DOCSLIB.ORG

ABSTRACT a Close Look at the Electrostatic Properties of Cu, Zn

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ABSTRACT a Close Look at the Electrostatic Properties of Cu, Zn ABSTRACT A Close Look at the Electrostatic Properties of Cu, Zn-Superoxide Dismutase Yunhua Shi, Ph.D. Mentor: Bryan F. Shaw, Ph.D. Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in the gene encoding Cu, Zn-superoxide dismutase (SOD1) are responsible for 1-2% of ALS cases. Numerous studies have proved that SOD1 forms neurotoxic aggregates, which add toxicity to motor neurons through a widely accepted “gain of function” mechanism. The electrostatic potential is an overlooked important biophysical property that can affect the aggregation propensity of SOD1. Protein net charge, a good representative of the electrostatic surface potential, is tightly regulated by a network of solvent accessible ionizable amino acid residues and coordinated small molecules such as water and metal ions. Few tools exist to detailed study the electrostatic potential of proteins, however, in this dissertation, we introduced capillary electrophoresis in conjunction with protein charge ladders to i) experimentally measure the net charge of WT and ALS-variant mutant SOD1 under various conditions, and ii) investigate the effect of electrostatic potential on the interaction between SOD1 and sodium dodecyl sulfate (SDS) molecules. Also, we predict and detect the deamidation of asparagine residues of Cu, Zn-SOD1 (human erythrocytes). With our novel tools, we successfully detect this sub-Dalton post-translational modification (< 1 Da) in aged Cu, Zn-SOD1 purified from human erythrocytes. The deamidation of SOD1 was proved to produce an ALS mutant analog which shares similar biochemical and biophysical properties to ALS mutant N139D. This solvent catalyzed spontaneous deamidation of SOD1 is incentive for understanding the mechanism of sporadic ALS. Finally, we study the effect of an external electric field on the structure of cytosolic proteins, and found that the electric field can induce the monomerization of metal replete A4V SOD1 but not apo form or that of the WT SOD1. We hypothesize that this abnormal monomerization on a relatively thermally stable protein is due to the induced rotational torque generated by the applied external electric field on the preexisted macrodipole of each subunit of SOD1. Thus, in this study, we are the first, to the best of our knowledge, to investigate the effect of a physiologically relevant electric field on the structure of a cytosolic protein. Copyright © 2015 by Yunhua Shi All rights reserved TABLE OF CONTENTS LIST OF FIGURES ...................................................................................................... viii LIST OF TABLES ....................................................................................................... xiv ACKNOWLEDGMENTS ........................................................................................... xvi DEDICATION ................................................................................................................. xix CHAPTER ONE .............................................................................................................. 1 Introduction to Copper-Zinc Superoxide Dismutase, Protein Net Charge and Protein Aggregation ........................................................................................................................... 1 Neurodegenerative diseases and protein aggregation .................................................... 1 Electrostatic potential and protein aggregation ....................................................................... 3 Protein charge ladder and capillary electrophoresis ................................................................ 6 Cu, Zn-superoxide dismutase and ALS ................................................................................... 7 Charge regulation of SOD1 upon amino acid substitution, metal binding and alteration in solution pH.......................................................................................................................... 11 Deamidaiton—a novel spontaneous non-isoelectric mutation can be detected in long- lived proteins ...................................................................................................................... 13 Abnormal factors driving the misfolding and/or disrupting the self-assemble of SOD1 ...... 15 CHAPTER TWO ........................................................................................................... 19 Abnormal SDS-PAGE migration of cytosolic proteins can identify domains and mechanisms that control surfactant binding ................................................................... 19 Abstract ................................................................................................................................ 19 Introduction ......................................................................................................................... 20 Results .................................................................................................................................. 23 Discussion ............................................................................................................................. 41 Conclusions ........................................................................................................................... 44 Experimental ......................................................................................................................... 44 v CHAPTER THREE .......................................................................................................... 48 Effect of Metal Loading and Subcellular pH on Net Charge of Superoxide Dismutase-1 ........ 48 Abstract ................................................................................................................................ 48 Introduction ......................................................................................................................... 49 Results and Discussion ...................................................................................................... 53 Conclusion ........................................................................................................................... 80 Materials and Methods ...................................................................................................... 82 Acknowledgements ............................................................................................................ 84 CHAPTER FOUR ......................................................................................................... 85 Protein Charge Ladders Reveal that the Net Charge of ALS-Linked Superoxide Dismutase Can Be Different in Sign and Magnitude from Predicted Values .......... 85 Abstract ................................................................................................................................ 85 Introduction ........................................................................................................................... 86 Results and Discussion .......................................................................................................... 91 Conclusion ........................................................................................................................... 116 Materials and Methods ........................................................................................................ 118 Acknowledgments ............................................................................................................... 121 CHAPTER FIVE ............................................................................................................ 122 Deamidation of asparagine to aspartate destabilizes Cu, Zn superoxide dismutase, accelerates fibrillization and mirrors ALS-linked mutations ............................................... 122 Abstract ............................................................................................................................... 122 Introduction ......................................................................................................................... 123 Results and Discussion ........................................................................................................ 127 Conclusion ........................................................................................................................... 151 Materials and Methods ........................................................................................................ 152 Acknowledgments ............................................................................................................... 156 CHAPTER SIX ............................................................................................................... 157 Voltage induced misfolding of zinc replete ALS mutamt superoxide dismutase-1. ............... 157 Abstract ............................................................................................................................... 157 Introduction ......................................................................................................................... 158 Results ................................................................................................................................. 160 vi Discussion ........................................................................................................................... 183 Method ...............................................................................................................................
Load more

Recommended publications
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Ykt6 Membrane-To-Cytosol Cycling Regulates Exosomal Wnt Secretion
    bioRxiv preprint doi: https://doi.org/10.1101/485565; this version posted December 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ykt6 membrane-to-cytosol cycling regulates exosomal Wnt secretion Karen Linnemannstöns1,2, Pradhipa Karuna1,2, Leonie Witte1,2, Jeanette Kittel1,2, Adi Danieli1,2, Denise Müller1,2, Lena Nitsch1,2, Mona Honemann-Capito1,2, Ferdinand Grawe3,4, Andreas Wodarz3,4 and Julia Christina Gross1,2* Affiliations: 1Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany. 2Developmental Biochemistry, University Medical Center Goettingen, Goettingen, Germany. 3Molecular Cell Biology, Institute I for Anatomy, University of Cologne Medical School, Cologne, Germany 4Cluster of Excellence-Cellular Stress Response in Aging-Associated Diseases (CECAD), Cologne, Germany *Correspondence: Dr. Julia Christina Gross, Hematology and Oncology/Developmental Biochemistry, University Medical Center Goettingen, Justus-von-Liebig Weg 11, 37077 Goettingen Germany Abstract Protein trafficking in the secretory pathway, for example the secretion of Wnt proteins, requires tight regulation. These ligands activate Wnt signaling pathways and are crucially involved in development and disease. Wnt is transported to the plasma membrane by its cargo receptor Evi, where Wnt/Evi complexes are endocytosed and sorted onto exosomes for long-range secretion. However, the trafficking steps within the endosomal compartment are not fully understood. The promiscuous SNARE Ykt6 folds into an auto-inhibiting conformation in the cytosol, but a portion associates with membranes by its farnesylated and palmitoylated C-terminus. Here, we demonstrate that membrane detachment of Ykt6 is essential for exosomal Wnt secretion.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Modeling of Human M1 Aminopeptidases for in Silico Screening of Potential Plasmodium Falciparum Alanine Aminopeptidase (Pfa-M1) Specific Inhibitors
    open access www.bioinformation.net Hypothesis Volume 10(8) Modeling of human M1 aminopeptidases for in silico screening of potential Plasmodium falciparum alanine aminopeptidase (PfA-M1) specific inhibitors Shakti Sahi*, Sneha Rai, Meenakshi Chaudhary & Vikrant Nain* School of Biotechnology, Gautam Buddha University, Greater Noida, 201312, India; Shakti Sahi – Email: [email protected]; Vikrant Nain- Email: [email protected]; Phone: +91-120-234275; +91-120-234283 Fax: +91-120-234205; *Corresponding authors Received June 18, 2014; Accepted June 27, 2014; Published August 30, 2014 Abstract: Plasmodium falciparum alanine M1-aminopeptidase (PfA-M1) is a validated target for anti-malarial drug development. Presence of significant similarity between PfA-M1 and human M1-aminopeptidases, particularly within regions of enzyme active site leads to problem of non-specificity and off-target binding for known aminopeptidase inhibitors. Molecular docking based in silico screening approach for off-target binding has high potential but requires 3D-structure of all human M1-aminopeptidaes. Therefore, in the present study 3D structural models of seven human M1-aminopeptidases were developed. The robustness of docking parameters and quality of predicted human M1-aminopeptidases structural models was evaluated by stereochemical analysis and docking of their respective known inhibitors. The docking scores were in agreement with the inhibitory concentrations elucidated in enzyme assays of respective inhibitor enzyme combinations (r2≈0.70). Further docking analysis of fifteen potential PfA-M1 inhibitors (virtual screening identified) showed that three compounds had less docking affinity for human M1-aminopeptidases as compared to PfA-M1. These three identified potential lead compounds can be validated with enzyme assays and used as a scaffold for designing of new compounds with increased specificity towards PfA-M1.
    [Show full text]
  • Download (11Mb)
    A Thesis Submitted for the Degree of PhD at the University of Warwick Permanent WRAP URL: http://wrap.warwick.ac.uk/108813/ Copyright and reuse: This thesis is made available online and is protected by original copyright. Please scroll down to view the document itself. Please refer to the repository record for this item for information to help you to cite it. Our policy information is available from the repository home page. For more information, please contact the WRAP Team at: [email protected] warwick.ac.uk/lib-publications STUDIES ON THE TARGETING AND PROCESSING OF PRORICIN. Michael Westby BSc. (Hons) Dunelm A thesis submitted for the degree of Doctor of Philosophy Department of Biological Sciences University of Warwick Coventry. U.K. September, 1991 CONTENTS Page No. Contents i-vii List of Figures viii-xi List of Tables xi Acknowledgements xii Declaration xiii Abbreviations xiv-xvi Dedication xvii Summary xviii î.o ihtbodpctioh 1 1.1 Summary 2 1.2 Plant storage proteins 3 1.2.1 Introduction 3 1.2.2 Classification of plant storage proteins 4 1.2.3 Storage proteins of cereals 4 1.2.4 Storage proteins of dicots. 4 1.2.5 Subcellular site of storage protein deposition- the protein bodies 9 1.2.6 Synthesis as preproproteins 11 1.2.7 Summary 15 1.3 Intracellular trafficking of newly-synthesised proteins 16 1.3.1 Introduction 16 1.3.2 Membrane translocation as a first step in compartmentalisation 16 1.3.3 Translocation across the ER membrane 18 1.3.4 Co-translatlonal modifications 21 1.3.5 Protein folding in the ER 21 1.3.6 Protein export
    [Show full text]
  • Goat Anti-MP100 / NPEPPS Antibody Peptide-Affinity Purified Goat Antibody Catalog # Af1679a
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Goat Anti-MP100 / NPEPPS Antibody Peptide-affinity purified goat antibody Catalog # AF1679a Specification Goat Anti-MP100 / NPEPPS Antibody - Product Information Application WB Primary Accession P55786 Other Accession NP_006301, 9520 Reactivity Human Predicted Mouse, Rat Host Goat Clonality Polyclonal Concentration 100ug/200ul Isotype IgG Calculated MW 103276 AF1679a (0.3 µg/ml) staining of Human Brain Goat Anti-MP100 / NPEPPS Antibody - Additional (Cerebral Cortex) lysate (35 µg protein in Information RIPA buffer). Primary incubation was 1 hour. Detected by chemiluminescence. Gene ID 9520 Other Names Goat Anti-MP100 / NPEPPS Antibody - Puromycin-sensitive aminopeptidase, PSA, Background 3.4.11.14, Cytosol alanyl aminopeptidase, AAP-S, NPEPPS, PSA This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which Format hydrolyzes amino acids from the N-terminus of 0.5 mg IgG/ml in Tris saline (20mM Tris its substrate. The protein has been localized to pH7.3, 150mM NaCl), 0.02% sodium azide, both the cytoplasm and to cellular membranes. with 0.5% bovine serum albumin This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is Storage involved in proteolytic events regulating the Maintain refrigerated at 2-8°C for up to 6 cell cycle. months. For long term storage store at -20°C in small aliquots to prevent Goat Anti-MP100 / NPEPPS Antibody - freeze-thaw cycles. References Precautions Involvement of puromycin-sensitive Goat Anti-MP100 / NPEPPS Antibody is for aminopeptidase in proteolysis of tau protein in research use only and not for use in cultured cells, and attenuated proteolysis of diagnostic or therapeutic procedures.
    [Show full text]
  • Protein's Intracellular Adventure Talking About
    Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Protein’s intracellular adventure Protein biosynthesis Correct protein folding Non-functional protein degradation Intracellular directing of proteins Talking about Ribosome – structure and function Chaperones – definition and role Proteasome – structure and function Import of proteins into organelles 1 Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Protein biosynthesis •Project – mARN • Machinery – ribosome • Raw material – aminoacyl-tARN Genetic code (degenerated or redundant) Project’s structural organization Eukaryotic messenger ARN 2 Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Raw material structure Eukaryotic transfer ARN (clover leaf) Organization of the machinery Ribosome – 3D Structure opened book lateral view top view Functional3 organization Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Organization of the machinery Molecular organization Biosynthetic process development Stages of protein biosynthesis • Initiation: initiation factors • Elongation: elongation factors • End of translation: releasing factors 4 Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Protein biosynthesis initiation Elongation’s steps Repeating stage, n cycles 5 Dr. Mircea Leabu. The ribosome and intracellular adventure of proteins (lecture iconography) Elongation: energetic needs
    [Show full text]
  • Protein Targeting and Degradation 775
    Contents CONTENTS CHAPTER • General Considerations • Free and Membrane-bound Ribosomes • Signal Hypothesis • Glycosylation of Proteins at the Level of ER Envelope Carrier Hypothesis 29 • • Proteins with a Carboxyl- terminal KDEL Sequence (=Recycling of Resident Proteins of the ER) Protein • Bacterial Signal Sequences and Protein Targeting • Eukaryotic Protein Transport Targeting and Across Membranes • Protein Import by Receptor- mediated Endocytosis Degradation • Protein Degradation GENERAL CONSIDERATIONS rotein turnover – that is synthesis and degradation – occurs constantly in eukaryotic cells but it is a Phighly selective process with different rates of turnover for various proteins. Turnover of proteins can Nuclear localization signal peptide control the level of certain enzymes, furnish amino acids in times of need and degrade faulty or damaged proteins Protein targeting signal recognition that are generated during synthesis or arise from The structure of the nuclear localization deleterious activities in the cell. Nascent proteins contain signal-binding protein α-karyopherin (or signals that determine their ultimate destination. A newly α-importin) with a nuclear localization signal peptide bound to its major synthesized protein in the prokaryotic Escherichia coli recognition site. cell, for example, can stay in the cytosol or it can be sent to the plasma membrane, the outer membrane, the space between them, or the extracellular medium. The eukaryotic cell is made up of many structures, compartments and organelles, each with specific functions requiring different types of proteins and enzymes. The synthesis of most of these proteins begins on free ribosomes in the cytosol. Therefore, eukaryotic cells must direct proteins to internal sites such as lysosomes, mitochondria, chloroplasts, nucleus etc. How then is sorting accomplished? In eukaryotes, a key choice is made soon after the synthesis of a protein begins.
    [Show full text]
  • 1 Large-Scale Deep Multi-Layer Analysis of Alzheimer's Disease
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.05.438450; this version posted August 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Large-Scale Deep Multi-Layer Analysis of Alzheimer’s Disease Brain Reveals Strong Proteomic Disease-Related Changes Not Observed at the RNA Level Erik C.B. Johnson1,2,†,*, E. Kathleen Carter1,2,†, Eric B. Dammer1,3,†, Duc M. Duong1,3, Ekaterina S. Gerasimov2, Yue Liu4, Jiaqi Liu4, Ranjita Betarbet1,2, Lingyan Ping1,2,3, Luming Yin3, Geidy E. Serrano7, Thomas G. Beach7, Junmin Peng8,9, Philip L. De Jager10, Vahram Haroutunian11,12, Bin Zhang13, Chris Gaiteri14, David A. Bennett14, Marla Gearing1,2,6, Thomas S. Wingo1,2,4, Aliza P. Wingo1,5,15, James J. Lah1,2, Allan I. Levey1,2,* and Nicholas T. Seyfried1,2,3,* 1Goizueta Alzheimer’s Disease Research Center, Emory University School of Medicine, Atlanta, GA, USA 2Department of Neurology, Emory University School of Medicine, Atlanta, GA, USA 3Department of Biochemistry, Emory University School of Medicine, Atlanta, GA, USA 4Department of Genetics, Emory University School of Medicine, Atlanta, GA, USA 5Department of Psychiatry, Emory University School of Medicine, Atlanta, GA, USA 6Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA, USA 7Banner Sun Health Research Institute, Sun City, AZ, USA 8Departments of Structural Biology and Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, TN, USA 9Center for Proteomics and Metabolomics, St.
    [Show full text]
  • Proteomic Profiling of Extracellular Vesicles Derived From
    cells Article Proteomic Profiling of Extracellular Vesicles Derived from Cerebrospinal Fluid of Alzheimer’s Disease Patients: A Pilot Study Satoshi Muraoka 1, Mark P. Jedrychowski 2, Kiran Yanamandra 3, Seiko Ikezu 1, Steven P. Gygi 2 and Tsuneya Ikezu 1,4,5,* 1 Department of Pharmacology and Experimental Therapeutics, Boston University School of Medicine, Boston, MA 02118, USA; [email protected] (S.M.); [email protected] (S.I.) 2 Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA; [email protected] (M.P.J.); [email protected] (S.P.G.) 3 Abbvie Inc. Foundational Neuroscience Center, Cambridge, MA 02139, USA; [email protected] 4 Department of Neurology, Boston University School of Medicine, Boston, MA 02118, USA 5 Center for Systems Neuroscience, Boston University, Boston, MA 02215, USA * Correspondence: [email protected]; Tel.: +1-617-358-9575 Received: 26 June 2020; Accepted: 21 August 2020; Published: 25 August 2020 Abstract: Pathological hallmarks of Alzheimer’s disease (AD) are deposits of amyloid beta (Aβ) and hyper-phosphorylated tau aggregates in brain plaques. Recent studies have highlighted the importance of Aβ and tau-containing extracellular vesicles (EVs) in AD. We therefore examined EVs separated from cerebrospinal fluid (CSF) of AD, mild cognitive impairment (MCI), and control (CTRL) patient samples to profile the protein composition of CSF EV. EV fractions were separated from AD (n = 13), MCI (n = 10), and CTRL (n = 10) CSF samples using MagCapture Exosome Isolation kit. The CSF-derived EV proteins were identified and quantified by label-free and tandem mass tag (TMT)-labeled mass spectrometry.
    [Show full text]
  • NPEPPS (NM 006310) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC209037 NPEPPS (NM_006310) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: NPEPPS (NM_006310) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NPEPPS Synonyms: AAP-S; MP100; PSA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 NPEPPS (NM_006310) Human Tagged ORF Clone – RC209037 ORF Nucleotide >RC209037 representing NM_006310 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCTGGCAGCTGCCGCCCCCTCCCTCGCTCGCCGCCTGCTCTTCCTCGGCCCTCCGCCTCCTCCCC TCCTCCTTCTCGTCTTCAGCCGCTCCTCTCGCCGCCGCCTCCACAGCCTGGGCCTCGCCGCGATGCCGGA GAAGAGGCCCTTCGAGCGGCTGCCTGCCGATGTCTCCCCCATCAACTACAGCCTTTGCCTCAAGCCCGAC TTGCTGGACTTCACCTTCGAGGGCAAGCTGGAGGCCGCCGCCCAGGTGAGGCAGGCGACTAATCAGATTG TGATGAATTGTGCTGATATTGATATTATTACAGCTTCATATGCACCAGAAGGAGATGAAGAAATACATGC TACAGGATTTAACTATCAGAATGAAGATGAAAAAGTCACCTTGTCTTTCCCTAGTACTCTGCAAACAGGT ACGGGAACCTTAAAGATAGATTTTGTTGGAGAGCTGAATGACAAAATGAAAGGTTTCTATAGAAGTAAAT ATACTACCCCTTCTGGAGAGGTGCGCTATGCTGCTGTAACACAGTTTGAGGCTACTGATGCCCGAAGGGC TTTTCCTTGCTGGGATGAGCCTGCTATCAAAGCAACTTTTGATATCTCATTGGTTGTTCCTAAAGACAGA
    [Show full text]
  • Aminopeptidase Expression in Multiple Myeloma Associates with Disease Progression and Sensitivity to Melflufen
    cancers Article Aminopeptidase Expression in Multiple Myeloma Associates with Disease Progression and Sensitivity to Melflufen Juho J. Miettinen 1,† , Romika Kumari 1,†, Gunnhildur Asta Traustadottir 2 , Maiju-Emilia Huppunen 1, Philipp Sergeev 1, Muntasir M. Majumder 1, Alexander Schepsky 2 , Thorarinn Gudjonsson 2 , Juha Lievonen 3, Despina Bazou 4, Paul Dowling 5, Peter O‘Gorman 4, Ana Slipicevic 6, Pekka Anttila 3, Raija Silvennoinen 3 , Nina N. Nupponen 6, Fredrik Lehmann 6 and Caroline A. Heckman 1,* 1 Institute for Molecular Medicine Finland-FIMM, HiLIFE–Helsinki Institute of Life Science, iCAN Digital Precision Cancer Medicine Flagship, University of Helsinki, 00290 Helsinki, Finland; juho.miettinen@helsinki.fi (J.J.M.); romika.kumari@helsinki.fi (R.K.); maiju-emilia.huppunen@helsinki.fi (M.-E.H.); philipp.sergeev@helsinki.fi (P.S.); muntasir.mamun@helsinki.fi (M.M.M.) 2 Stem Cell Research Unit, Biomedical Center, University of Iceland, 101 Reykjavik, Iceland; [email protected] (G.A.T.); [email protected] (A.S.); [email protected] (T.G.) 3 Department of Hematology, Helsinki University Hospital Comprehensive Cancer Center, 00290 Helsinki, Finland; juha.lievonen@hus.fi (J.L.); pekka.anttila@hus.fi (P.A.); raija.silvennoinen@helsinki.fi (R.S.) 4 Department of Hematology, Mater Misericordiae University Hospital, D07 Dublin, Ireland; [email protected] (D.B.); [email protected] (P.O.) 5 Department of Biology, Maynooth University, National University of Ireland, Citation: Miettinen, J.J.; Kumari, R.; W23 F2H6 Maynooth, Co. Kildare, Ireland; [email protected] Traustadottir, G.A.; Huppunen, M.-E.; 6 Oncopeptides AB, 111 53 Stockholm, Sweden; [email protected] (A.S.); Sergeev, P.; Majumder, M.M.; [email protected] (N.N.N.); [email protected] (F.L.) Schepsky, A.; Gudjonsson, T.; * Correspondence: caroline.heckman@helsinki.fi; Tel.: +358-50-415-6769 † These authors equally contributed to this work.
    [Show full text]