DOCSLIB.ORG

82171915.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
82171915.Pdf View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector International Journal of Infectious Diseases 49 (2016) 80–86 Contents lists available at ScienceDirect International Journal of Infectious Diseases jou rnal homepage: www.elsevier.com/locate/ijid Simultaneous detection of 13 viruses involved in meningoencephalitis using a newly developed multiplex PCR Mag-array system a,1 a,1 a a a a a Xiaodan Shi , Rui Wu , Ming Shi , Linfu Zhou , Mengli Wu , Yining Yang , Xinyue An , a a b b, a, Wen Dai , Liang Tian , Chen Zhang , Xuejun Ma **, Gang Zhao * a Department of Neurology, Xijing Hospital, The Fourth Military Medical University, Changle-Xi Road 167, Xi’an 710032, China b Key Laboratory for Medical Virology, Ministry of Health, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, No.155, Changbai Road, Changping District, Beijing 100050, China A R T I C L E I N F O S U M M A R Y Article history: Background: The early detection and identification of pathogens in central nervous system viral Received 14 December 2015 infections associated with neurological disease increases the survival rate. However, the limitations of Received in revised form 27 April 2016 current diagnostic methods contribute to a lack of proper diagnosis in 62% of patients. Therefore, a robust Accepted 19 May 2016 method for detecting multiple viruses in a single reaction with high specificity, throughput, and speed is required. Keywords: Methods: A multiplex PCR Mag-Array (MPMA) system was developed that integrates three strategies: MPMA system chimeric primer design, temperature switch PCR, and MagPlex-TAG techniques. The MPMA was used to Meningoencephalitis viruses amplify 13 target viral sequences simultaneously, with plasmids containing specific viral sequences as Cerebrospinal fluid standard samples. To evaluate its clinical performance, 177 cerebrospinal fluid (CSF) samples were tested. Results: The MPMA system presented high specificity and efficiency in detecting a control panel of 13 plasmids. Among 177 CSF samples, consistent results were achieved for 19 samples pre-tested using a commercial kit. Viral pathogens were found in 28/138 undiagnosed samples, with herpes simplex viruses (HSV-1 and HSV-2) being predominant. The 20 non-infectious samples revealed negative results. Compared to sequencing methods, sensitivity for detecting HSV-1 and HSV-2 was 100% and 98.78%, respectively, and specificity was 100% and 98.22%, respectively. Conclusions: A robust MPMA system that can simultaneously and reliably detect 13 meningoencephali- tis-associated viruses with high specificity, throughput, and speed has been developed. ß 2016 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by- nc-nd/4.0/). progresses to a life-threatening stage for which few curative 1. Introduction 4 methods are available. The common viral pathogens causing central nervous system (CNS) infections are human enterovirus Although the annual incidence of encephalitis and meningitis is (HEV), herpes simplex virus type 1 (HSV-1), herpes simplex virus estimated to be 0.07 to 12.6 cases per 100 000 individuals type 2 (HSV-2), cytomegalovirus (CMV), varicella zoster virus worldwide, severe disability has been reported in up to 56% of 1–3 (VZV), and Epstein–Barr virus (EBV). Mumps virus (MuV) and survivors and mortality rates range between 7% and 18%. Early 5,6 measles virus (MeV) are undergoing a worldwide resurgence. identification of the causative viral pathogen is important in order Among HEV, subtypes such as coxsackie A virus type 16 (CA16), to develop an effective treatment plan before the disease enterovirus type 71 (EV71), and echoviruses (ECHO) are frequently 7,8 found to be involved in CNS infection worldwide. In addition to these, JC virus (JCV) is a major viral cause of progressive multifocal * Corresponding author. Tel.: +86 2984775368. leukoencephalopathy that is rarely included in routine detection ** Corresponding author. Tel.: +86 1058900810. 9 systems, and Japanese encephalitis virus (JEV) is a major cause of E-mail addresses: maxj@ivdc.chinacdc.cn (X. Ma), zhaogang@fmmu.edu.cn viral encephalitis in geographical areas such as Asia and the (G. Zhao). 10 1 Western Pacific. Xiaodan Shi and Rui Wu contributed equally to this study. http://dx.doi.org/10.1016/j.ijid.2016.05.023 1201-9712/ß 2016 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). X. Shi et al. / International Journal of Infectious Diseases 49 (2016) 80–86 81 Traditional identification techniques such as pathogen culture In this study, a multiplex PCR Mag-array (MPMA) system was and antigen or antibody detection have limited capacity in their developed, based on the Luminex-200 system in combination with clinical application, owing to low sensitivity and specificity and MagPlex-TAG technology (xTAG); this system detects 13 viruses 11,12 high time requirements. Advanced molecular tools have aided simultaneously: HSV-1, HSV-2, CMV, VZV, EBV, MuV, MeV, JCV, the development of commercial products that offer much- JEV, CA16, EV71, ECHO, and HEV. 1 enhanced sensitivity and diagnostic turnaround times. However, these products have been designed to target only a few virus types, 2. Materials and methods greatly limiting their clinical application. Additionally, despite improvements in sensitivity over previous methods, large volumes 2.1. Plasmids and CSF samples of cerebrospinal fluid (CSF) are still required by currently available commercial products, which can be quite challenging for the Fragments of the specific genes from 13 selected viruses (HSV- patient due to the side effects of lumbar puncture. Therefore, there 1, HSV-2, CMV, VZV, EBV, MuV, MeV, JCV, JEV, CA16, EV71, ECHO, is an urgent need for a highly sensitive, highly specific, and high- and HEV) were synthesized by Sangon Biotech (Shanghai, China) throughput pathogen detection method. (Table 1) and subcloned into the pcDNA3.1 plasmid (Thermo Fisher 15 The Luminex-200 MagPlex-TAG beads array system (Luminex Scientific, Waltham, MA, USA). Each recombinant pcDNA3.1 Corp., Austin, TX, USA) is capable of simultaneously detecting plasmid was used as a standard plasmid for subsequent experi- 100 different PCR products and is thus ideal for high-throughput ments. A blank pcDNA3.1 plasmid was used as a vehicle plasmid 13 screening. For example, the Luminex-200 xTAG respiratory control (VPC). pathogen panel can simultaneously detect 14 selected viruses To further confirm the feasibility of the MPMA system, 177 CSF 14 involved in respiratory viral infections. Unfortunately, similar specimens were collected (138 undiagnosed specimens from products are not yet available for the detection of multiple viruses patients with meningoencephalitis symptoms, 19 samples pre- associated with CNS infection diseases. tested using commercial kits, and 20 specimens from patients Table 1 a Primers and probes 0 0 Name Sequence (5 !3 ) Gene target Conc. (nM) Tm GC% Length b HSV-1-F AGGTGACACTATAGAATATTTGATTTAAGAGTGTTGAATGTATGAAGCGCGAACTGACGA 81L 120 59.67 55.56 189 HSV-1-R GTACGACTCACTATAGGGAGGTGGGCGTGGCACTATC 120 60.51 66.67 HSV-1-P TTTGATTTAAGAGTGTTGAATGTA b HSV-2-F AGGTGACACTATAGAATATATTAGAGTTTGAGAATAAGTAGTTATCGGAGGCCCTTTGTTGC UL23 40 60.39 55 163 HSV-2-R GTACGACTCACTATAGGGAGCCGATCCGTCCTTGTTTTC 40 59.55 55 HSV-2-P TATTAGAGTTTGAGAATAAGTAGT b VZV-F AGGTGACACTATAGAATATTGTGTAGTTAAGAGTTGTTTAATGCAGGGAATTGGAGCGGTT QCMD 120 60.68 57.89 222 VZV-R GTACGACTCACTATAGGGAACTTGGTCGGATAGGGTGGT 120 60.25 55 VZV-P TTGTGTAGTTAAGAGTTGTTTAAT b CMV-F AGGTGACACTATAGAATAGATAGATTTAGAATGAATTAAGTGTCTACTACACGTCAGCGTTCG UL83 160 59.87 52.38 202 CMV-R GTACGACTCACTATAGGGAACACCTTGACGTACTGGTCAC 160 59.93 52.38 CMV-P GATAGATTTAGAATGAATTAAGTG b EBV-F AGGTGACACTATAGAATAGTGTTATAGAAGTTAAATGTTAAGTTCGTTGCCCACAGTCAGG LMP-2A 120 60.23 57.89 165 EBV-R GTACGACTCACTATAGGGAGGTTTTGCGGAGACAAGCAG 120 60.04 55 EBV-P GTGTTATAGAAGTTAAATGTTAAG MeV-F AGGTGACACTATAGAATAGTTTGTTGAAAGTGTAAAGTATATTCAGCAACTGCATGGTAGCTT KJ36545 120 60.27 47.62 250 MeV-R GTACGACTCACTATAGGGACTATCACTGGGTCATCCGTCG 120 60 57.14 MeV-P GTTTGTTGAAAGTGTAAAGTATAT MuV-F AGGTGACACTATAGAATATAGATTAGTTGATAAGTGTGTAATTCGGAGAACAAGCCAGATACC KF481689 100 59.52 52.38 202 MuV-R GTACGACTCACTATAGGGACTAGGACTGTACCGACTCCCA 100 60.06 57.14 MuV-P TAGATTAGTTGATAAGTGTGTAAT JCV-F AGGTGACACTATAGAATAAGAGAGTTTGTGTATATGTATAAATCCATGTCCAGAGTCTTCTGC argno 120 59.45 52.38 202 JCV-R GTACGACTCACTATAGGGAGCCATTCATGAGAGGATTGTGC 120 59.97 50 JCV-P AGAGAGTTTGTGTATATGTATAAA JEV-F AGGTGACACTATAGAATATTAAGAAGAATTGTATATGAGAGTTCATGGCAGTGTCCTACGTG GP1 120 59.75 55 183 JEV-R GTACGACTCACTATAGGGATTTCACATCCAGCCTCCGAC 120 60.04 55 JEV-P TTAAGAAGAATTGTATATGAGAGT b ECHO-F AGGTGACACTATAGAATAAGAGAGTTTGTGTATATGTATAAACCCTAAAAGTTATGAGGATTTCGCA VP1 120 59.41 40 131 ECHO-R GTACGACTCACTATAGGGAATTACCCTCCGTCCAGAATACG 120 59.37 40 ECHO-P AGAGAGTTTGTGTATATGTATAAA b EV71-F AGGTGACACTATAGAATATAGATTAGTTGATAAGTGTGTAATGAGCCCTCACACACGCTCTAC VP1 100 60.9 60 152 EV71-R GTACGACTCACTATAGGGACGCAGCTCGTCCTTGACAT 100 60.45 57.89 EV71-P TAGATTAGTTGATAAGTGTGTAAT CA16-F AGGTGACACTATAGAATAGTTTGTTGAAAGTGTAAAGTATATCCAGCCTGATATTTGTCGAAGC TW-3126-98 polyprotein 90 59.71 50 157 CA16-R GTACGACTCACTATAGGGACACAGTCACCAGGTTCCGAG 90 60.32 60 CA16-P
Load more

Recommended publications
  • Hand, Foot and Mouth Disease
    CDAlert Monthly Newsletter of National Institute of Communicable Diseases, Directorate General of Health Services, Government of India July 2008 Vol.12 : No.3 Hand, Foot and Mouth Disease INTRODUCTION Enterovirus71 or other enteroviruses have also been associated with HFMD and with outbreaks of the Hand, foot and mouth disease (HFMD) is a human disease. HFMD caused by Enterovirus71 has shown syndrome caused by intestinal viruses of the a higher incidence of neurologic involvement. Fatal Picornaviridae family. The most common strains cases of encephalitis caused by enterovirus 71 have causing HFMD are Coxsackie A virus and occurred during outbreaks. Enterovirus71 (EV71). It is a common viral illness of infants and children and is extremely uncommon To Summarise: in adults; however, still a possibility. Most adults Ø Coxsackie virus A16®Mild Infection HFMD have strong enough immune systems to defend the virus, but those with immune deficiencies are very Ø Enterovirus71®HFMD with severe neurologic susceptible. involvement including fatal encephalitis It is often confused with foot-and-mouth (also called Ø Other enteroviruses hoof-and-mouth) disease, a disease of cattle, sheep, RECORDED OUTBREAKS and swine; however, the two diseases are not Individual cases and outbreaks of HFMD occur related—they are caused by different viruses. worldwide. In temperate climates, cases occur more Humans do not get the animal disease, and animals often in summer and early autumn. Since 1997, do not get the human disease. outbreaks of HFMD caused by Enterovirus 71 have AETIOLOGY been reported in Asia and Australia. HFMD is caused by viruses belonging to the Ø In 1997, 34 children died in an outbreak in enterovirus genus (group).
    [Show full text]
  • Diseases in Search of Viruses
    DISEASES IN SEARCH OF VIRUSES BY C. H. STUART-HARRIS, M.D., F.R.C.P. Professor of Medicine, University of Sheffield* ft f>]/ery?ne agrees that tremendous changes have occurred in the past few years in the ?f the infectious diseases. Formidable have been both for the tt? weapons forged a c atlftent and the prevention of bacterial infections. As result, diphtheria has be- CQ^e almost extinct and the enteric diseases are much reduced, patients with strepto- 1) ^ disease and with pneumonia less often require hospital treatment, and the acute i^ness *n childhood has Virus infections have 1?t K considerably lightened. W Wever> altered in the same way or to the same extent. Some, such as poliomyelitis, a to both children and adults. undescribed S(J ? become threat Previously conditions as myalgic encephalomyelitis or Royal Free disease, aseptic meningitis with an and little known syndromes such as herpangina, pharyngo-conjunctival fever a^hemOrnholm disease have achieved a of interest and even of as cjjj position importance of ,S.es of morbidity. Moreover, the development of new techniques for the cultivation has led to the realization of a method of control of certain diseases and to a H^lr.Usesk 'cia regard to diagnosis. These changes have affected the work of both clin- oUtlns and microbiologists, and yet there has also arisen a considerable divergence of iti h?0^ between these two groups of medical men. One could almost say that they live -j,,0 different worlds. virune virologist, being equipped with new techniques for the laboratory study of CoVeSes> has been more and more excited over the possibility of fundamental dis- w concerning the nature of viruses, of their mode of multiplication and of the Uity restraining their multiplication by chemical substances.
    [Show full text]
  • The Medical and Public Health Importance of the Coxsackie Viruses
    806 S.A. MEDICAL JOURNAL 25 August 1956 it seems that this mother's claim cannot be upheld, Dit lyk dus of hierdie moeder se eis nie gestaaf kan word and we must still look for further evidence of human nie en ons moet nog steeds soek na verdere bewyse van parthenogenesis. menslike partenogenese. 1. Editorial (1955): Lancet, 2, 967. 1. Van die Redaksie (1955): Lancet, 2, 967. 2. Pincus, G. and Shapiro, H. (1939): Proc. Nat. Acad. Sci., 2. Pincus, G. en Shapiro, H. (1939): Proc. Nat. Acad. Sci., 26,163. 26, 163. 3. Balfour-Lynn, S. (1956): Lancet, 1, 1072. 3. Balfour-Lynn, S. (1956): Lancet, 1, 1072. THE MEDICAL AND PUBLIC HEALTH IMPORTANCE OF THE COXSACKIE VIRUSES JA.\1ES GEAR, V.MasRoCH M'D F. R. PRINSLOO Poliomyelitis Research Foundation, South African Institute for Medical Research The Coxsackie group of viruses derived their name paralytic poliomyelitis infected also with poliovirus. from the Hudson River Town, Coxsackie, in New York As a result of more recent studies their pathogenicity State, where the first two members of this group were has now been more clearly defined. 2 The group-A identified by Dalldorf and Sickies in 1947.1 Both these viruses have been incriminated as the cause of herp­ viruses were isolated in suckling mice from the faeces angina and, as the present studies show, are possibly of children acutely ill with paralytic poliomyelitis. The related to a number of other illnesses. Coxsackie-B pathogenicity for suckling mice is one of the distinguish­ viruses have been incriminated as the cause of Bornholm ing features of this group of viruses, and their relative disease and, as the present studies show, in parts of lack of pathogenicity for adult mice and other experi­ Southern Africa are important causes ofaseptic meningo­ mental animals accounts for their escape from recogni­ encephalitis and of myocarditis neonatorum.
    [Show full text]
  • HUMAN ADENOVIRUS Credibility of Association with Recreational Water: Strongly Associated
    6 Viruses This chapter summarises the evidence for viral illnesses acquired through ingestion or inhalation of water or contact with water during water-based recreation. The organisms that will be described are: adenovirus; coxsackievirus; echovirus; hepatitis A virus; and hepatitis E virus. The following information for each organism is presented: general description, health aspects, evidence for association with recreational waters and a conclusion summarising the weight of evidence. © World Health Organization (WHO). Water Recreation and Disease. Plausibility of Associated Infections: Acute Effects, Sequelae and Mortality by Kathy Pond. Published by IWA Publishing, London, UK. ISBN: 1843390663 192 Water Recreation and Disease HUMAN ADENOVIRUS Credibility of association with recreational water: Strongly associated I Organism Pathogen Human adenovirus Taxonomy Adenoviruses belong to the family Adenoviridae. There are four genera: Mastadenovirus, Aviadenovirus, Atadenovirus and Siadenovirus. At present 51 antigenic types of human adenoviruses have been described. Human adenoviruses have been classified into six groups (A–F) on the basis of their physical, chemical and biological properties (WHO 2004). Reservoir Humans. Adenoviruses are ubiquitous in the environment where contamination by human faeces or sewage has occurred. Distribution Adenoviruses have worldwide distribution. Characteristics An important feature of the adenovirus is that it has a DNA rather than an RNA genome. Portions of this viral DNA persist in host cells after viral replication has stopped as either a circular extra chromosome or by integration into the host DNA (Hogg 2000). This persistence may be important in the pathogenesis of the known sequelae of adenoviral infection that include Swyer-James syndrome, permanent airways obstruction, bronchiectasis, bronchiolitis obliterans, and steroid-resistant asthma (Becroft 1971; Tan et al.
    [Show full text]
  • DNA Viral Diseases
    Unit 6 Lecture 16 Unit 6 Lecture 16 DNA Viral Diseases Recall from unit one that viruses have DNA or RNA for their nucleic acid, but never both and that the DNA and RNA can be either single stranded or double stranded. This first section of viral diseases covers the DNA viruses. Families of DNA viruses are grouped according to the number of strands of DNA they possess, the presence or absence of an envelope, size, and the host cells they attack. Pox viruses The Pox viruses are the largest viruses. They cause skin lesions that start as flat, red macules, enlarge into papules, fill with a clear fluid to become vesicles, and then fill with pus to become pustules which are also known as pox or pocks. The pox crust over and may scar. Most animal pox viruses, and there are many, are species specific, but some animal pox viruses can infect humans, (cowpox, monkeypox, and goatpox). Smallpox is species specific to humans. A member of the Orthopoxvirus family, Smallpox has played and could still play an important role in the history of microbiology, immunization, epidemiology, and medicine. Over eighty percent of the European population contracted smallpox during the Middle Ages. Later, explorers took smallpox to the new world and introduced it to a very susceptible population of Native Americans resulting in an estimated 3.5 million deaths. Over time smallpox is believed to have killed about one BILLION people. The disease has been wiped out in the wild since 1978 as the result of a very intense vaccination program carried out by the World Health Organization (WHO).
    [Show full text]
  • Hand, Foot, and Mouth Diseases
    Arch Dis Child: first published as 10.1136/adc.40.213.560 on 1 October 1965. Downloaded from Arch. Dis. Childh., 1965, 40, 560. HAND, FOOT, AND MOUTH DISEASES BY S. R. MEADOW* (RECEIVED FOR PUBLICATION MARCH 25, 1965) Hand, foot, and mouth disease is being recognized hand, foot, and mouth disease. Series X, the 51 more often, and it is becoming clear that it is mainly cases of hand, foot, and mouth disease, will be des- a disease of children. The association of mouth cribed first. ulcers, and vesicles of the feet and hands, with Cox- sackie group A viruses has been found in many Hand, Foot, and Mouth Disease (Series X) centres, most often with the A type 16 virus, but sometimes with A types 5 and 10. Because of the Clinical Features. In the Banbury, Oxfordshire, mild nature of the disease and its sporadic out- area, there was an epidemic illness during September breaks, one observer rarely sees many cases, hence a and October 1963. The illness was mild, only half description of a series of 69 cases seen in general of the patients consulting a doctor, and ran a course practice may be of value. of under 10 days, regressing spontaneously. Hand, foot, and mouth disease was occurring in AGE INCIDENCE. Amongst 51 cases the age dis- many parts of Britain in the second half of 1963: it tribution was: 0-5 years, 24; 5-10 years, 10; 10-20 was reported in Buckinghamshire, Swindon, and years, 2; 20-40 years, 15. Bristol (Crow, Warin, and Wilkinson, 1963), and The small number in the 10-20 years group reflects copyright.
    [Show full text]
  • Nanomaterials and Nanotechnology-Associated Innovations Against Viral Infections with a Focus on Coronaviruses
    nanomaterials Review Nanomaterials and Nanotechnology-Associated Innovations against Viral Infections with a Focus on Coronaviruses Mahmoud Nasrollahzadeh 1,* , Mohaddeseh Sajjadi 1, Ghazaleh Jamalipour Soufi 2 , Siavash Iravani 3,* and Rajender S. Varma 4,* 1 Department of Chemistry, Faculty of Science, University of Qom, Qom 37185-359, Iran; mhd.sajjadi@gmail.com 2 Radiology Department, School of Medicine, Isfahan University of Medical Sciences, Isfahan 81746 73461, Iran; Jamalipour@med.mui.ac.ir 3 Faculty of Pharmacy and Pharmaceutical Sciences, Isfahan University of Medical Sciences, Isfahan 81746 73461, Iran 4 Regional Centre of Advanced Technologies and Materials, Palacký University in Olomouc, Šlechtitel ˚u27, 783 71, CZ-779 00 Olomouc, Czech Republic * Correspondence: mahmoudnasr81@gmail.com (M.N.); siavashira@gmail.com (S.I.); Varma.Rajender@epa.gov (R.S.V.) Received: 1 May 2020; Accepted: 20 May 2020; Published: 31 May 2020 Abstract: Viral infections have recently emerged not only as a health threat to people but rapidly became the cause of universal fatality on a large scale. Nanomaterials comprising functionalized nanoparticles (NPs) and quantum dots and nanotechnology-associated innovative detection methods, vaccine design, and nanodrug production have shown immense promise for interfacing with pathogenic viruses and restricting their entrance into cells. These viruses have been scrutinized using rapid diagnostic detection and therapeutic interventional options against the caused infections including vaccine development for prevention and control. Coronaviruses, namely SARS-CoV, MERS-CoV, and SARS-CoV-2, have endangered human life, and the COVID-19 (caused by SARS-CoV-2) outbreak has become a perilous challenge to public health globally with huge accompanying morbidity rates.
    [Show full text]
  • VIRUS REFERENCE LABORATORY* Paralytic
    1962 ANNUAL REPORT VIRUS REFERENCE LABORATORY* Department of Microbiology, Queen's University, Belfast During 1962 the followving have contributed to the work of the Virus Reference Laboratory: J. H. CONNOLLY, M.D., J. R. L. FORSYTH, M.B., MARGARET HAIRE, M.B., J. EVANS, A.I.M.L.T., and BARBARA WHITE. THIS is the sixth report of the Virus Reference Laboratory and, as in previous reports, only the more interesting and rewarding aspects of the work will be presented. POLIOMYELITIS. Laboratory Diagnosis. During 1962 there were thirty-one cases of paralytic poliomyelitis in Northern Ireland, including one death, giving an attack rate of 2.2 per 100,000 of the population. Type 1 poliovirus was isolated from all cases. In addition, there were three patients with limb paralysis in whom the C.S.F. findings were suggestive of polyneuritis; poliovirus was not isolated from these patients and they had no rise in poliovirus neutralizing antibody during their illnesses. A case of facial palsy in which a diagnosis of poliomyelitis was considered possible was found to be due to geniculate herpes. Type 1 poliovirus was also isolated from six cases of aseptic meningitis. The age and sex of the patients with poliomyelitis were as follows: AGE IN YEARS 0-1 1-3 3-5 5-7 7-9 9-11 20+ TOTAL Paralytic - 2 ... ... ... ....4 ... I ... 4 ... 31 - . Aseptic meningitis- I ... ... 2 ... ... 3 ... ... 6 Includes one death. Two of the patients with paralytic poliomyelitis were children less than a year old, one a 7-month-old boy and the other a 6-month-old girl.
    [Show full text]
  • Review for Reprint Orders, Please Contact: Reprints@Futuremedicine.Com
    REVIEW For reprint orders, please contact: reprints@futuremedicine.com Contemporary infectious exanthems: an update Francesco Drago1, Giulia Ciccarese*,1, Giulia Gasparini1, Ludovica Cogorno1, Sanja Javor1, Antonio Toniolo2 & Francesco Broccolo3 An exanthem is a skin rash that may be associated with mucous membrane eruption, fever or other symptoms. It may develop as manifestation of an infectious disease or as adverse reaction to drugs. Beside the ‘classical exanthems’ commonly occurring in childhood, other exanthems, defined as ‘atypical’ for the different morphology and causal agents, may occur. Among the atypical exanthems with infectious etiology, viral, bacterial, parasitic and helminth infections are implicated. We describe herein etiology and epidemiology of the atypical exanthems caused by infectious agents. In case of exanthem, to make a correct etiological diagnosis is crucial for both the patient and community concerning issues such as time off school, immunizations and risk in pregnancy and immunocompromised individuals. First draft submitted: 21 July 2016; Accepted for publication: 24 October 2016; Published online: 14 November 2016 An exanthem is defined as any eruptive skin rash that may be associated with lesions of the mucous KEYWORDS membranes (enanthem), fever or systemic symptoms. It may be the manifestation of an infectious • bacteria • diagnosis disease or an adverse reaction to drugs and is among the most frequent reasons for consultation of a • exanthem • parasite • skin dermatologist [1] . Beside the ‘classic exanthems’ (Table 1) [2], other exanthems with different morphol- eruption • skin infection ogy and caused by different infectious/toxic agents may occur. These skin rashes have been defined • skin rash • virus as ‘atypical exanthems’ [1,3].
    [Show full text]
  • A Case Report on Symptomatic Primary Herpetic Gingivostomatitis
    Journal of Dental Health, Oral Disorders & Therapy Case Report Open Access A case report on symptomatic primary herpetic gingivostomatitis Abstract Volume 8 Issue 8 - 2017 Primary herpetic gingivostomatitis is a common paediatric infection and the causative organism in 90% of cases is herpes simplex virus type 1, with complications that range Mervyn Turton Department of Dentistry, University of the Western Cape, USA from indolent cold sores to dehydration and even life-threatening encephalitis. A nine year old, female presented with a main complaint of difficulty eating due to pain associated Correspondence: Mervyn Turton, Department of Dentistry, with multiple shallow oval oral ulcers. PHG has to be differentiated clinically from acute University of the Western Cape, Robert Sobukwe Rd, Bellville, necrotising ulcerative gingivitis, recurrent HSV infection, herpangia, aphtous ulcers, Cape Town, 7535, South Africa, Email erythema multiforme, teething, allergic stomatitis and ulcers due to chemotherapy. Management of PHG is palliative and supportive, with symptomatic relief that primarily Received: November 11, 2017 | Published: December 29, involves pain management and oral fluids to prevent dehydration until the viral infection 2017 subsides, prevention of dehydration, and shortening the duration of lesions even though orolabial herpetic infections are usually self-limiting. The aim of this case study was to highlight a symptomatic case of PHG which required an astute diagnosis and a comprehensive treatment plan with emphasises on the importance for oral health clinicians to have a holistic approach to management of oral disease. Keywords: gingivostomatitis, herpes simplex virus, ulcers, fever Abbreviations: PHG, primary herpetic gingivostomatitis; disease as treating the patient holistically can bring about positive HSV, herpes simplex virus changes in the persons oral health status, awareness and behaviours.
    [Show full text]
  • Chapter 9: Mumps
    VPD Surveillance Manual 9 Mumps: Chapter 9.1 Chapter 9: Mumps Authors: Mariel Marlow, PhD, MPH; Jessica Leung, MPH; Mona marin, MD; Carole Hickman, PhD; Nakia Clemmons, MPH; Leah Shepersky; Huong Pham, MPH; Manisha Patel, MD, MS I. Disease Description Mumps is an acute viral illness caused by a paramyxovirus that typically presents as swelling of the parotid (parotitis) or other salivary gland[s]. Parotitis may be unilateral or bilateral and usually lasts about 3 to 7 days (average 5 days); most cases resolve within 10 days. Nonspecific prodromal symptoms may precede parotitis by several days, including low-grade fever, which may last 3–4 days, myalgia, anorexia, malaise, and headache. The incubation period ranges from 12–25 days, but parotitis typically develops 16 to 18 days after exposure to mumps virus.1 Mumps can occur in a person who is fully vaccinated, but vaccinated persons are at much lower risk for mumps and mumps complications. Mumps reinfection in patients who previously had natural infection or recurrent mumps (parotid swelling resolves and then weeks to months later occurs on the same or other side) can also occur.2–4 Mumps infection may present only with nonspecific or primarily respiratory symptoms or may be asymptomatic.5 Among unvaccinated people, approximately 20% of infections can be asymptomatic; frequency of asymptomatic infection among vaccinated people is unknown.6–8 Complications The most common complications of mumps include orchitis, oophoritis, mastitis, pancreatitis, hearing loss, meningitis, and encephalitis.
    [Show full text]
  • Recombination Events and Conserved Nature of Receptor Binding Motifs in Coxsackievirus A9 Isolates
    viruses Article Recombination Events and Conserved Nature of Receptor Binding Motifs in Coxsackievirus A9 Isolates Eero Hietanen and Petri Susi * Institute of Biomedicine, University of Turku, 20520 Turku, Finland; eevahi@utu.fi * Correspondence: pesusi@utu.fi; Tel.: +358-440499990 Received: 26 September 2019; Accepted: 1 January 2020; Published: 6 January 2020 Abstract: Coxsackievirus A9 (CVA9) is an enterically transmitted enterovirus and one of the most pathogenic type among human enteroviruses. CVA9 isolates use a distinctive RGD (Arg-Gly-Asp) motif within VP1 capsid protein that defines its ability to bind to integrin receptor(s) for cellular entry. To investigate CVA9 evolution and pathogenicity, genetic relationships and recombination events were analyzed between 54 novel clinical isolates of CVA9, as well as 21 previously published full length CVA9 sequences from GenBank. Samples were investigated by partial sequencing of the novel VP1 and 3Dpol genes, as well as including the corresponding areas from GenBank sequences. Phylogenetic analyses were combined with clinical data in a further attempt to analyze whether sequence evolution reflects CVA9 pathogenicity in the phylogenies. Furthermore, VP1 gene was also analyzed for receptor binding sites including the RGD motif and the putative heparan sulfate (HS) site. Analysis of the 559-nucleotide-long VP1 sequences identified six clades. Although most of the strains within each clade showed geographical clustering, the grouping pattern of the isolates in the analysis of the VP1 gene was strikingly different from grouping of 3Dpol, which suggests that recombination events may have occurred in the region encoding the nonstructural proteins. Inclusion of clinical data did not provide any evidence of symptom based phylogenetic clustering of CVA9 isolates.
    [Show full text]