNA. Journal of Biological Chemistry 277(5):3303-3309. 128. Tomoo K, et al. (2002) Crystal structures of 7-methylguanosine 5'-triphosphate (m(7)GTP)- and P(1)-7-methylguanosine-P(3)-adenosine-5',5'-triphosphate (m(7)GpppA)-bound human full-length eukaryotic initiation factor 4E: biological importance of the C-terminal flexible region. The Biochemical journal 362(Pt 3):539-544. 129. McKendrick L, Morley SJ, Pain VM, Jagus R, & Joshi B (2001) Phosphorylation of eukaryotic initiation factor 4E (eIF4E) at Ser209 is not required for protein synthesis in vitro and in vivo. Eur J Biochem 268(20):5375-5385. 130. Lachance PED, Miron M, Raught B, Sonenberg N, & Lasko P (2002) Phosphorylation of eukaryotic translation initiation factor 4E is critical for growth. Molecular and cellular biology 22(6):1656-1663. 131. Gallie DR, et al. (1997) The phosphorylation state of translation initiation factors is regulated developmentally and following heat shock in wheat. Journal of Biological Chemistry 272(2):1046-1053. 132. Manjunath S, Williams AJ, & Bailey-Serres J (1999) Oxygen deprivation stimulates Ca2+-mediated phosphorylation of mRNA cap-binding protein elF4E in maize roots. Plant Journal 19(1):21-30. 133. Dennis MD, Person MD, & Browning KS (2009) Phosphorylation of Plant Translation Initiation Factors by CK2 Enhances the in Vitro Interaction of Multifactor Complex Components. Journal of Biological Chemistry 284(31):20615-20628. 134. Truniger V & Aranda MA (2009) Recessive Resistance to Plant Viruses. Advances in Virus Research, Vol 75 75:119-+. 135. Caranta C, et al. (1996) A complementation of two genes originating from susceptible Capsicum annuum lines confers a new and complete resistance to pepper veinal mottle virus. Phytopathology 86(7):739-743. 136. Ruffel S, et al. (2006) Simultaneous mutations in translation initiation factors elF4E and elF(iso)4E are required to prevent pepper veinal mottle virus infection of pepper. J Gen Virol 87:2089-2098. 137. Ruffel S, et al. (2002) A natural recessive resistance gene against potato virus Y in pepper corresponds to the eukaryotic initiation factor 4E (eIF4E). Plant Journal 32(6):1067-1075. 195

138. Deom CM, Murphy JF, & Paguio OR (1997) Resistance to tobacco etch virus in Capsicum annuum: inhibition of virus RNA accumulation. Mol Plant Microbe In 10(7):917-921. 139. Charron C, et al. (2008) Natural variation and functional analyses provide evidence for co-evolution between plant eIF4E and potyviral VPg. Plant Journal 54(1):56-68. 140. Murphy JF & Kyle MM (1995) Alleviation of Restricted Systemic Spread of Pepper Mottle Potyvirus in Capsicum-Annuum Cv Avelar by Coinfection with a Cucumovirus. Phytopathology 85(5):561-566. 141. Murphy JF, Blauth JR, Livingstone KD, Lackney VK, & Jahn MK (1998) Genetic mapping of the pvr1 locus in Capsicum spp, and evidence that distinct potyvirus resistance loci control responses that differ at the whole plant and cellular levels. Mol Plant Microbe In 11(10):943-951. 142. Boiteux LS, et al. (1996) Resistance to potato virus Y (pathotype 1-2) in Capsicum annuum and Capsicum chinense is controlled by two independent major genes. Euphytica 87(1):53-58. 143. Johansen IE, Lund OS, Hjulsager CK, & Laursen J (2001) Recessive resistance in Pisum sativum and potyvirus pathotype resolved in a gene-for-cistron correspondence between host and virus. Journal of virology 75(14):6609-6614. 144. Gao ZH, et al. (2004) The potyvirus recessive resistance gene, sbm1, identifies a novel role for translation initiation factor eIF4E in cell-to-cell trafficking. Plant Journal 40(3):376-385. 145. Keller KE, Johansen IE, Martin RR, & Hampton RO (1998) Potyvirus genome-linked protein (VPg) determines pea seed-borne mosaic virus pathotype-specific virulence in Pisum sativum. Mol Plant Microbe In 11(2):124-130. 146. Kanyuka K, McGrann G, Alhudaib K, Hariri D, & Adams MJ (2004) Biological and sequence analysis of a novel European isolate of Barley mild mosaic virus that overcomes the barley rym5 resistance gene. Archives of virology 149(8):1469-1480. 147. Kanyuka K, et al. (2005) Evidence that the recessive bymovirus resistance locus rym4 in barley corresponds to the eukaryotic translation initiation factor 4E gene. Molecular plant pathology 6(4):449-458. 148. Stein N, et al. (2005) The eukaryotic translation initiation factor 4E confers multiallelic recessive Bymovirus resistance in Hordeum vulgare (L.). Plant Journal 42(6):912-922. 149. Kuhne T, Shi NG, Proeseler G, Adams MJ, & Kanyuka K (2003) The ability of a 196

bymovirucs to overcome the rym4-mediated resistance in barley correlates with a codon change in the VPg coding region on RNA1. J Gen Virol 84:2853-2859. 150. Parrella G, et al. (2002) Recessive resistance genes against potyviruses are localized in colinear genomic regions of the tomato (Lycopersicon spp.) and pepper (Capsicum spp.) genomes. Theor Appl Genet 105(6-7):855-861. 151. Moury B, et al. (2004) Mutations in Potato virus Y genome-linked protein determine virulence toward recessive resistances in Capsicum annuum and Lycopersicon hirsutum. Mol Plant Microbe In 17(3):322-329. 152. Ruffel S, Gallois JL, Lesage ML, & Caranta C (2005) The recessive potyvirus resistance gene pot-1 is the tomato orthologue of the pepper pvr2-eIF4E gene. Mol Genet Genomics 274(4):346-353. 153. Lellis AD, Kasschau KD, Whitham SA, & Carrington JC (2002) Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during potyvirus infection. Curr Biol 12(12):1046-1051. 154. Wittmann S, Chatel H, Fortin MG, & Laliberte JF (1997) Interaction of the viral protein genome linked of turnip mosaic potyvirus with the translational eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana using the yeast two-hybrid system. Virology 234(1):84-92. 155. Whitham SA, Yamamoto ML, & Carrington JC (1999) Selectable viruses and altered susceptibility mutants in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America 96(2):772-777. 156. Schaad MC, Anderberg RJ, & Carrington JC (2000) Strain-specific interaction of the tobacco etch virus NIa protein with the translation initiation factor eIF4E in the yeast two-hybrid system. Virology 273(2):300-306. 157. Leonard S, et al. (2000) Complex formation between potyvirus VPg and translation eukaryotic initiation factor 4E correlates with virus infectivity. Journal of virology 74(17):7730-7737. 158. Michon T, Estevez Y, Walter J, German-Retana S, & Le Gall O (2006) The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue. The FEBS journal 273(6):1312-1322. 159. Bishop CL, et al. (2007) The PsbZ subunit of Photosystem II in Synechocystis sp. PCC 6803 modulates electron flow through the photosynthetic electron transfer chain. Photosynthesis research 93(1-3):139-147. 160. Hao L, Wang H, Sunter G, & Bisaro DM (2003) Geminivirus AL2 and L2 proteins interact with and inactivate SNF1 kinase. The Plant cell 15(4):1034-1048. 197

161. Lindbo JA (2007) TRBO: a high-efficiency tobacco mosaic virus RNA-based overexpression vector. Plant physiology 145(4):1232-1240. 162. Davies SP, Carling D, & Hardie DG (1989) Tissue distribution of the AMP-activated protein kinase, and lack of activation by cyclic-AMP-dependent protein kinase, studied using a specific and sensitive peptide assay. Eur J Biochem 186(1-2):123-128. 163. Kishimoto A, Ogura T, & Esumi H (2006) A pull-down assay for 5' AMP-activated protein kinase activity using the GST-fused protein. Molecular biotechnology 32(1):17-21. 164. Nakazawa Y, Hiraguri A, Moriyama H, & Fukuhara T (2007) The dsRNA-binding protein DRB4 interacts with the Dicer-like protein DCL4 in vivo and functions in the trans-acting siRNA pathway. Plant molecular biology 63(6):777-785. 165. Raja P, Jackel JN, Li SZ, Heard IM, & Bisaro DM (2014) Arabidopsis Double-Stranded RNA Binding Protein DRB3 Participates in Methylation-Mediated Defense against Geminiviruses. Journal of virology 88(5):2611-2622. 166. Hughes JMX, et al. (1999) Translational repression by human 4E-BP1 in yeast specifically requires human eIF4E as target. Journal of Biological Chemistry 274(6):3261-3264. 167. German-Retana S, et al. (2008) Mutational analysis of plant cap-binding protein eIF4E reveals key amino acids involved in biochemical functions and potyvirus infection. Journal of virology 82(15):7601-7612. 168. Arava Y, et al. (2003) Genome-wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 100(7):3889-3894. 169. Ruiz A, Liu Y, Xu X, & Carlson M (2012) Heterotrimer-independent regulation of activation-loop phosphorylation of Snf1 protein kinase involves two protein phosphatases. Proceedings of the National Academy of Sciences of the United States of America 109(22):8652-8657. 170. Lindbo JA (2007) High-efficiency protein expression in plants from agroinfection-compatible Tobacco mosaic virus expression vectors. Bmc Biotechnol 7. 171. Hu C-D, Chinenov Y, & Kerppola TK (2002) Visualization of interactions among bZIP and Rel family proteins using bimolecular fluorescence complementation. Mol. Cell 9:789-798. 172. Sunter G & Bisaro DM (1992) Transactivation of geminivirus AR1 and BR1 gene expression by the viral AL2 gene product occurs at the level of transcription. The 198

Plant cell 4(10):1321-1331. 173. Bisaro DM (2006) Silencing suppression by geminivirus proteins. Virology 344(1):158-168. 174. Raja P, Wolf JN, & Bisaro DM (2010) RNA silencing directed against geminiviruses: Post-transcriptional and epigenetic components. Bba-Gene Regul Mech 1799(3-4):337-351. 175. Hardie DG (2007) AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nature reviews. Molecular cell biology 8(10):774-785. 176. Ghillebert R, et al. (2011) The AMPK/SNF1/SnRK1 fuel gauge and energy regulator: structure, function and regulation. The FEBS journal 278(21):3978-3990. 177. Robaglia C, Thomas M, & Meyer C (2012) Sensing nutrient and energy status by SnRK1 and TOR kinases. Current opinion in plant biology 15(3):301-307. 178. Shen W, Dallas MB, Goshe MB, & Hanley-Bowdoin L (2014) SnRK1 Phosphorylation of AL2 Delays Cabbage Leaf Curl Virus Infection in Arabidopsis. Journal of virology. 179. Celenza JL & Carlson M (1989) Mutational Analysis of the Saccharomyces-Cerevisiae Snf1 Protein-Kinase and Evidence for Functional Interaction with the Snf4 Protein. Molecular and cellular biology 9(11):5034-5044. 180. Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular biology and evolution 4(4):406-425.

199