Virus Reviews and Research Journal of the Brazilian Society for Virology

Home , Begomovirus, College of Amazon, Deltabaculovirus, Edson Elias, Gammabaculovirus, Podalia (Lycia)

Volume 18, September 2013, Supplement 1 Annals of XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 01 - 04, 2013, Náutico Praia Hotel & Convention Center, Porto Seguro, Bahia, Brazil

Editors Fernando Rosado Spilki Edson Elias da Silva

BRAZILIAN SOCIETY FOR VIROLOGY BOARD OF DIRECTORS (2013-2014) Officers President: Dr Eurico de Arruda Neto

Vice-President: Dr Bergmann Morais Ribeiro Dra Paula Rahal, UNESP (2013 – 2014) First Secretary: Dr Mauricio Lacerda Nogueira Dr Davis F. Ferreira, UFRJ (2013 – 2014) Second Secretary: Dra Luciana Jesus da Costa First Treasurer: Dr Luis Lamberti Pinto da Silva Environmental Virology (EV) Second Treasurer: Dra Clarice Weis Arns Dra Célia Regina Barardi, UFSC (2013 – 2014) Executive Secretary: Dr Fabrício Souza Campos Dr Fernando Rosado Spilki, Feevale (2013 – 2014)

Human Virology (HV) Councillors Dr Luiz Tadeu Figueiredo, USP-RP (2013 – 2014) Dra Maria Luisa Barbosa Dra Nancy Bellei, UNIFESP (2013 – 2014) Dra Viviane Fongaro Botosso Dra Maria Angela Orsi Immunobiologicals in Virology (IV) Dra Sílvia Cavalcanti, UFF (2013 – 2013) Dr Edson Elias da Silva, Fiocruz (2013 – 2014) Area Representatives Basic Virology (BV) Plant and Invertebrate Virology (PIV) Dr Paulo Brioso, UFRJ (2013 – 2014) Dr Tatsuya Nagata, UNB (2013 – 2014)

Veterinary Virology (VV) Dr Paulo Brandão, USP (2013 – 2014) Dra Rita Cubel, UFF (2013 – 2014)

Address Universidade Feevale, Instituto de Ciências da Saúde Estrada RS-239, 2755 - Prédio Vermelho, sala 205 - Laboratório de Microbiologia Molecular Bairro Vila Nova - 93352-000 - Novo Hamburgo, RS - Brasil Phone: (51) 3586-8800 E-mail: F.R.Spilki - [email protected] http://www.sbv.org.br/vrr Organizing Committee Bergmann Morais Ribeiro, UNB Célia R. M. Barardi, UFSC Clarice Weis Arns, UNICAMP Davis Fernandes Ferreira, UFRJ Edson Elias da Silva, Fiocruz Eurico de Arruda Neto, USP – Presidente da SBV e do XXIV CBV Fabrício Souza Campos, UFRGS Fernando Rosado Spilki, Universidade FEEVALE Francisco Murilo Zerbini, UFV Lauro Juliano Marin, UESC Luciana Jesus Costa, UFRJ Luis Lamberti Pinto da Silva, USP Luiz Tadeu Figueiredo, USP Maria Angela Orsi, LANAGRO Maria Luisa Barbosa, Instituto Adolfo Lutz Maurício Lacerda Nogueira, FAMERP Nancy Bellei, UNIFESP Paula Rahal, UNESP Paulo Sergio Torres Brioso, UFRRJ Paulo Eduardo Brandão, USP Rita de Cássia Nasser Cubel Garcia, UFF Silvia Maria Baeta Cavalcanti, UFF Tatsuya Nagata, UNB Viviane Fongaro Botosso, Instituto Butantan

Board of Examiners - Hélio Gelli Pereira Award Dr Mauricio Lacerda Nogueira (President) Dr Luis Lamberti Pinto da Silva Dr Paulo Eduardo Brandão

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Financial Support General Information

CAPES Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Secretary Office Hours September, 1st - 8am - 8pm CNPQ September, 2nd - 7am - 7:30pm September, 3rd - 7am - 7:30pm Tecnológico September, 4th - 7am - 5pm FAPESBConselho Nacional de Desenvolvimento Cientifico e Fundação de Amparo à Pesquisa do Estado da Bahia, Secretaria de Ciência, Tecnologia e Inovação Name Badge Name badges will be required for access in all activities, Ministério da Saúde including lunch. FAPESP Fundação de Amparo à Pesquisa do Estado de São Paulo Media Desk (for lecturers only) The media desk will be open as scheduled for the secretary Exhibitors BIOSAFE mediaoffice of desk the atmeeting. least 2 hours before the scheduled time for the Instituto Evandro Chagas presentation.Data - files with Please presentations note that the - use must of bepersonal delivered computers at the NOVA ANALÍTICA by presenters will not be allowed. POLIMATE QIAGEN Lounge area SARSTEDT A lounge area will be available for lecturers, invited persons SIGMA-ALDRICH and SBV staff. SÍNTESE VECO Certificates The registration desk of presentation/participation will be available at the registration desk of the event on the last day of Organizers Office Marketing Eventos Travelthe meeting. Agency Identification cards will be required.

Congress of Virology. WeINTERVIAGEM prepared specialis the official tours tour around operator Porto of theSeguro XXIV Brazilianfor your entertainment in your free time. Have fun!

Booking and information: [email protected]* YES TOURS is the official local / (73)tour 3288.7335agency.

RECIFE DE FORA (REEFS) R$ 120,00 reais per person TOUR BY COROA ALTA AND RIVER R$ 84,00 reais per person TRANCOSO R$ 60,00 reais per person ECO PARQUE (WATER PARK) R$ 132,00 reais per person ARRAIAL D’AJUDA BY NIGHT R$ 60,00 reais per person

Poster Presentations

of presentation and must be removed after the session. Local:The posters Beat Beach must beSea-side fixed after Bar 1pm and before 5pm of the day Sesison 1: September 2nd, 7-9 pm, posters numbered 01 to 336. Session 2: September 3rd, 7-9 pm, posters numbered 337 to 650

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 XXIV Brazilian Congress of Virology Scientific Program

Room 1 Satellite Symposium 1: CAPES-SBV MEETING: Brazilian priorities for planning a cooperation network in Virology Chair: Paulo Michel Roehe 9:00-9:05 Welcome - Paulo Michel Roehe, UFRGS, Porto Alegre, RS, Brazil 9:05-9:15 Suggestions for an agenda of cooperation in virology - Eurico Arruda, FMRP-USP, Ribeirão Preto,• SP, Brazil • 9:15-9:30 Virology as a CAPES priority - Maria Angelica Miglino, Veterinary Medicine Area Coordinator, CAPES, Brasília, DF, Brazil • 9:30-9:45 Priorities in veterinary virology - Clarice Weiss Arns, UNICAMP, Campinas, SP, Brazil 9:45-10:00 Priorities in plant virology - Paulo Sérgio Brioso, UFRRJ, Seropédica, RJ, Brazil 9: 00 am - 12:00 pm • 10:00-10:15 Priorities in human virology - Mauricio Lacerda Nogueira, FAMERP, São José do Rio Preto,• SP, Brazil • 10:15-10:45 Coffee-Break 10:45-11:00 Priorities in environmental virology - Celia Regina Barardi, UFSC, Florianópolis, SC, Brazil• • 11:00-11:15 Priorities in the production of biopharmaceuticals in virology - Edson Elias Silva, FIOCRUZ, Rio de Janeiro, RJ, Brazil • 11:15-11:30 Priorities in Basic Virology - Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil. 11:30-11:55 Questions and discussion among participants and audience • 11:55-12:00 Closing remarks and adjourn - Maria Angelica Miglino, Veterinary Medicine Area Coordinator,• CAPES, Brasília, DF, Brazil Room• 2 Satellite Symposium 2: Impact of viroids or virus diseases on agribusiness Some applied contributions to prevent yield losses due to viruses diseases in a vegetative propagation system: The potato as a study case - José Alberto Caram de Souza Dias, IAC, Campinas, SP, Brazil • Viroids in Brazil: current status, economic importance and control measures - Marcelo Eiras, Instituto Biológico, São Paulo, SP, Brazil • Effects of viruses in the production of tropical fruits - Paulo Ernesto Meissner Filho, Embrapa Mandioca e Fruticultura, Cruz das Almas, BA, Brazil Sunday, September 1 September Sunday, Chair:• Paulo Sérgio Torres Brioso, UFRRJ, Seropedica, RJ, Brazil 2:00 pm - 4:00 pm Room 3 Satellite Symposium 3: Selected topics on respiratory viruses Respiratory syncytial virus epidemics in an equatorial city - Fernanda Edna Moura, UFC, Fortaleza, CE, Brazil • Escape mutants of human respiratory syncytial virus resistant to palivizumab - Edison Luiz Durigon, Biomedical Sciences Institute, USP, São Paulo, Brazil • Viviane Fongaro Botosso, Butantan Institute, São Paulo, SP, Brazil Newcastle disease virus in poultry and free-living birds: an update - Adriano de Oliveira Torres Carrasco• Evolution, Universidade of parainfluenza Estadual viroses do Centro - Oeste, UNICENTRO, Guarapuava, PR, Brazil Co-chairs:• Viviane Fongaro Botosso, Butantan Institute and Edison L. Durigon, ICB-USP, São Paulo, SP, Brazil 4:00 pm - 4:30 pm Coffee Break Room 1 Pre-Congress Conference 4:30 pm - 5:30 pm High throughput prospection for emerging viruses - Andreas Nitsche, Robert Koch Institute, Division of Highly Pathogenic Viruses, Berlim, Germany Chair:• Clarissa Damaso, UFRJ, Rio de Janeiro, RJ, Brazil Opening Ceremony Peter Palese, Mount Sinai School of 7:00 pm - 9:00 pm Medicine, NY, USA Chair:• EuricoKeynote de Arruda Conference: Neto, USP, The Ribeirão quest for Preto, a pan-influenza SP, Brazi vaccine - 9:00 pm - 11:00 pm Reception and Visit to Exhibits

Monday, September 2 September Monday, Round Table 3: Daniele da Glória de Souza, UFMG, MG, Brazil A tetravalent dengue nanoparticle stimulates antibody production in mice - Luiz Felipe Leomil Coelho• Role, UNIFAL, of inflammatory Alfenas, MG, mediators Brazil in dengue infection - • Bioinformatics sequence and genome analysis in HCV - Paula Rahal, UNESP, São José do Rio Preto, SP, Brazil Chair:• Paula Rahal, UNESP, São José do Rio Preto, SP, Brazil Room 4 Oral Presentations Human Virology - 1 Convenor: Edison Luiz Durigon, ICB-USP, São Paulo, SP, Brazil

10:30 am - 11:00 am Coffee-break and Visit to Exhibits

Room 1 Conference 1: 11:00 am - 12:00 pm Viruses in Veterinary Medicine Detected by Metagenomic Approaches - Anne-Lie Blomstrom, Swedish University of Agricultural Sciences, Uppsala, Sweden Chair:• Paulo Eduardo Brandão, USP, São Paulo, SP, Brazil

12:00 pm- 2:00 pm Lunch-break and Visit to Exhibits

Room 1 Conference 2: 2:00 pm - 3:00 pm Towards a Cure for HIV Infection - Monsef Benkirane, Institut de Génétique Humaine CNRS, Montpellier, France Chair:• Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Room 1 Round Table 4: Update on Viral Vaccines Enhancement of antitumor immunity by fusion of herpes simplex 1 Glycoprotein D and HPV E7 Protein - Luís Carlos de Souza Ferreira, ICB – USP, São Paulo, SP, Brazil • New adjuvants for viral vaccines - Paulo Lee Ho, Butantan Institute, São Paulo, SP, News on polio vaccination - Edson Elias Silva, Fiocruz, Rio de Janeiro, RJ, Brazil • Update on dengue vaccines - Benedito Antônio Lopes da Fonseca, FMRP-USP, Ribeirão Preto, SP, Brazil• Chair:• Benedito Antônio Lopes da Fonseca, FMRP-USP, Ribeirão Preto, SP, Brazil Room 3 Round Table 5: Emerging and Potentially Zoonotic Infectious Diseases Bovine spongiform encephalitis in Brazil - Amauri Alfieri, UEL, Londrina, PR, Brazil Phylogeography of rabies virus - Pedro Carnieli Junior, Instituto Pasteur, São Paulo, SP, Brazil 3:00 pm - 5:00 pm • Hepatitis E in Brazil, a water-borne viral infection or zoonosis? - Marcelo Alves Pinto, Fiocruz, Rio de Janeiro,• RJ, Brazil Chair:• UEL, Londrina, PR, Brazil Room 2 Amauri Alfieri, Round Table 6: Novel Issues on Environmental Contamination by Viruses Norovirus in food - Nigel Cook, University of Wisconsin, USA Virus stability in water matrices - Christophe Gantzer, University Henry Poincaré, Nancy, France • •Huw Taylor, University of Brighton, England Chair:• FernandoUse of humanRosado gut-specificSpilki, Feevale, bacteriophage Novo Hamburgo, B124-14 RS, Brazilas environmental marker of anthropic pollution - Room 4 Oral Presentations on Basic Virology Convenor: Davis Fernandes Ferreira, UFRJ, Rio de Janeiro, RJ, Brazil 5:00 pm - 5:30 pm Coffee-break and Visit to Exhibits Room 2 Monday, September 2 September Monday, Helio Gelli Pereira Award Oral Presentations Chair: Maurício Lacerda Nogueira, FAMERP, São José do Rio Preto, SP, Brazil Room 1 Career Development Workshop The experience of a researcher at the veterinary immunobiologicals industry: insights into the role of PhDs in Brazilian industry- Fernando Rosado Spilki, FEEVALE, Novo Hamburgo, RS, Brazil • A small professional tale from a biologist: how to become a well suceeded virologist- Paulo Lee Ho, Butantan Institute, São Paulo, SP Brazil 5:30 pm - 7:00 pm • The interface between academic research and industry: search for antiviral agents - Renato Santana de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil Chair:• Paulo Sérgio Torres Brioso, UFRRJ, Seropédica, RJ, Brazil Room 3 Oral Presentations on Human Virology – 2 and Immunobiologicals Convenor: Viviane Botosso, Butantan Institute, São Paulo, SP, Brazil Room 4 Oral Presentations on Environmental Virology Convenor: Célia Regina Barardi, UFSC, Florianópolis, SC, Brazil Beat Beach Sea-side Bar 7:00 pm - 9:00 pm Poster Session 1 9:00 pm - 12:00 am Evening Social/Mixer

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Room 1 Mini-course 1: Basic concepts in classical virology Mario Celso Sperotto Brum, UNIPAMPA, Uruguaiana, RS, Brazil Room 2 Mini-course• 2: Proteomic applications in virology Alessandra Vidotto, FAMERP, São José do Rio Preto, SP, Brazil 7:30 am – 8:30 am Room 3 Mini-course• 3: Fundamentals of virology diagnostics – Serological diagnostics in virology Leonardo José Richtzenhain, USP, São Paulo, SP, Brazil Room 4 Mini-course• 4: Introduction to the general aspects of RNA virus entry, mechanisms of replication, and exit Davis Fernandes Ferreira and Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil Room 3 Round• Table 7: Virus-host Molecular Interactions in Plant and Invertebrate Viruses Generation of infectious full-length cDNA clones of plant viruses? - Wilhelm Jelkmann, University of Heidelberg, Germany • The dynamic transcriptome of a large and complex insect pathogenic virus, the baculovirus Autographa californica Nucleopolyhedrovirus (AcMNPV), in cells of the host Trichoplusia ni- Gary Blissard, Cornel University,• Ithaca, NY, USA Jari Valkonen, University of Helsinki, Finland Chair:• BergmannMolecular Morais insights Ribeiro, to strain-specific UnB, Brasília, resistance DF, Brazil to Potato virus Y in potato - Room 2 Round Table 8: Virus-Cell Interactions Role of innate immunity receptors in infection and activation of endothelial cells by dengue virus - Luciana B. de Arruda, UFRJ, Rio de Janeiro, RJ, Brazil • Cláudio 8:30 am - 10:30 am Bonjardim, UFMG, Belo Horizonte, MG, Brazil • BiochemicalCellular signaling analysis pathways of distinctive as target and forunique the prospectionhuman respiratory of anti-flaviviruses syncytial virus therapeutics proteins: polymerase - cofactor P, M2-1 antitermminator, and nonstructural NS1 - Gonzalo de Prat Gay, Fundación Instituto Leloir -• CONICET, Buenos Aires, Argentina Beyond the structural function of dengue virus capsid protein: the role of its interaction with lipids in Tuesday, September 3 September Tuesday, virus entry and replication- Andrea T. Da Poian, UFRJ, Rio de Janeiro, RJ, Brazil Chair:• Luciana B. de Arruda, UFRJ, Rio de Janeiro, RJ, Brazil Room 1 Round Table 9: Phylogeography of Dengue in Brazil: The Story of the Emergence of Endemic Disease DEN1 and DEN2 phylogeography of in Brazil 2 - Betania Drumond, UFJF, MG, Brazil Dengue 3 phylogeography in Brazil- Josélio Maria Galvão de Araújo, UFRN, Natal, RN, Brazil • DEN4 asian genotype in Brazil - Davis Fernandes Ferreira, UFRJ, Rio de Janeiro, RJ, Brazil Chair:• Maurício Lacerda Nogueira, FAMERP, São José do Rio Preto, SP, Brazil • Room 4 Oral Presentations on Veterinary Virology Convenor: Rita de Cássia Nasser Cubel Garcia, UFF, RJ, Brazil 10:30 am - 11:30 am Coffee-break and Visit to the Exhibits Room 1 Conference 3: 11:00 am - 12:30 pm Virus-Host Interaction and Invasion of the Central Nervous System - Katherine Spindler, University of Michigan, Ann Arbor, Michigan, USA Chair:• Eurico de Arruda Neto, USP, Ribeirão Preto, SP, Brazil 12:30 pm - 2:00 pm Lunch Break and Visit to Exhibits 2:00 pm - 7:00 pm FREE TIME Beat Beach Sea-side Bar 7:00 pm -9:00 pm Poster Session 2 9:00 pm -2:00 am Congress Party

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Room 1 Mini-course 1: Basic concepts in classical virology Mario Celso Sperotto Brum, UNIPAMPA, Uruguaiana, RS, Brazil Room 2 • Mini-course 2: Proteomic applications in virology Alessandra Vidotto, FAMERP, São José do Rio Preto, SP, Brazil. 7:30 am – 8:30 am Room 3 • Mini-course 3: Fundamentals of virology diagnostics molecular diagnostics in virology Fabio Gregori, USP, São Paulo, SP, Brazil Room 4 • Mini-course 4: Introduction to the general aspects of RNA virus entry, mechanisms of replication, and exit Davis Fernandes Ferreira and Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil Room 1 • Conference 4: 8:30 am - 9:30 am Advances in Potyvirus Biology - Jari Valkonen, University of Helsinki, Finland Chair: Francisco Murilo Zerbini Junior, UFV, Viçosa, MG, Brazil • 9:30 am - 10:00 am Coffee-break and Visit to Exhibits Room 1 10:00 - am General Assembly of the Brazilian Society for Virology (SBV) and Helio Gelli Pereira Awards Ceremony Noon - 1:30 pm Lunch Break and Visit to the Exhibits Room 1 Conference 5: 1:30 pm - 2:30 pm Viral and host control of vesicular stomatitis virus gene expression – Sean P. Whelan, Harvard, Boston, MA, USA Chair:• Luis Lamberti Silva, USP, Ribeirão Preto, SP, Brazil Room 3 Round Table 10: Recent Progress in Avian Virology Avian gyrovirus 2: is it a real avian pathogen? – Ana Cláudia Franco, UFRGS, Porto Alegre, RS, Brazil New IBV genogroups in Brazil- Nilo Ikuta, ULBRA, Canoas, RS, Brazil Wednesday, September 4 September Wednesday, • Vaccinal viruses in wild birds: How come? - Clarice Weis Arns, Unicamp, Campinas, SP, Brazil Chair:• Clarice Weis Arns, Unicamp, Campinas, SP, Brazil • Room 1 Round Table 11: Viral Infections of the Central Nervous System Herpesvirus infection of the CNS – Graciela Andrei, Laboratory of Virology and Chemotherapy, KU Leuven, Leuven, Belgium • Genetics of host susceptibility to CNS viral infection - Katherine Spindler, University of Michigan, Ann Arbor, MI, USA 2:30 pm - 4:30 pm • Enteroviral CNS infections in Brazil- Edson Elias da Silva, Fiocruz, Rio de Janeiro, RJ Chair: Edson Elias da Silva, Fiocruz, Rio de Janeiro, RJ • Room 2 Round Table 12: Frontiers on HIV Host-cell Interaction and Pathogenesis HIV-1 drug resistance acquired through superinfection – Amilcar Tanuri, UFRJ, Rio de Janeiro, RJ, Brazil • Resistance to HIV and persistence – Monsef Benkirane, Institut de Génétique Humaine CNRS, Montpellier, France • Mechanisms of reactivation of HIV latency– Renato Santana de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil Chair: Renato Santana de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil • Room 4 Oral Presentations on Plant and Invertebrate Virology Convenor: Thor Vinícius Martins Fajardo, Embrapa Uva e Vinho, Bento Gonçalves, RS, Brazil

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Helio Gelli Pereira Award The evaluation of several papers for the Award “Helio Gelli Pereira” will take a place on Spetember, 2nd from 5:30pm - 7:00pm at room 2. Presenters will have 10 minutes for oral presentation, and the end of the presentation will be added five minutes to evaluator’s questions.

Prêmio “Hélio Gelli Pereira” Pag. CHRYSANTHEMUM STUNT VIROID IN BRAZIL: SURVEY, IDENTIFICATION, BIOLOGICAL AND MOLECULAR CHARACTERIZATION AND DETECTION METHODS 15 Gobatto, D., Chaves, L.R.A., Harakava, R., Marque, M.J., Daròs, J.A., Eiras, M. STUDY OF HUMAN VIRUS IN SURFACE WATER SURFACE: Quantification, integrity, infectivity and molecular characterization. Fongaro G., Nascimento, M.A., Viancelli, A., Petrucio, M.M.M., Tonetta, D., Retherbuch, G., Silva, A.D´A., Esteves, P.A., Barardi, 15

from 5:30pm - 7:00pm from C.R.M. nd Characterization of norovirus infections in children admitted in a pediatric hospital for gastroenteritis in Belém, Northern Brazil. 15 Siqueira, J.A.M., Da Costa, L.A., Dos Santos, M.G., De Carvalho, T.C.N., Justino, M.C.A., D’Arc, J.P.M., Gabbay, Y.B.

September, 2 September, Rare G3P[3] rotavirus strain detected in Brazil: Possible human–canine interspecies transmission Luchs, A., Cilli, A., Morillo, S.G., Carmona, R.C.C., Timenetsky, M.C.S.T. 16

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Oral Presentation

Oral Presentation on Human Virology - 1 Pag HV14 - UNEXPECTED DETECTION OF BOVINE G10 ROTAVIRUS IN A BRAZILIAN CHILD WITH DIARRHEA Luchs, A., Timenetsky, M.C.S.T. 23 hv86 - THE EFFECT OF HOST IL28B GENOTYPE ON CLINICAL OUTCOMES OF HEPATITIS A AND B Toutinho, R.S., Fabrício-Silva, G.M., De Oliveira, J.C., Lewis-Ximenez, L.L., De Almeida, A.J., Pinto, M.A., Pôrto, L.C.M.S., 23 De Paula, V.S. HV103 - Araraquara Viral RNA Load in Patients with Hantavirus Cardiopulmonary Syndrome Machado, A.M., Souza, W.M., Pádua, M., Machado, A.R.S.R., Figueiredo, L.T.M. 24 HV290 - DETECTION AND GENOTYPING OF NOROVIRUS IN BLOOD AND STOOL SAMPLES OF CHILDREN HOSPITALIZED WITH ACUTE GASTROENTERITIS IN BELÉM, PARÁ, BRAZIL. Room 4 Room Reymão, T.K.A., Fumian, T.M., Justino, M.C.A., Linhares, A.C., Mascarenhas, J.D.P., Lucena, M.S., Siqueira, J.A.M., Barros, 24

8:30 - 10:30 am R., Gonçalves, M., Soares, L.S., Abreu, E., Gabbay, Y.B. HV336 - COMPARATIVE ANALYSIS OF RASSF1A PROMOTER METHYLATION LEVELS BETWEEN HEPATOCELLULAR CARCINOMA (HCC) AND NON-HCC TISSUES FROM BRAZILIAN HEPATITIS C VIRUS CHRONIC CARRIERS. 25 Rosa, A.G.S., Niel, C., Villela-Nogueira, C.A., Pannain, V., Araujo, N.M. HV395 - LABORATORY-BASED ROTAVIRUS SURVEILLANCE DURING THE VACCINATION PROGRAM, BRAZIL, 2010–2012. Carvalho-Costa, F.A., Leite, J.P.G., Volotão, E.M., Assis, R.M.S., Fialho, A.M., Andrade, J.S.R., Resque, H.R., Silva, M.F.M., 25 Gomez, M.M., Rose, T.L. Oral Presentation on Basic Virology Pag BV11 - EVOLUTIONARY HISTORY AND SPATIOTEMPORAL DYNAMICS OF RODENT-BORNE HANTAVIRUS Monday, September 2 September Monday, Souza, W.M., Bello, G., Amarilla, A.A., Alfonso, H.L., Aquino, V.C., Figueiredo, L.T.M. 18 BV74 - FOLLOWING THE STEPS OF AN EMERGING VIRUS ON ITS WAY INTO THE CELL BY LASER-SCANNING CONFOCAL FLUORESCENCE MICROSCOPY 18 Carvalho, C.A.M., Silva, J.L., Gomes, A.M.O. BV161 - THE ROLE OF LIPD RAFT IN SIGNALING EVENTS MEDIATED BY THE NON STRUCTURAL PROTEIN 1 OF DENGUE VIRUS IN HEPG2 CELLS 18 Silveira, P.F., Ribeiro, E.M.C., Simoes, L.P., Pimenta, P.F.P., Bonjardim, C.A., Silva, B.M.

Room 4 Room BV219 - JATROPHA CURCAS EXTRACT INHIBITS HIV-1 INDUCING INTERNALIZATION OF CD4 RECEPTOR 19 3:00 - 5:00 pm Silveira, P.P., Cunha, R.D., Barbizan, T., Pianowski, L.F., Tanuri, A., Aguiar, R.S. BV226 - AN ANTIBODY DEPENDENT DENGUE INFECTION ENHANCEMENT IS MEDIATED BY HOMOLOGOUS ANTI-ENVELOPE IgGs: IN VIVO AND IN VITRO OBSERVATIONS 19 Amorim, J.H., Fabris, D.L.N., Alves, R.P.S., Bizerra, R.S.P., Rodrigues, J.F., Ferreira, L.C.S. BV250 - Investigation of Yellow Fever Virus-Induced Endoplasmic Reticulum Stress Sanches, D., Rocha, C.M., Campos, S.P.C., Gaspar, L.P., Freire, M.S., Gonçalves, B.S., Chiarini, L.B., Silva, J.L., Gomes, A.M.O., 20 Oliveira, A.C.

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Oral Presentation on Human Virology - 2 and Immunobiologicals in Virology Pag HV455 - ANALYSIS OF THE SPATIAL DISTRIBUTION OF DENGUE IN AEDES AEGYPTI MOSQUITOES IN A NEIGHBORHOOD FROM SÃO JOSÉ DO RIO PRETO (SP) 26 Parra, M.C.P., Fávaro, E.A., Ozanic, K., Dibo, M.R., Chiaravalloti-Neto, F., Eiras, A.E., Nogueira, M.L., Mondini, A. HV462 - EPSTEIN-BARR VIRUS AND CHRONIC ADENOTONSILLAR HYPERTROPHY. Pestana, F.N., Arruda, E., Proença-Modena, J.L., Saturno, T.H., Escremim de Paula, F.E., Souza, J.M., Tamashiro, E.,Valera, 26 F.C., Anselmo-Lima, W.T. HV627 - DIVERSITY OF ENTEROVIRUS ASSOCIATED WITH INFECTIONS OF THE CENTRAL NERVOUS SYSTEM IN SÃO PAULO STATE, BRAZIL, 2004-2012. 26 Machado, B.C., Russo, D.H., Sousa, C.A., Timenetsky, M.C.S.T., Vieira, H.R., Carmona, R.C.C. Room 3 Room iv78 - A novel LAV tetravalent Dengue virus vaccine tested in African Green Monkeys. 5:30 - 7:00pm Piper, A., Ribeiro, M., Smith, K., Briggs, C., Huitt, E., Spears, C., Quiles, M., Thomas, M., Brown, D., Hernandez, R. 27 IV419 - EXPERIMENTAL INFECTION IN CYNOMOLGUS MONKEYS (Macaca fascicularis) WITH HUMAN ROTAVIRUS A 27 Bentes, G.A., Volotão, E.M., Guimarães, J.R., Lanzarini, N.M., Silva, A.S., Ganime, A.C., Leite, J.P., Pinto, M.A. IV495 - CAMELID NANOBODIES, AN ALTERNATIVE TO DIAGNOSIS HANTAVIRUS INFECTION Pereira, S.S., Fernandes, C.F., Prado, N.D.R., Morais, M.S.S., Luiz, M.B., Moreira, L.S., Mazzarotto, G.A.C.A., Strottmann, 28 D.M., Soares, A.M., Santos, C.N.D., Stabeli, R.G. Oral Presentation on Environmental Virology Pag EV43 - GIANT VIRUSES ISOLATION FROM DIFFERENT BRAZILIAN HABITATS: URBAN AND NATURAL ENVIRONMENTS 20

Monday, September 2 September Monday, Boratto, P.V.M., Campos, R.K., Silva, L.C., Ferreira, P.C.P., Kroon, E.G., Abrahão, J.S. EV61 - DETECTION OF HUMAN ADENOVIRUSES IN SURFACE WATER AND SEDIMENTS IN SANGRADOURO RIVER, SANTA CATARINA, BRAZIL 21 Elmahdy, E.M.I., Schissi, C.D., Nascimento, M.A., Fongaro, G., Barardi, C.R. ev233 - ENVIRONMENTAL SURVEILLANCE OF POLIOVIRUSES IN RIO DE JANEIRO IN SUPPORT TO THE ACTIVITIES OF GLOBAL POLIO ERADICATION INITIATIVE. 21 Pereira, J.S.O., Silva, E.M., Silva, L.R., Oliveira, S.S., Costa, E.V., Da Silva, E.E.

Room 4 Room ev409 - ROTAVIRUS DIVERSITY IN TREATED AND UNTREATED SEWAGE WATER FROM SIX DIFFERENTS CITIES

5:30 - 7:00 pm OF URUGUAY 22 Colina, R., Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain, A., Leite, J.P.G., Cristina, J. ev450 - Quantitative detection and recovery of infectious Enterovirus in different treated sewage sludge matrices 22 Barbosa, M.R.F., Bonanno, V.M.S., Garcia, S.C., Yanagi, Y., Sato, M.I.Z., Hachich, E.M. ev501 - DETECTION OF HUMAN BOCAVIRUS IN RAW WATER SAMPLES OF RIO DOS SINOS WATERSHED, RIO GRANDE DO SUL, BRAZIL 22 Kluge, M., Henzel, A., Spilki, F.R.

XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil Virus Reviews and Research, Volume 18, Supplement 1, 2013 Oral Presentation on Veterinary Virology Pag vv62 - ARBOVIRUSES IN WILD BIRDS IN THE STATE OF SÃO PAULO Sousa, E., Criado, M.F., Saturno, T.H., Prates, M.C.M., Kawanami, A.E., Oliveira, J.P., Teles, P.H.F., Werther, K., Arruda, E. 31 vv207 - MOLECULAR CHARACTERIZATION OF CANINE CORONAVIRUS STRAINS CIRCULATING IN PUPPIES WITH ENTERITIS BY PARTIAL “S” GENE SEQUENCING 32 Bottino, F.O., Costa, E.M., Castro, T.X., Cubel Garcia, R.C.N. vv224 - EXPERIMENTAL VACCINE TO BOHV-1 AND BOHV-5 FUNCTIONALIZED TO CARBON NANOTUBES ENHANCES THE IMMUNE RESPONSE IN MOUSE MODEL Barbosa, A.A.S., Leocádio, V.A.T., Souza, J.G., Laguardia-Nascimento, M., Daian, D.S.O., Da Fonseca, F.G., Barbosa-Stancioli, 32 E.F. vv270 - Vaccinia virus:transmission through experimentally infected milk in a mouse model Rehfeld, I.S., Fraiha, A.L.S., Matos, A.C.D., Souza, I.R., Costa, A.G., Furtado, A.M.B., Guedes, M.I.M.C., Lobato, Z.I.P. 33 Room 4 Room vv327 - INFECTION OF FARMED MARINE SHRIMP WITH WHITE SPOT SYNDROME VIRUS IN THE STATE OF 8:30 - 10:45 am SANTA CATARINA, BRAZIL 33

Tuesday, September 3 September Tuesday, Lenoch, R., Espíndola, J.C., Claus, M.P., Barreiros, M.A.B.,

vv494 - DIVERSITY OF G AND P GENOTYPES DETECTEDAlfieri, IN A.F.,BRAZILIAN Alfieri, A.A. PIG HERDS DURING 2005-2013 Lorenzetti, E., Campanha, J.E.T., Medeiros, T.N.S., Silva, D.R., Molinari, B.L.D., Rodrigues, W.B., Pereira, F.L., Balbo, L.C., 34 Massi, R.P.,

VV496 - MOLECULARAlfieri, A.A. DETECTION OF INFLUENZA A VIRUS IN DOGS Balbo, L.C., Silva, A.P., Bodnar, L., Beutemmüller, E.A., Facimoto, C.T., Miyabe, F.M., Massi, R.P., Headley, S.A., 34

VV634 - CHICKEN ANEMIA VIRUS AND AVIAN GYROVIRUS 2 DNA AS CONTAMINANTS IN POULTRY VACCINESAlfieri, A.A. Varela, A.P.M., Santos, H.F., Cibulski, S.P., Scheffer, C.M., Schmidt, C., Lima, F.E.S., Esteves, P.A., Franco, A.C., Roehe, P.M. 35 Oral Presentation on Plant and Invertebrate Virology Pag PIV7 - DETECTION OF FOUR VIRUSES IN APPLES AND PEARS BY REAL TIME RT-PCR USING 5’-HYDROLYSIS PROBES 28 Nickel, O., Fajardo, T.V.M. PIV277 - STUDY OF THE STATE OF VIRAL INFECTION IN APIARIES IN THE AREA OF THE PAMPA GAUCHO. Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F., Barcelos, C. de L. 29 PIV328 - INFECTION OF TOMATO PLANTS BY THE BEGOMOVIRUS Tomato chlorotic mottle virus (ToCMoV) INCREASES THE EXPRESSION OF UBIQUITINATION PATHWAY GENES 29 Lacerda, A.L.M., Fonseca, L.N., Boiteux, L.S., Brasileiro, A.C.M., Ribeiro, S.G. PIV373 - Infectious cDNA clones of the crinivirus Tomato chlorosis virus are competent for systemic plant infection and whitefly-transmission

Room 4 Room 30 Orílio, A.F., Fortes, I.M., Navas-Castillo, J. 2:30 - 4:30 pm PIV394 - CHARACTERIZATION OF DNAJ PROTEINS REVEALS THEIR ROLE DURING PEPPER YELLOW MOSAIC

Wednesday, September 4 September Wednesday, VIRUS INFECTION IN SUSCEPTIBLE HOSTS 30 Valente, D.D., Xavier, A.S., Bruckner, F.P., Nogueira, D.R.S., Zerbini, F.M., Alfenas-Zerbini, P. PIV408 - POPULATION GENETIC STRUCTURE OF Tomato leaf deformation virus INFECTING TOMATO CROPS IN ECUADOR AND PERU 30 Paz-Carrasco, L., Lima, A.T.M., Castillo-Urquiza, G.P., Ramos-Sobrinho, R., Vivas-Vivas, L., Zerbini, F.M., Alfenas-Zerbini, P. PIV459 - Evolution of pe-38 gene in Baculoviridae Fernandes, J.E.A., Ardisson-Araújo, D.M., Melo, F.L., Ribeiro, B.M. 31

15 Helio Gelli Pereira Award

CHRYSANTHEMUM STUNT VIROID IN BRAZIL: Universidade Federal de Santa Catarina, Departamento SURVEY, IDENTIFICATION, BIOLOGICAL de Microbiologia, Imunologia e Parasitologia. AND MOLECULAR CHARACTERIZATION AND DETECTION METHODS This study aimed to quantify human viruses, HAdV, Gobatto, D., Chaves, L.R.A., Harakava, R., Marque, M.J., JCPyV, HAV and RVA in surface waters used for human Daròs, J.A., Eiras, M. consumption, as well as evaluate the integrity, infectivity and perform a molecular characterization of HAdV 1. Instituto Biológico, CEP 04014-002, São Paulo, SP, present in these matrices. Three sites in the city of Brazil Florianópolis-SC were selected: Site 1) Peri Lagoon; 2. Athena 7 Diagnóstico, Atibaia, Brazil Site 2) Source water; Site 3) Public supply water 3. Instituto de Biología Molecular y Celular de Plantas, system. Water samples were collected, processed and Consejo Superior de 8 Investigaciones Científicas-Universidad Politécnica de Valencia, Spain integrity was evaluated by enzymatic assay (DNase I) viraland infectivity quantification by plaque was assay determined (PA) and by integrated qPCR. Viral cell culture using enzymatic assay and transcribed mRNA in the wholesale and retail more than 2 billion 12 dollars, (ICC-et-RT-qPCR). The results found that 93% (67/72) Inannually, Brazil, andornamental chrysanthemum flowers and stands plants out market as one movesof the of the samples were positive for HAdV, 45.8% (33/72) most valuable commercial species. The 13 stunting for RVA, 13.8% (10/72) for JCPyV and 12.5% (9/72) for disease induced by Chrysanthemum stunt viroid (CSVd) HAV. The evaluation of HAdV integrity and infectivity of has become a serious problem in 14 chrysanthemum the samples showed that in Peri Lagoon 83% (10/12) production systems worldwide. CSVd incites colour were undamaged and 75% (9/12) infectious; Source water 66% (8/12) were undamaged and 58% (7/12) situations, not induces visible symptoms, facilitating its infectious; Public supply water system 58% (7/12) were breaking and retards flowering, but in 15 many undamaged and 25% (3/12) infectious. HAdV-2 was the international borders. In Brazil, there are few studies prevalent serotype of the HAdV. When PA and ICC-et- spreadon this inpathogen, the field, with and passinga single unnoticedreport of 1716 itswhen possible cross RT-qPCR were compared, ICC-et- RT-qPCR was accurate, occurrence in chrysanthemum in the State of São Paulo. This work aimed to: (i) carry out a 18 survey, identify and characterize viroids present in chrysanthemum crops in efficient,Characterization sensitive and rapid. of norovirus the State of São Paulo; (ii) 19 challenge of chrysanthemum infections in children admitted in a varieties with a CSVd isolate; and (iii) develop diagnostic pediatric hospital for gastroenteritis in methods to 20 strengthen quarantine and indexing Belém, Northern Brazil. programs. Our survey showed that the CSVd is widely Siqueira, J.A.M., Da Costa, L.A., Dos Santos, M.G., De disseminated in 21 chrysanthemum crops in São Paulo Carvalho, T.C.N., Justino, M.C.A., D’Arc, J.P.M., Gabbay, State. All varieties of chrysanthemum evaluated were Y.B. susceptible, 22 without symptoms. The development of Seção de Virologia, Instituto Evandro Chagas, Secretaria oligonucleotides for conventional RT-PCR and RT-qPCR de Vigilância em Saúde, Ministério da Saúde, Ananindeua, will 23 allow the use of these techniques for diagnosis with high sensitivity, 100.000 times more sensitive than PA, Brasil 24 sPAGE. Dot-blot was sensitive and useful for diagnosis Several viruses have been associated with acute of large number of samples. The complete genome 25 gastroenteritis (AGE), and group A rotavirus (RVA) and sequencing of a CSVd isolate showed high percentage norovirus (NoV) are the most prevalent. This study aimed of nucleotide identity compared with other isolates 26 to assess their prevalence among children hospitalised for diarrhoea during a three-year surveillance study. and molecular characterization of the CSVd in Brazil. From May 2008-April 2011, overall positivity rates deposited in databases. This is the first identification of 21.6% (628/2904) and 35.4% (171/483) were STUDY OF HUMAN VIRUS IN SURFACE observed for RVA and NoV, respectively. The seasonality WATER SURFACE: Quantification, observed indicated distinct patterns when both integrity, infectivity and molecular characterization. hospitalisation for AGE remains constant throughout Fongaro G., Nascimento, M.A., Viancelli, A., Petrucio, virusesthe year. were Continuous compared. AGE Thismonitoring finding is may needed explain to better why M.M.M., Tonetta, D., Retherbuch, G., Silva, A.D´A., assess the patterns of infection. Esteves, P.A., Barardi, C.R.M.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

16 Helio Gelli Pereira Award

Rare G3P[3] rotavirus strain detected in Brazil: Possible human–canine interspecies transmission Luchs, A., Cilli, A., Morillo, S.G., Carmona, R.C.C., Timenetsky, M.C.S.T. Adolfo Lutz Institute, Virology Center, Enteric Diseases Laboratory, São Paulo, SP, Brazil An unusual strain of human rotavirus G3P[3] (R2638 strain) was detected from a 1-year-old child patient during the epidemiological survey of rotavirus in the state of São Paulo, Brazil in 2011. The aim of this study was to carry out sequence analyses of the two outer capsid proteins (VP4 and VP7) of the R2638 strain detected in order to obtain further information of the genetic relationships between human and animal rotaviruses. Rotavirus G3P[3] was detected using a commercial immunoenzymatic assay, SDS-PAGE, and genotyped by RT-PCR. The analysis of the genetic relationship between human and animal rotaviruses was carried out by sequencing the VP7 and VP4 genes. The VP7 gene of the R2638 strain displayed the highest nucleotide identity to the canine strains A79-10 (96.6%) and CU-1 (96.2%) isolated in USA. The VP4 sequence showed the highest nucleotide identity to P[3] canine rotavirus strain RV52/96 isolated in Italy at 94.1%. Furthermore, the VP4 genes of P[3] strains could be discriminated into two phylogentically distinct clusters. The present study reinforces the hypothesis that animal’s rotaviruses might be able to cross the species barriers, and the lack of systematic surveillance of rotavirus infection in small animals hinders the ability in 2006 rotavirus vaccine was included in the Brazilian toImmunization establish firm Program, epidemiologic and selective connections. vaccine Moreover, pressure could increase the circulation of uncommon strains. This monitoring in Brazil. is the first report of G3P[3] in over 20-year period of

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

18 Oral Presentation

BV11 - EVOLUTIONARY HISTORY AND BV74 - FOLLOWING THE STEPS OF AN EMERGING SPATIOTEMPORAL DYNAMICS OF RODENT-BORNE VIRUS ON ITS WAY INTO THE CELL BY LASER- HANTAVIRUS SCANNING CONFOCAL FLUORESCENCE Souza, W.M., Bello, G., Amarilla, A.A., Alfonso, H.L., MICROSCOPY Aquino, V.C., Figueiredo, L.T.M. Carvalho, C.A.M., Silva, J.L., Gomes, A.M.O. 1. Instituto Oswaldo Cruz - Fundação Oswaldo Cruz, Universidade Federal do Rio de Janeiro, UFRJ, Avenida IOC - FIOCRUZ, Av.Brasil, 4365, Manguinhos, Rio de Janeiro Carlos Chagas Filho, 373 (CCS) - Cidade Universitária, Rio - RJ, Brasil - CEP: 21040-360 de Janeiro/RJ 2. Faculdade de Medicina de Ribeirão Preto, FMRP- Arboviral infections are a major public health problem USP, Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto worldwide. Of the 210 different species of arboviruses - SP - 14049-900 circulating in Brazil, Mayaro virus (MAYV) is the fourth 3. Faculdade de Ciências Farmacêuticas de Ribeirão in number of infected individuals, behind only dengue, Preto, FCFRP USP-RP, Av. do Café, s/nº. -Campus yellow fever and Oropouche viruses. Although Mayaro Universitário - Ribeirão Preto - SP - 14040-903 fever in humans is even more debilitating than dengue and its urbanization from the Amazon region is imminent, Hantavirus (Family Bunyaviridae) are mostly associated the disease is largely neglected and many details of the to rodents and transmitted to man by inhalation of replication cycle of the virus are still unclear, including aerosolized infected excreta of these animals. The human the early events of infection. The aim of this work was infection by Hantavirus can lead to severe diseases such to analyze the behavior of MAYV particles during their as hemorrhagic fever with renal syndrome (HFRS) in entry into host cells. To this purpose, MAYV was labeled Asia and Europe, and pulmonary syndrome (HPS) in the Americas. To determine the origin, spreading and evolutionary dynamics of rodent-borne hantavirus, withsignals the were lipophilic tracked in fluorescent the host cells probe by laser-scanning DiD without were collected 190 N gene sequences of rodent-borne impairment to viral infectivity and the fluorescent results show that MAYV entry into cells occurs by an 25 years (1985 to 2010). Recombinant sequences and confocalendocytic fluorescencemechanism involving microscopy fast ininternalization real time. Our of hantavirusidentify identical identified sequences from 30 were countries not included over the in pastthe study. Nucleotide sequences were aligned and the spatio- labeled virus particles could be visualized inside the cell temporal and demographic dynamics of dissemination thea few endocyted seconds after cargo, virus since binding fluorescent to receptors signals on the from cell of rodent-borne hantavirus was reconstructed using the Bayesian Markov Chain Monte Carlo (MCMC) approach single particle level, we could capture the moment of the using the BEAST 1.7.4 program. It was estimated that surface.fusion between Following the DiD viral fluorescence envelope anddequenching the endosomal at the the N gene of hantavirus carried by rodents evolved at membrane, that was shown to occur faster (around 3 a rate of 6.8 x 10-4 (2.5 x 10-4 - 1 x 10-3) nucleotide min post-binding) than for other arboviruses. This work substitutions per site per year and that rodent-borne provides unique kinetic insights into the entry of virus hantaviruses originated around 2,000 years ago. particles in living cells. Understanding the dynamics of However, the rodent-borne hantavirus had a large virus infection may provide important insights to the period of slow growth and about 500 years ago started a development of antiviral strategies. Financial support: rapid spread worldwide that coincides with the human CAPES, CNPq, FAPERJ, FINEP, INBEB and PRONEX. traveling between continent. Hantaviruses associated to Murinae and Arvicolinae subfamilies, probably, were BV161 - THE ROLE OF LIPD RAFT IN SIGNALING originated in Asia 500-700 years ago spreading toward EVENTS MEDIATED BY THE NON STRUCTURAL Siberia, Europe, Africa and North America. Hantaviruses PROTEIN 1 OF DENGUE VIRUS IN HEPG2 CELLS associated to Neotominae subfamily, probably, emerged Silveira, P.F., Ribeiro, E.M.C., Simoes, L.P., Pimenta, P.F.P., 500-600 years ago in Central America and spread Bonjardim, C.A., Silva, B.M. toward North America. Finally, hantaviruses associated to Sigmodontinae occurred in Brazil 400 years ago and 1. Universidade Federal de Ouro Preto, UFOP, Campus were, probably, originated from Neotominae-associated Morro do Cruzeiro, Ouro Preto, Minas Gerais virus from northern South America. These data offer 2. Rede de pesquisa em virologia do interior do estado subsidies to understand the time-scale and worldwide de minas, INTRAVIRUS, Minas Gerais dissemination dynamics of rodent-borne hantaviruses. 3. Universidade Federal de Minas Gerais, UFMG, Financial support: FAPESP Campus Pampulha, Belo Horizonte, Minas Gerais

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

19 Oral Presentation

4. Fundação Oswaldo Cruz, FIOCRUZ, Augusto de virus resistance contributes to therapeutic failure. Lima, 1715, Belo Horizonte, Minas Gerais Therefore, searching for new class of drugs to reduce HIV-1 infection has been the best alternative to control The Dengue virus express non-structural proteins multi-resistant virus since an effective vaccine against which are involved primarily with the intracellular viral HIV-1 is not available. Here, we screened extracts from multiplication steps. However, there are several reports Jatropha curcas to evaluate cytotoxicity and antiviral that these proteins can interact with cellular proteins activity against HIV-1 in lymphocytes CD4+ (MT-4 and substantially change their functions and, therefore, cells).Our results showed that the fraction THS eluted control the rates of cell multiplication and the secreted- in hexane decreased HIV-1 infection up to 80% in a dose-dependent manner. The maximum inhibition of chemokines. One of these non-structural proteins are HIV-1 infection was observed at 260µg/ml of THS. Cell proteinNS1. After expression your synthesis, profile, NS1 suchassociates as cytokinesto membranes and viability experiments were showing no toxicity in these where it remains as the only viral protein in infected concentrations. Although there was no effect of this cells. In addition, in vivo assays have shown that NS1 compound in the production and release of the virus, can accumulate in the liver of animals and changes some THS blocked HIV-1entry into the cell but did not impair cellular functions. Data obtained by our group, suggest HIV pseudotyped with VSVG envelope proteins. These of MAP kinases MEK/ERK and NF-kB pathway proteins. entry mediated by CD4 internalization. Flow cytometry thatThese the signaling expression pathways, of NS1 like changes many the others, activation are activated profile resultsanalysis suggestedshowed that that CD4 THS receptor specifically was downregulated affects HIV-1 at level of plasma membrane in response to extracellular from the plasma membrane in MT-4cells after 10 min stimuli that can be mediated by GPI-anchored proteins that are associated with membrane micro domains that this compound promotes CD4 internalization into named lipid rafts in wich, according to data from ofcellular treatment vesicles. with THS.The Confocaltreatment microscopy with PKC confirmed inhibitor literature; NS1 is also associated by a GPI-anchor. To (GO6983) revert the effects of CD4 internalization investigate the importance of lipid rafts in triggering of suggesting that THS effect is dependent on PKC activity. signaling events mediated by NS1 we are analyzing the In fact, variants of CD4 harboring mutations that are not distribution of caveolina-1 (the main marker of rafts) in longer phosphorylated (serines and threonines residues cells expressing NS1 or DENV-infected by western blot in the cytoplasmic tail) showed no internalization in the of membrane fractions extracts. Our preliminary data presence of THS. In conclusion, THS extract it’s a new have shown that the expression of NS1 can promotes antiviral class that can be potentially used to block new changes in the distribution of caveolina-1 in HepG2 cells, HIV transmission by CD4 depletion. This property makes suggesting that this protein may be causing changes in THS extract a potential microbicide candidate that could be used in prevention strategies. are generating cells silenced for caveolina-1 that will cellularbe very useful signaling to assess pathways. the involvement To refine these of lipid results rafts we in BV226 - AN ANTIBODY DEPENDENT DENGUE signaling events mediated by expression of NS1 in liver INFECTION ENHANCEMENT IS MEDIATED BY HOMOLOGOUS ANTI-ENVELOPE IgGs: IN VIVO events elicited by NS1 can be useful to understand the AND IN VITRO OBSERVATIONS cells.complex The identificationrelations between of role ofcells lipid and rafts Dengue into signaling virus. Amorim, J.H., Fabris, D.L.N., Alves, R.P.S., Bizerra, R.S.P., Supported by: UFOP, FAPEMIG, CNPq and CAPES. Rodrigues, J.F., Ferreira, L.C.S. BV219 - JATROPHA CURCAS EXTRACT INHIBITS Instituto de Ciências Biomédias - Universidade de São HIV-1 INDUCING INTERNALIZATION OF CD4 Paulo, ICB - USP, Av. Professor Lineu Prestes, 1374 RECEPTOR The main correlate of protection for dengue virus (DENV) Silveira, P.P., Cunha, R.D., Barbizan, T., Pianowski, L.F., infection is the generation of neutralizing antibodies Tanuri, A., Aguiar, R.S. against the envelope glycoprotein, particularly the 1. Laboratório de Virologia Molecular UFRJ, LVM/ domain III (EDIII), which is involved with host cell UFRJ, Av. Carlos Chagas Filho 373, CCS, Bloco A, Sala 121 receptor recognition. The protection correlate is mainly Cidade Universitária, CEP: 2 determined in vitro by virus neutralization assays carried 2. Kyolab Pesquisas Farmacêuticas, Kyolab, Rua Isaura out with non- Fc receptor bearing cells. In order to investigate this point, the DENV2 EDIII was obtained as a Ap. Oliveira Barbosa Terini n° 231 Jd. Itapuã - Valinhos-SP Highly active antiretroviral therapy (HAART) has been properties. This protein was used as a vaccine antigen, used as standard treatment to HIV-1 infection; however, purifiedco-administered recombinant with protein or without retaining different native adjuvantsbiological

20 Oral Presentation in BALB/c mice. Animals immunized with inactivated the nuclear transcription factor CHOP, which regulates DENV or non-immunized mice were studied as controls. the expression of pro and anti-apoptotic genes. In this The induced antibody responses were studied and study, we investigate the ERS induced by the infection immunized mice were challenged with a homotypic of VERO cells by YFV through western-blotting and DENV2 (JHA1) strain. The antibodies generated before and after infection were tested regarding neutralization YFV, using a multiplicity of infection of 1. We analyzed activity. Immunized mice developed a Th2 immune fluorescencecell viability by microscopy. the LIVE/DEAD We infected assay and VERO we cellsobserved with response pattern with high levels of IgGs capable of that by 72 hours post infection, cells undergo cell death. neutralizing the virus in in vitro assays carried out with The ERS induction was noticed by CHOP overexpression. non-Fc receptor bearing cells. However, under in vivo Moreover, we observed phosphorylation of eIF2a, ATF6 infection challenges, we found that animals immunized cleavage and spliced XBP1 18 hours post infection. BiP with EDIII developed hematological disturbances, tissue expression levels remained unaltered. Apoptosis was damage and increased tissue viral load earlier than non- analyzed by the TUNEL assay and it was observed 72 immunized mice. As a consequence, immunized mice hours post infection. Our results suggest that the YFV died earlier than non-immunized mice. In addition, induces ERS in VERO cells through PERK, ATF6 cleavage, sera from EDIII-immunized mice were shown to induce XBP1 splicing and CHOP overexpression. Financial increased levels of infection in Fc-receptor bearing cells. Support: Capes, CNPq, FAPERJ, Pronex, INBEB The present results indicate that a strictly humoral and homologous immune response directed against DENV EV43 - GIANT VIRUSES ISOLATION FROM EIII causes a homotypic ADE by increasing the infection DIFFERENT BRAZILIAN HABITATS: URBAN AND level of Fc bearing cells and accelerating the onset of NATURAL ENVIRONMENTS damage symptoms in vivo. The contribution presented Boratto, P.V.M., Campos, R.K., Silva, L.C., Ferreira, P.C.P., Kroon, E.G., Abrahão, J.S. developing dengue vaccines should be reviewed. Universidade Federal de Minas Gerais, UFMG, Av. in this work is the first evidence that the process of BV250 - Investigation of Yellow Fever Virus- Antônio Carlos, 6627 - Bloco F4-258 - Pampulha Induced Endoplasmic Reticulum Stress The nucleocytoplasmic DNA large viruses (NCDLV) are a Sanches, D., Rocha, C.M., Campos, S.P.C., Gaspar, L.P., group formed by the largest viruses known . In the last Freire, M.S., Gonçalves, B.S., Chiarini, L.B., Silva, J.L., years, an increase in their study was observed, given that Gomes, A.M.O., Oliveira, A.C. some of them have many interesting features that set 1. Universidade Federal do Rio de Janeiro, UFRJ, Av this group apart from other viruses, Mimiviridae and the Carlos Chagas Filho, 373, CCS, Cid Universitária, Rio de Marseilleviridae families belong to NCDLV, and have been isolated from some locations as cooling towers, antartic Janeiro lakes, oceans, etc. However, despite Acanthamoeba spp. 2. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, (its natural host) presents a global distribution, there is 4365 - Manguinhos, Rio de Janeiro a lack of information regarding these viruses in some The yellow fever is a hemorrhagic disease of great regions of the world. Brazil is a country with many habitats relevance in Africa and South America, where it occurs where this study can be performed, representing an open as small outbreaks. It is caused by the yellow fever this work was to perform the isolation of giant viruses being transmitted by mosquitos. During its life cycle, the fieldfrom forthree giant Brazilian viruses regions study. Therefore,marked by thedifferent objective levels of virusYFV uses (YFV), the a endoplasmicflavivirus such reticulum as the Dengue for translation Virus, both of of pollution and urbanization. We collected about 425 viral proteins and assembly of new viral particles. The samples of water and soil from three regions differently accumulation of misfolded proteins in this organelle triggers the endoplasmic reticulum stress (ERS), which in Belo Horizonte (high pollution level), Central Lake leads to the dissociation of the binding immunoglobulin affectedin Lagoa by Santa human ( intermediary activity: the artificial pollution lake level) of Pampulha and the protein (BiP) from ATF6, PERK e IRE1. Once released, Serra do Cipó National Park (low pollution level). These these factors become active and start to mediate the ERS. ATF6 is transported to Golgi, where is cleaved. and then, the isolation of giant viruses was attempted PERK and IRE1 homodimerize, are phosphorylated and samplesin amoebae were of enriched, Acanthamoeba filtered castellanii (membranes specie, of 0.2 by μm) the become active. PERK phosphorylates and inactivates observation of cytopatic effect. Other tests were also eIF2a. IRE1 is a RNAse that alternatively splices XBP1 performed, including real-time PCR (for Mimiviridae mRNA, leading to the production of a response for and Marseilleviridae), helicase and polymerase genes ERS. One of these responses is the overexpression of sequencing optical and electronic microscopy. Four September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

21 Oral Presentation viruses were isolated by the described methods. The the enteric virus prevalence and also infectivity assays PCR analysis and the sequencing method grouped for future risk assessment studies. Financial support: all of them in the Mimiviridae family. In conclusion, CNPq/TWAS and CNPq Universal 470808/2009-8. this work showed that giant viruses also can be found in environments regardless the pollution level. This ev233 - ENVIRONMENTAL SURVEILLANCE OF reinforces the probably ubiquitous character of these POLIOVIRUSES IN RIO DE JANEIRO IN SUPPORT TO viruses, although some areas still need to be explored THE ACTIVITIES OF GLOBAL POLIO ERADICATION INITIATIVE. FAPEMIG, CAPES, MAPA. Pereira, J.S.O., Silva, E.M., Silva, L.R., Oliveira, S.S., Costa, to confirm this hypothesis. Financial Support: CNPq, E.V., Da Silva, E.E. EV61 - DETECTION OF HUMAN ADENOVIRUSES IN SURFACE WATER AND SEDIMENTS IN Fundação Oswaldo Cruz/Laboratório de Enterovírus , SANGRADOURO RIVER, SANTA CATARINA, BRAZIL Fiocruz, Av. Brasil, nº 4365, Pav. Hélio e Peggy Pereira, sala Elmahdy, E.M.I., Schissi, C.D., Nascimento, M.A., Fongaro, B217, Manguinhos - RJ. G., Barardi, C.R. Poliomyelitis is an acute infectious disease that Universidade Federal de Santa Catarina, UFSC, occurs following an infection caused by one of three Departamento de Microbiologia, Imunologia e Parasitologia poliovirus serotypes (serotypes 1, 2, and 3). Since the implementation of global polio eradication initiative, the Sediments are suggested to play an important role in incidence of wild poliovirus transmission has dramatically transmission of enteric viruses in the environment dropped (> 99%). However, wild polioviruses remain because of the sorption to and desorption from these endemic in three countries (Afghanistan, Pakistan and biosolids which can control the transport of viruses Nigeria) but cases of re-emergency have been reported and other waterborne pathogens through the water in previously polio-free countries (ex. Somalia and column. Human Adenovirus (HAdV) is highly prevalent Kenya). Environmental surveillance of polioviruses has in both sewage and biosolids and it has been included in been used as a supplementary tool in monitoring the all three of the U.S. Environmental Protection Agency’s circulation of wild poliovirus and/or vaccine derived contaminant candidate lists, which prioritize currently unregulated drinking water contaminants (EPA, 2012). paralysis (AFP) cases. This study aimed to isolate and The Sangradouro River located in Florianopolis, Santa polioviruscharacterize (VDPV), poliovirus even inand the Non-Polio absence ofEnteroviruses acute flaccid Catarina, Brazil receives the Peri lagoon water during (NPEV) from wastewater samples collected at one of the rainy episodes and also inadequate disposal of the stations of sewage treatment (ETE Alegria/ Cedae), wastewater and sewage from neighborhood houses located in Rio de Janeiro city. From December 2011 to June 2012 and from September to December 2012, 31 in surface water or sediment samples by real-time samples were collected and concentrated. Isolation andPCR hostels.(qPCR) Inalong this study,the Sangradouro HadV were River.quantified A total either of in RD and L20B cell cultures, followed by RT-PCR was 48 samples were collected in six points with different able to detect enteroviruses in 27/31 samples (87%). sediment characteristics during the summer season Poliovirus was isolated in 8/27 positive samples of 2013. Two liters of surface water samples were (29.6%): Sabin1= 1 sample, Sabin 2 = 5 samples, Sabin concentrated by negatively charged membranes and 20g 3 = 2 samples. The remaining isolates were NPEV. All using glycine buffer followed by polyethylene glycol nucleotide sequences of the VP1 gene. VDPVs were not of(PEG) sediment precipitation. samples The were HAdV concentrated genome was and detected clarified polioviruses were classified as Sabin-like based on the in 17/24 (70.8%) ranging from 105 to 108 genome Echovirus 3; 11 Echovirus 6, 7 Echovirus 7, 2 Echovirus copies (gc) per liter and 10/24 (41.7%) ranging from detected.20; 4 Coxsackievirus The following B4 NPEV and have2 Coxsackievirus been identified: B5. 1 and 109 to 1010 gc/L in surface water and sediment Environmental surveillance has been used successfully samples, respectively. Higher concentrations of gc of in monitoring the circulation of enteroviruses and it HadV in sediment samples may be due to its organic material composition which plays an important role in global polio eradication initiative. Our results show the protection of viruses against sunlight inactivation. isthe of continuous crucial importance circulation in ofthe Sabin-like final stages poliovirus of the WHO and On the basis of this preliminary study, we conclude that non-polio enteroviruses in the analyzed area during the the HAdV can be potentially found in high amounts in study period. study will continue by searching other enteric viruses sedimentsin these samples, due to itslooking stronger for affinityseasonal to contribution biosolids. This of

22 Oral Presentation ev409 - ROTAVIRUS DIVERSITY IN TREATED ev450 - Quantitative detection and AND UNTREATED SEWAGE WATER FROM SIX recovery of infectious Enterovirus in DIFFERENTS CITIES OF URUGUAY different treated sewage sludge matrices Colina, R., Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain, Barbosa, M.R.F., Bonanno, V.M.S., Garcia, S.C., Yanagi, Y., A., Leite, J.P.G., Cristina, J. Sato, M.I.Z., Hachich, E.M. 1. Regional Norte, Universidad de la República, UdelaR, Companhia Ambiental do Estado de São Paulo, Cetesb, Gral. Rivera 1350, 50000, Salto, Uruguay Av. Prof. Frederico Hermann Jr., 345 2. Fundacao Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365, Treated sewage sludge is increasingly applied to Manguinhos, 21040-360, Rio de Janeiro, Brazil 3. Centro de Investigaciones Nucleares - UdelaR, alternative to conventional means of disposal. However, UdelaR, agriculturalthe reuse is often land restricted as fertilizer, due to and the presence as a beneficial of toxic Transmission of Group A Rotavirus (RVA) between metals and pathogens that can lead to the contamination human populations through surface waters of ground water and food chain. The objectives of contaminated with sewage water (SW) is a serious this study were to determine the concentration of health problem worldwide. The aim of this study was Enterovirus in treated sewage sludge from different to determine and characterize the contamination of treatment processes and to evaluate the effectiveness of SW in different areas of Uruguay by RVA. We analyze the method concentration by the recovery of poliovirus the presence of RVA in SW collected samples from 1 (PV-1). Treated sewage sludge samples were collected six different cities located on the North, west and east from four wastewater treatment plants (WWTP) in São region of Uruguay. The SW samples were collected from Paulo, Brazil, with four different sampling events at each four cities without sewage treatment plant (STP) placed plant. Two samples were collected each month from on the north and west region that discharge directly its November 2011 to June 2012. The equivalent of 12g SW in the Uruguay River (SW-UR), while the others two of total solids (gTS) of sample was eluted in 3% beef cities from the east region have STP with UV treatment extract. The solids were separated by centrifugation system (SW-STP). In all the 6 cities, 42ml of SW were and the viruses in the supernatant were concentrated collected, and viral concentration was made by using an ultracentrifugation protocol. In the case of SW-UR, the phosphate buffer and treated with chloroform. For the samples were collected during an entirely year (from byrecovering organic flocculation.evaluation the The samples pellet was were resuspended spiked with in 02/11 to 02/12), fortnightly in each city. In the case of approximately 400 plaque forming units (PFU) of PV- SW-STP, the samples were collected bimonthly (from 1. Eluted viruses were enumerated by the single-layer plaque assay using the human rhabdomyosarcoma

09/11conducted to 06/12), from andthe thepreviously collection concentrated was made at affluentviruses, andperformed effluent by commercial in each STP. kit Viral according RNA to extraction manufactures was (RD)values cell comparing line. The the mean four recoverytreatment efficiency processes. of The the instructions and cDNA was generated using random methodmean concentration was 32%, with of indigenous significant Enterovirus difference (p<0.05) and the

Nested Multiplex PCR protocol directed against outer each treatment process were the following: dewatering hexamercapsid protein primers. genes Worldwide VP4 and VP7 standardized were conducted specific for mean recovery efficiency of the samples, considering RVA genotype determination. The RT-PCR analysis of 38.9%), mesophilic anaerobic digestion,FeCl3, and the SW-UR samples (n=126) showed a positivity of 41% (41.4PFU/gTS,organic polymer 52.2%), (5.4PFU/gTS, composting 20.6%), (<0.25PFU/gTS, mesophilic (n=51) and in the case of SW-STP (n=20), 40% were 16.2%). The method evaluated is considered simple and genotypes detected were as follow: 1) SW-UR: G2, P[6], anaerobicpresented digestion,recovery percentages FeCl3, and variable lime (<0.25PFU/gTS, from 11.5% positiveP[9]; 2) SW-STP:at affluent G2, and P[8], 10% P[4]. at VP4effluent. and TheVP7 diversityconsensual of to 85.3%. However it should be taken into account that fragment of the positive samples are under sequencing matrix. such performance suffers the influence of the sample ev501 - DETECTION OF HUMAN BOCAVIRUS processenvironmental to confirm dissemination the genotypes and through diversity phylogenetic of RVA in IN RAW WATER SAMPLES OF RIO DOS SINOS analysis.different regions These resultsof Uruguay. are the Financial first evidence support: ofPolos the WATERSHED, RIO GRANDE DO SUL, BRAZIL de Desarrollo Universitario, Univerisdad de la República Kluge, M., Henzel, A., Spilki, F.R. (CSIC) UdelaR (UdelaR). Comisión Sectorial de Investigación Científica September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

23 Oral Presentation

Universidade Feevale, FEEVALE, ERS 239, 2755 - Novo sequences and the year of isolation could be retrieved Hamburgo - RS, 93352-000 from GenBank. The Bayesian inference method available in the software BEAST v. 1.6.2 was used in order to Human bocavirus (HBoV), a member of the Parvoviridae analyze the phylogenetic relationship. Based on 257 sequences, the mutation rate was estimated to be 1.7318 from respiratory tract secretions of young children with x 10-3 (1.4374-2.075 x 10-3) nt substitution/site/year. family,acute respiratory was first described disease. Althoughin 2005 when HBoV it iswas frequently isolated The TMRCA inferred for G3 strain was calculated to be associated with respiratory infections in children, it 1786 (1765-1810). It was possible to separate three has also been detected in stool samples, leaving unclear distinct Lineages of G3 by phylogenetic analysis. All of its role as a causative agent of gastroenteritis. Since them contain animals and humans strains; however, HBoV can be excreted through feces, its presence in Lineage II contains the majority of human G3 strains, water should be considered as a possible source of and they are associated with urban environments. transmission. Therefore, the aim of this study is to Phylogeography and temporal analysis, suggested evaluate the presence of HBoV in raw water samples that G3 strain emerged in Asia and scattered through collected from ten drinking water treatment plants the globe in rural environments. The urban context of localized within the Rio dos Sinos watershed, Rio Grande RVA G3 circulation was later observed 100-110 years do Sul, Brazil. 500 ml of each sample was collected and ago, and the data analyzed also suggested that the concentrated using an adsorption-elution method, urbanization process took place in Asia, and posteriorly followed by the extraction of the viral DNA. The presence in Europe and the Americas. The Bayesian Phylogenetic of HBoV genome was detected by conventional PCR analysis suggests that a transmission between human using primers designed to align in highly conserved and animals may be the ancestral characteristic of the G3 regions of the HBoV genome, targeting the nonstructural strain, and its urbanization is a later phenomenon. The protein NP1. The reaction products were submitted to most recent common ancestor of this strain was dated electrophoresis on 2% agarose gel in a TBE buffer, stained back to 1786; however the emergence of the majority with SYBR Safe DNA Gel stain (Invitrogen) and visualized human urban Lineage II could be tracked back to around by UV light. So far, 29 water samples were analyzed from 1904. This data suggests that the urbanization of the RVA January to October 2011 and 5 of them were positive to HBoV genome. Those samples were previously tested with the industrialization process associated with the for enteroviruses and rotaviruses by conventional PCR andchange its fixationfrom rural on settlementshuman population towards may a predominantly be associated and they all resulted negative for those viruses. These urban population. Also, urbanized strains are apparently preliminary results suggest that HBoV may be included more prevalent than rural strains. The complexity that as an additional marker of fecal contamination in water naturally arises from this changing environment is an samples and further studies are necessary to evaluate its ideal situation to the emergence of a new zoonotic virus, risks for public health. Financial support: CNPq, Feevale, as indicated by the recent epidemics of SARS-COV, and Capes, FAPERGS H1N1. Financial Support: PPG-CCD-SES/SP; IAL

HV14 - UNEXPECTED DETECTION OF BOVINE hv86 - THE EFFECT OF HOST IL28B GENOTYPE ON G10 ROTAVIRUS IN A BRAZILIAN CHILD WITH CLINICAL OUTCOMES OF HEPATITIS A AND B DIARRHEA Toutinho, R.S., Fabrício-Silva, G.M., De Oliveira, J.C., Luchs, A., Timenetsky, M.C.S.T. Lewis-Ximenez, L.L., De Almeida, A.J., Pinto, M.A., Pôrto, Instituto Adolfo Lutz, IAL, Av Dr Arnaldo, 355 Centro L.C.M.S., De Paula, V.S. de Virologia 01246-902 1. Instituto Oswaldo Cruz - FIOCRUZ, IOC - Rotavirus group A (RVA) G3 genotype has broadest FIOCRUZ, Av. Brasil 4365 host range. The aims of this study were to carry out 2. Universidade Estadual do Rio de Janeiro, UERJ, Bayesian phylogenetic analyses using the nucleotide Despite advances in therapy and vaccine development, sequences of VP7 gene available in GenBank in order viral hepatitis infections still account for morbidity to investigate the evolutionary dynamic between RVA and mortality worldwide. Genetic diversity of host G3 strains originating in humans, wild and domestic immune response, such as IL28B SNPs, may contribute animals; quantify the mutation rates; and estimate to explain the variability in the outcome of hepatitis A the most recent common ancestors. For 5 bovines, 3 simians, 2 environmental, 8 canines, 22 equines, 3 felines, 5 rabbits, 5 porcines, 2 caprines, 3 murines, and and B infection. Host IL28B genotype has significant 199 human G3 strains; the entire or partial VP7 ORF influenceas an antiviral on treatment agent, in response non-treated to chronicpatients, hepatitis is still patients. Whether IL28B genotype influences directly September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

24 Oral Presentation unknown. For these reasons, this study aim to compare virulent hantavirus of world. To understand the role that viral load plays in the pathogenesis in patients with HPS, of hepatitis A and B viral infection. For this purpose, thesamples genetic from profile patients of IL28B with SNPs different to different hepatitis outcomes clinical blood samples from 20 acutely ill patients, divided into weteen quantified samples fromAraraquara patients virus in acuteS segment period, viral and RNA teen in IL28B by TaqMan real time PCR. In the total, 144 samples samples obtained from survivors (convalescent phase). outcomes,were enrolled confirmed into 3 cohorts: by serology, 100 acute, were 23 genotyped chronic and for To detection and quantitation of Araraquara virus RNA 21 fulminant hepatitis. Concerning acute samples, 86 of S segment was used a one-step SYBR Green real- belongs to hepatitis A and 14 hepatitis B group. Between time RT-PCR. From the sera of 20 human HPS patients, fulminant samples, 6 belong to hepatitis A, 2 from hepatitis B and 13 non-viral hepatitis patients. Genotyping results quantitative RT-PCR, including 2 samples that have not of IL28B17, 60 and 75 were confronted with different the hantavirus genome was amplified in 10 sera by characteristics factors (hepatitis type, group, clinical These 2 samples had low viral loads (3,67x104 and outcome, viral/non-viral). Statistic results showed that been2,64x104 amplified copies/ml previously of serum) by that conventional were likely RT-PCR. below the detection capacity of conventional RT-PCR. The analysis of viral load demonstrated high plasma levels onlyof the clinical hepatitis outcome type. IL28B60T were significant and IL28B75G associated variant with of viral RNA during acute infection phase (2,64x104 and IL28Balleles were haplotypes more frequent and alleles in chronic (p<0.05), patients independently (60.6%) 3,78x106 copies/ml). We observed that high plasmatic than in fulminant ones (39.4%). IL28B17TT haplotype viral load of Araraquara virus are inversely correlated and the absent of IL28B17G variant allele were more with IgG antibody concentration. In 10 survivors who frequent in acute patients than in chronic (87.8%/12.2%) had samples obtained after the acute phase, not was and fulminant ones (87.8%/12.2% and 71.1%/28.9%, observed detection of viral RNA, however high levels of respectively). IL28B60CC haplotype and the absent IgG antibody was observed. These results suggest that of IL28B60T variant allele were more frequent in patients with high viral loads on admission are more acute patients than in chronic ones, 93.9% and 6.1%, likely to have severe disease. respectively. IL28B75AA haplotype and the absent of IL28B75G variant allele were more frequent in acute HV290 - DETECTION AND GENOTYPING OF patients (93.5%) than in chronic ones (6.5%). With the NOROVIRUS IN BLOOD AND STOOL SAMPLES high resolution molecular typing of clinical groups was OF CHILDREN HOSPITALIZED WITH ACUTE GASTROENTERITIS IN BELÉM, PARÁ, BRAZIL. SNPs with the outcome of hepatitis A and B. This study Reymão, T.K.A., Fumian, T.M., Justino, M.C.A., Linhares, verified that there is evidence of the influence of IL28B A.C., Mascarenhas, J.D.P., Lucena, M.S., Siqueira, J.A.M., and B outcomes with IL28B in Brazil. Understanding Barros, R., Gonçalves, M., Soares, L.S., Abreu, E., Gabbay, is the first that shows association between hepatitis A Y.B. to viral infection provides new opportunities to control howthese thediseases host factorand for influences the development the immune of responseeffective Norovirus (NoV) are currently considered the major cause of acute gastroenteritis (AGE) in children less than 5 years old, causing more than 1 million hospitalizations/ therapeutics,HV103 - whichAraraquara justifies the study ofV iralthis locus. RNA year and around 200,000 deaths/year in this age group. Load in Patients with Hantavirus The most common symptoms of the infection by NoV Cardiopulmonary Syndrome are diarrhea, vomiting and fever. However, studies Machado, A.M., Souza, W.M., Pádua, M., Machado, have demonstrated other extra-intestinal symptoms, A.R.S.R., Figueiredo, L.T.M. like disseminated intravascular coagulation, seizures, encephalopathy, and necrotizing enterocolitis, and until Centro de Pesquisa em Virologia - FMRP -USP, CPV - now, little is known about its ability to spread outside FMRP - USP, Av. Bandeirantes 3900 - Monte Alegre - Ribeirão the gut. The present study, aims to investigate the role of Preto - SP NoVs causing viremia in children hospitalized for AGE, as Hantaviruses (Bunyaviridae) are rodent-borne well as to correlate the presence of NoVs RNA in serum emerging viral with a worldwide distribution and with with clinical severity and stool viral load. Paired stool high lethality in Americas. In the Americas, hantaviruses and serum samples were collected from 85 pediatric are known to cause Hantavirus pulmonary syndrome patients under 6 years hospitalized for AGE from March (HPS), this one is an increasing health problem in Brazil, to September 2012 in Belem, Brazil. Enzyme-linked especially in Central Plateau and Southeastern, where immunosorbent assay (EIA) and reverse transcription circulates the Araraquara virus, which may be the most quantitative PCR (RT-qPCR) were used to detect and

25 Oral Presentation quantify NoVs, respectively. Phylogenetic analysis of the Mean percents of methylation were as follows. CpG1: partial ORF2 region was used to genotype the strains 14.7% (normal tissues), 29.4% (cirrhotic) and 59.2% detected. NoVs were detected in 34.1% (29/85) of stool (HCC); CpG2: 11.3%, 26.4% and 65.4%; CpG3: 12.4%, samples. By qRT-PCR, we found a high rate of NoVs RNA 31.2% and 72.3%; CpG4: 11.1%, 29.1% and 57.9%; in serum samples (34.5%) among NoVs-positive AGE CpG5: 16.6%, 34.9% and 61.3%; CpG6: 16.4%, 35.7% cases, and was associated with a longer hospitalization and 60.0%. Understanding epigenetic changes in HCV- (6.5 vs. 4.0 days; p = 0.006), as well as with a higher stool associated HCC will help to elucidate the pathogenesis viral load (3.9x1011 vs. 1.1x1011 GC/g; p = 0.0472). for liver cancer prognosis, diagnosis and treatment. strains) and GII.7 (10%). The same genotype was found and may lead to the identification of molecular markers NoVsin paired strains stool were and classified serum as samples.GII.4 (90% Detection of genotyped and HV395 - LABORATORY-BASED ROTAVIRUS molecular characterization of NoVs GII in paired stool SURVEILLANCE DURING THE VACCINATION and serum samples suggest that the dissemination of PROGRAM, BRAZIL, 2010–2012. NoVs to the blood stream is not uncommon, but the role Carvalho-Costa, F.A., Leite, J.P.G., Volotão, E.M., Assis, of viruses spread outside the gut and the relationship R.M.S., Fialho, A.M., Andrade, J.S.R., Resque, H.R., Silva, with disease severity need to be further addressed. M.F.M., Gomez, M.M., Rose, T.L. Instituto Oswaldo Cruz - Fiocruz – Rio de Janeiro – RJ, the detection of NoV in serum samples. Future studies IOC, Av. Brasil, 4365, Manguinhos, RJ CEP 21040360 Thison children is the firstwith studyNoV-positive conducted AGE in and Brazil viremia concerning should be conducted for a clearer understanding of the NoVs Diarrheal diseases are the second leading cause of death pathogenesis. Finnancial support: CNPQ/IEC/SVS in children worldwide, enteric viruses are responsible for about 40% of the cases. Group A rotaviruses (RVA) HV336 - COMPARATIVE ANALYSIS OF RASSF1A are frequently detected in children with acute diarrhea, PROMOTER METHYLATION LEVELS BETWEEN and have worldwide distribution. In Brazil, a monovalent HEPATOCELLULAR CARCINOMA (HCC) AND NON- vaccine (Rotarix) is part of the immunization schedule, HCC TISSUES FROM BRAZILIAN HEPATITIS C starting in 2006. This study aims to assess the current VIRUS CHRONIC CARRIERS. epidemiological picture of RVA diarrhea; 3,841 fecal Rosa, A.G.S., Niel, C., Villela-Nogueira, C.A., Pannain, V., samples obtained in the period 2010-2012 from patients Araujo, N.M. from 14 Brazilian states were studied. Polyacrylamide gel 1. Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil, electrophoresis and enzyme immunoassay were utilized 4365, Manguinhos, Rio de Janeiro, RJ, Brasil for RVA detection. Positive samples were genotyped by seminested multiplex RT-PCR. RVA was detected 2. Universidade Federal do Rio de Janeiro, UFRJ, in 18.4% (n = 707) of the patients. Concerning RV-A Hepatocellular carcinoma (HCC) is one of the most genotypes, the following rates were observed: G2P[4], common tumors worldwide. HCC is frequently diagnosed n=440 (62.2%); G3P[8], n=85 (12%); G not typed (NT) after the development of clinical deterioration at which P[8], n=38 (5.4%); G9P[8], n=32 (4.5%); G2P[NT], n=13 time survival is measured in months. Hepatitis C virus (1.8%); G1P[6], n=12 (1.7%); G1P[8], n=9 (1.3%); GNT (HCV) infection is a major cause of chronic hepatitis and P[6], n=9 (1.3%); G3P[6], n=7 (1%); G4P[8], n=7 (1%); a major risk factor for HCC in Brazil. Hypermethylation G3P[NT], n=6 (0.8%); G9P[NT], n=2 (0.3%); G1P[9], of promoter regions of tumor suppressor genes has n=1 (0.1%); G2P[6], n=1 (0.1%); GNTP[4], n=1 (0.1%); been shown to facilitate the development of human GNTP[NT], n=44 (6.2%). Among children less than cancers, including HCC. This study was performed to 1 year-old, the rates of RVA detection were 107/598 determine whether occurrence of aberrant methylation (17.9%) in 2010, 52/393 (13.2%) in 2011, and 43/326 of RASSF1A gene promoter might be associated with (13.2%) in 2012. A shift in the rate of detection of the hepatocarcinogenesis in Brazilian HCV chronic carriers. distinct genotypes was observed during the study Methylation levels were measured by bisulphite period. G2P[4]/G2P[NT]/GNTP[4] was detected in 86.7% (366/422) of RV-A positive subjects in 2010, in 50.3% (75/149) in 2011, and only 9.6% (13/136) in pyrosequencingincluding 15 HCC, of two DNA cirrhotic extracted and from eight formalin-fixed, normal liver paraffin-embeddedtissues were analyzed. liver In tissues. each Twenty-fivesample, the samples,percent the detection rate of the G3P[8]/G3P[NT] genotype: of methylation was determined for six promoter CpG 2012.2.4% (10/422)This finding in 2010,was accompanied 22.1% in 2011 by (33/149),an increase and in islands (1 to 6). At each of them, low, intermediate 41.2% (56/136) in 2012. Therefore, in 2012, G2 has not and high levels of methylation were measured for normal liver, cirrhotic and HCC tissues, respectively. its emergence in 2006. Certainly, the shift observed in been the predominant genotype for the first time since September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

26 Oral Presentation

RVA genotypes circulation during the study period has HV462 - EPSTEIN-BARR VIRUS AND CHRONIC epidemiological implications, particularly with respect ADENOTONSILLAR HYPERTROPHY. to Rotarix effectiveness. Pestana, F.N., Arruda, E., Proença-Modena, J.L., Saturno, T.H., Escremim de Paula, F.E., Souza, J.M., Tamashiro, HV455 - ANALYSIS OF THE SPATIAL DISTRIBUTION E.,Valera, F.C., Anselmo-Lima, W.T. OF DENGUE IN AEDES AEGYPTI MOSQUITOES IN A NEIGHBORHOOD FROM SÃO JOSÉ DO RIO PRETO Faculdade de Medicina de Ribeirão Preto , FMRP-USP, (SP) Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto Parra, M.C.P., Fávaro, E.A., Ozanic, K., Dibo, M.R., Epstein-Barr virus (EBV), the main cause of infectious Chiaravalloti-Neto, F., Eiras, A.E., Nogueira, M.L., mononucleosis, is a herpesvirus that infects B Mondini, A. lymphocytes of 95% of humans. Chronic adenotonsillar 1. Faculdade de Medicina de São José do Rio Preto, hypertrophy (CAH) is a poorly understood disease FAMERP, Av. Brigadeiro Faria Lima, 5416, São Pedro, São and the most frequent indication for tonsillectomy José do Rio Preto in the world. This study assessed the EBV infection 2. Unversidade Estadual Paulista, UNESP, in palatine tonsils, adenoids, nasal secretions and peripheral blood in patients with CAH undergoing 3. Universidade de São Paulo, USP, tonsillectomy at the University of Sao Paulo Hospital in 4. Universidade Federal de Minas Gerais, UFMG, Ribeirao Preto, Brazil. A total of 180 patients with CAH, Dengue is an important arboviral infection with without symptoms of acute respiratory infections, who worldwide distribution and Aedes aegypti mosquitoes underwent tonsillectomy in 2011-2012 were enrolled. are the main vectors of dengue viruses (DENV 1-4) in Brazil. São José do Rio Preto, which is located at EBV genome was detected in 137 (76%) of patients. the northwestern region of São Paulo State, has been EBVOverall, detection 122 (68%) and quantification had detectable were EBV done in bypalatine qPCR. presenting high incidences of the disease every year and tonsil tissue samples, 110 (61%) in adenoids, 76 (42%) the geographic information systems (GIS) can contribute in respiratory secretions, 51 (28%) in the peripheral for a better comprehension of dengue distribution and blood and 10 (7.3%) in all four tested sites. The median for more effective surveillance measures in cities that tissue viral loads were 1.72x105 and 2.37x105 genome present an endemic circulation of the disease. Adult copies/g in palatine tonsils and adenoids, respectively. trap information combined with spatial analysis can The median EBV loads in respiratory secretions and provide fundamental information of DENV spread and peripheral blood were respectively 7.65 x 102 and 7.28 transmission. The aim of our study was to associate x 102. Approximately 55% of the patients had EBV viral viral surveillance in mosquitoes with spatial analysis to loads higher than 105 copies/g of adenotonsillar tissue. identify possible hot spots of DENV transmission. We There was no relationship of high viral loads in all of the have placed MosquititoTM traps twice a week in an area tested samples with the different degrees of tonsillar that comprises 25 census tracts and 102 blocks from May hypertrophy. The results suggest that EBV infection is not to October 2012. The specimens were pooled and labeled a cause of chronic adenotonsillar hypertrophy and is not according to genus/species, gender and collection site. related with the grades of palatine tonsils hypertrophy. The geocoding was performed with TerraView open However, the presence of high viral loads of EBV in software (DPI/INPE). Our analysis was performed with the palatine tonsils and adenoids was associated with mosquitoes collected from the epidemiological week 10 simultaneous detection of EBV in respiratory secretions until the epidemiological week 44. Approximately 340 and peripheral blood. This suggests that these lymphoid traps were positive for the presence of Aedes aegypti tissues may function as reservoirs of EBV-infected mosquitoes, among 1,332 traps that were installed in cells, and that children with hypertrophic tonsils are the study area. We were able to detect DENV-1, DENV-2 important sources of EBV shedding, which assures the and DENV-4 in four adult traps of three different census virus transmission to susceptible hosts. tracts. One of these tracts can be considered a hot spot HV627 - DIVERSITY OF ENTEROVIRUS ASSOCIATED an infected adult male, which is an indication of local WITH INFECTIONS OF THE CENTRAL NERVOUS forvertical dengue transmission. transmission In thisbecause tract, we DENV were transmission able to find SYSTEM IN SÃO PAULO STATE, BRAZIL, 2004-2012. would occur without the presence of infected human Machado, B.C., Russo, D.H., Sousa, C.A., Timenetsky, subjects. Our preliminary data indicate that census M.C.S.T., Vieira, H.R., Carmona, R.C.C. tracts can present different risks of dengue transmission Instituto Adolfo Lutz, IAL, Ave. Dr. Arnaldo, 355, and control measures should be applied according to 01246-902 viral surveillance in mosquitoes and humans alike. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

27 Oral Presentation

Human enteroviruses (HEVs) are responsible for a wide culture but poorly in mammalian cells. Thus, these HR spectrum of clinical diseases. HEVs comprise a large viruses are attenuated for growth in mammals. For DV genus in the Picornaviridae family, with 113 serotypes the use of live, attenuated virus vaccines (LAV) yields delineated into four species (A–D) based mostly on their the best chance of developing: 1). A safe and effective phylogenetic relationships. Members of the enterovirus vaccine that will protect against all four DV serotypes B species cause a central nervous system (CNS) infection, 2). Initiate the desired immune response, neutralizing like encephalitis, meningoencephalitis and mainly antibodies as well as an effective cellular response and aseptic meningitis. The aim of this study was to establish 3). Produce a balanced immune response. Recent work the occurrence of HEVs in patients with infectious of the CNS in São Paulo State, Brazil. This retrospective antibodies are preferentially made against epitopes study was conducted in convenient surveillance clinical in the dengue field revealed that for DV, neutralizing Arbovax vaccine method creates live virus vaccines for and brain biopsy) collected from 922 patients with onlyall four found serotypes in the with native, altered live-virus transmembrane configuration. domains The specimensinfections of(cerebralspinal the CNS, in a fluidperiod and/or of 2004 stool, to swab 2012. anal, We that are embedded within the virus’s protective outer investigated the presence of enterovirus (EVs) in these membrane, so that all virus ectodomains, or outside samples by cell culture to isolate the viral agent. The surfaces that are available to the host’s immune system samples that showed citopathic effect (CPE) in the cell and are indistinguishable from those of the wild-type Dengue virus. By this method, the best possible substrate (IFA), using monoclonal antibodies (Chemicon, USA), for immune response is generated, an attenuated virus culture were submitted by Indirect Immunofluorescence with wild-type virus structure. This tetravalent vaccine formulation was tested in African Green Monkeys and RT-PCR(140/922) and of all VP1 CNS partial infectious; sequencing corresponding to identification to 92.1% found to be safe, immunogenic, and demonstrated of(n=129/140) EVs isolated. of Entrovirusesaseptic meningitis, were identified1.4% (n=2/140) in 15.2% of limited interference upon vaccination and post challenge. encephalitis, 2.9% (n=4/140) of meningoencephalitis, 100% of the animals sero-converted to DV 1,2, 3 and and 3.6% (n=5/140) other viral neurological infections. 4 prior to challenge on day 62. All vaccinated animals Echoviruses (E) were isolated most frequently, with 90 showed an anamnestic response of >3 fold increase over cases (64.3%), Coxsackievirus B (CV-B), with 11 cases control animals. These host range tetravalent vaccine (7.8%), and 39 cases with EVs untypeable (27.9%). E-6 strains contain the homologous non-structural proteins recently found to be critical for the development of a n=33/140), followed by E-30 (20.7%; n=29/140), E-18 complete protective response in humans. This vaccine is was(12.1%; the n=17/140), most commonly CV-B5 identified(5.7%; n=8/140), serotype E-11 (23.6%; (2.9; scheduled to move to Phase I clinical trials. n=4/140), E-4 (3.6%; n=5/140), CV-B4 (1.4%; n=2/140), E-9, E-13 and CV-B1(0.7%; n=1/140). EVs were detected IV419 - EXPERIMENTAL INFECTION IN in all the period of the year with the highest rate in the CYNOMOLGUS MONKEYS (Macaca spring and summer months. Data obtained in this study fascicularis) WITH HUMAN ROTAVIRUS A contribute to the knowledge about HEVs circulation Bentes, G.A., Volotão, E.M., Guimarães, J.R., Lanzarini, implicated in CNS infections over a 9-year period in São N.M., Silva, A.S., Ganime, A.C., Leite, J.P., Pinto, M.A. Paulo State. Financial support: FAPESP: 2012/50234-5. Instituto Oswaldo Cruz/Fundação Oswaldo Cruz, iv78 - A novel LAV tetravalent Dengue virus IOC/Fiocruz, Av. Brasil, 4365, Pav. Helio e Peggy Pereira, vaccine tested in African Green Monkeys. Manguinhos, Rio de Janeiro/RJ Piper, A., Ribeiro, M., Smith, K., Briggs, C., Huitt, E., Rotavirus is the most common cause of severe acute Spears, C., Quiles, M., Thomas, M., Brown, D., Hernandez, diarrhea in infants and young children worldwide. The R. incidence of rotavirus disease is similar in developed 1. North Carolina State University , NC STATE, 128 and developing countries but the mortality is higher Polk Hall, Raleigh, NC, USA 27695 in the former countries. Their double-stranded RNA 2. Arbovax, Arbovax, 617 Hutton Street, Suite 101, consists of 11 segments, which encode six viral capsid proteins (VP1, 2, 3, 4, 6 and 7) and six nonstructural Raleigh NC 27606 Arbovax, in collaboration with NC State, has developed serogroups (A-G) based upon the antigenic properties of a novel strategy to produce a Dengue virus (DV) live, proteinsVP6, an inner (NSP1-6). capsid Rotavirus protein, of is which classified groups into A, B seven and attenuated tetravalent vaccine by creating viral mutants C are human pathogens. Rotavirus spreads from person with truncated transmembrane domains. These are to person, mainly by faecal-oral transmission. Detectable host range mutants (HR) and grow well in insect cell rotavirus antigenaemia and viremia suggests that

28 Oral Presentation rotavirus escapes from the intestinal tract. In this study, different rodent reservoirs in several geographic areas we report the experimental infection of nine infant- juvenile cynomolgus monkeys (Macaca fascicularis) HPS is characterized by fever and vascular leakage, using a human rotavirus A (RV-A Wa) produced in suggestsresulting in the noncardiogenic development ofpulmonary region-specific edema antigens.followed cell culture. The aim was to assess the suitability of by shock. With a case-fatality rate about 50%, a rapid and the cynomolgus as a model of rotavirus infection and accurate diagnosis during the early course of the disease diarrhea. Six animals were inoculated orally with RV-A is essential to reducing the high mortality rate associated Wa by catheter, and three animals were administrated with hantavirus infection. Camelids produce, in addition orally with saline solution (control group). Clinical and to conventional antibodies, IgG composed exclusively of corporal temperatures were monitored every day. The heavy chains, in which the antigen binding site is formed blood was collected in 0, 1st, 3rd, 7th and 10th days post only by the single domain, called VHH or nanobody. This infection (dpi) for measurement of total white blood cells, work proposes the use of camelid nanobodies against hematocrit and electrolytes levels. Faeces were collected Araucaria hantavirus recombinant nucleoprotein daily from the 0 to the 10th dpi. Both samples were tested (rNH) of a Brazilian hantavirus to develop alternative to the rotavirus presence by RT-PCR and qPCR. The study was approved in Ethics Commission for the Use To generate VHHs, the phage display technology was of Animals – CEUA/Fiocruz (LW-35/11). The monkeys methodsemployed. to VHH diagnosis domains and were confirm isolated hantavirus by RT-PCR infection. using inoculated with rotavirus had the subclinical infection cDNA obtained after RNA extraction from peripheral form. Every biochemistry and hematological parameters lymphocytes of an immunized Lama glama. Amplicons had low alterations comparing animals inoculated with were cloned into PHEN1 phagemid vector and TG1 E. coli strain to construct a VHH immune library with a was observed in these parameters, and majority animals titer of 2,3 x1018 cfu/mL. Subsequently, VHH domains controlhad no signals, group except animals, one but animal, any statisticalwhich had significanceoccurrence were displayed fused to M13KO7 phage coat protein of diarrhea for three days. Nevertheless, the infection III and the selection steps performed on immobilized occurred in all inoculated animals, the RNA rotavirus was rNH protein. After two round of selection, 69 individual detected in faeces and serum. This monkey model can be positive clones were sequenced, analyzed and the 11 Y immunotherapy in rotaviruses disease. clones recognized specifically rNH protein by ELISA. The used in future to evaluate the efficacy of immunoglobulin IV495 - CAMELID NANOBODIES, AN ALTERNATIVE sequences that showed different profiles deposited into TO DIAGNOSIS HANTAVIRUS INFECTION GenBank.the rNH by One ELISA, of the western selected blotting VHHs and was surface purified plasmon by Ni- Pereira, S.S., Fernandes, C.F., Prado, N.D.R., Morais, NTA affinity cromatography and recognized specifically M.S.S., Luiz, M.B., Moreira, L.S., Mazzarotto, G.A.C.A., VHHs could be an alternative tool to diagnosis hantavirus Strottmann, D.M., Soares, A.M., Santos, C.N.D., Stabeli, resonance.infections. FINANCIALThese findings SUPPORT: support CNPQ the idea that selected R.G. PIV7 - DETECTION OF FOUR VIRUSES IN APPLES 1. Fundação Oswaldo Cruz Rondônia, Porto Velho, AND PEARS BY REAL TIME RT-PCR USING Brazil, FIOCRUZ RONDÔNIA, RUA DA BEIRA, 7671, BR 5’-HYDROLYSIS PROBES 364, KM 3,5 Nickel, O., Fajardo, T.V.M. 2. Centro de Pesquisa em Medicina Tropical, Porto Velho, Brazil, CEPEM, Avenida Guaporé 215, Lagoa, Porto Embrapa Uva e Vinho, CNPUV, Caixa Postal 130, Velho RO 95.700-000 Bento Gonçalves, RS 3. Instituto Carlos Chagas - Fiocruz Paraná, Brazil, Apple latent viruses such as Apple stem pitting virus, ICC/FIOCRUZ PARANÁ, Algacyr Munhoz Mader, 3775, Apple stem grooving virus, Apple chlorotic leaf spot virus Curitiba/PR, and Apple mosaic virus are commonly found in apples 4. Centro de Estudos de Biomoléculas Aplicadas à and pears. They are main targets of virus elimination Saúde, CeBio, Rua da Beira 7671 Br 364 Km 3,5 sentido procedures from elite and pre-basic material that Cuiabá usually require evaluation of health by processing a large number of samples. Real time RT-PCR offers substantial Hantaviruses that belong to the Bunyaviridae family advantages over conventional RT-PCR for plant virus can cause Hantavirus pulmonary syndrome (HPS) in diagnosis such as immediate availability of results the American continent. The infection in human occurs which obviates laborious gel analysis, reduced sample through inhalation of aerosolized excreta from chronically manipulation that reduces amplicon contamination and infected rodents and the association of the disease with high sample processing capacity. The objective of this

29 Oral Presentation work was to design primers and probes for a real time workers of Apis mellifera and dead pups were collected RT-PCR protocol for detection of ASPV, ACLSV, ASGV and from six hives of two apiaries. These individuals were processed at molecular biology laboratory of the Federal primers were designed by searching for highly conserved University of Pampa, Sao Gabriel campus, where we ApMV.nucleotide Specific fragments probes in the labeled respective with coat FAM/TAMRA protein genes and performed extraction of total RNA, cDNA synthesis and of the four viruses using software CLC Sequence Viewer 6, and used to detect the viruses in tissues of apples and pears. Total RNA was extracted from apple and pear PCR(Deformed with specific Wing primersVirus, Kacugofor viral Virusesdetection, and as wellVarroa as bark scrapings and adsorbed on to silicium dioxyde. aDestructor multispecies Virus). primer Positive that detects results three were Iflavirus obtained types for The StepOnePlus Real Time PCR System was used for the presence of Varroa destructor virus (VDV-1) with a thermocycling. Results were analysed graphically using proprietary StepOne Software v2.2.2. Related to the previously known viral status based on RT-PCR and/ specific primer for this one, as well as viral amplification or biological indexing of the analyzed apple samples, inrecord different of VDV-1 samples in South using America the multispecific hives. These primer,results 89.2% (25/28), 96.4% (27/28), 100% (28/28) and 88% suggestingallow a better the understanding presence of other of the viruses. problems This thatis the affect first (22/25) of infections by ASGV, ASPV, ACLSV and ApMV, or may affect the region apiaries, as well as provides subsidies for new viral detections in Apis mellifera. known pre-existing ASPV infections by primers and Financial support:CNPq respectively were confirmed. In pears, recognition of a selection of the main commercial cvs. of apples and PIV328 - INFECTION OF TOMATO PLANTS BY THE probepears. wasThese 100%. results Viral demonstrate infections the were sensitivity confirmed and in BEGOMOVIRUS Tomato chlorotic mottle reliability of the designed primers and probes for virus (ToCMoV) INCREASES THE EXPRESSION detection of these pathogens. Real Time RT-PCR using OF UBIQUITINATION PATHWAY GENES labeled probes represents a valuable tool to increase Lacerda, A.L.M., Fonseca, L.N., Boiteux, L.S., Brasileiro, feasibility of processing large numbers of samples and it A.C.M., Ribeiro, S.G. is therefore well adapted for control of sanitary quality 1. Embrapa Recursos Genéticos e Biotecnologia, such as required by healthy plant propagation material CENARGEN, Parque Estação Biológica - PqEB - Av. W5 479609/2011-0 Norte (final) 70770-917 – Brasilia certification programs. Financial support: CNPq Proc. Nr. 2. Embrapa Hortaliças, CNPH, Rodovia Brasília/ PIV277 - STUDY OF THE STATE OF VIRAL Anápolis BR 060 Km 09 Gama - DF CEP 70351-970 INFECTION IN APIARIES IN THE AREA OF THE PAMPA GAUCHO. Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F., controls the degradation of protein in eukaryotes. The Barcelos, C. de L. Ubiquitinationsubstrate targeted is a bypost-translational ubiquitin molecules modification are degraded that by the 26S proteasome complex. The ubiquitination Universidade Federal do Pampa, UNIPAMPA, pathway involves an enzymatic cascade that tags the substrate by the attachment of ubiquitin molecules In recent years, we have seen a sharp and worrying with participation of E1 ubiquitin activating enzyme, an decline of the global bee populations, a phenomenon E2 ubiquitin conjugation enzyme and an E3 ubiquitin known as Colony Collapse Disorder (CCD), that is seriously threatening beekeeping and crops that depend plant viruses show ability to disturb the ubiquitination on bees for pollination. Among the reasons cited for this ligase,pathway that by confersinducing, specificity inhibiting to or the modifying substrate. enzymes, Several decline as suspects, are the viruses. Because the swarms mainly E3 ligases. The aim of the present work is to are densely populated and have a high rate of contact study expression of genes involved in the ubiquitination between the colony members, relating each other for pathway during the tomato-begomovirus interaction. communication and feeding, bee colonies provide great An mRNA-Seq from cDNAs libraries of inoculated and opportunities for viral transmission. The virus can affect non-inoculated tomato near isogenic lines Santa Clara all developmental bee stages, including eggs, brood and (susceptible) and LAM 157 (resistant) was performed adults, and drastically reducing honey production and and seven genes of the ubiquitination pathway were pollination. Among the family of viruses that affect the the hives of Apis mellifera in the state of Rio Grande do identified:conjugating one enzyme E3 ubiquitin-protein E2-like protein. These ligase, genes three showed F-box beesSul. This is the study Iflaviridae aims to family, identify with the no viruses scientific of this records family in proteins, two RING finger proteins and one Ubiquitin- that are present in beehives of different state cities. Adult plants were inoculated with ToCMoV (Tomato chlorotic September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentationsignificant up-regulation (log2 fold change > 2.0) when XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

30 Oral Presentation

Valente, D.D., Xavier, A.S., Bruckner, F.P., Nogueira, reverse transcription qPCR (qRT-PCR). The expression of D.R.S., Zerbini, F.M., Alfenas-Zerbini, P. mottlethese genes virus). is currentlyThese results being were evaluated further in confirmeda time course by assay following virus inoculation. Since it has been 1. Universidade Federal de Viçosa, UFV, Laboratório de described that the silencing of ubiquitination pathway Microbiologia Industrial/ BIOAGRO genes enhanced the begomovirus Tomato yellow leaf 2. Universidade Federal de Viçosa, UFV, Laboratório de curl virus infection, the next step of this study will be Virologia Vegetal Molecular/ BIOAGRO the silencing of these ubiquitin pathway genes using During co-evolution between virus and host, a complex interaction has been developed involving several of silencing effectiveness, plants will be inoculated mechanisms of pathogen attack and host defense. Host VIGSwith (Virus-inducedToCMoV and the gene resulting silencing). phenotype After confirmation evaluated. defense responses cause up- and downward shifts in Financial support: Fundo Embrapa/Monsanto, CNPq, gene expression. To understand the process of tomato INCT-Interações Planta-Praga, FapDF infection by the potyvirus Pepper yellow mosaic virus PIV373 - Infectious cDNA clones of the crinivirus Tomato chlorosis virus are as differentially expressed during the early stages of competent for systemic plant infection (PepYMV),viral infection. a subtractive Among the library induced identified genes severalwas the genes one and whitefly-transmission encoding a DnaJ (HSP40) protein. Members of the DnaJ Orílio, A.F., Fortes, I.M., Navas-Castillo, J. multigene family contain a highly conserved 70-amino acid signature region, the J domain, and assist as co- Inst. Hortofruticultura Subtropical y Mediterránea chaperones of HSP70s in various cellular processes. La Mayora, IHSM-UMA-CSIC, Estación Experimental “La The involvement of HSP proteins in the enhancement Mayora”, 29750 Algarrobo-Costa, Málaga, Spain. or inhibition of pathogenesis in a wide range of viral infections has been described. Our own previous Tomato chlorosis virus (ToCV) is a crinivirus (genus data demonstrate that DnaJ induction contributes to Crinivirus, family Closteroviridae) that causes important the early stages of PepYMV infection. To advance our emerging diseases in tomato and other crops. ToCV is understanding of the role of this protein during PepYMV limited to the phloem, is not transmitted mechanically infection, the complete sequence of two genes encoding and naturally is transmitted in a semipersistent Solanum lycopersicum homologs of DnaJ (SlDj1 and SlDj2)were cloned. Both SlDj1 as SlDj2 proteins have vaporariorum and T. abutilonea. The ToCV genome the conserved J, G/F and C-terminal domains but mannerconsists byof thetwo whiteflies molecules Bemisia of linear, tabaci, positive-sense Trialeurodes subcellular localization of SlDj was analyzed by confocal complex structure. Here we present the construction of themicroscopy zinc finger using domain a SlDj-GFP is present fusion. only In healthy in SlDj1. plants The RNAinfectious encapsidated cDNA clones into of long the ToCV flexuous genome virions (RNA1 with and a the subcellular localization of SlDj1 and SlDj2 is nuclear RNA2) under the control of the CaMV 35S promoter in and cytoplasmatic while in PepYMV-infected plants, 12 days after inoculation, SlDj1 and SlDj2 are localized only leaves with clones of both RNAs resulted in systemic in the cytoplasm. SlDj did not interact directly with any ainfection. binary plasmid.Tomato plants Agroinfiltration also were infected of N. benthamiana by grafting individual viral protein in a two-hybrid assay. It is likely them with agroinfected N. benthamiana plants, showing that in the context of infection these proteins interact the typical symptoms caused by this virus consisting in either with the intermediates of the processing of the chlorotic spots on the lower leaves that extend towards viral polyprotein, or indirectly through a bridge protein. the top of the plant and evolves to interveinal yellowing. Financial support: CNPq, CAPES, FAPEMIG and INCT Furthermore, the viral progeny generated in tomato Planta-praga. was transmitted to new tomato plants by B. tabaci. The infectious clones obtained constitute a genetic system PIV408 - POPULATION GENETIC STRUCTURE OF that will allow to identify the viral genes involved in Tomato leaf deformation virus INFECTING replication, movement in the host plant, transmission TOMATO CROPS IN ECUADOR AND PERU and pathogenicity by reverse genetics. Paz-Carrasco, L., Lima, A.T.M., Castillo-Urquiza, G.P., Ramos-Sobrinho, R., Vivas-Vivas, L., Zerbini, F.M., PIV394 - CHARACTERIZATION OF DNAJ PROTEINS Alfenas-Zerbini, P. REVEALS THEIR ROLE DURING PEPPER YELLOW MOSAIC VIRUS INFECTION IN SUSCEPTIBLE 1. Dep. Fitopatologia/BIOAGRO, Universidade Federal HOSTS de Viçosa, DFP/BIOAGRO/UFV, Avenida Peter Henry Rolfs, s/n. Campus Universitário. 36570-000, Viçosa, MG.

31 Oral Presentation

2. Lab Fitopatología/Estación Experimental del Litoral del Sur, INIAP, Km 26 Vía Durán-Tambo, al Oeste de Guayaquil, Cantón Yaguachi, Guayas, Ecuador specificwas a found GV), Gammabaculovirus a gene in the genome (Hymenopteran-specific of some baculovirus 3. Departamento de Microbiologia, Universidade NPV) and Deltabaculovirus (Dipteran-specific NPV). It ligase (E3) activity, the pe-38 gene. It has been associated Federal de Viços, UFV, Avenida Peter Henry Rolfs, s/n. (BC)to viral that transcription contains a RING-finger and viral DNA domain replication. with ubiquitin- Despite Campus Universitário. 36570-000, Viçosa, MG this importance, the evolutionary history of this gene in The family Geminiviridae is characterized by a particle the BCs family remains unclear. Therefore, the objective morphology of twinned incomplete icosahedra and of this work was to determine the evolutionary events a genome comprised of circular, single-stranded that shaped the current pe-38 gene distribution among BCs. Initially, the BLAST program was used to search for Begomovirus) are responsible for serious agricultural pe-38 orthologous in BC genomes available in GenBank. DNA.threats in Whitefly-transmitted Latin America. We have geminiviruses recently reported (genus the We found that pe-38 orthologous were present only widespread occurrence of a monopartite begomovirus, in the group 1 Alphabaculovirus and in four related Tomato leaf deformation virus (ToLDeV), in Ecuador. Betabaculovirus. Interestingly, the genome of the Here, we determined the genetic structure of ToLDeV Choristoneura occidentallis granulovirus (ChocGV) lacks populations based on the analysis of 67 full-length genome sequences of isolates collected from Ecuador (determined in this study) and 9 additional sequences the pe-38 gene, but presented the flanking upstream of isolates from Peru (previously available from regionmay indicate of its in aother non-homologous GV genomes. Inrecombination this region, we event find Genbank). Subdivision analysis indicated a markedly abetween gene that the has Choristoneura orthologous in occidentallis NPV genome. granulovirus This finding genetic differentiation between isolates collected from (ChocGV) and an ancestral NPV took place and that the both countries (FST: 0.42929). Overall, the Ecuadorian pe-38 gene present in the NPV may have originated in subpopulation showed lower genetic variability than 38 gene was reconstructed by using the PhyML program. Interestingly, while the CP, TrAP and Ren genes from GVs.It was To found confirm that that the hypothesis, diversity between the phylogeny the GV of proteins the pe- thatthe Peruvian from Peru subpopulation (π = 0.00853 wereand 0.05174, about 2.5 respectively). times more was greater than the one found in NPV, indicating that variable than those from the Ecuadorian subpopulation, the proteins of GVs have been diverging for a longer its Rep and markedly the AC4 genes were much more time. Additionally, we also found that pe-38 gene of BCs variable (about 10 and 18 times more variable than those of isolates from Ecuador, respectively). Neutrality makorin, an ubiquitin ligase. Therefore, it is reasonable tests (Fu and Li’s D* and F*) indicated positive selection showedto assume a significant that pe-38 similarity gene of BCs with was a plant acquired gene from called a acting on the AC4 gene of isolates from Peru. However plant genome by an ancestral GV. Financial Support: the evidence was weak, since no positively selected sites CNPq. were detected by the SLAC or PARRIS methods. A single recombination event involving an isolate from Peru as a vv62 - ARBOVIRUSES IN WILD BIRDS IN THE STATE minor parent was detected by RDP in all 63 haplotypes OF SÃO PAULO from Ecuador analyzed in this study. The contrasting Sousa, E., Criado, M.F., Saturno, T.H., Prates, M.C.M., molecular variability levels between isolates of ToLDeV Kawanami, A.E., Oliveira, J.P., Teles, P.H.F., Werther, K., from Peru and Ecuador suggest a more recent foundation Arruda, E. of this latter subpopulation. Financial support: FAPEMIG, 1. Universidade de São Paulo, USP, Av. Bandeirantes, INIAP, CAPES 3900 - Vila Monte Alegre 14049-900, Ribeirão Preto-SP PIV459 - Evolution of pe-38 gene in 2. Universidade Estadual Paulista, UNESP, Via Baculoviridae de Acesso Prof.Paulo Donato Castellane s/n 14884-900 - Fernandes, J.E.A., Ardisson-Araújo, D.M., Melo, F.L., Jaboticabal, SP Ribeiro, B.M. Zoonotic arboviruses of the families Togaviridae and Universidade de BRasília, UnB, Campus Universitário Flaviviridae, are maintained in nature in complex cycles Darcy Ribeiro - Asa Norte - Brasília involving arthropod vectors that feed on animal blood. Emergence and reemergence of such arboviruses are Baculoviridae is a family of dsDNA viruses that infects natural phenomena related to their adaptation and a few orders of insects. They are divided into four evolution. The present study aimed at searching for genomic RNA of the arboviruses Mayaro (MAYV), of nucleopolyhedrovirus), Betabaculovirus (Lepidopteran- the family Togaviridae; and Chikungunya (CHIKV) and genera, Alphabaculovirus (Lepidopteran-specific September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

32 Oral Presentation

West Nile (WNV), of the family Flaviviridae, in wild birds enzyme (Invitrogen®). Differential primers directed necropsied at the Department of Veterinary Pathology, to the spike (S) gene were used in PCR assays for CCoV UNESP, Jaboticabal, SP, Brazil. Fifty two samples of brain, genotyping/subtyping: EL1F/EL1R (3538-3883) to liver, spleen and blood of 52 wild birds were analyzed. amplify CCoV-I whereas S5F/S6R(3486-4179) and Pea-size tissue fragments and blood clots were placed in CEPol-1/TGSP-2 (20168-20537) for CCoV-IIa and CCoV- Trizol (Invitrogen) and stored at -70°C until processed. RNA was extracted by the Trizol manufacturer’s protocol sequencing using BigDye Terminator Cycle chemistry. and reverse transcription was carried out to obtain IIb.Nucleotide The amplicons and amino were acid purified (AA) similarity and subjected with Genbankto direct database was assessed using BLAST tool. By RT-PCR, Step SYBR-Green). MAYV RNA was detected in 10% of single infection was detected in 16 samples: 6 CCoV-I, cDNA,the birds which tested: was 1 amplified crested caracara by Real-Time (Polyborus RT-PCR plancus, (One- 9 CCoV-IIa and 1 CCoV-IIb. Nine samples were positive brain and spleen); 1 roadside hawk (Buteo magnirostris, for more than one genotype/subtype: CCoV-I/IIa (7), spleen); 1 burrowing owl (Speotyto cunicularia, brain); CCoV-I/IIb (1) and CCoV-IIa/IIb (1). Sequence analysis 2 black vulture (Coragyps atratus, one of them in liver, of 22/25 strains revealed that they shared high identity brain, blood and spleen; and another in liver, brain and with other CCoV prototypes. However, nonsynonymous blood). CHIKV RNA was detected in 11% of the tested substitutions were found in these strains that were not birds: 1 crested caracara (Polyborus plancus, brain, described before: two AA changes (residues 1207,1264) liver and blood); 1 roadside hawk (Buteo magnirostris, in CCoV-I, 13 in CCoV-IIa (residues 1174, 1218, 1244, liver, spleen and blood); 1 burrowing owl (Speotyto 1264, 1265, 1282, 1305, 1334, 1336, 1339, 1359, cunicularia, brain, liver and blood); 2 black vultures (Coragyps atratus, one of them in liver and spleen and The CCoV-IIb strains exhibited the insertion of three another in liver); and 1 dove (Columba livia, brain, liver 1363,nucleotides 1370) at and the five 5’end in CCoV-IIbof the S (residuesgene which 5,6,7,8,18). resulted and spleen). WNV RNA was detected in 6% of the tested birds: 1 crested caracara (Polyborus plancus, spleen and 1 strain. These results show that mixed CCoV infections blood); 1 black vulture (Coragyps atratus, blood and inare addition usual in of RioAA atde residue Janeiro five and as furtheralso found studies in UCD- are spleen); and 1 toucan (Ramphastos toco, blood, liver and needed to clarify the importance of these AA changes spleen). These results show that important arboviruses in CCoV evolution. Financial support: FAPERJ, CAPES, with high potential public health impact infect wild birds, CNPq, PROPPI-UFF suggesting that they may play potentially important epidemiological roles as reservoirs of such agents, thus vv224 - EXPERIMENTAL VACCINE TO BOHV-1 creating possibilities for their emergence as causes of AND BOHV-5 FUNCTIONALIZED TO CARBON human infection in the studied region. Financial Support: NANOTUBES ENHANCES THE IMMUNE RESPONSE FAPESP and CNPq. IN MOUSE MODEL Barbosa, A.A.S., Leocádio, V.A.T., Souza, J.G., Laguardia- vv207 - MOLECULAR CHARACTERIZATION OF Nascimento, M., Daian, D.S.O., Da Fonseca, F.G., Barbosa- CANINE CORONAVIRUS STRAINS CIRCULATING Stancioli, E.F. IN PUPPIES WITH ENTERITIS BY PARTIAL “S” GENE SEQUENCING Universidade Federal de Minas Gerais, UFMG, Bottino, F.O., Costa, E.M., Castro, T.X., Cubel Garcia, Avenida Presidente Antônio Carlos, 6627, CEP 31.270-901, R.C.N. Belo Horizonte - MG Universidade Federal Fluminense, UFF, Rua Prof. Bovine herpesviruses 1 and 5 (BoHV-1 and 5) are closely Hernani Melo 101, São Domingos, Niterói, RJ, Brasil related alphaherpesviruses infecting cattle and co- infection is likely to occur. Both viruses are associated Canine coronavirus (CCoV) is an important agent of with neurological, respiratory and reproductive disease, causing great economic losses. Vaccination has been the in two genotypes, CCoV-I and CCoV-II. Recently, CCoV- recommended in control programs, although to date gastroenteritisII genotype was in puppies.divided Toin date,two CCoVssubtypes: are classifiedCCoV-IIa there is no vaccine capable of establishing a protective (classical strains) and IIb (TGEV-like strains). The aim of immune response against both viruses. Recombinant this study was to realize the molecular characterization proteins have been widely used for production of helpful of CCoV strains detected in 25 fecal samples from molecules employed in prevention and treatment of diarrheic puppies in Rio de Janeiro. Genomic RNA was several diseases. Carbon Nanotubes (CNT) has been extracted using the PureLink™ Spin Column-Based Kit broadly studied due to their exceptional properties (Invitrogen®). The reverse transcription was performed such as biocompatibility, high aspect ratio and cell with random primer (Invitrogen®) and Superscript III internalization ability, and CNT functionalized with

33 Oral Presentation antigens have immunogenic potential, as shown in samples were collected at days 0, 2, 5, 8, 10, 20 and 30 p.i. previous studies. In this work, we have used the CNT for PCR and serology tests. The fecal and blood samples technology to build experimental immunogens against were pooled and analyzed per group. No clinical signs BoHV-1 and 5. These molecules functionalized or not or macroscopic lesions were observed. Sera from mice to the CNT, were used in a prime-boost immunization of groups G2 and G3 showed neutralizing antibodies protocol in C57Bl-6 mice, comparing to recombinants titers at days 20 and 30 p.i. Furthermore, viral DNA was alone or added with alum and inactivated commercial detected in some samples at different times of collection. vaccine. Following that, mice TCD4+ and CD8+ Oral swabs positive samples were detected in G3 and G4, in at least one mouse, from days 2 to 10 p.i. Moreover, quantifying the marker CD25. The proteins recognition pooled feces and blood samples were DNA positive, in at lymphocytes activation was analyzed by flow citometry, least one group, at days 6, 8 and 30 p.i. and at 2, 10 and with BoHV-1 and 5 was also accessed. Mice immunized 30 p.i., respectively. It has been shown that mice could be profilewith the by recombinantIgG and IgM fromproteins bovines functionalized naturally infected to the infected after oral inoculation with VACV contaminated milk, as shown by the DNAmia and fecal positive samples. activated CD4+ and CD8+ cells than the other groups. These partial results suggests that VACV contaminated CNTThe recombinantplus the adjuvant proteins alum, were showed recognized a higher by profile the IgG of milk may be able a route of transmission through oral and IgM antibodies from bovines naturally infected with ingestion. Financial support: FAPEMIG, CNPq, CAPES, both viruses, showing that the CNT doesn’t interfere PROGRAD-UFMG and PRPq-UFMG experimental immunogens were successfully recognized vv327 - INFECTION OF FARMED MARINE SHRIMP withby sera the fromrecognition infected profile bovines of the and molecules. showed Sincea better our WITH WHITE SPOT SYNDROME VIRUS IN THE cellular response in mouse model, they could be tested STATE OF SANTA CATARINA, BRAZIL as vaccine prototype against BoHV-1 and 5 infections in Lenoch, R., Espíndola, J.C., Claus, M.P., Barreiros, M.A.B., bovine model in a near future. Alfieri, A.F., Alfieri, A.A. vv270 - Vaccinia virus:transmission 1. Universidade Federal do Paraná, UFPR, R. Pioneiro, through experimentally infected milk in 2153 – Jardim Dallas – Palotina/PR a mouse model 2. Instituto Federal Catarinense, IFC, BR280, Km 27, Rehfeld, I.S., Fraiha, A.L.S., Matos, A.C.D., Souza, I.R., bairro Colégio Agrícola-Araquari-SC Costa, A.G., Furtado, A.M.B., Guedes, M.I.M.C., Lobato, 3. Universidade Estadual de Londrina, UEL, Rodovia Z.I.P. Celso Garcia Cid, Pr 445 Km 380-Londrina-PR Universidade Federal de Minas Gerais - Escola de White spot syndrome is a viral infection responsible for Veterinária, UFMG - EV, Av. Antônio Carlos, 6627, São Luis, considerable economic damage to the global shrimp- cep: 31270-901, Belo Horizonte, MG, Brasil farming industry. Initially, the infection manifests epidemically, with high mortality rates. Later, the infection Bovine vaccinia (BV) is a re-emerging zoonosis caused by remains endemic, interfering with the productivity of Vaccinia virus (VACV) and is involved in several outbreaks the tanks. In Brazil’s southern region, the infection was in dairy cattle and humans throughout Brazil, which is one of the most important milk producers in the world. the production of farmed marine shrimp. This study Previous studies have described the presence of viable firstwas conductedidentified in to 2005 evaluate and thehad presencea significant of whiteimpact spot on viral particles in milk samples of cows experimentally and syndrome virus (WSSV) both in farmed marine shrimp naturally infected with VACV. However, it is not known if (Litopenaeus vannamei) and in natural reservoirs on the the VACV infectious particles presented in infected milk northern Santa Catarina coast. In the period between could be transmissible. Therefore, the aim of this work 2005 and 2008, 440 samples of different L. vannamei was to study the possibility of transmission of VACV by tissues were collected from 12 regularly monitored experimentally infected milk. Fourty female BALB/c mice with 4 weeks of age were divided in four groups: the collected samples were representative of post-larvae G1, G2, G3 e G4. The G1 was the negative control group. shrimparriving farms. at the farm,The samples of animals were with stratified 30, 60, andby age, 90 days and The mice of the other groups were inoculated orally with of cultivation, and of animals at harvest. Additional samples, independent of regular sampling, were acquired from lots with high mortality rates. In addition, 100µLduring ̸ themouse 30 daysof contaminated post-infection milk (d.p.i). containing Feces 107and PFUoral 210 samples of native animals that were present in the ̸ swab mL of samples VACV-GP2. were Clinical collected examination in alternate was days, performed from day reservoirs and harvest channels of the farms, including 0 to day 30 and then submitted to PCR. Blood and sera

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation mangrove and fiddler crabs (Aratus pisoni and Uca XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

34 Oral Presentation thayeri), Atlantic blue crabs (Callinectes sapidus), showing the high diversity of genotypes circulating in identifiedBrazilian pig in theherds PoRVA during strains the period analyzed of 2005 in this to 2013. study zooplankton,by PCR according fish, andto the native methodology shrimp (Penaues described schmitti), by the The P[6]-Gottfried is one of the most common genotype wereWorld included.Organisation Identification for Animal of Health WSSV (OIE). was performedWSSV was detected in pigs, while in this study was only detected the genotype P[6]-M37-like, commonly detected in infection was asymptomatic at one farm (11.1%), and human hosts, in combination with G3, G4, G5, and identifiedeight farms at (88.9%) 9 (75.0%) had ofanimals the 12 presenting farms evaluated. with clinical The G9 genotypes. The commercial vaccine for neonatal signs, with mortality rates ranging from 75 to 100%. Of diarrhea control in piglets is composed by OSU (G5P[7]) the 440 samples of L. vannamei collected, 93 (21.13%) and Gottfried (G4P[6]) PoRVA strains, while in this study were detected genotypes different from vaccine. These werecrab, Atlanticpositive bluefor WSSV. crab, zooplankton,The virus was and also native identified shrimp, in of human rotaviruses is tightly intermingled with the 22suggesting (10.47%) their tissue role samples as natural from reservoirs. mangrove These crab, resultsfiddler findingsevolution strongly of animal suggest rotaviruses. the evidence Financial that evolutionSupport: demonstrate the wide distribution of WSSV in farmed FINEP, CAPES, CNPq, and Fundação Araucária/PR. marine shrimp and in natural reservoirs in the region and during the period studied. VV496 - MOLECULAR DETECTION OF INFLUENZA A VIRUS IN DOGS vv494 - DIVERSITY OF G AND P GENOTYPES Balbo, L.C., Silva, A.P., Bodnar, L., Beutemmüller, E.A., DETECTED IN BRAZILIAN PIG HERDS DURING Facimoto, C.T., Miyabe, F.M., Massi, R.P., Headley, S.A., 2005-2013 Alfieri, A.A. Lorenzetti, E., Campanha, J.E.T., Medeiros, T.N.S., Silva, D.R., Molinari, B.L.D., Rodrigues, W.B., Pereira, F.L., 1. Universidade Estadual de Londrina, UEL, Rodovia Balbo, L.C., Massi, R.P., Alfieri, A.A. Celso Garcia Cid, PR 445 Km 380, Campus Universitário Londrina Universidade Estadual de Londrina, UEL, Rod. Celso 2. Universidade do Norte do Paraná, UNOPAR, Av. Garcia Cid, Pr445 Km380 CEP 86057-970, Londrina-PR Paris, 675 - Jd. Piza.CEP 86041-140 - Cx. P. 401 Londrina - Group A rotavirus (RVA) infection cause neonatal Paraná diarrhea in many animal species worldwide. The genotypes G3, G4, G5, G11, P[6]-Gottfried, and P[7] are family and usually cause respiratory illness in various Influenzaspecies, such A virusesas humans, belong domestic to the Orthomyxoviridaepoultry, pigs, and genotypes, such as G1, G2, G6, G8, G9, G10, G12, G26, horses. The subtype H3N8 is known to cause respiratory commonlyP[1], P[5], P[6]-M37-like, identified in piglets. P[8], P[11], However, P[13], several P[19], unusual P[23], H3N8 has been reported as an emerging respiratory in pigs. This study was developed to identify the G and P diseasepathogen in of equines. dogs in the However, United States an influenza in 2004. AThis subtype novel P[26],genotypes P[27], of 73P[32], wild-type and P[34] PoRVA have strains also beenof Brazilian identified pig herds. All diarrheic stool samples from suckling piglets collected during 2005 to 2013 were submitted to PAGE virus,subtype called H3N8, canine suggesting influenza transmission A virus (CIV), between share horses ≥96% technique and one RVA positive fecal sample in PAGE nucleotideand dogs without sequence reassortment identity to equinewith other influenza strains. A virus This from each pig herd was selected to realize the RT-PCR report investigated the death of three mongrel dogs assay using rotavirus VP7 (G type) and VP4 (P type) consensus primers. The RT-PCR amplicons of the 73 old and was icteric. The other two dogs were about 5 PoRVA strains were sequenced and analyzed using the withmonths nonspecific old and wereclinical taken signs. from One the dog street was seven presenting years BLASTn and RotaC v2.0 software. The sequence analysis hemorrhagic diarrhea. Pathological lesions of the of 73 wild-type PoRVA strains revealed the presence of the following G and P genotype combinations: G4P[6]- M37-like (32.87%), G9P[23] (12.32%), G5P[13] (8.21%), firstalterations dog included of the other hepatitis, two dogs pulmonary included hemorrhage,depletion of G5P[6]-M37-like (8.21%), G9P[7] (8.21%), G3P[6]- andintestinal meningoencephalitis. lymphoid tissue and Significant hemorrhagic pathological enteritis. M37-like (6.84%), G9P[6]-M37-like (4.1%), G5P[7] Fragments of the lungs and kidneys were collected and (2.73%), G3P[13] (2.73%), G9P[23] (2.73%), G4P[7] tested by RT-PCR using the primers M52C and M253R. (1.36%), G11P[23] (1.36%), G1P[7] (1.36%), G3P[23] (1.36%), G4P[13] (1.36%), G5P[X] (1.36%), G3P[X] A virus (244 bp) from all pulmonary tissues evaluated. (1.36%) and GXP[6]-M37-like (1.36%). Common and PCRThese assays data amplifiedsuggest the the circulation partial segment of CIV 7in of the Influenza canine uncommon genotypes of RVA detected in piglets were population of Brazil. Since the history of the three dogs is September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

35 Oral Presentation unknown, the source of infection either by contact with other infected dogs or horses remains obscure.

VV634 - CHICKEN ANEMIA VIRUS AND AVIAN GYROVIRUS 2 DNA AS CONTAMINANTS IN POULTRY VACCINES Varela, A.P.M., Santos, H.F., Cibulski, S.P., Scheffer, C.M., Schmidt, C., Lima, F.E.S., Esteves, P.A., Franco, A.C., Roehe, P.M. 1. Universidade Federal do Rio Grande do Sul, UFRGS, Av. Sarmento Leite 500, sala 208, Porto Alegre, CEP 90050- 170 2. FEPAGRO – Saúde Animal , IPVDF, Estrada do Conde 6000, Eldorado do Sul, CEP 92990-000, Rio Grande do Sul 3. EMBRAPA Suínos e Aves , EMBRAPA, BR 153 Km 110, CEP: 89700-000, Concordia, Santa Catarina In view of the potential role of vaccines as a source of pathogen dissemination, this study was set up in order to detect AGV2 and CAV genomes in vaccines for poultry. vaccines produced by eight different manufacturers Thirtyagainst fivevarious largely avian employed, pathogens, commercially and farming available were evaluated. Total DNA was extracted from 500 µL of each of the vaccines with PureLinkTM Genomic DNA Mini of DNA were used in the assays. A quantitative duplex KitTaqMan® (Life Technologies). real-time PCR Approximately(Wendlant et al.; fifty this nanograms event) was performeda StepOneTM using Real-Time AGV2- PCR and system CAV-specific (Life Technologies). primers and probes.Copies ofAmplification AGV2 genomes and detectionwere detected were performed in 9 of the in vaccines evaluated, in amounts which varied from 93 to 156,187 copies/50ng. Regarding CAV, viral genomes were detected in 10 of the vaccines tested, of which three were in fact CAV vaccines and six vaccines to other pathogens. The three CAV vaccines showed distinct numbers of copies of CAV genome, corresponding to 2,175,381; 54,238 and 2,386 genome copies/50ng. The remaining non-CAV vaccines contained between 7 and 173 copies of CAV genome molecules/50ng. Four of the examined vaccines contained DNA of both CAV and AGV2. These results revealed that both CAV and AGV2 genomes may be detected in poultry vaccines. In addition, although CAV contamination of biological hashighlight been reportedthe need previously,for preventive this ismeasures the first reportto avoid of AGV2contamination DNA as contaminantof vaccines with of vaccines. such viruses. These Financial findings support: CAPES, CNPq, FINEP

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation BASIC VIROLOGY -BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

37 Basic Virology: BV

BV22 - Antiviral Activity Against Influenza, dissemination dynamics of rodent-borne hantaviruses. Herpes And Rubella Virus Observed In The Financial support: FAPESP Hemolymph Of Podalia Sp (Lepidoptera: Megalopygidae) BV44 - Alteration On Protein Expression Of Carvalho, N.D., Figueiredo, C.A., Oliveira, M.I., Silva, P.E., Superoxide Dismutase 1 On Liver Of Balb/C Curti, S.P., Mendonça, R.M.Z., Moraes, R.H.P., Mendonça, Mice After Infection By Caraparu Virus R.Z. (Bunyaviridae) Camini, F.C., Ferreira, P.N., Almeida, L.T., Bernardes, 1. Instituto Oswaldo Cruz - Fundação Oswaldo Cruz, C.S., Silva, M., Pedrosa, M.L., Pinto, C.A., Ferreira, P.C.P., IOC - FIOCRUZ, Av.Brasil, 4365, Manguinhos, Rio de Janeiro Magalhães, J.C., Magalhães, C.L.B. - RJ, Brasil - CEP: 21040-360 2. Faculdade de Medicina de Ribeirão Preto, FMRP- 1. Universidade Federal de Ouro Preto, UFOP, Campus USP, Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto Morro do Cruzeiro, Ouro Preto, MG - SP - 14049-900 2. Universidade Federal de Minas Gerais, UFMG, 3. Faculdade de Ciências Farmacêuticas de Ribeirão Campus Pampulha, Belo Horizonte, MG Preto, FCFRP USP-RP, Av. do Café, s/nº. - Campus 3. Universidade Federal de São João Del Rey, UFSJ, Universitário - Ribeirão Preto - SP - 14040-903 Campus Alto Paraopeba, Ouro Branco, MG 4. Rede de Pesquisa em Virologia do Interior de Minas Hantavirus (Family Bunyaviridae) are mostly associated Gerais, INTRAVÍRUS, Minas Gerais to rodents and transmitted to man by inhalation of aerosolized infected excreta of these animals. The human Oxidative stress occurs when there is an imbalance infection by Hantavirus can lead to severe diseases such between oxidants and antioxidants leading to potential as hemorrhagic fever with renal syndrome (HFRS) in cellular damage. Most cells can tolerate a mild degree Asia and Europe, and pulmonary syndrome (HPS) in the Americas. To determine the origin, spreading and antioxidant enzymes, like superoxide dismutase (SOD). evolutionary dynamics of rodent-borne hantavirus, of oxidative stress, because they have sufficient were collected 190 N gene sequences of rodent-borne “Reactive Oxygen Species” (ROS), which is metabolized Theto hydrogen SOD detoxifies peroxide the (H2O2).superoxide The anion down (O2-), regulation the main of 25 years (1985 to 2010). Recombinant sequences and SOD has been recognized to be an important contributor hantavirusidentify identical identified sequences from 30 were countries not included over the in pastthe to many viral pathogenesis, leading to intense oxidative study. Nucleotide sequences were aligned and the spatio- stress. Caraparu virus (CARV) is a member of group C, temporal and demographic dynamics of dissemination family Bunyaviridae. In countries of South America, of rodent-borne hantavirus was reconstructed using the group C bunyaviruses are among the common agents Bayesian Markov Chain Monte Carlo (MCMC) approach of human febrile illness, and have caused multiple using the BEAST 1.7.4 program. It was estimated that notable outbreaks of human disease in recent decades; the N gene of hantavirus carried by rodents evolved at nevertheless, little is known about the pathogenic a rate of 6.8 x 10-4 (2.5 x 10-4 - 1 x 10-3) nucleotide characteristics of these viruses. The purpose of this substitutions per site per year and that rodent-borne study was to investigate the effect of CARV in protein hantaviruses originated around 2,000 years ago. expression of SOD1 (the most abundant cytoplasmatic However, the rodent-borne hantavirus had a large isoform) on liver of infected mice. Balb/c mice were period of slow growth and about 500 years ago started a infected subcutaneous with 5log10 PFU of CARV and rapid spread worldwide that coincides with the human control animals were inoculated with MEM. Animals traveling between continent. Hantaviruses associated were euthanized 3, 7 and 14 dpi and liver samples were to Murinae and Arvicolinae subfamilies, probably, were collected. CARV was detected in liver of infected mice originated in Asia 500-700 years ago spreading toward and histopathology revealed acute hepatitis. Western Siberia, Europe, Africa and North America. Hantaviruses Blot analysis showed that, on CARV-infected mice there associated to Neotominae subfamily, probably, emerged 500-600 years ago in Central America and spread of SOD1 at days 3 and 7 (~ 20 and 15%, respectively), toward North America. Finally, hantaviruses associated wascompared a significant with control reduction animals. in protein However, expression protein levels to Sigmodontinae occurred in Brazil 400 years ago and of SOD1 in CARV-infected mice on day 14 showed an were, probably, originated from Neotominae-associated increased (~14%) compared to controls mice. Our data virus from northern South America. These data offer indicates that following to CARV, liver mice display a subsidies to understand the time-scale and worldwide lowered abundance of the antioxidant SOD1 and the up regulation appears to be due to later event on disease

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

38 Basic Virology: BV progression. This study can contribute to further increased on liver of CARV-infected mice at 3 and 7 days evaluate the role of oxidative stress and antioxidants pi, with levels returning to those in control mice by day defenses on hepatic pathogenesis of CARV, as well as other Bunyaviridade members. FINANCIAL SUPPORT: against the infection by CARV and expand features FAPEMIG, UFOP, CNPq 14.related Thus, to its elucidating pathogenesis the are inflammatory important because mechanisms this disease is a problem of public health and potential BV45 - Caraparu Virus (Bunyaviridae) emergent. FINANCIAL SUPPORT: FAPEMIG, UFOP, CNPq Infection Increase Gene Expression Of Inducible Nitric Oxide Synthase And BV47 - Production Of Recombinant Dengue Tumor Necrosis Factor-Alpha On Liver Of Virus Nonstructural Protein Ns1 In Pichia Balb/C Mice Pastoris. Almeida, L.T., Ferreira, P.N., Camini, F.C., Bernardes, Divino, F.C.P., De Paula, S.O., Cardoso, S.A., Oliveira, C.S., Silva, M., Pedrosa, M.L., Pinto, C.A., Ferreira, P.C.P., M.D., Monteiro, J.M.C., Honda, E.R., Oliveira, L.L. Magalhães, J.C., Magalhães, C.L.B. 1. Universidade Federal de Viçosa, UFV, Av. P H Rolfs, 1. Universidade Federal de Ouro Preto, UFOP, Campus s/n - Campus Universitário, Viçosa - MG, 36570-000 Morro do Cruzeiro, Ouro Preto, MG 2. Centro de Pesquisas em Medicina Tropical, CEPEM, 2. Universidade Federal de Minas Gerais, UFMG, Porto Velho/ RO, Brazil Campus Pampulha, Belo Horizonte, MG Dengue is a viral disease transmitted to humans mainly 3. Universidade Federal de São João Del Rey, UFSJ, by the Aedes aegypti mosquito. The disease is caused by Campus Alto Paraopeba, Ouro Branco, MG any of four closely related members of the Flaviviridae 4. Rede de Pesquisa em Virologia do Interior de Minas family (DENV-1, DENV-2, DENV-3 and DENV-4). The NS1 Gerais, INTRAVÍRUS, Minas Gerais glycoprotein of 46-50 kDa is found on the cell surface Caraparu virus (CARV) is an arthropod borne virus of and secreted extracellularly. It has been co-localized the family Bunyaviridae, initially isolated in Pará State, with markers of RNA replication in association with Brazil. In humans, CARV causes a disease characterized membrane structures that are likely sites of replication. by dengue-like symptoms. Although there is no literature Mutations at glycosylation sites of the NS1 dramatically report demonstrating that CARV cause hepatic disease affect viral replication in early stages demonstrating a in humans, in experimentally infected mice CARV- decrease in RNA synthesis. Our group has been working infection induces hepatitis; however the pathogenesis of on expression of differents viral proteins in eukaryotic CARV associated with liver injury remains incompletely systems, in this study the gene of dengue-1 NS1 was optimized to increase the levels of proteins expression a key factor in several diseases viral. Its formation in Pichia pastoris yeast. The synthetic genes were cloned defined.is catalyzed The by nitric NO oxidesynthase (NO) (NOS), has beenwhich shown exists to in be 3 into the expression pPICZαA vector and the recombinant isoforms - constitutively expressed neural NOS (nNOS), plasmid obtained was used to transform Pichia pastoris endothelial NOS (eNOS), and inducible NOS (iNOS). KM71 strain. The integration of the vector into genome While the isoforms eNOS and nNOS contributes to the maintenance of normal physiology of cell, iNOS acts as a induction with methanol, the expression of recombinant key molecule in combating viral infections. Additionally, yeastNS1 was was analyzed confirmed by SDS-PAGE,by PCR, using a band specific corresponding primer. After to the expression of iNOS is transcriptionally regulated recombinant protein was observed in the supernatant. Thus, our results show that the strategy adopted provides a good alternative for the production of dengue TNF-α. Several studies using animal models have been byused a numberto study ofthe proinflammatory role of NO in the cytokines, pathogenesis including of antigens, with potential for use in a recombinant dengue vaccine, and diagnostics. Financial support: CAPES, RT-PCR technique, we investigated whether the mRNA CNPq, FAPEMIG inflammatoryexpression of liveriNOS injury.and TNF- Then,α could using be a quantitativealtered on BV50 - Hrsv-Ns1 Inhibitor Discovery hepatic pathogenesis triggered by CARV. Balb/c mice Through Fluorescence Spectroscopy were infected subcutaneous with 5log10 PFU of CARV Titration With Flavonoids and control animals were inoculated with MEM. Animals Gomes, D.E., Cornélio, M.L., Fossey, M.A., Souza, F.P. were euthanized 3, 7 and 14 dpi and liver samples were collected. CARV was detected on liver of infected Universidade Estadual Paulista (IBILCE - S.J. Rio mice and histopathology revealed acute hepatitis. The Preto), UNESP, Rua Cristóvão Colombo, 2265. Jardim mRNA expression of iNOS and TNF-α Nazareth - São José do Rio Preto

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters were significantly - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

39 Basic Virology: BV

Human Respiratory Syncytial Virus (hRSV) is the Haemorrhagic Fever (DHF) in areas where the disease principle cause of acute respiratory infections in was not previously prevalent were observed. In terms children, like bronchiolitis and pneumonia. The hRSV of epidemiological impact, Dengue (DENV) infections a paramyxovirus class has a single strand RNA with 10 represent the most important infectious disease in Brazil. Consequently, the development of a rapid and that contributes to hRSV replication is the immune genessystem which evasion codifies provided 11 proteins.by Non-Structural An important Protein factor 1 (NS1) with 139 amino acids and 15kDa. Such protein efficientinvolving diagnosticchemistry, testengineering, is considered biology a and high medicine priority. plays an important role inhibiting or neutralizing Nanotechnology- with great potential is a field for use of interdisciplinary in methods of detection, research several steps of IFN pathway, as well as, silencing the diagnosis and treatment. The Gold Nanorods (AuNR) ribonucleoproteic complex of hRSV. The aim of this study are of particular interest, especially considering their optical properties and chemistry of the surface, which allows easy connection to organic molecules adapted wasthis toprotein. develop The the expression fluorescence of spectroscopyNS1 was performed titration betweenthrough NS1pJexpress401-NS1 and flavonoids totransformed propose a inhibitor into BL-for a biosensor for rapid diagnosis for DENV through toserological specific analysis needs. The by UV-visible aim of this spectroscopy. work is to In develop order to build this tool, AuNR were previously functionalized 21(DE3)resin), with bacteria imidazole at 0,5mM gradient of IPTG from and 40 its to purification 500mM. A with intermediary reagents to allow interaction with the was achieved by affinity chromatography (nickel envelope protein of DENV serotype 3. This interaction setand ofbefore fluorescence that UV-VIS measurements absorption spectra were performed determined to electron microscopy and atomic force microscopy. After describe the interaction between flavonoids and NS1, waschecking confirmed the functionalization, by UV-visible spectroscopy, monoclonal transmission antibodies were associated to the tool and interaction demonstrated thewhich concentration is an indication of NS1 of andinteraction. flavonoids. Calculations According toof by UV-visible spectroscopy. The functionalized AuNR thebinding result constant a fluorescence (Kb) and quenching number of process sites (n) occurred were determined. The Kb constant in general was about 10- DENV monoclonal antibodies and sera from immunized 5M-1 indicating a strong interaction, and n found to be wereanimals. then This tested biosensor by ELISA, proved confirming to be a their rapid reactivity alternative to one. The results were able to discriminate the driven for screening positive patients, showing high sensitivity force of interaction having the following sequence from the stronger to the weaker: Miricetin> Quercetin> the scale experiments for possible commercialization. Kaempferol-3βD-glucoyranoside> Kaempferol. The andFinancial specificity. support: Further CAPES, tests CNPq are necessary to adapt results showed that NS1 has one binding site for each BV72 - Antiviral Activity Of Siparuna Guianensis Leaves Crude Extracts Against oneand ofthus, the mayflavonoids be considered tested here. as a In potential conclusions inhibitor the data for Bovine Herpesvirus. revealsNS1, which the futures interaction tests betweenon blocking flavonoids its function and on NS1, the Simoni, I.C., Fernandes, M.J.B., Ferreira, T.P.S., Guimarães, immune system subversion is ongoing L.G.L.

BV68 - Development Of A Biosensor For 1. Instituto Biológico, Centro de Pesquisa e Dengue Virus Using Gold Nanorods Desenvolvimento de Sanidade Animal, São Paulo, SP, Brasil Technology 2. Universidade Federal de São João Del Rei, Depto de Versiani, A.F., Caires, A.J., Ladeira, L.O., Da Fonseca, F.G. Ciências Naturais, MG 3. Universidade Federal do Tocantins 1. Universidade Federal de Minas Gerais, UFMG, Av. Antônio Carlos, 6627 - Pampulha 31270-901 - Belo Horizonte, Siparuna guianensis Aublet (Siparunaceae) also called MG, Brazil negramina is a medicinal plant used in folk medicine by 2. Laboratório de Virologia Básica e Aplicada, ICB, South-American Indians as a natural remedy for fevers. LVBA insecticide and vermicide properties. Constituents 3. Laboratório de Nanomateriais, ICEx Thefound negramina in this genus has alsowere presentedalkaloids, anti-inflammatory,steroids, essential Dengue is the most important arboviral disease in oils and a mixture of diglycosyl and monoglycosyl increases in the epidemic activity, expansion of the No information about its antiviral property was found thegeographical world, and distribution, in the last continuous twenty years transmission significant flavonoidsencouraging derivatives us to study of the quercetin in vitro and activity kaempferol. against of several serotypes and emergency of the Dengue bovine herpesvirus. The fresh leaves from wild plants of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

40 Basic Virology: BV

Siparuna guianensis were collected in Gurupi, Tocantins. immunolocalized inside C6/36 cells, inoculated with the The metanolic extracts (CME) from dried leaves were supernatant (liver, lung kidney and cerebellum) of tissue obtained by extraction with methanol for 7 days at room macerates. The corporal temperature in the majority of mice increased after the second day post-infection. phase was collected and concentrated under in vacuum Elevated enzyme levels of alanine aminotransferase and temperature.to dryness using After rotary filtration evaporator. of the Thesolvent, vegetal the material organic aspartate aminotrasferase were observed. In secondary was lyophilized and stored at 4 C for subsequent infections morphological alterations were observed analysis. The antiviral activity bioassays were evaluated in liver, lung and heart. The tissue injuries were more by two methods. First, serially dilutions of CME were severe than those seen in animals with signs of primary added to MDBK cell line and then the cells were infected with 100 TCDI of bovine herpesvirus strain Colorado; DENV-1 RNA were present in C6/36 cells inoculated with or the CME in non-toxic concentration was added to cell infection. DENV-1 particles, specific DENV-1 antigen and and after it was inoculated with logarithmical dilutions of BALB/c mice to infection and reinfection by DENV-1 of virus. Controls without CME and/or virus were made theand animal DENV-2 sera. and These those studies they can confirm be used the as susceptibility a model for and acyclovir was also used. In all bioassays, after testing of drugs and vaccine candidates against DENV. Financial support: Faperj/ CNPq/IOC/Fiocruz stained with 0.4% cristal violet solution for 30 minutes. incubationThe activities at were 37 C calculated for 72 hours as the cells difference were fixed between and BV81 - Antiviral Effect Of Lambda-2t On the treated and control virus titer and expressed by viral Vaccinia Virus Replication inhibition index (VII) or based on 595 nm absorbance Fernandes, M.C., Duarte, M.E.R., Noseda, M.D., Damaso, of cristal Violet staining. CME presented total inhibition C. of virus infection with VII 7.5 in maximum non-toxic 1. Universidade Federal do Rio de Janeiro, UFRJ, Av. concentration at 250 ug/mL and mantained antiviral Pedro Calmon, 550 - Cidade Universitária, Rio de Janeiro - RJ, activity until 20 ug/mL. 21941-901 BV77 - Experimental Murine Model For The 2. Universidade Federal do Paraná, UFPR, R. Quinze Pathogenesis Study Of Dengue Viruses de Novembro, 1299 - Centro, Curitiba - PR, 80060-000 Barreto-Vieira, D.F., Jácome, F.C., Rasinhas, A.C., Silva, M.A.M., Barth, O.M. Vaccinia virus (VACV) is the prototypic member of the genus Orthopoxvirus of the Poxviridae family. Different Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365, VACV strains are used as smallpox vaccine in several Manguinhos, Rio de Janeiro, Brasil countries but adverse effects following vaccination are frequently described. One of these strains is VACV-IOC (Instituto Oswaldo Cruz), which was successfully used in humans and for a virus vaccine developing is the absence the Brazilian vaccination campaign. Nevertheless, there Aof great a suitable difficulty animal to study model dengue which virus presents (DENV) a disease infection with in is no antiviral therapy available to treat infections caused similar aspects of the Dengue haemorrhagic fever and by these viruses. In addition, there are frequent reports Dengue shock syndrome. In the majority of models the of Cantagalo virus (CTGV) infection in dairy cattle and animals are immunocompromised and/or inoculated milkers in Brazil, which is also a strain of vaccinia virus. by routes like the intracerebral, with neuroadapted CTGV was originally isolated from pustular lesions in DENV. Tissues of adult BALB/c mice infected with non- cows in 1999 and is related to VACV-IOC. In search for neuroadapted DENV-1 and DENV-2 serotypes from patient sera were analyzed. The tissue fragments were antiviral effect of Lambda-2T (LT) on the replication of processed following the standard techniques of fotonic efficientdifferent antiviralstrains of drugs, VACV. weLT is present a sulfated the galactan results of from the and transmission electron microscopy. In primary the carrageenan family, extracted from red seaweed infection with DENV-1 and DENV-2 morphogical Gigartina skotsbergii. VACV-IOC (300 PFU) was incubated alterations were observed inside hepatic, lung, kidney with different concentrations of LT during adsorption on BSC-40 cells for 2 hours at 4oC. We observed that LT, at DENV antigen was observed in C6/36 cells inoculated low concentrations (5µg/mL), was able to reduce viral andwith cerebellumthe supernatant tissues. of spleen DENV-1 and particles lung macerates and specific and plaque formation in 80% after 48 hours of infection. with the animal sera. Ultrastructural studies of alveolar When administrated 3 hours after adsorption, inhibition macrophages of animals infected with DENV-2 showed caused by 5µg/mL LT was even greater, nearly 90%. DENV-like particles inside the rough endoplasmic reticulum and Golgi complex, suggesting viral replication. 10µg/mL, but no effect was observed on the formation LTof cometwas also tails, efficient suggesting in reducing that the viral drug titters has no in effect 80% onat SeptemberDENV particles 2013 Volume were 18 – ultrastructurally Supplement 1 - Abstracts/Posters identified, and- Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

41 Basic Virology: BV the production of extracellular virus. However, similar HCV alone or in association with conventional drug experiments with CTGV demonstrated that this strain is treatment. Financial support: FAPESP/ CAPES less sensitive to the effect 10µg/mL when added 3 hours post-infection. Plaque formation was inhibited by 30% BV84 - Effect Of Inactivated Parapoxovis at 48 hours PI. The mechanism by which LT affects the Virus In Cytokine Expression In Mice replication of these viruses, when added 3 hours PI, is Anziliero, D., Spilki, F.R., Flores, E.F., Weiblen, R. 1. Universidade Federal de Santa Maria, UFSM, expression or release. Future experiments will address Avenida Roraima, 1000, Predio 20, sala 4200 stillthis unknownissue in detail. and reflectsFinancial differences support: inCNPq, virus Capes, gene Faperj, INPeTAm, PIBIC-UFRJ. 2. Universidade Feevale Inactivated Parapoxvirus ovis (iPPVO) is an BV83 - Caffeine Inhibts Hcv Replication In immunomodulator with activity on the innate immune Vitro Batista, M.N., Carneiro, B.M., Braga, A.C.S., Rahal, P. mRNA and protein synthesis in response to in vivo iPPVO Universidade Estadual Paulista Julio de Mesquita response.inoculation. Thus Mice study were investigated inoculated intraperitoneallythe profile of cytokine with Filho, IBILCE/UNESP, Rua Cristóvão Colombo, 2265 Bairro: iPPVO (n=4) or with MEM (control, n=4). At intervals after Jardim Nazareth 15054-000 - SJRP inoculation (24, 48, 72, 96hpi), spleen and serum samples were collected for determination of cytokine mRNA Hepatitis C is a liver infection caused by hepatitis C virus expression by qPCR, protein concentration by ELISA (HCV), which infects hepatocytes. Usually the infection and by a bioassay (INF-α/β). Type I interferon antiviral does not generate an adequate host immune response activity could be determined by inhibition of cytopathic causing, in most cases, a chronic condition. Hepatitis effect and plaque reduction assay at 6 and 12hpi, with C has been considered the major worldwide cause of cirrhosis and hepatocellular carcinoma. PEG-INF in in viral plaque formation by EMCV. iPPVO treatment association with ribavirin is the standard treatment. a significant antiviral activity above 90% of reduction However, it shows a low sustained virological response for some genotypes along with severe side-effects and inducedcytokines a IL-1 significantβ, TNF-α increasedand IL-8 could in mRNA be detected expression by a high costs, therefore new treatments are being sought. frompeak in all fold cytokines increase over assayed. the control The proinflammatorygroup of 5.4-fold Caffeine shows promising effects against HCV chronic (24hpi), 3-fold (48hpi) and 10-fold (48hpi), respectively. infection, since it improves liver cellular pathways, Our data support previous studies describing Th1 type response as predominant, represented in this study by includingpatients, and detoxification induces death pathways. of liver cancer Furthermore, cells. Moreover, caffeine the control group. Auto regulatory cytokines (Th2), consumptioncaffeine can interferes delay fibrosis on cell evolution pathways inused HCV to infectedHCV life amainly 15-fold IL-10 increase and IL-4in INF-γ could and be 6-fold detected IL-12 at mRNAend points over cycle. The aim of this work was to test inhibitory effect studied (72 and 96hpi) at peaks of 4.7-fold and 4.9-fold of caffeine on the cell-culture-derived HCV particles (HCVcc) replication in vitro. Hepatocellular carcinoma levels of cytokines, except for IL-8 and IL4 (not assayed) cell lineage (Huh-7.5) were cultured and transfected/ increase,could be detected respectively. in serum Furthermore, samples at protein significant level (pg/ high infected with subgenomic replicon (SGR-JFH1-FEO) or complete genome of HCV genotype 2a (J6/JFH1 RLUC). was similar of that obtained by qPCR for the respective Initially the cells expressing the SGR-JFH1-FEO were ml)mRNAs, by ELISA. especially The forprofile those of of protein highest detection response by as ELISA IL-12 transferred to 96 wells plates and after 24 hours different caffeine concentrations were added: 10mM to 1uM on iPPVO induces a complex cytokine response, strongly 10-fold dilution series. Cells were incubated for 24h, (1035pg/ml)represented by and Th1 INF-γ cytokines (460pg/ml). that are We followed conclude by autothat 48h and 72h followed by MTT cytotoxicity assay. Viral regulatory Th2 cytokines. These effects may contribute RNA expression was evaluated by Luciferase reporter for the increased resistance to certain pathogens assay. Protein expression was evaluated by Western observed in animal treated with iPPVO. CAPES/FAPERGS. blotting using NS3 antibody. We observed in samples treated with caffeine a dose-dependent inhibition effect BV87 - Activity Of Toxins Of Crotalus on subgenomic and full-length replication systems. Durissus Terrificus On Hcv Replication Caffeine inhibited SGR-JFH1-FEO 82%(sd:10%) and Shimizu, J.F., Russo, R.R., Cintra, A.C.O., Sampaio, S.V., HCVcc 76%(sd:12%) on its higher viable concentration. Aquino, V.H., Rahal, P., Jardim, A.C.G. In conclusion, caffeine inhibits HCV replication in vitro 1. Instituto de Biociências, Letras e Ciências Exatas, and it has a potential as a new antiviral therapy against

42 Basic Virology: BV

IBILCE/UNESP, Rua Cristóvão Colombo, 2265, Jardim are more effective when used before the infection. Thus, Nazareth, 15054-000, São José do Rio Preto inhibitors of M2-1 protein would allow the treatment of 2. Faculdade de Ciências Farmacêuticas de Ribeirão infections already in course. Flavonoids are polyphenols Preto, FCFRP/USP, Av. do Café, s/nº. - Campus Universitário widely distributed in the plant kingdom that has been shown to inhibit virus replication in different tests in - Ribeirão Preto - SP - 14040-903 vitro. The objective of this work is to clone, express and Hepatitis C affects thousands of people worldwide. There obtain a model of M2-1 protein to study its interaction is no vaccine for hepatitis C virus (HCV) and the current therapy is not effective for all treated patients, present PCR, cloned in pET-28a(+) vector and transformed in high costs and severe side effects. Many compounds withEscherichia flavonoids. coli BL21 The C43 M2-1 (DE3) gene strain. was The amplified induction by extracted from animal toxins have demonstrated was performed according to Esperante, et al. 2011, and therapeutic potential, some with antiviral activity. In Brazil there is a diversity of venomous serpents, which resin. The initial structure of the protein was generated the potential of its venom’s complexes is unclear. In this the protein was purified with affinity chromatography context, compounds extracted from snake venom can SiteMap program was used to predict binding sites provide an alternative to the development of new antiviral byand I-Tasser the molecularserver and refineddocking with was GROMACS performed program. with therapies. In this work, we evaluated the effect of the GLIDE program through GLIDE XP method. The gene complex crotoxin and its subunits crotapotin and PLA2- 8,69uM of protein/liter, with a 260:280nm ratio of 0,78. on HCV replication. Huh 7.5 cell line stably expressing amplificationThe region between gave a bandresidues of ~603pb Pro32-Ser170 and we presents purified CBsubgenomic extracted replicon from the (SGRluc-FEO) venom of C. were durissus treated terrificus for 48 high potential for small ligands interaction. The docking hours with different concentrations of compounds and replication levels were accessed by Luciferase assays. their rings (or glycosylation) between the domains of Cellular cytotoxicity was mesuared by MTT assay and inoligomerization this region showedand RNA thatinteraction. flavonoids The main accommodate forces of the percentage of cell viability was determined. Those analyses showed that crotoxin and crotapotin at non- hydrogen bond and electrostatic interactions, and non- toxic concentrations showed a weak inhibitory effect interaction of glycosylated flavonoids with the protein are on HCV replication. Alternatively, treatment of cells bond and hydrophobic interaction. Further steps include with PLA2-CB has shown to be the most effective in glycosylated flavonoids interacts mainly by hydrogen inhibiting HCV replication. At concentration with 80% crosslink the theoretical and experimental data to come cell viability the replication levels were reduced to 7.2% thewith study possible of the inhibitors protein ofinteraction M2-1 protein. with flavonoids and of PBS control. Therefore, our data demonstrates that BV95 - The Evaluation Of Trichilia Catigua to inhibit viral replication. However, more studies are Extracts In The Replication Of Herpes theneeded venom to understand of C. durissus how terrificusthese compounds can be promisingact in the Simplex Virus machinery of HCV. Espada, S.F., Faccin-Galhardi, L.C., Lopes, N., Godoi, A.M., Mello, J.C.P., Linhares, R.E.C., Nozawa, C. BV94 - Cloning And Expression Of M2-1 1. Universidade Estadual de Londrina, UEL, Rodovia Protein From Human Respiratory Syncytial Virus (Hrsv) And Structural Prediction By Celso Garcia Cid Pr 445 Km 380 Molecular Modeling. 2. Universidade Estadual de Maringá, UEM, Av. Teixeira, T.S.P., Gomes, D.E., Souza, F.P. Colombo, 5.790 Instituto de Biociências, Letras e Ciências Exatas, Catuaba plant (Trichilia catigua) possesses substances IBILCE/UNESP, Rua Cristóvão Colombo 2265, Jardim with known antioxidant and antimicrobial activities. Nazareth, S. J. do Rio Preto - SP, 15054-000 Empirically, it has been shown to present medicinal The hRSV is one of the main agents of lower respiratory tract infection in children under 2 years old and is benefitsaim of this such study as, was digestive, to evaluate for the physical antiviral and activity mental of responsible for thousands of deaths per year worldwide. fatigue,the crude insomnia, extract andanxiolytic fractions and obtained anti-inflammatory. from T. catigua The The protein M2-1 is a key protein for properly in the replication of the herpes simplex virus type 1 transcription and viral particle assembly. Several studies (HSV-1). HSV infection is worldwide, endemic in urban relate their structure to its function, but there is no areas and has been mostly associated with orolabial description of the interaction between M2-1 protein and inhibitors. The main drugs available on the market individuals. The antiviral activity was determined by manifestations, but can be severe in immunodeficient September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

43 Basic Virology: BV the time-of-addition protocol of the crude extract (CE), (HF698) and HPV negative (C33) cell lines. The cell lines aqueous and ethyl acetate fractions (FAq, FAc), at the were transfected with vector containing the HTRA1 ORF concentrations varying from 1.5µg/ml to 100.0µg/ or empty vector. The mRNA and protein overexpression ml, before (-2h), during (0h) and after (1h and 2h) the viral infection, by plaque reduction assay, in HEp-2 respectively, in both cell lines transfected with HTRA1 cell cultures. The 50% cytotoxic concentration (CC50), wasexpression confirmed vector. by The qPCR cell and lines immunohistochemical, transfected were determined by MTT test, for CE, FAq and FAc was subjected a cell proliferation and viability assays. C33 >400µg/ml for all the compounds. The 50% inhibitory concentrations (IC50) for CE, FAq and FAc were 4.59µg/ and showed reduction viability than cells without HtrA1 ml, 12.5µg/ml and 11.12µg/ml, respectively. The cellsexpression. expressing On the HtrA1 other grew hand, significantly in HPV-positive fewer coloniescell line selectivity index (SI = CC50/IC50) were >87.15 for CE, there was an increase in the number of colonies in cells >32 for FAq and >35.97 for FAc. The percentages of expressing HtrA1 compared to cells lacking HtrA1 and viral inhibition (%VI) were 93.7, 90.8 and 100% for CE, there was no difference between cells expressing or FAq and FAc, respectively, at the highest concentrations lacking HtrA1 in the cell viability assay. These results tested when treatment was performed simultaneously suggest that the different patterns observed in the two (time 0h) with the infection. Regarding prophylactic cell lines studied may be due the HPV presence in HF698 and it absence in C33. Therefore, the HPV proteins could obtained. The results for virucidal test and inhibition of andadsorption therapeutic assay also activity demonstrated no significant that CE, results FAq and were FAc transcriptional silencing by siRNA will result in HtrA1 affected the viral particles and inhibited HSV-1 binding influencesprotein increase. in HTRA1 Furthermore, activity. We additional will analyse studies, if the E6as to cells by the following %VI 42.55% and 100.0% for CE; apoptosis and cell cycle assays, will be performed to 39.53% and 100.0% for FAq and 97.32% and 100.0% for assess HtrA1 function in HF698 and C33 cell lines. FAc, respectively, at the highest concentrations tested. Financial support: FAPESP, CAPES This experiment showed that the crude extract and the fractions of T. catigua demonstrated low toxicity, BV97 - Differences In The Formation Of desirable selectivity and action in the early stages of Actin Tail In Vaccinia Virus And Cotia Virus HSV-1 replication. Infected Bsc-40 Cells Ribeiro, M.D., Afonso, P.P., Schnellrath, L.C., Damaso, C. BV96 - Htra1 Overexpression In High-Risk Hpv-Positive And Hpv Negative Cell Lines. Universidade Federal do Rio de Janeiro, UFRJ, Av Stuqui, B., Termini, L., Sichero, L., Villa, L.L., Rahal, P., Carlos Chagas Filho, 373, Prédio do CCS Bl C - 028 Calmon, M.F. Cotia virus SPAn232 (COTV) is a Brazilian poxvirus 1. Instituto de Biociências, Letras e Ciências Exatas, isolated in 1961 and represents a new genus of the UNESP/IBILCE, R- Cristóvão Colombo, 2265, B- Jardim Poxviridae. We have previously observed that COTV infection induces the formation of shorter actin tails Nazareth, São José do Rio Preto which have different formats when compared to those 2. Instituto do Câncer do Estado de São Paulo, ICESP, induced by vaccinia virus strain WR (VACV-WR; genus Av. Dr. Arnaldo, 251 - Cerqueira César - São Paulo Orthopoxvirus). Actin tails are important to propel 3. Instituto Nacional de Ciência e Tecnologia- Instituto extracellular virus particles away from infected cells. do HPV, INCT-HPV, R- Dr Cesário Mota Júnior, Consolação, Proteins have been described as essential to this process, São Paulo such as N-WASP, WIP, Nck and Grb2, in addition to the kinases of the Abl and Src families that phosphorylate The Human Papillomavirus is the most prevalent virus tyrosine residues (tyr) of the viral protein A36. Our among sexually transmitted infections and it is associated current interest is to study the differences in the with some malignancies. One of the mechanisms used in induction and formation process of actin tails during cell transformation by E6 protein from high-risk HPVs COTV and VACV-WR infections. Initially, we evaluated is the interaction of its carboxy-terminal domain, known the recruitment of some essential proteins to the as PDZ, with PDZs domains presents in some cellular actin tails by infecting cells with VACV-WR (MOI=5) or proteins, triggering them to degradation. A protein that COTV (MOI=10). After 16 h cells were processed for is associated with various pathological conditions and has PDZ domain is the protease HtrA1. This protein is Abl, Src and phospho-Tyr. Our results showed that these poorly expressed in some cancers, suggesting a tumor immunofluorescenceproteins were recruited using to the antibodies tips of VACV-WR-induced against N-WASP, suppressor role. The aim of this study was to evaluate the actin tails, consistent with previous studies. N-WASP and effect of the HTRA1 overexpression in HPV 16 positive p-Tyr, but not Src, seem to be recruited to the tip of COTV

44 Basic Virology: BV actin tails. Src and/or Abl kinase inhibitors, Imatinib Urupá in the presence of SG for 2 h at 4ºC and 48 h post- and Desatinib, reduce poxvirus spread in monolayers, which can be evaluated by comet assays. Cells were inhibition of 87.2% for CTGV and 88.8% for the isolate infected (250 PFU) and after 1 h different concentrations infectionfrom Urupá viral at 0,1µg/ml. plaques wereThese counted.data suggest We that verified there an is of each drug were added and plaques were placed at a a diversity of circulating CTGV isolates in RO that need to be better characterized. stained. Imatinib showed no cytotoxicity until 60 ug/ fixedml after angle 24 hof using 5 degrees neutral for red 72 uptake h when assay, were and fixed reduce and BV102 - Structural Analysis Of A Vaccine comet formation induced by VACV-WR at the non-toxic Platform Based On Ms2 Virus-Like Particles concentration of 30 ug/ml for 72 h. Experiments with Vicente-Santos, A.C., Barroso, S.P.C., Peabody, D., Ferreira, COTV are currently being performed. Desatinib was not D.F., De Mesquita, J.F., Silva, J.L., Oliveira, A.C. toxic until 40 ug/ml after 24 h, but at this concentration Universidade Federal do Rio de Janeiro, UFRJ, Av. Carlos destroyed monolayers after 72 h, and other virus assays Chagas Filho, 373, CCS, bloco E, sala 10, CEP. 21941902 are in progress. Finnancial Support: FAPERJ, CNPq, INPeTAm Virus-like particles (VLPs) can be considered as dense arrays of one or more repetitive subunits of a protein BV99 - Biological Differences Of Clinical and this characteristic confers highly advantageous Specimens Of Cantagalo Virus Isolated properties for their use as vaccines platforms. The During Outbreaks In Rondônia platforms used here are VLPs of the bacteriophage MS2, Rezende, B.C., Damaso, C. an E. coli phage. We evaluated the structural stability of Universidade Federal do Rio de Janeiro, UFRJ, Av. VLPs containing highly immunogenic peptides related Carlos Chagas Filho, 373 - CCS, Cidade Universitária, Rio de to the infectious cycle of HIV-1 by submitting them to high hydrostatic pressure (HHP) and other chemical and Janeiro - RJ physical denaturant agents and evaluating the changes Cantagalo virus (CTGV) was isolated in 1999 from by means of light scattering, small-angle x-ray scattering vesicular lesions in dairy cattle in Rio de Janeiro state and characterized as a strain of vaccinia virus (VACV). The dichroism (CD). We analyzed the morphology of VLPs outbreaks have caused important economical problems (SAXS)by transmission intrinsic andelectron extrinsic microscopy. fluorescence In addition, and circular the in several states, particularly in Rondônia (RO). ST-246 structure prediction of the coat protein with peptide is a potent antiviral drug that affects orthopoxvirus insertions was done by homology modeling approach. spread and release and sulfated galactan (SG) is a The results obtained so far were performed with VLPs polysaccharide extracted from the algae Botryocladia formed by a single chain dimer of the coat protein, occidentalis which is known to inhibit the entry of the native coat protein, two constructions with a Flag virus in cells. In this work, we studied the diversity of epitope and with VLPs containing peptides of the the isolates from RO concerning their sensibility to extracellular loop of CCR5 cell co-receptor and the V3 the above mentioned antiviral drugs. Therefore, BSC- loop of gp120 of HIV-1. The spectral center of mass and 40 cells were infected with CTGV or different clinical light scattering data indicate that there are differences isolates from RO for 48 hours (h) when virus plaque in the structure and stability of VLPs with insertion of diameter was determined. The size of poxvirus plaques the epitopes, except for results using HHP, in which the is directly related to the cell-to-cell spread of the virus construction with inserts showed the largest shift of the center of mass. CD measurements indicate no changes in of CTGV isolate CM-01 (1999) virus plaques is 707.8 secondary structure between dimer and native protein, andµm. mayOn the reflect other genotypic hand, isolates diversity. collected The mean in 2009 diameter from but single chain constructs with Flag epitope had a Jaru, Governador Jorge Teixeira and Espigão D’Oeste in different behavior. SAXS data show that the effect of 3 RO presented the mean diameter of 680.6 µm, 679.8 µm hours of pressurization was not able to promote the and 650.6 µm, respectively. Isolates from Governador VLPs disassembly. Our results demonstrate that the Jorge Teixeira in 2012 presented plaques of 925.0 µm. To VLPs assembled from coat protein containing peptides evaluate the effect of ST-246 on the replication of these insertions behave differently from the ones assembled CTGV isolates, we infected BSC-40 cells with 300 PFU from native coat protein, however they showed structural and after adsorption we added different concentrations stability under most of the conditions used, suggesting of ST-246 for 48 h. Our results showed an inhibition of that these particles are very promising for application 89.8% for CTGV and 92.5% for the isolate from Urupá as a vaccine platform. Financial support: CAPES-FAPERJ- at 0,01 µM. To evaluate the effect of GS in adsorption, CNPq-PRONEX-INBEB we infected cells with 300 PFU of CTGV or isolate from

45 Basic Virology: BV

BV104 - Characterization Of Clones Of The 2. Universidade Federal do Triângulo Mineiro, UFTM, Brazilian Smallpox Vaccine Strain Av. Frei Paulino, 30 Medaglia, M.L.G., Lucas, C.O., Arruda, L.B., Damaso, C. The human Respiratory Syncytial Virus (hRSV) is the Universidade Federal do Rio de Janeiro, UFRJ, Avenida major cause of lower respiratory tract illnesses in Carlos Chagas s/n Ilha do Fundão, Rio de Janeiro children and elderly people worldwide. Its genome encodes 11 proteins including the surface protein F, G Smallpox is a pustular disease exclusive to humans and SH which are responsible for entry and distribution caused by variola virus (Poxviridae, Orthopoxvirus of virus in the host cell. Among the surface protein, little genus). Vaccination with vaccinia virus (VACV) led to its is known about the function of SH protein. Knowing eradication in 1980. Nevertheless, some countries still their structure and function is essential to a better maintain routine vaccination for restricted personnel. understanding of its mechanism. The aim of this study was However, the high rates of post-vaccinal complications modeling and caracterization of the RSV SH protein and demand the development of safer vaccines. The isolation analysis of structural behavior in different environment: water and phopholipid bilayer for understanding and been a current approach. The Brazilian smallpox vaccine evaluating the formation of its pentameric structure. ofwas attenuated produced clones by the from Instituto efficacious Oswaldo vaccine Cruz-RJ strains using has The SH protein model was generated by I-TASSER the VACV strain IOC, and several of its biological features server, and its funcional and structural caracteriscts was analyzed by PredictProtein and PsiPred. Molecular clones of VACV-IOC, clones B141 and B388, for further Dynimics Simulation were performed for analysis of remaincharacterization. unknown. Both Hence, showed we similar plaque viral purified yield two in hidrophobicit of protein central region, studies of the BSC-40 cells, whereas clone B141 progeny was 5.7-fold protein behavior on the membrane and pentamer higher in HEp-2 cells. In addition, both clones showed formation. The results showed that SH protein model comparable levels of extracellular virus titers and size of prediction resulted in a linear model with a helix-alpha actin tails, even though the production of actin tails by between amino acid 20-42 and the anlysis performed by clone B141 was 1.3-fold lower. Mice infected with either PsiPred indicated this region as transmembrane region. Molecular Dynamics Simulation showed that in solution and less severe primary lesions compared to the virulent the protein changes its linear conformations for globular VACV-IOCstrain VACV-WR, clone viawhich tail presented scarification 100-fold produced higher similar viral yield at the primary lesion. In addition, no secondary central domain. The presence of the SH protein itself or lesions were observed in B141 or B388 infected mice. conformationof the pentamer confirming in bilayer resulted the hydrophobicity in a decrease ofof the By this route of immunization, both VACV-IOC clones area per lipid, giving the chains less mobility and greater alignment. The pentamer simulation showed passage antibodies 21 days post-immunization (4,000 and 1:30, of water molecules through the pore in an environment induced similar titers of specific IgG and neutralizing where histidine residues H22 and H51 are protonated, indicating the dependence of this activity with the respectively).cell subsets. MiceMoreover, survived both inducedintranasal priming infection of IFN-γ, with medium pH. Based on this analysis, it was proposed TNF-αdoses as or high IL-2 asproducing 107 PFU T of cells, either as wellVACV-IOC as polyfunctional clones with the structure tertiary and quaternary of the SH protein no weight loss. Virus replication was limited to trachea and lungs, whereas the infection of VACV-WR spread to of the bilayer for understanding its function in viral spleen and liver. Finally, mice immunized with either andinfectivity. analyze its influence on the environment consisting B141 or B388 survived following lethal challenge with VACV-WR and did not present weight loss, clinical signs BV107 - P34 Peptide Inhibits The Entry Of of disease or viral yield in lungs and liver. Equine Arteritis Virus Into Rk13 Cells Fernandes, M.H.V., Silva, D.S., Castro, C.C., Corrêa, R.A., BV105 - Estudo Da Estrutura Da Proteína Motta, A.S., Fischer, G., Vargas, G.D., Lima, M., Hübner, Sh Do Vírus Sincicial Respiratório S.O. Humano: Análise Funcional Da Estrutura Pentamérica Por Ferramentas De 1. Universidade Federal de Pelotas, UFPel, Universidade Bioinformática Federal de Pelotas – UFPel – CP 354 – 96010-900 – Pelotas – Araujo, G.C., Oliveira, R.J., Araujo, A.S., Souza, F.P. RS – Br 1. Universidade Estadual Paulista “Júlio de Mesquita 2. Universidade Federal do Rio Grande do Sul, UFRGS, Filho”, UNESP, Rua Cristóvão Colombo, 2265 UFRGS, Porto Alegre/RS, Brasil

46 Basic Virology: BV

The P34 is a peptide produced by Bacillus sp P34, a against Dengue virus (DENV) and infection prevention and control is based on public politics against virus sp. that lives in the Amazon basin. P34 has antibacterial, vector. In the last decade, the research for new medicines bacteriafungicidal isolated and antiviral from the activity intestine related. of the In fish our Leporinus previous has been through great improvement, especially after the studies, the P34 peptide showed the ability to inhibit introduction of biological models in vitro done in large the equine arteritis virus (EAV), then we intended to scale, which allowed a consistent statistic analysis of the evaluate its mechanism of action against this virus. It results. Previous studies have shown that Celastraceae was searched if the P34 inhibited the EAV infection by family have species with relevant antimicrobial activity. occupying the same receptors used by the EAV to infect Members of this genus are used in folk medicine for gastric diseases, and as antiseptic, anti-asthmatic, anti- were infected with 100 TCID50 of EAV or with 100 RK13 cells. Confluent monolayers of RK13 cell cultures present study, two hexane-ethyl ether (SEH, FSEH), two and incubated at 37 ºC for 1 h. Following incubation, the tumor,ethyl acetate antiviral, extracts and anti-inflammatory(SEAT, FSEAT) and agents.one methanol In the TCID50virus or ofthe EAV mixture mixed werewith theaspirated, peptide cells P34 (2,29were μg/mL)washed extract (SEM), obtained from roots of Maytenus sp, were and fresh E-MEM was added. The peptide P34 was evaluated against DENV-2. Roots were colected at Ouro also added to RK13 cells for 1 h and after this the virus Preto municipality – MG, and the samples had been infectivity was assessed by inoculating 100 TCID50 of obtained by continuous extraction using hexane/ethyl EAV for 1 h at 37 °C onto those cells. After incubation for ether (1:1), ethyl acetate and methanol as solvents, in 72 h the plates were frozen-thawed and viral titers were Soxhlet apparatus. The in vitro cytotoxicity and antiviral measured. The infection of RK13 cells with 100 TCID50 of activity were evaluated by the MTT colorimetrical EAV resulted in a titer of 106,5 TCID50/100µl. RK13 cells method. The results were expressed by the cytotoxicity treated for 1 h with the peptide P34, before the addition concentration of 50% (CC50), effective concentration of 50% (EC50) and values of selective index (SI = CC50/EC50). FSEAT, SEM and SEAT exhibited antiviral ofcompared 100 TCID50 with of the EAV, EAV did control not influence inoculation. virus infectivityHowever, activity with EC50 values of 12,19 ± 1,3mg/ml, 12,43 sincewhen the there peptide was P34 no significantand 100 TCID50 titer of reduction EAV were when both ± 1,1mg/ml, 17,42 ± 2,7mg/ml and SI of 7,21, 8,93 and added to the cells, no infectious virus was detected even 13,22, respectively. The results obtained in this work after 72 h. These results suggest that P34 inhibits the demonstrate that chemical constituents of those samples are promissory as anti-dengue agents. These active binding, penetration or entrance. Besides, the P34 does samples will be submitted to phytochemical studies in entrynot interact of EAV withinto RK13 RK13 cells, cell surfacesapparently and influencing the hindrance viral order to isolate some promising substance responsible of cellular receptors and/or of viral attachment proteins for the antiviral effect. Financial support: CNPq, CAPES, are not involved in its antiviral mechanism. Financial FAPEMIG, Pronex-Dengue, INCT-Dengue support: CNPq and CAPES BV114 - Prospective Study Of Bats As Natural BV113 - In Vitro Anti-Dengue Virus Activity Resevoir Of Flavivirus In Zona Da Mata, Of Extracts Isolated From Roots Of Minas Gerais, Brazil Maytenus Sp Carvalho, C.M., Sacchetto, L., Siqueira, T.R., Souza, R.F., Rodrigues, R.A.L., Rodrigues, V.G., Duarte, L.P., Silva, Nobre, P., Trindade, G.S., Santos, M.B., Drumond, B.P. G.D.F., Filho, S.A.V., Kroon, E.G. 1. Universidade Federal de Juiz de Fora, UFJF, Rua 1. Universidade Federal de Minas Gerais, ICB, ICB/ José Lourenço Kelmer, s/n - Campus Universitário Bairro São UFMG, Av. Presidente Antônio Carlos, 6627, Pampulha, Belo Pedro Horizonte, MG, Brasil 2. Universidade Federal de Minas Gerais- Minas Gerais, 2. Universidade Federal de Minas Gerais, ICEx, DQ, UFMG, Av. Antônio Carlos, 6627 - Pampulha DQ/UFMG, Av. Presidente Antônio Carlos, 6627, Pampulha, 3. Grupo de Pesquisa em Ecologia de Vírus - Minas Belo Horizonte, MG, Brasil Gerais/Brazil, ECOVIR 3. Universidade Federal de Ouro Preto, UFOP, DEFAR/ 4. Rede de Pesquisa em Virologia do Interior de Minas UFOP, Ouro Preto, MG Gerais, INTRAVIRUS Dengue is considered the most important arboviral Bats (Chiroptera) are very abundant, diverse, and disease of humans and it is estimated that 100 million geographically dispersed vertebrates, They have been dengue cases occur every year around the world. increasingly recognized as reservoir hosts for zoonotic viruses. More than 66 viruses have been detected or

SeptemberHowever, 2013there Volume is no therapeutic18 – Supplement agent 1 - Abstracts/Posters or specific vaccine - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

47 Basic Virology: BV isolated from naturally infected bats, as Rabies virus, aim to study the interaction between DENV and YFV with megakaryocyte precursors. We infected MEG-01 and Flavivirus, including Chikungunya virus, Japanese cells (Human Megakaryoblastic cell line) with DENV- Hantavirus,encephalitis Influenza,virus, West Coronavirus, Nile virus SARS(WNV), coronavirus St Louis 2 and YFV 17 DD in a multiplicity of infection of 1. We encephalitis virus (SLEV) and Dengue virus (DENV). Members of the genus Flavivirus, cited above and Yellow YFV proteins since 24h post infection (p.i.) by confocal fever virus (YFV) are important human pathogens. At confirmedmicroscopy. YFVWe analyzed infection the by production detecting of intracellular infectious particles by plaque assay and observed increasing cause disease in human. Minas Gerais is characterized by production until 96h p.i. and followed by decrease. We leastoccurrence eleven of flaviviruses great epidemics occur inof Brazildengue and and nine also of yellow them analyzed cell viability by extracellular activity of LDH fever outbreaks have been reported in this state. Besides and trypan blue exclusion. We observed higher LDH the importance of bats, there are very few studies activity from 96h p.i. with YFV but not with DENV-2. A regarding their role as reservoir of zoonotic viruses, decrease of cell number was evident after 72h p.i., but excepting rabies, in Brazil and Minas Gerais. Therefore, we only observed an increase of cell mortality from the aim of this study was to investigate bats as natural 120h p.i. for both viruses. We observed mitochondrial physiology changes during DENV and YFV infection by MG). Tissue samples (heart, lungs, kidney, intestine, measuring oxygen consumption. We also did not observe hostsliver and of flaviviruses spleen) were in Zonaobtained da Mata, from Minas 17 bats Gerais collected (ZM- in the Mata do Krambeck and Serra do Papagaio (ZM- observing reduction on infected 4N cell population MG) and preserved in RNAlater (QiagenTM). Twenty- changes144h p.i. on compared the cell differentiation to control. Our profile data untilsuggest 96h thatp.i., YFV can infect and replicate in MEG-01 cells. Our data and used for RNA extraction. Each sample was tested also suggest that DENV-2 and YFV infections inhibit cell fiveby reverse mg of transcription liver and spleen followed were by pooled, polymerase macerated chain growth until 72h and induce cell death from 120h p.i., reaction (RT-PCR) in order to detect SLEV, YFV, WNV and with mitochondrial alterations without changing the DENV 1 to 4. Although none of the samples presented kinetics of cell differentiation until 96h p.i., reducing the the expected amplicons for each of the viruses tested, 4N cell population 144h p.i. further analyses will be carried on to test the presence BV124 - The Involvement Of Virulence Factors In Autophagy During Poxvirus ofas viruseshosts for in zoonotic other organs viruses including in this region flaviviruses that may and Infection coronaviruses.contribute to the This knowledge is the first of prospective ecological and study biological of bats Schnellrath, L.C., Attias, M., Damaso, C. aspects of zoonotic viruses in this region. Financial Universidade Federal do Rio de Janeiro, UFRJ, Av Support: FAPEMIG, CNPq, CAPES, UFJF, PROPESQ/UFJF Carlos Chagas Filho, 373, Prédio do CCS, Bloco C/ sala C-028 BV118 - Interaction Of Yellow Fever Virus Poxviruses, which the family prototype is vaccinia virus And Dengue Virus With Megakaryoblasts (VACV), encode a wide variety of virulence factors that are Campos, S.P.C., Castro, M.G., Sanches, D., Rodrigues, related to their host range spectrum and pathogenicity. M.F., Paredes, B.D., Silva, J.S., Gomes, A.M.O., Oliveira, Among these factors, a great part is involved in the A.C. antiviral response triggered by interferons (IFNs). This Universidade Federal do Rio de Janeiro, UFRJ, Av. signaling pathway leads to an increased expression of Carlos Chagas Filho, 373, CCS, Cidade Universitária - 21941- the double stranded RNA-dependent protein kinase (PKR), inhibiting protein synthesis in infected cells 902 - RJ through phosphorylation of eukaryotic initiation factor Dengue Virus (DENV) and Yellow Fever Virus (YFV) have 2 (eIF2). Correlation between induction of autophagy great importance in economy and public health in Africa, and activation of PKR has been reported. VACV expresses South America and Asia. They are the etiologic agents of proteins that prevent dsRNA-PKR interactions. acute hemorrhagic fevers that are related to hemostasis Therefore, this study sought to investigate if the absence dysfunction, with coagulation factors consumption and of these proteins could lead to the induction of autophagy thrombocytopenia. The low platelet count is related to during infection. In cells which the action of IFN-related the evolution of the disease severity. Platelets play a pathways was not counteracted by VACV, infection led to crucial role in hemostasis and are cytoplasmic fragments phosphorylation of both PKR and eIF2. Protein synthesis of megakaryocytes. Each megakaryocyte produces from shut-off was also observed by metabolic labeling. We 5.000 to 10.000 platelets. To better clarify the processes observed a non-productive infection with approximately in which viral infection leads to thrombocytopenia, we

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology:3-log inhibition BV of virus yield. By immunofluorescence XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

48 Basic Virology: BV assays we detected a punctate pattern of LC3 after 8 tested and 27 showed antiviral activity against DENV- hours post-infection. The evident colocalization of LC3 2. Fourteen extracts showed a SI lower than four, six and LAMP was assessed by confocal microscopy. We extracts showed a SI between 4 and 10, and seven extracts also observed the formation of autophagossomes in showed a SI higher as 10. All 27 extracts which showed the cytoplasm using transmission microscope. 3MA, antiviral activity were tested in the virucidal assay and only one was not virucide. In conclusion, about 15% of the process, since its presence blocked the number of the extracts tested showed an antiviral activity against ancells inhibitor with punctate of autophagy, pattern of confirmed LC3 in nearly the existence95% during of DENV-2, as shown by their CC50 and CE50, and 96% had infection. Otherwise, the addition of 3-MA was not able a virucide activity. to recover the virus replication. In other cell types such BV127 - Diferencial Induction Of 2’5’oas Gene Family By Dengue Virus 2 (Denv-2) Infection aswas human unable cancer to induce cell lineautophagy. and mouse The fibroblastpattern of cells,LC3 In Human Cells althoughwas indistinguishable replication was from deficient non-infected in both, cells infection by Silva, L.K.S., Almeida, G.M.F., Oliveira, D.B., Botelho, L.M., Ferreira, P.C.P., Kroon, E.G. Universidade Federal de Minas Gerais, UFMG, this process in some cell lines. Financial Support: CNPq, immunofluorescence. Nevertheless, the restriction in Universidade Federal de Minas Gerais, Av. Antônio Carlos virusFAPERJ, replication CAPES, INCT-IMPeTAm. is not sufficient for the induction of 6627, Pampulha, Belo Ho BV125 - Screening For Antiviral Activity The 2’5’OAS gene family comprises four different genes Of Extracts From Yeast, Filamentous named OAS1, OAS2, OAS3 and OASL, found on human Endophytic Fungi And Plants Of Various chromosome 12, that can produce up to ten different Brazilian Ecosystems Against Dengue variants by alternative splicing. These genes were always Virus (Denv-2) associated to induction by IFNs and to antiviral activity, Silva, L.K.S., Silva-Fernandes, A.T., Almeida, G.M.F., but even though 2’5’OAS genes are regulated directly Rodrigues, R.A.L., Marinho, P.E.S., Ruiz, A.C.G., Johann, by IFN treatment, some of them can also be induced S., Vieira, M.L.A., Rosa, L.H., Rosa, C., Kroon. E.G. by IFN independent stimuli. It has already been shown Universidade Federal de Minas Gerais, UFMG, Av. that some 2’5’OAS genes are induced directly by viral Antônio Carlos, 6627, Campus Pampulha, CEP: 31270-901. infections and dsRNA in cells lacking a proper type I and Belo Horizonte, Minas III IFN response, characterizing these isoforms as viral stress-inducible genes (VSIG) in addition to interferon stimulated genes (ISGs). 2’5’OAS genes have also been to 100 million cases per year and approximately 3.5 implicated in a proper host innate response against Denguebillion of ispeople a significant at infection public risk. health Over the threat, past 30 with years 50 Dengue viruses. To determine how these genes are infection rates have dramatically increased, in part upregulated by Dengue virus (DENV) infections, A549 due to urbanization. Dengue virus (DENV) infections, cells were infected with DENV-2 or Vesicular stomatitis transmitted by Aedes mosquitoes, can be caused by virus (VSV) as a control at a MOI of 1, or treated with any of the four DENV serotypes (DENV1-4). There is inactivated viruses, and total RNA was extracted 24 no vaccine or effective antiviral treatment available for hours later. Reverse transcription reactions were made DENV, and mosquitoes control measures have largely and the resulting cDNA was used for 2’5’OAS genes and failed to curb dengue incidence in most parts of the IFN expression evaluation. As expected, VSV infections world. Therefore, novel approaches for protection are resulted in the induction of all four 2’5’OAS genes in required, and it is very important to develop antiviral these cells. However, DENV-2 infections resulted in drugs against this virus. The aim of this study was to the upregulation of OASL and OAS2 genes, but not of discover new antiviral compounds from extracts of yeast, OAS1 and OAS3. Inactivated viruses did not induced

Brazilian ecosystems. Cytotoxicity and antiviral activity infections resulted in the induction of type I IFNs which filamentousassays were conducted endophytic in fungiLLCMK-2 and cell plants lines of using different MTT significativecould only be levels partially of thesecorrelated genes, to the and 2’5’OAS both viruses genes assay. Virucidal assays were also conducted in LLCMK-2 upregulation detected. The fact that DENV-2 infections cell lines using crystal violet coloration assay. The results induces only small levels of OASL and OAS2 genes, while were expressed by the 50% cytotoxic concentration VSV infections induces all 2’5’OAS genes at the same (CC50), 50% effective concentration (EC50), values time, can be seen as evidence for the presence of innate of selective index (SI = CC50/EC50) and 50% virucide immune evasion mechanisms in DENV-2 infected cells. concentration (VC50). Altogether 176 extracts were Further studies are necessary to fully comprehending

49 Basic Virology: BV the relationship between DENV and the 2’5’OAS system BV134 - Yellow Fever Virus-Induced of their hosts. Mitochondrial Dysfunction: Changes In Mitochondrial Energetic Metabolism And BV130 - Determination Of The Cytokine Apoptosis Induction Levels In The Supernatants Of Spleen Sanches, D., Campos, S.P.C., Rocha, C.M., Freire, M.S., Cell Cultures Of Mice Immunized With Silva, J.L., Gomes, A.M.O., Oliveira, A.C. Tetravalent Synthetic Peptides Derived From Dengue Virus Envelope Domain I And 1. Universidade Federal do Rio de Janeiro, UFRJ, Av Ii Carlos Chagas Filho, 373, CCS, Cid Universitária, Rio de Almeida, L.G.N., Fumagalli, M.J., Rodrigues, N.F., Janeiro Livonesi, M.C., Costa, L.C.F., Santos, M.C.S.G., Malaquias, 2. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, L.C.C., Coelho, L.F.L., Rocha, R.P. 4365 - Manguinhos, Rio de Janeiro 1. Universidade Federal de Alfenas, Unifal, Laboratório Flaviviruses cause diseases like Dengue and Yellow de Vacinas, Departamento de Microbiologia e Imunologia fever. These viruses are transmitted by mosquitoes 2. Universidade Federal de Alfenas, Unifal, Dep. de mainly in South America, Central America and Asiatic Análises Clínicas e Toxicológicas, Faculdade de Ciências southeast, where they have a particular importance for Farmacêuticas public health. Virus-induced apoptosis is related to a cytopathological consequence of an infection in vivo or Dengue is a major public health problem worldwide, in vitro. During apoptosis, mitochondrial pathway has especially in the tropical and subtropical regions of been described as a crucial step during viruses-induced the world. Infection with a single Dengue virus (DENV) apoptosis. Once the mitochondrial pathway is activated, serotype causes a mild, self-limiting febrile illness called dengue fever. However, a subset of patients experiencing and caspases can be activated, culminating in apoptotic secondary infection with a different serotype progresses lossprocess. of mitochondrial Here, we investigate membrane the potential role of mitochondrial (Δ�m) occurs to the severe forms of the disease, dengue hemorrhagic cell death pathway during Yellow Fever Virus (YFV) fever/dengue shock syndrome. These forms are infection and its consequence to mitochondrial characterized by spontaneous bleeding and plasma energetic metabolism. We infected Vero cells with YFV leakage after an excessive immune activation of T cells using a MOI=1. We analyzed the cell viability using and macrophages. In this study, we immunized mice Live/Dead and LDH assay. Apoptosis was analyzed by with three tetravalent and conserved synthetic peptides PhosphatidylSerine (PS) exposure and TUNEL, while named Pep01, Pep02 and Pep03. Positive and negative controls were mice infected with 4 x 104 plaque forming units of DENV-1 and PBS treated animals, respectively. themitochondrial role of mitochondrial pathway was pathway investigated was followed by Bongkrekic by Δ�m Spleen cells from immunized animals, positive and throughacid, an adenine fluorescence nucleotide microscopy. translocator The (ANT) importance inhibitor. of negative controls were obtained and infected with 0,01 The mitochondrial energetic metabolism was studied MOI of each serotype in separate or mock-infected with by oxygraphy. Apoptosis was observed after 72 hours supernatant derived from C6/36 non-infected cells. After post infection (h.p.i.) through TUNEL and PS exposure. 72 hours, the supernatants were harvest and used for The dependence of caspases activation during the cytokine determinations. Levels of IL-5, IL-10, TNF-alpha apoptosis process was also observed, using z-Vad-fmk, and IFN-gamma were determined by standard sandwich ELISA. Spleen cells derived from mice immunized with 72 h.p.i. demonstrating that the apoptotic mitochondrial the synthetic peptides showed a high expression of IL-10 apathway pancaspase is being inhibitor. activated We and also apoptosis observed is loss dependent of Δ�m of ANT activity. Oxygraphy results show a slighter

(p<0.01)if compared and to a positive lower expression control. The of cytokine TNF-alpha IL-5 and was IFN- not of oligomycin-sensitive oxygen consumption at 48 gammadetected (p<0.001) in any group after analyzed. infection These with all peptides DENV serotypes are good increaseh.p.i., that of indicateroutine respiration,an increase but in oxygena significant consumption increase candidates to dengue vaccine because they are able to rate coupled to ATP synthesis. Our results suggest that the mitochondrial pathway is activated, contributing and IFN-gamma) involved in dengue hemorrhagic fever partially for the caspase-dependent cell death process reducedevelopment. levels of Furthers pro-inflammatory studies will cytokines be conducted (TNF-alpha to best induced by YFV. Our data also suggest changes on analyze the T cell activity induced by these peptides. mitochondrial energetic metabolism associated to virus Financial support: FAPEMIG; CNPq. infection. Support: CNPq, CAPES, FAPERJ, INBEBB, PRONEX

50 Basic Virology: BV

BV137 - Nanoparticles With Entrapped model uses spleen cells derived from immunocompetent Inactivated Dengue Virus Are Able To mouse infected with a low viral dose of non-adapted Stimulate Antibody Production In Mice DENV-1 strain via the subcutaneous route. The spleen Fumagalli, M.J., Almeida, L.G.N., Gomes, A.B.V.T., cell culture from DENV-1 infected mice infection showed Martins, R.S., Malaquias, L.C.C., Coelho, L.F.L., Rodrigues, N.F. a10 significant after infection expression with all ofserotypes the IFN in gama vitro. and Thus, TNF-α this Universidade Federal de Alfenas, UNIFAL, Laboratório (p<0.001)model could and be a usefulnot detectable to study amountmechanism of IL-5 of dengueand IL- de Vacinas, Departamento de Microbiologia e Imunologia virus infection, pathogenesis as well as to evaluate Dengue is a major public health problem worldwide, candidate vaccines. Financial support: FAPEMIG; CNPq. especially in the tropical and subtropical regions of BV159 - Evaluation Of Antiviral Activity the world. Infection with a single Dengue virus (DENV) Against Dengue-2 Virus Of Hs-1 Peptide serotype causes a mild, self-limiting febrile illness called From Hypsiboas Semilineatus dengue fever. However, a subset of patients experiencing Monteiro, J.M.C., Safar, N.V.H., Oliveira, M.D., Cardoso, secondary infection with a different serotype progresses S.A., Oliveira, L.L., De Paula, S.O. to the severe form of the disease, dengue hemorrhagic fever/dengue shock syndrome. Currently, there are Universidade Federal de Viçosa, UFV, Avenida PH no licensed vaccines or antiviral drugs to prevent or Rolfs, s/n, Campus Universitário treat dengue infections. Polymeric nanoparticles with adsorbed or entrapped antigens represent a novel Dengue virus is an arbovirus of the family Flaviviridae, method for controlling the release of immunogens and to which has been the most prevalent arthropod-borne optimizing the immune response via selective targeting viral diseases among the world population. There are of the antigen presenting cells. In this study we used four serologic types of dengue virus (DENV 1-4), which a murine model to evaluate the IgG production after cause long lasting immune responses, but different ones. administration of bovine serum albumin with entrapped Several studies reveal that some peptides from skin of inactivated DENV serotypes. This formulation induced amphibians have antimicrobial and antiviral activities. As such, sequences of these peptides were synthesized the immunized mice as demonstrated by indirect ELISA. and tested in vitro in order to obtain biologically active aFurther production investigation of anti-DENV will IgGbe necessaryantibodies to(p determine< 0.01) in compounds to develop drugs with wide spectrum and if these antibodies have neutralizing activity against multiple applicability. Effective drugs against dengue the four DENV serotypes. Financial support: FAPEMIG; virus haven’t been developed yet. As such, the present CNPq. study aimed to evaluate the antiviral activity against dengue-2 virus of the synthetic peptide, called HS-1, BV140 - An Ex Vivo Cellular Model For The which sequence was previously obtained from the skin Study Of T Cell Cross-Reactivity After A of the anuran Hypsiboas semilineatus. In the citotoxicity Secondary Infection By Dengue Virus assay, a twofold serial dilution of the peptide, started Rocha, P.R., Livonesi, M.C., Costa, L.C.F., Santos, M.C.S.G., at 1mg/mL, were tested on monolayers of VERO cells, Rodrigues, N.F., Malaquias, L.C.C., Coelho, L.F.L. and after that, neutralization assays were performed to investigate the mechanism of action of the HS-1 Universidade Federal de Alfenas, UNIFAL, Rua Gabriel Monteiro da Silva, 700. Centro - Alfenas/MG. to determine whether the HS-1 peptide could confer Dengue is a major public health problem worldwide, peptide.protection The to firstcell neutralizationreceptors against assay viral was infection, carried outfor especially in the tropical and subtropical regions of this, the peptide was pre-incubated with VERO cells. In the world. Infection with a single Dengue virus (DENV) the second neutralization assay the peptide was pre- serotype causes a mild, self-limiting febrile illness called incubated with Dengue-2 virus to evaluate the ability of dengue fever. However, a subset of patients experiencing this peptide to act directly on viral particle. To evaluate secondary infection with a different serotype progresses the capacity of the HS-1 peptide to inhibit the virus to the severe forms of the disease, dengue hemorrhagic adsorption, a third neutralization assay was performed, fever/dengue shock syndrome. These forms are in this assay the viruses were incubated with the cells characterized by spontaneous bleeding and plasma at 4°C, at this temperature the virus adsorbed on the leakage after an excessive immune activation of T cells cells surface but doesn’t internalize. The results suggest and macrophages. In this study we proposed an ex vivo that the HS-1 peptide acts both in the viral particle cellular model to evaluate the T cell cross-reactivity after (disrupting the particle or preventing the adsorption) a secondary infection with all serotypes of DENV. This and in the protection of cell receptors. In subsequent September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

51 Basic Virology: BV studies HS-1 peptide will be tested with other serotypes Derived Peptides Involved In The Virus of dengue virus. Nucleocapsid Assembly In Vitro Braga, V.L.A., Mendes-Silva, A., Albernaz, F.P., Bianconi, BV167 - Identification Of Transcription M.L., Peabody, D.S., Silva, J.L., Gomes, A.M.O., Souza, Factors Involved In Il-6 Expression Induced T.L.F., Oliveira, A.C. By The Non Structural Protein 1 Of Dengue Virus In Hepg2 Cells 1. Universidade Federal do Rio de Janeiro, UFRJ, Av Freitas, B.F., Silveira, P.F., Ribeiro, E.M.C., Pimenta, P.F.P., Carlos Chagas Filho, 373, CCS, Bl E, sl 08, Cid Universitária, Bonjardim, C.A., Silva, B.M. RJ, RJ 1. Universidade Federal de Ouro Preto, UFOP, Campus 2. Universidade do Novo México, UNM, Albuquerque, Morro do Cruzeiro, Ouro Preto, Minas Gerais NM 87131 2. Universidade Federal de Minas Gerais, UFMG, Av. In the order of 170 million people are infected worldwide Antônio Carlos, 6627, Belo Horizonte, Minas Gerais with the Hepatitis C Virus (HCV), which represents a 3. Fundação Oswaldo Cruz, FIOCRUZ, Augusto de public health problem. The HCV core protein (HCVCP) Lima, 1715, Belo Horizonte, Minas Gerais is involved in viral and cellular processes and is 4. Rede de pesquisa em virologia do interior do estado responsible for the interaction with the viral RNA and capsid assembly. Three regions of the core protein are de minas, INTRAVIRUS, Minas Gerais Dengue virus nonstructural protein 1 (NS1) is a the amino acids 22-39 (VKFPGGGQIVGGVYLLPR), glycoprotein involved with viral RNA replication specifically50-67 (RKTSERSQPRGRRQPIPK), important during nucleocapsid and assembly:85-102 that seems to play several important roles in dengue (PWPLYGNEGMGWAGWLLSPRG). To better understand pathogenesis. The NS1 association with host cellular the structural and physicochemical aspects of their proteins have been reported and suggesting an interactions with the RNA and viral envelope during involvement of NS1 in signal transduction events and HCV assembly we used membrane models (micelles and in modulation of expression of some cellular genes that could facilitate virus replication or contribute to used so far were sodium dodecyl sulfate, n-octyl-beta- pathogenesis. However, very little is known on this issue, vesicles),D-glucopyranoside, and non specificHexadecyltrimethylammonium nucleic acids. The micelles especially regarding NS1 involvement in regulation of bromide and n-dodecylphosphocholine, and the vesicles some important signal transduction pathways elicited were composed by sphingomyelin, phosphocholine and cholesterol. The nucleic acids used were poly (GC) and study the effects of NS1 expression on these pathways p53 consensus, and we followed the interaction process bywe cloned dengue a infection,DENV1 NS1 such coding as NF-κBsequence and in MAPK.a pCDNA3 To plasmid that was used to generate stable NS1-expressing isothermal titration calorimetry. In the presence of cells. We observed, upon FBS treatment, that the NS1 bydifferent fluorescence micelles, spectroscopy, only the peptide circular 85-102 dichroism was able and expression increases the nuclear translocation of NF- complex formation. Luciferase assays allowed us to toand adopt acrylamide a alpha-helix quenching structure reveal as that verified the interactionby circular κB p65 protein, which was paralleled by a DNA-Protein dichroism.between peptide Analyses 85-102 of tryptophan and micelles intrinsic involves fluorescence a partial the NS1-expressing cells when compared to parental internalization of the tryptophan residue. Calorimetric showcells. Wean alsoincrease observed, in NF-κB by ELISA transcriptional and qPCR, alterationactivities inof IL-6 expression in NS1-expressing cells. To identify the interactions of micelles and the different peptides and mechanism of modulation of IL-6 expression in these measurementsshowed similar revealthermodynamics different heat of profilesthe interaction for the cells we performed luciferase assays to identify the of peptide 50-67 with different DNAs. Fluorescence responsive elements of IL-6 promoter region that could polarization data showed that, in the range of have an altered function in these cells. Our preliminary concentrations used, the presence of the peptides does results suggest that the AP1 transcription factor seems not prevent the formation of nucleocapsid-like particles to be the principal element involved in IL-6 expression in (NLPs) by the interaction between core protein and nucleic acids. Our data reveal new information that may to the understanding of NS1 biological roles in dengue assist the understanding of HCVCP regions involved in thispathogenesis. model. Taken Supported together, by: these UFOP, findings FAPEMIG, may contributeCNPq and the HCV assembly, which is a central target for drugs for CAPES. the Hepatitis C treatment.

BV170 - Structural And Physicochemical Analysis Of Hepatitis C Virus Core- September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

52 Basic Virology: BV

BV171 - Cellular Localization Analysis Of Biologia, UFRJ, IB, Av. Carlos Chagas Filho, 373, bloco A, sala The Hepatitis C Virus Core Protein During A1-050, Ilha do Fundão, RJ, 21941902 Nucleocapsid-Like Particles Assembly 5. Universidade Federal do Rio de Janeiro, Depto Braga, V.L.A., Mendes-Silva, A., Carvalho, C.A.M., Silva, Clínica Médica, UFRJ, Rua Rodolpho Paulo Rocco, 255, Ilha J.L., Gomes, A.M.O., Souza, T.L.F., Oliveira, A.C. do Fundão, HUCFF, RJ, 21941913 Universidade Federal do Rio de Janeiro, UFRJ, Av INTRODUCTION: Hepatitis C is a health problem in Brazil Carlos Chagas Filho, 373, CCS, Bl E, sl 08, Cid Universitária, with 3 million people infected. Only 50% of the treated RJ, RJ patients, with the conventional therapy (pegylated Hepatitis C virus (HCV) infection is a major cause of interferon and ribavirin, PEG-IFN/RBV), achieve success. chronic liver disease worldwide, infecting around 3% Nowadays, other therapeutic targets are being studied, of world population. HCV capsid protein (HCVCP) specially the viral protease inhibitors (PIs). OBJECTIVE: is involved in several viral and cellular processes, The aim of this work is to develop a molecular tool for including the assembly process. This work aims to phenotypic assay. MATERIAL AND METHODS: The gain more information about the cellular localization vector pET17b containing NS3 helicase domain and and the assembly process of HCV in different cells the accessory protein NS4A was constructed. NS3 protease variants were cloned into this vector through correlation spectroscopy (FCS) and using the HCVCP homologous recombination. In vitro production of the modelsfused with through the confocalGreen microscopyFluorescent and Protein fluorescence (GFP) NS3 protease was performed using transcription and (HCVCPGFP). With this mean, we constructed vectors translation in vitro assay. In cooperation with University to express the full-length HCVCPGFP, composed by 191 Hospital Clementino Fraga Filho, UFRJ, samples from amino acids (HCVCP191GFP), in HepG2 and Huh7 cells. patients with chronic hepatitis C were collected at Also, we constructed, by deletions of HCVCP191GFP, two different times during PEG-INF/RBV treatment. Of the other forms of the HCV core protein, composed by 124 68 patients with genotype 1 studied in a previous work, and 179 amino acids, HCVCP124GFP and HCVCP179GFP, respectively. In HepG2 cells, the data obtained by confocal which confer resistance to these viral protease inhibitors. microscopy showed that, 24 hours post transfection, inSerum 3 of from them these we have3 patients identified was collected resistance and mutations, the viral the HCVCP191GFP is placed in the nucleus, more RNA extracted. Reverse transcription and NS3 PCR concentrated in the nucleolus. In Huh7 cells, analysis of nuclear distribution indicates that HCVCP191GFP is product was cloned in the vector described above. Clones also located in the nucleus and, interestingly, this protein amplification was done for every time point. Each PCR seems to be sited on lipid droplets surface. The nuclear transcription and translation reactions. NS3 protease distribution analyses of truncated forms are in progress. werewas subsequentconfirmed by characterized sequencing and using submitted NS3 antibodies to in vitro Our data intend to reveal a new approach to understand in a Western Blotting. RESULTS: Clones from all three the assembly of Hepatitis C virus capsid, which is an important target for drugs to impair the Hepatitis C We are standardizing protein production by in vitro virus replication. patientstranscription were and obtained translation. and confirmed CONCLUSIONS: by sequencing. These in vitro assays will be a tool to phenotypically test the BV175 - Development Of A Molecular Tool NS3 protease variant. It is a cell-free technique, which For In Vitro Production Of Ns3 Protease Of is less costly and complex and subject to eventual use in Hepatitis C Virus. routine laboratories, and it is possible to predict if the Valentin, E.S., Ramos, J.A., Ürményi, T.P., Tanuri, A., Rondinelli, E., Silva, R., Hoffmann, L. FAPERJ/PPSUS/MS, INCT-INPeTAm/CNPq/MCT, CNPq patientand CAPES. will benefit by the PI therapy. Financial Support: 1. Universidade Federal do Rio de Janeiro, Inst de Biofísica, UFRJ, IBCCF, Av. Carlos Chagas Filho, 373, CCS, bl BV179 - Generation And Characterization G, sl G1050, Ilha do Fundão, RJ, 21941902 Of Stable Clones Of Hepatocytes With 2. Inst Nac para Pesquisa Translacional em Saúde e Controlled Expression Of Dengue Virus Ambiente, INCTINPeTAm/CNPq/MCT, Av. Carlos Chagas Ns1 Protein Filho, 373, CCS, Ilha do Fundão, RJ, 21941902 Lima-Reis, A.L., Silveira, P.F., Ribeiro, E.M.C., Pimenta, P.F.P., Bonjardim, C.A., Silva, B.M. 3. Instituto Federal de Educação, Ciência e Tecnologia do RJ, IFRJ, R. Sen. Furtado, 121, Maracanã, Rio de Janeiro - 1. Universidade Federal de Ouro Preto, UFOP, Campus RJ, 20270021 Universitário Morro do Cruzeiro Ouro preto - MG 4. Universidade Federal do Rio de Janeiro, Inst de September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

53 Basic Virology: BV

2. Universidade Federal de Minas Gerais, UFMG, Av. 2. Universidade Federal de Pelotas, UFPel, Caixa Postal Antônio Carlos, 6627 Belo Horizonte - MG 354 3. Fundação Oswaldo Cruz, FIOCRUZ, Av. Augusto de Herpesviruses are cosmopolite agents causing several Lima, 1715 Belo Horizonte - MG infections to humans and animals, especially in 4. Rede de Pesquisa em Virologia do interior do estado immunocompromised individuals. Since their discovery, de minas, intravirus, MG the antimicrobial peptides receive special attention Dengue virus (DENV) is a enveloped virus with a single positive strand RNA genome of about 11 kilobases, prevention and treatment of infections against a large which encodes 3 structural and 7 nonstructural proteins asnumber an important of microorganisms. therapeutic alternativeThe P34 inantimicrobial the field of including the NS1 protein. NS1 is a highly conserved peptide is produced by a species of Bacillus isolated from 48kDa membrane-associated glycoprotein that was initially described as essential for RNA replication. It (Leporinus sp.) in the Amazon basin, and its inhibitory can be found in the cell as a monomer, associated with theactivity intestinal was detected contents against of the gram fish fish positive Piau-com-pinta and gram cellular organelle membranes and co-localizing with negative bacteria, besides antiviral action against the viral replication complex, and as a heterodimer in bovine herpesvirus and equine arteritis virus (EAV), a membrane GPI-anchored form, colocalizing with lipid according to recent studies from our research group. rafts. Its association with various organelles and cellular Aiming to evaluate the antiviral effect of P34 peptide proteins involved in signal transduction pathways against feline herpesvirus type-1 (FHV-1), virus titration suggest thatNS1 could play an important role in dengue pathogenesis. Data obtained by our group, by using liver monolayers in the presence or absence of P34 peptide. cells expressing NS1 in a constitutive form, showed that was performed in triplicate on confluent CRFK cell in inhibition of 94,4%. Tests were also performed to Thereevaluate was whether significant P34 reduction has a virucidal on virus effect titer, resultingon FHV- NS1IL-6 inchanges liver cells. the activationTo better understandprofile of MAP this kinases role of NS1and 1 by incubation in the presence or absence of peptide. NF-kB,in intracellular as well as thesignaling profile pathwaysof expression modulation, of interleukin we After 6 hours virus infectivity was analyzed by virus are generating stable HepG2 cells expressing NS1 in a controlled manner. For this, we cloned the DENV1 NS1 title of FHV-1 in the presence of P34, unlike to observed coding sequence into pMEP4, an eukaryotic-expression titrations.with EAV. The There results was demonstrate no significant that reduction P34 peptide of has the vector that express inserted genes in response to a diverse activity, with antiviral action against to FHV-1 addition of metals in the culture medium. HepG2 cells and virucidal action directed to EAV, although both are were calcium phosphate transfected and then ring enveloped. Given the promising results, further studies are being conducted to evaluate the potential use of P34 analysis showed a controlled accumulation of NS1 mRNA peptide in vivo. clonedafter induction after selection with cadmium with Geneticin. chloride. OurIn addition, first qPCR we BV191 - Inhibition Of Hepatitis C Virus observed an increase of NF-kB transcriptional activity Replication By Dicer Substrate Rna in cells induced to express NS1 protein, corroborating Carneiro, B.M., Braga, A.C.S., Batista, M.N., Harris, M., our previous results by using stable NS1-expressing Rahal, P. cells. Now we are analyzing the NS1 expression by 1. University of Leeds, Uni Leeds, University of Leeds, we will analyze the effects of NS1 expression over viral Woodhouse Lane, Leeds, UK westernmultiplication. blot and The immunofluorescence generation and characterization microscopy. Next of 2. IBILCE - Universidade Estadual Paulista, IBILCE/ these clones will be useful to identify some molecular UNESP, Rua Cristovão Colombo, 2265 - São José do Rio Preto/ mechanisms of usurpation of the cellular machinery and SP subversion of the immune system used by Dengue virus, such as modulation of other signaling pathways and Hepatitis C virus (HCV) frequently establishes persistent other genes involved in the pathogenesis of dengue. infections in the liver, leading to the development of chronic hepatitis, and, potentially, to liver cirrhosis and BV187 - Effect Of The P34 Peptide Against hepatocellular carcinoma at later stages. No vaccine Feline Herpesvirus Type-1 In Vitro is available for HCV and the current treatment, which Silva, S.D., Corrêa, R.A., Castro, C.C., Fernandes, M.H.V., Lima, M., Fischer, G., Vargas, G.D., Motta, A.S., Hübner, S.O. consists of administering pegylated interferon-α and 1. universidade Federal do Rio Grande do Sul, UFRGS, ribavirin,effects. The has objective limited of efficacy this study against was certainto test HCVthe genotypes, and also produces significant adverse September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

54 Basic Virology: BV

self-inactivating (SIN) lentiviral vector containing a CMV HCV replication. DsiRNA molecules were designed to promoter. The shRNA target were 5’UTR (2 molecules) ability of five Dicer substrate RNAs (DsiRNA) to inhibit and NS5A coding sequences of HCV genome. HEK 293T and coding regions for NS3, NS4B, NS5A, NS5B. These cells were transfected using PEI with the following targetmolecules five weredistinct transfected regions of into the Huh7.5HCV genome cells that – 5’ wereUTR plasmids DNA: envelope plasmid (pRSV-REV harboring stably harboring an HCV subgenomic replicon expressing the gene encoding VSV-G), the packaging plasmid (pCAG- HIVgp) and CMV-shRNA-eGFP plasmid. Supernatant and tested on HCVcc-infected cells. All of the DsiRNAs ainhibited firefly HCV luciferase/neoR replication using reporter either (pSGR-FEO-JFH1) the subgenomic centrifuged, and used to infect Huh7.5 cells stable system or HCVcc-infected cells. DsiRNAs inhibited the wasexpressing harvested HCV 48h subgenomic and 72h post-transfection,replicon containing briefly a replication of subgenomic replicon in 90% compared to the negative control. Huh7.5-infected cells when treated days post-infection, cells were lysed and luciferase with dicer substrate RNA reached almost the same level fireflylevels read luciferase on a geneplate reporterreader. Results (SGR-JFH1-FEO). shown that Three HCV of inhibition of subgenomic system. When DsiRNAs replication could be knocked down by 99% (relative were transfected before infection with HCVcc, inhibition to negative control) by infection with lentiviral vectors. levels reached 99.5%. Also, DsiRNAs were tested for 21 In vivo studies are still necessary, therefore, lentiviral days to check the selection of resistant clones. After this cell delivery of shRNAs directed to HCV genome has time, only few colonies were observed with some of the demonstrated to be promising tool for HCV therapy. DsiRNAs tested. DsiRNA has been found to be a more Financial support: FAPESP/CAPES potent molecule than canonical 21 nt siRNAs for the inhibition of HCV replication. It has also been found to BV193 - Inhibition Of Hcv Using Sirna exhibit low levels of selection of resistant clones in vitro. Targeted To The Virus And Heat Shock New studies are necessary on in vivo models, and better Proteins delivery methods are needed. Thus, DsiRNA molecules Braga, A.C.S., Carneiro, B.M., Batista, M.N., Rahal, P. may be an option for treatment of chronically infected Universidade Estadual Paulista, UNESP, Rua Cristóvão HCV patients in the future. Financial suport: FAPESP/ Colombo, 2265, CEP 15054-000 - São José do Rio Preto, SP CAPES Hepatitis C is a consequence of infection through hepatitis BV192 - Delivery Of Shrna Molecules By C virus (HCV) and it is estimated that approximately Lentivirus Vectors For Treatment Of 170 million people are chronically infected worldwide. Hepatitis C Virus In Vitro Studies have shown the existence of interactions between Carneiro, B.M., Braga, A.C.S., Batista, M.N., Harris, M., viral and host proteins during the HCV replication cycle, Rahal, P. and these interactions may be used for the development 1. IBILCE - Universidade Estadual Paulista, IBILCE/ of new therapies against hepatitis C. Heat shock proteins UNESP, Rua Cristovão Colombro, 2265 - São José do Rio (HSPs) consist of cellular proteins that interact with HCV proteins, and the inhibition of these host proteins Preto/SP could reduce viral replication. In this study we inhibit 2. University of Leeds, Uni Leeds, University of Leeds, the cellular proteins Hsp90 and Hsp27 alone and in Woodhouse Lane, Leeds, UK combination with the inhibition of viral regions 5’UTR, Chronic Hepatitis C virus (HCV) infection affects 2.2% of NS3 and NS5A using the RNAi pathway. We used a stable the world’s population and is known to be the leading culture Huh7 expressing subgenomic HCV replicon factor necessitating liver transplantation in patients in SGR-JFH1 for transfection of siRNAs molecules. After developed countries. There is no vaccine available and 72 hours of incubation the culture was analyzed by Western blot and qPCR. All siRNA molecules directed to viral genome showed inhibition of viral replication and current treatment has limited efficacy and also produces the best response was obtained by inhibiting the 5’UTR significantinhibition of adverse HCV in effects.vitro. However, Molecular RNAses therapies present using in region. Inhibition of Hsp27 gene showed no reduction RNAihuman pathway or animal has serum demonstrated easily degrade to be highly RNAi efficientmolecules. on in levels of viral replication, but the inhibition of Hsp90 Therefore, new delivery methods for siRNAs or shRNA cellular proteins, successfully reduced virus replication. are needed. The objective of this study was to develop The use of this molecule in combination with siRNA a viral vector capable to infect HCV positive cells and 5’UTR resulted in viral replication inhibition. In a long- delivery a shRNA molecule designed to inhibit virus term treatment, siRNA targeting the 5’UTR region was replication. Four shRNA sequences (one negative control and three directed to virus genome) were cloned on a siRNA targeting Hsp90 led to cell death, a result which found to be very efficient in reducing the HCV, and September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

55 Basic Virology: BV

BV200 - Possible Model For Overexpression Finally, this study suggests that the combination therapy Of Anxa1 In Cells Positives For Hpv16 affirmsof siRNAs the canimportant be an roleeffective of this alternative protein in cellfor survival.treating Marilia, F.C., Laura, S., Villa, L.L., Vassallo, J., Rahal, P. hepatitis C in patients with HCC, since the reduction of Hsp90 expression was successful for both tumor and 1. Instituto do Câncer do Estado de São Paulo, ICESP, HCV suppression. Av. Arnaldo , 251, 8° andar- São Paulo-SP 2. Instituto de Biociências, Letras e Ciências Exatas, BV199 - Tracing The History Of Denv-2 In The UNESP-IBILCE, Rua Cristóvão Colombo, 2265 Americas 3. Universidade de São Paulo, USP, Av. Dr. Arnaldo, Mir, D., Romero, H., Bello, G. 255 1. Universidad de la República, Montevideo, Uruguay, 4. Hospital A.C. Camargo, Rua Professor Antônio UdelaR, Iguá 4225 Esq. Mataojo C.P. 11400 Montevideo Prudente, 211 2. Instituto Oswaldo Cruz, Rio de Janeiro, Brazil, Overexpression of ANXA1 was demonstrated in penile FIOCRUZ, Av. Brasil, 4365 - Manguinhos, Rio de Janeiro - squamous cell carcinoma samples and its protein CEP: 21040-360 expression is strongly associated with high risk HPV A common observation in phylogenetic studies of dengue infection. It is known that ANXA1 and p53 are substrates virus (DENV) is that of lineage replacement. One of the for the E6AP-mediated ubiquitylation. In one hypothetical best documented replacement event occurred in the model, the protein E6 from HPV16 redirects E6AP away 1980s when the Asian-American (AS-AM) genotype of from annexin A1, increasing the stability of annexin A1, and thereby contributing to viral pathogenesis. To test displacing the local American (AM) genotype. The DENV- this hypothesis, it was evaluated the expression of p53 and ANXA1 proteins in HPV16 positive cell lines (SiHa, DENV-22 AS-AM was genotype introduced has been for the continuously first time in evolving the Americas, in the Americas since its introduction, leading to several waves CasKi and HF698), HPV negative cell line (C33) and in of dengue epidemics and the emergence of different keratinocytes transfected with plasmids containing the viral lineages in the region. In this study, we investigated oncogenes E6, E7 and E6/E7 from HPV16. In addition, the spatiotemporal dissemination pattern of the DENV-2 it was evaluated if the E6 transcriptional silencing by at a regional level and identify those countries and viral dsiRNA would result in any change in the p53 and ANXA1 lineages that are most likely to disseminate and seed mRNA or protein levels. We observed that ANXA1 was new epidemics. To address these questions, we apply overexpressed in HPV positive cells compared to HPV a full probabilistic model within a Bayesian framework negative cells. Besides, in the keratinocytes expressing that utilizes both the temporal and spatial information E6 protein, the expression of p53 protein decreased of the sampled sequences to a comprehensive data set and the expression of ANXA1 protein increased. In of 341 DENV-2 E gene sequences of the AS-AM genotype the keratinocytes expressing only E7 protein, it was isolated from 28 different American countries over a not observed difference in the expression of p53 and period of 29 years (1983 to 2011). Our phylogenetic ANXA1 proteins. In SiHa transfected with dsiRNA analysis reveals that genetic diversity of DENV-2 AS-AM HPV16 E6, the level of E6 mRNA decreased compared genotype circulating in the Americas can be organized in to SiHa transfected with scrambled dsiRNA but there four major genetically distinct lineages that arise, spread was no difference in the mRNAs levels of ANXA1 and and die out with different dynamics across regions. The p53 between cells expressing and lacking HPV16 E6. spatial diffusion pattern obtained indicates a primary However, expression of p53 protein increased in cells spread axis between the Greater and the Lesser Antilles transfected with dsiRNA HPV16 E6 compared to cells and secondary axes linking the Caribbean with both transfected with scrambled dsiRNA and the expression South and Central America. According to this model, of ANXA1 protein diminished in cells transfected with the Caribbean acts as a reservoir and source of DENV- dsiRNA HPV16 E6 compared to cells transfected with 2 lineages that are subsequently disseminated to scrambled dsiRNA. So, probably, in cells HPV16 positive continental regions which act as sinks. Whilst Suriname the protein E6 from HPV16 redirect E6AP away from and Guyana seems to represent important transit points annexin A1 being that E6–E6AP complex functions as an for DENV-2 dissemination from the Lesser Antilles to E3 ubiquitin ligase in the ubiquitylation and degradation South America, Venezuela and Brazil were the main of p53. Financial support: FAPESP secondary hubs of dissemination to other South American BV201 - Expression Of Innate Immune Genes countries and Nicaragua was the most important hub of In Human Cells Infected By Bunyavirus DENV-2 spreading within Central America.

56 Basic Virology: BV

Ferreira, J.G.G., Batista, I.C.A., Pereira, Patrícia V.B., 1. Aggeu Magalhães Research Center, Oswaldo Cruz Oliveira, C.C., Oliveira, D.B., Almeida, G.M.F., Oliveira, Foundation , CPqAM/Fiocruz, Av. Professor Moraes Rego, s/n J.G., Ferreira, P.C.P., Calzavara-Silva, C.E. - Campus da UFPE - Cidade Universitária | Recife/PE 1. Universidade Federal de Minas Gerais, UFMG, Av. 2. Federal University of Pernambuco, UFPE, Av. Prof. Antônio Carlos, 6627, Pampulha - Belo Horizonte - MG, Moraes Rego, 1235 - Cidade Universitária, Recife - PE - CEP: 31270-901 50670-901 2. Centro de Pesquisas René Rachou, CPqRR/ FIOCRUZ, Avenida Augusto de Lima, 1715, Barro Preto - a spectrum of illness ranging from inapparent infection Belo Horizonte - MG 30190-002 Theto acute yellow hemorrhagic fever virus, disease prototype that flavivirus can be fatal. genus, The causes only ways to prevent yellow fever virus are the vaccination The virulence of the pathogenic Bunyaviruses is and education of the population in the prevention of directly linked to the roles of viral virulence factors the disease. Antiviral drugs are not available to the and their capacity to counteract the host pathways. population and about 200,000 cases of yellow fever are These viruses use cellular proteins to promote their estimated per year in the world. Traditional methods for own replication/transcription and,in response, host antiviral screening are laborious, time-consuming and induces transcriptional reprogramming to activate antiviral affects.In order to verify the early steps of Apeu we realize a high-throughput screening of 5,200 extracts virus (APEV) and Thayna virus (THAV) induced innate difficultfrom a tolibrary use in comprisinghigh-throughput 6,000 assays. different In this natural study, immune system activation, we performed TaqMan-based substrates. This screening was performed by using a qPCR assays using cDNA obtained from mRNA extracted BHK-21 cell line expressing the YFV bicistronic replicon from A549 cells after 4hs or 8hs of infection with APEV, (BHK-21-repYFV17D-LucNeoIres), which contains TAHVand VSVvirus (ssRNAcontrol virus), besides a phosphotransferase gene. The evaluation of the antiviral by TLR9, differently of TAHV, which followsVSV due theactivity firefly of the luciferase substrate reporter can be genemade andbased neomycin on the mockto TLR7 control. recognition. We verified However, that APEVAPEV isfollows recognized VSV decreasing TICAM1 expression after 4hs of infection.It is reporter gene responding in a concentration-dependent also possible to note an early induction of TLR pathway measurementmanner. Ninety-four of the extracts activity showed of the fireflyan inhibition luciferase of by VSV when compared to APEV and TAHV. TAHV and 50% or more of replicon replication based on reporter mainly VSV, but no APEV, increased expression of IRF5, gene expression, at concentrations of 20 and 40 µg/ notably after 8hs of infection. All the viruses were able to mL. The antiviral activity of screened substrates were increase the expression of TLR3, IRF3 and 7. TRAF3 was slightly more expressed (4hs and 8hs) in cells infected Gaussia luciferase reporter gene (YFV-GLuc). Of the 71 by APEV, but not by VSV and TAHV. The TICAM and IRF3 confirmedextracts tested in cell with culture the recombinantinfected with virus,a YFV 59expressing extracts expression levels were normalized after 8hs of infection. showed ability to reduce the reporter virus replication We also observed and 8-fold increase of IRF5 expression to values above 50%. Therefore, the use of YFV replicon after 8hs of incubation with VSV. Also, VSV inducedIFNb1 cell line enables successful high-throughput screening expression just after 4hs of infection, meanwhile TAHV of natural compounds with potential antiviral activity against yellow fever virus. inducedcells started IFNβ to increased diminish,but levels remained only after higher8hs of infection.than the BV237 - Autophagy Induction During Cotia Atother this viruses. time,IFNβ Finally, expression APEV, even levels after 8hs in VSV-infectedof infection, Virus Infection Afonso, P.P., Attias, M., Damaso, C. expression. We concluded that these viruses are able to wastriggers unable different to induce recognition a significant and intracellular increase ofsignaling IFNb1 Instituto de Biofísica Carlos Chagas Filho, IBCCF- pathways leading to differences in the immune responses UFRJ, Av. Carlos Chagas Filho, 373 and, consequently, determining the pathogenic potential Cotia virus SPAn 232 (COTV) is a poxvirus isolated in of each tested viruses. 1961 from sentinel mice in Cotia, Brazil. Our group has BV204 - Screening Of 5,200 Natural Extracts recently characterized COTV as a new poxvirus genus And Identification Of Several Compounds and we are currently interested in studying new aspects With Antiviral Activity Against Yellow of virus-host cell interactions. In some cell lines, COTV Fever Virus induced classical features of autophagy. By transmission Carvalho, A.G.O., Kassar, T.C., Bertani, G.R., Gil, L.H.V.G. electron microscopy, we observed the presence of

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology:myelinic BV figures in the cytoplasm of COTV-infected cells XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

57 Basic Virology: BV which resemble autophagosomes in different maturation demosntrated to be susceptible vectors to ROCV. The stages. Some of them are next to immature and mature aim of this work was to perform a prospective study virus particles and others enclose mature virus particles. of Culicidae naturally infected with DENV, YFV and These structures accumulate during late stages of the ROCV, in Montes Claros-MG. Mosquitoes were collected virus cycle and are not visualized in non-infected cells. mosquitoes (up to 20 individues) were macerated and autophagic protein LC3 is present in a punctuate pattern attotal UNIMONTES-MG, RNA was extracted. and Total properly RNA identified.was used for Pools cDNA of Analysisin COTV-infected by immunofluorescence cells and this pattern assay is onlyreveals observed that the at synthesis followed by nested-PCR to detect Flavivirus. the post-replicative stage of the virus cycle. The number A total of 4210 mosquitoes were collected, including A. of cells showing punctuate LC3 is similar between in cells scapularis, A. aegypti, A. albopictus, Psorophora sp. and infected with COTV and in starved or rapamycin-treated Limatus sp. Initially, 82 pools were tested for DENV. One cells. LC3 colocalized with the autophagic cargo-binding pool of A. aegypti was positive for DENV 1. A total of 41 protein p62 and also colocalized with LAMP-2 (lysosome pools (including A. scapularis, A. aegypti, A. albopictus, pattern marker) indicating that autophagosomes are Psorophora sp. and Limatus sp.) were tested for YFV able to mature during infection. The autophagy inhibitor and ROCV. All pools were negative for YFV. One amplicon 3-MA is not able to reduce the number of infected cells with the expected size for ROCV was detected in one showing a LC3 punctate pattern. Western blot analysis pool of A. scapularis. The others pools are being tested shows a LC3 conversion (LC3-I to LC3-II) early and late for DENV, YFV and ROCV and the obtained amplicons during infection, which is enhanced in the presence Among the Culicidae, A. scapularis is a widespread and areits epidemiological going to be sequenced competence to and confirm capacity de theto transmit results. of autophagic flux inhibitors, suggesting that COTV various agents of human and animal diseases have long infectionprevent LC3induces conversion autophagic nor flux.affected Silencing viral oftitres, Beclin but 1 been recognized. Although there is no report of DENV ortriggered Atg7 expression a relocalization mediated of LC3, by specificwhich accumulated siRNA did not at infecting A. scapularis, it is known that different species the perinuclear region. Support: CNPq, Faperj, INPeTAm of Aedes sp are related to DENV transmission what should be further investigated. Moreover, our results BV240 - Molecular Investigation Of indicate a possible occurrence of ROCV in Northern Flaviviruses In Culicidae In Northern Minas Gerais. Financial support: FAPEMIG, CNPq, CAPES, Minas Gerais, Brazil. UFJF, PROPESQ/UFJF. Rezende, I.M., Carvalho, C.M., Lima, G.A.D., Silva, A.C., Rodrigues, R.A., Silva, M.C., Kroon, E.G., Borges, BV247 - The In Vitro Antiherpetic Activity MA.G.Z., Drumond, B.P. Of A Polysaccharide Of Green Seaweed (Enteromorpha Sp.) 1. Universidade Federal de Juiz de Fora, UFJF, Rua Lopes, N., Faccin-Galhardi, L.C., Espada, S.F., Godoi, José Lourenço Kelmer, s/n - Campus Universitário Bairro São A.M., Ray, B., Linhares, R.E.C., Nozawa, C. Pedro 2. Universidade Federal De Minas Gerais, UFMG, Av. 1. Universidade Estadual de Londrina, UEL, Rodovia Antônio Carlos, 6627, Pampulha Belo Horizonte - MG Celso Garcia Cid, Pr 445 Km 380, CEP 86.057-970, Londrina 3. Universidade Estadual de Montes Claros, - PR UNIMONTES, Campus Universitário Professor Darcy Ribeiro 2. University of Burdwan, , Bardhaman, West Bengal, - Vila Mauricéia - Montes Claros India 4. Grupo de Pesquisa Ecologia de Vírus , ECOVIR, The green algae, members of the family Ulvaceae, are 5. Rede de Pesquisa em Virologia do Interior de Minas a rich source of polysaccharides referred to as ulvans. Gerais, INTRAVIRUS These high molecular weight compounds have several biological and pharmacological activities, determined by The genus Flavivirus (Flaviviridade) contains many their chemical structure, including the degree of sulfation, important arboviruses of public health importance molecular weight, sugar constituent, spatial conformation such as Yellow fever virus (YFV), Dengue virus (DENV), and dynamic stereochemistry. The diseases caused by Rocio virus (ROCV). These viruses have been detected herpes simplex virus (HSV) represent a medical and in Brazil and are etiological agents of febril diseases, social problem due to their communicability, recurrence hemorrhagic fever and encephalitis. YFV is transmitted and the establishment of latent infection. Therefore, the by Aedes sp. and Haemagogus mosquitoes, DENV is search for new antiherpetic compounds, particularly, transmitted by species from Aedes genus, mainly A. makes it extremely challenging. The aim of this study is aegypti, Psorophora ferox and A. scapularis were already to investigate the antiviral activity of a polysaccharide of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

58 Basic Virology: BV green seaweed (Enteromorpha sp.) to HSV-1 in HEp-2 cell the codon TGA. This vector has a GFP downstream site cultures. The 50% cytotoxic concentration (CC50) of the 111 allowing to verify whether the translation is being substance was 1000 µg/ml, determined by MTT assay. The antiviral action was assayed by plaque reduction and high concentration of plasmid was produced assay, by the use of the following protocols: the time-of- stopped.by Maxiprep. The mutationWild type was and confirmed mutated byvectors sequencing were addition assay (-3h, 0, +1h, +2h), the inhibition of virus transfected in human hepatocellular carcinoma cell line adsorption and penetration, and the virucidal effect. The HepG2 and cells were cultured for 48h. The expression compound showed a great activity at time 0h with the 50% inhibitory concentration (IC50) of 28.25 µg/ml and The results show that GFP expression is observed in cells the selectivity index of 35.4. It was also observed that the oftransfected GFP was with analyzed both, underwild type fluorescence and mutated microscope. vector, inhibitory effect was maintained until 2h post-treatment, suggesting the expression of NS5A protein is not being with 100% of viral inhibition at the concentration of 100 terminated. HepG2 cells stably expressing wild type and µg/ml. Thus, the viral inhibition caused by this substance mutated vectors are being established to allow further most likely occurs in the initial stages of viral replication, experiments to better understand this process. Financial but, after the entry of the virus into the cell, since no Support: FAPESP, Processo nº 2013/02856-0 effect was observed in the inhibition of adsorption and penetration assays and virucidal test. The pre-treatment BV269 - The Equine Herpesvirus Infection has showed no inhibition even when the substance was Depends Of Erk1/2 Mapk Signaling Pathway added 3h before the infection at concentrations eight For Biossinthesis times greater than that of the IC50. Further studies will Fernandes, M.J.B., Codignoto, P.S.C., Patrício, G.F., be conducted in order to better clarify at what point of Simoni, I.C., Conceição, A.O. the HSV-1 replication Enteromorpha sp. polysaccharide 1. Instituto Biológico, CPDSA/IB, Av. Cons. Rodrigues may act. Financial support: CAPES/CNPq/Fundação Alves, 1252, São Paulo, SP, Brasil Araucária/UEL 2. Universidade Estadual de Santa Cruz, Ilhéus, UESC BV266 - Investigation Of Stop Codons In The mitogen activated protein kinases/extracellular Hepatitis C Virus Ns5a Protein signal-regulated kinase 1/2 (MAPK/Erk1/2) cellular Campos, G.R.F., Rahal, P., Bittar, C. signaling pathway has been described as an important Instituto de Biociências, Letras e Ciências Exatas, Ibilce/ component to virus entry and biosynthesis. However, UNESP, Rua Cristóvão Colombo, 2265, Jardim Nazareth the involvement of the ERK1/2 signaling pathway in the equine herpesvirus type 1 (EHV-1) infection is not The hepatitis C virus (HCV) is a single strand positive known. The aim of this study was to verify if the infection RNA virus member of the Flaviviridae family. The of Vero cells by EHV-1 was dependent of MAPK/Erk1/2 signaling pathway in vitro. Inhibition of Erk1/2 signaling pathway and titer analysis of strain A4/72 of EHV-1 in infectionThe treatment leads is to based liver inflammationon interferon and which ribavirin, may cause but Vero cells were used. Cells were serum starved for 24 liverin severe cirrhosis, cases, the fibrosis liver transplant and hepatocellular is needed. carcinoma. Due to the hours and the Erk1/2 pathway was suppressed by the RNA genome, HCV has a high mutational rate resulting selective inhibitor U0126 for one hour. To observe the in high variability. Among its proteins, the NS5A shows interference of MAPK inhibition on viral biosynthesis, to be important to act in the resistance of the virus cells were treated with 100 TCDI50 of virus and incubated to interferon as well as in the apoptotic processes of for 5h. The cells were then frozen and thawed to titer the damaged cells, with a possible role in the hepatocellular viruses. The virus titer showed 0.7-log reduction. The carcinogenesis. Recent studies reported mutations that results showed evidence that the EHV-1 is dependent on give rise to stop codons in the NS5A protein region the activation of this MAPK/Erk1/2 signaling pathway recurrent in different patients. The presence of these stop codons would lead to early termination of the to establish which steps of the virus cycle the ERK1/2 polyprotein preventing the translation of complete NS5A forparticipates an efficient as wellreplication. as the state Further of activation studies are of ERK1/2needed and as a consequence the following protein, the viral RNA proteins. Financial support: FAPESB dependent RNA polymerase NS5B. The aim of this study is to evaluate in cell culture the impact of the presence BV278 - Inhibition Of Yellow Fever Virus of the TGA codon in the position 111 (originally TGG) of Entry By Lactoferrin the NS5A protein in its translation. We performed a site Ferreira, M.V.M., Mendes, Y.S., Alves, N.S., Carvalho, directed mutation in the vector CMV_SGR_JFH1_GFP5A C.A.M., Campos, S.P.C., Schwarcz, W.D., Silva, J.L., that contains JFH-1 subgenomic fragment, generating Gonçalves, R.B., Gomes, A.M.O., Oliveira, A.C.

59 Basic Virology: BV

1. Universidade Federal do Rio de Janeiro, UFRJ, 1. Universidade Federal do Rio de Janeiro, UFRJ, Av. Carlos Chagas Filho 373, CCS bloco E - sala 8, Cidade Instituto de Microbiologia - Departamento de Virologia, Universitária - RJ Cidade Universitária, RJ 2. Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil 2. Universidade Federal do Rio de Janeiro, UFRJ, 4.365, Manguinhos, Pavilhão Rocha Lima, Rio de Janeiro - RJ Instituto de Química - Departamento de Bioquímica 3. Universidade Federal do Estado do Rio de Janeiro, 3. Universidade Federal do Rio de Janeiro, UFRJ, Núcleo UNIRIO, Rua Frei Caneca 94, Centro, 3º andar, Rio de Janeiro de Pesquisas em Produtos Naturais - NPPN - RJ Mayaro virus (MAYV) is an arborivus (Togaviridae family, Alphavirus genus), endemic in South America tropical regions, particularly Africa and South America, and responsible for sporadic outbreaks of Mayaro Thecausing Yellow an Feveracute Virusfebrile (YFV) disease is an of endemic major public flavivirus health in fever in rural communities of Brazil and Bolivia. impact. Although a large percentage of patients develops spontaneous cure, approximately 60% of patients who 3-O-glycosides guayjaverin, quercitrin, and a mixture progress to more severe cases die within two weeks. In(2:1) this of isoquercitrin work, the flavonol and hyperin quercetin were isolated along from with the its Due to the high morbidity associated with the absence methanol extract of the leaves of Brazilian shrub Bauhinia antiviral drugs became a target of medical importance. fractions containing them were also investigated for their ofLactoferrin, specific treatmentsa glycoprotein for present this infection, in various searching secretions for longifolia.in vitro antiviral These flavonoids activity against and the MAYV AcOEt replication and n-BuOH in such as milk, tears and saliva, shows several biological Vero cells. Quercetin was the most active among the pure functions, including modulation of the immune response and defense against numerous pathogens such as different viruses of medical and socioeconomic flavonoids,highest activity with amongselectivity all theindex samples (SI) of with94 (IC50=10.3 SI of 623 importance. The main goal here is to evaluate the μg/ml).(IC50=5.5) AcOEt and and 208 n-BuOH (IC50=2.8) fractions respectively. demonstrated At 25 µg/the antiviral activity of bovine lactoferrin (bLf) against YFV mL quercetin, AcOEt and n-BuOH fractions were able infection and to elucidate the step(s) where bLf would to inhibit MAYV in a dose-dependent manner by more be acting in the viral cycle. Our results show that bLf has than 90 %, a strong inhibitory effect on viral replication a viral inhibitory activity of approximately 80% without when compared to ribavirin (SI=8). Furthermore, MAYV causing cytotoxic effects in Vero cells, our cellular model. To investigate which steps and mechanisms are involved isomeric mixture (isoquercitrin and hyperin) at 100 µg/ in this inhibition, cells were pre-treated or incubated replication was inhibited about 84% by the flavonoid with bLf only in the viral adsorption step, and our data antiviral effect up to maximum tested concentration. Our indicate that infection is inhibited by about 60% and mL.results Guayjaverin showed B.and longifoliaas quercitrin asdid an not interesting show significant source 70%, respectively. In contrast, the presence of bLf only of quercetin derivatives with antiviral activity against an after viral adsorption and internalization steps leads alphavirus replication and that the presence of different to an inhibition of less than 10%. Furthermore, when sugars decreased their antiviral activity. Although assessing the ability of bLf to bind to viral particles, we quercetin and derivatives are fairly common in the plant our results suggest that bLf has antiviral activity, acting observedmainly on no the significant early events changes of the in infection viral titer. cycle Together, of YFV kingdom,licensed antiviral this is the drugs first for report most on mosquito the anti-Alphavirus transmitted by binding to the cell surface and possibly hampering activityviruses. Therefore, for these flavonoids.the potential To activity date, thereof quercetin, are no the virus-cell interaction. The present study can help in AcOEt and n-BuOH against our alphavirus model is a the better understanding of the cycle and formulation of very important step in the search for new drugs against novel strategies for the development of effective antiviral these important pathogens. Financial Support: CNPq, CAPES, FAPERJ, INBEB CNPq/CAPES/FAPERJ/PRONEX/INBEB drugs against different flaviviruses. Financial support: BV306 - Human Respiratory Syncytial Virus BV286 - Quercetin And Quercetin N, P And M Protein Interactions In Hek-293t 3-O-Glycosides From Bauhinia Cells Longifolia(Bong.)Steud.With Anti-Mayaro Oliveira, A.P., Simabuco, F.M., Tamura, R.E., Guerrero, Virus Activity M.C., Ribeiro, P.G.G., Libermann, T.A., Zerbini, L.F., Yamamoto, K.A., Dos Santos, A.E., Kuster, R.M., Salles, Ventura, A.M. T.S., Meneses, M.D.F., Da Silva, M.R.S., Ferreira, D.F. 1. Universidade de São Paulo, USP, Cidade Universidade

60 Basic Virology: BV

2. Universidade de Campinas, UNICAMP RNA extraction of the samples were carried out using 3. Instituto do Câncer do Estado de São Paulo, ICESP the RNA assay Minikit (QIAGEN), and RT-PCR performed 4. Harvard Medical School, BIDMC according to a previously published protocol. For the 5. International Centre Genetic Engineering and detection of IgM antibodies and HI, the IgM-ELISA assay and HI test were used respectively. For blood count the Biotechnology, ICGEB automated hematology MS4 + was used. For coagulation Characterization of Human Respiratory Syncytial Virus the CLOT timer-laser sensor was used and for the (HRSV) protein interactions with host cell components is determination of urea, creatinine and enzyme aspartate crucial to devise antiviral strategies. Viral nucleoprotein, aminotransferase (AST) and alanine aminotransferase phosphoprotein and matrix protein genes were (ALT), the COBAS MIRA PLUS 400-SP was used following optimized for human codon usage and cloned into the manufacturers’ protocols. Results demonstrated the expression vectors. HEK-293T cells were transfected with presence of viral RNA in the liver, spleen, kidney, lymph these vectors, viral proteins were immunoprecipitated, node and brain; IgM antibodies were not detectable, HI and co-immunoprecipitated cellular proteins were antibodies were detectable secondary response of 3, 4 to 10 d.p.i. Leukopenia and increased AST were observed in both infections. The results indicate that non-human identified through mass spectrometry. Cell proteins primate species Callithrix penicillata is highly susceptible identifiedresults indicate with thathigher nucleoprotein confidence scoresinteracts were with probed arginine in to DENV infection and suggest that they may be a reliable themethyl-transferase, immunoprecipitation methylosome using specific protein antibodies. and Hsp70. The model for studying dengue fever. Phosphoprotein interacts with Hsp70 and tropomysin, and matrix with tropomysin and nucleophosmin. BV312 - ANTI-HMPV ACTIVITY OF DL-GALACTANS Additionally, we performed immunoprecipitation of OBTAINED FROM Cryptonemia seminervis these cellular proteins in cells infected with HRSV, Mendes, G.S., Colodi, F.G., Duarte, M.E.R., Noseda, M.D., followed by detection of co-immunoprecipitated viral Cavalcanti, J.F., Santos, N., Romanos, M.T.V. proteins. The results indicate that these interactions also 1. Departamento de Virologia, Instituto de occur in the context of viral infection, and their potential Microbiologia Paulo de Góes, UFRJ, Brasil contribution for a HRSV replication model is discussed. Financial Support: FAPESP/USP/CNPq 2. Departamento de Bioquímica e Biologia Molecular - Universidade Federal do Paraná. Curitiba - Paraná – Brasil BV310 - Callithrix Penicillata: A Possible Respiratory tract infections (RTIs) are a leading cause of Experimental Model For The Study Of morbidity and mortality worldwide. For children under Dengue Virus the age of 5 years old, RTIs are ranked as the second leading Ferreira, M.S., Castro, P.H.G., Silva, G.A., Rodrigues, S.G., cause of death, regardless of geographical location. In Nunes, B.T.D., Domingues, R.A.B., Vasconcelos, P.F.C. 1. Evandro Chagas Institute, IEC 2. National Primate Center, CENP children,causes of respiratory bronchiolitis syncytial and viruslower (RSV), respiratory parainfluenza tract 3. Metropolitan College of Amazon, FAMAZ virusesillnesses. (PIVs), In 2001, and a previously influenza virusunknown are knownvirus, human major metapneumovirus (HMPV), was added to this list. HMPV is a member of the Metapneumovirus genera of the experimental model to study the pathogenesis of dengue Pneumovirinae subfamily in the Paramyxovirus family. DespiteVirus (DENV), many this efforts remains over thea challenge. past years To investigate to find an No vaccine or antiviral therapy is currently available the levels of viremia and the immune response of IgM by for prevention or treatment of HMPV infection. In this ELISA and of hemagglutination inhibition (HI) antibodies work, the anti-human metapneumovirus (anti-HMPV) followings in infections caused by DENV-3 (secondary activity was determined for two sulfated DL-hybrid infection) in animals; two viral suspensions (one of the galactans (P6 and P7) obtained from the red seaweed DENV-2 and the other DENV-3) were prepared from virus Cryptonemia seminervis and four depolymerized isolates of patients who died of Dengue Hemorrhagic products obtained by reductive partial hydrolysis (P15, Fever and Dengue Shock Syndrome (DHF/DSS). Three P16, P17 and P18). Structural studies carried out in animals were experimentally infected with the DENV-2 three homogeneous depolymerized fractions P16, P17 suspension (infective dose: - 4.47 × 10 4 PFU / ml) and and P18 (Mw of 51.6, 60.1 and 63.8 kDa, respectively) after one year and seven months same were infected with showed that these galactans present different chemical DENV-3 (infective dose: 3.23 × 10 3 PFU / ml). On days characteristics, as monosaccharide composition, content 3, 4 and 10 post infection (d.p.i.), animals were bled to of sulfate groups (14.1, 23.0 and 29.9 %, respectively) obtain blood, serum and euthanized to collect visceras. and agaran:carrageenan molar ratio diads, 2.7:1 for

61 Basic Virology: BV

P16 and P17 and 1:1 for P18. Cytotoxicity tests showed A pattern was associated with lipophilicity, and virucidal activity. The molecules were also capable of interact activity was evaluated using Real Time RT-PCR, and with cellular receptors and inhibit viral penetration. noall significantthe fractions damage analysed to LLC-MK2 showed cells.promising The antiviralresults, This work shows the great potential of the structures some inhibiting more than 90%of viral replication. synthesized in vitro, since it allows bioguided studies Due to this, the mechanism of action of this compounds aiming to improve the activity and reduce/increase was evaluated. Sulfated DL-galactans and their the toxicity of a compound. Financial support: FAPERJ, depolymerized products exhibited antiviral activity at a CAPES, CNPq. very early stage of the viral infection cycle. All fractions, except P17 inhibited HMPV replication by binding to BV322 - Porphyrin-Membrane Interactions the viral particle. Additionally depolymerized galactans And Their Antiviral Activity Against Sinv P17 and P18 inhibited the recognition of cell receptor And Vsv by HMPV and penetration to the host cell, respectively. Cruz-Oliveira, C., Freire, J.M., Neris, R.L.S., Figueiredo, Financial support: FAPERJ, CAPES, CNPq. C.M., Assunção-Miranda, I., Castanho, M.A.R.B., Da Poian, A.T. BV313 - INFLUENCE OF STRUCTURAL ALTERATIONS IN ISATIN MOLECULE ON ANTIVIRAL ACTIVITY 1. Instituto de Bioquímica Médica, IBqM - UFRJ, Rio Mendes, G.S., Bastos, R., Cavalcanti, J.F., Pinto, A., Santos, de Janeiro, Brasil N., Romanos, M.T.V. 2. Instituto de Medicina Molecular, Universidade de Lisboa, IMM, Lisboa, Portugal 1. Departamento de Virologia, Instituto de 3. Instituto de Microbiologia Professor Paulo de Góes, Microbiologia Paulo de Góes, UFRJ, Brasil IMPPG - UFRJ, Rio de Janeiro, Brasil 2. Instituto de Química, UFRJ, Brasil INTRODUCTION: Porphyrins are amphipathic cyclic Respiratory infections caused by viruses play an molecules composed by a tetrapyrrole ring that can important role in public health and the economy. HMPV bear a metal atom in the center. We demonstrated is an emerging virus known to cause severe disease in that porphyrins are potent antiviral compounds that children, elderly and imnocompromised patients. At the moment, there are no antiviral drugs licensed for (SINV) and Vesicular Stomatitis (VSV) viruses. Since the treatment of infections caused by HMPV, there is inactivatethese viruses some are virusesenveloped including viruses flaviviruses, and porphyrins Sindbis are also no effective measures for prevention and control amphipathic molecules that intercalate cell membranes, we hypothesized that they could interact with viral alternatives to combat these infections is necessary. ofIsatin infections is an endogenous by this virus, compound so the reported search for to efficientpossess porphyrins PPIX, MesoPPIX and ZnPPIX were used to a wide range of biological activities. In view of the envelope,study porphyrin-membrane impairing virus interactions. infection. The As fluorescentporphyrins broad spectrum activities of isatin derivatives, we aimed at evaluating the antiviral activity of seven novel from aqueous to hydrophobic environment, we evaluated mannich bases derived from isatin against human fluorescencethe partitioning emission of these spectra compounds are affectedto membranes by changes using metapneumovirus in LLC-MK2 cells. And all the seven molecules synthesized proved to be more toxic than Progressive LUV (Large Unilamelar Vesicles) addition to the isatin. Since the CC50 isatin was higher than 200 fluorescence spectroscopy. MATERIAL AND METHODS: µg/mL and molecules ranged from 18.8 µg/mL for the most toxic to 118.8 µg/mL for the least. Regarding anti- awere solution calculated. containing Porphyrin porphyrins partition resulted into fluorescence PC(100%), HMPV activity, isatin was able to inhibit viral replication emissionPC:PE(4:1), curves PC:PS(4:1), from which PC:Chol(3:1), partition PC:Sph(3:1)coefficients (Kp)and even in very low concentrations, and its ED50 was 3.97 PC:Sph:Chol(1:1:1) as well as LUVs mimicking SINV µg/mL. Of the seven molecules tested, six had a lower and VSV envelopes were tested. To correlate membrane ED50 value, i.e., presented a higher inhibitory potential partition with porphyrins antiviral activity, viruses than isatin. This data may suggest that the substitution were incubated with 50, 100, 200 and 300 uM of each pattern interferes with the antiviral activity. In this case, porphyrin for 1 hour and virus infectivity was accessed the molecules that were not substituted in position 5 of by plaque assay in BHK cells. RESULTS AND DISCUSSION: the ring had the lowest percentage of inhibition within PPIX and MesoPPIX showed higher Kp values (14,9-25,9 this class, and also showed higher values of ED50 (4.14 x103 for MesoPPIX and 10,6-14,1 x103 for PPIX) than µg/mL and 1.2 µg/mL, respectively). Studies were then, ZnPPIX (1,6-3,6 x103) in all LUVs tested. Kp values from performed to determine in which stage of the replicative porphyrin partition to SINV or VSV synthetic envelopes cycle of HMPV they interfere, as well as virucidal activity. were: 3 x103 and 1,9 x103 for ZnPPIX, 16,8 x103 and September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

62 Basic Virology: BV

19,2 x103 for MesoPPIX and 10,6 x103 and 12 x103 for Pandeló, D., Delvecchio, R., Abreu, C.M., Glinsk, J., Costa, PPIX, respectively. ZnPPIX and MesoPPIX inactivated T.B.F., Rabay, A.N.B.M., Filho, L.F.P., Pianowski, L.F., both SINV and VSV in concentrations up to 200 and 300 Tanuri, A., Aguiar, R.S. uM in a dose dependent manner, whereas PPIX impaired only SINV replication. CONCLUSION: Using porphyrin 1. Universidade Federal do Rio de Janeiro, UFRJ, Av Carlos Chagas Filho 373, CCS/Bloco A, sala A2-121.CEP- 21941-902, Fundão, RJ fluorescentand to correlate properties, these valuesit was possibleto their toantiviral calculate activity. their 2. Kyolab Laboratórios, Kyolab, R. Isaura Ap. O. partitionFurthermore, coefficient our results for different suggest model that membranesporphyrin Barbosa Terini, 231, Jd Itapuã - Valinhos-SP. CEP-13273-105 antiviral activity does not depend only on viral envelope 3. Planta Analytica LLC, Planta Analytica, 39 Rose St, phospholipid content. Porphyrin accessibility to viral Danbury, CT 06810, Estados Unidos envelope membrane, protected by envelope proteins, or porphyrin interaction with envelope proteins could The HIV eradication in infected individuals is not explain the differences in antiviral activity. Supported effective because of the establishment of viral latency by: CNPq, CAPES, FAPERJ and PRONEX. during the early stages of infection. These latency reservoirs are not affected by HAART. Several molecular BV323 - Antiviral Screening Of Brazilian mechanisms are responsible for the establishment of Plant Extracts Against Dengue Virus Barbosa, E.C., Francisco, F.L.M., Rocha, E.S.O., Kroon, E.G., Alves, T.M.A., Calzavara-Silva, C.E., Oliveira, J.G. HIVthe latencynucleus (promoter and upstream methylation, pathways histone are also modification involved andin HIV cell latency. activation). Here Thewe evaluate internalization the activity of NF-κB of a new into 1. Centro de Pesquisas René Rachou/Fiocruz Minas, compound extracted from Euphorbia sp, denominated CPqRR, AV Augusto de Lima 1715, Belo Horizonte MG Ingenol B (ING B) (KYOLAB Laboratories) to reactivate 2. Universidade Federal de Minas Gerais , UFMG, Av. HIV latency and the molecular mechanism involved. Antônio Carlos 6627, Pampulha, Belo Horizonte MG J-Lat cells (clones 6.3 and 8.4) were used as model of HIV Seven hundred and twenty plant extracts obtained from the Fiocruz collection of Brazilian plant and fungi in the presence of ING B. Cytotoxicity effects were also extracts (COLAB) were screened for antiviral activity latency.evaluated. The Reporter reactivation plasmids was assessed expressing by flow luciferase cytometry in against Dengue virus (DENV). Ethanolic extracts of control of HIV LTR enhancers (p3´Blue LTR-Luc) were different anatomical parts of a wide range of plant species have been evaluated in vitro against Dengue were evaluated by nuclear translocation and upstream virus 2 (DENV-2) by the 3-(4,5-dimethylthiazol-2-yl)- used to evaluate the transcription activation. NF-κB effects 2,5-diphenyltetrazolium bromide assay using LLCMK2 western blotting assays were performed to evaluate PKC cells. A total of 29 out of the 720 extracts tested have pathwaysactivation. with ING PKC-inhibitors. B was a better Immunofluorescence candidate to reactivate and disclosed antiviral activity against DENV. These 29 HIV latency if compared with others activators and extracts were obtained from plants belonging to twelve no cytotoxicity effects were associated (lower than distinct families: Malpighiaceae (9), Erythroxylaceae (3), 0.32 µM). Our results have demonstrated that the Melastomataceae (1), Euphorbiaceae (1), Calophyllaceae (3), Boraginaceae (1), Myrtaceae (2), Rubiaceae (2), sites and independent of HIV-Tat transactivation. The Hypericaceae (1), Fabaceae (4), Peranemataceae reactivationING B treatment is essentially promotes mediatedHIV-GFP expression by NF-κB bindingat high (1), Celastraceae (1). These extracts will be further levels in latency models. This latent HIV-1 reactivation tested by plaque reduction assay (PRNT) in different is associated mainly with PKCs isoforms activation and cytotoxicity assessment. Active extracts from natural potential of ING B as new compound able to reactivate HIV latency that can potentially be combined with concentrationsproducts could tobe, confirm in the theirfuture, antiviral a source effect of antiviral and for NF-κB nuclear translocation. Our results suggested the drugs for dengue treatment and also for other diseases HAART therapy to eradicate HIV from the body. Financial caused by viruses of the Flaviviridae family, or even by a support: CNPq, FAPERJ, Kyolab wide spectrum of viruses. Financial support by Fiocruz, BV334 - Phylogeography And Evolutionary CPqRR, CNPq and Fapemig History Of Hepatitis B Virus Genotype F In BV329 - Hiv-1 Latency Reactivation By A New Brazil. Ingenol Ester Molecule Mello, F.C.A., Araujo, O.C., Lago, B.V., Motta-Castro, A.C., Moraes, M.T.B., Gomes, S.A., Bello, G., Araujo, N.M.

63 Basic Virology: BV

1. Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil, for immunization purposes. Previously we screened 4365, Manguinhos, Rio de Janeiro, RJ, Brasil hRSV strain A2 L protein sequence with SYFPEITHI and 2. Universidade Federal do Mato Grosso do Sul, UFMS Pred/Balbc algorithms, to predict CD8 T cell epitopes. Nine peptides showing the best binding scores to Hepatitis B virus (HBV) genotype F (HBV/F) is considered BALB/c MHC-I molecules (H-2Kd, Ld and Dd) were to be indigenous to the Americas, but its emergence and selected. Sequence homology analysis showed that these spread in the continent remain unknown. Previously, sequences are conserved among different hRSV strains. only two HBV/F complete genome sequences from Brazil The selected peptides were synthesized and used to were available, limiting the contribution of Brazilian immunize BALB/c mice, for evaluating T cell response. isolates to the phylogenetic studies of HBV/F. Here, we examined the prevalence and geographic distributions by ex vivo stimulated T cells. In this report these of HBV/F subgenotypes in Brazil, determined the full- Twoexperiments peptides were induced repeated significant and new IFN-γ data production reinforce length genomic sequences of HBV/F isolates from that CD8 T cell epitopes are present in these peptides. different Brazilian geographic regions, and investigated Additionally, to show in vivo functionality, their ability the detailed evolutionary history and phylogeography of HBV/F in Brazil. Complete HBV/F genomes isolated and lung lymphocytes of hRSV-infected animals was also from 12 Brazilian patients, representing the HBV/F to stimulate the production of IFN-γ from splenocytes subgenotypes circulating in Brazil, were sequenced L protein contains H-2d restricted epitopes that can be and analyzed together with sequences retrieved measuredadded to the and already confirmed. reported These ones results to compose show that a multi- hRSV from GenBank, using the Bayesian coalescent and epitope vaccine. Financial Support: FAPESP/USP/CNPq phylogeographic framework. Phylogenetic analysis using all Brazilian HBV/F S-gene sequences available BV363 - Detection And Typing Of Dengue in GenBank showed that HBV/F2a is found at higher Virus In Aedes Aegypti Collected In The frequencies countrywide and corresponds to all City Of São José Do Rio Preto-Sp. sequences isolated in the Brazilian Amazon Basin. In Fávaro, E.A., Parra, M.C.P., Mondini, A., Ozanic, K., Dibo, addition, our evolutionary analysis using complete M.R., Colombo, T.E., Chiaravalloti-Neto, F., Eiras, A.E., genome sequences estimated an older median ancestral Nogueira, M.L. age for the Brazilian HBV/F2a compared to the Brazilian HBV/F1b and HBV/F4 subgenotypes, suggesting that 1. Faculdade de Medicina de São José do Rio Preto, HBV/F2a represents the original native HBV of Brazil. Famerp, Av. Brigadeiro Faria Lima, 5416 Vila São Pedro CEP: The phylogeographic patterns suggested a north-to- 15090-000 2. Universidade Estadual Paulista/FCFAR-Araraquara, HBV/F1b and HBV/F4 strains appeared to have spread Unesp, Rodovia Araraquara-Jaú Km 1 Bairro Machados southfrom Argentina flow of HBV/F2a to Brazil. from Our Venezuela study suggests to Brazil, a plausible whereas 3. Universidade de São Paulo, USP, Av. Prof. Almeida route of introduction of HBV/F subgenotypes in Brazil Prado, 1280 Butãnta and demonstrates the usefulness of recently developed 4. Universidade Federal de Minas Gerais, UFMG, R: computational tools for investigating the evolutionary Antonio Carlo, 6627 Pampulha BH history of HBV. Dengue is a viral disease which is spreading worldwide BV353 - Mapping Of Tcd8 Cell Epitopes In and infects 50 million people annually. The transmission Human Respiratory Syncytial Virus L of the disease occurs when infected mosquitoes of the Protein Aedes aegypti species bite susceptible hosts. The vector Medina-Armenteros, Y., Farinha-Arcieri, L.E., Braga, is extremely adapted to urban environments, and it can C.J.M., Carromeu, C., Tamura, R.E., Ventura, A.M. be captured either intra or peridomicile. The use of traps to catch adult mosquitoes has been an important tool for Universidade de São Paulo, USP, Avenida Professor entomological surveillance of the vector. The objective Lineu Prestes 1374, São Paulo-SP, Brasil 05508-900 of this study is to evaluate the use of the Mosquitito Since it has been reported that in humans there is a trap as an entomological surveillance tool for Aedes relationship between human respiratory syncytial aegypti. The study was conducted in a neighborhood of São José do Rio Preto, a city located in the Northwest of and symptom-reduction, and that the polymerase the São Paulo state. Twenty seven Mosquitito traps were virus(structural (hRSV) L specificprotein) cytotoxicis highly T-lymphocyte conserved among (CTL) installed, on Mondays and Thursdays, remaining in each residence during 24 hours. The installation site was the CD8 T cell epitopes H-2d-restricted within L sequence covered peridomicile, close to vases or foliage in only different strains, this work aimed at the identification of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

64 Basic Virology: BV one house per block drawn. The houses were chosen dimensional Western blots indicates that ENO1 presents following guidelines for household characteristics such 5 isoforms with different isoeletric points indicating as the presence of covered area for installation of the trap and the presence of small and large vegetation. showed that the distribution of these isoforms differs After removing the trap, the collected mosquitoes were post-translationalbetween control and modifications. infected cells. Comparative Conclusions: analysis The sent to the Laboratory of Vectors SUCEN/FAMERP for infection of HepG2 cells by DENV leads to an increase in alpha-enolase secretion which is dose-dependent but from March 2012 to May 2013, 2,363 Mosquititos it has no effect on ENO1 intracellular content. Our data identificationwere installed, offrom the where species 690 category. females and In the449 periodmales, also suggests that DENV infection ENO1 modulates post- Aedes aegypti, species were collected; totaling 1,139 specimens in 509 traps. Besides this species, 4,929 Culex we will study the effects of ENO1 secreted by infected quinquifasciatus specimens and one Uranotaenia sp were translationaland control cells modifications. on plasminogen In our activation. future investigations, Discussion: present in 586 traps; totaling 6069 captured mosquitoes. The increase of ENO1 secretion by infected cells might Traps were found positive for Aedes aegypti throughout the year. The month with the highest number of collected plasminogen activation promoting haemostatic specimens was January 2013 (86 mosquitoes); following bedysfunction associated and with playing fibrinolysis an important impairment role in throughdengue October 2013 and August 2012 (50 each month), March pathogenesis. Financial Support: CNPq and FAPERJ 2013 and November 2012, 47 and 46 of the vector specimens were collected, respectively. The month with BV372 - Assessment Of The Use Of The the lowest number of collected mosquitoes was April Mosquitito Trap As An Entomological 2012 (2 vector specimens). Therefore, the Mosquitito Surveillance Tool For Aedes Aegypti. can be used as an entomological surveillance tool for Fávaro, E.A., Dibo, M.R., Ricci, L.S., Nogueira, M.L., Parra, Aedes aegypti, to be installed in a certain amount of pre- M.C.P., Cassiano, J.H., Zanforlin, J.R., Chiaravallori-Neto, programmed residences in the city this could guide the F., Mondini, A., Eiras, A.E. activities toward the vector control. 1. Faculdade de Medicina de São José do Rio Preto, BV371 - Dengue Virus Modulates Secretion Famerp, Av Brigadeiro Faria Lima, 5416 Vila São Pedro And Post-Translational Modifications Of 2. Superintendência de Controle de Endemias, SUCEN, Alpha-Enolase In Hepg2 Cells. Av. Philadelpho Manoel Golveia Neto, 3101 Jardim Mona Higa, L.M., Curi, B.M., Zingali, R.B., Da Poian, A.T. 3. Faculdade de Saúde Pública, USP, Av. Professor Lineu Prestes, 2565, Butãnta 1. Instituto de Bioquímica Médica-UFRJ, IBqM, 4. Universidade Estadual Paulista Julio de Mesquita 2. Unidade de Espectrometria de Massas e Proteômica Filho, UNESP, Rod. Araraquara-Jaú Km 1 Machados -UFRJ, UEMP-UFRJ, 5. Universidade Federal de Minas Gerais , UFMG, Av. Introduction: Haemostatic dysfunction is a common Antonio Carlos, 6627, Pampulha feature in the severe forms of the dengue diseases. Previously, our group used a proteomic approach to study Dengue is a viral disease which is spreading worldwide the effects of dengue virus (DENV) infection on protein and infects 50 million people annually. The transmission secretion from HepG2 hepatic cells. We showed that of the disease occurs when infected mosquitoes of the DENV infection alters the secretion of several proteins Aedes aegypti species bite susceptible hosts. The vector including alpha-enolase (ENO1). Recently, ENO1 was is extremely adapted to urban environments, and it can described as a plasminogen receptor that modulates be captured either intra or peridomicile. The use of traps its activation. In this work, we study the effects of to catch adult mosquitoes has been an important tool for DENV infection on the modulation of alpha-enolase entomological surveillance of the vector. The objective of in HepG2 cells. Material and Methods: ENO1 secretion this study is to evaluate the use of the Mosquitito trap as was analyzed by indirect ELISA. To assess cell viability, an entomological surveillance tool for Aedes aegypti. The we performed trypan blue and LDH activity assays. study was conducted in a neighborhood of São José do Western Blot were used to inquire ENO1 intracellular Rio Preto, a city located in the Northwest of the São Paulo content. Two-dimensional gels western blots were used state. Twenty seven Mosquitito traps were installed, on to analyze ENO1 isoforms. Results: Our data show that Mondays and Thursdays, remaining in each residence ENO1 secretion correlates with viral load in a dose- during 24 hours. The installation site was the covered dependent manner. However, DENV infection does not peridomicile, close to vases or foliage in only one house affect the ENO1 intracellular content. Cell viability was per block drawn. The houses were chosen following not affected by DENV up to 24h post-infection. Two- guidelines for household characteristics such as the

65 Basic Virology: BV presence of covered area for installation of the trap and sequences were aligned using the MEGA 4.0 program. the presence of small and large vegetation. After removing The VACV-WR strain (GenBank: AY243312.1) were the trap, the collected mosquitoes were sent to the used as the reference. Our results revealed that 94,7% (36/38) of the analyzed genes possess polymorphisms of the species category. In the period from March 2012 to between GPIV and S2V. Of those genes, three presented LaboratoryMay 2013, 2,363 of Vectors Mosquititos SUCEN/FAMERP were installed, for identification from where one or more synonymous mutation. The remaining 690 females and 449 males, Aedes aegypti, species were divergent genes (n = 33) presented non synonymous collected; totaling 1,139 specimens in 509 traps. Besides mutation that in some cases culminate in premature this species, 4,929 Culex quinquifasciatus specimens stop codon. Some C1 and C2 virulence and host tropism and one Uranotaenia sp were present in 586 traps; totaling 6069 captured mosquitoes. Traps were found and amino acid content. The S2V and GP1V strains positive for Aedes aegypti throughout the year. The genesshared showna nucleotide significant content divergences of 99,2% as in higher the nucleotide as when month with the highest number of collected specimens compared the VACV-BR with other VACV vaccine strains. was January 2013 (86 mosquitoes); following October Although the GP1V has shared a close nucleotide content 2013 and August 2012 (50 each month), March 2013 with VACV-WR, many polymorphisms between them can and November 2012, 47 and 46 of the vector specimens be observed, such as the premature stop codon in the were collected, respectively. The month with the lowest F13L (palmytilated EEV membrane protein) gene of the number of collected mosquitoes was April 2012 (2 vector GP1V, and nucleotide substitutions present in the VACV- specimens). Therefore, the Mosquitito can be used as WR and absent in both GP1V and S2V. All these results, an entomological surveillance tool for Aedes aegypti, reinforce the circulation of more than one VACV subtype to be installed in a certain amount of pre-programmed in Brazil. residences in the city this could guide the activities toward the vector control. BV379 - “Inhibitory Activity Of Dl-Galactans From Criptonemia Seminervis Marine Alga BV374 - The Analysis Of Virulence And Host On Dengue Virus Type 1, In Cell Culture” Tropism Genes Depict The Genetic Diversity Cavalcanti, J.F., Colodi, F., Ferreira, L.G., Mendes, G.S., Between The Two Brazilian Vaccinia Virus Noseda, M.D. , Duarte, M.E.R., Romanos, M.T.V. Clades. Assis, F.L., Ferreira, P.C.P., Trindade, G.S., Drumond, B.P., 1. Universidade Federal de Minas Gerais, UFMG, Av. Kroon, E.G., Abrahão, J.S. Antônio Carlos, 6627, Pampulha, Belo Horizonte/MG, 31270- 901 (31) 3409-3002 1. Universidade Federal de Minas Gerais, UFMG, Av. 2. Universidade Federal de Juiz de Fora, UFJF, Rua José Antônio Carlos, 6627, Pampulha, Belo Horizonte/MG, 31270- Lourenço Kelmer, s/n - Bairro São Pedro, Juiz de Fora/MG, 901 (31) 3409-3002 36036-900 2. Universidade Federal de Juiz de Fora, UFJF, Rua José Lourenço Kelmer, s/n - Bairro São Pedro, Juiz de Fora/MG, Vaccinia virus (VACV) is a zoonotic agent endemic in 36036-900 Brazil. In recent years, VACV has spread to all Brazilian regions by an unknown chain transmission affecting Vaccinia virus (VACV) is a zoonotic agent endemic in dairy cattle and workers in rural villages. Since 1999, Brazil. In recent years, VACV has spread to all Brazilian several VACV strains have been frequently isolated regions by an unknown chain transmission affecting during outbreaks in Brazil and have been featured dairy cattle and workers in rural villages. Since 1999, molecular and biologically. These approaches have several VACV strains have been frequently isolated revealed the presence of two Brazilian VACV (VACV- during outbreaks in Brazil and have been featured BR) clades. The aim of this work was to investigate the molecular and biologically. These approaches have genetic polymorphism between these clades, assessing revealed the presence of two Brazilian VACV (VACV- nucleotide sequences of virulence and host tropism BR) clades. The aim of this work was to investigate the genes. We conducted the sequencing of 38 genes, being genetic polymorphism between these clades, assessing 24 immunomodulatory genes, 11 viral-release related nucleotide sequences of virulence and host tropism genes; 02 kelch-like genes and 07 viral antigenic targets. genes. We conducted the sequencing of 38 genes, being The coding sequences were obtained from VACV-BR 24 immunomodulatory genes, 11 viral-release related strains Serro virus 2 (SV2) (Clade 1) (C1) and Guarani genes; 02 kelch-like genes and 07 viral antigenic targets. P1 virus (GP1V) (Clade 2) (C2) and the nucleic acid The coding sequences were obtained from VACV-BR sequences were aligned using the MEGA 4.0 program. strains Serro virus 2 (SV2) (Clade 1) (C1) and Guarani The VACV-WR strain (GenBank: AY243312.1) were P1 virus (GP1V) (Clade 2) (C2) and the nucleic acid used as the reference. Our results revealed that 94,7% September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

66 Basic Virology: BV

(36/38) of the analyzed genes possess polymorphisms activity, inhibiting The fractions P19, P20, P21 and P22 between GPIV and S2V. Of those genes, three presented presented 94.7%, 99.7%, 88% and 99.5% inhibition on one or more synonymous mutation. The remaining viral particles (virucidal activity), 57.6%, 0%, 32.8% and divergent genes (n = 33) presented non synonymous 5.5% inhibition on the cell receptor and 98.5%, 97.7%, mutation that in some cases culminate in premature 96.4% and 99.9% inhibition during the penetration stop codon. Some C1 and C2 virulence and host tropism events, respectively. Studies are being conducted to determine the activity on events after penetration. and amino acid content. The S2V and GP1V strains These are promising results, since the polysaccharides genesshared showna nucleotide significant content divergences of 99,2% as in higher the nucleotide as when are considered pharmacologically active molecules and compared the VACV-BR with other VACV vaccine strains. can be used in the development of new natural drugs. Although the GP1V has shared a close nucleotide content with VACV-WR, many polymorphisms between them can BV388 - Analysis Of Subcellular be observed, such as the premature stop codon in the Localization Of Oropouche Virus During F13L (palmytilated EEV membrane protein) gene of the Its Replication Cycle In Hela Cells GP1V, and nucleotide substitutions present in the VACV- Mendonça, L.R., Criado, M.F., Silva, M.L., Arruda, E., Da WR and absent in both GP1V and S2V. All these results, Silva, L.L.P. reinforce the circulation of more than one VACV subtype Universidade de São Paulo, USP, Depto. de Biologia in Brazil. Celular e Molecular e Bioagentes Patogênicos - FMRP BV380 - “Antiviral Evaluation Of Sulfated Oropouche virus (OROV) is the second most frequent Polysaccharides From Gayralia Oxysperma cause of arboviral febrile illness in Brazil. Despite its Marine Alga On Dengue Virus Type 1” epidemiological importance, most details about the Cavalcanti, J.F., Duarte, M.E.R., Noseda, M.D. , Mendes, replication cycle of OROV remain unknown. Thus, this G.S., Ducatti, D.R.B., Romanos, M.T.V. study aims to analyze the subcellular localization of 1. Universidade Federal do Rio de Janeiro, UFRJ, Av. OROV during its replication cycle and identify structures Carlos Chagas Filho, 373 - Ilha do Fundão; Rio de Janeiro R.J of the host cell involved in viral assembly and budding. To this end, we inoculated HeLa cells with OROV (M.O.I. CEP: 21949-900 2. Universidade Federal do Paraná, UFPR post-infection (p.i.): 0h, 1h30, 2h30, 4h, 6h, 8h, 10h Dengue and dengue hemorrhagic fever are caused by = 1) and fixed infected cells at the following time points serotypes of dengue virus, which are closely related, by TCID50 and monitored the intracellular presence/ but antigenically different, known as dengue 1 (DENV- and 12h. For each time point, we quantified viral titres 1), dengue 2 (DENV-2), dengue 3 (DENV-3) and dengue using a polyclonal anti-OROV antibody. At 1h30 and 4 (DENV-4). Infection with these viruses produces distribution2h30 p.i., we ofobserved OROV by OROV indirect staining immunofluorescence, spread in puncta a spectrum of clinical symptoms ranging from a through the cytosol. Viral titre was null at these time points, suggesting that the observed staining pattern disease. There are no promising prospects for reversing was from viral proteins recently released after viral nonspecificthe growing framework epidemic toand severe geographical and fatal expansionhemorrhagic of uncoating. At 4h p.i., there was a visible reduction of viral staining and virus titre was still null, indicative the treatment of dengue and frequent epidemics caused of viral eclipse. At 6h and 8h p.i., there was increased dengue.by these Dueviruses, to the the unavailability aim of this study of specific was to drugs evaluate for staining with reticulated pattern spread through the the activity of four sulfated polysaccharide fractions cytosol, especially in the perinuclear region and close to obtained from the Gayralia oxysperma marine alga (crude the plasma membrane. At 6h p.i., supernatant viral titre polysaccharide fraction [P19], P19 partial hydrolysis was 101.75 TCID50/mL, indicating the release of newly [P20], ion exchange chromatography of P20 with 1M synthesized infectious viral particles to the supernatant. [P21] and 1,5M [P22] of NaCl) on the dengue virus type At 10h and 12h p.i., we observed a concentration of OROV 1 biosynthesis, using as model C6/36 cell culture. When staining in large vesicular structures at the perinuclear cytotoxicity was evaluated, all fractions showed CC50 region and also dispersed through the cytosol, possibly values higher than 200 µg/mL (maximum concentration related to virus factories. Altogether, the present results tested). In screening experiments it was observed that provide an initial characterization of the intracellular all fractions showed 99.9% inhibition. This inhibitory distribution of OROV during its replication cycle. These activity can be attributed to the high molecular weight of the fractions and its high degree of sulfation. Regarding the mechanism of action, all fractions presented virucial findings will be complemented in double-staining indirect immunofluorescence assays to compare viral September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

67 Basic Virology: BV

Carvalho, J.V., Da Silva, L.L. structures. Financial support: FAPESP, CNPq localization with specific protein markers of cellular Faculdade de Medicina de Ribeirão Preto USP, FMRP- BV411 - Substances Of Canistrocarpus USP-RP, Av. Bandeirantes 3900 Bairro: Monte Alegre Cervicornis Inhibit Replication In Vitro Nef is an HIV-1 accessory protein that plays important Of Human Immunodeficiency Virus Type 1 roles in progression to AIDS. Nef downregulates cell Barcelos, I.O., Barros, C.S., Teixeira, V.L., Pinho, R.T., surface expression of CD4 and MHC-I in infected cells. Cirne-Santos, C.C., Paixão, I.C.N.P. MHC-I downregulation prevents recognition and 1. Universidade Federal Fluminense , UFF, Rua Outeiro destruction of infected cells by cytotoxic T-cells. Nef de São João Batista, s/nº, Valonguinho - Niterói, RJ - 24.020- 150 resulting in targeting of these proteins to lysosomes 2. Fundação Oswaldo Cruz , Fiocruz, Avenida Brasil, altersfor degradation. the intracellular Although trafficking this effect of MHC-Iof Nef molecules, has been extensively documented, the mechanism by which Nef 4365, Manguinhos - Rio de Janeiro, RJ - 21.040-360 Our aim is to better understand these mechanisms, clinical syndrome resulting from infection by human inducesidentifying changes cellular in MHC-I factors trafficking used by is mostlyNef to unknown.alter the Acquired Immunodeficiency Syndrome (AIDS) is a immunosuppression. HIV infects CD4+ cells and, downregulation of HLA-A2 by Nef, we use HeLa cells immunodeficiencyonce inside a cell, virusintegrates (HIV), its which genetic causes material profound into intracellularthat constitutively trafficking express of MHC-I HLA-A2. (HLA-A2). Flow Tocytometry monitor the genetic material of the host. Currently, available treatment for the disease is HAART, highly active of HLA-A2 and confocal microscopy showed that Nef antiretroviral therapy. However, effective drugs can fail in confirmedcauses redistribution that Nef decreases of these molecules cell surface to endosomes expression an advanced stage due to chronic adverse effects and the and TGN. To better understand the similarities between emergence and transmission of variant strains resistant CD4 and HLA-A2 downregulation, we compared the to the drugs used in treatment. This shows the need for distribution of these poteins in cells expressing Nef and continued efforts in the discovery of new antiretroviral/ found co-localization of CD4 and HLA-A2 in endosomes. anti-HIV agents. The aim of this study is to search In addition, treatment with lysosomal inibitors leads to new substances with anti-HIV-1 activity, seeking new increased CD4 and HLA-A2 colocalization in enlarged strategies and alternatives of treatment to the combat endosomal structures. Next, we tested whether targeting to AIDS. For the study were used substances isolated of MHC-I to lysosomes by Nef requires the activity of from brown alga Canistrocarpus cervicornis which were the ESCRT (endosomal sorting complexes required for denominated C9, C26-2 and C28. Were used MT-2 cells, transport) machinery, by overexpressing either HRS or a which were maintained at 37 °C, 5% of CO2 and used for mutant of the AAA ATPase VPS4 (VPS4 E/Q). Under these cytotoxicity and antiviral assay. For the antiviral assay conditions, HLA-A2 re-localized by Nef, accumulates were used the viral isolated from HIV-1 IIIB. Cytotoxicity in enlarged endosomes containing HSR or VPS4 E/Q. assay was performed by MTT method and antiviral Together, our data indicate that Nef targets MHC-I to assay was assessed by percent inhibition. Results lysosomes via the ESCRT-dependent multivesicular showed that substances were not cytotoxic to the cells. body pathway, a route previously implicated in CD4 C9, C26-2 and C28 presented 492µM, 178µM, 246µM of downregulation. The better understanding of how Nef CC50, respectively. All the substances inhibited the viral replication in a dose-dependent manner. C9 inhibited up shed light on strategies to interfere with the activity of to 99%, whereas C26-2 inhibited up to 80,9% and C28 manipulatesthis viral protein.Financial intracellular support: trafficking FAPESP pathways could inhibited up to 87,5% the replication of HIV-1. Thus, we can conclude that, with the results presented, the natural BV423 - Studies Of Antiviral Activity And substances C9, C26-2 and C28 are promising to continue Cytotoxicity Of Diterpenes Isolated From studies in vitro of their mechanism of action and future Oxoquinoline Derived Marine Brown development of drugs with antiviral action. Financial Algae Using Human Cervical Explants And support: CAPES, CNPq, FAPERJ. Cell Lines. Stephens, P.R.S., Amorim, L.S.C., Ocampo, P.L., Castello- BV414 - Characterization Of Intracellular Branco, L.R., Laneuville, V.T., Batalha, P., Santos, F., Souza, Trafficking Routes Used By The Hiv- M.C., Sako, K., Cunha, A.C., Paixão, I.C.N.P. 1 Nef Protein To Downregulate Main 1. Laboratório de Virologia Molecular - Instituto de Histocompatibility Complex (Mhc) Type I Molecules

68 Basic Virology: BV

Biologia, LVM - IB - UFF, Rua Mário Santos Braga - Ingá, FAMERP, Laboratório de Pesquisa em Virologia, FAMERP, Niterói - RJ, 24020-140 São José do Rio Preto, SP, Brazil 2. Laboratório de Imunologia Clínica - Instituto 2. Universidade Federal do Rio de Janeiro, UFRJ, Oswaldo Cruz, LIC - IOC - Fiocruz, Avenida Brasil, 4365 Laboratório de Genômica Estrutural, Instituto de Biofísica 3. Laboratório de Produtos Naturais de Algas Marinhas, Carlos Chagas Filho LPNAM - IB - UFF, R. Mário Santos Braga - Ingá, Niterói - RJ, 3. FIOCRUZ, FIOCRUZ, Centro de Pesquisas Aggeu 24020-140 Magalhães - CpqAM, Recife 4. Universidade Federal do Rio de Janeiro, Inst. According to UNAIDS 2009, there were more than 33 million people living with HIV worldwide. Brazil has a Microbiologia, UFRJ, Laboratório de Genética e Imunologia population of approximately 192 million inhabitants das Infecções Virais and (from 1980 to 2010) more than 470.000 AIDS cases Yellow Fever Virus NS4b (YFV-NS4b) is a non-structural were diagnosed, with more than 34.000 new cases per protein that is related to viral replication and immune year. Currently, there is no effective HIV/AIDS vaccine evasion, but its precise role and cellular partners are or cure, although the introductions of antiretroviral not yet known. Proteomics has been applied to study of the interaction between virus and the host cell proteins. individuals with access to treatment. However, the We have expressed GST fusion YFV-NS4b protein in drugsemergence significantly of drug-resistant improved viral the prognosisstrains is ofincreasing. infected Therefore numerous studies have been developed, such E. coli, the synthesis of the protein was confirmed by and low-cost anti-HIV substances. The literature has Westernusing GST-NS4b blot and as NS4b-GSTa bait and protein HeLa wascellular purified extracts by asbeen preventive shown that strategies studies in using order the to exfind vivo some model low-toxicity (human affinityto search column. virus-host GST Pull protein down interactionsstudies were usingperformed 1DE cervical explant) are suitable for histopathological coupled to LC-MS/MS. After MS analysis, the proteins analysis as well as for drug testing. The aim of this study is to evaluate the cytotoxicity and anti-viral activity of diterpenes isolated from marine brown algae and identifiedinfection, entry were into classified host cell, by regulation their cellular of viral roles genome based oxoquinoline derivatives in cervical explants (epithelial inreplication, their definition viral transcription, in databases, as:interferon initiation signaling of viral and stromal tissues) and PM-1 cells. We used human pathway, signal transduction, defense response, RNA cervical explants obtained from fertile age women processing, translation, protein maturation, post-Golgi from the Hospital Federal de Bonsucesso (HFB), Rio de vesicle-mediated transport, cell cycle checkpoint and Janeiro, Brazil. Cytotoxicity assays were performed by apoptosis. We have used the Scaffold 3 Software and the MTT 3-(4,5-dimetiltiazol-2-il)2,5-difenil brometo de tetrazolium assay and measurement of ELISA p24 antigen in supernatants from explant cultures and cell 207increased proteins in wereNS4b confirmedpull down in when the pullcompared down assay.with lines treated with marine diterpenes and oxoquinoline Fifty-nine proteins were found to be significantly derivatives and both infected by HIV-1. The diterpenes isolated from marine brown algae and oxoquinoline GSTpathways, alone, as and Antimicrobial the Fisher testResponse, was significant Dermatological for 58 derivatives studied by our group have important effects proteins.Diseases andThe thisIngenuity analysis Systems indicated identified an mTOR 16 pathwaypossible on HIV replication, as we have observed more than 90% inhibitor as a potential inhibitor of CypA. Our results viral inhibition. Cytotoxicity levels lower than 30% were observed in both classes of substances. Further preclinical studies are needed to better evaluate these ofmTOR immunofluorescence pathway inhibitor. and We platesalso evaluated assays showed the role a substances as potential candidates for microbicides or significantof CypA in reductionviral replication in YFV byreplication overexpression when using it in the systemic drugs. Financial Suport: FIOCRUZ, Brazilian BHK LucNeo Replicon YF17D cells treated or not with Ministry of Health, UNESCO, CNPq, FAPERJ, CAPES, Cyclosporine A, and the YFV replication was inhibited FOPESQ-UFF-PROPPI. can provide important information for understanding BV435 - Proteomics Approach Identifies byFlavivirus the CypA biology pathway. and generate Furthermore, potential these targets findings for Cellular Protein That Interacts With Yfv- antiviral drugs. Financial Support: FAPESP, CNPq, Ns4b PRONEX-Dengue, LNBio/CNPEM Vidotto, A., Morais, A.T.S., Pacca, C.C., Mohana-Borges, R., Gil, L.H.V.G., Nogueira, M.L. BV436 - Molecular Characterization Of 1. Faculdade de Medicina de São José do Rio Preto, Occult Infection In Samples With Isolated Anti-Hbc September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

69 Basic Virology: BV

Santos, A.O., Pereira, A.V.C., Botelho, L.P., Virgens, J., 2. Universidade Federal do Rio de Janeiro, UFRJ, Vieira, D.S., Salcedo, J.M.V. Laboratório de Genômica Estrutural, Instituto de Biofísica 1. Fundação Oswaldo Cruz RO , FIOCRUZ-RO –, Da Carlos Chagas Filho Beira, 7671 - BR 364 - Km 3,5 - Bairro: Lagoa 3. Laboratório Dalton de Espectrometria de Massas, 2. Instituto de Pesquisa em Patologias Tropicais, IQ, IQ - UNICAMP, Laboratório Dalton de Espectrometria de IPEPATRO, Da Beira, 7671 - BR 364 - Km 3,5 - Bairro: Lagoa Massas, Instituto de Química, UNICAMP 3. Fundação Universidade Federal de Rondônia, UNIR, Dengue is the most important arbovirus in Brazil and is Campus - BR 364, Km 9,5 also a serious public health problem. The viruses belong to the four serotypes are transmitted mainly by the bite Occult infection with the Hepatitis B virus (HBV) is of Aedes sp mosquitoes. The DENV are composed of a characterized by the presence of viral DNA in the serum single, approximately 11 kb positive-strand RNA genome of HBsAg negative individuals. It is not clear whether that encodes a single polyprotein, which is cleaved into isolated anti-HBc is involved in increasing predisposition three structural proteins, capsid (C), membrane (M) towards occult HBV infection. This study aims to form a and envelop (E), and seven nonstructural proteins, NS1, clinical accompaniment and molecular characterization NS2a, NS2b, NS3, NS4a, NS4b and NS5. The genome of this serological standard, to contribute to the replication occurs in the cell cytoplasm through a knowledge of occult infection, and to elucidate the replication complex involving viral and cellular proteins molecular mechanisms that collaborate to bring about and viral RNA. NS4b is a non-structural protein that is the change in expression of different proteins from HBV. related to viral replication and may also be involved in 40 individuals with isolated anti-HBc and detectable modulation of the activity of NS3 helicase and inhibition HBV DNA in serum were selected. Serological and of the interferon in DENV infections. However, the NS4b molecular tests will be performed on these individuals real role and cellular partners are not known. Proteomics every 6 months for 2 years. First, PCR was performed, has been applied in several instances to the study of the using primers that amplify a fragment of 109bp from the interaction between virus and the host cell proteome. pre-core region. Samples returning a positive result after The aim of this study was to identify interactions between DENV2 NS4b protein and host cellular complete genome. The sequences obtained will then be proteins by Proteomics. The DENV2 NS4b protein was theclustered first PCR with will the be reference submitted sequences for amplification extracted of from the expressed using the pGEX-5X-1 vector, in E. coli BL21 GenBank using Clustal X software, and edited with Se- al software. Phylogenetic analysis will be performed using Monte Carlo Markov Chain (MCMC), using BEAST (DE3). Synthesis of the fusion protein was confirmed by v.1.5.3. Of the 23 samples with isolated anti-HBc gained WesternSDS-PAGE blot to compareanalysis andthe HeLaDENV2 cell NS4b extract was proteins purified that by from DNA extraction and PCR, 12 gave positive results affinityinteracted column. with WeGST-NS4B performed and aGST Pull alone. down The assay bands and differentially pulled were cut out of the gel and submitted sequencing. In Rondonia, Brazil, we do not dispose of in situ digestion using trypsin for subsequent analysis by in the first PCR, and were chosen for complete genome mass spectrometry (MS). The MS data were performed very important to elucidate associated factors, and to a search against NCBInr database and subsequently studies related to this clinical profile. Therefore, it is Scaffold 3.6 software analysis. Thus, it was possible to HBc patient corresponds with cases of occult hepatitis B analyzethat have until the thegreatest serological potential profile pathogenic of the isolated and clinical anti- DENV2, with protein threshold to 90%. Among proteins repercussions, or, conversely, until the development confirm the interaction of 74 proteins in NS4b-GST Pull down assay. We also performed analysis using the greater clinical epidemiologic importance. FINANCIAL was identified polyprotein DENV2, which validates the ofSUPPORT: the serological FIOCRUZ/RO, profile CEPEM/RO results in a pattern of no 26 proteins, among these proteins are myozenin-2 BV443 - Searching For Interactions Between proteinand stanniocalcin-1. threshold to These 95% andproteins the Scaffoldhave been identified poorly Cellular Proteins And Dengue Virus Ns4b studied and functions related to the immune system. Protein Thus, myozenin-2 and stanniocalcin-1 can be targeted Scagion, G.P., Pacca, C.C., Koolen, H.H.F., Mohana- for future validations, since the NS4b is involved on the Borges, R., Gozzo, F.C., Nogueira, M.L., Vidotto, A. interferon signaling inhibition. Therefore, this study may be the starting point to produce new knowledge about 1. Faculdade de Medicina de São José do Rio Preto, the NS4b role in DENV2 pathogenicity and replication FAMERP, Laboratório de Pesquisa em Virologia, Av. and help in developing new strategies for Dengue Brigadeiro Faria Lima, 5416 prevention. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

70 Basic Virology: BV

BV464 - Antiviral Activity Of Extracts 415, Rodovia Ilhéus- Itabuna, Km-16 Solobrinho, Ilhéus - BA, Of Bacteria Isolated From Soils Mounds 45662-000 (73) Against Bovine Viral Diarrhea Virus, 2. Universidade Federal de Minas Geraes, UFMG, Surrogate Model For Hepatitis C Virus Av. Antônio Carlos, 6627, Pampulha Belo Horizonte - MG, Barnabé, A.C.S., Padilla, M.A., Kohn, L.K., Porto, P.S., 31270-901 Morandi, B.C., Menezes, C.B., Fantinatti-Garboggini, F., 3. Fundação Centro de Hematologia e Hemoterapia Uetanabaro, A.P.T., Bomfim, G.F., Arns, C.W. de Minas Gerai, Hemominas, Alameda Ezequiel Dias, 321, 1. Universidade Estadual de Campinas, UNICAMP, Santa Efigênia Belo Horizonte - MG, 30130-110 Departamento de Genética, Evolução e Bioagentes, Instituto de Biologia and can induce leukemia, T-cell lymphoma (ATL) and 2. CPQBA/UNICAMP, CPQBA/UNICAMP HTLV-1HTLV-associated retrovirus myelopathy was the first (HAM to be / isolated TSP). The in humansHTLV-1 3. Universidade Estadual de Santa Cruz, UESC can be transmitted by breastfeeding, during intercourse 4. Universidade Estadual de Feira de Santana, UEFS and through blood transfusions or sharing contaminated Hepatitis C virus (HCV) is an important human pathogen needles and syringes. Transmission of HTLV-1 more that causes acute and chronic hepatitis, evolving effective from men to women and infected women get frequently to cirrhosis and hepatocellular carcinoma. sick more often than men. Greater female susceptibility There is currently no vaccine available and treatment to HAM / TSP is reported in different populations has limited effectiveness; however, research in this area around the world and its cause is unclear although is ongoing. The termites are present in tropical soils recent studies point to a possible hormonal factor. In and have in their bacterial microbiota species as class this context, the aim of this study was to evaluate the Actinobacteria and the genus Bacillus. In the present study, was evaluated the antiviral activity of extracts in human lymphocyte lines permanently infected with of bacteria isolated from soil mounds in northeastern regulationHTLV-1 (C-91PL by 17 β cells)estradiol and of uninfectedthe NFκB pathway cells (Jurkat genes Brazil against bovine viral diarrhea virus (BVDV), as a cells) .Cells were treated with different concentrations surrogate model of HCV. Extracts were obtained from microorganisms isolated from land of termite were is not cytotoxic at the concentrations evaluated. Cell incubated in culture medium for four week at 30°C of 17β estradiol (1μM to 0.0001 µM). The hormone and these inoculums were extracted by liquid-liquid expression of cellular genes related to pathway the extraction with ethyl acetate. Determination of antiviral viability was assessed by flow cytometry (HFS). The activity was based on cytopathic effect inhibition the BVDV virus (100 TCID50/50 µL) after 72 hours of NFκBµM and was 0.01 evaluated µM in C91PL by PCR cells of (CD4 a set + of/ CD25 84 genes + / HTLV- after incubation. Was performed the virus titration technique treatment1 positive) with and 17βJurkat estradiol cells (CD4 in the + /concentrations CD25 + / HTLV-1 of 1 and calculated the percentage of viral inhibition (PI) negative). Altogether 15 genes were regulated. Thus 11 of the samples. 66 extracts were tested, but only one genes regulated in a concentration-dependent manner, extract, CDPA27_1, presented antiviral potential against in which showed a negative regulation in infected cells. BVDV, with 98% of PI. Two extracts, LC32_1 e CDPI07_1, showed toxicity at the concentration tested (50µg/Ml) for the MDBK cell line. The microorganisms from termite Thepathway results during suggest infection that fluctuations with HTLV-1, in contributingestradiol levels to mounds are source of natural products important for may alter the expression of regulatory molecules NFκB pharmaceuticals. Additional studies are necessary to observed in infected individuals, especially in the context evaluate the mechanisms of action and the chemical theof infection processes in women. of inflammation and chronic infection compounds responsible for the activity. Financial BV497 - Cytotoxic And Antiviral (Anti- support: FAPESP/CNPq Hsv-1) Activities Of Extracts Of Clusia BV465 - Modulation Of Cellular Genes Fluminensis Planch & Triana The Nfκb Pathway By 17b-Estradiol In Meneses, L.C., Barcelos, I.O., Giongo, V., Silva, M.C.A., Cell Lines Infected With Htlv-1 (Human Kaplan, M.A.C., Paiva, S.R., Paixão, I.C.N.P. T-Lymphotropic Virus 1). 1. Universidade Federal do Rio de Janeiro, UFRJ, Av. Martins, M.L., Barbosa-Stancioli, E.F., De Carvalho, L., Carlos Chagas Filho, 373. Bl. H, Cidade Universitária, RJ - Souza, J.G., Gomes, R.A., Martins, C.P.S., Fagundes, E.M.S. 21.941-902 1. Universidade Estadual de Santa Cruz, UESC, BR- 2. Universidade Federal Fluminense , UFF, Rua Outeiro

71 Basic Virology: BV de São João Batista, s/nº, Valonguinho - Niterói, RJ - 24.020- impacts of adenoviruses on cells of different organisms, 150 studies evaluating the effect of infectious viral particles on the expression of cellular genes are frequent. Therefore, Herpes simplex virus type 1 (HSV-1) is a virus that has the aim of this study was to evaluate the expression of enveloped double-stranded DNA. The HSV-1 infects four cellular genes involved in cell cycle, in the early mucosal epithelial cells and is able to establish latency phase of infection - 1h post infection (p.i). HAdV-5 was in sensory ganglia. The transmission of this virus occurs inoculated onto human lung carcinoma cell line (A549) reaching the concentrations of 1 and 5 MOI (multiplicity in direct contact with infected secretions. The most of infection). Negative control, mock inoculated cells, whencommon some clinical kind ofmanifestations fissure in the skinare mucocutaneous or mucosa gets was also performed in order to normalize the results. lesions, genital infections, neonatal infections, One hour p.i, total RNA was extracted by a commercial keratoconjunctivitis, encephalitis and gingivostomatitis. kit (Ambion), followed by cDNA synthesis. Real time Prolonged treatment with drugs already known, such PCR was performed using primers that targeted the as acyclovir, favors the emergence of resistant strains, following genes: CCNDBP1, TGFBR1, DHFR and Smurf2; especially in immunocompromised patients. Due to this trend, it is necessary and urgent to develop and search The comparative threshold cycle (Ct) method was for new substances to prevent and treat infections by β-actinused in coding order geneto quantify was used changes as the endogenousin gene expression control. HSV-1. Clusiaceae currently comprises 14 genera, and between the no infected negative control and the is characterized from the chemical point of view the infected groups. Our preliminary results showed that the expression of CCNDBP1 and DHFR genes remained coumarins, terpenoids, among others. In this study, was virtually unchanged at this time point and tested virus presenceevaluated the of activity xanthones, of crude benzophenones, extracts of vegetative flavonoids, and concentrations. Nevertheless, TGFBR1 and Smurf2, a native of the Brazilian coast, in the in vitro replication increase of 9.7 and 3.3 fold, respectively, when compared reproductiveof HSV-1. The parts natural of Clusia extracts fluminensis evaluated Planch showed & Triana, some moleculesto the negative involved control, in thein the TGF-β 5 MOI signaling, concentration. showed This an cytotoxicity compared to positive control, acyclovir, with the exception of hexane extracts of ripe fruit (CFFRH), advance through the cell cycle, what is habitual during leaves methanol (CFFM) and methanolic fruit (CFFRM). wasHAdV an infection. expected These behavior, results since represent TGF-β cascade a previous blocks The extracts showed high inhibition percentage approach regarding the possible impacts of adenoviral against HSV-1, reaching 81,4 to 100% inhibition in infection over transcription in human cell lines. Financial noncytotoxic concentrations (50μg/ml), except for the support:BV530 - I nhibitionCAPES & FAPERGS. Of Dengue Virus Infection dichloromethane extract of flowers (CFFLD), whose By Bovine Lactoferrin CC50idea that = 19μg/ml.the plant Theextracts results represent obtained a valuable with extracts source Pereira, J.G. of Clusiasubstances fluminensis with potential Planch &anti-HSV-1 Triana corroborate activity, being the promising for in vitro studies of its mechanism of action. Universidade Federal do Rio de Janeiro, UFRJ, Av Financial support: CAPES, CNPq, FAPERJ. Carlos Chagas Filho, 373, CCS, Bl E, sl 08, Cid Universitária, RJ, RJ BV517 - Effect Of Adenovirus 5 Infection With The Expression Of Four Genes Bovine lactoferrin (bLf) is a multifunctional iron- Involved In Cell Cycle binding glycoprotein, known for exerting a broad- Giehl, I.C., Rigotto, C., Henzel, A., Staggemeier, R., Dalla spectrum primary defense against bacteria, fungi and Vecchia, A., Jesus, L.F., Bianchi, E., Spilki, F.R. viruses. In order to investigate the mechanism by which bLF exerts its antiviral activity, we evaluated the effects Universidade Feevale, FEEVALE, Rodovia RS 239, of bLf treatment on the infection process of dengue n2755 - sala 205, CEP:93352-000, Novo Hamburgo/RS virus serotype 2 (DENV-2), an arbovirus responsible for hundreds of millions of cases of human infection Adenoviruses are DNA and no enveloped viruses each year. Our results show that bLf was able to inhibit that belong to the Adenoviridae family. Some human infection by DENV-2 in Vero cells without leading to cytotoxic effects. Furthermore, when assessing the (HAdV-5) are causative of respiratory tract infections. stages of viral infection compromised by treatment with adenoviruses,HAdV-5 encodes most several specifically proteins that human can interfere serotype with 5 bLf, we demonstrated that the antiviral action of the cellular mechanisms that regulate cell cycle progression protein occurs predominantly during viral entry into the and apoptosis. In order to understand what might be the cell. Imaging of the early steps of cell infection by DENV-2

72 Basic Virology: BV

than 95% virucidal effect for the partitions acetate, the effect of bLf on the dynamics of this phase of viral labeled with fluorescent probes is underway to evaluate Mastic oil 22%, and acetate of pomegranate did not DENV-2 infection and highlight the antiviral potential of flavonoidspresent virucidal mastic effect. and Crude We conclude Extract that of pomegranate. some of the infection.bLf. Our findings suggest a new approach against partitions in our substances act directly on the virus particle, and we are now assaying for this interaction at BV538 - Effect Of Extracts Schinus the molecular level. FAPERJ, CNPQ, INBEB Terebinthifolius And Punica Granatum On Mayaro Virus Replication. BV540 - Cytotoxic And Anti-Hsv-1 Activities Tiago, S.S., Marcelo, D.F.M., Yamamoto, K.A., Kuster, Of Natural And Synthetic Heterocyclic R.M., Da Silva, M.R.S., Ferreira, D.F. Ribeiro, M., Giongo, V., Borges, J., Pestana, C., Faria, D., Bernardino, A., Teixeira, V., Paixão, I.C.P. 1. Universidade Federal do Rio de Janeiro, UFRJ, Departamento de Virologia, Instituto Microbiologia Prof. Universidade Federal Fluminense, UFF, Outeiro de Paulo de Góes. CCS Saso Joao Batista ss/n - Centro Niterói-Rio de Janeiro- Brasil 2. Universidade Federal do Rio de Janeiro, UFRJ, Infection with herpes simplex virus type 1 is responsible Núcleo de Pesquisas de Produtos Naturais, Centro de Ciências for the development of oral, ocular and genital lesions, da Saúde establishing a lifelong latency in the host subject to 3. Universidade Federal do Rio de Janeiro, UFRJ, periodic reactivations. Despite the use of nucleoside Departamento de Bioquímica, Instituto de Química, Centro analogues, mainly acyclovir as effective therapy, in most Tecnológico cases the prolonged use and immune status of the host can stimulate the emergence of resistance to these Mayaro virus (MAYV) is an arbovirus belonging to the drugs. For this reason the elucidation of new molecules, genus Alphavirus, Togaviridae family which causes a natural or synthetic, that could act in a different step of disease known as Mayaro fever presenting symptoms HSV-1 replication or synergistically with acyclovir are similar to the classic dengue fever. MAYV is endemic in tropical and subtropical regions on the borders of the the potential anti-herpes activity of caulerpina, isolated Amazon Basin. The Brazilian popular medicine has been thefrom main Caulerpa focus ofracemosa viral resistance and quinoline studies. derivatives We identified JV 23(Fluoride radical), JV 28(Chloride and methil radicals) extracted from the plants Schinus terebinthifolius and JV 29( Methil ester and Chloride radicals) in VERO exploring(known as the mastic) anti-inflamatory and Punica properties granatum of (knownsubstances as cells infected with strains AR-29 and KOS. In time of Pomegranate). In this work we tested the antiviral effect addition studies, all the substances quinoline derivatives of these substances against the Alphavirus MAYV. The examined were considered suitable for viral inhibition toxicity of these substances in VERO cells was tested by in the presence of the strain AR29. In the order hand, the incorporation of neutral red after 24h of treatment. the caulerpina only inhibited the replication of HSV-1 The CC50 of each substance was determined: 242, 315, virus in cells infected with KOS strain. The substance JV 29 also showed virucidal activity. Based on our results oil of Schinus, respectively, and 590 and 442 µg/mL we conclude that the caulerpina and substances derived 102for Crudeand 5000 Extract µg/mL and in Acetate acetate, offlavonoids Punica, respectively.1 and 2 and from quinoline JV23, JV28 and JV29 showed promise for After the determination of non-toxic concentrations of anti-HSV-1 activity. the substances, tests were conducted to evaluate the antiviral effect. Cells were infected with MAYV using BV542 - Antiviral Activity Of Synthetic a MOI=0,1. Treatment of cells was carried out for 24h Quinolone Against Bovine Herpesvirus-5 with increasing concentrations of the substances. The Pinto, A.M.V., Leite, J.P.G.L., Santos, F.C., Souza, M.C.B., Paixão, I.C.N.P. of plaque formation. The IC50 of each was determined viralby a productiondose response was graph,quantified and usingwere the4,3; methodology 4,5; 14 and 1. Universidade Federal Fluminense, UFF, Universidade Federal Fluminense, Rua Professor Hernani Melo, 101, São oil of Schinus, respectively, and 12 and 30 µg/mL for Domingos 830Crude µg/mL Extract µg/mL and Acetate for acetate, of Punica, flavonoids respectively. 1 and 2 The and 2. Laboratório de Virologia Comparada, Fundação selectivity index (ratio CC50/IC50), was determined and Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365, Manguinhos, the values were greater than 7 for all substances. We also CEP: 21040-360 Rio de Janeiro tested the substances for virucide properties, adsorption impairment and pretreatment. Our results show more Bovine herpesviruses type 5 (BoHV-5) is an important etiologic agent of meningoencephalitis in cattle and has September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

73 Basic Virology: BV

ISGs, but can also be induced in an IFN independent way several Brazilian states. During the lytic cycle of BoHV-5 directly by viral stress or other stimuli. The Bunyaviridae beenreplication identified the genomein outbreaks is expressed of neurological in three disease temporal in family is composed by a group of more than 300 viruses, phases known as immediate-early, early and late. This mainly transmitted by arthropods, that can cause mild study aimed to evaluate the in vitro cytotoxic effect and the antiviral properties of a series of synthetic and encephalitis to hemorrhagic fever in humans and quinolonecarboxamide and theirs derivatives obtained toare severerecognized conditions as posing varying an increasing from non-specific threat to human fever by chemical synthesis in BoHV-5 RJ42/01 replication. health. So far there is no data linking 2’5’OAS genes to The cytotoxic effect has been measured in Madin- antiviral response against Bunyaviruses. We designed Darbin bovine kidney cells treated with different drug quantitative PCR reactions for detection of all four concentrations. Cytotoxic concentration (CC50) values human 2’5’OAS gene family members and evaluated have been determined for acyclovir: CC50 (989 ± 2.0) the expression of each one in bunyavirus infected cells, and compounds MPD19-Cl CC50 (1798 ± 4.1); MPD31- using VSV infected cells as a positive control. Tahyna and CH3: CC50 (1239 ± 4.5); and MPD59-CH3 CC50 (1046 ± Apeu viruses induced none to very low levels of: each 7.1). Antiviral analyses of the compounds against BoHV- OAS family and IFNs in A549 cells ; OASL in VERO cells 5 RJ42/01 virus consisted in measuring the inhibition of ; each OAS family in PBMCs. In contrast, VSV infections cytopathic effect by plaque assay (PA) and EC50 values, induced higher levels of all these genes. We can conclude determined for acyclovir: EC50 (166 ± 2) and compounds that Tahyna and Apeu viruses are able to evade the IFN MPD19-Cl: EC50 (10 ± 6.2), MPD31-CH3: EC50 (6.0 ± system by inhibiting IFN and OAS genes in infected cells, 1.5) and MPD59- CH3: EC50 ( 42 ± 8.0). Time-of-addition studies revealed blockage virus production in differents potential of these viruses. Financial Support: FAPEMIG, stage of virus replication with exception to the compound aCNPq, finding CAPES. that increases the concern about the emerging MPD 31 that slightly inhibited viral replication in the inhibition of virus replication after 3h p.i. Acyclovir firstwere two used hours as control post infectionslightly reduced but it showed the viral expressive titer. For better understanding about mechanisms of the antiviral activity by these compounds further investigations are underway Financial support: CNPQ/UFF/ FIOCRUZ

BV577 - Tahyna And Apeu Viruses (Bunyaviridae) Are Able To Evade The Interferon Response By Inhibiting Type I Ifns And 2’5’oas Genes Induction Oliveira, D.B., Almeida, G.M.F., Botelho, L.M., Silva, L.K.S., Abrahão, J.S., Bonjardim, C.A., Trindade, G.S., Kroon, E.G., Ferreira, P.C.P. Universidade Federal de Minas Gerais, UFMG, Avenida Antônio Carlos, 6627, Caixa Postal 486, Bloco F4, Sala 258 31270-901 Bel IFNs are cytokines that exerts antiviral and immunomodulatory actions through the regulation of IFN stimulated genes (ISGs). These genes are expressed as a result of intracellular signaling pathways activated by the binding of an IFN to its cellular receptor and are crucial for creating and maintaining a correct immune response. The 2’5’OAS gene family comprises four different genes (OAS1, OAS2, OAS3 and OASL) that can produce up to ten different variants by alternative splicing. 2’5’OAS gene products are latent enzymes with important antiviral activity, since they are able to suppress protein synthesis on virus infected cells. These genes are induced directly by IFN stimulation like other

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV Environmental Virology: EV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

75 Environmental Virology: EV

EV3 - Swine Manure Sanitary Surveillance Silva, L.C.F., Dornas, F.P., Almeida, G.M., Campos, R.K., For Biofertilizing Purposes Boratto,P.V.M., Franco-Luiz, A.P.M., La Scola, B., Ferreira, Fongaro, G., Viancelli, A., Elmahdy, E.M., Pilotto, M.R., P.C.P., Kroon, E.G., Abrahão, J.S. Kunz, A., Barardi, C.R. 1. Universidade Federal de Minas Gerais, UFMG, Av. 1. Universidade Federal de Santa Catarina, UFSC, Antônio Carlos, 6627 - CEP: 31.270-901 Belo Horizonte - MG Campus Universitário Reitor João David Ferreira Lima - - Brasil Trindade Florianópolis 2. Aix Marseille Universite 2. Embrapa Suínos e Aves, Embrapa, Linha Tamanduá Viruses are extremely diverse and abundant and are - Concórdia (SC) present in countless environments. Giant viruses of The use of anaerobic biodigesters (AB) for swine manure the Megavirales order have emerged as a fascinating management allows storage and biogas recovery. The research topic for virologists around the world. As evidence of their ubiquity and ecological impact, depends on safety parameters (presence of pathogens). mimiviruses have been found in multiple environmental finalThis study effluents aimed can to bequantify used asporcine biofertilizers, circovirus but (PCV2) this samples. Currently, the isolation of giant viruses has been and Rotavirus–A (RVA) genomes by qPCR, and total prospected, but it seems to be laborious due the isolation coliforms (TC) and Escherichia coli (EC) by classical protocols limitations and lack of information regarding microbiological methods (MPN) in biofertilizers from the interactions between viruses and substrates. Thus, swine manure. A total of 14 samples were collected this study aimed to verify the stability of Acanthamoeba during the summer/2013 in Concórdia, Brazil, consisting polyphaga mimivirus (APMV) in hospital (ventilator of Biofertilizer A–BFA (farm with nursery production), plastic device tube) and environmental (soil, freshwater and saline water) substrates and validate an enrichment both analyzed before and after AB treatment and protocol for isolation of Mimiviridae. Therefore, to test Biofertilizer B–BFB (farm with grow-finish production) the APMV recovery from the assayed substrates, a total analyzed before AB. Regarding PCV2 presence, all Biofertilizersamples (BFA, C–BFC BFB and(farm BFC) with were grow-finish 100% positive production), before buffered saline (PBS) and added to autoclaved treatment (1x108GC/mL, 3x107GC/mL and 5x107GC/ ofsubstrates, 106 purified which APMV were was previously re-suspended tested in phosphatefor APMV mL, respectively). The treatment process did not show DNA and/or infectious particles. After one hour, all the samples were titrated in Acanthamoeba castellanii BFA and BFB were positive, ranging respectively from by the TCID50 method. Along one year, every month, total2×107 efficiency, to 4×108GC/mL and 25% and and 2x107 100% to of3x109GC/mL. samples on substrates described above, initially added with APMV, Regarding RVA presence, 100% of nursery production were submitted to amoebae titration and Real-Time farm (BFA) were positive before (1x1011GC/mL) and PCR. Furthermore, at the same time, the substrates after treatment (ranging from 2×105 to 2×108GC/mL). added to APMV were submitted to enrichment protocol.

(BFB) before but surprisingly was detected on 50% of rice medium and kept in the dark at room temperature RVAthese was samples not detected after treatment on grow-finish (ranging production from 3x105 farm to Briefly,for 5 days. 500 Followingul of samples this were incubation, added to5000 450 pathogen-ml water- 3x106GC/mL) which can be explained by the different free amoebas were added to the samples, and 5000 sampling times. For BFC, RVA was present in a range of more amoebas were added after twenty days. The 3x107 to 3x1012GC/mL. In addition, treatment process samples were titrated in amoebae after thirty days and then every subsequent month for one year. The effect and RVA reduction observed after AB treatment can of enrichment protocol in biology, morphology and didbe explainednot show efficiencyby the capacity on TC and of ABEC removal.to induce The manure PCV2 genetics of recovered viruses was evaluated by one- precipitation in sludge form, carrying aggregated viral step-growth-curves, electron microscopy and genetic analysis. The enrichment protocol implemented was (biofertilizer). However, these results reinforce the need able that remarkably increased viruses detection from particlesto improve and pathogensreducing the inactivation final viral load in inbiofertilizers, the effluent all tested substrates. Moreover, biological, morphological before their use in agriculture. and genetic tests revealed that the enrichment protocol maintained viral particle reliability. In conclusion, our EV8 - Acanthamoeba Polyphaga Mimivirus work demonstrated a long-lasting stability of APMV Stability In Differents Substrates: in environmental and hospital device samples and Implications For Prospecting Studies proposed a reliable and easy protocol to improve giant viruses isolation.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

76 Environmental Virology: EV

EV79 - Molecular And Biological 1. Universidade Federal de Minas Gerais, UFMG, Av. Characterization Of Kroon Virus A New Presidente Antônio Carlos, 6627, Pampulha, Belo Horizonte, Giant Virus Of The Mimiviridae Family MG, Brasil Isolated From An Urban Lake 2. Universitée de la Méditerranée, Univmed, Marseille, Dornas, F.P., Boratto, P.V.M., Rodrigues, R.A.L., Silva, France L.C.F., Ferreira, P.C.P., Bonjardim, C.A., Trindade, G.S., Kroon, E.G., La Scola, B., Abrahão, J.S. The Mimiviridae family comprises giant DNA viruses, included in nucleocytoplasmic large DNA viruses 1. Universidade Federal de Minas Gerais, UFMG, (NCLDV) group. These viruses infect ubiquitous Av. Antônio Carlos, 6627 - Pampulha 31270-901 - BELO amoeba’s species of Acanthamoeba genus, which HORIZONTE - MG indicate the possibility of these viruses being ubiquitous 2. Universitée de la Méditerranée, Marseille, França, as well. Several studies have been trying the isolation Univmed, Marseille, França of NCLDV in samples of cooling towers, soil, water, etc. Among Brazilian’s biomes, the Amazon rainforest The members of the Mimiviridae have been isolated comprises uncountable species of plants, animals and from samples of water, soil, contact lens, cooling towers, micro-organisms. However, viruses of this biome are etc. Although, despite those studies have demonstrated poorly studied. Thus, the aim of this work is to search for the presence of giant viruses in different ecosystems, viruses of the Mimiviridae family in the Rio Negro River, there is no data regarding giant viruses in Minas Gerais AM, Brazil. Samples were collected at various points of State. Therefore, this work aimed to isolate viruses of the river and submitted to an enrichment process in rice the Mimiviridae family as well as other giant viruses in a lake in Lagoa Santa city, MG, Brazil. Waters samples were equidistantly collected from 14 points of this lake, mediumeluted in andPBS and filtered inoculated afterwards in amoeba (in 200nm (Acanthamoeba filters) in in a total of 5 collection procedure per point (n=70).The ordercastellanii) to retain cultures possible aiming viruses viral in the isolation filter. Samples and, at were the water samples were submitted to an enrichment process same time, submitted to Real-Time PCR assay, for

in Mimiviridae family. The results of Real-Time PCR in PBS and then inoculated in amoebae (Acanthamoeba in rice medium and then were filtered afterwards (in amplificationtests indicated of the the presence viral helicase of the gene, viral a helicasemarker gene 200nmcastellanii) filters) cultures to retain to isolation. the viruses. In parallel,Samples thewere samples eluted in some water samples and one virus was isolated from were submitted to a Real-Time PCR assay, targeting a sample using amoeba cultures and named Amazonia the helicase viral gene, which is conserved in the virus. Phylogenetic analyses were performed using the Mimiviridae family. The PCR results indicated the MEGA 5.0 program and showed virus relationship with the Mimiviridae family indicating that Amazonia virus is samples were positive in isolation tests (all PCR positive a member of the family, representing another giant virus amplificationsamples). We ofselected viral target one viralin 6 samples. sample, Accordingly,named Kroon 2 isolated in Brazil. Additionally, cytopathic effect assays, virus, for further characterization. Biological analyses, optical microscopy and gram stain were done, revealing including cytopathic effect assays, resistances tests, unique characteristics of Amazonia virus. The recently optical microscopy and gram stain have revealing unique isolated virus will be submitted to resistance tests, features of Kroon virus. Electron microscopy imaging one-step growth curve and electronic microscopy for a revealed a giant virus, with dimensions similar to that better biological and morphological characterization. described for other mimiviruses. The helicase gene The isolation of Amazonia virus reinforces the idea sequencing and phylogenetic analyses indicated that that giant viruses are ubiquitious and suggests that Kroon virus belongs to group A mimivirus, clustering these viruses may have some ecological importance. together with APMV, mamavirus and Samba virus. The Key-words: Mimiviridae, Rio Negro River, giant viruses, isolation of Kroon virus, from an urban lake reinforce the virus characterization, virus isolation. Finantial support: idea that giant viruses are ubiquitious and suggests that CNPq, FAPEMIG, CAPES, MAPA, PRPq these viruses may be ecologically important in aquatic ecosystems. EV133 - Detecting Human Pathogenic Viruses On Aquatic Environments: Development EV112 - Amazonia Virus: Another Giant Of A Qpcr Platform For Water Quality Virus Of The Mimiviridae Family Isolated Assessment In The Brazilian Amazon Rainforest Alves, P.A., Brandão, L.R., Almeida, G.M., Fonseca, F.G., Rodrigues, R.A.L., Dornas, F.P., Boratto, P.V.M., Campos, Rosa, C.A., Trindade, G.S. R.K., Silva, L.C.F., Ferreira, P.C.P., Bonjardim, C.A., Trindade, G.S., Kroon, E.G., La Scola, B., Abrahão, J.S. Universidade Federal de Minas Gerais, UFMG, Av. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

77 Environmental Virology: EV

Antônio Carlos, 6627, Campus Pampulha, CEP: 31270-901. collected, from January to December 2012, with two Belo Horizonte, MG fortnightly collections in July. The water samples (two liters) were concentrated by adsorption-elution in Viruses are considered important contaminants of aquatic environments that can, consequently, be silica method. NoVs detection was performed using the important sources for infections such as gastroenteritis. filtering membrane followed by RNA extraction by the However, viruses are not yet included in the parameters primers pair JV13I/JV12Y, and in the second step the commonly evaluated in order to determine water quality. semipair JV13I/GI nested RT-PCR and JV12Y/NoroII-R, method using which in the target first stepthe viral the The most frequent human pathogenic viruses that can be found in water samples are Human adenovirus (HAdV), GII, respectively. A total of 52 samples were collected and Rotavirus A (RVA), Norovirus genus (NoV) and Hepatitis RNA-dependentanalyzed for NoVs RNA presence, polymerase with anda positivity is specific of 38.5%,for GI/ A virus (HAV). The aim of this study was the development of a real time PCR platform for the detection of human as GII and 10% (2/20) as GI+GII. The co-circulation of enteric viruses (HAdV, RVA, NoV and HAV) in aquatic ofboth which genogroups 60% (12/20) was detected were classified in the beaches as GI, 30% of Paraiso (6/20) environments. Positive controls were synthesized, cloned (July) and Murubira (November). The greater number into pGEM-T easy vector (Promega), and used for the of positive samples was detected in the beach of Paraiso validation of the designed primer pairs. Standard curves (n=7), followed by Farol (n=5) and Areiao/Murubira ranging from 1ng to 10.0 fg were prepared, reactions (n=4) beaches. In April, NoVs was detected in all sites were performed using the SYBR® Green PCR Master studied. These results show the circulation of NoVs in the most popular beaches of Mosqueiro Island. This suggests the existence of a probable source of fecal contamination, Mixwere: (Applied HAV (94%; Biosystems), 0,998), RVA and (99%; the 0,996), detected HAdV efficiency (92%; evidencing a risk to human health, mainly by hazard and0,999) linearity and NoV coefficients (105%; 0,983). (R2) for These each initial primer results pair of accidental ingestion during recreational activities, indicate that the platform can be used for detection of especially involving children. To our knowledge, this is the targeted viruses in environmental samples, which will be prepared and used as template for our reactions from Northern of Brazil. in the near future. the first report about the presence of NoVs in beaches EV162 - Evaluation The Use Of Bacteriophages EV139 - Detection Of Noroviruses To Control Of Biofilm Formed By Bacterial Genogroups I And Ii In Bathing Water From Isolates From Reverse Osmosis Systems. Mosqueiro Island, Belém Area, Pará State, Dias, R.S., Fonseca, L.A.B.V., Albanese, J.M., Belgini, Brazil. D.R.B., Siqueira, V.M., Suhette, R., Torres, A.P,R., Sousa, Deus, D.R., Teixeira, D.M., Spada, P.K.P., Correa, V.C., M.P., Silva, C.C., De Paula, S.O. Santos, D.S.A., Girard, R.P., Lopes, L.C., Morais, L.L.C.S., Mascarenhas, J.D.P., Gabbay, Y.B. 1. Universidade Federal de Viçosa, UFV, Universidade Federal de Viçosa – UFV, CP 36570-000 1. Seção De Virologia Do Instituto Evandro Chagas , 2. Research Center for Chemistry, Biology and Iec, Svs, Ms, Br 316 Km 7 Ananindeua, Pará Agriculture , CPQBA, Campinas University - UNICAMP, CP 2. Seção De Meio Ambiente Do Instituto Evandro 6171, CEP 13081-970, Campinas, SP, Brazil Chagas, Iec, Svs, Ms, Br 316 Km 7 Ananindeua, Pará 3. Centro de Pesq. e Desenv. Leopoldo Américo Miguez 3. Universidade Federal Do Pará, Ufpa, R. Augusto de Mello, Cenpes, Federal University of Rio de Janeiro – UFRJ, Corrêa, 1 - Guamá, Belém, Pará CP 21941-915, RJ, Brazil Bathing water quality can be affected by various The current trend in wastewater management by contaminants sources such as dumping of untreated or industries focuses on pollution prevention, either by ineffectively treated sewage. Therefore, these aquatic the reduction of the use of natural resources or the environments can present several viruses, including application of clean technologies with low environmental the noroviruses (NoVs), which are involved in sporadic impacts. In this sense, the technology of reverse osmosis cases of acute gastroenteritis, hospitalizations and (RO) membrane has been widely used by various outbreaks, and can be associated with the contamination of recreational water as well. This study aimed to detect microbial communities that develop adhered to a NoVs genogroups I and II, in bathing water samples, industries,surface and suchsurrounded as petroleum by extracellular refineries. polysaccharides Biofilms are collected from four freshwater beaches (Farol, Murubira, Areiao e Paraiso) located at Mosqueiro Island, Belem assemblages of diverse species occupying the same area, Para State, Brazil. One sample per month was substances. As microbial communities, biofilms are September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

78 Environmental Virology: EV functional discrete environment that have a complex and Maranhão state. These samples were grouped into level of organization with a distinctive and specialized structure and particular activities, which depend on the species, to optimize the analysis. The DNA extractions poolswas performed with 20μL by serum PCI protocol to the each and 5 then, animals were of submitted the same to a Real-Time PCR assay, targeting the helicase viral relationships between their constituents. Since biofilms gene, which is conserved in the Mimiviridae family, using aresettings, very beingdifficult a persistent to eradicate, source the ofability (re)contamination. of bacteria to the Kit Step One® from Applied Biosystem. The pools form biofilms poses a major problem in various industrial samples to the monkeys Cebus apella were positive growth rate of the constituent organisms and the (n=9) and the pools bovines samples (n=15), while all Theinduction impenetrable of resistance character are examples of the biofilm, of mechanisms the slow the samples belonging to Alouatta caraya monkeys were proposed to explain the observed increased endurance negative. Sequencing analyses revealed samples with high identity with mimiviruses and megaviruses isolates. application of bacteriophages has been nowadays seen Although inconclusive in the context of mimiviruses of biofilms to antimicrobial and disinfectant agents. The pathogenesis, our results indicate that giant virus may in waste water treatment plants and RO systems. One be in association with vertebrates in Brazilian Amazon. asbacteriophage a good alternative was isolated to prevent from activated and control sludge. biofilms It was named according to the characteristics of the bacterium EV255 - Evaluation Of Trhee Different and the culture medium in which it was isolated: Concentration Methods To Recovery UFVhalophage01. After the addition of phage, it was Noroviruses From Strawberry Samples Melgaço, F.G., Victoria, M., Corrêa, A.A., Miagostovich, M.P. possible to observe statistically significant reduction in 1. Fundação Oswaldo Cruz, Fiocruz, Av. Brasil, 4365, to the bacterial isolates tested, thus its interference in biofilm biomass of most strains, isolated from RO system Manguinhos, Rio de Janeiro feed water. The UFVhalophage01 phage is not specific 2. Universidade Federal Fluminense, UFF, Rua Prof. biofilmor by infection formation of the maybe cell duewithout to its necessarily ability to causing inhibit Hernani Melo,101, São Domingos, Niterói, RJ biofilmcell lysis. formation Financial mainly Support: by PETROBRASthe action of depolymerase, 3. Universidad de la República Regional Norte, unorte, Rivera, 1350, Salto, Uruguay EV223 - Detection Of Mimivirus And Megavirus Genome In Vertebrate Sera Norovirus (NoV) is the most important agent of food Samples borne outbreaks of acute gastroenteritis and their Rodrigues, F.P., Dornas, F.P., Boratto, P.V.M., Ferreira, P.C.P., Bonjardim, C.A., Trindade, G.S., Kroon, E.G., La Scola, B., Abrahão, J.S. identification in foods is difficult due to the complexity of(skimmed the food milk), matrix. polyethylene This study evaluatedglycol (PEG) the precipitation efficiency of 1. Universidade Federal de Minas Gerais, UFMG, Av. threeand adsorption-elution viral concentration methodsfor Human as organic NoV flocculationGII.4 (NoV Antônio Carlos, 6627 - Pampulha - BELO HORIZONTE - MG GII.4) and Murine Norovirus (MNV-1) recovery from 2. Universitée de la Méditerranée, Marseille, França, Univmed, Marseille, França two buffers (Glycine 0.05M/Tris-HCl 0.1M and PBS) and strawberries samples. For organic flocculation method, The members of the Mimiviridae have been isolated from PEG precipitation method used Glycine 0.05M/Tris- samples of water, soil, contact lens, and cooling towers twoHCl 0.1Mcontainers with 3% (filter beef bag extract and becker)as an elution were buffer.evaluated. The in amoebaes, and the genome has already detected in adsoption-elution method, using negatively charged human. During metagenomic studies, which culminated membranes, was performed with Glycine 0.05M/Tris- with the discovery of Schmallenberg virus, the presence of Mimivirus genomewas demonstrated in sera of Centriprep Concentrator®. The viral RNA was extracted cattle in Europe. In addition to that, many evidences HClby QIAamp 0.1M buffer, viral followingRNA mini an kit® ultrafiltration (Qiagen) and step the using cDNA a support the idea that mimiviruses might be a vertebrate pathogen. Therefore, this work aimed to detect viruses time PCR using primers and probes previously described. of the Mimiviridae family as well as other giant viruses produced. The viral quantification was performed by real in silvatic and domestic animals samples from legal higher recovery success for both viruses independent of Amazon Region. To develop this study, we selected 68 For the flocculation method, the Glycine buffer showed monkeys’ samples to the specie Alouatta caraya, 163 monkey samples to the specie Cebus apella, both from thewhen container compared used. to Considering becker, although the recovery Glycine efficiency buffer the Tocantins state and 134 bovines samples of Pará fordid bothnot provide viruses athe good use resultof filter for bag MNV-1 was morerecovery. efficient The September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

79 Environmental Virology: EV

Virus detection was performed by qPCR using primers that targeted a conserved region (hexon) of the virus combined analysis of success and efficiency of recovery genome. Viable HAdV were detected in 4 water samples determinedrecovery for that GII.4 organic and MNV-1,flocculation respectively. using Glycine The PEGand (4/55 = 8.8% - 3 springs and 1 stream) and 5 sediment filter bag was the best option, with 15.9% and 12.8% samples (5/20= 25% - 2 springs, 2 dams and 1 stream ). (6.4%) and MNV-1 (10.8%) as well the adsorption- The highest incidence of viable HAdV in sediment found methodologyelution method, recovered for GII.4 NoV (0.7%) GII.4 withand aMNV-1 low efficiency (0.9%). in this study suggests that viral particles aggregate to sediment could be more protected and resistant to be the method of choice for recovery those viruses from inactivation when compared to those distributed in the Thesestrawberries results suggestand could that be an organicused assist flocculation epidemiologic should water column. In combination with the cell culture (i.e., investigations of outbreaks associated with NoV. ICC-RT-qPCR) important information concerning virus Financial support: MCTI/CNPq/ANVISA no. 23/2012 e viability were obtained suggesting fecal contamination APQ1/FAPERJ. This research study is under the scope in the Sinos River region, which can pose a risk to public of the activities of Fiocruz as a collaborating center of health. Financial support: CAPES/ FAPERGS/ CNPQ/ PAHO/WHO of Public and Environmental Health. FEEVALE

EV375 - Detection Of Infectious EV376 - Full Genome Sequencing Of Samba Adenoviruses In Water And Sediment Virus: A Giant Virus Of The Mimiviridae Samples In The Rio Dos Sinos Watershed, Rio Family Isolated From Negro River, In The Grande Do Sul State, Brazil. Brazilian Amazon Rainforest Staggemeier, R., Bortoluzzi, M., Heck, T.M.S., Weiler, C., De Assis, F.L., Aguiar, E.R.G.R., Campos, R.K., Boratto, Luz, R.B., Fabres, R.B., Soliman, M.C., Souza, F.G., Fleck, P.V.M., Silva, L.C.F., Ferreira, P.C.P., Marques, J.T., La J.D., Kluge, M., Jesus, L.F., Henzel, A., Rigotto, C., Spilki, Scola, B., Kroon, E.G., Abrahão, J.S. F.R., Almeida, S.E.M. 1. Universidade Federal de Minas Gerais, UFMG, Av. Universidade Feevale, Feevale, RS 239, 2755, Novo Antônio Carlos, 6627, Pampulha, Belo Horizonte/MG, 31270- Hamburgo, RS 901 (31) 3409-3002 The watershed of Rio dos Sinos, northeastern of Rio 2. Université de la Méditerranée - France Grande do Sul, is located in an area of the Guarani The Mimiviridae family comprises giant DNA viruses aquifer where the cities of Rolante and Riozinho are which are studied as putative pneumonia agents in inserted. Enteric viruses in the soil have the ability humans. Recent metagenomic studies have detected to migrate through it by the successive adsorption- DNA of viruses of this family in natural aquatic desorption process, thus, reaching groundwater due to ecosystems. Although the Amazon rainforest is known the penetration of viral particles through soil. Among by its huge biodiversity, viruses of this biome are poorly the enteric viruses, adenoviruses (AdV) have been the studied. Recently, our team isolated a giant viruses from focus of many studies, mainly due to their persistence water samples collected at Rio Negro river, in a region in the environment. The integrated cell culture-reverse near to Manaus. Biological and molecular analysis, such transcription-quantitative PCR (ICC-RT-qPCR) assay as electronic microscopy, PCR and sequencing of viral has been developed for the detection of viable virus gene, indicated the isolation of a new member of the Mimiviridae family, named Samba virus (Samba). In this sensitive approach in detecting infective viruses by study we performed Samba full genome sequencing and particles.combining providingcell culture a relativelyand molecular rapid, techniques.The efficient and main goal of this study was to assess the viral viability was used to de novo genome sequencing using the analysis.454 platform. Purified Genome viral genomicassembly DNA tools (10 revealed micrograms) that water samples. Samples were collected from dairy farms Samba present a genome size of 1.2 Mb, the second ofhumanin the cities AdV of (HAdV) Rolante by and ICC-RT-qPCR Riozinho, in in the sediment watershed and largest viral genome ever described. Samba genome is approximately 50,000 nt larger than APMV. The open- wells, ponds and streams) were concentrated by the reading frames (ORF) predictions were performed using ofnegatively Rio dos charged Sinos. membrane Fifty-five watermethod samples and 20 sediment (springs, Markov-based methods implemented by Glimmer3 samples were directly eluted with E-MEM. To avoid and Fgenes platforms, which predicted 1032 and 1298 citotoxicity, samples were previously diluted 1:2 (water) ORF’s, respectively. We also performed the transfer of and 1:4 (sediment) and inoculated onto A549 cells for annotation (RATT: Rapid Annotation Transfer Tool) 24 hours. After this step, total RNA was extracted by a from a closely genome already annotated. The three commercial kit (Invitek®) followed by cDNA synthesis.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmentalpredictions Virology: were EV manually curated and the ORFs fixed in XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

80 Environmental Virology: EV

Costal Region Influenced By Upwelling putative genes, from which a search to gene similarity was System aconducted. final prediction. Many of Finally, the genes 938 within ORF’s thewere Samba annotated genome as Barbosa, J.E.F., Pereira, P.S., Lorena, L.G.M., Vogel, V.A., had not previously been found in viruses, except in the Ferreira, D.F., Nepomuceno, A., Caprez, M., Amorim, virus of Mimiviridae family, including that putatively L.M.F., Giongo, V., Paixão, I.C.P. encoded proteins with a role in protein translation and involved in DNA repair. Moreover, 442 (47,12%) putative 1. Universidade Federal Fluminense, UFF, Outeiro de genes remains without homologues encoded proteins. In Saso Joao Batista ss/n - Centro Niterói-Rio de Janeiro- Brasil the following months our group will study the function 2. FIOCRUZ, IOC, Av. Brasil -Rio de Janeiro of Samba hypothetical genes, aiming to associate them 3. Universidade Federal do Rio de Janeiro, UFRJ, with viral structure and host-virus relashionships. Avenida Brasil-Rio de Janeiro-Brasil EV377 - Evaluation Of Removal Efficiency Of Marine viruses are among the most common, abundant Enteric Viruses By Secondary Treatment, and diverse biological entities living in the seawater Activated Sludge, In A Sewage Treatment column. In spite of this fact little is yet know about Plant In Rio Grande Do Sul virus abundance and distribution in tropical aquatic Fabres, R.B., Fontana, T., Soliman, M.C., Staggemeier, ecosystems and in particular there are no studies R. Kluge, M., Rodrigues, M.T., Bortoluzzi, M. Fleck, J.D., Rigotto, C., Henzel. A., Nascimento, C.A., Giehl, I., controlling their spatial and seasonal distribution. Here, Vecchia, A., Spilki, F.R., concerning the influence of environmental factors relationships with hosts and environments variables in Universidade Feevale, Feevale, RS 239, 2755, Novo wethe evaluatedupwelling for region the first of Arraialtime virus do abundanceCabo coastal and region their Hamburgo, RS of Rio de Janeiro State, Brazil. Seawater samples were The waste water treatment systems are usually divided into preliminary treatment, primary, secondary and sampling stations. We have also compared two different possibly tertiary. Secondary treatment is also called takenviral abundance during four counting seasons methodscampaigns (EFM of a versusseries ofFCM), five biological features as main characteristic the removal of organic dissolved (soluble BOD) and suspended (suspended or particulate BOD). The objective of showingVirioplankton that the abundance greatest efficiencyranged from counts 0.79 was to 7.95 obtained x108 whenpart.ml-1, we usedwhereas the bacteriopankton FCM counting protocol abundance (P < ranged 0.05). Human adenovirus (HAdV) inactivated sludge after from 2.6 to 13.4 x 107 cell.ml-1. The distribution of viruses were evaluated in relation to their possible host, being thissecondary study wastreatment to evaluate in a theSewage removal treatment efficiency plant of located in Canoas, RS. Sewage samples were collected viral abundance positive correlated with both bacteria after primary and tertiary treatment between 2011 and 2012, totalizing 10 samples. Viral nucleic acids were In this study, PCR primers CPS1/CPS2 were successful extracted with a commercial kit (RTP DNA/RNA Virus (rin =yielding 0.65; P PCR< 0.01) products and chlorophyll-a of approximately (r = 0.61; 165 P bp <0.01). from Mini Kit) and the real time polymerase chain reaction virus communities concentrates from sampling sites (qPCR) was performed using primers design to amplify studied. Our TEM approach on virioplankton diversity the hexon protein gene of HAdV, namely VTB2 HAdVCf were grouped according size classes based on the (5’-GAGACGTACTTCAGCCTGAAT-3’) and VTB2 HAdVCr diameter of the heads, with the dominant virioplankton (5’-GATGAACCGCAGCGTCAA-3’). Our results showed capsid diameter in the range of 30–60 nm. Principal that all samples after preliminary treatment were component analysis showed a clear evidence that there positive for HAdV with minimum and maximum values ranging from 4.0x10³ genomic copies/mL (gc/mL) and Arraial do Cabo and that high abundances of viruses were iscorrelated a seasonal mainly influence with ininorganic biotic and forms abiotic (NO2-and variables NO3- of for the activated sludge secondary treatment was very ), PO43-, chlorophyll-a and bacteria. Thus, our seasonal- spatial study indicated that viral abundance in Arraial do 5.2x104gc/mL.low, since the reduction The HAdV on removal genomic efficacy copies observedbetween the two treatment steps was below 1 log. In this study, Cabo coastal region depends on hosts cells abundances, activated sludge secondary treatment was ineffective for which are controlled mainly by nutrient availability. removal of HAdV in domestic sewage. Financial support: EV510 - Thermal And Temporal Stability Of FAPERGS, CAPES, CNPQ, Feevale. Human Adenoviruses In Fresh Water EV387 - Seasonal-Spatial Assessment Of Moresco, V., Damazo, N.A., Pilotto, M.R., Barardi, C.R.M. Virioplankton Abundance In A Brazilian

81 Environmental Virology: EV

Universidade Federal de Santa Catarina, UFSC, 3. Instituto Gulbenkian de Ciência, IGC, Rua da Quinta Laboratório de Virologia Aplicada, MIP, CCB, UFSC Grande, 6 2780-156 Oeiras, Portugal Surface waters are constantly contaminated by enteric Vaccinia virus (VACV), a member of the family Poxviridae viruses introduced in the aquatic environment. The and genus Orthopoxvirus (OPV), is the etiological agent temperature can contribute to viral inactivation, of a zoonosis called Bovine Vaccinia (BV) in Brazil. however, the real stability of the enteric viruses in these Outbreaks of BV are often reported in small dairy environments is not entirely known. Human adenoviruses properties, affecting both cattle and milkers. Although (HAdV) are one of the most persistent enteric viruses in the aquatic environment and are responsible for several little is known about the circulation of VACV in nature waterborne outbreaks. Current methods used to detect researchesand urbanized have locations.clarified many Studies aspects showed of the that infection, VACV HAdV in water samples are usually based on molecular has a wide range of hosts and it’s notable that wild and techniques, although these methods do not predict viral domestic animal may have direct or indirect contact infectivity. An alternative to evaluate the stability of with cattle. Abrahão et al. proposed an important role infectious viruses is to infect permissive cells in vitro. The aim of this study was to evaluate the thermal and infected Mus musculus during an outbreak in Marina temporal stability of HAdV2 seeded in fresh water and forcity, smallMinas rodents Gerais instate BV epidemiology(MG). Considering after that finding other an OPV have rodents as their reservoirs and emphasizing (FACS) and plaque assay (PFU). Fresh water samples Cowpox virus’ urban circulation among small rodents, storedwere seeded in different with known temperatures amounts using of HAdV2 flow and cytometry stored our group attempted to assess VACV possible circulation at +22°C, +4, -20 and -80°C. The stability was evaluated in mice (M. musculus) from three different urban areas at at time zero (T0), and after 5 (T5), 10 (T10), 15 (T15) MG. Twelve mice were trapped with size selective traps and 30 (T30) days of storage, in triplicates. The log at the cities of Belo Horizonte, Sabará and Ouro Preto. reduction (log10 = Nt/N0) of viral titres obtained in Blood, toraxic and abdominal viscera were sampled. RNA each temperature and respective assay were compared extraction was performed for blood samples (gathered in with original viral titres at T0. FACS assay showed a 3.73 pools), each subsequently submitted to cDNA synthesis. log10 overall reduction in the samples stored at +22°C A real time PCR was then conducted to target a fragment at T30, being observed an average of 1 log reduction in of a conserved gene among OPV, the VACV growth factor each time. Samples stored at +4, -20 and -80°C showed an gene or vgf. Our preliminary results show that one pool average of 1.70 log10 reduction at T5, with no subsequent is positive for vgf qPCR. It is a new data related to the viruses decay until T30. PFU assay, demonstrated 0.4 epidemiology of VACV since its circulation in urbanized log10 reduction for samples stored at +22°C at T30 with areas has never been reported before. Our results call no reductions in the other temperatures evaluated. Due attention to a non-explored side of VACV’s epidemiology to the difference of infectivity analysis between the two and encourage further investigation to assess whether assays resulting in different values of log10 reduction, VACV circulates frequently among urban rodents. If so, both were able to demonstrate a temporal HAdV decay why VACV’s reports are not found in Brazilian urban when stored at +22°C and a high viral stability in lower areas as seen for other zoonosis which also involve mice? temperatures, including +4°C. The present work will Analyses by nPCR and attempts to isolate the virus will continue evaluating the samples stored up to 180 days. be performed to corroborate the results obtained so far. Financial support: CNPq Universal 471755/2011-7; CAPES EV637 - Standardization Of The Optimal Period Of Human Adenovirus EV544 - Changing The Paradigm: Detection Bioaccumulation By Oysters Crassostrea Of Vaccinia Virus In Urban Areas In The Gigas Evaluated By Different Cell Culture State Of Minas Gerais, Brazil Techniques Miranda, J.B., Müller, U.B., Borges, I.A., Ambrósio, L.L.D., Pilotto, M.R., Moresco, V., Barardi, C.R.M. Ferreira, P.C.P., Bonjardim, C.A., Abrahão, J.S., Kroon, E.G., Howard, J.C., Trindade, G.S. Universidade Federal de Santa Catarina, UFSC, Campus Universitário Reitor João David Ferreira Lima, CEP 1. Universidade Federal de Minas Gerais, UFMG, 88040-900 Av. Antônio Carlos, 6627, Pampulha Belo Horizonte - MG, 31270-901 2. Universität zu Köln, , Frangenheimstraße 4 50931 Bivalveof water shellfish,and are able such to as accumulate oysters, are and filter concentrate feeding Köln, Alemanha animals.in their tissuesAs a consequence, different types they of can pathogens filter large from volumes fecal

82 Environmental Virology: EV origin, including enteric viruses. Rates of pathogens bioaccumulation can be affected by various environmental factors for instance, temperature, salinity, etc. When conducted in laboratory scale for research purposes, bioaccumulation assays must be carefully undertaken in order to reach good and reproducible results. The aim of this study was to standardize the optimal period of human adenovirus type 2 (HAdV-2) bioaccumulation by oysters Crassostrea gigas for subsequent depuration and viral stability studies. Oysters were placed in a 20L aquarium containing predetermined amounts of HAdV-2 for bioaccumulation and were harvested after 3h, 8h and 24h. One aquarium without virus was used as negative control. The oysters were opened, the digestive glands were dissected and tissue extracts were prepared by an absorption-elution protocol using PEG precipitation according to the method already. The amount of HAdV-2 present on tissue extracts were evaluated by two different cellular techniques in order to check viral presence and infectivity: plaque assay and ICC-RT-qPCR (integrated cell culture preceded by reverse transcription quantitative PCR) assay. The results of HAdV-2 bioacumulation by oysters after 3h, 8h and 24h were respectively: 1,30 x 104 PFU/g (plaque forming unit per gram of oyster) and 1,95 x 105 GC/g (genome copies per gram of oyster); 6.2 x 104 PFU/g and 1.46 x 106 GC/g and 4.7 x 102 PFU/ g and 1.53 x 105 GC/g. Both assays were able to determine that, the 8h period of HAdV-2 uptake was the optimal one and, after 24h, oysters started to release viral particles from their tissues. This standardized protocol will be applied for depuration studies and thermal stability of the virus in oyster tissues after depuration. Financial support: CNPq Universal 471755/2011-7; CAPES

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV HUMAN VIROLOGY -HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

84 Human Virology: HV

HV1 - Incidence, Genotypic Costa, G.B., Borges, I.A., Miranda, J.B., Augusto, L.T.S., Characterization And Determination Ferreira, P.C.P., Moreno, E.C., Abrahão, J.S., Kroon, E.G., Of The Dynamics Of Excretion Of Human Trindade, G.S. Polyomavirus In Urine Samples Of Healthy Individuals. 1. Laboratório de Vírus, Departamento de Urbano, P.R.P., Oliveira, R.R., Romano, C.M., Fink, Microbiologia ICB/UFMG, UFMG, Avenida Antônio Carlos, M.C.D.S., Pannuti, C.S. 6627, Pampulha Belo Horizonte 2. Instituto Mineiro de Agropecuária, IMA, Rua da Instituto de Medicina Tropical, IMTUSP , R. Dr. Enéas Maria Amélia, 93, Centro, Serro Carvalho de Aguiar 470, prédio 1, 2 andar 3. Fundação Hemominas, HEMOMINAS, Rua Grão The Polyomavirus JC and BK are the most important Pará, 882, Santa Efigênia, Belo Horizonte members of Polyomaviridae family, genus Vaccinia virus was used as vaccine in smallpox Orthopolyomavirus, due to their degree of pathogenicity eradication campaign. Nowadays, the vaccination just in humans. The human polyomavirus JC (JCV) was continues in USA and Europe, applied to militaries and isolated from a fragment of the brain of a patient laboratory workers, and infections are reported by with Hodgkin’s lymphoma and progressive multifocal the contact with recent vaccinated people. Currently, leukoencephalopathy by Padgett et al. On the other in Brazil, VACV is responsible to cause outbreaks of hand the human polyomavirus BK was also isolated in an exanthematic disease known as Bovine Vaccinia 1971 by Gardner et al from the urine of a patient who (BV). The aim of this study was to report a household underwent renal transplantation in VERO cell line. transmission case occurred after a BV outbreak. It was There are few data on human polyomavirus JC and BK in collected 5 serum samples from a family (father, mother healthy individuals on the world and in Brazil. Moreover and 3 daughters) living in a rural area of Minas Gerais the forms of excretion and transmission of these State and lesions swab samples from the father who’s viruses are not yet fully elucidated. This study aimed had lesions similar those observed in BV’s outbreaks. to determine the incidence, the dynamics of excretion, Also, the father related signals and symptoms like and the molecular characterization of polyomavirus JC fever, headache, myalgia and lymphadenopathy. and BK in serial samples of urine of healthy individuals. Epidemiological data was also analyzed. Serological A secondary objective was to analyze phylogenetically diagnosis for neutralizing antibodies anti-OPV was the subtypes of the viruses found during the study. Were realized by plaque reduction neutralizing test. Three included 71 patients of both genders, aged from 21 to serum samples (father, mother and one daughter) were 65 years-old. Urine samples were collected every month positives, with antibodies titer ranging from 800 to for six months. All samples in the study were screened 3200 neutralizing units/mL. Real time PCR was realized from serum and swab samples and showed one positive sample, from another daughter. The epidemiological fragment of the gene of VP1 protein of the virus. At the by a real time PCR which amplifies a fragment of the T data showed that the father and mother were vaccinated end of 6 months of follow-up, the incidence of urinary antigen gene, and to a conventional PCR that amplifies a during the smallpox eradication campaign and have excretion of polyomaviruses BKV and JCV in the study the vaccine take. Besides, they have daily contact with population was 53.52% and 64.79% respectively The cattle and horses, and make cheese from raw milk. Only the father practice hand milking. Their daughters cases, intermittent in 8% and sporadic in 50% of cases. don’t practice activities that demonstrate exposition to profile of excretion of JCV was continuous in 42% of VACV. BV is an emerging infectious disease that is often in 80% of cases, intermittent in 17% and continuous in reported in Brazil, however, control measures to avoid only 3% of cases. Subsequently, the positive samples The profile of excretion of BKV was shown to be sporadic environmental virus dissemination are not well-known were sequenced and analyzed phylogenetically showing by the vulnerable population. Our data show a small BV that the more prevalent genotypes were JCV 1, subtype outbreak and suggest a possible household transmission, 1b and 3, followed by genotype 1, subtypes 1a and 4. once was detected DNAemia and anti-OPV antibodies in Regarding the BKV genotype 1 subtype 1a was the most prevalent, followed by 4 and 1, subtype 1b regarding of the spreading of the infection in rural areas. HV4 - Orthopoxvirus Household twoFinancial daughters. support: This CNPq, case FAPEMIGreflects the lack of knowledge Transmission In A Family Resident In A HV5 - Evidence Of Orthopoxvirus Bovine Vaccinia Endemic Rural Area Circulation In A Vulnerable Rural Population In Minas Gerais State

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

85 Human Virology: HV

Costa, G.B., Borges, I.A., Miranda, J.B., Augusto, L.T.S., 1. Instituto de Ciências Biomédicas, USP, ICB-USP, Av Ferreira, P.C.P., Abrahão, J.S., Kroon, E.G., Moreno, E.C., Prof Lineu Prestes 1374 sala 225, São Paulo, SP. cep 05508-000 Trindade, G.S. 2. Hospital Universitario, Universidade de Sao Paulo, 1. Laboratório de Vírus, Departamento de HU-USP, São Paulo Microbiologia ICB/UFMG, UFMG, Avenida Antônio Carlos, 3. Centro Medico Sao Francisco, CMSF, Curitiba 6627, Pampulha Belo Horizonte 4. Nucleo de Pesquisas em Geriatria Clınica e 2. Instituto Mineiro de Agropecuária, IMA, Rua da Prevenção, NPGCP-UNIFESP, São Paulo Maria Amélia, 93, Centro, Serro 3. Fundação Hemominas, HEMOMINAS, Rua Grão illness having outbreaks of varying severity with the Pará, 882, Santa Efigênia, Belo Horizonte Influenzawinter months is an heavily acute, affecting typically children febrile, and respiratorythe elderly. In Brazil, Vaccinia virus, which is included in Orthopoxvirus (OPV) genera, is responsible for a Whilethe rates both of Influenzahospitalization type A for and lower B can respiratory cause epidemic tract disease called Bovine Vaccinia (BV), characterized by outbreaks,disease amongst Influenza infants A outbreaksand children. generally Due to increasesa higher vesiculopustular infections in dairy cattle and horses, mortality rate it is essential to differentiation between as well as in humans. Infections can occur after direct contact with animals naturally infected. Besides, wild and preventable by vaccination and can now be managed peridomestic rodents can be involved in the transmission Influenza and other respiratory viruses. The virus is of this disease. The aim of this study was to investigate the diagnostic performances of three enzyme-linked withimmunosorbent specific antivirals. assays; ThisDirectigen study aimedEZ Flu to A+B compare (BD, rural area to BV, evaluating the humoral immunity and the immunologicalexposure factors profile involved of people in livingpossible in aninfections. endemic It was conducted an epidemiological survey and 240 Maryland,Pandemic USA),(Bioeasy, QuickVue Belo Horizonte, Influenza A+BBRA) test with (Quidel, viral human sera samples were collected. The population San Diego, USA) and Bioeasy Influenza Ag A/B/A H1N1 comprises 127 (52.9%) men and 113 (47.1%) women, aged from 5 to 90 years. Of these individuals, 185 (77%) culturetests were (Influenza performed A) in and accordance clinical to samples the manufacturer (Influenza had contact with cattle and horses, 114 (47.5%) practice B) previously quantified by Real-time RT PCR. All the milking, 213 (88.8%) consume unpasteurized milk or raw cheese. Besides, 128 individuals (53.3%) have instructions.T-25 (ct = 23.22) For the isolated first test in we MDCK used a cellsseries with of dilutions a viral a vaccination history, where only 77 (32%) have the (1,load 1/5, of 1.04e5 1/10, copies 1/20, 1/40)of DNA of to thecompare Influenza the diagnostic A sample vaccine take. Humoral immunity was checked by plaque performances of the Directigen and the QuickVue. With reduction neutralizing test, considering positives the the second test we used the same methodology for samples that reduced in 50% the number of plaques found in virus control (positive control). It was found (ct = 30.06) with a viral load of 4.15e3 copies of DNA that 74 (30.8%) individuals have neutralizing antibodies Influenzato compare B clinicalthe Directigen nasopharyngeal and the washBioeasy. sample Our R-950study anti-OPV. The antibodies titers of positive individuals demonstrated the effectiveness of the test by returning ranged from 100 to 6400 neutralizing units/ml. In Brazil, no invalid results (n=20) from heavily diluted samples. after smallpox eradication, the vaccination that confers immunity against OPV was discontinued and several dilution by Directigen and 10 fold by QuickVue while outbreaks have been described in several regions of the The detection of Influenza A ranged from a 20 fold country. Our data reveal a low number of seropositive individuals, and even those with vaccine take (n = InfluenzaDirectigen B has had a a higher 5 fold diagnosticdilution for yield both than Directgen QuickVue and 77), with vaccination history, only 44 were positives, Bioeasy assays. In conclusion, our findings suggests that indicating some residual OPV immune response. Therefore, we can’t exclude the OPV circulation in forand influenza speed with virus results type Abeing and theobtained same yieldwithin that 15 Bioeasy and 20 rural areas and neither the population vulnerability to forminutes, influenza including B virus. labor All and assays incubate showed time. good accuracy infection. Financial support: CNPq, FAPEMIG HV10 - Antigen-Antibody Dissociation HV9 - Phenotypic And Genotypic Significantly Improves The Ns1 Capture Characterization Of Influenza A/H1n1 Elisa Sensitivity For Dengue Virus Type 4 Pandemic Virus Diagnosis In Brazil Thomazelli, L.M., Oliveira, D.B.L., Macedo, P.V., Lotufo, Lima, M.R.Q., Nogueira, R.M.R., De Filippis, A.M.B., J.P.B., Cunha, C.A., Neto, J.T., Durigon, E.L. Nunes, P.C.G., Sousa, C.S., Heringe, M., Dos Santos, F.B.

86 Human Virology: HV

Oswaldo Cruz Institute / FIOCRUZ, IOC, Av Brasil, The genus Orthobunyavirus, family Bunyaviridae 4365, Rio de Janeiro comprises several arboviruses already detected in Brazil. Oropouche (OROV) is considered the most In Brazil, dengue became a public health problem after prevalent arbovirus after Dengue virus in the country, the introduction of DENV-1 in 1986. In July of 2010, DENV- being the most prevalent in the Amazon region. 4 was isolated in Roraima. The detection of DENV NS1 Epidemiological situation of these viruses in MT is as an alternative method useful for the early diagnosis unknown. RNA was extracted with QIAmp viral RNA kit of dengue has been shown. However, in secondary from serum samples of 604 patients with acute febrile infections NS1 is less likely to be available for capture illness from Mato Grosso (2012). Pools of adult female in an immunoassay due to immune-complex formation. Culex quinquefasciatus (n=319) and Culex sp. (n=138) We aimed to analyze the NS1 ELISA sensitivity for early were collected with Nasci aspirators and hand net in diagnosis of DENV-4 cases recently reported and aiming 200 points in Cuiabá between January and April, 2013. to improve the sensitivity, results were compared to Total RNA was extracted (Trizol) from 50 pools of Culex those by dissociating immune complexes from primary quinquefasciatus and 5 of Culex sp. RNA from human samples (n=604) and mosquitoes pools (n=55) were virus isolation and/or were analyzed. The IgG—ELISA submitted to reverse transcription (Superscript III) andwas secondaryperformed cases. immune DENV-4 response sera (n=471)characterization. confirmed The by with primer BUN-S (Orthobunyavirus; segment S). The Platelia™ Dengue NS1 Ag-ELISA (BioRad Laboratories) cDNA of 98 human samples and 55 pools of mosquitoes was used for NS1 capture. To improve the test sensitivity, were submitted to N-RT-PCR with primers BUN-C/ two dissociation protocols were used: acid (AD) and BUN-S and BS-C e BS-S, this latter amplify the segment heat-meadiated (HD). Positive NS1 was observed in S of Simbu group orthobunyaviruses (300 bp). Results 54.38% of primary and 39.07% of secondary cases. The demonstrate 1/98 (1%) human sample from Cuiabá and overall NS1 assay sensitivity increased to 70.48% and 2/50 (4,0%) pool of Culex quinquefasciatus positive for 77.49% (p=0,017), after the AD and HD procedures, an Orthobunyavirus from Simbu group. The sequences (mosquitoes and human sample) presented 84-94% of sensitivity increase was observed in primary (82.01%) identity with OROV sequences from IEC/Para. In urban respectively.and secondary After cases the (73.10%, HD procedure, p=0,002).The a significant NS1 assay NS1 centers, Culicoides paraensis and Culex quinquefasciatus results should be interpreted with caution when used are considered vectors for OROV. C. quinquefasciatus alone due to the false negative results and the addition is an excellent reservatory, transmitting OROV only in of a HD step prior to the assay to improve the sensitivity high viremic levels. Oropouche fever is clinically similar on endemic areas where secondary infections are more but milder than Dengue Fever and, serology has been frequently reported is suggested. Support by: CAPES, demonstrated in humans in two cities from Pará in the CNPq, FAPERJ, PAPES VI, FIOCRUZ, MS border with MT, affected by Cuiabá-Santarém highway.

HV16 - Investigation Of Orthobunyavirus with funds from CAPES, CNPq and PROPEQ / UFMT. Circulation In Humans With Febrile Acute This is the first report of OROV in MT. * Project developed Illness And In Culex Quinquefasciatus HV17 - Virological Surveillance Of Mosquitoes In Mato Grosso, Brazil Adult Mosquitoes Naturally Infected Cardoso, B.F., Serra, O.P., Zuchi, N., Heinen, L.B.S., With Arboviruses From Alphavirus And Gondim, B.H., Pereira, F.C., Santos, F.A.L., Santos, Flavivirus Genus In Cuiabá, Mato Grosso, M.A.M., Souto, F.J.D., Dezengrini-Slhessarenko, R. Brazil 1. Laboratório Central de Saúde Pública do Mato Serra, O.P., Cardoso, B.F., Gondim, B.H.F., Heinen, L.B.S., Grosso, MT- Laboratório, R Tenente Thogo da Silva Pereira Pereira, F.C., Zuchi, N., Santos, F.A.L. , Rodrigues, J.S.V., Ribeiro, A.L.M., Myiazaki, R.D., Dezengrini-Slhessarenko, 63 - Centro Sul - Cuiabá/MT R. 2. Universidade Federal de Mato Grosso, UFMT, Av. Fernando Corrêa da Costa, nº 2367 - Bairro Boa Esperança. 1. Universidade Federal do Mato Grosso, UFMT, Av. Cuiabá - MT Fernando Corrêa da Costa, nº 2367 - Bairro Boa Esperança. 3. Secretária de Vigilância em Saúde, SVS, Centro Cuiabá - MT Político Administrativo, Palácio Paiaguas, Bloco D. Cuiabá/ 2. Hospital Universitário Júlio Muller, HUJM, Rua Luís MT Philippe Pereira Leite, S/N - Alvorada - Cuiabá-MT 4. Secretária Estadual de Saúde, SES, R. Treze de Junho, Arbovírus are transmitted by hematophagus arthropods, 1055 - Centro Sul Cuiabá - MT circulating in nature in cycles involving vectors, hosts and reservoirs. The aim of this study is to determine the September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

87 Human Virology: HV variety and frequency of mosquitoes naturally infected Entomological surveillance has proven to be an with arboviruses from genus Alphavirus and Flavivirus important strategy for monitoring Culicidae species in Cuiabá. To achieve that, we collected mosquitoes in tropical areas and, to predict the risk of human in three residencies from 200 points determined by exposure to arboviruses. In this preliminary study, we the urban census map (IBGE) and GPS locators, using collected adult mosquitoes in 200 locations from Cuiabá, Nasci aspirators and hand net. Mosquitoes where determined with GPS and IBGE maps. Using Nasci aspirators, we collected 1603 pools (1-10 mosquitoes), in pools (1-10 mosquitoes) according to species, sex 795 female, 808 male, between Jan-Apr/2013. 403 identifiedand point withof collection dichotomy and key stored at specific at -80°C. level, 1603 allocated pools are Aedes aegypti, 2 Aedes albopictus, 748 Culex sp, where obtained, 795 are hematophagus female pools, 319 C quinquefasciatus, 5 C bidens interfor, 95 C comp comprising A aegypti (207), A albopictus (1), Aedes pipiens, 1 C spinosus, 11 Psorophora var. albigenu, 1 sp (1), C quinquefasciatus (319), C comp pipiens (95), Psorophora ciliata, 6 Psorophora sp, 2 Mansonia wilsoni, Culex sp (138), C bidens interfor (5), C spinosus (1), 1 Sabethes chloropterus, 7 Limatus sp, 1 Uranotenia sp, Psorophora sp (5), Psorophora varipes albigenu (11), 1 Galindomyia sp. The majority of the female collected Psorophora ciliata (1), Sabethes cloropterus (1), Limatus sp (6), Uranotenia sp (1), Galindomyia sp (1) and dogs, birds, chickens, horses or monkeys, as they were Mansonia wilsoni (2). 40 pools of A aegypti and 34 of C wherecollected fulfilled surrounding with blood,these species probably in the from residencies. humans, quinquefasciatus and 4 of Culex sp where submitted to This variety of vector species in Cuiabá represent a RNA extraction (Trizol), reverse transcription, multiplex potential risk for arboviral spread in the imminence of their introduction by travelers or migratory birds, due to the proximity with Pantanal and the habit of the RT-PCR1 472 bp; for DENV-2Flavivirus 316 and bp; Alphavirus DENV-3 amplification659 bp; DENV-4 and birds from there to rest every night in the UFMT zoo. species-specific222 bp; YFV 253 semi-N-RT-PCR bp; SLEV 232 bp, for WNV Flavivirus 195 bp, (DENV- ILHV Agents as Cacipacoré, West Nile, Saint Louis, Equine 474 bp, ROCV 230 bp, IGUV 254 bp, BSQV 388 bp) and Encephalitis, Chickungunya, Yellow Fever, Oropouche Alphavirus (MAYV 270bp; EEEV 124 bp; WEEV 208 bp, VEEV 400 bp, AURAV 89 bp). 1/40 (2.5%) of A. aegypti showed a band consistent with DENV-4 size. Sequencing andvariety others of Cuiabá, could cityfind that susceptible annually vectors contributes and withhosts the to establish their cycles. This is the first report of Culicidae most prevalent serotype in Cuiabá since 2012, when the is underway to confirm the amplification. DENV-4 is the majority of Dengue notified cases in the State. Cuiabá time. Frequency and distribution of arboviral infected hasrivers a diversified and streams ecosystem, inside the consisting urban perimeter, of extensive climate areas introductionmosquitoes in of Cuiabáthis virus is wasimportant detected to in improvement MT for the first of of fauna and flora preservation, small rural properties, health surveillance strategies aiming to prevent and mosquitoes. Virological surveillance in the 795 pools control outbreaks in MT.*Financial support:CAPES/ andis currently humidity being conditions performed, that favor aiming the toamplification identify their of FAPEMAT/UFMT. frequency of infection with arboviruses by RT-PCR. These data demonstrate the importance of entomological HV19 - Entomological Surveillance Of surveillance for gathering information and promoting Adult Mosquitoes Vectors Of Arboviruses health surveillance strategies to prevent outbreaks in In Cuiabá, Mt MT. *Financial support: CAPES/FAPEMAT/UFMT. Serra, O.P., Cardoso, B.C., Gondim, B.H.F., Pereira, F.C., Santos, F.A.L. , Heinen, L.B.S., Zuchi, N., Ribeiro, HV29 - G3 Rotavirus Strain: A Complex A.L.M., Carvalho, A.C., Rodrigues, J.S.V., Correa, L.V.A., Evolutionary Dinamic Myiazaki, R.D., Dezengrini-Slhessarenko, R. Luchs, A., Souza, R.P., Timenetsky, M.C.S.T. 1. Universidade Federal de Mato Grosso, UFMT, Av. Instituto Adolfo Lutz, IAL, Av Dr Arnaldo, 355 Centro Fernando Corrêa da Costa, 2367 - Boa Esperança. Cuiabá - de Virologia 01246-902 MT Rotavirus group A (RVA) G3 genotype has broadest 2. Ministério da Saúde, MS, Av Presidente Getúlio host range. The aims of this study were to carry out Vargas, N 1426 Popular - Cuiabá - Mato Grosso Bayesian phylogenetic analyses using the nucleotide 3. Hospital Universitário Júlio Müller, HUJM, Rua Luís sequences of VP7 gene available in GenBank in order Philippe Pereira Leite, S/N - Alvorada - Cuiabá-MT to investigate the evolutionary dynamic between RVA 4. Secretaria Municipal de Saúde - Cuiabá/MT, SMS, G3 strains originating in humans, wild and domestic Rua São Joaquim, n°. 315 - Bairro: Porto. Cuiabá - MT animals; quantify the mutation rates; and estimate the most recent common ancestors. For 5 bovines,

88 Human Virology: HV

3 simians, 2 environmental, 8 canines, 22 equines, 3 order to study the etiology of the respiratory illness, felines, 5 rabbits, 5 porcines, 2 caprines, 3 murines, and 199 human G3 strains; the entire or partial VP7 ORF necropsy of thirteen passengers and crew members sequences and the year of isolation could be retrieved fifteen samples from respiratory secretions and tissue from GenBank. The Bayesian inference method available real time RT-PCR assays were performed. The full-length in the software BEAST v. 1.6.2 was used in order to with respiratory symptoms were investigated. Influenza analyze the phylogenetic relationship. Based on 257 sequences, the mutation rate was estimated to be 1.7318 hemagglutinin (HA) gene of influenza positive samples x 10-3 (1.4374-2.075 x 10-3) nt substitution/site/year. wasB virus sequenced. as the cause Only of influenza a respiratory B virus illness was outbreak detected The TMRCA inferred for G3 strain was calculated to be inonboard seven the individuals, cruise ship. this Sequence finding implicated analysis of influenza the HA 1786 (1765-1810). It was possible to separate three gene indicated that the viruses were closely related to distinct Lineages of G3 by phylogenetic analysis. All of the B/Brisbane/60/2008-like virus, Victoria lineage, the them contain animals and humans strains; however, vaccine virus for the 2011-2012 Southern hemisphere Lineage II contains the majority of human G3 strains, and they are associated with urban environments. vaccines for use in the 2012-2013 season changed, it is Phylogeography and temporal analysis, suggested season.crucial Sincean intensive the recommended surveillance composition of circulating of influenza viruses that G3 strain emerged in Asia and scattered through worldwide. Molecular analysis is a very important tool to the globe in rural environments. The urban context of characterize the pathogen responsible for the outbreak. RVA G3 circulation was later observed 100-110 years In addition, laboratory disease surveillance can ago, and the data analyzed also suggested that the urbanization process took place in Asia, and posteriorly an immunopreventable disease. Financial support: IAL/ in Europe and the Americas. The Bayesian Phylogenetic contributeSES/SP. to the control measures towards influenza is analysis suggests that a transmission between human and animals may be the ancestral characteristic of the G3 HV38 - Genetic Analysis Of Seasonal strain, and its urbanization is a later phenomenon. The Influenza A(H3n2) Viruses Isolated In most recent common ancestor of this strain was dated Brazil During 2010 – 2012 back to 1786; however the emergence of the majority Borborema, S.E.T., Santos, K.C.O., Da Silva, D.B.B., Pinho, human urban Lineage II could be tracked back to around M.A.B., Pereira, J.C., Curti, S.P., De Paiva, T.M., Santos, 1904. This data suggests that the urbanization of the RVA C.L.S. Instituto Adolfo Lutz, IAL, Av Dr Arnaldo 355, with the industrialization process associated with the Cerqueira Cesar, SP andchange its fixationfrom rural on settlementshuman population towards may a predominantly be associated urban population. Also, urbanized strains are apparently more prevalent than rural strains. The complexity that respiratory infections and responsible for annual naturally arises from this changing environment is an Influenzaepidemics virusesand occasional are a commonpandemics, cause which of resulted human ideal situation to the emergence of a new zoonotic virus, in serious threat to public health and socioeconomic as indicated by the recent epidemics of SARS-COV, and H1N1. Financial Support: PPG-CCD-SES/SP; IAL impacts.Molecular Influenza and antigenic vaccines surveillance have to be updated are important frequently to HV37 - Molecular Characterization Of becauseprovide circulatinginformation influenza about the viruses circulating continuously viruses evolve. that Influenza B Virus Outbreak On A Cruise will guide vaccine development and strategies. Our Ship In Brazil 2012 study was performed to monitor the emergence of new Borborema, S.E.T., Da Silva, D.B.B., Santos, K.C.O., Pinho, M.A.B., Curti, S.P., De Paiva, T.M., Santos, C.L.S. Brazil. Samples obtained from respiratory specimens Instituto Adolfo Lutz, IAL, Av Dr Arnaldo 355, variantsor necropsy of influenzatissues collected A(H3N2) during viruses January circulating 2010 to in Cerqueira Cesar, SP time RT-PCR. Genetic analysis based on the full-length Cruise ship holidays are increasing in popularity Decemberhemagglutinin 2012 (HA) were gene laboratory-confirmed sequences was performed. by real- worldwide. The nature of the environment may facilitate Nucleotide sequences were edited and aligned using the transmission of infectious diseases. In February Sequencer 4.7 and Bioedit 7.0, respectively. Phylogenetic 2012, an outbreak of respiratory illness occurred on tree was constructed by neighbor-joining method the cruise ship MSC Armonia during a summertime applying Kimura’s two-parameter method using MEGA in Brazil. A 31-year old woman from crew member 5. A total of 84 HA sequences were analyzed, 6 of which was hospitalized with respiratory failure and died. In were from fatal cases. This analysis showed that the

89 Human Virology: HV

of hormonal contraceptive. Cytological abnormalities were similar to ones circulating in other Brazilian states, circulatingsuch as Goias, influenza Distrito A(H3N2) Federal, Matostrains Grosso, in Sao Mato Paulo Grosso state LSIL, ASCUS and HSIL. The techniques used for tracking do Sul, Tocantins and Piaui. Samples fall into two major mostproved frequently to be adequate. found were, Besides respectively: that, our results inflammation, suggest genetic clades represented by A/Victoria/208/2009 that in order to obtain more accurate results and an and A/Perth/16/2009. The smaller A/Perth/16/2009 genetic clade carries signature amino acid substitutions the Pap smear and the molecular methods) should be E62K and N144K. The majority of Brazilian A(H3N2) efficientperformed diagnostic, together. Certainly, the three this analysis approach (the will clinical, result samples belong to A/Victoria/208/2009 genetic clade, in the decreasing of false-negative, earlier diagnostics but until 2011 remained antigenically related to A/ and treatment, and better prognostic. Financial Support: Perth/16/2009. With the A/Victoria/208/2009 clade, CNPq; FAPESB; UESC the most commonly Brazilian circulating subgroups HV49 - Emergence Of Dengue Virus 4 viruses is essential for updating vaccines, for tracking the Genotype American In São José Do Rio wereemergence subgroups of drug 5 resistant and 6. viruses, Surveillance and for of monitoring influenza Preto, São Paulo, Brazil. zoonotic infections. Financial support: IAL/SES/SP. Colombo, T.E., Vedovello, D., Pacca, C., Fávaro, E., Nogueira, M.L. HV39 - Epidemiology Of The Human Papillomavirus (Hpv) In Women In Southern 1. Faculdade de Medicina de São José do Rio Preto , State Of Bahia FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro, São José Nascimento, J.H.F., Soares, D.M.V., Santos, F.P., Mariano, do Rio Preto, São Paulo A.P.M., Mello, S.R.G. 2. Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Rua Cristóvão Colombo, 2265 - Jardim 1. Universidade Estadual de Santa Cruz, LAFEM/ Nazareth, São José do Rio Preto, São Paulo UESC, Rodovia Jorge Amado, km 16, Bairro Salobrinho, Ilhéus/BA. CEP 45662-900 DENV-4 had a brief circulation in Brazil in 1982 in 2. Laboratório de Anatomia Patológica/Hospital the Northwestern region of Brazilian Amazon in a Calixto Midlej, HCMF/LAPPAQ, Rua Antônio Muniz, Nº focal epidemic. No further cases of infection had been 200, Pontalzinho. Itabuna . Bahial Cep: 45.602-650 registered in the country until 2008, when the virus was detected in three patients, who had no international Human Papillomavirus (HPV) is one of the most traveling history, in Manaus. DENV-4 reemerged in the prevalent sexually transmitted pathogens associated country in 2010 in the municipalities of Boa Vista and to malignancy, infecting 50 to 80% of sexually active Cantá in Roraima State, spread to different geographic women worldwide and responsible for 99.7% of cancers regions of Brazil. In the present work about DENV-4 of the cervix. Cervical cancer is a critical public health transmission in SJRP from 2011 to 2013, we used serum problem as it is the second most common cancer in women worldwide. The main objective of this study was to determine the prevalence of HPV in women attending samplescirculation. of The suspected viral surveillance and confirmed was performed DENV patients with health units in the south region of Bahia and to compare providedMultiplex RT-PCR by the using Health Flavivirus Secretariat generic to primers profile DENVbased three diagnostic methods to detect the virus or their on non-structural protein (NS5), followed by Nested pathological effects and/or the cervical lesions. It was conducted a cross-sectional study, evaluating 195 women in the period from April 2011 to April 2012. Initially, assays with species-specific primers and cultured cells of it was proceeded gynecological clinical examination, Aedes albopictus for the identification and confirmation followed by endocervical samples collection, DNA offor DENV-4. DENV and There 375 were (48%) 997 were cases positive confirmed for inDENV-4. SJRP from Up extraction and cytological analysis. In the clinical Januaryto now, 31 2011 DENV-4 to March have 2013. been subjectedWe amplified to sequencing 783 samples of analysis, it was used the acetic acid in the vaginal canal the entire envelope gene and were used for phylogenetic and cervix to visualize possible lesions characteristics reconstruction. The phylogenetic analysis of serotype 4 caused by HPV. The brush-swab containing endocervical cells was used to obtain HPV-DNA by nested PCR The with genotype that circulating in Brazil (genotype prevalence of HPV was 47.7% by PCR test, 35.3% by showAmerican). that the Looking samples inside identified the genotypes in this study two groupeddistinct cytological analysis and 26.7% in the clinical diagnosis. clades formed in DENV-4 phylogenetic reconstructions, It was found no correlation between the infection and indicating two possible lineages. This data shows risk factors described in the literature, such as age, that the phylodinamics of dengue circulation can be sexual activity, smoking, immunosuppression and use much more complex than expected even in a small September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

90 Human Virology: HV city, with circulation not only of different serotypes replicate within these tissues, which become reservoirs but also different strains. These data provide us more of replicating viruses in the absence of acute respiratory information about the dynamics of DENV circulation symptoms. Financial support: FAPESP, CAPES and CNPQ. and its role in emergence of outbreaks and endemic circulation. Financial support: Pronex; INCT-Dengue; HV58 - Time-Scale Of Minor Hiv-1 Complex FAPESP; CAPES Circulating Recombinant Forms (Crfs_ Cpx) From Central And West Africa HV51 - Rhinovirus E Enterovirus Infect Delatorre, E., Bello, G. Lymphoid Tissues Of Hypertrophic Adenoids And Tonsils Instituto Oswaldo Cruz - Fundação Oswaldo Cruz, Paula, F.E., Silva, M.L., Proença-Modena, J.L., Valera, IOC-FIOCRUZ, Av. Brasil, 4365. Manguinhos. Rio de Janeiro. F.C.P., Saturno, T.H., Prates, M., Buzatto, G.P., Tamashiro, RJ E., Anselmo-Lima, W., Arruda, E. Several HIV-1 CRFs with a complex mosaic structure Faculdade de Medicina de Ribeirão Preto, FMRP, Av. including: 09_cpx, 11_cpx, 13_cpx and 45-cpx, circulate Bandeirantes, 3900 at low prevalence in Central and West African regions. Here we reconstruct the evolutionary history of Chronic adenotonsillar hypertrophy is a frequent these complex CRFs and we further investigate the dissemination dynamic of the CRF11_cpx clade. Two of the tissues of adenoids and palatine tonsils. Frequently HIV-1 datasets comprising 148 pol (26 CRF09_cpx, otorhinolaryngologicpatients with chronic illness adenotonsillar due to chronic diseases inflammation undergo 91 CRF11_cpx, 19 CRF13_cpx and 12 CRF45_cpx) and surgery for removal of hypertrophic tissues. HRV and 70 env (7 CRF09_cpx, 41 CRF11_cpx, 12 CRF13_cpx HEV are picornaviruses frequently involved in the and 10 CRF45_cpx) sequences sampled from different etiology of acute infections, and are frequently detected central and western African countries over a period in adenoids and palatine tonsils. This study aimed at of > 10 years were used in this study. Evolutionary, detecting whether there is replication of picornaviruses phylogeographic and demographic parameters were in adenoids and palatine tonsils surgically removed from jointly estimated from sequence data using a Bayesian patients with adenotonsillar diseases. To assess the coalescent-based method. The analysis of both HIV-1 picornavirus replication activity the presence of minus datasets point to quite consistent onset dates for CRF09_ strand RNA was determined by in situ hybridization cpx (~1965: 1956-1974), CRF11_cpx (~1955: 1946- (ISH) and viral capsid protein was detected by 1964) and CRF13_cpx (1965: 1958-1972) epidemics; immunohistochemistry (IHQ). Of 179 enrolled patients, while some divergence was found for the estimated respectively 49% and 53% had palatine tonsils and date of origin of CRF45_cpx epidemic (pol = 1969 [1963 adenoids positive for a picornavirus by qPCR. HRV was - 1976]; env = [1957: 1946 - 1966]). Phylogeographic more frequently detected in adenoids 44/173 (25%), reconstructions indicate that the CRF11_cpx clade most while HEV was more common in palatine tonsils probably emerged in Cameroon and from there it was 73/179 (41%). A control group was made of tissues from patients who underwent cochlear implant, and early 1970s and to other central and western African HEV was detected in 2/12 (17%) tonsils and adenoids, firstcountries disseminated at later times.to the CentralDemographic Africa reconstructionsRepublic in the whereas HRV was detected in 3/12 (25%) adenoids suggest that the CRF11_cpx epidemic grew between and in none of the tonsils. IHQ with antibody for VP1 1965 and 1990 with a median exponential growth rate capsid protein indicated the presence of virus capsids of around 0.3 year-1, and after stabilize. These results in lymphoid tissue, within and outside of the lymphoid reveal that minor HIV-1 CRFs_cpx clades have been follicles of tonsils and adenoids, and also in epithelial circulating in central and western Africa for a long time, cells from adenoids. The frequency of detection was comparable to other much more prevalent HIV group M 24/52 (46%) in tonsils and 22/44 (50%) adenoids clades. Our analysis also suggests that those CRFS_cpx tested by IHQ. The ISH detected minus strand RNA in all lineages may have experienced a long, but slow, epidemic samples tested (7 tonsils and 9 adenoids), with signal growth phase before stabilize; which may explains their in and out of lymphoid follicles of tonsils and adenoids, current low prevalence. on the ciliated epithelium of the adenoid, and rarely on positive cells in squamous epithelium from tonsils. HEV HV65 - Respiratory Virus Profile In was detected predominantly in tonsils and HRV A and Symptomatic Children In A Large Hospital HRV C in adenoids. The high frequency of detection of In Porto Alegre City RNA (-) and VP1 in tissues from patients with chronic Baccin, T.G., Silveira, M.L., Guloch, R., Gregianini, T.S., adenotonsillar diseases, indicates that picornaviruses Castro, A.

91 Human Virology: HV

1. Grupo Hospitalar Conceição, GHC, Av, Francisco 1. Instituto Evandro Chagas, IEC, BR 316 Km 07, Trein, 596 - Bairro Cristo Redentor - Porto Alegre - RS CEP Ananindeua - Pará 91350-200 2. Laboratório Dr. Paulo Azevedo , LPA, Avenida Braz 2. Fundação Estadual de Produção e Pesquisa em de Aguiar, 99, Belém - Pará Saúde, IPB-Lacen, FEPPS-IPB/LACEN, Avenida Ipiranga 5400 limitations in identifying the precise beginning of a Acute respiratory infections (ARIs) are an important Gynecologicalcervical intraepithelial cytology neoplasia or Pap test(CIN) has or significantsquamous cause of hospitalizations and morbidity in early cell carcinoma of the cervix, and knowing that the childhood worldwide. The most infections are caused by presence of HPV infection is a necessary causal factor to the appearance of these lesions, the combination of strategies to detect HPV viral DNA associated with virusesTogether mainly these Influenza viruses accountA and B, forrespiratory 35-87% syncytialof ARIs virus,in children human and parainfluenza cannot be distinguished virus and on adenovirus. basis of appearance of these lesions due to the statistical power clinical presentation and symptoms. In southern Brazil, cytologyof the positive has proven predictive more value efficiency when inusing predicting molecular the tests. In this context we aim to identify HPV infections, 2010 but reemerged in 2011 and has since then been in women between 20 and 50 years old attended for theincreasingly pandemic circulating. influenza The H1N1 study was was not detectedrealized in gynecological routine exams that could be associated to Central Laboratory of Grupo Hospitalar Conceição, one cytology without alterations, in the city of Belém, Pará. of the largest hospitals in public health in the State. All After the cytology it’s concluded we used Hybrid Capture 2 (HC2) QIAGEN, for primary molecular screening who presented signs and symptoms of ARI (assisted in 1429child emergencynasopharix department),samples from were patients tested <15 with years indirect of age CH2 positive samples and 30% of CH2 negative samples followedas a Quality by control.Linear ArrayA total , ofROCHE 93 samples to type was definition submitted in for all methodologies and cytology results demonstrate immunofluorescenceA were sent to State (IFI),Central between Laboratory January (LACEN-RS) through Decemberfor real time 2012. reverse The transcription-polymerase positive samples to Influenza chain reaction (qRT-PCR) analysis. Eight hundred forty one classificationsImmature squamous as Inflammatory metaplasia 3(3.22%) 87(93.5%), and Low atypical grade (59,1%) patients were males and 581 (40,9%) were cellsSquamous of undetermined intraepithelial significance lesion LSIL ASGUS 2(2.15%). 1(1.07%), Using females. Most of the children had less than one year of molecular tools, HPV DNA was found in 12/93(12.9%) age (79,2%). At least one respiratory virus was detected and high risk infection are present in 7/12(58,3%) in 569 (38,2%) respiratory samples and co-detection of distributed through types 51(4) and 59(3) and low risk types detected 5/12(41.6%) are 55(3) and 66(2). In Pap detection of respiratory viruses. The most detected test without cellular alteration we have 9/87(10.3%) of virusesvirus, RSV, was was <1%. detected The variability during the was entire clear yearin seasonal with a HPV positivity and these are preferably caused by high peak in winter. RSV was found in 372 samples (26,1%), risk types 7/9(77.7%). Even with not extensive sample size, we could demonstrate the importance to adopt the molecular tools associated to Pap test in prospective Parainfluenza-3A (2,9%) which in39 79 (93%) (5,5%) were samples A(H1N1)pdm09 and Adenovirus virus. in screening programs to prevent precursor lesions and 46Most (3,2%). patients Forty in whichtwo children the pandemic were found virus with was Influenza detected cervical cancer, mainly after the HPV vaccine era trying to use the right approach in different women life period. fever, dyspnea and rhinorrhea. There was concordance had <1 year of age (67%) and >80% presented cough, HV76 - Prevalence And Genotyping Of qRT-PCR. In conclusion, routine testing of common Human Papillomavirus (Hpv) Using Pcr And inrespiratory 89,7% between viruses IFI in diagnostic children and with confirmation ARIs leads with to Rflp Of Viral L1 Gene In Women Of Alagoas, improvement of individual patient management. Brazil. Financial support: Ministério da Saúde Nascimento, V.X., Souza, N.C.C., Fonseca, P.D.L., Soares, L.W.O., Mendes, M.M.B., Santos, A.R., Todaro, A.R., HV67 - Association Of The Hpv Molecular Carvalho, L.W.T., Ramalho, F.E.A.V., Neto, R.E. Test To The Cytology Exam In Routine Laboratory of Genomics and Proteomics Center for Gynecology. Agricultural Sciences Campus Delza Gitaí BR 101 Norte Km Paixão, C.G.S., Silvestre, R.V.D., Mello, W.A., Farias, S.L., Junior, L.B.D. 85 CEP 57100-000 Rio Largo AL, Brazil

92 Human Virology: HV

Cervical cancer is the second most common cancer in the and others potential pathogens including non-polio world and the human papillomavirus (HPV) is present in 99% of the cases. The viral persistence of high-risk HPV is into four Human Enterovirus (HEV) species A-D. In Brazil considered the main cause for cancer development. HPV enterovirusthe last case (NPEV). of poliomyelitis These NPEVs due are to presently wild PV classifiedoccurred infection is more common among young and sexually in Souza city, Paraíba state in Brazil, in 1989. However, active individuals, and 75% to 80% of the population continuous AFP surveillance is critical in order to comply will be infected during their lifetime. Half of all new with the World Health Organization (WHO) eradication program and to promptly detect potential cases of activity. It is estimated that there are over 200 types of importation since wild poliovirus are still endemic in a casesHPV, but are onlydetected 110 describedduring the to first date. three Among years the of nearlysexual few countries of Asia and Africa. This study describes the 50 types of HPV that infect humans, the International results of detection and characterization of NPEV isolates types as carcinogenic, since they are epidemiologically reverse transcription (RT)-PCR and molecular typing Agencyassociated for withResearch anogenital on Cancer cancer (IARC) development has classified (16, 18,14 by amplificationpartial sequencing of the 5´of non-codingthe VP1 gene. region Stool (5´NCR) samples by 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and were obtained from patients diagnosed with AFP in the northern region of Brazil, as well as in Maranhão e 66). We investigated the prevalence of the HPV and its Piauí, during 2007 and 2011. Fecal specimens from 564 3genotypes were classified in women as probable with normal high-risk and abnormaltypes (26, cervical 53, and AFP cases were received and 20% suspensions were cytology at Alagoas state, Brazil. Cervical samples of 100 women were subjected to HPV-DNA testing by PCR with and L20B cell lines, incubated at 36°C and examined MY09/11 primers. HPV-positive specimens were typed clarifieddaily for withthe chloroformpresence of and cytopathic inoculated effect. in RD, A HEp2-Ctotal of by RFLP (Restriction Fragment Length Polymorphism). 28 (5%) specimens were positive in cell culture and 8 A structured epidemiological questionnaire was isolates were characterized as HEV-B species (2 samples administered to each woman. Among 100 patients were Coxsackievirus B3, 2 Echovirus 9, 1 Echovirus examined, HPV was detected in 19 %. The overall 11 and 3 Coxsackievirus B6), when compared to the prevalence of high-risk, low-risk and undetermined-risk GenBank sequences. The remaining twenty isolates HPV types was 31.6, 63.1, and 5.6 %, respectively. HPV-6 was the most common type detected (36.8 %), followed are currently awaiting for further analysis. During the by types 16, 33 e 58 (10.5%) and 11, 40, 53, 69, 70 and wereeradication amplified, of wild purified poliovirus for in sequencing the world, reactionother NPEVs and because the available methods in screening programs and our data are of potential importance in broadening 71for (5.6cervical % each). cancer In doBrazil, not asdetect HPV the infection presence is not of notifiedviruses. havethe knowledge been identified on the as epidemiologicalthe cause of polio-like features syndrome of AFP Thus, the inference of prevalence by molecular methods cases. Financial Support: Instituto Evandro Chagas/SVS/ is fundamental for development of effective programs MS that seek early virus detection to prevent cervical cancer development and its precursor lesions. Financial HV82 - Il17 Gene Polymorphism (Rs 763780 support: Capes - Propep/UFAL T>C) And Viral Load In Chronic Hepatitis B Patients HV80 - Detection And Characterization Vasconcelos De Deus, D.M., Santos, J.C., Lopes Neto, Of Non-Polio Enteroviruses Associated E.P.A., Coêlho, M.R.C.D. With Acute Flaccid Paralysis In Northern Brazil, Maranhão And Piauí, 2007-2011 Universidade Federal de Pernambuco, UFPE, AV. Lima, S.T., Alves, J.C.S., Wanzeller, A.L.M., Linhares, A.C., Professor Moraes,1235 - Cidade Universitária, Recife - PE - Tavares, F.N. CEP: 50670-901 Instituto Evandro Chagas, IEC, Rod BR 316, S/N, KM Interleukin-17 (IL-17) is an important mediator in 07, Bairro Levilândia, Ananindeua, PA delayed immune response, increasing the production of chemokines in different tissues and the recruitment of characterized by rapid onset of weakness, including Elevated serum levels of this cytokine may indicates Acute(though flaccid less frequently) paralysis (AFP) muscle is aweakness clinical syndromethat may monocytesa high risk and for neutrophils the development to the site of of hepatocellularinflammation. carcinoma (HCC). High levels of IL17 gene expression These symptoms may progress to maximum severity are related to cirrhosis in patients with hepatitis B. causewithin respiratoryseveral days failure to weeks. and AFP difficult is the in most swallowing. severe The T>C (rs763780) single nucleotide polymorphism clinical manifestation of acute poliovirus (PV) infection (SNP) causes an amino acid replacement (His161Arg).

93 Human Virology: HV

Since the T>C SNP in the IL17F gene, might be one of Increasing doses of the compounds were added to stable the etiopathogenic agents related to aggravation of liver complications in chronic hepatitis B The aim of were accessed after 48 hours. The results indicated this study was to determine the frequency of the IL17F repliconthat 4 compounds cells, and replicationdecreased efficiencyHCV replication and cell in viability a dose- gene polymorphism (rs763780) genotypes and the dependent manner with an EC50 of 2.3, 4.0, 8.2 and hepatitis B virus (HBV) DNA level in chronic hepatitis B patients without treatment. This study was performed replication as judged by reductions in both luciferase from October 2012 to April 2013. We investigated 79 38.9activity μM. and All HCV 4 compounds protein expression significantly assessed inhibited through HCV patients from the Hepatology Outpatient at the Hospital western blotting for NS5A. An effect on HCV IRES driven of Federal University of Pernambuco. Genotyping was translation was excluded and we conclude that these performed by real-time PCR according to the HRM (High compounds directly inhibit virus genome replication. genotypes frequency was CC (17.7%), CT (50.6%) and length virus system where the compounds blocked viral ResolutionTT (31.6%) Melting) and it’s were analysis in Hardy-Weinberg and viral quantification. equilibrium The Thereplication inhibitory to 0.2, effects 2.4, were4.9 and confirmed 11% compared by using to the DMSO full (p=0.3879). Among the 79 patients studied, the median control. These data provide information of the potential HBV DNA level was 2.047IU/mL. However, we observed of Brazilian natural compounds as antiviral against a higher viral load among the males with TT genotype hepatitis C virus. patients below age 40, with CC genotype (4.717IU/mL) HV92 - Clinical Case: Intrafamilial andor CT beyond genotype age (2.414IU/mL), 40 years (p<0.0001). showed a lower Whereas viral maleload Transmission Of Vaccinia Virus During A Bovine Vaccinia Outbreak In Brazil genotype, might have problems in clearance-HBV, Oliveira, G.P., Silva-Fernandes, A.T., Assis, F.L., Alves, (p<0.0001).mainly due to Male the higher subjects viral with load. IL17TT, In addition, the no increase mutant P.A., Franco-Luiz, A.P.M., Figueiredo, L.B., Almeida, ageing might be related to a further aggravation in the C.M.C., Travassos, C.E.P.F., Trindade, G.S., Abrahão, J.S., development of liver complications. Kroon, E.G.

HV89 - Effects Of Compounds Isolated From 1. Universidade Federal de Minas Gerais, UFMG, Av. Plants On Hepatitis C Replication Presidente Antônio Carlos, 6627, Pampulha, Belo Horizonte, Jardim, A.C.G., Santos, V.A.F.F.M., Felippe, L.G., Amako, MG Y., Igloi, Z., Shimizu, J.F., Furlan, M., Harris, M., Rahal, P. 2. Universidade Estadual do Norte Fluminense Darcy Ribeiro, UENF, Av. Alberto Lamego, 2000, Campus Campos 1. Institute of Bioscience, Language and Exact Science, dos Goytacazes, Rio de Janeiro IBILCE/UNESP, Rua Cristóvão Colombo, 2265, Jardim Nazareth, 15054-000, São José do Rio Preto The Bovine Vaccinia (BV) is an emerging zoonosis 2. Institute of Chemistry. Department of Organic caused by Vaccinia virus (VACV) that circulates between Chemistry, IQ/UNESP, Rua Prof. Francisco Degni, 55 Bairro: bovines and humans causing economic losses and public Quitandinha 14800-900 - Araraquara, SP health problems. In general, human cases are related to direct contact with sick cattle but there is a lack of 3. University of Leeds, University of Leeds information about human-to-human transmission of Hepatitis C virus (HCV) infection is a worldwide problem VACV during BV outbreaks. In this study, we molecularly of public health. Current therapy based on pegylated demonstrated a case of VACV transmission between interferon and ribavirin presents low sustained humans in São Francisco de Itabapoana County, Rio de virological response, is expensive and causes severe Janeiro state, in September 2002. A 49-year-old patient side effects. Although recent developments of direct reported the development of lesions on his hands a few acting antivirals offer hope for improvements to HCV days after contact with sick cattle. The lesions evolved from macules to papules, vesicles, pustules and, after new antivirals or combination of therapies for HCV some weeks, to scabs. In addition, this patient presented therapy,treatment. there In this is still context, a need compounds to develop extracted more efficient from a high fever, ranging from 39 °C to 40 °C, myalgia, plants can provide an alternative approach to new headache and axillary lymphadenopathy. Approximately six days after the beginning of the healing stage, patient untapped, resource of potential antiviral compounds. reported that his son, a 14-year-old student, presented therapies.Here we evaluatedThe Brazilian the floraantiviral represents effects a ofvast, Brazilian largely similar symptoms, including lesions, fever, headache and natural compounds on HCV replication. We used a axillary lymphadenopathy. Remarkably, the son did not cell line stably expressing SGR-JFH-1 FEO replicon by work as a milker and did not have contact with cattle. To electroporation of human hepatoma Huh-7.5 cells. investigate this case, our group went to the affected farm September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

94 Human Virology: HV and collected scab and swab samples from the hands of genotype was the most prevalent (78%), followed by gB3 patients. The samples were inoculated in Vero cell and (18%) and gB1 (4%). Genotypes gB4 and gB5 were not after the appearance of cytopathic effects, DNA was extracted and then submitted to a PCR assay targeting the through comparison between non-synonymous (dN) a56r gene that is a molecular marker for Brazilian VACV. found. Identification of regions under seletive pressure, The a56r PCR products were directly sequenced using demonstrated the presence of positive selective pressure the MegaBACE platform. Both exanthematic samples andon the synonymous variable region (dS) substitutionof the UL55 taxes gene. (ω=dN/dS), Financial support: UFABC/CNPq VACV isolates were grouped in the same phylogenetic showedtree branch, the revealing amplification an unique of a nucleotide 950bp fragment. substitution The HV108 - Cytokines And Mitochondrial marker present only in the samples isolated during this Products Involved In Fulminant Hepatic outbreak. Our data indicate that human-to-human VACV Failure Caused By Hepatitis A Virus transmission occurred during a BV outbreak in Brazil, Infection raising new questions about the risk factors of the VACV Melgaço, J.G., Vieira, Y.R., Lewis-Ximenez, L.L., Soriani, transmission chain. F.M., Menezes, G.B., Pinto, M.A., Vitral, C.L.

HV93 - Frequency Of Glycoprotein B 1. Fundação Oswaldo Cruz, Fiocruz, Av Brasil, no Genotypes In Transplant Recipients And 4365, Manguinhos, Rio de Janeiro, Brasil Evidence Of Positive Selective Pressure On 2. Universidade Federal Fluminense, UFF, Rua Hernani The Gb Gene de Melo Stangherlin, L.M., De Paula, F.C., Ruiz, L.G.P., Nogueira, 3. Universidade Federal de Minas Gerais, UFMG, M.L., Braz, A.S.K., Silva, M.C.C. Pampulha, Belo Horizonte 1. Universidade Federal do ABC, UFABC, Rua abolição A total of 2,570 cases of deaths associated with viral sem número, Santo André, SP hepatitis is reported annually in Brazil. Most of these 2. Faculdade de Medicina de São José do Rio Preto, fatal cases resulted from fulminant hepatic failure FAMERP (FHF), a rare but potentially fatal disease seen in a small number of people (1%) with viral hepatitis. The unique Human cytomegalovirus is a ubiquitous infectious agent treatment for FHF is hepatic transplantation. In FHF, worldwide. After primary infection, the virus remains in a persistent or latent state in immunocompetent than those observed in acute viral hepatitis. In general, individuals, due to an equilibrium between the immune the inflammationcause of death and before necrosis transplantation grade are more is severesepsis system and viral replication. However, HCMV is a accompanied by high level of circulatory endotoxins classical opportunistic agent and severe diseases can in circulation. To access immunological mechanisms occur in settings of immunosuppression (e.g. AIDS of extensive liver lesions observed in FHF cases, seven patients and transplant recipients) or in the absence patients with FHF induced by hepatitis A virus (HAV) of a fully competent immune system (congenital infection, eight patients with acute hepatitis A and 10 infection). The factors responsible for virulence and pathogenesis are not fully understood but it is clear that of plasmatic cytokine levels (IL6, IL8, IL10, TNF-alpha, a variety of mechanisms that allow the virus to escape healthIFN-gamma) controls and (HC) mitochondrialwere investigated DNA by quantification(mtDNA). A the humoral and cellular immune responses contribute quantitative immunoassay was used to evaluate the to pathogenesis. In addition, is postulated that genetic variability may have impact on HCMV virulence and order to evaluate the rate of mtDNA in plasma samples. pathogenesis. HCMV strains have polymorphisms cytokineThe results profile, showed and ana real increase time PCRin the was levels employed of both in in several regions, and in particular, the envelope NADH dehydrogenase (2,891.75 ng/100µL serum) and glycoproteins are of interest since viral proteins are cytochrome C (1,853.68 ng/100µL serum) in plasma involved with cell attachment and entry, and are targets samples from patients with FHF comparing HC patients of the host immune system. To date, the most studied (0.018 ng/100µL serum and 0.025 ng/100µL serum, polymorphisms involved the UL55 gene that encodes the glycoprotein B (gB) one of the major constituents A acute patients also showed increased levels of mtDNA of the virus and a target for neutralizing antibodies. respectively)(75.70 Cyt C, (p<0.05). 98.05 NADH) Plasma in samples comparison from hepatitiswith HC In this work we aimed to analyze the distribution of gB genotypes in renal transplant recipients and to 27.28 fold increased in comparison with health controls investigate the presence of selective pressure on the patients (p<0.05). The plasmatic level of IFN-gamma was UL55 gene. From a total of 24 samples analyzed the gB2

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human(p<0.05). Virology: HV These findings confirmed the high expression of IFN-gamma in plasma during the necro-inflammatory XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

95 Human Virology: HV process induced by HAV infection. This study also diversity does not seem to be a disease progression provides important evidences of mitochondrial factor. dysfunction and DNA damage, both contributing to critical events of viral fulminant hepatitis, and suggests HV120 - Hiv-1 Genetic Diversity And Drug their use as outcome markers of viral FHF. Resistance In Failing Antiretroviral Therapy Patients From Amazonas State – HV110 - Comparative Study Of Hepatitis A Brazil Vp1/2a And Vp1 Genotyping Genes And Its Costa, C.M., Couto-Fernandez, J.C., Oliveira, C.M.C. Correlation To The Clinical Outcome Of The Disease 1. Tropical Medicine Foundation Dr Heitor Vieira Lemos, A.S., Tourinho, R.S., Rodrigues, C., Lewis- Dourado, FMT-HVD, Av Pedro Teixeira, n 25, Dom Pedro. Ximenez, L.L., De Almeida, A.J., Pinto, M.A., De Paula, CEP 69040-000. Manaus-Amazonas-Brasil V.S. 2. Fundação Oswaldo Cruz, FIOCRUZ, Av Brasil, 4365, Manguinhos. CEP 21040-900. Rio de Janeiro - RJ - Brasil Instituto Oswaldo Cruz - FIOCRUZ, IOC - FIOCRUZ, Av. Brasil 4365 Molecular epidemiology is an important tool in the studies of HIV-1. The geographical distribution of HIV variants is heterogeneous and this tool allows us to sequencing of selected genome regions, including the now the epidemiological characteristics of pandemic GeneticVP1 amino variants terminus of and HAV the haveVP1/2A been junction. identified The VP1 by HIV. In this study we evaluated 117 HIV-1 sequences amino terminus and the VP1/2A junction can be used to from patients failing ART submitted to the genotyping distinguish one strain from another. On the basis of the from Amazonas state (Brazil) during the years 2009 to genetic variability observed within the putative VP1/2A 2012 to know the genetic diversity of HIV-1 subtypes and the prevalence of resistance mutation associated III from human and IV, V e VI from Simians. However, to antiretroviral therapy (ART) in this region. The mean junction,some studies 6 HAV demonstrated genotypes have that been HAV identified: strains of I, VP1 II e age was 34 (±15) years, CD4 652 cells/mm3 and viral amino terminus contain more informative variable load were 36,050 copies/ml. Viral resistance genotyping positions than the VP1/2A junction. To gain insight into was performed using Trugene Genotyping System the molecular epidemiology of HAV, we investigated the and subtype analysis was performed at the Brazilian genetic variability of HAV strains recovered from acute Algorithm for HIV-1 drug resistance. The majority of and fulminant patients using the complete sequence of the VP1/2A and VP1 gene from the correspondent and 6.8% were non-B. One of the non-B virus was the sample. The genotyping results were correlated to the genotyped virus was classified as subtype B (93.2%) hepatitis A clinical outcome of each patient to analyze with nucleoside reverse transcriptase inhibitors (NRTI) it as a disease prognostic factor. Genotyping analysis recombinanthas shown that BC. more The HIV-1 than genotyping 50% of the profile samples associated carried the M184V resistance mutation. The timidine associated mutations (TAMs) T215Y/F and M41L were found wasprimers, accessed from HAV through RNA amplification of 94 serum samples. of the VP1 Expected (1119 in 48% and 35% of the samples, respectively. For the bp)amplicons and VP1/2A were (243bp)sequenced genetic and region, the usingresults specific were non-nucleoside RT inhibitor (NNRTI), the substitution analyzed phylogenetically by Bayesian reconstruction K103N was the most prevalent (50%). The resistance method using Tamura Nei 93 model. Results showed mutations associated to protease inhibitor (PI) were: that 63 samples were reactive for HAV RNA, which 46 for L63P (45,3%), M36I (44,4%) and L90M (18%). This VP1/2A and 17 for both HAV genetic regions. Fifty-four samples were successfully sequenced for VP1/2A and Brazil. The minor mutation L63P was clearly associated 11 for VP1 region. Phylogenetic analysis demonstrated mutation profile is in accordance to therapy adopted in that, independently of the genetic region used, strain north Brazilian region mapping, and Brazilian mapping genotype does not change. Although, VP1 region contains toconsequently, B subtype (p

96 Human Virology: HV

Matos, R.P.A., Jardim, A.C.G., Bittar, C., Yamasaki, L.H.T., 1. Universidade Federal de Alfenas, UNIFAL, Rua De Carvalho-Mello, Rahal, P. Gabriel Monteiro da Silva, 700. Centro - Alfenas/MG. 1. Instituto de Biociências Letras e Ciências Exatas, 2. Universidade Federal de Minas Gerais, UFMG IBILCE/UNESP, Rua Cristóvão Colombo, 2265 Bairro: Jardim Dengue is a major public health problem worldwide, Nazareth - São José do Rio Preto especially in the tropical and subtropical areas. Infection 2. Universidade Federal de São Paulo, UNIFESP, Rua with a single Dengue virus (DENV) serotype causes a Pedro de Toledo, 669. Bairro: Vila Clementino - Sao Paulo, SP mild, self-limiting febrile illness called dengue fever. However, a subset of patients experiencing secondary Hepatitis C Virus (HCV) is the major etiological agent infection with a different serotype progresses to the of chronic hepatitis worldwide. The World Health severe forms of the disease (dengue hemorrhagic fever/ Organization estimates that 3% of the population of dengue shock syndrome). These forms are characterized the world is infected. The aim of this study was to by spontaneous bleeding and plasma leakage after an analyze serum samples of two patients infected with excessive immune activation of T cells and macrophages. HCV genotype 1 that presented intrafamilial and sexual In this study we evaluated the immunogenicity of three contact in order to evaluate the genetic and phylogenetic tetravalent and conserved synthetic peptides (Pep01, relationships among viral variants. Patient 11 was male Pep02 and Pep03) in a murine model by measuring and non-responder, and patient 10 was female and end- of-treatment responder. We analyzed baseline samples subtypes). Sera from Pep01, Pep02 and Pep03 immunized and samples collected 2 and 6 months after treatment. peptide-specificmice had mean total antibody IgG titers levels of (total 96 +- IgG, 56; IgG1 133 and+- 46 IgG2a and Investigation of possible risk factors for acquisition and transmission of HCV was performed by analysis of mice did not produce detectable levels of anti-peptides epidemiological questionnaires previously answered ≥antibodies. 3200, respectively. The IgG1 titersPBS treatedinduced and by all DENV-1 peptides infected were by patients. The coding region NS5A of HCV was cloned similar to that found for total IgG. In contrast, no one and sequenced, resulting in 90 complete sequences of of these peptides induced IgG2 antibodies. The plaque NS5A. Both patients declared to have unprotected sexual reduction neutralization assays showed an absence or a intercourse and shared use of personal hygiene objects, low titer of neutralizing antibodies. Serum derived from as razors. The phylogenetic tree showed that sequences of both patients grouped together with bootstrap 20 only for DENV-1 and the serum derived from Pep03 support and control sequences located in different mice immunized with Pep01 had a neutralizing titer ≤ clusters. This data demonstrate that the variants of for DENV-1 and DENV-3. Serum from Pep02 immunized these patients were more related to each other than vaccinatedmice had no animals neutralizing showed activity. had a neutralizingFurther investigation titer ≤ 20 to the variants from the control patients, suggesting will be required to improve immunogenicity and a common source of contamination. However, these functional activity to make peptides a viable option for patients presented different quasispecies composition DENV vaccines. Financial support: FAPEMIG; CNPq. and evolutionary dynamics over time. The quasispecies of patient 11 clustered according to the collect point. HV144 - Tetravalent And Conserved Conversely, the phylogeny analysis in patient 10 suggests Synthetic Peptides Derived From Dengue that quasispecies detected after treatment originated Virus Envelope Domain I And Ii Are from pre-treatment quasispecies. The differential Recognized By Dengue Igm Positive Serum Human Samples Costa, L.C.F., Rocha, P.R., Gomes, A.V.B.T., Filho, S.L.M., profileof the ofdisease quasispecies and therapy observed administration. for each patient So, maythe Junior, C.J.C.Z., Malaquias, L.C.C., Coelho, L.F.L. bepopulation due to the of influencequasispecies of host detected factors in during each patient the course can be an important factor related to treatment response. Universidade Federal de Alfenas, UNIFAL, Rua Gabriel Financial support: FAPESP Monteiro da Silva, 700. Centro - Alfenas/MG Dengue is a major public health problem worldwide, HV136 - Tetravalent Synthetic Peptides especially in the tropical and subtropical regions of the Derived From Dengue Virus Envelope world. Despite the magnitude of the problem, there Domain I And Ii Are Able To Induce are still limitations related to the diagnosis, due to the Antibodies With Low Neutralizing presence of false negative results often presented in the Activity laboratory reports. Studies with the envelope protein Rodrigues, N.F., Rocha, P.R., Livonesi, M.C., Costa, L.C.F., are extremely important for the development of new Santos, M.C.S.G., Rocha, E.S.O., Kroon, E.G., Malaquias, vaccines and diagnostic tests. Serological methods are L.C.C., Coelho, L.F.L. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

97 Human Virology: HV important for the diagnosis of dengue infections, among population in the host, therefore, in these cases them, the enzyme linked immunoassay that can detect traditional sequencing techniques are unable to detect. IgM against Dengue virus. In this study, a panel of 82 For detection of minority quasispecies, ultra-deep serum samples from dengue suspected patients was

Elisa kit Panbio Capture Dengue IgM. Assay performance pyrosequencingin the population. (UPDS) Regarding is a realiable this issue, and we efficient determined tool, classifiedof the commercial as positive kitand was negative compared using thewith commercial the new beingHVR1 ablequasispecies to detect evenfrom variants 43 patients with frequencyinfected <1%with indirect ELISA assays using synthetic peptides derived HCV genotype 1 or 3 using the UPDS approach, in from E protein (Pep 01, Pep 02 and Pep 03) as substrate. collaboration with the Division of Viral Hepatitis in CDC- Of a total of 82 serum samples, (52.4%) were positive Atlanta/USA. In total, 240.445 HVR1 sequences were by the commercial Elisa kit Panbio Capture Dengue IgM, obtained from pre-therapy sample. Using the pipeline 18 (21,95%) showed immunogenicity against Pep01; developed by DVH-CDC group, 88.797 sequences 40 (48,78%) against Pep02 and 66 (80,48%) against analysed using median-joining networks and Bayesian with high quality were filtered. These sequences were Pep03.by positive Among using the Pep01 serum as samples substrate, classified 22 (52,3%) as positive using samples with different structures, from high conserved byPep02 the commercialas substrate kit and (42), 40 11 (95,23%) (26%) are using also Pep03classified as population structural analysis. These analysis identified negative by the commercial kit (40), 28 (70%) were also (oneresult. sub-population) Next steps of tothis high study stratified will include ones (7during sub- substrate. Among the negative samples classified as populations).and pos-therapy Networks sample analysisanalysis. also These confirmed results thiswill using Pep02 as substrate and 13 (32.5%) using Pep03 contribute to the understanding of HCV quasispecies classifiedas substrate. as negative Concluding, using the Pep01 Pep03 as substrate, showed a 20 superior (50%) dynamics and therapy and how a high resolution tool as performance to that found in the commercial test UPDS is essential to it. Financial support: CAPES, FAPESP PanBio. Future analysis will be conducted to measure and CDC. the peptides as substrate for detected IgM from dengue HV150 - Phylogenetic Analysis Of Dengue thesuspected sensibility serum and samples. specificity Financial of the ELISAsupport: assays FAPEMIG; using Virus 1 Isolated In Alfenas, Minas Gerais, CNPq. Brazil. Menezes Filho, S.L., Gomes, A.V.B.T., Fagundes, L.G.S., HV146 - Hepatitis C Virus Quasispecies Rocha, R.P., Araki, C.S., Colombo, T.E., Nogueira, M.L., Analysis Using Ultra-Deep Pyrosequencing Malaquias, L.C.C., Coelho, L.F.L. Yamasaki, L.H., Khudyakov, Y., Vaughan, G., Ganova- Raeva, L.M., Diminitrova, Z.E., Pavel, S., Campo, D.S., 1. Universidade Federal de Alfenas, UNIFAL-MG, Jardim, A.C.G., Bittar, C., Carvalho-Mello, I.M.V.G., Laboratório de Vacinas, Departamento de Microbiologia e Rahal, P. Imunologia 2. Faculdade de Medicina de São José do Rio Preto, 1. Universidade Estadual Paulista “Julio de Mesquita FMSJRP, Lab. de Pesquisas Em Virologia, Dept. de Doenças Filho”, UNESP, Rua Cristovao Colombo, 2265 Jd. Nazareth, Infecciosas e Parasitárias Sao Jose do Rio Preto - SP, Brasil 2. Center of Diseases Control and Prevention, CDC, Dengue is a major public health problem worldwide, 1600 Clifton Rd., Atlanta-GA, EUA especially in the tropical and subtropical areas with 3. Universidade Federal de São Paulo - Escola Paulista around 2.5 billion people living in areas at risk regions of the world. The disease is caused by a positive single de Medic, UNIFESP, Sao Paulo-SP, Brasil strand RNA virus that belongs to genus Flavivirus, family Hepatitis C is a major public health problem. New HCV Flaviviridae. There are four serologically related viruses antiviral drugs were released on market on 2010, however, designated as DENV-1, DENV-2, DENV-3 and DENV-4. excluding for genotype 1, the most used therapy used Infection with one of these serotypes causes a mild, self- currently is still based on Interferon (IFN) and Ribavirin. limiting febrile illness called dengue fever. However, a Viral genome variability is one of the factors that lead in reduced number of patients could develop the severe therapy failure. HCV presents a high mutability during forms of disease called dengue hemorrhagic fever and replication course, implicating in arising of intra-host dengue shock syndrome. In this study, we isolated and variants called quasispecies. The hypervariable region 1 performed a phylogenetic analysis of a DENV-1 strain (HVR1) from envelope protein presents as quasispecies isolated from a dengue hemorrhagic fever patient from and may be related to IFN therapy resistance. Resistant Alfenas, South of Minas Gerais. The serum obtained from quasispecies may not represent majority of variants this patient was used to infect C6/36 cells and after September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

98 Human Virology: HV the fourth passage the supernatant was collected and HV155 - Molecular Epidemiology And Origin used for viral RNA extraction. The viral RNA was used Of Htlv-1 In The Southern Bahia - Another in a RT-PCR to amplify the envelope region. The PCR Endemic Area For The Virus In The State. product was sequenced and the sequence obtained was Aleluia, M.M., Mello, M.A.G., Marin, L.J., Rego, F.F.A., analyzed using MEGA software. The analysis showed Pereira, L.S., Galvão-Castro, B., Gonçalves, M., Bispo, that this strain isolated in Alfenas, MG/2012 is closely S.M., Alcântara, L.C., Gadelha, S.R. related to strains isolated in Rio de Janeiro State during 2010-2011. This isolated was placed within lineage L1 1. Universidade Estadual de Santa Cruz, UESC, from DENV-1 group together with other isolates from Rod. Ilhéus Itabuna km 16, Salobrinho, Ilhéus, Bahia. Cep 45662900 of isolation and phylogenetic analysis of a DENV strain 2. Fundação Osvaldo Cruz, FOC Brazil,isolated Venezuela from South and of Colombia. Minas Gerais, This is Brazil. the first Financial report 3. Escola Bahiana de Medicina e Sauúe Publica support: FAPEMIG; CNPq. 4. Universidade Estadual do Sudoeste da Bahia, UESB HV151 - Htlv-1 Co-Infection Is Able To In order to clarify the HTLV introduction and dispersion Reactivate Hiv-1 Latent Virus By Tax in the south of Bahia, we analyzed 29 samples from HTLV- Transactivation 1 seropositive women. Before the blood collection, all of Geddes, V.E.V., Pandeló, D., Aguiar, R.S. them answered a standardized questionnaire. The DNA was extracted by QIAgen Kit. It was performed a nested- 1. Universidade Federal do Rio de Janeiro, UFRJ, PCR to the LTR region of the HTLV. The sequences were Cidade Universitária, Ilha do Fundão, Rio de Janeiro - RJ submitted to the LASP HTLV-1 Automated Subtyping 2. Laboratório de Virologia Molecular, LVM, Av. Carlos Tool. The phylogenetic analyses were generated using the Chagas Filho 373 - CCS - Bloco A - Sala 121 - 2o andar, UFRJ neighbor-joining e máxima-verossimilhança methods. The evolutionary model of Tamura-Nei with gamma One major conundrum in HIV/AIDS cure concerns distribution was selected as the best adaptive model by the virus latency established in resting memory T software Modeltest 3.7. The likelihood ratio was used lymphocytes and other non-dividing cells. This latent to calculate the statistical support for the branches reservoir is a major barrier to the eradicate HIV-1 from in trees. Bayesian tree were constructed to verify the positive patients and is not affected by highly active posterior probability statistical parameter. To evaluate antiretroviral therapy (HAART). Indeed, co-infections genetic ancestry of the population, it was analyzed with other retrovirus, such as HTLV-1, might modulate the replication of HIV-1.HTLV-1 codify a transactivator protein Tax-1 that is able to activate not only HTLV-1, but mtDNA ancestry markers and β-globina haplotypes. also HIV-1 transcription. In this study, we evaluated if the From(bootstrap the total, support 21 samples of 100%). were The successfully phylogeny amplified analysis co-infection with HTLV-1 can activate HIV latency and andshowed sequenced multiple and introductions they were of classified the virus as in HTLV-1 Brazil. aAIn investigate the molecular mechanism of this modulation. HTLV-1 proviral clone (PK30) was transfected in grouped with Brazilian and South Africa sequences, lymphocytes TCD4+ models of HIV-1 latency (J-Lat cells, addition,supporting for thethe firsthypothesis time, Mozambique that Africans sequences infected were clones 6.3 and 8.4). These cells harbor a HIV integrated with the virus have been brought from the southern latent genome that express GFP as reporter gene of regions of Africa. In relation to the genetic ancestry, the transcription activation. The co-infection with HTLV-1 African ethnicity was predominantly found by mtDNA promotes activation in up to 15% of HIV-1 latent cells, markers. In addition, the type benin was detected by

(up to 18%). This activation was mediated by Tax the introduction and dispersion of this virus in Brazil, that promote up to 25% of HIV-1 activation. However, compared with positive controls by TNF-α treatment β-globinespecially analyses.in the Bahia. These Financial data corroboratesupport: PROPP-UESC to clarify Tax mutant variants (M20) that lose transactivation e FAPESB activity were not able to promote HIV-1 transcription. Our results with glycerol gradients showed that Tax HV157 - Detection Of The Pandemic promote the activation of the Positive Elongation Norovirus Variant Gii. 4 - Sydney 2012 In Rio Factor b (pTEF-b) that phosphorylate CTD domain of Branco, Acre, Northern Brazil. cellular RNA polymerase II. In conclusion, HTLV-1 co Silva, L.D., Rodrigues, E.L., Lucena, M.S.S., Lima, I.C.G., infection modulates HIV transcription increasing the Soares, L.S., Oliveira, D.S., Mascarenhas, J.D.P., Linhares, virus production and the risk to develop AIDS. Financial A.C., Gabbay, Y.B. support: FAPERJ/CNPq

99 Human Virology: HV

Instituto Evandro Chagas, IEC, Rodovia Br 316 Km 07 SABMI/IEC, Rodovia BR-316, Km 7, S/N 67030000 Ananindeua, Pará Levilândia, Ananindeua-PA 3. Seção de Parasitologia, Instituto Evandro Chagas, Noroviruses (NoVs) are an important cause of acute gastroenteritis in humans worldwide and are considered SAPAR/IEC, Rodovia BR-316, Km 7, S/N 67030000 the second causative agent of viral gastroenteritis in Levilândia, Ananindeua-PA The human astroviruses (HAstVs) have been associated are associated mainly to GII.4 genotype whose variants with outbreaks and sporadic cases of acute gastroenteritis childrenhave been under associated five years with old.global The epidemics human infections of acute involving young children and other age groups gastroenteritis. The main objective of this study was worldwide. The transmission of HAstVs occurs by the to analyze stool samples from children with acute fecal-oral route, person to person contact or by ingesting gastroenteritis collected between July and September contaminated water or food. Diarrhea and vomiting are 2012, obtained within the National Surveillance Program the main symptoms caused by these agents. The HAstVs of Rotavirus Gastroenteritis, coordinated by Brazilian belong to the Astroviridae family, genus Mamastrovirus, being divided into eight “classic” genotypes (HAstV-1 performed using a commercial enzyme immunoassay – HAstV-8), and the recently described VA1, VA2, VA3, Ministry of Health. The detection of NoV was first MLB1 and MLB2. The objective of this study was to detect HAstVs in fecal samples collected from children (EIA).GII (Cap The C, viral Cap genome D1 and was Cap amplified D3) and byprimers RT-PCR for using P2 primersregion (EVP2F, specific EVP2R). for region DNA D sequencing of the viral was capsid performed of NoV epidemiological aspects. Four expeditions to the city of using the Big Dye Terminator Cycle Sequencing Ready underRio Branco, five Acre, years were old, performed and their during correlation the months with of Reaction Kit. A total of 25 samples were collected of February, April, June and August of 2012, with duration children with acute gastroenteritis from Rio Branco, Acre. Patient’s ages ranged from 4 months to 8 years two emergency units (UPA). The detection of HAstVs was old. These samples were analyzed by EIA and 48% ofdone fifteen by reverse days each. transcriptase-polymerase Fecal collections were chain realized reation in (12/25) were positive for NoVs, which occurred mainly (RT-PCR) using the primers pair Mon 269/Mon 270. in children between 6-12 months (42%-5/12). NoVs HAstVs were detected in 13 (3.2%) of the 401 samples genotype characterization, detected the New Orleans analyzed, being 2.9% (2/69) in June and 8.9% (11/123) 2009 and Sydney 2012 GII.4 variants. The sequence in August. The HAstVs were detected in 5.1% (10/194) had a high nucleotide identity among them (range 98,8 and 1.4% (3/207) of the samples, in both symptomatic - 99,5%) and differed 97.4 - 98.8% when compared and asymptomatic groups, respectively. The distribution with other NoVs strains, in analysis of the region P2. of positive cases by age group demonstrated that the This study demonstrated the circulation of the two most female children of 0-6 months old (12.1%-5/41) were the most affected group. The HAstVs has been considered and Sydney 2012 in the city of Rio Branco, Acre and this as an important etiological agent of acute gastroenteritis recently identified GII.4 variants, New Orleans 2009 GII.4 Sydney 2012 variant, in Brazil. Additional studies de Janeiro (13.5%-43/318) and São Paulo (28.2%- representsare needed and the continued first detection surveillance of the recentlywill provide emerged more in66/234). Brazil, The as verifieddata obtained in Belém in this (13.1%-40/305), study demonstrate Rio information about emergence, circulation and antigenic the circulation of HAstVs in Acre and are important to orient health actions, due to the inexistence of similar in this region. studies in that region. diversification of the NoVs genotypes that predominate HV158 - Detection Of Astrovirus In Fecal HV160 - Detection Of Norovirus In Fecal Samples From Children Under Five Years Samples From Children With And Without Old From Rio Branco, Acre, Brazil. Acute Gastroenteritis From Rio Branco, Medeiros, T.B., Silva, L.D., Rodrigues, E.L., Lucena, M.S.S., Acre, In The Year Of 2012 Menezes, E.M.F., Lima, I.C.G., Resque, H.R., Soares, Rodrigues, E.L., Silva, L.D., Medeiros, T.B., Lucena, M.S.S., L.S., Loureiro, E.C.B., Rodrigues, I.R.C., Silva, M.C.M., Menezes, E.M.F., Lima, I.C.G., Soares, L.S., Loureiro, Mascarenhas, J.D.P., Gabbay, Y.B. E.C.B., Rodrigues, I.R.C., Silva, M.C.M., Mascarenhas, 1. Seção de Virologia, Instituto Evandro Chagas, SAVIR/ J.D.P., Gabbay, Y.B. IEC, Rodovia BR-316, Km 7, S/N 67030000 Levilândia, 1. Instituto Evandro Chagas, IEC, Rodovia BR-316, Ananindeua-PA Km. 7. Ananindeua, Pará 2. Seção de Bacteriologia, Instituto Evandro Chagas,

100 Human Virology: HV

2. Universidade do Estado do Pará, UEPA, Rua do Ambiental PMJF, DVEA, Av. Rio Branco, nº 3353 - Centro Una, n.º 156. Belém, Pará Juiz de Fora CEP 36021-630 4. Laboratório de Vírus, Instituto de Ciências Biológicas Norovirus (NoV) belongs to Caliciviridae family and are a common cause of non-bacterial diarrheic outbreaks, UFMG, UFMG, Av. Antônio Carlos, 6627 - Pampulha - Belo transmitted by the fecal-oral route, by contaminated Horizonte - MG CEP 31270-901 water and food or by person to person contact. This study Dengue virus (DENV) (Flavivirus, Flaviviridae) occurs as aimed to detect and analyse epidemiological aspects of four antigenically distinct but genetically related viruses NoV infection in fecal specimens collected from children named DENV-1 to -4. DENV is transmitted by species from Aedes genus (Culicidae), mainly A. aegypti. DENV- Branco, Acre. A total of 401 samples were collected in 1 to DENV-4 circulate in Brazil and the country has the underJanuary, five March, years June old, and during August four of 2012. expeditions The specimens to Rio higher numbers of DENV in Latin America. Minas Gerais were collected from children attended at the Emergency state usually present high number of dengue cases and Unit of the I and II District. The samples were tested by until May 2013, 313,545 suspected cases and 88,881 a commercial enzyme immunoassay (EIA) and reverse transcriptase-polymerase chain reaction (RT-PCR) using aegypti infestation index rapid survey) presented an confirmedincrease of four cases times were when reported. the index The from LIRAa March/2012 (Aedes for NoV genogroups GI and GII, respectively. A positivity (1.90%) was compared to the index from March/2013 theof 12.7% primers (51/401) Mon 432-434/ was observed 431-433, for thatNoV arefor at specific least one method. The highest positivity 31.9% (22/69) (2,981) dengue cases, in 2013, was also observed. The (7.80%).aim of this An increasework was in suspectedto perform (3,877) a prospective and confirmed study age group showed that males of 6-12 months old were of A. aegypti infection with DENV in Juiz de Fora-MG. wasthe most verified affected in June. with Analysis positivity of of the 25% positive (9/36) cases and byas Larvae and mosquitoes were collected in epidemic and the second the females of 12-24 months old with 20% non-epidemic periods in 2012 and 2013 and properly (9/45). The frequency of vomiting observed in diarrheic children, both positive and negative for NoV, was similar 50 larvae) and mosquito (53 pools, each contained 20 in almost all months of collection, with exception of June, identified.mosquitoes) Pools were of macerated larvae (165 and pools, used each for total contained RNA when the positivity of 76.4% (13/17) was observed in extraction. Total RNA was used for cDNA synthesis the NoV positive cases and 34.6% (9/26) in the negative followed by nested-PCR to detect DENV. DENV was not ones. Studies have demonstrated the importance of detected in none of mosquitoes pools tested. DENV NoV as etiological agent that required medical care. The was detected in six pools of larvae (3.63%) obtained in Central, Northwest, East and South regions. These results than 9.8% (30/305) detected in a surveillance carried reinforce the circulation of DENV in Juiz de Fora - MG and positivityout in hospitals verified and in emergency this study (12.7%) departments was a inlittle Belém. higher In in different regions of the city that are highly inhabited. Manaus the NoV were observed in 35.4% (171/483) of Moreover, as known for DENV, the vertical transovarian the samples from Emergency Units. The data obtained in transmission of DENV was detected here and may be this study are relevant considering the few information implicated in DENV maintenance in the Juiz de Fora available about the NoV circulation in Rio Branco. These urban environment. Financial support: FAPEMIG, CNPq, results may contribute to the improvement of Public CAPES, UFJF, PROPESQ/UFJF. Health of this state. HV176 - Three-Dimensional Models Of Ns3/4a HV174 - Investigation Of Dengue Virus In Protease Containing Resistance Mutations Aedes Aegypti, In Juiz De Fora, Minas Gerais, To Protease Inhibitors From Patients With Brazil. Chronic Hepatitis C Protease Inhibitors Sacchetto, L., Botelho, J., Duque, E., Campos, G.M.M., Naïve. Pereira, M.S., Rosa e Silva, M.L., Kroon, E.G., Drumond, Hoffmann, L., Da Silva, M.L., Ramos, J.A., Valentin, E.S., B.P. Ürményi, T.P., Rondinelli, E., Bisch, P.M., Silva, R. 1. Universidade Federal de Juiz de Fora, UFJF, Rua José 1. Universidade Federal do Rio de Janeiro, Inst de Lourenço Kelmer, s/n Campus Universitário/Bairro São Pedro Biofísica, UFRJ, IBCCF, Av. Carlos Chagas Filho, 373, CCS, bl 2. Rede de Pesquisa em Virologia do Interior de Minas G, sl G1050, Ilha do Fundão, RJ, 21941902 Gerais, INTRAVIRUS 2. Instituto Nacional de Metrologia, Qualidade e 3. Departamento de Vigilância Epidemiológica e Tecnologia, INMETRO, Av. Nossa Senhora das Graças, 50 - Xerém, Duque de Caxias, RJ, 25250020

101 Human Virology: HV

3. Instituto Federal de Educação, Ciência e Tecnologia Instituto Evandro Chagas, IEC, • Rodovia BR-316 km do RJ, IFRJ, R. Sen. Furtado, 121, Maracanã, Rio de Janeiro - 7 s/n - Levilândia - 67030-000 - Ananindeua / Pará / Brasil RJ, 20270021 Astrovirus (AstVs) is a common viral pathogen that causes 4. Universidade Federal do Rio de Janeiro, Depto Clínica Médica, UFRJ, Rua Rodolpho Paulo Rocco, 255, Ilha do Fundão, HUCFF, RJ, 21941913 gastroenteritisas HAstVs VA1, (GE)VA2, worldwide.VA3, MLB-1 They and areMLB-2. classified Elderly in 5. Inst Nac para Pesquisa Translacional em Saúde e eightand children classic typesare the and most others affected five new group ones, when described comes Ambiente, INCTINPeTAm/CNPq/MCT, Av. Carlos Chagas to outbreaks, mainly due to person-to-person contact Filho, 373, CCS, Ilha do Fundão, RJ, 21941902 and ingestion food and contaminated waters. During the period of May 2008 to April 2011, 483 fecal samples INTRODUCTION: New compounds are being considered were collected from hospitalized diarrheic children, for anti-HCV therapy since the low sustained virological rates with pegylated interferon and ribavirin (PEG-IFN/ Northern Brazil. These samples were initially tested for RBV) treatment. NS3/4A protease inhibitors (PIs) are underrotavirus five detectionyears old in with a pediatric negative clinic results. from Belem-Para,They were already approved by Food and Drug Administration submitted to viral RNA extraction by the silica method (FDA) and by the Brazilian Sanitary National Agency (Anvisa). However, resistance mutations often occur and the classic HAstVs (Mon269/Mon270) detection. andAfter testedthat, a withsubset primers of 125 negative specific samples to norovirus for NoV (NoV) and of these mutations since before the beginning of HAstVs were also tested with primers SF0073/SF0076 andPIs treatment may influence is important on therapy to efficacy.the correct Identification clinical that detect both classics and new MLB-1 and MLB-2 management. OBJECTIVE: The aim of this work is to HAstVs. The nucleotide sequence was determined by assess the three-dimensional (3D) prediction models direct cycle sequencing and the chromatograms were to NS3/4A serine protease from patients treated with analyzed with BioEdit software and compared with PEG-IFN/RBV previously studied. We found already others registered in GenBank. A positivity of 3.5% described PIs resistance mutations in 3 of a cohort of (17/483) was observed when using the classic HAstVs 68 patients (4,4%). MATERIAL AND METHODS: The 3D primers which 94.1% (16/17) being characterized by NS3/4A protease models were predicted by comparative nucleotide sequencing: 64.7% (11/16) as HAstVs-1, molecular modeling using software MODELLER and the 23.5% (4/16) as HAstVs-2 and 5.9% (1/16) as HAstVs-3. validation was done by Ramachandran plot, DOPE score In regard to the subgroup of 125 samples, two (1.6%) and calculating RMSD with template. It was used 2FM2 as the reference structure. RESULTS: In 3D models we can observe a lot of amino acid alterations and some of werethe HAstV-1 positive was being the classified most prevalent. as HAstVs-1 The HAstVsand HAstVs-8. type 8 which are near Serine-139. This is one of the amino acids Aswas verified not frequently in studies found, conducted but it already in different was described countries in that are found in the active site of the protease and the a study conducted in Belem, Para. The new types MBL- target binding site of the most widely used PIs. It suggests 1 and MLB-2 were not detected in this study. Maybe, that it can interfere at PI and NS3/4A protease active improvements in the technique are necessary to obtain site ligation and consequently interfering in treatment better results. Therefore, the researches of these agents are important considering the few studies available in mutations on PI ligation we are performing molecular Brazil and mainly in the Northern region. outcome.docking usingTo better AutoDock. understanding CONCLUSIONS: the influence 3D ofmodels these showed that the presence of mutations near NS3 HV180 - Molecular Diagnostic Of Herpes Simplex Virus Type-1 In Serum Samples Of Immunocompromised Patients protease active site may influence the PI ligation and Lopes, A.O., Perse, A.S., Grinsztejn, B., Wagner, S., De consequentlywith these drugs. the FinancialPI therapy support: efficacy. FAPERJ/PPSUS/MS, This approach can Paula, V.S. suggestINCT-INPeTAm/CNPq/MCT, which patients will CNPqnot benefit and CAPES. from treatment 1. Instituto Oswaldo Cruz, IOC, Av. Brasil, 4365 - HV177 - Molecular Characterization Manguinhos, Rio de Janeiro, Brazil Of Astrovirus Affecting Hospitalized 2. Instituto de Pesquisa Evandro Chagas, IPEC, Av. Children From Belém, Pará, Northern Brasil, 4365 - Manguinhos, Rio de Janeiro, Brazil Brazil. Portal, T.M., Siqueira, J.A.M., Carvalho, T.C.N., Oliveira, Herpes is a recurrent viral disease, usually benign, can D.S., Linhares, A.C., Mascarenhas, J.D.P. , Gabbay, Y.B. be caused by herpes simplex virus type-1 (HSV-1) that belong to Herpesviridae family. The HSV-1 can induces

102 Human Virology: HV lesions around the mouth, but in immunocompromised NoroII-R(-) [2nd Step]). The nucleotide (nt) sequence patients the virus may cause lasting and severe was determined by direct cycle sequencing including manifestations that may lead to death. The treatment the most properly region D. In order to investigate the involves the use of antiviral aciclovir, famciclovir, possibility of a recombination event, ORF1/2 junction velaciclovir. In relation to the laboratorial diagnosis, the region was analyzed (Mon 431/432-G2SKR) with the gold standard is the virus isolation, in many cases due to SimPlot construction. A positivity of 35.4% (171/483) low titers, the virus cannot be isolated. Another method was observed. The nt sequencing of A/B regions were for the HSV diagnosis is the Polymerase Chain Reaction as GII.4d, 7.7% as GII.7 and 11.5% as GII.b. Using the allows the diagnosis of different samples such as blood, obtained in 52 positive samples, being 80.8% classified (PCR),saliva and being lesion. a highly The aim sensitive of this andstudy specific, was to besides,detect the it HSV-1 in immunocompromised patients by qualitative regionas recombinants D, five of by the ORF1/2 six samples junction classified region, as when GII.b PCR. For this purpose, were enrolled in this study, 41 werecompared characterized with two asparental GII.3 and strains three [GII.b were (AY68254) confirmed samples from HIV-positive patients collected during 2012 in the Instituto de Pesquisa Evandro Chagas/ nt 5070 located 15 nucleotides upstream of the ORF1/2 Fiocruz. These samples were tested by conventional andoverlap. GII.3 An (U02030)]. international The NoV breakpoint working was group identified recently in PCR for gene gI (410 bp) and gG (269 bp), which codify proposes a new nomenclature using both ORF1 and VP1 glycoprotein I and glycoprotein G of viral envelope, sequences, considering that recombination is a common respectively. The results showed that, to gI region, HSV DNA was detected in 36,6% (15/41) of HIV positive the GII.b strain as GII.P21. The NoV-recombination patients and to gG region 44% (18/41) of samples event.GII.P21/GII.3 In order is to onehave of a betterthe most classification, detected theyworldwide, named were positive. Among HSV positives samples, 46% were being responsible for AGE outbreaks in Europe, Asia detected in men, in this group HSV DNA was detected in and Australia. In this study, this strain was related with both region. Among women, 38% were positive to gG severe cases of diarrhea leading to hospitalization, and 15% were positive to gI. PCR allowed the detection demonstrating the high virulence of this genotype, what of co-infection of HSV-1 in patients infected with HIV reinforce the need of a continuous NoV-surveillance. and the detection was more frequent in the gG region. In conclusion, this techniques can be used to detect co- HV186 - Molecular Epidemiology Of infection HSV1/HIV and to monitoring HSV infection in Alfaherpesvirus In Immunocompromised immunocompromised patients. Patients In Brazil Perse, A.S., Lopes, A.Z., Almeida, A.J., De Paula, V.S. HV184 - Detection Of Norovirus Recombinant Gii.P21/Gii.3 In Hospitalized 1. Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil, Children For Acute Gastroenteritis From 4365 Belém, Pará, Northern Brazil 2. Hospital Universitário Gaffree Guinle, Siqueira, J.A.M., Fumian, T.M., Barros, R.J.S., Reymão, HUGGUNIRIO T.K.A., Portal, T.M., Júnior, E.C.S., Linhares, A.C., Herpes simplex type 1 (HSV-1) and herpes simplex Mascarenhas, J.D.P., Gabbay, Y.B. Instituto Evandro Chagas, IEC, Rod. BR 316, Km 07, subfamily, possessing the ability to infect and cause S/N, Levilândia, CEP: 67030-000. Ananindeua-Pará typelatency 2 (HSV-2) in sensory are classified nerves .in Certain the Alphaherpervirinae situations such as stress, hyperthermia, organ transplantation and The norovirus (NoV) RNA-recombination can increase immunosuppression can lead to reactivation of the virulence and lead to a mistake in molecular infection. During reactivation, the viral particles are epidemiological studies, having major implications in transported via anterograde transport along the vaccine design strategies. The present study reports the peripheral sensory neurons may cause an infection in detection of NoV recombinant GII.P21/GII.3 affecting the tissue mucocutaneous, keratoconjunctivitis and children hospitalized for acute gastroenteritis (AGE). encephalitis. Based on the DNA sequence of clinical The fecal collection specimens occurred from May 2008 isolates, divergence between different genotypes are to April 2011. The enzyme immunoassay (EIA) and well described for herpesviroses human, but in Brazil reverse transcription-polymerase chain reaction (RT- there are no information about molecular epidemiology PCR) from region B (Mon 431-434) were used for NoV of the herpesviroses . This research aims to characterize detection. The samples with positive results by EIA and the genotypes of HSV-1 and HSV-2 in HIV/AIDS negative by RT-PCR, were submitted to semi-nested RT- circulating and study the epidemiology of these viruses PCR from region A (JV12Y(+)/JV13I(-) [1st Step]; GI(+)/ in Brazil. For this purpose, 72 samples of HIV patients

103 Human Virology: HV reagents from a public Hospital were analyzed. The 16 (12.1%) were positive to alphaviruses; 131 (99.2%) polymerase chain reaction (PCR) assay was performed to genes glycoprotein G (gG) and glycoprotein I (gI) from By IgM-ELISA, a total of 90 serum samples were also HSV-1; and glycoprotein genes G (gG) and glycoprotein totested flaviviruses 64 (71.1%) and of 113 them (85.6%) were topositive orthobunyaviruses. to DEN IgM, B (gB) from HSV-2. Twenty six samples were positive suggesting recent infection by dengue and all serum for the gene gG and thirty-three samples positive for samples tested were negative for YFV. The serologic the gI gene of HSV-1; no sample were positive to HSV- results demonstrate the occurrence of a Dengue fever 2. The PCR products were directed sequencing and the results showed a homology between 90-99% with seroprevalence to other arboviruses of different genera the nucleotide sequences previously described in the outbreaksuggest a inhigh Mazagão circulation municipality; of these viruses finally, in a veryMazagão. high literature suggesting that the samples of this study Financial support: IEC/ SVC/MS are closely related to samples from group A of HSV- 1 . Our data clearly demonstrate that 42 percente of HV190 - Evidence Of Person To Person immunocompromised patients have HSV-1 DNA detect Transmission Of Hepatitis A Virus In in the serum samples. These results contribute to the Household Outbreaks understanding of HSV1 epidemiology in Brazil and can Lima, L.R., Hasselmann, B., Lewis-Ximenez, L.L., De be useful in predicting disease progression and guiding Paula, V.S. treatment initiation decisions. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil 4.356 HV189 - Serologic Surveillance For Introduction: Hepatitis A virus is transmitted by fecal- Arbovirus In, Mazagão, Amapa State, oral route through contact from person-to-person or January -2013 through ingestion of contaminated food or water. The Ferreira, M.S., Martins, L.C., Chiang, J.O., Rodrigues, person-to-person transmission is easier especially S.G., Rodrigues, D.S.G., Nunes-Neto, J.P., Santos, M.P., indoors where there are improper hygiene conditions Vasconcelos, P.F.C. and high proportion of individuals susceptible. Thus, 1. Instituto Evandro Chagas, IEC, mileneferreira@iec. the intimate family contact is a risk factor for disease dissemination. Based on that, this work aims to evaluate pa.gov.br the intrafamilial transmission of HAV. Methods: Serum 2. Instituto Evandro Chagas, IEC, pedrovasconcelos@ samples were collected from patients with hepatitis iec.pa.gov.br A (index case) and their family members (contacts) at 3. Secretária Municipal de Saúde de Mazagão-Amapá, Ambulatory of Viral Hepatitis. Patients who agreed to Almost all arboviruses are zoonoses maintained in the participate in the study signed an informed consent. wild environment. Therefore, people who maintain Thus, thirty families were included, total of 97 serum closed contact with enzootic foci of arboviruses are most at risk of becoming infected. Several arboviruses detection of IgG and IgM anti-HAV by ELISA and rapid are serious problems for the public health problems, samples.test. Then, Serum HAV-RNA samples was weredetection firstly by submitted nested-PCR to such as dengue Virus (DENV), Mayaro (MAYV) and employing primers for the VP1/2A region of the viral Oropouche (ORO) which occur in the Amazon region. RNA and HAV-RNA positive samples were sequencing. Due the report of a febrile outcreak a serological survey Results and Conclusion: Among 30 families that were to Arbovirus infections was performed in Mazagão investigated in 16 were detected evidence of household municipality, state of Amapa in January 2013. A total of transmission by serology and/or molecular biology. 132 serum samples were collected from febrile patients Of the contacts include in this study 31% showed IgM living in the urban area and in the neighborhood of anti-HAV, 39,7% showed IgG anti-HAV and 29,3% were Magazão Municipality, Amapá state. Samples were susceptible to HAV. The majority (70%) of the patients screened by hemagglutination – Inhibition (HI) test under 20 years old were susceptible to hepatitis A. against 18 of arbovirus antigens from genera Alphavirus HAV-RNA was detected by nested-PCR in 42% (41/97) (East Encephalitis equine virus, Western Encephalitis of serum samples collected and all isolates sequenced equine virus, Mayaro virus, Mucambo virus), Flavivirus belong to HAV genotype I. In four families was possible (Yellow fever virus, Dengue virus type 1, 2 3 and 4, suggest the person-to-person transmission due high Saint Louis Encephalitis virus, Rocio virus, Ilheus virus) nucleotidic identity (99,4% and 100%) between the and Orthobunyavirus (Caraparu virus, Guaroa virus, nucleotidic sequences of HAV isolates. This study Tacaiuma virus, Maguari virus, Oropouche virus and found a large amount of families exposed to household Catu virus); samples were also assayed by IgM–ELISA to outbreaks demonstrating that this place is favorable DENV and YFV. From 132 human samples tested by HI, for spread of hepatitis A, which is further facilitated September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

104 Human Virology: HV

Braga, A.C.S., Lemos Júnior, M.A., Carneiro, B.M., Silva, household outbreaks and due large number of younger J.B.G., Rahal, P. bystill personsusceptible to person to infection. transmission Financial confirmed Support: in IOC- two 1. Universidade Estadual Paulista, UNESP, Rua Cristóvão Colombo, 2265, CEP 15054-000 - São José do Rio FIOCRUZHV196 - Candom CAPESparative E-mail: A [email protected] Of The Saliva Preto, SP And Urine Samples For Congenital Cmv 2. Faculdade de Medicina de São José do Rio Preto, Infection Screening. FAMERP, Av. Brigadeiro Faria Lima, 5416, CEP 15090-000 Souza, G.O.S., Oliveira, J.S., Cardoso, E.S.C., Zeidan, G.C., São José do Rio Preto, SP Gadelha, S.R., Marin, L.J. Hepatitis C is a consequence of infection by hepatitis C 1. Universidade Estadual de Santa Cruz, UESC, virus (HCV) and it is estimated that approximately 170 2. Centro Universitário Leonardo da Vinci, million people worldwide are chronically infected. Many UNIASSELVI patients are asymptomatic and are usually diagnosed The cytomegalovirus (CMV) is the most frequent cause of after a long period of time, resulting in complications congenital infection worldwide and the infection can be such as cirrhosis and hepatocellular carcinoma. These symptomatic or asymptomatic. Early diagnosis of CMV asymptomatic patients also represent a natural source of in newborns is very important to avoid sequel and it can the disease and the spread of HCV. This virus is infectious be done by PCR from various clinical specimens. The through contact with blood and transmission can urine is considered the gold standard sample; however occur by contaminated materials such as syringes and there are some limitations to use urine, especially on a needles. Many studies suggested acupuncture therapy as a possible route of transmission however, there is the collection. The present study aimed to verify the needles often penetrate the skin, subcutaneous tissue largeusefulness scale ofscreening saliva as due compared the difficult with tothe obtain use of during urine for the diagnosis of CMV infection in 1000 newborn noand studies muscles confirming and usually this residual hypothesis patient yet. bloodAcupuncture can be from Maternity Santa Helena- Ilhéus, Bahia. The study found on those material. The aim of this study was to was approved by the Ethics Committee of the UESC investigate the presence of HCV RNA in acupuncture (209/08). Saliva and urine samples were collected with needles used on HCV positive patients. Needles from sterile swabs and sterile bags collectors, respectively. HCV positive patients were collected from two to four The saliva samples were collected from 100% children different acupuncture sessions. HCV negative patients while the urine samples only 33.4%. The detection of the were also included in this study as negative control. The viral genome in saliva and urine sample was performed results obtained by Real-time PCR showed that in 50% of HCV patients it was possible to detect the presence infection in 13 infants. Considering only the 334 infants of viral RNA in the samples. Needles collected from different sessions from the same patient had the same bythat PCR. it was It waspossible detected to collect and confirmed both samples, congenital it had beenCMV detected 5 congenital infections (prevalence of 1.50%). result. These data demonstrate that the acupuncture Analyzing the 666 infants that only saliva samples were therapy may indeed be a route of transmission of collected, 8 congenital infections (prevalence of 1.20%) HCV and underscore the importance of bio-security were detected. The comparison between the use urine procedures to prevent accidents potentially infectious. and saliva for detection of CMV viral genome showed HV205 - Hbv And Hdv Infections In Hiv- Infected Patients In Midwest, Brazil important to emphasize that the use of saliva samples Puga, M.A.P. nohad significant provided differencemore positive (p = samples.0.7372). BesidesThese newborns that, it is would not have the diagnosis of infection since it was Universidade Federal do Mato Grosso do Sul, UFMS, not possible to collect urine. Thus, our results suggest rua filinto muller, cidade universitária, LAC-CCBS, sem número on a large scale screening, saliva samples present a quick thatand easydue thealternative difficulty to toobtaining obtaining satisfactory urine for resultsa newborn and A cross-sectional study on prevalence of HBV and HDV can be used as an alternative for the diagnosis of this infection, risk factors and genotype distribution of infection. Financial support: FAPESB e UESC. HBV infection was conducted among 848 HIV-infected patients recruited at reference centers in the Midwest HV197 - Hcv Detection In Acupuncture Region of Brazil. Of the patients investigated, 222 had Needles serological markers of HBV infection. The prevalence rate of HIV-HBV co-infection was 2.4%. No HIV-HBV

105 Human Virology: HV infected patient presented as positive for anti-HDV 2. Programa de Pós Graduação em Ciências Médicas, and one (0.1%) HIV/HBV patient was found to be PPGCM/UFF, Faculdade de Medicina, UFF anti-HCV-positive. Male gender, increasing age, family 3. Disciplina de Doenças Infecciosas e Parasitárias, history of hepatitis, use of illicit drug and homosexual UFF, DIP/HUAP/UFF, Rua Marquês do Paraná 303, Niterói activity were independent factors associated with HBV (RJ) CEP 24033-900 exposure. The phylogenetic analysis based on the S gene region revealed the presence of genotypes D (76.9%), Human Parvovirus B19 (B19V), a member of the F (15.4%) and A (7.7%) among the study population. Parvoviridae family, genus Erythrovirus, causes a wide This study demonstrates the low prevalence of HIV-HBV spectrum of clinical conditions. The most common infection and also highlights of early vaccination against clinical presentation of B19V infection is the childhood HBV as well as testing for HBV, HCV and HDV in all HIV- exanthem known as erythema infectiosum (EI). Previous infected individuals. studies have demonstrated that the disease appears to cycle in approximately 4-5 years. To date, B19V has been HV206 - Compliance With And Response To grouped into three distinct genotypes: genotype 1, with Two Hepatitis B Vaccination Schedules subtypes 1a (B19V) and 1b; genotype 2; and genotype Among Female Sex Workers In Campo 3, with subtypes 3a and 3b. The aim of this study was Grande, Mato Grosso Do Sul to investigate the distribution of B19V genotypes during Castro-Souza, L. two outbreaks of EI in Niterói, RJ. A total of 26 serum Universidade Federal do Mato Grosso do Sul, UFMS, samples collected from patients with EI attending at Rua Filinto Muller, cidade universitária, s/ número, LAC- general medical outpatient clinic at HUAP/UFF during 1999-2000 (20 samples) and 2004-2005 (6 samples) CCBS were examined. Viral DNA was extracted from sera using The most effective measure in combating Hepatitis B QIAamp DNA Blood Mini Kit (QIAGEN, Brazil) and a semi- virus (HBV) infection is the active immunization. Thus, nested PCR using primers pair P12/P16 (4127-4689) was offered the hepatitis B vaccine, in two different vaccination schedules, in a total of 256 female sex the VP1/VP2 capsid gene was performed. The 476bp workers susceptible to HBV infection in Campo Grande, and P13/P16 (4214-4689) for partial amplification of MS, and also investigated the adhesion and response to hepatitis B vaccine in this population. The two vaccination ampliconsto direct sequencingwere purified using using the GFXTM BigDye PCR terminator DNA and Gel v. schedule used was: accelerated (0, 1 and 2 months) Band1.1 cycle Purification sequencing kit (GE,kit (Applied Healthcare, Biosystems,CA, UK) and subjected USA). and conventional (0, 1 and 6 months) schedules. Of all Nucleotide and amino acid (AA) similarity with Genbank susceptible subjects, 230 (89.8%) individuals received database was assessed using BLAST tool. According to the sequence analysis of VP1/VP2 capsid region, all the or conventional, and only 82 (35.6%) complied with 26 strains shared higher nucleotide identity (100-99%) the first dose of vaccination schedules, accelerated with 1a B19V isolates and then were characterized compliance rate (p = 0.52), when the conventional and as belonging to the genotype 1a. It is well known that theaccelerated full scheme. vaccination There was schedules no significant were difference compared. in genotype 1 is widespread around the world. In Brazil, Protective titers of anti-HBs were detected in those that although genotype 1 is the more common, all three completed the three doses of HBV vaccine. Alternative schemes for hepatitis B vaccination and health education to determine the B19V genotypes circulating in different programs are needed for the control and prevention genotypesoutbreaks inhave Rio beende Janeiro, identified. Brazil. This is the first report against HBV infection, besides improving vaccination coverage in these female sex workers. HV214 - Stability Of Hepatitis B Virus Nucleic Acid In Plasma Samples After 7 Days At 42°C HV213 - Genomic Typing Of Human Parvovirus Almeida, R.W., Espírito-Santo, M.P., Sousa, P.S.F., Almeida, B19 Circulating During Outbreaks Of A.J., Lampe, E., Fernandes, C.A.S., Morais, S.R.S., Bazzo, Erythema Infectiosun In Niterói, Rj, Brazil M.L., Pires, A.F.N.P.C., Nery-Silva, C.R., Lewis-Ximenez, Cubel Garcia, R.C.N., Pereira, R.F.A., Macedo, D.F.R., L.L. Castro, T.X., Azevedo, K.M.L., Setubal, S., Oliveira, S.A. 1. Laboratorio de Hepatites Virais, IOC/FIOCRUZ, 1. Instituto Biomédico, Universidade Federal Av. Brasil, 4.365 - Pav. HPP, Manguinhos, Rio de Janeiro - RJ Fluminense, MIP/CMB/UFF, Rua Prof. Hernani Melo 101, CEP: 21040900 Niterói, RJ. CEP:24210-130 2. Laboratório Central de Saúde Pública Noel Nutels,

106 Human Virology: HV

LACEN/RJ, Rua do Resende, 118 - Bairro de Fátima CEP: The laboratory diagnosis of hepatitis B virus (HBV) 20.231-092 / Rio de Janeiro infection is based mainly on serological assays. Yet the 3. Laboratório de Pesquisas III, Serviço de Análises detection and quantitation of viral DNA is necessary Clínicas, UFSC, HU, Campus Universitário, S/N°, Trindade- when addressing directly the question of infectivity or when monitoring the viral load during therapy. We Florianópolis-SC described the validation of a real-time PCR assay for 4. Dpto. DST, AIDS e Hepatites Virais, Sec. Vigilância em Saúde, Ministério da Saúde, SAF Sul Trecho 02, Bloco F, MGB probes. The method was calibrated on the basis of Torre 1, Edifício Premium, ULAB 70070-600 -Brasília HBVserially DNA diluted quantification clinical samples with TaqMan positive chemistry for HBV DNA and Viral nucleic acid integrity in biological samples for tested by COBAS® AmpliPrep/COBAS® TaqMan® HBV molecular testing is crucial for reliable laboratory Test, v2.0. The sequences of the probe BS-1 and the results. The aim of this study was to evaluate the stability primers HBV-Taq1 and HBV-Taq2 were designed from of hepatitis B virus (HBV) DNA in plasma samples for the conserved regions of HBV surface gene as described external quality assessment panels (EQA) for HBV viral by Weinberger and collaborators. However, we replaced load and furthermore identify shipping requirements for the TAMRA quencher for MGB NFQ and HBV DNA was sample storage. To assess the stability of plasma samples isolated from 200 ul of plasma using the High Pure containing different concentrations of HBV DNA, serial Viral Nucleic Acid kit (Roche Diagnostics, Mannheim, dilutions were carried out on an infected sample with Germany) according to the manufacturer’s instructions, HBV viral load of 6.40 log(10)IU/ml, yielding viral differently of the QiaAmp blood and tissue kit (QiaGen, loads of 5 log(10), 4 log(10) and 3 log(10) IU/ml that Hilden, Germany) cited by the author. Using a dilution were prepared in triplicate and incubated at 42oC for series of 100 to 105 UI of HBV DNA, as few as 2.5 UI/ up to 7 days and frozen at -70°C. Viral load testing for mL could be reproducibly detected. The crossing points HBV DNA was performed for all samples using COBAS® were linearly proportional to the logarithm of the input AmpliPrep/COBAS® TaqMan® HBV Test, v2.0, Roche, copy number over 6 orders of magnitude (R2= 0.99). and compared to fresh frozen plasma (FFP) samples that were not incubated and immediately stored at -70oC slope value of -3.5827 was 0.90. The assay is presently (day 0), and used as a parameter to establish the range Thebeing calculated validated PCR against efficiency a broad for spectrum this assay, of based viral load on the of of tolerable result for measurements made in the days different genotypes. Financial support: FIOCRUZ after. The results of this study demonstrate a decrease HV220 - Genetic Diversity Of Dengue Virus of HBV DNA viral load tested after storage at 42°C for Type 2 Isolated In Roraima Between 2008 up to 7 days that ranged from 0.005 to 0.30 log10 IU/ And 2011 ml that did not exceed 0.5 log10, which is the estimated Siqueira, T.C.S., Granja, F., Sousa, D.D., Cordeiro, J.S., intra-assay variation for molecular tests. As the decrease Lima Jr., W.P., Nascimento, I.A.S., Silva, G.A.V., Naveca, F.G., Acosta, P.O.A. B virus in plasma samples at temperatures of up to 42 ° of viral load was non-significant, shipments of hepatitis 1. Universidade Federal de Roraima, UFRR, Campus non-lyophilized samples for HBV DNA detection may be Paricarana: Av. Cap. Ene Garcez, nº 2413. Bairro Aeroporto. Cshipped are suitable without within dry 7ice days. or iceThese packs findings for short confirm periods that CEP: 69310-00 of time, and thus diminishing costs. Financial support: 2. Leônidas e Maria Deane Institute, Fiocruz, ILMD, Brazilian Ministry of Health Fiocruz HV216 - Standardization Of A Real-Time Dengue is an arboviral disease caused by the DENV Quantitative Pcr Assay For Detection Of virus that belongs to genus Flavivirus, family Flaviridae, Hepatitis B Virus transmitted mainly by the mosquito Aedes aegypti. Almeida, A.J., , Espírito-Santo, M.P., Sousa, P.S.F., Lampe, DENV has 4 serotypes: DENV1, 2, 3 and 4, beyond E., Fernandes, C.A.S., Morais, S.R.S., Silva, I.A.S., Pinheiro, of the intraserotype variability also is subdivided in S.X.S.L., Silva, L.D.A., Marques, V.A., Lewis-Ximenez, L.L. genotypes. Serotype DENV2 circulates in Brazil since 1. Laboratorio de Hepatites Virais, IOC/FIOCRUZ, 1990, where was in Rio de Janeiro (RJ) city. In Roraima state, from 1999 the serotype DENV2 did not show Av. Brasil, 4.365 - Pav. HPP, Manguinhos, Rio de Janeiro - RJ reports of circulation only in 2001 and 2004. This state CEP: 21040900 shows a hyperendemic situation of Dengue, place that 2. Laboratório Central de Saúde Pública Noel Nutels, currently there is the 4 serotypes in circulation. The LACEN/RJ, Rua do Resende, 118 - Bairro de Fátima CEP: present study had as objective analyze of the genetic 20.231-092 / Rio de Janeiro diversity of DENV2 isolated in Roraima state through September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

107 Human Virology: HV phylogenetic analyze to provide important information study was: NoV (11.1% 56/505), GARV (10.9% 55/505), that assist in this serotype and its genotypes surveillance. AdV (10.9% 55/505) and AstV (2.2% 11/505). Co- Then was accomplished viral isolation and indirect infection was observed in 18 fecal samples involving two viruses, mainly AdV-GARV (33.3% 06/18), AdV- DENV2 provided from LACEN-RR. Positive samples were NoV (27.7% 05/18) and NoV-GARV (16.6% 03/18) and immunofluorescenceanalyzed by RT-PCR efrom sequenced. C6/36 cells A phylogenetic in suspicious tree of three viruses, such as GARV-AstV-NoV (5,6% 01/18) and was built with sequences of DENV2 from 2008 to 2011. GARV-AstV-AdV. The comparison of viral prevalence data Isolated strains end up grouped in a clade together with the Asian/American genotypes, genotype circulating on the number of hospitalization between 2006 and 2007 Americas and only one circulating in Brazil. The analyze withcoinciding official with report the decrease showed of an GARV important prevalence, reduction shortly in results demonstrated that Roraima strains belongs to after the introduction of the Rotarix vaccine. On the other this genotype without variation between 2008 and 2011. hand, was observed a trend of increase from 2008 to 2011 High similarity (99%) was found with isolated strains associated with an important increment in prevalence of from RJ in 2008, entry route of DENV2 in Brazil and with NoV and AdV infections, probably indicating more severe history of severe outbreaks caused by this serotype. cases of ADD caused by these viruses. Altogether these However, low similarity was found with Venezuela’s results suggest an important contribution of NoV, GARV strains, neighbor country and potential entry route for and AdV in cases of hospitalization by ADD. Financial new serotypes and/or genotypes in Brazil. This study support: CAPES, CNPq, FAPEMIG and Propesq-UFJF suggests that, probably, DENV2’s strains isolated in Roraima came in through other states of Brazil instead HV225 - Production Of Chimeric Protein of Venezuela. Financial support: Universidade Federal de In Prokaryotic System For Diagnostic Of Roraima- UFRR e REDE DENGUE/ CNPq Htlv-1 Carmo, A.P., Silveira, D.M., Daian, D.S.O., Martins, M.L., HV221 - Putative Role Of Enteric Viruses Da Fonseca, F.G., Stancioli, E.F.B. In Oficcial Reports Of Hospitalization By Acute Diarrheal Disease In Juiz De Fora, Mg 1. Universidade Federal de Minas Gerais, UFMG, Assis, A.S.F., Valle, D.A., Reis, T.A.V., Barletta, V.H., Avenida Presidente Antônio Carlos, 6627, CEP 31270-901, Munck, A.K.R., Tibiriça, S.H.C., Carvalho, I.P., Rosa e Belo Horizonte/ MG Silva, M.L. 2. GIPH – Interdisciplinary HTLV Research Group , GIPH, Alameda Ezequiel Dias, 321, CEP 30130-110, Santa 1. Universidade Federal de Juiz de Fora, UFJF, Rua Efigênia, Belo Horizonte/MG José Lourenço Kelmer, s/n - Campus Universitário São Pedro 3. Setor de Pesquisa - Fundação HEMOMINAS, - CEP: 36036-330 HEMOMINAS, Alameda Ezequiel Dias, 321, CEP 30130-110, 2. Universidade Federal do Rio de Janeiro, UFRJ, Av. Santa Efigênia, Belo Horizonte/MG Pedro Calmon, 550 - Cidade Universitária - Rio de Janeiro, RJ The Human T-lymphotropic viruses 1 and 2 (HTLV-1 Acute diarrheal disease (ADD) affects millions of children and HTLV-2) are retroviruses transmitted sexually and worldwide often requiring hospitalization. Despite that, by breast feeding and contaminated blood transfusion, sharing of contaminated needles and syringes, or the viral pathogens involved stand out the group A transplantation of infected organs and tissues. HTLV-1 is usuallyrotavirus the (GARV), etiological norovirus agent (NoV), is not identified.adenovirus Among(AdV) associated with leukemia (ATL) and a mielopathy (HAM/ and astrovirus (AstV), some of them associated with high morbidity and mortality, especially in developing countries. The purpose of this study was to investigate TSP),impact besides on the morbidity other inflammatory of carriers. diseases. Laboratory HTLV-2 testing is the presence of these viruses in ADD cases, aiming to notfor HTLV-1clearly associatedand HTLV-2 with infections disease, is but mandatory it has significant routine for blood transfusion and organ transplantation in of infantile hospitalization (0 - 4 years) by ADD in Juiz many countries worldwide. The most used tests for verifyde Fora, their MG. putativeFrom January contribution 2006 to inDecember the official 2011, report 505 the diagnosis of HTLV-1/2 are enzyme immunoassays diarrheal fecal samples were obtained from children under 5 years old. Detection of viruses was realized by Western blot (WB) and PCR assays. The aim of this study PCR and RT-PCR. The rates of hospitalization for ADD (ELISA/EIA),was to construct indirect a plasmid Immunofluorescence vector containing a coding (IFA), were obtained from Ministry of Health’s Hospitalization region for prokaryotic expression of a chimeric-HTLV-1 Data System. It was observed that 157 (31.1%) fecal samples were positive at least for one of the enteric infected individuals (HAM/TSP - HT and asymptomatic viruses tested. The prevalence of these viruses in this protein and validate its specificity by WB using sera of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

108 Human Virology: HV

- AS) as well as negative controls. The target gene was HRV (3 samples), HAdV + HRSV (2 samples) and KIPyV linked into an expression plasmid vector, pQE (Qiagen), + HRSV (1 sample). The majority of patients with and used to transform an Escherichia coli strain suitable viral infection (78.8%; 26/33) presented moderate/ for heterologous expression. Positive clones were severe episode of asthma with clinical presentation of selected and the induction of protein expression was dyspnea (96.9%; 32/33), wheezing (90.9%; 30/33), performed using IPTG. After parameters’ optimization, and cough (84.8%; 28/33). These results suggest that in the studied population, viral infections, especially AdV, tested in a Multi Screen WB and these preliminary HBoV and HRV may be associated with exacerbation theresults recombinant showed that protein both, wasHT purifiedand AS properlysera strongly and and/or worsening of asthma attacks. Financial support: recognize the chimeric protein, and no reaction was seen CNPq, FAPERJ. with the negative controls (noninfected individuals). This work provides promising evidences that the HV239 - Prevalence Of Insulin Resistance recombinant HTLV-1 protein was successfully expressed Among Chronic Hepatitis C Patients And in the prokaryotic expression system and that the Related Risk Factors Caldas, G.C., Miguel, J.C., Silva, E.F., Marques, B.L.C., infected serum, which can be a suitable target for future Villela-Nogueira, C.A., Almeida, A.J., Lewis-Ximenez, proteindevelopment demonstrates of clinical specific diagnostic interaction tests. with HTLV-1 L.L., Lampe, E., Villar, L.M. HV236 - Respiratory Viral Infections Among 1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 Asthmatics Infants 2. Universidade Federal do Rio de Janeiro, UFRJ Silva, R.C., Mendes, G.S., Amorim, A.R., Rojas, M.A., 3. Universidade Federal do Estado do Rio de Janeiro, Couceiro, J.N.S.S., Goudouris, E.S., Prado, E.A., Cunha, UNIRIO J.M.T., Santos, N. There is an association between hepatitis C virus (HCV) Universidade Federal do Rio de Janeiro, UFRJ, Av. and insulin resistance (IR). The aim of this study was to Carlos Chagas Filho - 373, C. Universitária, I. Fundão, R determine the prevalence of IR among chronic hepatitis Janeiro, 21941-972 C patients, and to assess the association between Asthma is as a chronic condition that affects a large hundred thirty-eight chronic hepatitis C patients were number of children worldwide. It emerges from a IR,recruited laboratory at three parameters Viral Hepatitis and clinical Reference findings. Centers Two complex interaction of genetic predisposition and in Rio de Janeiro. Socio demographic (sex and age) environmental factors. Acute viral respiratory infection and anthropometric [weight (kg), height (m), waist is one the leading cause of hospitalization of young circumference (cm), blood pressure (mmHg) and children and may be related to exacerbated asthma body mass index (kg/m²)] data were obtained. Serum episodes in all age groups, particularly in children. specimens were used for determination of anti-HCV, HCV The development of molecular tests facilitated the RNA, HCV genotype, ALT, AST, GGT, alkaline phosphatase, understanding of the relationship between viral thyroid stimulating hormone, glucose, triglycerides, infection and asthma exacerbation. The aim of this HDL-cholesterol, VLDL- cholesterol, LDL-cholesterol study was to determine the rates of respiratory virus infections in infants with exacerbation of asthma, treated non-invasive methods. IR was determined by HOMA-IR at the Emergency Service of the IPPMG/UFRJ. Asthma and insulin. Stage of hepatic fibrosis was determined by was done using SPSS Statistics version 17.0. The mean progressive worsening of dyspnea, wheezing, chest pain, whereage of HOMA-IRstudy population >2 was definedwas 54.1 as years IR. All (± data 10.8 analysis years) inceptioncough or aor combination exacerbation of wasthose defined symptoms. as an Ninety-one abrupt or and 57.6% were female. HCV genotype 1 was the respiratory samples (nasal+oral swabs combined) were most prevalent (66.8%) and most of patients were obtained from 85 patients 2 to 13 year-old. The asthma not submitted to antiviral treatment (82.8%). Mean body mass index was 27.5Kg/m2 (±4.23) and 56.3% moderate or severe. Samples were analyzed by real time of HCV patients presented high systemic arterial blood attackPCR for was virus classified detection. by theThirty-three attending samplesphysician (36.26%) as mild, pressure (BP) (> 130 x 85 mmHg). IR was observed in were positive for at least one virus: 9 single infections 152 patients (63.9%) and 57.2% of them were female. detected with HRV (9.89%), 5 with HBoV (5.49%), 3 with HCV chronic patients presenting IR (HOMA >2) had FLUV (3.29%), 2 with HAdV and HRSV each (2.19%), and 1 with KIPyV and HMPV each (1.09%). Additionally, 0.006) and VLDL-cholesterol (p = 0.02), compared with co-infections with these viruses were observed in 10 higherpatients levels without of triglycerides IR. Age (p = (p0.03), = 0.014), waist circumferenceviral load (p < cases (10.99%): HAdV + HBoV (4 samples), HBoV +

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human(p Virology: < 0.001), HV body mass index (p = 0.003) and weight XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

109 Human Virology: HV

Andrade, J.S.R., Ferreira, M.S.R., Xavier, M.P.T.P., Fumian, chronic HCV hepatitis and IR. In conclusion, this study T.M., Leite, J.P.G., Portes, S.A.R., Miagostovich, M.P. (pdemonstrated = 0.001) were high significantlyprevalence of higher IR among in patients HCV-positive with patients demonstrating the necessity of preventive Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 - measures in order to avoid adverse effects during HCV Manguinhos - Rio de Janeiro - RJ treatment. The genus Norovirus belongs to the family Caliciviridae HV244 - Study Of Prevalence And Clinical subdivided into 44 genotypes, including 16 GI, 23 GII, Aspects Of Congenital Cmv Infection In 2 GIII, 2 GIV, and 1 GV. GI and GII are responsible for Ilhéus, Bahia and are divided into five genogroups (G) and further most infections in humans. NoV are the main agents of Cardoso, E.S.C., Regina Raiol, M.R., Marques, M., Gadelha, outbreaks of acute gastroenteritis (AGE) worldwide, S.R., Cardoso, M.C., Marin, L.J. affecting individuals of all age groups. The lack of data on 1. PMBBM, UESC, , Ilhéus the molecular characterization of NoV in the state of Rio 2. Maternidade Santa Helena do Hospital São José, Grande do Sul (RS) stands out by the number of outbreaks Ilhéus of AGE reported in recent years. The aim of this study 3. Departamento de Ciências da Saúde, UESC, , Ilhéus was to determine the role of NoV in the etiology of AGE outbreaks in the state of RS from 2004 to 2011, and to 4. Departamento de enfermagem, CESUP, Ilhéus investigate the genetic diversity of the viruses detected The cytomegalovirus (CMV) is common around the during this period. For this purpose, we analyzed 2265 world and it is the most common cause of congenital stool samples sent from the Central Laboratory of RS infection, with prevalence between 0.2 to 3% of all (LACEN-RS) to the Laboratory of Comparative and live births. This prevalence is higher in populations Environmental Virology (LVCA) from 741 outbreaks where the maternal seropositivity is high. The vertical of AGE occurred in this period. For simultaneous transmission occurs via placenta, through the birth canal detection of NoV GI and GII, it was performed a reverse or by breastfeeding. The congenital CMV infection may be transcription followed by polymerase chain reaction symptomatic or asymptomatic, but most newborns have no symptoms at birth. However, these asymptomatic targets a partial region of the polymerase gene (region children may develop late sequel such as hearing loss or (RT-PCR),B). For genotype using the specificcharacterization, primers Mon sequencing 431-434, thatwas developmental delay. Despite of the high prevalence of carried out using primers targeting a partial region of this infection, there is no epidemiological information the capsid gene. NoV was detected in 36,1% (817/2265) of congenital cytomegalovirus infection in the southern of the samples studied, and linked to 327/741 (44,1%) Bahia. This study aimed to determine the prevalence of the AGE outbreaks. The molecular characterization of congenital CMV infection in the Ilhéus region and to of GI and GII was performed by sequencing of genomic evaluate clinical features of the infection. The study was approved by the Ethics Committee on Human Research viral capsid protein VP1 (regions C and D). Of this total, of the UESC (209/08). It was analyzed 2,100 newborns. amplification110 viruses were of nucleotides characterized by two as regions GII and that two encodes as GI, The congenital CMV infection was determined by being the GII.4 genotype mostly detected, followed by detection of viral DNA by nested PCR in at least two GII.6. In lower number were also characterized GII.2, samples of saliva and / or urine before the third week of GII.3, GII.4, GII.6, GII.12, GII.13, GII.14, GII.15, GII.17, GII.21, and GI.1 GI.3. With the subsequent sequencing newborn, showing an incidence of 1.1%. In relation to life.the symptoms,The CMV congenital 86.34% of infection patients was were confirmed asymptomatic in 23 variants of GII.4 circulating in the state, namely: 2003, at birth and 13.66% had symptoms. One of the children of2004, the P22006a, region, 2006b also locatedand 2010. in VP1, The we great identified diversity five died because the virus infection, a second showed of genotypes found and high prevalence of genotype microcephaly and the third had abnormal hearing. GII.4 and its variants supports the need to maintain a Newborns positive for the virus are been monitoring by molecular and epidemiological surveillance of these a medical group and it will be done laboratory exams viruses in the country, associating the emergence of new until they are three years old, in order to achieve the variants of NoV with global outbreaks. Financial support: CNPq/ FIOCRUZ-IOC benefitsHV248 -of N theorovirus early diagnosis. Associated With Acute HV253 - Genetic Analyses Of Ha From Gastroenteritis In The State Of Rio Grande Pandemic And Post-Pandemic Influenza A Do Sul H1n1pdm09 Viruses Isolated In Rio Grande Do Sul, Brazil

110 Human Virology: HV

Borges, L.G.A., Sant’anna, F.H., Fallavena, P.R.V., Biofísica, UFRJ, IBCCF, Av. Carlos Chagas Filho, 373, CCS, bl Gregianini, T.S., Matias, F., D’Azevedo, P.A., Veiga, A.B.G. G, sl G1050, Ilha do Fundão, RJ, 21941902 1. Universidade Federal de Ciências da Saúde de Porto 2. Inst Nac para Pesquisa Translacional em Saúde e Alegre, UFCSPA, R. Sarmento Leite, 245 / sala 309 - Centro – Ambiente, INCTINPeTAm/CNPq/MCT, Av. Carlos Chagas Porto Alegre-RS – Brazil. CEP 90050 Filho, 373, CCS, Ilha do Fundão, RJ, 21941902 2. Laboratório Central do Rio Grande do Sul, LACEN- 3. Instituto Federal de Educação, Ciência e Tecnologia RS, Av. Ipiranga, 5400, Jardim Botânico. Porto Alegre- RS do RJ, IFRJ, R. Sen. Furtado, 121, Maracanã, Rio de Janeiro - RJ, 20270021 4. Universidade Federal do Rio de Janeiro, Depto Grande do Sul (RS) was the most affected state, with Clínica Médica, UFRJ, Rua Rodolpho Paulo Rocco, 255, Ilha During the influenza 2009 pandemics in Brazil, Rio do Fundão, HUCFF, RJ, 21941913 concerning the molecular evolution of this strain in overBrazil 3,000are scarce. confirmed The shortcoming A(H1N1)pdm09 is even cases. worse Studies in the INTRODUCTION: New compounds are being released for current post-pandemic period, since there is no data hepatitis C treatment targeted to HCV NS3 protease. The available in relation to the evolution of the established actual treatment is pegylated interferon and ribavirin A(H1N1)pdm09 viruses In this study the hemagglutinin (PEG-IFN/RBV) which results in sustained virological response in only 50% of the treated patients. Resistance were analyzed. Sequences were aligned using MUSCLE, mutations to protease inhibitors (PIs) are reported by (HA)embedded segment in MEGA of six 5Influenza software. A(H1N1)pdm09 Amino acid substitutions genomes in vivo and in vitro assays. Therefore it is important were visually inspected using the sequences of archetype to verify the presence of resistance mutations in both strains California/04/2009 and California/07/2009 majority sequences and in quasispecies variants to assess as references. For phylogenetic analyses, the aligned possible emerging resistances. OBJECTIVE: This work aims to detect, in a dynamic approach, quasispecies of software. The phylogenetic trees were reconstructed HCV and PIs resistance mutations from HCV chronically sequencesusing the maximum were first likelihood evaluated method using implemented the FindModel in infected patients treated with PEG-IFN/RBV. MATERIAL the PhyML program (v3.0 aLRT). The HA protein from AND METHODS: 68 patients with chronic hepatitis C, genotype 1, were selected from the Federal University Hospital Clementino Fraga Filho, Rio de Janeiro. Blood 2011The amino isolates acid had substitution 5 modifications HA Q310H, in antigenic implicated sites, samples were collected at different time points (pre- whilewith high that mortality from 2009 rates, isolates was found had in 2 the modifications. RS samples treatment, 48 hours, 7 days, 30 days and 3 months), viral AVS03 and AVS04 (2009). However, the alteration RNA was extracted and RT-nested PCR from partial NS3 D239N/G, that is associated with severe illness, was directed sequenced to identify the majority sequences. associated with changes in antigenic properties, is proteaseFrom those gene in which were done.resistance PCR-amplified mutations productswere detected, were notpresent observed in the in2011 the isolates. isolates. Studies The modification have attempted E391K, to products were sequenced by next generation sequencing in the major viral antigenic determinants HA proteins analysis(NGS) using of the Ion quasispecies Torrent technology. was done. RESULTS: PCR-amplified The correlatewith ill prognosis, the presence pathogenicity of the amino and acidvirulence. modifications Isolates analyses of the majority sequences from three patients presented changes in HA (K2E, Q310H and S220T). At showed the presence of the following resistance present it is evident that the A(H1N1)pdm09 viruses persisted and are constantly evolving. Therefore, patient 2, relapser, V36L and V55A; and patient 3, monitoring the circulating strains is crucial to ensure mutations:sustained virological patient 1, classifiedresponder, as T54S. non-responder, Sequencing T54S; data proper local prevention and control measures against from NGS are being analyzed by bioinformatics tools. these pathogens. Preliminary results of the quasispecies variants showed high diversity among patients, but conserved pattern of HV254 - Emerging Variants Of Hepatitis virus variability in samples of the same patient before C Virus-Ns3 Protease From Chronically and during PEG-IFN/RBV treatment. CONCLUSIONS: Infected Patients By Next Generation Assessment of NS3 protease gene sequences before the Sequencing. PI therapy allow the knowledge of majority and minority Hoffmann, L., Valentin, E.S., Ramos, J.A., Ürményi, T.P., Rondinelli, E., Silva, R. 1. Universidade Federal do Rio de Janeiro, Inst de sequencesINPeTAm/CNPq/MCT, with resistance CAPES, mutations FAPERJ/PPSUS/MS. that can influence in treatment efficacy. Financial support: CNPq, INCT-

111 Human Virology: HV

HV256 - Serological Survey Of Dengue Virus Ganime, A.C., Carvalho-Costa, F.A., Santos, M.S., Costa Infection In Zona Da Mata, Mg Filho, R., Leite, J.P.G., Miagostovich, M.P. Siqueira, T.R., Veiga, R., Sutana, L.B., Oliveira, T.M., Botelho, J., Rosa e Silva, M.L., Kroon, E.G., Drumond, B.P. 1. Instituto Oswaldo Cruz - Fundação Oswaldo Cruz, IOC-FIOCRUZ, Av. Brasil,4365; HPP-B205 Manguinhos, Rio 1. Universidade Federal de Juiz de Fora, UFJF de Janeiro, RJ, Brasil CEP: 21040-360 2. Universidade Federal de Minas Gerais, UFMG 2. Instituto Nacional de Cardiologia, INC 3. Laboratório Lawall - Juiz de Fora, Minas Gerais, 3. Hospital Pró-Cardíaco, HPC Brazil, LAWALL 4. Rede de Pesquisa em Virologia do Interior de Minas The monitoring of environmental microbial contamination in healthcare facilities could be a valuable Gerais, INTRAVIRUS tool to determine pathogens transmission in those Dengue virus (DENV) (Flaviviridae, Flavivirus) is the settings; however it is limited to bacterial indicators. most important arbovirus in the world. Any of the four Viruses are commonly found in those environments DENV types can cause asymptomatic disease, dengue and are rarely used for these procedures. The aim of fever or severe dengue. The four serotypes of DENV this study was to assess distribution and viability of a circulate in Brazil, including Minas Gerais (MG). In 2013, human DNA virus on fomites in an Adult Intensive Care a great epidemic has been taking place in Minas Gerais Unit of a private hospital in Rio de Janeiro, Brazil. Human Adenovirus (HAdV) were investigated in 141 fomites by cases. Juiz de Fora-MG had great epidemics of DENV scraping the surface area and screened by quantitative within last 313,545 years and, suspected until casesmay 2013, and 88,8813,877 confirmedsuspected PCR (qPCR) using TaqMan System. A total of 63 samples (44.7%) were positive and presented viral load ranging case were reported, in Juiz de Fora-MG. The aim of from 2.48 x 101 to 2.1 x 103 genomic copies per milliliter casesthis work and 2,981was toconfirmed study the dengue serological cases andresponse one fatal to DENV and haematological indicators (hematocrit and 38 were selected for virus isolation in A549 and/or platelet count) from patients with clinical suspect of (gc/mL).HEp2c cell Ten lines samples and the detected viability at was cycle demonstrated threshold < Dengue, during the 2013 epidemic in Zona da Mata- MG. Serum samples were collected from 67 symptomatic patients who were attended in a private laboratory. bycharacterized integrated onecell ofculture/nested-PCR them as specie B, serotype in five out 3 (HAdV- them. The samples were examined using the Dengue IgM/IgG Nucleotide3). Results highlightsequencing the confirmed risk of nosocomial all sample transmission as HAdV and Test Bioeasy. A total of 26 patients (38.8%) presented via contaminated fomites and point out the use of HAdV DENV antibodies (4 IgM positive, 9 IgG positive and 13 as a biomarker of environmental contamination. IgM/IgG positive). Results of haematological indicators were obtained from 45 patients. Six patients (2 IgM/ HV260 - Molecular Detection Of Dengue IgG positive, 1 IgM positive, 1 IgG positive and 2 IgM/ Virus In Patients During 2012/2013 Epidemics IgG negative) presented platelet count bellow the In Juiz De Fora, Minas Gerais, Brazil reference values. Eleven patients presented leucopenia Botelho, J., Carvalho, E.D., Oliveira, T.M., Sutana, L.B., (5 IgM positive and 4 IgG positive). One patient 85 years Rezende, I.M., Veiga, R., Fernandes, G.C., Rosa e Silva, old patient had platelet count bellow 100.000 p/mm3 M.L., Kroon, E.G., Drumond, B.P. (42.000 p/mm3) and normal hematocrit. None of the 1. Universidade Federal de Juiz de Fora, UFJF, R José other patients presented raised hematocrit or platelets Lourenço Kelmer, s/n - Campus Universitário Bairro São count below 100.000 p/mm3, what are indicators of Pedro Juiz de Fora severe disease. Our results demonstrate once more the circulation of dengue virus in Juiz de Fora, MG. Previous 2. INTRAVIRUS Rede de Pesquisa em Virologia do studies indicated the circulation of Dengue virus 1 and Interior de Mina, INTRAVIRUS 2 during the last epidemic periods. The serological tests 3. Laboratório Lawall - Juiz de Fora, Minas Gerais, indicate primary and possibly secondary infections in Brazil, Laboratório Lawall the patients. Further tests will be carried on to trace the 4. Centro de Pesquisa da Santa Casa de Misericórdia de dengue serotypes circulating in the city during the 2013 Juiz de, Centro de Pesquisa epidemic. Financial support:FAPEMIG, CNPq, CAPES, 5. Universidade Federal de Minas Gerais, UFMG UFJF, PROPESQ/UFJF. Dengue virus (DENV) (Flavivirus, Flaviviridae) is the HV258 - Human Adenovirus Detection In most important arbovirus worldwide, being transmitted Hospital Fomites by Aedes sp.mosquitoes. DENV exists as four different serotypes: DENV-1 to DENV-4. The epidemiological September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

112 Human Virology: HV scenario in Brazil is characterized by the co-circulation CV-A16 sequences obtained from sporadic cases of of four DENV serotypes and the country has the higher number of DENV in Latin America. Minas Gerais state different Brazilian States between 1998 and 2011. In usually present high numbers of dengue cases and Juiz HFMDaddition, and 12 acute international flaccid paralisys CV-A16 (AFP) sequences occured relatedin four de Fora, located at Zona da Mata Mineira, had great to HFMD cases, obtained from the GenBank database, epidemics of DENV in last years. The aim of this work was were also analyzed. Overall the CV-A16 grouped in to perform a prospective study of DENV in patients with 87% similarity while the level of similarity between clinical suspect of DENV infection. Biological samples the outbreak isolates and the other 5 Brazilian CV-A16 were obtained from patients attended in Santa Casa de strains were about 98%, regardless the main illness Misericórdia (Juiz de Fora-MG). Serum samples were produced. All HFMD associated sequences clustered used for total RNA extraction that was then used for cDNA separated from that isolated in AFP occurrences. CV- synthesis followed by nested-PCR to detect DENV. From A16 isolated from HFMD in other regions clustered 54 serum samples, one was positive for DENV-1, two were independently, indicating that Brazilian strains are positive for DENV-2 and another positive sample is being probably typical from this region and co-circulated with typed. These results are in agreement with previous those from surrounding countries. The results indicate the CV-A16 as the etiological agent responsible for the of DENV-1 and DENV-2 in Juiz de Fora- MG. Although HFMD outbreak occurred in the Amapa State in 2009. findingsDENV-4 hasof our been group presenting that demonstrated a great circulation the circulation in Brazil during the 2013 epidemic it was not detected in Juiz de of HFMD caused by CV-A16 in Brazil. Financial support: Fora, MG, so far. The obtained amplicons are going to be ThisFIOCRUZ, is the CGLAB first descriptionand CNPQ and phylogenetic analysis genotypes circulating in this city and to establish their HV263 - Molecular Epidemiology Of Denv- sequencedphylogenetic to relationship.confirm the results, Financial to determinesupport: FAPEMIG, the viral 2 American/Asian Genotype In São José Do CNPq, CAPES, UFJF, PROPESQ/UFJF. Rio Preto, São Paulo, Brazil Vedovello, D., Colombo, T.E., Biselli, J., Pires, L., Depiere, HV262 - An Outbreak Of Hand-Foot- S., Nogueira, M. And-Mouth Disease In Amapá, Brazil, And Molecular Epidemiology Of 1. Faculdade de Medicina de São José do Rio Preto, Coxsachievirus A16 FAMERP, Av. Brg. Faria Lima, 5416 - 15090-000, SJRP, SP Burlandy, F.M., Campos, R.M., Tavares, F.N., Costa, E.V., 2. Universidade Estadual Paulista Julio de Mesquita Silva, E.E. Filho, UNESP/IBILCE, R. Cristóvão Colombo, 2265, 15054- 000, SJRP, SP 1. Instituto Oswaldo Cruz, IOC, Av. Brasil, 4365, cep 3. Universidade Paulista, Unip - Rio Preto, Av. Pres. 21045-900 – Rio de Janeiro - RJ Juscelino Kubitschek de Oliveira, 15091-450, SJRP, SP 2. Instituto Evandro Chagas, IEC, Seção de Virologia Rodovia BR-316, Km 07, s/nº Levilândia, Ananindeua- PA Dengue virus (DENV) is the most disseminated arbovirus affecting human populations. A third of the global Human Enteroviruses can cause a variety of diseases in human population is at risk of infection with DENV humans. Enterovirus 71 and coxsackievirus A16 (CV- and approximately 50–100 million cases are reported A16) are the main cause of hand-foot-and-mouth disease annually There are four closely related serotypes (HFMD), but the former is the most common etiologic of DENV (DENV1-DENV4) showing potentially co- agent. HFMD is a common childhood illness characterized circulating. There aren’t models that predict an epidemic by fever and vesicular eruptions on hands, feet and in of dengue in endemic regions and the mechanisms by the mouth, that usually affects children under age 10. which dengue virus causes severe illness remain to be This study describes the virological investigation of a elucidated. Two epidemics caused by DENV2 occurred HFMD outbreak occurred in Amapa State, Brazil, during in Brazil (1998 and 2007-2008) and studies reported November and December (2009). Fecal specimens from that the virus circulating in 2007-2008 was genetically distinct from 1998. In this study we characterizated at and HEp2C cells. A total of x (26,3%) specimens were phylogenetic level the DENV-2 strains circulated during 19positive cases forof HFMDvirus isolationwere clarified in RD and cells. inoculated Isolates inwere RD the 2010 to 2013 epidemic in the São José do Rio Preto characterized at the 5’ non-coding region and molecular typed by parcial sequencing of the VP1 gene as CV-A16. To evaluate the genetic relationship and the molecular city.using Confirmation a RT-M-N-PCR of DENV(RT-Multiplex-Nested-PCR) infection in patients SJRPwith epidemiology of CV-A16 in Brazil, samples from Amapa occurredFlavivirus by generic EIA for NS1primers protein based followed on bynon-structural confirmation outbreak were analyzed alongside to 5 other Brazilian protein (NS5): 1036 samples were incoming during September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

113 Human Virology: HV the 2010 to 2013 years: 68 (6,56%) were positives for antiviral effect up to maximum tested concentration. Our DENV-2 (1 in 2010 year, 14 in 2011, 26 in 2012 and 27 results showed B. longifoliaas as an interesting source in 2013). The envelope gene of DENV-2 positive samples of quercetin derivatives with antiviral activity against an was completly sequenced (n= XXX). The Maximun alphavirus replication and that the presence of different likelihood Phylogenetic tree was performed by 1485nt sugars decreased their antiviral activity. Although corresponding to the entire gene. The analysis showed quercetin and derivatives are fairly common in the plant that the São José do Rio Preto strains clustered in the same genotype of the others brazilians strains and belong to the same genotype (American/Asia) and forming a kingdom,licensed antiviral this is the drugs first for report most on mosquito the anti-Alphavirus transmitted activityviruses. Therefore, for these flavonoids.the potential To activity date, thereof quercetin, are no that occurs on other studies with DENV-2 of that same AcOEt and n-BuOH against our alphavirus model is a singleregion. group. these In previousour strains studies was verified show similar that aftergrouping the very important step in the search for new drugs against reintroduction of DENV-2 in Brazil (2007-2008 seasons) these important pathogens. Financial Support: CNPq, no major antigenic changes in this gene has not yet been CAPES, FAPERJ, INBEB observed. Financial support: CNPq - INCT-Dengue and FAPESP HV267 - Use Of Saliva Samples For Hepatitis C Epidemiological Studies In Brazil. HV265 - Molecular Surveillance For Medina, H.C., Miguel, J.C., Da Silva, E.F., Marques, B.L.C., Arthropod-Borne Viruses (Arboviruses) Chagas, R.R., De Paula, V.S., Villela-Nogueira, C.A., Do And Hemorrhagic Fever Viruses In Febrile Ó, K.M.R., Coimbra-Motta, A.R.C., Flores P.P., Melo, Patients From Rio De Janeiro M.M.M., Milagres, F.A.P., Lewis-Ximenez, L.L., Lampe, E., Campos, R., Meneses, M.D.F., Graeber-Gerberding, M., Villar, L.M. De Souza, L.M., Veiga, C.S.B., Fernandes, C.A., De Aguiar, S.F., Schmidt-Chanasit, J., Ferreira, D.F. 1. Viral Hepatitis Laboratory, Oswaldo Cruz Institute, FIOCRUZ, LHV/IOC 1. Universidade Federal do Rio de Janeiro, UFRJ, UFRJ 2. Laboratory of Technological Development of Virology, Av. Carlos Chagas Filho 373 – , CCS, Instituto de Microbiologia LDTV/IOC 2. Laboratório Central de Saúde Pública Noel Nutels, 3. Hepatology Division, Clementino Fraga Filho LACEN, LACEN Rio de Janeiro, RJ University Hospi, HUCFF/UFRJ 3. Bernhard Nocht Institute for Tropical Medicine, BNI, 4. Laboratory of Clinic Immunology, LCI/MS Hamburg, Germany 5. Faculdade de Medicina da Universidade Federal Mayaro virus (MAYV) is an arborivus (Togaviridae Fluminense, UFF family, Alphavirus genus), endemic in South America 6. Federal University of Tocantis, UFT and responsible for sporadic outbreaks of Mayaro 7. Secretaria do Estado de Saúde de Pernambuco, SES/ fever in rural communities of Brazil and Bolivia. PE

3-O-glycosides guayjaverin, quercitrin, and a mixture Large scale epidemiological studies for hepatitis C virus In(2:1) this of isoquercitrin work, the flavonol and hyperin quercetin were isolated along from with the its methanol extract of the leaves of Brazilian shrub Bauhinia blood sampling and expensive sophisticated methods for (HCV)detection infection are less are available difficult in to some conduct parts in of Brazil,the country. since fractions containing them were also investigated for their This study was conducted in order to evaluate anti- longifolia.in vitro antiviral These flavonoids activity against and the MAYV AcOEt replication and n-BuOH in HCV prevalence among individuals from three different Vero cells. Quercetin was the most active among the pure groups: i) individuals from high HCV endemicity (Reference Laboratories for hepatitis diagnosis from Southeast and Northeast regions); ii) individuals from flavonoids,highest activity with amongselectivity all theindex samples (SI) of with94 (IC50=10.3 SI of 623 low HCV endemicity (general population from North, μg/ml).(IC50=5.5) AcOEt and and 208 n-BuOH (IC50=2.8) fractions respectively. demonstrated At 25 µg/the Mid-West and Southeast regions) and iii) individuals mL quercetin, AcOEt and n-BuOH fractions were able presenting some risk behavior (crack users or beauty to inhibit MAYV in a dose-dependent manner by more professionals). Saliva samples were obtained using than 90 %, a strong inhibitory effect on viral replication commercial device (Salivette, Sarstedt) from 825 when compared to ribavirin (SI=8). Furthermore, MAYV individuals between years 2009 to 2012 and distributed as follows: group 1 (n=200), group 2 (n= 305) and group isomeric mixture (isoquercitrin and hyperin) at 100 µg/ 3 (n=320). Anti-HCV was assayed in saliva samples using replication was inhibited about 84% by the flavonoid a commercial assay (Murex, Italy) where sample volume September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV mL. Guayjaverin and quercitrin did not show significant XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

114 Human Virology: HV was increased compared to sera samples (serum sample 29.8 years (SD: 8.5 years). The majority of participants were: male (85%), with less than high school education ROC curve was employed for cut off calculation. Mean (61%) and sharing the paraphernalia of crack inhalation volume=age (± standard 20�l anddeviation) saliva was sample 38 (±16) volume=180�l) years and 52% and (72.2%). The prevalence of anti-HCV was 3.6% (95% CI: were female. Anti-HCV prevalence varies according HCV 1.9-6.5). In the multivariate analysis, injecting drug use endemicity, where 26.5% from high HCV endemicity (OR= 7.2; 95% CI: 1.4-35.8) and age over 40 years (OR= group, 0.6% from low HCV endemicity group and 24.9; 95% CI: 2.6-233.5) were independently associated 1.25% for individuals presenting some risk behavior. with HCV infection. The prevalence of HCV infection in These results show the potential of salivary samples for crack users is higher than general population. These anti-HCV detection among individuals from different results reinforce the importance of Public Health HCV endemicity what can facilitate the achievement programs including health education, health promotion. of epidemiological surveys. Financial Support: CAPES, There is an urgent need for further research and for CNPq, FAPERJ. targeted interventions for crack use in Brazil. Financial support: FAPEG HV271 - Hepatitis C Virus Infection In Crack Users Institutionalized In Central Brazil: HV272 - Profile Of Immunization Of Hepatitis Preliminary Results B Virus In The Male Prisoners Of Caruaru In Del-Rios, N.H., Araújo, L.A., Teles, S.A., Martins, R.M.B., The State Of Pernambuco, Brazil. França, D.D.S., Silva, L.N., Santos, N.C., Pinheiro, R.S., Albuquerque, A.C.C., Nascimento-Júnior, J.A.A., Silva, Louzeiro, L.L., Moreira, E.S., Ramos, J.S., Carneiro, M.A.S. K.R.A., Coêlho, M.R.C.D., Silva, J.L.A., Morais, V.M.S., Cahú, G.G.M. 1. Instituto de Patologia Tropical e Saúde Pública, UFG,Goiânia, IPTSP / UFG, Rua 235 - s/n - Setor 1. Faculdade Associação Caruaruense do Ensino Universitário, Goiânia, Goiás Superior, ASCES, Av. Portugal, n. 584 Bairro Universitário, 2. Faculdade de Enfermagem, UFG, Goiânia, FEN Caruaru-PE. Cep.: 55016-400 / UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário - 2. Laboratório de ImunopatologiaKeizo-Asami (LIKA), Goiânia - Goiás Universidad, LIKA/UFPE, Av. Prof. Moraes Rêgo, S/N Cidade 3. Pontifícia Universidade Católica de Goiás, Goiânia, universitária. Recife-PE PUC - Goiás, Av, Universitária 1.440, Setor Universitário 3. Programa de Pós-graduação em Medicina Tropical, Goiânia-Goiás CCS/UFPE, Pós. Med. Trop./UFPE, Av. Prof. Moraes Rêgo, 4. Hospital Espírita Eurípedes Barsanulfo, Goiânia, S/N Cidade universitária. Recife-PE Casa de Eurípedes, Via Ana Luzia de Jesus - Setor Rio Incarcerated population shows high vulnerability to Formoso, Goiânia, Goiás infectious diseases such as hepatitis B, due to the contact Hepatitis C virus (HCV) infection is a public health with various risk factors, such as sex and drug use. The aim of this study was to determine the prevalence in mortality. Crack use is prevalent among drug users in inmates from the municipality Caruaru, Pernambuco, problemBrazilian cities, associated and associated with significant with severe morbidity drug use, and Brazil that have been infected by Hepatitis B Virus health and social problems. The common use and sharing (HBV) or who was vaccinated. It was conducted a cross- of hazardous makeshift paraphernalia are a key concern, sectional descriptive in the period from May to July 2011, as these risks may be associated with oral injury and which 1042 inmates were evaluated by the search of including possible infectious disease transmission such anti-HBc and anti-HBs. It was found a 32.1% (334/1042) as the HCV. The aim of this study was to estimate the of inmates with some kind of a serological marker for prevalence of anti-HCV in crack users institutionalized HBV. From 1042 inmates, 87 (8.3%) had anti-HBc + anti- in Goiânia-GO city, and to identify risk behaviors to HBs, 206 (19.8%) had only anti-HBs and 41 (4.0%) had this infection in this population. From august 2012 only anti-HBc. Mean age was 28.6 ± 10.1 years, with and january 2013, 307 crack users institutionalized ages between 18 and 94 years. A little less than a half in the referral hospital for the treatment of chemical had between 6 months and 2 years of incarceration time dependency (Hospital Espirita Eurípedes Barsanulfo) and 55.3% were married. Risk factors reported were: in Goiania, Goiás were interviewed about demographic tattoo (63.7%); intranasal cocaine (34.1%), sex with and risk characteristics for HCV infection. Blood Samples another man (5.7%), condom use (60%), STDs (17.2%), were collected from all crack users and were tested by transfusion (5.3%). It was observed that prisioners enzyme-linked immunosorbent assay (ELISA) for the have already been in contact with HBV, but produced presence of HCV antibodies (anti-HCV). The mean age was neutralizing antibody, while others showed only

115 Human Virology: HV antibody vaccination. However, there were prisoners Albuquerque, A.C.C., Melo, M.A., Souza, J.B., Leitão, who could be ill, acute or chronic forms, due only to V.M.G. the presence of anti-HBc. The prison population is a high-risk group for the disease studied and therefore Faculdade Associação Caruaruense do Ensino Superior, screening tests, counseling and immunization programs ASCES, Av. Portugal, n. 584 Bairro Universitário, Caruaru- should be deployed in this environment. PE. Cep.: 55016-400

HV273 - Identification Of Hepatitis B Virus The sex workers are more vulnerable to infectious Genotypes Among Institutionalized diseases due to risk factors such as promiscuity and Patients From Goias State drug use. The aim of this study was to determine the HIV Castro, I.A., Moraes, T.C., Cunha, M.P., Almeida, T.N.V., and HCV seroprevalence in sex workers from Caruaru Souza, M.B.L.D., Fiaccadori, F.S., Cardoso, D.D.P. city in Pernambuco. We conducted a cross-sectional descriptive study, evaluating 66 sex workers, from 11 Instituto de Patologia Tropical e Saúde Pública, IPTSP brothels from the period of November 2012 to March - UFG, Rua 235 - s/n - Setor Universitário - CEP: 74605050 - 2013. A questionnaire was applied to obtain information Goiânia - Goiás related to the occupation and blood was collected in order to detect HIV and HCV antibodies. Ages ranged According to WHO, approximately one third of the world from 18 to 53 years old, with an average of 28.1 years population (two billion people) show serologic evidence old. Infectious diseases seropositivity was observed in of hepatitis B virus (HBV) infection, of these, 240 million 3.0% (2/66) of the population and 1.5% (1/66) for HIV are chronic carriers of the virus. Institutionalized and 1.5% (1/66) to HCV. It was observed that from 66 and mentally handicapped individuals represent a women studied, 21.2% started the profession with less risk group for infection by HBV due to the special than 15 years old, 44.3% had more than four partners behavior presented by them among other features. per night, 71.2% had a tattoo on the body, 25.8% had Therefore, between July-2011 and August-2012 the done transfusion of blood/blood products and 7.6% HBV infection prevalence was evaluated in a population used or injected drugs. The present study showed that of institutionalized patients, with psychiatric and some women were infected with the etiologic agents neurological disorders, in the state of Goias. For this, compromising public health and were not aware of 333 serum samples were screened for the presence of it. This reinforces the need for clinical and laboratory serological markers, and the overall rate of HBV infection monitoring, supporting, prevention and care programs was 12.9%. All the samples that were positive for any of for these women. the markers were submitted to molecular analysis, and HBV-DNA was detected in six out 57 samples (10.5%). HV276 - Performance Of Rapid Hepatitis C Patients with psychiatric and neurological pathologies Virus Antibody Assays Among High And infected by HBV in an institutional environment are Low Risk Populations considered chronic carriers of the virus and may become Scalioni, L.P., Cruz, H.M., De Paula, V.S., Marques, B.L.C., a source of viral spread to HBV-seronegative individuals. Miguel, J.C., Silva, E.F., Oliveira, J.C., Marques, V.A., Portilho, M.M., Vilella-Nogueira, C.A., Motta-Castro, of this virus in order to provide information for the A.R.C., Milagres, F.A.P., Lewis-Ximenez, L.L., Lampe, E., Thus,development it is important of prevention to evaluate and thecontrol genotypic measures profile of Villar, L.M. disease in this population. The six HBV-DNA positive 1. Instituto Oswaldo Cruz, IOC, Av Leopoldo Bulhões, of the HBV genome regions S and preS2. After the quality 1480 - HPP, sala B09 samplesdetermination were subjected by Phred softwareto amplification the sequences and sequencing obtained 2. Universidade Federal de Tocantins, UFT were matched and compared with prototype strains 3. Hospital Universitario Clementino Fraga Filho/UFRJ from the GeneBank and the phylogenetic analysis found Rapid tests for detection of anti-HCV antibodies can high similarity (98-99%) with genotype A. Genotype facilitate the access of diagnosis in limited resource A has been found by many authors in other Brazilian scenarios. The aim of this study is to evaluate the performance of rapid tests for anti-HCV detection in sera Central-West region. populations, reflecting the circulation in the country and HV274 - Hiv And Hcv Seroprevalence In Professional Sex Workers In The City Of (S),behavior whole for blood HCV. (WB) Biological and oral samples fluid were (OF) obtainedsamples from Caruaru-Pe. populations3 groups: (I) with 194 differentindividuals endemicity referred toprofiles Viral Hepatitis and risk Centers at Rio de Janeiro who donate paired samples

116 Human Virology: HV

(S, WB and OF) evaluated by rapid tests WAMA Imuno- rotavirus, astrovirus, adenovirus and calicivirus, which Rápido HCV (WAMA Diagnóstica)(T1) and Bioeasy HCV include the Norovirus (NoV), have been associated Rapid Test (Bioeasy Diagnóstica Ltda)(T2) and, 174 oral with the disease. Because of the rapid transmission, the rapid detection of noroviruses is essential to implement individuals residing in remote areas, where 430 paired measures to reduce the rapid spread of gastroenteritis fluid samples tested in Oraquick HCV (Orasure)(T3); (II) infections caused by this virus. Diagnostic procedures samples by T3; (III) 200 paired samples from crack users for NoV are based on the detection of virus in stool samplesand beauty were professionals tested by tested T1 and at T2 T1 andand T2 459 and oral 43 fluidoral samples by electron microscopy, enzyme immunoassay, immunochromatography kits or reverse transcription sera samples by EIA and those reactive samples were polymerase chain reaction (RT-PCR). Although RT-PCR fluidsubmitted samples to testedPCR. inThe T3. reproducibility, Anti-HCV was evaluatedrepetitivity in is used around the world as a standart tool for routine and cross reactivity for other infections (dengue, HIV, diagnosis of NoV infection, this test is an expensive malaria and syphilis) were also evaluated. Sensitivity and time consuming. Thus, a rapid and sensitive diagnostic test for NoV detection is required. This study I 99.09% and 100% at T2 test using sera or whole andblood; specificity 98.18% ofand rapid 93.75% tests at varied T1 test respectively: for sera; 95.35% group RIDASCREEN® Norovirus 3rd Generation ELISA assay aimedand rapid to evaluate immunochromatographic the sensitivity and specificity RIDA®QUICK of the Norovirus 3rd Generation (R-Biopharm, Germany) and 100% in T3 test for oral fluid; 90.91% and 93.75% kits in comparison with the RT-PCR as the reference atpresented T1 test the for oralbest fluidperformance and 86.36% with andonly 100% 4 anti-HCV at T2 testfalse in negative oral fluid. (FN) At results group comparedII, T3 rapid to testEIA, inhowever oral fluid all of these samples did not have HCV RNA at sera. At group method,pair). One using hundred the specific and primerseighty-one CAL-32 faecal and samples MO3-N III, T2 rapid test in whole blood and sera presented the (firstwere collected pair) and from primers patients JV-12 with and acute ACAL-36 gastroenteritis (second best performance without false positive (FP) or FN. at the Aliança Hospital in Salvador, Bahia, during Reproducibility and repetitivity studies presented 100% May-July 2012. All samples were testes with the two of concordance. At cross reactivity evaluation, 5 FN antigen detection assays as well as with the RT-PCR results were found, being at T1 assay: 1 reactive sample method. Compared with the RT-PCR based reference for dengue and another reactive sample for HIV, and at the overall diagnostic sensitivies of the ELISA and the T2 assay: 1 reactive sample to dengue, 1 reactive for HIV immunochromatographic assay were 63.63% and and 1 reactive for Plasmodium vivax. We also observed 3 FP results at Wama assay among reactive samples for and 96.29% respectively. These results suggest that the P.vivax. In conclusion, rapid tests for anti-HCV detection 34.41%both assays and allow the diagnosticthe rapid and specificities economic screening were 77.77% of a present appropriate sensitivity for detection of active large number of samples and thus are useful diagnostic infection in populations with different HCV endemicity, tools for detection of norovirus infections; however however the performance of those tests varies according due to their sensitivities, RT-PCR is still required for the manufacturer of the assay and the type of biological samples employed. Amparo à Pesquisa do Estado da Bahia – FAPESB confirmed the results. Financial support: Fundação de HV280 - Evaluation Of The Ridascreen HV281 - Asian Genotypes Of Dengue Virus 4 In Enzyme Immunoassays And The Ridaquick Brazil Immunochromatographic Test For The Pinho, A.C.O., Sardi, S.I., Paula, F.L., Peixoto, I.B., Detection Of Norovirus In Faecal Samples Brandão, C.J.F., Bandeira, A., Fernandes, F.M.C., Welby- Paula, F.L., Sardi, S.I., Pinho, A.C.O., Peixoto, I.B., Brandão, Borges, M., Campos, G.S. C.J.F., Bandeira, A., Welby-Borges, M., Campos, G.S. 1. Universidade Federal da Bahia, UFBA, Av. Reitor 1. Universidade Federal da Bahia, UFBA, Av. Reitor Miguel Calmon s/n - Salvador - BA. CEP 40.110-100 Miguel Calmon s/n - Salvador - BA. CEP 40.110-100 2. Universidade Federal do Recôncavo da Bahia, UFRB, 2. Universidade Federal do Recôncavo da Bahia, UFRB, Av.Carlos Amaral, 1015 - Santo Antônio de Jesus - BA. CEP: Av.Carlos Amaral, 1015 - Santo Antônio de Jesus - BA. CEP: 44.570-000 44.570-000 3. Hospital Aliança, HA, Av Juracy Magalhães Jr, 2096 3. Hospital Aliança, HA, Av Juracy Magalhães Jr, 2096 - Salvador - BA. CEP 41920-900 - Salvador - BA. CEP 41920-900 Dengue, an important viral disease transmitted to Viral gastroenteritis is one of the most common illnesses humans by mosquitoes of the Aedes genus, represents in humans worldwide, and different agents such as a serious public health problem in Brazil and other September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

117 Human Virology: HV tropical countries. Infection with dengue virus (DENV) other studies have shown that the substitution W501R causes a disease whose spectrum ranges from clinically in a genotype 1a led to a normal ATPase, poor nucleic asymptomatic to severe clinical forms (hemorrhagic acid binding and poor duplex unwinding, we analyzed dengue). DENV, member of the family Flaviviridae, the impact of the W501R substitution in a genotype 3a genus Flavivirus, is a positive single-stranded RNA, an on helicase function in vitro. The helicase NS3 variant enveloped virus with four antigenic serotypes: DENV 1, DENV 2, DENV 3 and DENV 4. The objective of this study from soluble fraction. The methodologies of MBHA, FP- was to report DENV-4 genotype I isolates, which were sequenceSSB-DNA bindingwas cloned, and expressedATP assay inwere E. coli,used and to evaluatepurified detected in Brazil in hospitalized patients. The patients, the helicase activity in RNA and DNA unwinding, DNA- who received care at a hospital in the city of Salvador helicase binding and ATPase, respectively. To evaluate (Bahia, Brazil) in 2011, were positive for IgM/IgG anti- the replication of mutated variant in hepatoma cell line DENV or the NS1 antigen. The viral RNA was extracted Huh-7.5, the mutation W501R was inserted into the from serum samples with QIAamp Viral RNA Mini kits subgenomic replicon pSGR-Luc-JFH1 and the luciferase (QIAGEN, USA) for detection and serotyping of DENV level was measured. The MBHA procedure showed that by RT-PCR (Reverse Transcriptase - Polymerase Chain the activity of DNA and RNA unwinding was faster in Reaction) and nested-PCR, respectively. The E gene from NS3 helicase wild type than in the NS3 helicase mutant protein. By the FP-DNA binding analysis was observed a weaker DNA–NS3 helicase mutant binding than the theThe three molecular DENV-4 and samples phylogenetic was amplified analysis using of the 2 DENV-4pairs of DNA – NS3 helicase wild type binding. The evaluation serotype-specificisolates demonstrated primers that used the virusin the is RT-PCR genotype reaction. I and of ATP hydrolysis activity revealed a decrease in the is derived from Asian lines. The results of this work velocity of NS3 helicase W501R mutant ATPase activity reinforce the need of epidemiological molecular studies when compared to the NS3 helicase wild. The replicon to surveillance DENV infections in endemic countries, cells analysis showed a total loss of replication ability such as Brazil. The introduction of DENV-4 in Salvador of the replicon carrying the mutation W501R when is a cause for concern because epidemics of serotypes compared to wild type replicon. These results suggest 1, 2 and 3 have occurred in Bahia in the past and the that the patient has the HCV wild type sequences that introduction of a new serotype in a city with a population are maintaining the virus replication. Financial support: that has been exposed to the other 3 DENV serotypes FAPESP, CAPES, CNPq, NIH grant RO1 AI088001 and the may increase the incidence of clinically severe DHF with UWM Research Foundation. grave or fatal prognoses. Financial support: PRONEX- DENGUE CNPq and Fundação de Amparo à Pesquisa do HV287 - Impact Of The Emergence And Re- Estado da Bahia (FAPESB) Emergence Of Different Dengue Virus Serotypes In The State Of Rio De Janeiro HV285 - Impact Of The W501r Substitution In Heringer, M., Nogueira, R.M.N., De Filippis, A.M.B., A Hcv Genotype 3a On Ns3 Helicase Function Lima, M.R.Q., Simões, J.B., Nunes, P.C.G., De Santis, B.G., Provazzi, P.J.S., Mukherjee, S., Hanson, A.M., Carneiro, Sampaio, S.A., Dos Santos, F.B. B.M., Calmon, M.F., Frick, D.N, Rahal, P. Instituto Oswaldo Cruz/FIOCRUZ, IOC/FIOCRUZ, 1. Instituto de Biociências, Letras e Ciências Exatas, Av. Brasil, 4365, Manguinhos, Rio de Janeiro - RJ. CEP 21040- UNESP-IBILCE, Rua Cristóvão Colombo, 2265. São José do 360 Rio Preto/SP. Brasil The state of Rio de Janeiro has been of great 2. University of Wisconsin- Milwaukee, UWM, 3210 N. epidemiological importance for introduction and spread Cramer Street. Milwaukee, WI 53211. USA of dengue viruses (DENV) and over the last 27 years The hepatitis C virus (HCV) chronically infects 170 was marked by extensive epidemics. The existence of a million people worldwide. The recent approval of the continuous program of virological surveillance aims to detect and monitor the circulation of DENV serotypes in a triple combination with PegIFN/RBV has increased the state, where DENV-1, DENV-2, DENV-3 and DENV-4 HCVcure specificrates in directly genotype acting 1 anti-viralspatients tothat around are given 75%. in co-circulate. Given the limited options for prevention and However, the genotype 3 presents resistant mutation to control, it has been shown that laboratory diagnosis plays protease inhibitors approved evidencing the need for an important role in the Epidemiological Surveillance better understanding of the genotype 3. The amino acid System, by continuous monitoring infections and substitution W501R in the NS3 Helicase was reported in a patient infected with HCV genotype 3a who did to describe the epidemiological, laboratory and clinical not respond to interferon/ribavirin therapy. Since confirmingdengue cases new occurred cases. The in main the objectiveState of Rioof this de study in the is September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

118 Human Virology: HV period January 2010 to December 2012. A total of 2,833 were previously tested by real-time PCR for a panel of dengue suspected cases were analyzed, and 1,323 cases common respiratory viruses. A total of 707 samples from 194 individuals were tested, of which 655 (151 NS, 135 NW, 159 PT and 147 AD) were from 180 patients (47.5%) were confirmed. The MAC-ELISA confirmed with CAH, and 52 samples (14 NS and NW; 12 PT and 32.6% of the cases, the RT-PCR confirmed 56.3%, the AD) were from a control group of 14 individuals without inoculatedtested. DENV-2 into C6/36 was thecells prevalent confirmed serotype 33.1% of thein 2010,cases CAH. HPeV was detected in 12 of 180 (6.66%) CAH andwhile NS1 during antigen 2011 capture the prevalent confirmed serotype 27.5% ofwas the DENV- cases patients (1 NS, 2 NW, 4 PT and 8 AD) and 1 of 14 control 1. In 2011 the introduction of DENV-4 was detected, an patients (a 2 year old female positive in both PT and outbreak caused by this serotype was reported in 2012. AD). HPeV was detected predominantly in tissues (80%) Our analysis has shown that patients with secondary when compared with respiratory secretions (20%), infection have a higher risk of presenting severe suggesting that lymphoid tissues could be possible sites forms of the disease (OR = 7,87 / 95%IC = 2,15-30,56 of replication. To the best of our knowledge this is the severe forms were more frequent on children 15 years studies based on sequencing and phylogenetic analysis /old p and<0,001). under, Moreover, among infected paired with analyzes, DENV-2 has 2 (ORshown = 1,8 the / firstshall reportbe done of to HPeV determine infection genotypes in tonsils, of andthese further HPeV strains. Financial support: FAPESP, CNPq.

95%CIinfections. = 0,10-1,22 Fatal cases / p <0,05).were more From frequent the total inof childrenthe fatal HV289 - Male Anogenital Hpv: Leaving The cases15 years confirmed old and (nunder = 67), in 201160% werein comparison due to secondary to other Role Of A Simple Vector? years. The DENV-2 serotype was responsible for 42.8% Dobao, E., Afonso, L., Menezes, W., Nicol, A., Nery, J., Cavalcanti, S. deaths in 2011 and in 2012, DENV-4 was responsible for 1. Universidade Fed Fluminense, UFF, Rua Ernani 25% of deaths. Financial support: FAPERJ, CNPq, CAPES of deaths in 2010, DENV-1 was identified in 71.47% of Melo 101 Centro Niteroi and FIOCRUZ 2. Santa Casa de misericordia do RJ, SCMRJ, Santa HV288 - Detection Of Human Parechovirus Luzia 36 centro RJ In Tonsils From Patients With Chronic 3. Instituto Oswaldo Cruz, IOC, Av Brasil, Manguinhos Adenotonsillar Hypertrophy Rio de Janeiro RJ De Souza Luna, L.K., Doltrário, A.B., Proença-Modena, J.L., Valera, F.C.P., Tamashiro, E., Anselmo-Lima, W.T., HPV infection and associated diseases in the male Arruda, E. population has assumed increasing importance, especially because of the upward trends of anal carcinoma 1. Centro de Pesquisa em Virologia - FMRP - USP, CPV - FMRP - USP, Av. Bandeirantes, 3900 - Vila Monte Alegre. (MSM), HIV seropositive and immunocompromised. 14049-900, Ribeirão Preto - SP inHowever, specific the groups, recognition such as that men man who is have no longer sex with a mere men 2. Oftalmologia, Otorrinolaringologia, Cir. da Cabeça e infection vector for this disease and has assumed a main Pescoç, HCFMRP - USP, Av. Bandeirantes, 3900 - Vila Monte role is still poorly discussed. We believe that, as there is Alegre. 14049- 900, Ribeirão Preto - SP no single medical specialty to treat HPV infection in men, such as gynecology for women, there is a fragmentation of Respiratory viruses are frequently detected in knowledge and experience that needs to be widespread. palatine tonsils and adenoids of patients with Chronic It is important a rising release of this condition among Adenotonsillar Hypertrophy (CAH), a persistent physicians and patients, to bring out at the baseline this hypertrophy of tonsils and adenoids of unknown diagnostic hypothesis, even when the clinical lesion is etiology. In this study, human parechovirus (HPeV), an not a typical anogenital wart, avoiding diagnostic losses emerging picornavirus related with a broad spectrum and further decrease of morbidity. In this study, we aimed of diseases similar to those caused by enteroviruses, to present atypical lesions of anogenital HPV infection was detected by real-time RT-PCR targeted to the in male patients to bring out this hypothesis in the conserved 5’UTR in nasal swabs (NS), nasopharyngeal differential diagnosis of anogenital lesions. To achieve washes (NW) and tissue fragments of palatine tonsils results, we report 4 cases of atypical lesions in patients (PT) and adenoids (AD) obtained from patients (ages: infected with anogenital HPV, providing histopathology 1-25 years; mean±SD: 6.24±3.26; median: 5.05) with CAH who underwent tonsillectomy at the University of that patients have been misdiagnosed and mistreated Sao Paulo Hospital in Ribeirao Preto, Brazil. Samples andfor herpesspecific and viral candidiasis typing by PCR. and Itto is of important them died. to noticeAll of were collected from November 2011 to July 2012 and them progressed to squamous cell carcinoma during September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

119 Human Virology: HV these treatments. The knowledge about the behavior of anogenital HPV infection in men has been full of was detected in all months of the study. Great genomic gaps, even among doctors and high-risk groups such as asymptomaticdiversity of CV was children observed. (P<0.05), The GII.6 and NoV virus and circulation the GII.4 MSM and HIV seropositive. Therefore, several patients NoV were the most and the least prevalent viral strains, have been maintained without diagnosis, as sources respectively. The SaV genotypes GI.1 and GI.3 were also of infection or even suffering from high-grade lesions with clinical unsatisfactory outcomes. Our goal with viral strains were documented. The results from this these case reports is to contribute to the dissemination detected.study contribute Moreover, to fivethe CVknowledge outbreaks about caused NoV by and distinct SaV of an emerging problem, stimulating discussion and its recognition as a differential diagnosis in anogenital these viruses in indoor outbreaks. Financial support: lesions. Financial Support: PROAP/UFF, Capes molecular epidemiology, and also confirm the role of

HV291 - CALICIVIRUS IN DAY CARE CHILDREN CNPqHV292 & -PRPPG/UFG Comparison Of The Performance Of IN THE CENTRAL WEST REGION OF BRAZIL: Hbsag Detection Among Dried Blood Spot ASYMPTOMATIC VIRAL EXCRETION AND Samples (Dbs) From Hepatitis B Virus (Hbv) SIGNIFICANT NOROVIRUS GENOMIC DIVERSITY Monoinfected And Coinfected With Hiv Santos, H.C.P., Mendanha, D.M., Fiaccadori, F.S., Lemes, Patients. L.G.N., Turones, L.C., Cardoso, D.D.P., Souza, M. Flores, G.L., Miguel, J.C., Da Silva, E.F., De Oliveira, J.C., Potsch, D.F.V., Lewis-Ximenez, L.L., Lampe, E., Villar, IPTSP, Universidade Federal de Goiás, IPTSP/UFG, L.M. Rua 235 s/n, Setor Universitário, 74605-050, Goiânia, Goiás, Brasil Fundação Oswaldo Cruz, Fiocruz the Caliciviridae family. These agents are transmitted by B virus (HBV) share the same routes of transmission Calicivirusesthe fecal-oral (norovirus route, through and sapovirus)contaminated are classifiedfood, water in The(parenteral human immunodeficiencyand sexual route). Worldwide,virus (HIV) andchronic hepatitis HBV or fomites, by vomit aerosols and also through person- infection affects about 10% of HIV-infected patients. The to-person contact. The caliciviruses (CV) are a common use of alternative biological samples, such as dried blood cause of acute gastroenteritis, and the noroviruses spot (DBS) samples, may provide the access for the (NoV) are considered the leading cause of epidemic diagnosis of HBV infection, especially in high risk groups, acute viral gastroenteritis worldwide. Outbreaks which may be co-infected with HIV. This study aims to commonly take place in semi-close settings such as investigate the performance of an enzyme immunoassay long-term care facilities, schools, hospitals, nursing (EIA) adapted for the detection of HBsAg marker in DBS homes, and cruise ships. Molecular and epidemiological samples from patients with HBV mono-infection and co- data of the circulating CV strains among day care infection with HIV. A total of 89 subjects were recruited children are still considered scarce, and the role of from Viral Hepatitis Ambulatory (IOC/FIOCRUZ) and asymptomatic CV excretion on viral transmission is still Clementino Fraga Filho Hospital (UFRJ), both located in Rio de Janeiro. DBS and serum samples were obtained various populations in the world, and also the limited from each individual and submitted to commercial undefined.number of Consideringstudies involving the high children prevalence that attend of CVs day in EIA (ETIMAK-4, Diasorin) for HBsAg detection. The care centers, the main objective of this study was to manufacturer’s protocol was followed for serum samples, monitor the occurrence of NoV and sapovirus (SaV) in however the sample volume has been increased for a day care center in Central West Brazil, and to describe the molecular epidemiology of the circulating strains. by ROC curve was employed where reactive samples For this, fecal samples obtained from children in a DBSpresented (150 �L)optical and density cut off (OD)value value previously higher determinedthan 0.115. day care center, from October 2009 to October 2011, As results, HBsAg was detected in 89 serum samples were submitted to RNA extraction, followed by reverse where 81 were mono-infected and 8 were co-infected transcription, using a random primer. The samples with HIV. The overall concordance of HBsAg detection among sera and DBS samples was 87%. In the group by monoplexPCR, for NoV and SaV detection. Genomic of mono-infected HBV individuals, the concordance for weresequencing tested byand multiplexPCR, phylogenetic and analysis the results of confirmeda partial HBsAg detection among sera and DBS was 88%, on the segment of the capsid region (region C) were carried other hand, among HBV/HIV co-infected individuals, the out on calicivirus positive samples. From the total 539 concordance between tests was 75%. HBsAg detection fecal samples 43 (8%) were positive for NoV and 25 among DBS samples presented high concordance to sera results among mono-infected and co-infected HIV/HBV

(4.6%)September for 2013 SaV. Volume Positivity 18 – Supplement rates for CV 1 - Abstracts/Posterswere significant - Humanin Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

120 Human Virology: HV patients, but this agreement was low among co-infected HV298 - The Role Of Human Parvovirus HBV/HIV individuals. Nevertheless, a larger number B19 Co-Infection With Hepatitis A of HBV/HIV co-infected individuals and the analysis of Virus In Cynomolgus Monkeys (Macaca some clinical factors (HIV viral load and CD4 cell count) Fascicularis) Experimentally Infected should be include in this study in order to evaluate this Pinto, M.A., Amado, L.A.L., Marchevsky, R.S., Garcia, interference. R.C.N.C., Almeida, A.J., Pelajo-Machado, M., Azevedo, M.L.B., De Castro, T.X., Ramos, S., Hooper, K., Brown, K. HV296 - Development And Evaluation Of Molecular Tests For Hbv Dna Detection 1. Universidade Estadual da Zona Oeste, UEZO, And Quantification Among Sera Samples. Avenida Manuel Caldeira de Alvarenga Portilho, M.M., Espírito-Santo, M.P., Marques, V.A., 2. Instituto Oswaldo Cruz, Fiocruz, Avenida Brasil Miguel, J.C., Lewis-Ximenez, L.L., Lampe, E., Villar, L.M. 4365 Fundação Oswaldo Cruz, Fiocruz 3. Biomanguinhos, Biomanguinhos, Avenida Brasil 4365 The molecular diagnosis of Hepatitis B virus (HBV) DNA 4. Universidade Federal Fluminense, UFF is important to determine and monitor the antiviral 5. Hospital Universitario Gaffree e Guinle, HUGG treatment. However, commercial methods are expensive 6. Health Protection Agency to be implemented in areas with low resources. The aim of this study was to develop a method for HBV DNA It has been suggested that B19V infection in association with hepatitis A virus may contribute to fulminant method for HBV DNA detection among sera samples. hepatic failure. However, there is no experimental study quantificationSerum samples and were to obtainedevaluate froman “in 116 house” individuals qualitative (66 HBsAg reactive and 50 without HBV serological markers) with hepatitis A virus (HAV). Therefore, in order to referred to Viral Hepatitis Reference Laboratory in Rio availableevaluate ifon the the acute laboratory liver failure finds withcould B19 be co-infectioninduced by de Janeiro. HBsAg reactive samples were submitted to synergistic interaction between hepatitis A virus and commercial real time PCR (COBAS® TaqMan HBV Test, human parvovirus B19, nine cynomolgus monkeys Roche Diagnostics). For HBV qualitative and quantitative were inoculated with serum obtained from a fatal case detection, DNA was extracted using “High Pure Viral of fulminant B19 infection and fecal suspension of Nucleic Acid Kit” (Roche Diagnostics) and submitted acute case of hepatitis A. Six animals were followed by to one round PCR for core gene of HBV and a real time hematological, biochemical and virological parameters PCR with TaqMan® probes for surface gene of HBV. A recombinant plasmid was constructed using the for monitoring acute hepatitis A in cynomolgus included, fortiters fifty of ninetotal days.antibodies The principal and IgM diagnosticto HAV, liver parameters enzymes Life Technologis) for standard curve. The analytical (ALT and AST) elevation, viremia, HAV RNA shedding quantificationsensitivity of in panel house of real-time HBV (Optiquant PCR was HBV, estimated Acrometrix, at 10 HBV DNA copies/mL, ranging from 10 to 1x108 HBV DNA B19 infection, a reduced numbers of reticulocytes, copies/mL. Among HBsAg reactive samples, 64 were anderythrocytes, necroinflammatory lymphocytes, liverplatelets, lesions. drop Concerninghematocrit and hemoglobin levels were associated with high 1.922 log copies of HBV DNA/mL) and 28 were obtained detectable viral load of human parvovirus B19 replication quantifiedby quantitative by commercial PCR (mean PCR viral (mean load=3.761 viral load=3.993 ± 1.829 log ± copies of HBV DNA/mL). Among individuals without that period the viral load and anti-HAV IgM titers became HBV markers, 2 samples were detected by in house real inundetectable. the inoculated The groups absence during of megakaryocytes the first 20-40 and dpi. lower After time PCR (mean viral load=15.390 ± 2190 copies HBV bone marrow cellularity were associated with high viral DNA/mL) and none of them was detected by in house load of B19V. IgG antibodies to human parvovirus B19 qualitative PCR. Qualitative “in house” PCR detected HBV were detectable throughout the investigated period. DNA in 50 HBsAg reactive serum samples, showing 75% Signs of self cure of parvovirus B19 occurred in 2 of single of agreement with commercial kit (p=1.000). In house inoculated B19 and 1 of co-inoculated group during the qualitative PCR for HBV DNA detection presented good injury induced by HAV in monkeys was not associated followwith a up.worsening The results in the showed animals that infected inflammatory with B19V. liver It efficiency,can be useful while for quantitative molecular PCRdetection must beof optimizedHBV in areas for HBVwith limited DNA quantification resources. Financial in sera. support: These methodologiesCNPQ, FAPERJ, FIOCRUZ. isthis the animal first reportas an usefulthat demonstrated model to a vaccinethe susceptibility challenge, of cynomolgus monkey to human B19V, which qualifies

121 Human Virology: HV new antiviral trials, and pathogenesis studies, in order HV304 - Emerging Viruses In Recreational to better understand the effects of B19V infection. Waters, Rio De Janeiro, Brazil Vieira, C.B., Ferreira, M.S.R., Fioretti, J.M., Miagostovich, HV303 - Molecular Detection Of Adenovirus M.P. In Stool From A Semi-Isolated African- Descendant Community In Ananindeua Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil 4365 City, Pará State, Brazil Viruses excreted in feces of infected people are important Spada, P.K.P., Aragão, G.C., Teixeira, D.M., Kaiano, J.H.L., contaminants of surface water due to the continuous Lima, I.C.G., Oliveira, D.S. , Siqueira, J.A.M., Mascarenhas, discharge of domestic sewage. Although many infectious J.D.P., Gabbay, Y.B. causes of diarrhea have been established, approximately Instituto Evandro Chagas, IEC, Br 316, Km 7, S/N, 40% of all diarrhea cases are of unknown etiology. Bairro Levilândia. Ananindeua-Pará Recent studies have described a new and emergent virus associated with diarrhea in water contaminated with Human adenoviruses (HAdV) belong to the family sewage as klassevirus (KV), aichivirus (AiV) members Adenoviridae, genera Mastadenovirus which are of a Picornaviridae family and human bocavirus (HBoV) constituted by over 90 serotypes. Of these, 52 showed belonging to Parvoviridae family. The aim of this study was to demonstrate the circulation of these viruses in the species A-G. Serotypes 40 and 41 (HAdV-F) and 52 city of Rio de Janeiro using an environmental approach. the(HAdV-G) ability wereto infect related humans with and gastroenteritis are classified cases.into seven The For this retrospective study, 24 surface water concentrate poor sanitary conditions and health status of the majority samples obtained from an urban lagoon and concentrated of the population are factors that increase its spread. The using an adsorption-elution method with a negatively African-descendant communities named Quilombola are charged membrane were analyzed. All samples were included in this group, which are characterized by living previously positive for human adenovirus. Nucleic acid partially isolated from the rest of society. The aim of was extracted by QIAamp viral RNA mini kit® (Qiagen) this study was the detection of HAdV in stool specimens collected in the Abacatal Quilombola Community, located to virus detection. One step reverse transcription-nested in the frontier of Ananindeua and Marituba cities, in the andpolymerase qualitative chain tests reaction of genomic (RT-nPCR), amplification using were primers used metropolitan region of Belém, Pará, Northern Brazil. From April 2008 to July 2010, weekly visits were made of KV genome was performed. The AiV were detected by in this community to detect diarrheic episodes. The fecal thatRT-PCR amplifies using aprimers region localizedP3 to the at junction RNA polymerase region of gene the samples were submitted to DNA extraction by silica genome 3C/3D. PCR for HBoV detection was carried out method. The nested polymerase chain reaction (Nested- VP1/VP2. KV was detected in eight samples (33.3%) usingand the specific nucleotide primers sequence for the analysis coding ofregion the PCR of the product gene PCR)reaction was and employed an internal with fragmentprimers that of 171 amplify bp (Hex3deg/ a specific characterized all of them as human KV 1. AiV were hexonHex4deg) gene in of 301the bpsecond (Hex1deg/Hex2deg) reaction. Samples in the were first detected in three (12.5%) and HBoV in just one sample sequenced, analyzed and compared to other obtained (4.1%). These results demonstrate the circulation of from GenBank. The HAdV were detected in 61.5% these viruses in the environmental water surfaces and (48/78) of the diarrheic cases. Genomic sequencing pointed out the importance of conducting further studies was realized in 18 (37.5%) positive samples, being 9 including clinical samples in order to elucidate the role (50%) characterized as type F (serotype 41), 4 (22.2%) of this virus in cases of acute gastroenteritis in the city as HAdV-C, 3 (16.6%) as HAdV-D, 1 (5.5 %) as HAdV-A and its impact in public health. and 1 (5.5%) as HAdV-B. The prevalence observed in this study (61.5%) was higher than one (2.6%- 10/380) HV311 - Polymorphism Of Rotavirus obtained among diarrheic children attended in hospitals Genotype P[8] In Brazil: In Silico Analysis or health units from Belém. Species directly associated Of Variant Strains Circulating In Rio De with gastroenteritis cases (A and F) were dominant in Janeiro From 1996 To 2004 these samples (55.5%). Complementary studies will Maranhão, A.G., Silva, R.C., Norma Santos, N. be conducted in order to demonstrate co-infection with other enteric viruses. These data are relevant, Universidade Federal do Rio de Janeiro, UFRJ, Av. considering the lack of epidemiological information Carlos Chagas Filho - 373, I Fundão, R Janeiro - RJ, 21.941- concerning the presence of these agents in Quilombola 902 communities either in the Northern Region as in other Rotaviruses (RVs) are members of the Reoviridae regions of Brazil.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV family, and classified into eight species (A-H). RV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

122 Human Virology: HV species A (RVA) are the main etiologic agents of acute Hepatitis E (HEV) virus epidemiology in Latin America gastroenteritis and responsible for nearly 400,000 is complex. Although serological studies performed deaths worldwide. The viral genome is enclosed within between 1997 and 2006 in Brazil show HEV prevalence a three-layered particle and consists of 11 segments ranging from 0–8% in the general population and 0–18% dsRNA. The outer capsid proteins VP7 and VP4 carry among at-risk groups, variations in the methodology and independent neutralization and protective antigens. A binary system is used to classify RVA into P and G real seroprevalence of HEV infection. This study aimed assaysto establish performance the frequency makes itof difficult HEV detection to estimate among the encoding genes, respectively. Thus far, 37 P genotypes samples referred to a clinical laboratory with suspected genotypes based on the specificity of the VP4 and VP7- hepatitis E. A retrospective study was performed on genotypes, P[8] accounts for 73.8% of global prevalence laboratory records regarding HEV between 1997 and and,of human 27 G genotypes RVA infections have been and identified.hence its Amongimportance the VP4 as 2012. Data collected comprised ELISA test for anti- an effective vaccine candidate. VP4 is a trimeric protein HEV IgG and IgM antibodies results, age, sex, year, and involved in cell attachment and membrane penetration. hepatic enzymes levels: alanine aminotransferase High-level infectivity requires that VP4 be cleaved by (ALT), aspartate aminotransferase (AST), total bilirubin, trypsin into two fragments, designated VP8* and VP5*. gamma-glutamyl transferase and alkaline phospatase. Five important epitopes have been mapped on the VP8* Between 1997 and 2012, 2,573 anti-HEV IgG and 404 peptide: M1L10 (aa 1-10), I35R44 (aa 35-44), I55D66 anti-HEV IgM tests were performed. Individuals ranged (aa 55-66), V115G123 (aa 115-123) and L223P234 (aa between 0–91 years and 52% were females. Overall 223-234). A major challenge in immunization is the anti-HEV IgG positivity was 1.6% and anti-HEV IgM was vast inter- and intragenotypic diversity accomplished 4.0%. Detection frequencies varied with year, ranging by RVA. Two currently available RVA vaccines includes from 0–8.6% for IgG and 0–8.8% for IgM. Interestingly, P[8] as an antigenic component. Therefore, it is possible the years of 2011 and 2012 displayed the highest IgG that genetic mutations and antigenic variations on the frequencies, 5.9% (2/34) and 8.6% (12/139); IgM frequencies for these years were 8.8% (3/34) and RVA vaccines. The polymorphism of RVA-P[8] strains 5.8% (8/139), respectively. As expected, among the 40 VP4circulating gene of in P[8] Rio strains de Janeiro will influence between the 1996 efficacy and of2004 the samples in which anti-HEV IgG was detected, only 2 was evaluated. The partial VP4 encoding gene of 20 came from persons under 20 years of age. Conversely, P[8] strains was sequenced and compared to reference 11 of the 15 anti-HEV IgM positive samples belonged strains. The deduced amino acid sequences were used as to this age group. Regarding hepatic enzymes, anti-HEV basis for in silico analysis of the VP4 protein. We observed the circulation of three major P[8] lineages during the persons presenting elevated ALT (p=0.039), whereas the studied period. Comparison between the VP8* trimeric IgGlow overall detection anti-HEV was significantly positivity and more percentage frequent of among cases structures of a RVA reference strain (Wa) and Brazilian with hepatic enzymes tests requests preclude further P[8] strains showed mutations at amino acid residues associations. In conclusion, this study demonstrates a located at the epitopes I55D66 (aa 64) and V115G123 low overall detection rate of anti-HEV, although year-to- (aa 120-121). Although the RVA vaccine program has clearly been successful in Brazil, these results suggest detection of anti-HEV antibodies should be included the possibility of the emergence of P[8] strains that could yearmore rates widely show in significant the differential percentages, diagnosis indicating of acute that evade the immune response elicited by a RVA vaccine and hepatitis in this setting. cause a vaccine breakthrough. Consequently, continuous monitoring of RVA intragenotypes diversity is critical HV315 - Detection Of Mutations In The S to understand how it could affect vaccine effectiveness. Region Of Hepatitis B Virus (Hbv) In Hiv Financial support: CAPES, CNPq, FAPERJ Infected Treatment-Naive Patients In Central Brazil HV314 - Hepatitis E In São Paulo, Brazil: Oliveira, M.P., Matos, M.A.D., Carneiro, M.A.S., Teles, Results From A Clinical Laboratory S.A., Pimentel, K.N., Del-Rios, N.H.A., Silva, A.M.C., Database 1997-2012 Kozlowski, A.G., Reis, N.R.S., Martins, R.M.B. Passos, A.M., Pelegrini, A., De Sá, J., Granato, C.F.H. 1. Instituto de Patologia Tropical e Saúde Pública, UFG, 1. Disciplina de Infectologia, Escola Paulista de IPTSP-UFG, Rua 235 - s/n - Setor Universitário - Goiânia- Medicina, EPM-UNIFESP, São Paulo, SP, Brazil GO-Brasil 2. Grupo Fleury SA, , São Paulo, SP, Brazil 2. Faculdade de Enfermagem, UFG, FEN-UFG, Rua

123 Human Virology: HV

227 Qd 68, S/N - Setor Leste Universitário - Goiânia-GO- do HPV, INCT-HPV, Rua Dr. Cesário Mota Júnior, 61 - São Brasil Paulo - SP 4. Secretaria de Saúde de Botucatu, Secretaria de individuals infected with HIV. Also, many of HBV-HIV co- Saúde, Rua Major Matheus, 7 - Botucatu -SP Theinfected HBV patients infection have occurs mutations in a in significant the HBV genome number that of Introduction: Cervical cancer is the second leading may have implications for the prognosis, diagnosis and cause of women death worldwide and high-risk Human therapeutics of hepatitis B. Although sY100C substitution Papillomavirus (HPV) is the causative agent of this in the S region of the viral genome has been related to a disease. Epidemiological data on the prevalence of HPV low expression of the HBsAg, one in vitro study has shown in a given population is essential for the establishment of that this substitution did not affect the detection and/ effective preventative strategies. Objective: The objective or secretion of HBsAg. sT131N replacement has been of this study was to determine HPV prevalence in women suggested as a natural polymorphism of genotypes A and seen at the Primary Health Care Units in Botucatu, São G, and it is associated with persistence of HBV even after Paulo State, Brazil. Patients and Methods: A total of 515 the anti-HBs seroconversion, as well as vaccine escape. women in reproductive age were included in this study. sD144A substitution is also associated to vaccine escape, At the moment of specular exam, cervical samples were as well as immunoprophylaxis failure using HBIG, and it collected to HPV status evaluation and with Pap smear is often found in patients with genotype A. This study screening tests. HPV genotyping was performed using aimed to investigate the presence of mutations in the Linear Array HPV Genotyping Test (Roche Molecular S region of the HBV genome in HIV infected treatment- Systems Inc.) and all smears were evaluated at the naive patients in Central Brazil. This is a cross-sectional Cytology Unit of the Department of Pathology according study conducted in HIV infected treatment-naive to the Bethesda system criteria. This study protocol was individuals attended at a reference hospital for infectious approved by the local Ethics Committee. Results: The diseases in Goiania city. After serological screening of median age of the studied population was 32.9 years, the population (n=505), 29 HBsAg-positive subjects and the majority of HPV-infected women are less than were selected for this study. HBV DNA was detected by 30 years-old (107, 61.8%). HPV DNA was detected in a semi-nested PCR followed by nucleotide sequencing of 173 (33.6%) women and the analysis revealed that 96 (55.5%) of those represented infections with a single the viral genome was carried out by deduction of amino genotype, and 77 (44.5%) samples have multiple theacids S regionfrom theof HBV.sequences The identification of nucleotides. of mutations Mutations in genotypes infections. High- and low-risk HPV genotypes in the S region of HBV were found in 80% (16/20) of were detected in 109 (63.0%) and 115 (66.5%) samples, the HBV DNA positive patients. Of these, six had the respectively. Moreover, the most prevalent high-risk substitution sY100C along with sT131N, and in nine HPV genotypes were HPV-16 (15.6%) followed by HPV- was detected sT131N isolated. One patient had a triple 31 (9.3%) and HPV- 45 (8.1%). The most commonly mutation (sY100C, sT131N and sD144A) in the HBV genome. All these patients were infected with genotype CP6108 (5.8%). Abnormal cytology was observed in 17 identified(3.0%) women. low-risk Discussion types and were Conclusion: HPV-53 We (9.3%) observed and substitutions in the S region of HBV in HIV seropositive a higher HPV prevalence (33.6%) and higher infections A.patients. The findings Further of studiesthis study are demonstrate needed to elucidate the presence the role of rate with multiple genotypes in women in reproductive of these mutations. Financial support: FAPEG age compared to other studies done in Brazil with the same population. Also, we observed that HPV-16 HV317 - Prevalence Of Human Papillomavirus was the most prevalent genotype in our population as In Women Attending Cervical Screening In founded worldwide. Financial Support : FAPESP (Grant The Southeast Of Brazil #2012/01278-0), INCT- HPV and Capes. Candeias, J.M.G., Bolpetti, A.N., Pinto, G.V.S., Villa, L.L., Luque, A.L.F., Silva, M.G. HV319 - Identification Of G2 Rotavirus 1. Instituto de Biociências - Depto Microbiologia e Causing Antigenemia In Children Hospitalized For Acute Gastroenteritis In Imunologia, IBB - UNESP, Distrito de Rubião Junior s/n - Belém, Pará, Brazil. Botucatu - SP Barros, R.J.S., Vinente, C.B.G., Abreu, E., Reymão, 2. Faculdade de Medicina de Botucatu - Departmento T.K.A., Guerra, S.F.S., De Oliveira, A.S.L., Fumian, T.M., de Patologia, FMB - UNESP, Distrito de Rubião Junior s/n - Gabbay, Y.B., Soares, L.S., Justino, M.C.A., Linhares, A.C., Botucatu - SP Mascarenhas, J.D.P. 3. Instituto Nacional de Ciência Tecnologia das Doenças

124 Human Virology: HV

1. Instituto Evandro Chagas, IEC, BR-316, Km 7, S/N°. 2 diabetes is also rapidly emerging as a global health Levilândia. Ananindeua-Pa care problem that threatens to reach pandemic levels 2. Programa de Pós-Graduação em Virologia, PPGV/ by 2030. Prevalence of HCV in the general population IEC, BR-316, Km 7, S/N°. Levilândia. Ananindeua-Pa in Brazil is 1.38%, but little information is known regarding HCV prevalence among patients with type 2 Group A rotavirus is a major cause of acute diabetes. The objective of this study was to investigate gastroenteritis, causing > 450.000 deaths annually, the prevalence of HCV infection in type 2 diabetes. mostly in developing countries. Recent studies have Serum samples from 411 individuals with type 2 shown the ability of rotavirus to evade gastrointestinal diabetes referred to reference hospitals from 3 states tract and infect different organs, causing atypical clinical from Brazil (Minas Gerais, São Paulo and Ceará) were manifestations. The aim of this study was to determine a possible association between rotavirus G genotypes to the American Diabetes Association guidelines (2008). included.The current Defining research type was 2 approved diabetes bywas the done Fiocruz according ethics fecal samples were collected from children hospitalized committee. Demographic data rec-orded included age identifiedfor acute gastroenteritis in blood and fecal in a pediatricsamples. hospitalPaired serum in Belém, and and gender. Measurements of fasting glucose, aspartate Brazil, from March 2012 to March 2013. All recruited aminotransferase (AST), alanine aminotransferase children were aged less than 6 years and their parents (ALT), gamma glutamyltransferase (GGT) were or guardians signed an informed consent form before performed following standard laboratory procedures. any study procedure. Quantitative polymerase chain Insulin was determined by electrochemiluminescence reaction (qPCR) was performed to detect viral RNA in method. HCVAb screening was done using commercial clinical samples. Positive strains were subjected to RT- enzyme immunoassay (Murex anti-HCV v.4.0, Diasorin) following manufacturer’s instructions. Population was two paired (stool and serum) samples were collected: comprised by 251 (61.07%) females and mean age± and47.2% Nested-PCR (34/72) forand genotype43.1% (31/72) identification. of fecal Seventy- and standard deviation was 56.8 ± 28.6 years. The prevalence serum specimens were positive by qPCR, respectively. of HCV in type II diabetes was 1.7%. Median values for Positivity was observed in paired clinical samples in biochemical data were 23 U/L for ALT, 21 U/L for AST, 30.5% (22/72) of cases. The most common genotype 32 U/L for GGT, 144 mg/dl for glucose and 11.4 µU/L found was G2 in 40.9% (9/22) of paired samples (serum for insulin. We concluded that HCV prevalence is slightly and corresponding feces). Twenty-one (95.4%) fecal prevalent among type 2 diabetic patients compared to samples were G2 rotavirus genotype and only one (4.6%) general population in Brazil. G1 rotavirus genotype. In 59.1% (13/22) of serum samples reacting positive by qPCR, we were unable to HV321 - Complete Genome Sequence And further determine the G genotype. To our knowledge Characterization Of Hepatitis D Virus Genotype 3 In Brazil by rotavirus in Brazil. Our data show that antigenemia Marques, V.A., De Almeida, A.J., Lewis-Ximenez, L.L., this represents the first study to assess antigenemia Lampe, E. the current predominance of this genotype in Belém, Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil, wasBrazil. associated Further analyses with G2 are rotavirus needed infection, to assess reflecting whether G2 antigenemia translates into a more severe clinical 4365 – Manguinhos, Rio de Janeiro - R.J, Brasil outcome. Financial support: Instituto Evandro Chagas/ Hepatitis D virus (HDV) co- or super-infection is a major SVS/MS; Coordenação de Aperfeiçoamento de Pessoal health risk for persons with acute or chronic Hepatitis de Nível Superior. B virus infection due to HDV infection is associated with a more severe form of hepatitis and increased risk HV320 - Prevalence Of Antibodies Against of complications. Currently, there are eight genotypes Hepatitis C Virus (Anti-Hcv) Infection of HDV distributed over different geographic areas. Among Type 2 Diabettes Patients. Previous data have described HDV-3 as the most frequent Villar, L.M., Vasques, A.C., Geloneze, B., Miguel, J.C., in Brazil, being associated with cases of fulminant Silva, E.F., hepatitis. The aim of this study is to characterize the 1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 genetic variability of full HDV-3 genome. The HDV strain 2. Universidade de Campinas, UNICAMP was isolated from a treatment-naive male patient with chronic HDV infection, 25 years-old, who followed at the Chronic hepatitis C virus (HCV) has become the global Viral Hepatitis Ambulatory, Rio de Janeiro, Brazil. HDV “epidemic” with an estimated 123 million people RNA was extracted from 200 ul serum using a High Pure currently infected worldwide. At the same time, type Viral Nucleic Acid Kit, according to the manufacturer’s

125 Human Virology: HV

sinkhole, respectively, but not treated water. The food instructions.genome. PCR products Amplification were submitted was performed to direct by nucleotide RT-PCR vegetables. Seven hundred serum samples were tested usingsequencing. five pairs The consensus of primers sequence that cover was the obtained entire after HDV isfor based anti-HEV on wild IgG meat,by EIA cassava using theflour, recomWell cereals and HEV some kit alignment with HDV-3 full-length genome sequences (Mikrogen, Neuried, Germany). Besides the potential risk available in GenBank. The phylogenetic analysis and the of acquiring HEV infection, either by the consumption of deduced amino acid sequence were performed using wild meat as well by the poor conditions of sanitation, MEGA v.5 software package. The genome of the sample the overall prevalence of anti-HEV was found to be low (3,8%) in Mâncio Lima, which and showed only 88.7% similarity with the sequences identifiedof genotype in 3 thischaracterized study consisted in others of countries 1673 nucleotides of South HV326 - Niche Modeling Evidencing The America. A more inclusive phylogenetic analysis using Spatial Speciation Of Arenavirus Reservoirs 41 partial (nucleotide positions 908-1267) reference In South America Oliveira, A.L.R., Bisordi, I., Souza, R.P. the Brazilian isolates belong to genotype 3. The region of Centro de Virologia - Instituto Adolfo Lutz, NDTV - LHDAg (large HDAg) from the Brazilian sample contains sequences, from different HDV genotypes, confirmed that CV - IAL, Av. Dr. Arnaldo 355 CEP: 01246-902 São Paulo, multiple amino acid substitutions, which are conserved in complete sequences of genotype 3 from Venezuela SP Brasil and Peru. However, the analysis of the carboxy-terminal Arenaviruses are associated with severe hemorrhagic region of the LHDAg of HDV-3 isolated from Brazilian disease in humans in Africa and South America. samples, including the sample of this study, showed some Among the natural reservoir of Arenavirus in South degree of diversity when comparing one to each other. America, the genus Calomys is specially important as In conclusion, the great genetic difference found among both Argentinean and Bolivian hemorrhagic fevers this isolate and the other full-length characterized HDV- are associated with Calomys musculinus and Calomys 3 from South America highlight the need of more studies callosus respectively. Popularly knew as “Vesper mouse” in this area to clarify the extend of genome variability of the genus Calomys is a frequent inhabitant of the South Brazilian HDV isolates. American open vegetation forms. In order to understand the evolution of Arenavirus in South America it is HV325 - Low Prevalence Of Hepatitis E In necessary to understand the temporal and geographical A Riverside Community In The Far West distribution of Calomys. This study aims to describe Amazon, Acre, Brazil the spatial partiotining of Calomys in South America Gardinali, N.R., Salvador, S.B.S., Mejido, D.C.P., Pinto, M.A., Baptista, M.L., Pereira, T.M., Arruda, R.A., Arenavirus. In the current study, the MAXENT ecological Montovani, S.A., Silva-Nunes, M., Oliveira, J.M. andniche analysis modeling its influencealgorithm in was the currentutilized distributionto model the of Instituto Oswaldo Cruz/ Fiocruz - Laboratório de distribution of Calomys callosus, Calomys musculinus and Desenvolvimento Tecnológico em Virologia and Laboratório Calomys tener, reservoirs of Machupo, Junin and Pinhal de Enterovírus; Universidade Federal do Acre (unpublished data) arenaviruses respectively. Cases of the disease were also plotted and analyses against the Hepatitis E virus (HEV) infection is the major cause of same set of environmental layers in order to understand epidemic and sporadic hepatitis in developing countries the distribution of the disease in relation to reservoir with poor sanitation conditions. Genotypes 1 and 2 distribution and the possible existence of natural nidality are associated with enteric, human infection whereas within rodent subpopulations. The resulting analysis genotypes 3 and 4 are primarily zoonotic and associated suggests that Calomys callosus, Calomys musculinus and to the consumption of raw or undercooked meat (pork, Calomys tener presents a near parapatric distribution, wild boar and/or deer). In Brazil, HEV genotype 3 is with little area overlap. Population niches overlaps largely disseminated among swine herds, but only a and produce a continuum of similar ecological roles single human autochthonous case has been described across an environmental gradient. The typical area of up to now. Among swine handlers the anti-HEV IgG occurrence of Calomys tener is the open formations of seroprevalence is estimated in the 6 to 8%, whereas in southeastern Brazil. The occurrence of Pinhal virus is urban areas it´s around 2%. In the present study, the within the area of occurrence of Calomys tener, but the seroprevalence of HEV antibodies was evaluated in the low incidence of the virus do not allow further analysis. general population of Mâncio Lima (AC, Brazil), located Calomys callosus occurs in Bolivia, Paraguay, Northern at extreme western Amazon. Only 0,5% and 15% of Argentina and western Brazil. The niche model predicts the riverine population has electricity and toilets with the existence of the species in Central Brazil and in the

126 Human Virology: HV

Northeastern Caatinga. All cases of Bolivian Hemorrhagic Mendes, G.S., Silva, R.C., Reis, F.C., Lima, D.P., Amorim, fevers studied were restricted to the northern portion A.R., Santos, N. of Calomys callosus distribution, indicating a strong natural nidality. The same phenomenon is observed with Universidade Federal do Rio de Janeiro, UFRJ, Cidade Calomys musculinus and the Junin occurrence. Further Universitária - Ilha do Fundão - CCS - RJ analysis are necessary to uncover the evolutionary Acute diarrhea (AD) is a major problem of public health. process that led to the current distribution. Financial A variety of virus is involved in the etiology of AD. support Among virus pathogens, rotavirus (RV), norovirus (NoV) and astrovirus (AstV) are the most common agents HV330 - A Viral Meningitis Outbreak associated to AD. Other viruses such as Aichi virus Associated With Echovirus 18 In São Paulo (AV) and newly described viruses such as salivirus/ State, Brazil klassivirus (SV/KV) and cosavirus (CosV) are emerging Carmona, R.C.C., Machado, B.C., Vieira, H.R., Vilanova, as possible AD etiologic agents. In this work, we evaluate B.C., Souza, C.A., Timenetsky, M.C.S.T., Katz, G. the frequency of enteric viruses (RV, NoV, AstV, AV, SV/KV 1. Instituto Adolfo Lutz, IAL, Av. Dr. Arnaldo, 355, Sao and CosV) among children and adults with and without Paulo, SP, Brasil, 01246-902 AD in State of Rio de Janeiro. For this purpose, 225 stool 2. Centro de Vigilancia Epidemiologica do Estado de samples collected from 2010 to 2012 were examined Sao Paulo, CVE for the presence of viral genome by using conventional and real-time RT-PCR methodologies. Viral RNA was Human enteroviruses (HEVs) are responsible for a wide detected in 46 (20.4%) samples. Of those, 28 (60.9%) spectrum of clinical disease. They are the most common were from individual between 16-81 years of age and cause of viral meningitis and represent a serious public- 18 (39.1%) from children between 1-15 years of age. health problem, especially during outbreaks. The aim of Forty-one samples were positive for well-established this study was to describe the HEVs serotype responsible enteric pathogens: RV was the most common virus for an outbreak of 11 suspected cases of aseptic detected (71.7%; 33/46), followed by NoV (13%; 6/46), meningitis among children from two schools in the City co-infection of RV+NoV was detected in 2 samples of Bauru, São Paulo State, Brazil, between October and (4.3%). Eighteen of those samples were collected from individuals with AD and 23 from individual without AD. from 05 children were sent at the Adolfo Lutz Institute Novemberfor research of of 2012. HEVs. Cerebrospinal Cell culture, fluidRNA extraction (CSF) samples and by sequence analysis: SV/KV (8.8%, 4/46) and, AV (2.2%, Real Time Polymerase Chain Reaction (PCR) were Emerging1/46). CosV viruses was not were detected. detected Samples in 5 samples, positive confirmed for SV/ performed on each sample to determine the presence KV were collected from 3-, 29-, 36- and 44-years old of HEVs. Samples which were positive for enterovirus individuals without AD; the samples positive for AV came in cell culture were subject to reverse transcription - from a 2-year old child without AD. All samples positive PCR (RT-PCR) and VP1 partial sequencing to identify for emerging viruses were collected in 2010. The results the etiological agent of the outbreak. The serotype of demonstrate that SV/KV and AV circulated among adult each isolate was determined by BLAST search of the and children in Rio de Janeiro, although in low rates. VP1 amplicon sequence available in GenBank. All CSF However, it was not possible to associate theses agents specimens were diagnosed as enterovirus-positive by to AD. Extensive epidemiological surveillance of novel real time-PCR. Phylogenetic analysis of two successfully enteric viruses may provide a better understanding of sequenced samples revealed echovirus 18 (E-18) as the distribution, genetic diversity, and association of the etiological agent.E-18 was reported as cause of an the viral agents associated with AD. Financial support: outbreak of aseptic meningitis in schoolchildren from FAPERJ, CAPES, CNPq. City of Bauru, São Paulo State, Brazil. Rapid detection HV335 - Epidemiological Evaluation Of Hsv- are important in appropriate patient management and 1 And Hsv-2 In Risk Behavior Groups andepidemiological identification investigation. of HEV serotypes Additionally, in clinical we specimens illustrate Dos Santos, A., Lima, L.R., Perse, A.S., Motta-Castro, the utility of molecular methods for the detection and A.R.C., Castro, L.S., Rezende, G., De Paula, V.S. typing of enteroviral infections. Financial support: 1. Fundação Oswaldo Cruz - Instituto Oswaldo Cruz, Fapesp 2012/50234-5 Fiocruz-IOC, Av. Brasil, 4365 - Manguinhos, Rio de Janeiro HV331 - Emerging Enteric Viral Infections 2. Universidade Federal de Mato Grosso do Sul, UFMS, In Children And Adults With And Without Av. Sen. Filinto Müller, 1 - Campo Grande - MS Diarrhea

127 Human Virology: HV

Both Herpes simplex virus type 1 and Herpes simplex and factors inherent to professional activity. The aim virus type 2 (HSV-1 and HSV-2) are highly prevalent of this study was to estimate the prevalence and risk worldwide. HSV-1 is widespread in general population, factors/behaviors associated with HBV infection, and to while HSV-2 is more usual among risk behavior groups detect HBV genotypes circulating in FSW in Goiânia-GO, such as men who have sex with men (MSM) and Central Brazil. FSW were recruited during May 2009 to female sex workers (FSW). Genital herpes can cause June 2010, using Respondent- Driven Sampling. A total considerable morbidity and may lead to congenital and of 402 FSW were interviewed about demographic and neonatal infections. This clinical manifestation of Herpes risk factors for HBV infection and tested for detection of simplex viruses can be caused by either HSV-1 or HSV-2 HBV markers (HBsAg, anti-HBc and anti-HBs) by ELISA and is the most prevalent sexually transmitted infections (Hepanostika Uniform Organon Téknika and Biokit). All in industrialized countries. Besides that, genital herpes HBsAg-positive samples were tested for the presence of is highly associated with sexual risk behaviour groups as HBV DNA by nested polymerase chain reaction (PCR), MSM and FSW. The aim of this study was to evaluate the and genotyped by sequencing of the S gene. The overall prevalence and incidence of HSV-1 and HSV-2 in two risk HBV prevalence was 16.9% (IC 95%: 11.4 – 23.3). Four behavior groups, MSM and FSW, from Mato Grosso do FSW were HBsAg positive, 161 anti-HBs positive and 63 Sul, Brazil. For this purpose, 683 samples (283 samples anti-HBc positive. The HBV DNA was detected in three from MSM and 400 samples from FSW) were tested by enzyme-linked immunosorbent assay for IgG and IgM The multivariate analysis showed lower education, anti-HSV-1/HSV-2. The IgM anti-HSV-1/HSV-2 positive serum samples. All were identified as subgenotype A1. samples were tested by multiplex PCR to evaluate the disagreement on condom use, obtaining male condom presence of HSV-1 or HSV-2. The results demonstrated earlierin the workplace, age at first and sexualignoring intercourse, signals and symptoms cocaine use, of that the prevalence of the MSM group is 82,58% and sexually transmitted Diseases (burning pain on urination, from the FSW group is 99,5%. No individual from MSM genital ulcers/sore, and itching) were independently group was positive for IgM anti-HSV-1/HSV-2 and in FSW

PCR demonstrated 2 negative samples, 1 positive sample associatedinterventions with to HBVprevent prevalence HBV infection (p < 0,05). and The other present STDs groupfor HSV-2 five andsamples 2 positive were positive samples (1,24%). for HSV-1 The and multiplex HSV-2. findingsamong FSW. offer Financial a starting support: point CNPQ to planning effective Our results demonstrated high prevalence of HSV-1/ HSV-2 and underscore the need for education on safer HV339 - Pyrosequencing As A Useful Tool sex practices among risk behavior groups. For Detection Of Lamivudine Resistance Mutations In Hiv/Hbv Coinfected Patients HV337 - Hepatitis B Virus (Hbv) Infection Spitz, N.T.D., Lago, B.V., Moraes, M.T.B., Gomes, S.A., Among Female Sex Workers In Central Soares, C.C. Brazil: Prevalence, Risk Behaviors And Genotypes Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365, Matos, M.A., França, D.D.S., Caetano, K.A.A., Carneiro, Manguinhos, Rio de Janeiro/RJ M.A.S., Martins, R.M.B., Matos, M.A.D., Pinheiro, R.S., Chronic hepatitis B virus (HBV) is common in human Kerr, L.R.F.S., Mota, R.M.S., Teles, S.A. 1. Faculdade de Enfermagem, Universidade Federal individuals with a prevalence ranging from 5 to 20% de Goiás , FEN/UFG, Rua 227 Qd 68, S/N - Setor Leste immunodeficiencyin various studies of virusHIV-infected type-1 patients. (HIV-1) Both infected share similar routes of transmission and can lead to chronic Universitário - Goiânia - Goiás - Brasil disease, cancer, and death, and neither can be eradicated 2. Instituto de Patologia Tropical e Saúde Pública., with the use of current therapies. Reverse-transcriptase IPTSP/UFG, Rua 235 - s/n - Setor Universitário. Goiânia, (RT) is an important enzyme for the replication of Goiás-Brasil both viruses and for this reason it is used as a target in 3. Universidade Federal do Ceará, UFC, Av. da antiretroviral therapy. Lamivudine (LAM) is a nucleoside Universidade, 2853 - Benfica, Fortaleza - CE. Brasil analogue which inhibits RT and is used in treatment

Hepatitis B infection is one of the most frequent infectious compromised by the emergence of resistant viral strains diseases and represents a serious problem of public against HBV and HIV. However, its clinical benefit has been health worldwide, particularly due to the risk of chronic HBV, the primary LAM-resistance mutation (rtM204V/I) complications. Female sex workers (FSW) have been carryingaffects viral specific replication mutations and in HBVcompensatory and HIV RT mutations genes. In recognized as a population at higher risk for hepatitis (rtL180M, rtV173L) that partially restore replication B virus (HBV) infection due to their social vulnerability

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Humanefficiency Virology: HV are often co-selected. The aim of this study XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

128 Human Virology: HV is to evaluate by pyrosequencing, the incidence of LAM in SJRP from 1990 to 1998. Only in 2008, DENV-1 was resistance mutations in both viruses. RtM204V/I were detected again in SJRP. It was also the main serotype in successfully analyzed in 23 samples. Mixed population the 2011 outbreak. DENV-2 was introduced in the city (wild type -wt- and mutant strains) was found in 69.6% in 1998 and DENV-4 in 2011. Thus, we show that three (16/23) of samples. Only rt204V mutant population was different serotypes of dengue have been detected in found in 21.7% (5/23) of samples and in 2 (2/23; 8.7%) the city in different proportions and the impact of this only wt strains were found. Compensatory mutation hyperendemic circulation should be further evaluated rtL180M was investigated in 14 samples and only wt for epidemiological purposes. strains were found. RtV173L was studied in 20 samples. Only wt strains were found in 90% (18/20) and only HV344 - Epidemiological Profile Of rt173L mutant population was found in 10% (2/20) of Pandemic Influenza A Cases In Southern the samples. Mutant subpopulation was found in some Brazil: Post-Pandemic Period And Vaccine samples percentages lower than 10%, showing that Baccin, T.G., Gregianini, T.S., Kretzmann, N.A., Gorini da pyrosequencing is a very sensitive technique that may Veiga, A.B. be useful in detecting and quantifying subpopulations of 1. Univerdidade Federal de Ciências da Saúde de Porto resistant viruses, that may be not be detected by other Alegre, UFCSPA, R. Sarmento Leite, 245 Anexo I B: CENTRO, methods. It can be useful in predicting the appearance of mutant strains that can derail the treatment, improving Porto Alegre / RS the outcome of therapy. Financial support: Fiocruz, 2. FEPPS-Instituto de Pesquisas Biológicas-Labaratório CNPq/PIBIC Central, IPB/LACEN-RS, Av. Ipiranga, 5400 - Jardim Botânico - Porto Alegre/RS HV340 - Hyperendemic Circulation Of Dengue Virus Serotypes 1, 2 And 4 In São José Do Rio Preto, São Paulo, Brazil in all geographical regions. Although it causes mild Colombo, T.E., Silva, M.L.C.R., Vedovello, D., Reis, A.F.N., Influenzasymptoms virusesin the majority are highly of cases, contagious illnesses and can circulate result Cury, A.A.F., Oliveira, F.H., Cruz, L.E.A.A., Bronzoni, in hospitalizations and deaths mainly among high- R.V.M., Nogueira, M.L. risk groups. During the 2009 pandemics caused by 1. Universidade Estadual Paulista Júlio de Mesquita Filho , IBILCE/UNESP influenza2010, a massive A(H1N1), vaccination the State ofprogram Rio Grande was doapplied Sul (RS) in 2. Faculdade de Medicina de São José do Rio Preto, aloneRS when confirmed 44.9% of 3,585 the population influenza joined A(H1N1) the cases.program. In FAMERP, São José do Rio Preto, SP, Brazil 3. Departamento de Vigilância de São José do Rio Preto, DV/SJRP, São José do Rio Preto, SP, Brazil Duringwere collected. the 2011, A 1,501total of cases 1,433 of samples SARI and was Influenza- sent to likethe illnessCentral wereLaboratory notified in and Porto nasopharyngeal Alegre (LACEN-RS) samples Dengue is the most common arboviral infection for viral detection by real time reverse transcription- worldwide and it is caused by four distinct serotypes polymerase chain reactions. Only 107 (7.5%) cases of (DENV 1-4). São José do Rio Preto (SJRP), São Paulo has been presenting a hyper endemic circulation of DENV since 2008, when three serotypes started circulating the A(H1N1) virus were confirmed versus 182 (12.7%) in the city. This is a report of DENV transmission in casesyears old, of seasonal differently influenza of the pandemic A. The incidence period when of both the SJRP from 2011 to 2013. We used serum samples of influenzapatients more types frequently virus was affected higher inwere patients 21-30 aged years 0-10 old group. The median viral load was higher in patients infected with seasonal, in comparison to those infected suspectedviral surveillance and confirmed was based DENV on Multiplex patients RT-PCR provided with by with A(H1N1) virus (1.86(0.06-157.58) vs. 0.05(0.0020- theFlavivirus Health genericSecretariat primers to profile based DENV on circulation.non-structural The 2.44)), contrary of pandemic period. The median viral protein (NS5) were performed, followed Nested assays loads were different between females and males only in patients infected with seasonal virus and females had highest viral load in relation to male (11.7{0.15-340.34} with species-specific primers for the identification of versus 0.81{0.02-47.3}, p=0.02). In 2011 most of the DENVsamples 1-4. for ThereDENV wereand 327 997 (41,5%) cases confirmed were positive in SJRP for fromDENV-1, January 78 (10%) 2011 DENV-2, to March 375 2013. (48%) We DENV-4 amplified and 783 3 (0,5%) DENV-1/DENV-4 coinfection, showing a complex patientscough, dyspnea, that were myalgia infected and by rhinorrhea influenza wereA virus the (79%, most p<0.001),frequent symptomsdid not receive (positivity vaccine. >60%).The presence Nevertheless, of fever, and only serotype to cause autochthonous DENV cases fever and dyspnea showed a positive correlation with patternSeptember of 2013 serotypes Volume 18 circulation. – Supplement DENV-1 1 - Abstracts/Posters was the first - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

129 Human Virology: HV

These results suggest that HBV infected slaves brought only patients infected by pandemic virus died (12.9%, to Brazil came mostly from the East African coast, and infectionp=0.001) byin A(H1N1)contrast with virus 2009 (p<0.05). pandemic Curiously, period in when2011 probably exported during the late 19th century through 6% of patients infected by pandemic virus died. In other Mozambican route by Portugese sailors. However, hand in the whole population (5.3%) the mortality rate was similar that observed in the pandemic period (5.9%). hypothesis and to establish the routes involved to the evolutionaryspread of HBV/A1 studies in Brazil. are necessary to confirm this virus reemerged only in May 2011 and co-circulated After the pandemic period (2009), influenza A(H1N1) HV348 - Active Human Herpesvirus 6 And don´t know what is happening with the pandemic virus 7 Infections In Plasma Of Patients With withselection. influenza These A seasonalanalyses andprovide B viruses. important Wherever scenery we Encephalitis And Neurological Diseases: about the host-pathogen interaction after massive An Alternative Of The Use Of Cerebroespinal exposure during pandemic period. Financial Support: Fluid Detection. FEPPS and Ministério da Saúde Tavares, C., Bonatelli, M., Nucci, A., Costa, S., Bonon, S.

HV347 - Comparative analysis of the HBV/A1 University Of Campinas, UNICAMP, Cidade full-length genome: The role of the slave Universitária “Zeferino Vaz” - Faculty Of Medical Sciences trade in the spread of HBV/A1 in Brazil The aim of this study was to identify the incidence of Lago, B.V., Mello, F.C.A., Motta-Castro, A.R., Gomes, S.A. HHV6-A, B and HHV-7 in patients suspected of having Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil, CNS infections and to differentiate patients with signs 4365, Manguinhos, Rio de Janeiro, Brasil and symptoms of encephalitis and non-encephalitis at the Hospital of Clinics, Campinas, SP, Brazil. A Hepatitis B virus (HBV) infection is one of the major public health problems, especially in developing countries. It is nested polymerase chain reaction (N-PCR) for HHV- estimated that 2 billion people have been infected with cerebrospinal6 and HHV-7 fluidwas (CSF)performed and a andplasma compared. examination Criteria by HBV worldwide and more than 240 million are at risk of for diagnosis of HHV-CNS infections included fever, developing cirrhosis and hepatocellular carcinoma due headache, seizure, altered consciousness, etc. A total of to chronic infection. Among them, 65 million are living 53 patients, 26 males and 27 females aged between 0.05- in Africa. It have been established that HBV subgenotype 74 years (median=23 years old), were enrolled in this A1(HBV/A1), the most prevalent Brazilian genotype, study. Thirteen patients had active HHV-6 and/or HHV- has an African evolutionary origin. Studies conducted in 7 infection (24.5%). The incidence of HHV-6 and HHV-7 isolated Afro-Brazilian communities, which are closed active encephalitis infections was 44%. The incidence of to external contact since the slavery, found almost HHV-6 viral encephalitis was 40%; HHV-7 encephalitis exclusively HBV/A1, suggesting that it was introduced was detected in 36%. Coinfection HHV6+HHV7 occurred in Brazil by the slave trade. The aim of this study is to in 20%. There were no HHV6-A infections observed. compare HBV/A1 isolates from different African regions The incidence of active HHV infections was noticeably with Brazilian isolates in order to investigate, throughout higher in encephalitis patients (p = 0.005). These genetic identity, which African regions/countries have contributed to dissemination of HBV/A1 in Brazil.For is frequently associated with encephalitis among others, findingswhich demonstrates suggest that that infection these withpathogens HHV-6 have and HHV-7a high A1 from different Brazilian regions were selected. Up potential for neuro-invasiveness. Nested-PCR in CSF may thisto now, purpose, thirty-seven 50 samples, HBV previously full-length classified genomes as HBV/were be helpful in the detection of patients with HHV-CNS infection and non HHV-CNS infection and plasma can be were successfully sequenced and compared with 150 used in situation were is impossible to collect the LCR to amplifiedHBV/A1 sequences by PCR assay.Twenty-one available in GenBank/NCBI.Three HBV/A1 genomes clones from 10 different samples were also sequenced in of plasma is a valid tool for the diagnosis of neurological order to verify subpopulation divergences.Phylogenetic examination.diseases associated This study with confirms herpesvirus that andthe PCRcan beanalysis used analysis demonstrated that Brazilian sequences are to evaluate the clinical impact of the lymphotropic more closely related to Asian/East African sequences herpesviruses and their role as human pathogens in CNS than with sequences from south-western African infections. Finnancial Support: FAPESP regions (genetic distance values: 0,17 versus 0,26).A higher identity between Brazilian and Somalian samples HV350 - The Use Of Antigenemia Test For (0,18) suggested that most of the captives who were able Detection Of Active Human Herpesvirus 6 & 7 to perpetuate HBV/A1 infection belonged to this region. (Hhv-6 And Hhv-7) And Its Relationship With

130 Human Virology: HV

Antigenemia For Human Cytomegalovirus Sousa, D.D., Cordeiro, J.S., Granja, F., Siqueira, T.C.S., In Brazilian Transplanted Patients. Nascimento, I.A.S., Lima Junior, W.P., Silva, G.A.V., Oliveira, R., Gulin, A., Pancielli, P., Lima, C., Vigorito, A., Naveca, F.G., Acosta, P.O.A. Rossi, C., Costa, S., Bonon, S. 1. Universidade Federal de Roraima, UFRR, Campus University of Campinas-Faculty of Medical Sciences, Paricarana: Av. Cap. Ene Garcez, nº 2413. Bairro Aeroporto. FCM/UNICAMP, Cidade Universitária “Zeferino Vaz” CEP: 69310-00 The aim of this work is to use antigenemia (AGM) 2. Instituto Leônidas e Maria Deane - FioCruz - AM, assays to detect and monitor active infections caused ILMD - FioCruz - AM by HHV-6 and HHV-7 in patients undergoing HSCT, as 3. Programa de Pós-graduação em Recursos Naturais, well as evaluating the clinical impact of these viruses PRONAT - UFRR in relation to active human cytomegalovirus infection Dengue is the most important human arboviral disease (CMV). Methods: Fifty seven patients undergoing HSCT and the major health problem in developing countries. were monitored weekly, from day 0 until day 100 of Dengue virus (DENV) is an arbovirus that belongs to the post-transplantation period, using antigenemia assays and a plasma Nested PCR (N-PCR) technique for antigenically distinct serotypes DENV-1-4. Roraima is the detection of active betaherpesvirus infections and hyperendemic for dengue and shows the circulation to avoid the detection of latent infections. Methods: genus Flavivirus family Flaviviridae, classified in four of four serotypes after DENV4 reintroduction in 2010. HHV-6 and HHV-7 antigenemia assays were developed Between 2007 and 2011,14.078 cases of febrile illnesses in peripheral blood mononuclear cells from HSCT were noticed in State which dengue infection was discarded by laboratory methods of anti-dengue IgM for these viruses and peroxidase staining. Active HCMV and/or NS1 antigen-capture ELISA (NS1) and whose patientsinfection withdetection the use was of performedmonoclonal using antibodies a commercial specific was to evaluate the accuracy of dengue diagnose in NS1 and/or antigenemia assays for HHV-6 and HHV-7, 53 out negative samples in comparison with Real-time RT-PCR of the 57 patients monitored had active betaherpesvírus etiologic agent was not identified. The aim of this study immunofluorescence kit. Results: Using plasma N-PCR (qPCR) in 2012. In 986 samples from patients with infections (93%); in 68.4% the infection was caused presumptive diagnose for dengue 78,8% were negative by HCMV, in 68.4% by HHV-6 and in 78.9% by HHV-7. by ELISA assay (Platelia™DENGUE-NS1-Ag, BIORAD®) Detection of active betaherpesvírus infections using used in Central Laboratory of Roraima, this is the primary antigenemia assay for HCMV, HHV-6, HHV-7 occurred, diagnose method used in the health system of the state respectively, in 29/57 (50.9%), 39/57 (68.4%) and in the acute phase of disease. 150 samples were selected 45/57 (78.9%); triple infections occurred in 15/53 from the NS1 negative total to perform qRT-PCR. RNA was (28.3%), double infections occurred in 29/53 (54.7%) extracted with Axygen Bioscience® kit and subjected to while mono-infection occurred in 10/53 (18.9%). a TaqMan qRT-PCR that detects any serotype genome, Conclusions: The standardization and development developed by Gurukumar, 2009 adapted by Naveca, of HHV-6 and HHV-7 antigenemia assays appear to be 2012, from these samples 21,3% were positive by this effective in the diagnosis of active infections caused by test. Among the possible causes of false-negative NS1 these herpesviruses and can be used to detect active the fact of Roraima be a hyperendemic state, in which of their activation during immunosuppression may a high rate of secondary infection is expected, as know suggest their participation in progression of HCMV number are the high sensitivity/specificity of qPCR and herpesvirus infections, especifically. The possibility this fact decreases the sensitivity of NS1 tests due to infection in patients after hematopoietic stem cell the immune-complexes formed. Future studies may be transplantation (HSCT) and the management of the conducted to evaluate these hypotheses, as well as the patients can be improved. Future studies can be done to relation between serotypes and negativity of NS1. The use HHV-6 and HHV-7 antigenemia to quantify the viral data should be an alert to the health system in the sense load of these virus in blood of patients and to monitor that acute phasepatients are discarded by laboratorial the antiviral treatment in comparation to Nested-PCR assays; this phase needs constant care due to the plasma detection and Real Time PCR and to study the possibility of HFD/DSS, important in an endemic area. real necessity of monitoring patients to HHV-6 and HHV- Financial support: Universidade Federal de Roraima - 7 infections after the transplants. Finnancial Support by UFRR FAPESP HV354 - Il28b And Itpa Alleles Frequency In HV352 - Genetic Diversity Of Dengue Virus Brazilian Patients With Hcv Serotype 1 In Boa Vista - Rr, Brazil

131 Human Virology: HV

Delvaux, N., Costa, V.D., Costa, M.M., De Almeida, A.J., the CC genotype of rs1127354 and the AA genotype Villar, L.M., Villela-Nogueira, C.A., Coelho, H.S.M., Pollo- of rs7270101 in IPTA gene were the most frequent in Flores, P., Esberard, E.B.C., Uaraná, T., Lewis-Ximenez, Brazilian patients. Financial support: FAPERJ, CNPq, L.L., Lampe, E. Plataforma PDTIS/FIOCRUZ (RPT01A). 1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, HV360 - Preliminary Research Of Antibodies 4365 - Manguinhos, Rio de Janeiro - CEP: 21040-360 Against Hantavirus In The Population 2. Hospital Universitário Clementino Fraga Filho da From Jataí County, Goiás UFRJ, HUCFF da UFRJ, Rua Rodolpho Paulo Rocco, 255 - Costa, V.G., Novaes, D.P.S., Flor, E.C., Ramos, C.D.L., Cidade Universitária - Ilha do Fundão - RJ Gaban, L., Souza, L.O., Paula, C.R., Pimentel, V.A., Silva, 3. Hospital Universitário Antônio Pedro da UFF, HUAP D.P.B., Moreli, M.L. da UFF, Rua Marques de Paraná, 303 - Centro - Niterói - Rio 1. Universidade Estadual de Goiás, UEG, Jataí, GO de Janeiro 2. Laboratório de Virologia, Universidade Federal de Hepatitis C virus (HCV) infects about 170 million Goiás, UFG, Rodovia BR 364, km 192, Parque Industrial, people worldwide and it is estimated that over two 3.800, Jataí-GO million individuals are infected in Brazil. The treatment Emerging diseases are of great interest for public human of patients with chronic HCV infection is still a major and animal health systems, especially those with high challenge both in terms of clinical effectiveness and mortality, such as hantaviruses. Hantavirus, family cost-effectiveness. Several studies have shown that, in Bunyaviridae, is transmitted to humans through aerosols addition to viral factors, host genetic variants near genes of excreta from infected wild rodents. Hantaviruses, of interleukin 28B (IL28B) and inosine triphosphate emerging in the Americas since 1993, causes pyrophosphatase (ITPA) are strongly associated with SVR cardiopulmonary syndrome. Currently, Brazil present and protecting against hemolytic anemia, respectively. the highest number of cases (1573) in the Americas In IL28B gene, a single nucleotide polymorphism (SNP) with 633 deaths. The state of Goiás has recorded cases in rs12979860 revealed that the CC genotype is rather of illness and is located between endemic states for associated with SVR than CT or TT. In ITPA gene, in hantavirus, being Jataí county the third in this state in rs1127354, patients that bear the CC genotype are number of cases of illness. However, no epidemiological more likely to develop anemia than AC/AA genotypes, studies related to the disease in this region. Accordingly, whereas, in rs7270101 reduced hemoglobin is higher with aim to know the levels of IgG antibodies against in patients with the AA genotype than with AC/CC hantavirus and to become individuals more aware about genotype. Another important aspect to be studied is the the illness, this research was conducted in Jataí. The genetic variation of polymorphisms in different ethnic project was approved by the Ethics Committee of Federal groups. Several studies demonstrated that the frequency University of Goiás (n° 348/2010). The participants of the CC genotype of IL28B is higher in patients with resided in peri-urban and rural areas and the samples European ancestry than in individuals of African descent. In ITPA, genotypes CC/AC (rs1127354) are found at lower frequency in the Caucasian population than in the were collected on filter paper, through use of disposable eastern. In contrast, the genotypes AC/CC (rs7270101) microknifediluted in PBSin the buffer, fingertip. were Aditionally, processed it by was ELISA applied test, a are found more in whites, but were not detected in Asians. questionnaire.using N protein Subsequently, of Araraquara samples virus. 323 in the serum filter samples papers, Thus, different polymorphisms in both genes need to be were collected and processed, of which 52% were males examined in the Brazilian population to obtain national and 48% females. Age of participants ranged from 10 results. We aimed to verify the frequency of alleles in the to 78 years and was observed seroprevalence IgG anti- SNP rs12979860 (IL28B), rs1127354 and rs7270101 hantavirus of 2.2%. There was no association between (ITPA) in Brazilian samples. One hundred eighty three seroprevalence of hantavirus and gender of participants HCV infected patients were analyzed by DNA sequencing. by Fisher test (p=0.123). There was also no statistical Concerning the rs12979860, CC, CT and TT variants were difference by Fisher test seropositive compared to the detected, respectively, in 30% (55/183), 49% (89/183) and 21% (39/183). Regarding the rs1127354, 96.2% results the seroprevalence of IgG anti-hantavirus in (176/183) showed CC genotype and 3.8% (7/183) AC urbanpopulation and ruralof Jatai areas was (p=0.279) 2.2%. In conclusion,(p<5%). Based due into ourthe genotype. On rs7270101, 82.5% (151/183) showed AA majority of city population is unaware of disease is need genotype, 17% (31/183) AC genotype and 0.5% (1/183) public health policies aimed at awareness severity of CC genotype. These preliminary results demonstrated hantaviruses. that the CT genotype of rs12979860 in IL28B, and

132 Human Virology: HV

HV366 - Searching For Antivirals For Use 3. Centro de Pesquisas Aggeu Magalhães, CPqAM/ In Infections By Htlv-1: Evaluation Of New FIOCRUZ-PE, Rua Professor Moraes Rego, sn Adamantane Derivatives Franco, G.M., Souza, J.G., Canestri, L.O.R., De Fátima, A., Dengue virus has four antigenically distinct serotypes Souza-Fagundes, E.M., Barbosa-Stancioli, E.F. Universidade Federal de Minas Gerais, UFMG, Av. (DENV-1dengue, theto DENV-4) development classified of ina thevaccine Flaviviridae is a priority. Family, Antônio Carlos, 6627, Pampulha - Belo Horizonte - MG, CEP: genus Flavivirus. As there is no specific treatment for 31270-901 for dengue is considered a viable approach. The use of Developmentoptimized sequences of DNA vaccines targeted encoding to the antigen antigens processing specific Human T-lymphotropic virus 1 (HTLV-1), a human compartment with the membrane protein associated retrovirus, is the causative agent of an aggressive T-cell Lysosome (LAMP), has been shown to enhance immune leukemia known as adult T-cell leukemia (ATL) and a neurodegenerative disease called HTLV-1 associated encoding native antigens. Vaccine plasmids encoding myelopathy/tropical spastic paraparesis (HAM/TSP), responsespre-membrane compared and envelope to unmodified (prM/E) DNA proteins vaccines for the four dengue serotypes were constructed with therapeutic approaches to HTLV-1-related pathologies besidesare still limited. other The inflammatory aim of this study diseases. is the Nevertheless,evaluation of sequences, HEK-293 cells were transfected with the two new adamantane derivatives, ADA1 and ADA2 having and without LAMP. After confirmation of the DNA in common the moiety (C10H15), for which antiviral plasmids for confirmation of protein expression and A, Rubella virus and HIV. Preliminary data are being cellularof either trafficking.monovalent Subsequently, (mono-DNA) or BALB/c tetravalent mice (tetra- were propertiesevaluated in hadMT2 alreadycells, a human been cell described lineage permanently to Influenza immunizedDNA) endotoxin-free 3 times, three plasmid weeks interval,formulations. with 100Three μg infected with HTLV-1. The citotoxicity of the derivatives weeks after the last immunization, serum samples were was evaluated in the concentrations of 1µM, 0.01µM and 0.0001µM for 72h (MTT assay), and, concomitantly a Western Blot (WB) assay was performed in the same collectedtheir spleenocytes for virus-specific harvested antibody for T cell responseresponse analysis conditions by using the total proteins extracted from by ELISA and PRNT. Then, animals were sacrificed and the cells, after centrifugation. The supernatant of these Overall, dengue LAMP plasmids constructs elicited by IFN-γ ELIspot using prM/E overlapping peptides. assay (CBA Th1/Th2/Th17 - BD). Both derivatives did antibody titers as well as stronger T cell responses cellsnot present was used toxicity to detect to MT2 cytokines cells in inany a of flow the citometrydilutions higherthan its levels counterpart of virus-specific without LAMP.IgG2a, Onhigher the neutralizingother hand, tested. In the WB assay, a pool of HTLV-1 serum from tetra-DNA induced a greater antibody levels and lowers positive HAM/TSP patients indicated variation in the antibody neutralization titers as compared to mono- DNA. T cell epitope repertoire was reduced by tetra- and concentration dependent, highlighting the protein DNA, suggesting that epitope dominance among dengue proteinmodulation profile by ADA1 of MT2 in treatedthe 0.0001µM cells that concentration. were drug

serotypesprotective immunity might have against influenced all dengue T cell serotypes activation, has Thetreated cytokines cells with profile ADA1 analyzed in the 0.01µM did not concentration demonstrate compromisingproven to be challenging. vaccine efficacy. Our Induction study provides of concomitant insights significantshowed an variation,expression however, a little higherthe supernatant of IL-6, IL-10 of MT2and preliminary data demonstrate that ADA1 can be a aboutHV381 vaccine - Hp efficacyv-6 L crand dengueSequence antigen V ariabilityformulations. IFN-γpossible than antiviral the other candidate. drug and concentrations. These Detected In Laryngeal Papillomatosis Impacts Upon Viral Transcriptional HV368 - Development Of A Tetravalent Dna Activity Chimeric Vaccine Against Dengue Virus Bonfim, C.M., Sichero, L., Sobrinho, J.S., Nogueira, R.L., Guimarães, G.F., Moura, L.R., Nascimento, E.J., Marques, Kupper, D.S., Valera, F.C.P., Nogueira, M.L., Villa, L.L., E.T.A., Gil, L.H.V.G. Rahal, P. 1. Universidade Federal de Pernambuco , UFPE, Rua 1. Universidade do Estado de São Paulo, UNESP/ Professor Moraes Rego, sn/Departamento de Genética IBILCE, Rua Cristóvão Colombo, 2265 - Jardim Nazareth 2. University of Pittsburgh, CVR, 3501 Fifth 2. ICESP, Instituto do Câncer , Av. Dr. Arnaldo, 251 - Avenue/9022 Biomedical Science Tower 3 Pittsburgh, PA Cerqueira César - São Paulo - SP - CEP: 01246-000 15261 3. Faculdade de Medicina de Ribeirão Preto, FMRP, Av. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

133 Human Virology: HV

Bandeirantes, 3900 - Monte Alegre - CEP: 14049-900 Ribeirão Rua 235 - s/n - Setor Universitário - CEP: 74605050 - Goiânia Preto/SP - GO 4. Faculdade de Medicina de São José do Rio Preto, 2. Faculdade de Enfermagem/Universidade Federal FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro São José de Goiás, FEN/UFG, Rua 227 Qd 68, S/N - Setor Leste do Rio Preto, 15090-000 Universitário - Goiânia - GO 5. Escola de Medicina da Universidade de São Paulo, 3. Faculdade de Enfermagem/UEMS, UEMS/MS, USP, Av. Dr. Arnaldo, 455 - Cerqueira César - CEP: 01246- Rodovia Dourados - Itahum Km 12 Cidade Universitária 000 - São Paulo - SP - Brasi 79800000 - Dourados, MS 6. Instituto Nacional de Ciência e Tecnologiadas 4. Secretaria Municipal de Saúde de Jataí-GO, SMS- doençasdo HPV, INCT, Rua Dr. Cesário Motta Jr. n º 61 - Cep: Jataí-GO, ua Riachuelo, 2762, B. Vila Fátima CEP: 75.800- 01221-020 - São Paulo 000 5. Hospital das Clínicas/Universidade Federal de Goiás, Recurrent respiratory papillomatosis (RRP) is characterized by the development of papillomas, which HC/UFG, 1ª Avenida, s/n - Setor Leste Universitário - 74.605- are benign tumors in the upper respiratory tract. This 020 - Goiânia - Goiás disease is associated to Human Papillomavirus (HPV) Hepatitis A virus (HAV) infection constitutes a serious infection, mainly by types 6 and 11 which are considered public health problem, being responsible for about oncogenic low-risk HPV. The LCR (long control region) 1.5 million new infections worldwide each year. Poor contains cis-regulatory elements for cellular and viral sanitary conditions particularly lack of safe water and transcription factors (TF) that modulate viral early sewerage systems have been associated with increased gene expression and replication. Nucleotide alterations HAV prevalence. In Brazil, there are more than 1. 200.000 within the LCR may overlap TFs elements and impact families living in rural settlements. Most of them have no access to safety water, and many had lived previously in and ultimately on the clinical outcome associated to landless camping in poor hygiene conditions. The aim uponHPV infections. the binding Our affinity, aim was the to transcriptionalcharacterize molecular activity of this study was to estimate the prevalence of hepatitis variants of HPV among individuals diagnosed with RRP A among people living in rural settlements in Central and to analyze the impact of LCR nucleotide divergence Brazil. During 2008-2010 and 2011, individuals living upon viral early transcription. We analyzed 11 biopsy in rural settlement in Goias (n= 435) and Mato Grosso specimens of juvenile laryngeal papillomatosis and 9 do Sul (n= 364) were interviewed and blood samples of adult laryngeal papillomatosis. HPV-6 was found were collected and tested for HAV antibodies (total anti- in 14 (70%) samples and HPV-11 in 6 (40%) samples. HAV) by ELISA, respectively. Inclusion criteria for the variants not described previously. Computational This study was approved by the Ethical and Research of Sequencinganalysis showed of the that HPV-6 nucleotide LCR revealed changes five detected genomic studythe Clinical were: Hospitalliving in ofthe the settlement Federal Universityand aged ≥of 5 Goias year. overlap potential binding sites for transcription factors (n.127/2010) and Federal University of Mato Grosso do such as Foxa-1, Elf-1 and Gata-1. The HPV-6vc variant was Sul (n.1027/2007), update with the approval in 2011. 10 times more active than the HPV-6a molecular variant. Globally 86.7% (95% CI: 84.2 – 88.9) of individuals had Further, we observed that other alterations observed been previously infected by HAV, ranging from 16.2% strongly impacts transcriptional activity indirectly (95% CI: 9.3 – 26.7) to 98.7% (95% CI: 97.3 – 99.3) in measured by luciferase assays. To our knowledge, this those aged 5-9 years and 30 years or over, respectively. Increasing age, living in rural settlements of Mato Grosso activity among naturally occurring variants of HPV-6. do Sul, and had lived previously in landless camping isResearch the first in this report area describing is anticipated differences to provide in important promoter were independently associated with HAV infection in

HPV-6 intratype genomic variability. should be a target population for hepatitis A vaccination. information concerning the biological significance of this population (p < 0.05). Infants living in rural settlers HV385 - Epidemiology Of Hepatitis A In Rural HV390 - Prevalence Of Hepatitis C Virus In Settlements In Central Brazil A Rural Settlement’s In State Of Goiás, Pinheiro, R.S., Matos, M.A., Caetano, K.A.A., Araújo, L.A., Central Brazil Del-Rios, N.H.A., Moraes, L.C., Rodrigues, F.P., Silva, Araújo, L.A., Del-Rios, N.H.A., Martins, R.M.B., Teles, A.M.C., Carneiro, M.A.S., Martins, R.M.B., Teles, S.A. S.A., Silva, A.M.C., Diniz, F.A., Santos, L.S.M., Marques, 1. Laboratório de Virologia/ IPTSP/UFG, IPTSP-UFG, J.M.S., Matos, M.A., Caetano, K.A.A., Andrade, A.A., Carneiro, M.A.S.

134 Human Virology: HV

1. Instituto de Patologia Tropical e Saúde Pública, 2. Laboratório de Hepatites Virais, IOC - FIOCRUZ, UFG,Goiânia, IPTSP / UFG, Rua 235 - s/n - Setor IOC - FIOCRUZ, Av. Brasil, 4365, Manguinhos, Rio de Universitário, Goiânia, Goiás Janeiro. CEP 21040360 2. Faculdade de Enfermagem, UFG, Goiânia, FEN HCV infection is a global public health problem. Although, / UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário - some of infected individuals can spontaneously eliminate Goiânia - Goiás the virus, most patients develop chronic infection, Hepatitis C virus (HCV) is a predominant cause of chronic which over time can lead to complications, such as, hepatitis, cirrhosis and hepatocellular carcinoma liver cirrhosis and hepatocellular carcinoma. Whereas, worldwide. HCV infection is endemic in many countries, many studies have been conducted on the virus and with an estimated approximately 150 million HCV- on the natural diversity of their genome sequence, infected people worldwide. Studies have shown that many relatively little is known about how this virus modulate families had lived previously in landless camping in poor the metabolism of the host and the consequences of hygiene conditions. These adverse conditions favor the these changes at molecular level. Here, we employed a occurrence of infectious diseases such as hepatitis viral proteomic approach using a DIGE-MS/MS analysis to fecal-oral transmission (A and E) and sexual/parenteral (B, C and D). This study aimed to determine the HCV blood donors against twelve HCV infected individuals of infection prevalence, analyze associated risk factors compare plasma proteomic profiles from twelve healthy and also to identify these virus genotypes and subtypes chronic infection. For each group, samples were collected among people living in rural settlement’s in State of Goiás, whichfrom the seven beginning evolved ofto spontaneousthe infection clearance and approximately and five to Central Brazil. A total of 464 settlers were interviewed 24 weeks after. In order to minimize the dynamic range and blood samples were collected. All samples (sera) effect in plasma analysis, samples were depleted from were tested for the presence of antibodies to HCV (anti- HCV) using an enzyme-linked immunosorbent assay chromatography. Proteins were then analyzed by DIGE (ELISA) and immunoblot. Anti-HCV-positive samples theassociated six most with abundant a MALDI-TO/TOF plasma proteins mass using spectrometer. an affinity were submitted to HCV RNA detection by polymerase chain reaction (PCR) with primers complementary to the conserved area of the 5’ non-coding (NC) region Protein identification were performed using the MASCOT of HCV and genotyped by line probe assay (LiPA). This search engine and then filtered to meet at least 95% study was approved by the Ethical and Research of identificationdetected spots confiability in samples using collected the software from the Scaffold. acute the Clinical Hospital of the Federal University of Goiás Thephase results of patients showed who a significant had spontaneous number of clearance differentially and (n.127/2010). The mean age of the study population was chronic infection when compared with controls. A 37.6 years (SD: 19.9 years) and 73.7% had up to nine smaller number of differentially detected spots were years of formal education. Four samples were anti-HCV found in the same patients after six months. There was positive, resulting on a prevalence of 0.9% (95% CI: 0.3- little difference in the number of differentially detected 2.3). Genotyping of HCV RNA positive samples revealed spots among patients in the same group when compared the presence of genotypes, subtype 1a. Individuals reported positive surgical procedures, drug use, blood nine proteins differentially expressed. All of them were transfusions and multiple sexual partners. This research thesynthesized two collection in the liver points. and are We associated were able with to identified the acute showed low prevalence of hepatitis C in the population phase of several pathologies. This work has generated studied. However, epidemiological investigations are an important amount of data related to differentially relevant for analyze the effectiveness of intervention expressed proteins in the plasma of patients with measures for control and prevention of this infection. hepatitis C in different conditions of the illness that Financial support: CNPq of pathophysiology, can contribute to better understand HV399 - Plasma Proteins Profile Of Hepatitis altogether,this disease. in Financial the future, support: associated CNPq with e CAPES. specific studies C Virus Infected Patients Using A Dige-Ms/ Ms Approach HV400 - Study Of The Association Between Trinta, K.S., Brunoro, G.V.F., Lewis-Ximenez, L.L., Lampe, Polymorphisms In The 3’ Utr Region Of E., Perales, J. Cyp2b6 Gene And The Effectiveness Of Anti- Hiv Therapy. 1. Laboratório de Toxinologia, IOC - FIOCRUZ, IOC - Almeida, T.B., Arruda, M., Brindeiro, R.M., Tanuri, A., FIOCRUZ, Av. Brasil, 4365, Manguinhos, Rio de Janeiro. CEP Cardoso, C.C. 21040360 Laboratório de Virologia Molecular - IB - UFRJ, LVM

135 Human Virology: HV

- UFRJ, Av. Carlos Chagas Filho 373, CCS, Bloco A, Sala 121, Alexandre Ferronato, 1200 - Setor Industrial Sul, Sinop - MT, CCS, UFRJ, RJ, Brasil 78550-000 Nearly 8 million HIV+ patients are currently undergoing Arboviruses are zoonoses that depend on animal species HAART (Highly Active Antiretroviral Therapy). However, to replicate and spread within the environment. In terms the treatment is not effective for all these patients, and of public health, the most important arboviruses are the about 10-20% of them do not reach therapeutic success. ones transmitted by mosquitos. Mosquito collection is HAART effectiveness is limited mainly by the emergence an important tool to investigate viral circulation patterns of drug resistant viruses but also by host factors within urban settings and forests. Our goal was to assess affecting drug absorption, activation and metabolism. the presence of arboviruses in mosquitoes collected at Since therapeutic success depends on the maintenance urban/forest transition areas from October 2011 to April of appropriated drug levels, the genes coding for 2012. We used manual aspirators to collect mosquitoes enzymes involved in antiretrovirals (ARVs) metabolism from São José do Rio Preto (SP) and Sinop (MT) which are important candidates for pharmacogenetic studies. are areas with known active arboviral circulation. The The aim of this study was to investigate the association specimens were grouped in pools according to date of between single nucleotide polymorphisms (SNPs) in collection, site, gender and genus/species. Viral RNA was the 3’ UTR region of the gene coding for CYP2B6, which extracted using TRIZOL and the pools were tested with metabolizes efavirenz and nevirapine. For this purpose, a Hemi-Nested-Multiplex-RT-PCR that uses generic and we have conducted a case-control study including 95 HIV+ We collected 302 mosquitoes that were grouped in 141 months, including 33 cases of HAART failure (viral loads > specificpools. More primers than to55% amplify of the Flavivirus samples andwere Alphavirus. analyzed. individuals50 copies/mm3) undergoing and 62 controls first-line with HAART undetectable for at least viral 6 One pool containing Aedes scapularis was positive for loads. Patients were selected from the cities of Curitiba dengue 4 (DENV-4) and six pools were positive for Culex and Porto Alegre. SNP genotyping was performed by direct sequencing. Only 7 SNPs (rs138892132, rs189811422, rs28969429, rs145450819, rs3211391, flavivirusin Aedes (Ochlerotatus) (CxFV). These scapularis.pools were Although sequenced we and cannot the rs28969421 and rs189966711) out of the 56 already resultsdiscuss weredata confirmed.on the competence This is the offirst this report mosquito of DENV as described in CYP2B6 3’UTR were observed in our sample. DENV vector, the report itself is an important warning The SNPs rs145459819 and rs3211391 were absent for the investigation of its role in dengue transmission among controls and excluded from further analysis. dynamics. This prelimary data is also in accordance Results of the logistic regression models showed that with what was found in the city of São José do Rio Preto the G allele at rs189811422 confers protection against HAART failure (OR = 0.33; 95%CI=0.12-0.9; p=0.02 for detected. It is likely that this virus has established a the AG/GG group). These results suggest that SNPs in incontinuous 2007/2008, circulation when the in circulationthe region. ofThe CxFV detection was first of CYP2B6 regulatory region may also affect efavirenz and these viruses in transition areas is extremely useful to nevirapine clearance, probably due to differences in understand the spread of viruses that were primarily gene expression. The data obtained in the present study circulating in urban areas. DENV, which is mainly a reinforce the role of host genetics in HAART effectiveness. disease from urban settings in Brazil, may be radiating to wider areas through other vectors from Aedes genus.

ThisFinancial knowledge support: may CNPq be crucialand FAPERJ. to define better therapy HV403 - ENTROPY LEVEL ON RESISTANCE regimens according to the genetic profile of the patients. POSITIONS OF HEPATITIS C NS3 PROTEIN HV402 - Arbovirus Occurrence Among SUBTYPES 1A AND 1B AGAINST PROTEASE Mosquitoes Collected At Urban/Forest INHIBITORS FROM DIFFERENT GEOGRAPHICAL Transition Areas From São José Do Rio LOCATIONS Preto/Sp And Sinop/Mt (Brazil). Alves, R., Queiroz, A.T.L., Todão, J.S., , De Carvalho, Ozanic, K., Carvalho, C.P.T., Parra, M.C., Pereira, E.F., I.M.V.G. Bronzoni, R.V.M., Nogueira, M.L., Mondini, A. Instituições 1. Faculdade de Medicina de São José do Rio Preto, The hepatitis c virus (HCV) infection is a major public FAMERP, Av. Brigadeiro Faria Lima, 5416 - 150900-000 - São health problem and several new drugs that targets José do Rio Preto, SP 2. Universidade Estadual Paulista, UNESP, Rodovia already approved for use. Clinical trials characterized Araraquara - Jaú Km 1, 14801-902 - Araraquara, SP specificseveral viralmutations proteins associated (DAA) are to ontreatment clinical trialsfailure. or 3. Universidade Federal do Mato Grosso, UFMT, Av. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

136 Human Virology: HV

However, the high mutation rate and HCV quasispecies state of Rio de Janeiro (RJ) in 1986, the DENV-2 (1990), characteristics make it hard to draw any conclusions DENV-3 (2000) and DENV-4 (2011). Between 2000 and about natural polymorphism of patients naive of 2001, the co-circulation of DENV-1, 2 and 3 was oberved, treatment from different geographical locations. To with the latter predominating in the following years. obatain more information 1277 HCV NS3 protein In 2009, DENV-1 re-emerged in several regions of the genotype 1a and 1b sequences from patients without country, including the Southeast. As some samples may expousure to DAA treatment were obtained from be potentially more virulent than others, the impact of LosAlamos and Genbank databases. The datasets were those viruses over the population may be estimated by separated according to geographical location (Europe, monitoring those viruses. Given the re-emergence of USA and Brazil) and subtype (1a and 1b). Phylogenetic DENV-1 in the country, we propose to characterize viral reconstructions were performed for genotypes and strains isolated since this serotype introduction (1986) until the year of 2011. The viruses were isolated in resistance mutations was performed translating nucleic clone C6/36 Aedes albopictus cell culture for extraction geographicalacids sequence confirmation into amino clades.acids. Shannon The analysis entropy of naive was of viral RNA. Overlapping fragments of approximately calculated for every associated resistance position of the protease domain (181 aa) in each geographical group. gene - E) sequencing in both directions on an automated Naive resistance mutations were observed up to 5% at 900sequencer bp were from amplified the PDTIS/IOC for partial Platform. genome (envelopeSequence positions 36, 41, 43, 54, 80, 109, 155, 156 and 168 mixed analysis was performed by Chromas 1:45 software, in all three geographical groups and both genotypes. sequences alignment by CLUSTAL W and phylogenetic analysis by MEGA 5. The results obtained based on the geographical analysis with the highest level on US E gene sequencing showed that DENV-1 strains recently Thegenotype position 1a samples 80 showed (Entropy significant = 0,79309) difference and low-level on the isolated in State of Rio de Janeiro, Espírito Santo, Minas entropy on Brazilian genotype 1a samples (Entropy = Gerais, Mato Grosso do Sul, Alagoas and Ceará, belong to 0,2155). The information complexity of NS3 protein Q80 genotype V (America / Africa), but grouping into distinct position on geographical locations is important to be clades. The analysis of the identity from 495 amino analyzed when compared with the absence of resistance acids (AA) of the E gene demonstrated the presence of mutation Q80K on Brazilian naive samples and the mutations that resulted in changes of AA in domains I high level presence on American and European naive and III of this protein. These changes were conserved samples (Q80K = 36 %). However, all three genotype in the strains of three different lineages characterized 1b geographical groups presented low entropy level of and wer responsible for the differentiation of those in Q80K and a high level of entropy at position 170. This the phylogenetic analysis. The low circulation of DENV-1 high complexity information pattern on that position of and the low percentage of identity of the newly isolated genotype 1b sequences is associated to V170I natural viruses compared to those from the 80s, suggests that polymorphism, not described yet as resistance mutation. the re-emergent DENV- 1 did not evolved locally, but Studies on resistance against the HCV DAA treatments resulted from independent viral introductions in the make it clear that naive patients natural polymorphisms country. Financial support: CNPq, FAPERJ, FIOCRUZ. are associated with discontinuation of treatment and, the different geographical patterns of both subtypes, HV407 - Epidemiological Profile Of Hepatitis raising important questions about the impact that same B In Roraima State Between 2007 And 2012 subtype natural polymorphism in different countries Granja, F., Barros, J.A., Lima Jr., W.P., Ferreira, J.C., Sousa, can have on the protocol of treatment. D.D., Naveca, F.G., Acosta, P.O.A.

HV405 - Twenty-Five Years Of Denv-1 In 1. Universidade Federal de Roraima, UFRR Brazil: Virological And Molecular 2. Laboratório Central de Roraima, LACEN-RR Surveillance Of Strains Isolated Between 3. Intituto leonidas e maria deane, ILMD, Fiocruz 1986 And 2011 The hepatitis B is an infectious disease with high Nogueira, F.B., Dos Santos, F.B., Castro, M.G., Nunes, transmissibility, mobility and lethality, showing as acute P.C.G., Filippis, A.M.B., Faria, N.R.C., Simões, J.B.S., or chronic form, taking the second place among the most Sampaio, S.A., Santos, C.R., Nogueira, R.M.R. frequent viral hepatitis in Roraima State. The objective Instituto Oswaldo Cruz, IOC/FIOCRUZ, Av. Brasil, 4365 - Manguinhos, Rio de Janeiro - RJ, 21040-900 of the hepatitis B carriers at in Roraima between 2007 ofand this 2012. study A descriptive was describe study the was epidemiological made, retrospective, profile In Brazil, the activity of dengue virus (DENV) increased having as source Information SINAN (Sistema de

Septembersignificantly 2013 after Volume the 18 – introduction Supplement 1 - Abstracts/Posters of DENV-1 in - the Human Informação Virology: HV de Agravos de Notificação) of the Health XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

137 Human Virology: HV

Ministry of Brazil. In this period were registered 1812 positive anti-HEV IgM and IgG antibodies. In 2006, a 4 new cases of viral hepatitis which 561 (31%) were years old female presented with unexplained increased hepatitis B. As for the distribution in relation to sex we found that 58,5% of the carriers are men. In relation to rejection, approximately 3 years after a living donor race we found that 59,9% brown; 24,42% caucasian; liver transplantation enzymes and due biopsy to biliary confirmed atresia. acute This scenario cellular 6,06% black; 3,92% indigenous; 1,07% yellow and remained unchanged over 6 years. Anti-HEV IgM and IgG 4,63% without information. The range age predominant tested positive in 2012. Serological tests and biopsy ruled were between 20 and 29 years with 25,5% of the new out hepatitis B virus, hepatitis C virus, cytomegalovirus detected cases, this data can be related to the vaccination and Epstein-Barr virus. Anti-nuclear antibodies also coverage, which has not yet reach the ideal percentage. tested negative. The patient presents with good general Being Roraima an endemic area, all of the hepatitis B state of health, whereas liver enzymes remain elevated carriers are tested to Delta hepatitis, and it showed in to date. The serum sample retrospectively tested for this period a rate of co-infection of 4,92%. Relative to HEV-RNA was obtained in 2012, when the patient was the Roraima States counties, Mucajaí showed its highest admitted at the hospital for a follow-up biopsy. The HEV rates of detection in 2012 with 117/100.000 habitants, strain isolated in this study using a sequence analysis of followed by Caracaraí and Boa Vista with similar a 304-nt ORF2 fragment (Brazilh4, GenBank accession detection rates of 26/100.000 habitants. Although number KF152884) shares 87–93% homology to recent advances in relation to diagnosis, treatment and sequences of human HEV previously characterized by prophylaxis of hepatitis B, it remains as an important our group in Brazil, and 83–97% homology to swine health public problem in current days. This information HEV from Brazil. Phylogenetic analysis revealed this human HEV strain clustered together with strains to reduce the negative impact of the infection, looking characterized as genotype 3 subtype 3b. In conclusion, canfor thehelp reduction in definition of new and cases, implementation noticing the of vaccination measures HEV infection should be incorporated in the differential coverage, and helping the planning of actions to disease diagnosis of acute hepatitis and acute cellular rejection control as way to reduce global effects of this serious among liver transplant recipients, including pediatric health problem. patients. Financial support: FAPESP 2012/22925-3 e 2013/03701-0 HV416 - First Report And Molecular Characterization Of An Autochthonous HV424 - Characterization Of Recombinant Hepatitis E Virus Genotype 3 Infection In Hepatitis A Virus-Like Particles For A 10 Years Old Female Liver Transplant Diagnosis Kit Development Recipient In Brazil Caiado, B.V.R., Sena, J., Sousa, R.C.V., Pacheco, M.F.T., Passos, A.M., Pelegrini, A., Porta, G., Miura, I.K., Pugliese, Marques, E.T.A., Dhalia, R. R.P.S., Danesi, V.L.B., Porta, A., Guimarães, T., Seda, J., Antunes, E., Granato, C.F.H. 1. Universidade Federal de Pernambuco, UFPE, Av. Prof. Moraes Rego, 1235 - Cidade Universitária, Recife - PE - 1. Disciplina de Infectologia, Escola Paulista de CEP: 50670-901 Medicina, EPM-UNIFESP, São Paulo, SP, Brazil 2. University of Pittsburgh, , PA, USA 2. Grupo Fleury SA, , São Paulo, SP, Brazil 3. Faculdade Maurício de Nassau 3. A.C.Camargo Cancer Center, , São Paulo, SP, Brazil 4. Centro de Pesquisas Aggeu Magalhães, CPqAM/ Hepatitis E virus (HEV) causes acute and chronic FIOCRUZ, Av. Professor Moraes Rego, s/n – Cidade hepatitis in organ transplant recipients. Serological Universitária – Recife/PE . CEP 50.670-4 evidence for HEV infection has been demonstrated in Hepatitis A virus (HAV) is the main form of acute various population groups in Brazil, and only a few viral hepatitis worldwide, constituting an important health problem. In order to monitoring/control HAV immunocompromised patients. To date, however, no transmission, it is critical to differentiate HAV from other acutecases of cases HEV have infection been in confirmed children amonghave been healthy reported and liver-affecting diseases. Commercial diagnostic kits in Brazil. This study aimed to identify and characterize available are based in inactivated HAV that grows very the presence of HEV-RNA among patients referred to slowly, in cell culture, limiting antigens production. An a clinical laboratory to perform anti-HEV antibodies attractive strategy to increase viral antigens production tests. A retrospective study was performed on 54 is the expression of virus-like particles (VLPs). The HAV serum samples previously subjected to ELISA test for genome is encoded in a single-stranded RNA molecule anti-HEV antibodies in 2012. HEV-RNA was detected coding for 4 structural proteins (VP4-VP2-VP3-VP1) and

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - trough Real-Time RT-PCR in one confirmed case, withHuman Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

138 Human Virology: HV

7 non-structural proteins (2A-2B-2C-3A-3B-3C-3D) that is a phosphorylated and glycosylated protein that acts as are expressed as a polyprotein precursor, lately converted a kinase and can bind to RNA; along with NSP2, form the to individual proteins mainly by 3C viral protease viroplasm interacting with VP2 and NSP6. Until now, 11 cleavage. Here we described three different approaches NSP5 genotypes (H1-H11) were established. The aim to generate HAV-VLPs in recombinant baculovirus of this study was to investigate the genetic diversity systems: 1- expression of all structural proteins fused to of NSP5 gene from RVA detected in children in the 2A and 3C, interspaced by a DNA spacer (VP4-VP2-VP3- Triangulo Mineiro region, Brazil, period 2005 to 2011. VP1-2A-DNA spacer-3C); 2- expression of all structural Twenty-six rotavirus samples were selected, submitted proteins (VP4-VP2-VP3-VP1) and 3C, using bicistronic vector; 3- expression of VP4-VP2 and VP3-2A (from followed by sequencing and phylogenetic analysis. Long Foot-and-Mouth Disease Virus – FMDV)-VP1-2A, also toelectropherotype nucleic acid extraction, samples NSP5 clustered amplification into three by RT-PCR,distinct using bicistronic vector. Synthetic baculovirus optimized NSP5 genotypes: eight samples clustered within the DNAs coding for all strategies were chemically produced, branch H1 and were found to be associated with G1P[8], cloned and used to generate recombinant bacmids by G9P[8] and G12P[8]; other 2 samples fell into H6 branch site directed transposition. Bacmids were screened by and were associated with G12Pnon-typed(NT) and one sample clustered within the branch H3, associated to transfect Spodoptera frugiperda 9 (Sf9) insect cells, PCRin order to confirm to generate corrected recombinant integration baculovirus. and after Currentlythat used clustered within the branch H2 and were associated all cloning strategies were obtained, and bacmids were with G2P[4] G3P4. Theand fifteenG8P[4]. short Triangulo electropherotype Mineiro H1 and strains H2 genotypes samples split equally into two sub-clusters already have recovered baculovirus. For the next step, distinct from prototypes strains; interestingly one clade successfullywe are planning recovered. to infect For Sf9 the cells first in order strategy to generate we also of H2 strains were formed by samples from 2006 to baculovirus from the second and third strategies. 2008 years and the other by strains from 2008-2010. H6 wild type samples showed close relationship with a trough sucrose gradient sedimentation and electronic strain from Paraguay. H3 was closely related with a cat Obtainedmicroscopy, VLPs respectively. are going to Finally be purified all VLPs and are characterized going to be RVA from Italy and another Brazilian human strain. This validated in terms of immunogenicity, using referenced study provides valuable information for understanding HAV human sera panels, aiming to develop a VLP-based the diversity and evolution of RVA strains which is diagnosis kit. Financial support: FIOCRUZ-PE, CNPq and of great importance for current vaccination national CAPES. program. Financial support: Plataforma sequenciamento ILMD-Fiocruz Amazonia, FUNEPU HV427 - Phylogenetic Analysis Of Nsp5 Gene From Group A Rotavirus Detected In HV429 - Hepatitis Delta Virus (Hdv) Cases Of Infantile Diarrhea In Triângulo Prevalence Among Blood Donors In Mineiro Region, Brazil, From 2005 To 2011 Luanda, Angola Dulgheroff, A.C.B., Silva, G.A.V., Naveca, F.G., Domingues, Savassi-Ribas, F., Spitz, N.T.D., Borges, L.F., Varella, R.B., A.L.S. Gomes, S.A., Soares, C.C. 1. Universidade Federal do Triângulo Mineiro, UFTM, 1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, Av. Frei Paulino, 30. Bairro: Abadia, Uberaba-MG 4365, Manguinhos, Rio de Janeiro/RJ, CEP 21040-900 2. Instituto Leônidas e Maria Deane - Fiocruz - 2. Universidade Federal do Rio de Janeiro, UFRJ Amazônia, ILMD - Fiocruz HDV is a subviral pathogen of humans, a satellite of Rotavirus A (RVA) is the main cause of acute gastroenteritis hepatitis B virus (HBV) that depends on the envelope in children worldwide and a monovalent vaccine against protein of HBV for its assembly and propagation. HDV is rotavirus (G1P[8]) was introduced into the brazilian highly endemic in Mediterranean coutries, Middle East, immunization program since 2006. Rotavirus genome Central Africa and northern parts of South America. Of consists of 11 segments of double-stranded RNA and the 240 million chronic carriers of HBV worldwide, more particles are formed by a triple capsid, where the outer than 15 million have serological evidence of exposure layer is composed of VP4 and VP7 proteins encoded to HDV. Although Africa is considered an endemic by the fourth and ninth genomic segments, used in region for this infection, for many countries, there is no available data in the literature. The aim of this study was to investigate the seroepidemiological and molecular aon dual characterization classification of system11 segments to define of RVA P was and proposed. G types, respectively.Non-structural Recently, protein a 5 new (NSP5), classification encoded by system segment based 11 213 serum samples and 151 whole blood samples were profile of HDV in blood donors from Luanda, Angola. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

139 Human Virology: HV analyzed. Originally, samples were subjected to HBsAg detection by polymerase chain reaction (PCR) and detection. HBsAg was found in 19.2% (41/213) and genotyped by the Line Probe Assay (LiPA). The HCV 9.3% (14/151), respectively. All reactive samples were infection prevalence was 0.9% (95% CI: 0.22 to 2.7) in tested for anti-HDV and positive were tested for HDAg. patients with diseases onco-hematological. The viral Blood samples were not tested for HDV markers. Of the RNA was detected in 0.57% (2/3) of anti-HCV positive 41 HBsAg positive serum samples, 22% (9/41) were anti-HDV positive and 43.9% (18/41) were in the gray in the study population. Risk characteristics, reported zone. HDAg was detected in two anti-HDV positive samples,by individuals and the anti-HCV genotype/subtype positive, use 1b,non-injecting were identified drug samples. Anti-HDV positive and HBsAg reactive samples use, blood transfusion before 1994, tattooing, surgery were subjected to RT-PCR for viral RNA detection, which and multiple sexual partners. This research showed was not found in any sample. Our results shows a still low prevalence of hepatitis C in the population studied. high prevalence of HBV in Angolan general population However, epidemiological investigations are relevant for and also describes a high seroprevalence of HDV among analyze the effectiveness of intervention measures for these HBsAg carriers. Studies about HDV epidemiology in control and prevention of this infection. sub-Saharan countries are scarce, these data contributes for a better understanding of HDV circulation in African HV431 - Lamivudine-Resistant Mutations continent. Financial support: Cnpq and FIOCRUZ (Rtl180m/M204v) In Recombinant Of Hepatitis B Virus (Hbv) Genotypes A/G From HV430 - Prevalence Of Hepatitis C Virus Treatment-Naïve Patient With Chronic Infection In Patients With Disorder Onco- And Occult Hbv Infection Hematological In Central Brazil Barros, J.J.F., Lewis-Ximenez, L.L., Peres, L.R., Sousa, Marinho, T.A., Pessoni, G.C., De Moraes, A.A., Dos P.S.F., Mello, F.C.A., Gomes, S.A., Moraes, M.T.B. Santos, M.A.C., Teles, S.A., De Matos, M.A.D., Martins, R.M.B., Da Silva, L.N., De Oliveira, M.P., Tamíris, A.M., 1. Fundação Oswaldo Cruz/Instituto Oswaldo Cruz, Kozlowski, A.G. FIOCRUZ/IOC, Av. Brasil, 4365, Manguinhos - Rio de Janeiro - RJ - Brasil CEP: 21040-360 1. Instituto de Patologia Tropical e Saúde Pública, 2. 1Laboratório de Virologia Molecular, Instituto IPTSP-UFG Oswaldo Cruz,, LVM, Pavilhão Hélio e Peggy Perreira (HPP), 2. Faculdade de Enfermagem, FEN-UFG sala B15 3. Associação de Combate ao Câncer de Goiás, ACCG- 3. Ambulatório de Hepatites Virais, Laboratório de HAJ Hepatites Vi, , Pavilhão 108 4. Universidade Federal de Goiás, UFG Chronic hepatitis B virus (HBV) infection is a serious According to the World Health Organization (WHO), global health problem an important cause of morbidity approximately 150 million people are chronically and mortality in endemic areas. Approximately 2 billion infected with hepatitis C virus (HCV) and 350 million people in the world have been infected by HBV and people die each year from liver complications related nearly 400 million individuals worldwide have been to infection. HCV, as well as hepatotropic can infect infected with chronic hepatitis B virus (HBV). Occult HBV and replicate in peripheral blood lymphocytes and mononuclear cells can induce a weak disorder onco- absence of surface antigen (HBsAg, the main serological hematological. As the etiology of most diseases infectionmarker of is active defined infection). by detectable The cause HBV of genome an overt in HBV the onco-hematological is still unknown, some authors infection becoming an occult one is unknown. Drug have suggested the role of this virus in the genesis resistance in hepatitis B virus (HBV) patients treated with of lymphomas. This study aimed to investigate the Nas (nucleotide analogues), such as, lamivudine (LAM) has been associated with the emergence of polymerase among patients with disorder onco-hematological gene mutations within the Reverse-transcriptase (RT) seroepidemiologicalattended at two hospitals profile in ofreference the hepatitis to the C treatment infection region. In this study, a recombinant of HBV A/G for S of these diseases (Hospital Araujo Jorge e Hospital das region presenting primary LAM-resistance mutation Clinicas) in Goiania, Goias. A total of 350 patients were (rtM204V) and rtL180M isolated from a treatment- interviewed for socio-demogrphic characteristics and naïve patient with occult HBV infection is reported. The risk factors for HCV infection. Blood samples were patient was a 23-year-old Brazilian male with classical collected and sera were tested for the presence of acute infection (seropositive for HBsAg, HBeAg and antibodies to HCV (anti-HCV) using an enzyme-linked anti-HBc in 10/2008. After six months, all serological immunosorbent assay (ELISA) and immunoblot. The markers became negative except anti-HBc but HBV anti-HCV positive samples were submitted to HCV RNA September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

140 Human Virology: HV

Nested Multiplex PCR protocol directed against outer patient was monitored for HBV markers for about three capsid protein genes VP4 and VP7 were conducted for DNAyears was with detectable a total of in14 low serial titles serum <104 samples copies/mL. available. This RVA genotype determination. VP4 and VP7 consensual Genomic regions of S, pre-C and C genes were PCR fragment of the positive samples were sequenced and phylogenetic analysis were carried out in order to subjected to pyrosequencing to verify the presence of amplified,mixture of genotypes. followed by Phylogenetic nucleotide sequencingtrees of HBV and isolates also showed that 39% were positive for RVA (n=48). Until were obtained using the Neighbor Joining Method and confirmnow, thirty-eight the genotypes. DNA RT-PCRsequence analysis were obtainedof the samples from recombination analysis was carried out using SIMPLOT RVA RT-PCR positive samples (1ST round consensual version 3.5.1. In this study we describe HBV recombinant fragment of VP7 and/or VP4 genes). The Phylogenetic of genotypes A/G in the S gene during occult infection. analysis revealed the following genotypes distribution: Mutations were found at codon (or AA) rtL180M/ P[4]G2 (n=9), P[8]G2 (n=4), P[8]G3 (n=1), P[8]G12 M204V motif in the RT domain of the HBV polymerase (n=1), P[ND*]G2 (n=14), P[4]GND (n=4), P[8]GND (n=5). for two recombinant A/G subgenotypes during occult infection, although the patient was treatment naïve. The the circulation of RVA in the North region of Uruguay. results obtained from pyrosequencing analysis suggest TheseInterestingly, results ourrepresent data revealed the first a studieshigh prevalence demonstrating of G2 the transmission of the HBV recombinant A / G occurred during the chronic phase of infection. Since the HBV G12 in our country. * (ND = Not-determined) Financial surface and polymerase genes overlap, mutations in the andsupport: the firstPDU, identificationUdelaR. of emerging genotype P[8] RT domain can affect the amino acid sequences of the HBsAg protein, especially the “a” determinant or T-cell HV439 - Evaluation Of Dengue Viral Load On epitope, leading to alterations of immunogenicity and Different Days After Disease Onset can lead to chronic disease. HBV molecular monitoring Silva, F.M.F., Castro-Jorge, L.A., Feitosa, A.L.P., Abrão, should be employed for an adequate management in E.P., Sobral, M.C.M., Espósito, D.L., Romano-Passos, L.M., HBV occult infection. Fonseca, B.A.L.

HV432 - Molecular Characterization 1. Health Center of Sumarezinho, CSE Sumarezinho, Of Rotavirus From Patients With Acute 2. School of Medicine of Ribeirão Preto, FMRP, USP, Av. Gastroenteritis In Salto City, North Bandeirantes, 3900 - Monte Alegre - CEP: 14049-900 Uruguay Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain, A., problem in tropical and subtropical regions of the world. Arreseigor, E., Lopez, P., Cristina, J., Leite, J.P.G., Colina, Dengue pathogenesis virus (DENV) is iscomplex a significant and the public relationship health R. between viral and host factors involved in dengue severity 1. University of Republic, UDELAR, 1350, Gral. Rivera remains unclear. The present study aimed at to evaluate st the magnitude of dengue viral load on samples collected 2. Centro de Investigaciones Nucleares - UdelaR, UdelaR at different days after onset of symptoms. Samples were collected from 316 patients attended at Health Centers 3. Salto Public Hospital, MSP of Ribeirao Preto city (Sao Paulo, Brazil) from 2007 to 4. Fundacao Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365, 2011. NS1 viral protein or IgM antibodies and genome Manguinhos, 21040-360, Rio de Janeiro, Brazil Group A Rotavirus (RVA), are the major cause of acute detectionusing the QuantiTect were used Virus to kit confirm (QIAGEN). dengue Analyzing infection. the worldwide. RVA are the leading cause of hospitalization Dengueviral load virus according genome to was the dayamplified after disease by real timeonset, RT-PCR it was gastroenteritisand death due to (AG) AG inamong children infants under of this five age years group, old observed a clear difference between days 0 to 4, and after mostly in developing countries. In this study, we analyzed day 5, coinciding with the initial proposal to divide the clinical samples of young children (between 0 and 5 years disease course in the acute phase (0 to 4 days after onset old) with AG who were treated in two health institutions of symptoms) and recovery (after 5 days). Evaluating of Salto city, Uruguay: Salto Public Hospital and Salto the viral load of each individual serotype, it was possible Medical Center. 136 clinical samples were collected from to observe a clear difference between the two stages of February 2011 to June 2012. 119 of them were fecal the disease. DENV-1 and 3 showed the largest difference material and 17 were vomit. Viral RNA extraction was performed by commercial kit according to manufactures instructions and cDNA was generated using random betweenconclude thethat, two independent phases (p <0.0001).of the serotype, DENV-2 the showed viral lessload ofin a DENV-infecteddifference, but stillpatients significant falls quickly (p = 0.0220). after theWe

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV hexamer primers. Worldwide standardized specific XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

141 Human Virology: HV

gastroenteritis, contributing to a better monitoring and to investigate the association of viral load with dengue control of these infections. Financial support: FUNEPU/ fifthseverity, day viralof symptoms load must onset always (convalescent be considered phase). separately Thus, UFTM, FAPEMIG, Plataforma sequenciamento ILMD- in two stages of the disease. Financial Support: FAPESP, Fiocruz Amazonia. CNPq. HV445 - Seroepidemiological Evaluation Of HV440 - Genetic Diversity Of Noroviruses Hbv, Hcv And Hiv In An Institutionalized Associated With Infantile Gastroenteritis Population Of Goiás, Brazil In Triangulo Mineiro Region, Brazil. Cunha, M.P., Moraes, T.C., Castro, I.A., Souza, T.C.D., Figueiredo, E.F., Dulgheroff, A.C.B.,Silva, G.A.V., Naveca, Souza, M.B.L.D., Cardoso, D.D.P., Fiaccadori, F.S. F.G., Domingues, A.L.S. IPTSP / Universidade Federal de Goiás, IPTSP / UFG, 1. Universidade Federal do Triângulo Mineiro, UFTM, Rua 255, esquina com 1° Avenida, 3° Andar, Sala 420, Setor Pça. Manoel Terra, 330, Uberaba, MG, CEP38025-015, Leste Universitário Microbiologia/DMIP/ICBN The hepatitis B virus (HBV), hepatitis C virus (HCV) and 2. Instituto Leônidas e Maria Deane - Fiocruz - Amazônia, ILMD-FIOCRUZ, Rua Terezina, 476, Manaus - mainly by vertical, parenteral and sexual routes, and AM, CEP: 69057070, Lab. de Biodiversidade em Saúde humaninfection immunodeficiency by these agents remains virus (HIV) an important are transmitted health Enteric adenoviruses and astroviruses are agents of problem worldwide. In this context, institutionalized diarrheal disease, a common cause of morbidity and individuals with mental problems constitute a risk mortality in developing countries. Adenoviruses are group for acquisition of HBV, HCV and HIV infection due nonenveloped, double-stranded DNA viruses, members to their low awareness of the risks of viral infection, of the family Adenoviridae, genus Mastadenovirus. and also because of their prolonged stay in long-term facilities. Therefore, the main purpose of this study adenoviruses are members of subgroup F, serotypes was to determine the prevalence of HBV, HCV and HIV They40 and are 41. classified Astroviruses into are 6 subgroups nonenveloped (A to viruses F); enteric with serological markers in an institutionalized population positive sense single-stranded RNA genome, members with psychiatric and neurological disorders, located in of Astroviridae family, genus Mamastrovirus; human the State of Goiás, Brazil. Blood samples were collected from 333 participants, and the sera were analyzed for 8). Informations on variability of these agents are scarce the presence of serological markers of HBV (HBsAg, astrovirusesin Brazil, so havethe aim been of classified this study in eightwas toserotypes characterize (1 to anti-HBsAg, anti-HBc), HCV (anti-HCV) and HIV (anti- and analyze the genetic diversity of Adenoviruses and HIV) infection, by enzyme-linked immunosorbent assay, Astroviruses detected in fecal samples from cases of using commercial kits. The overall prevalence for HBV infantile gastroenteritis occurred in the Triangulo infection was 12.9% (43/333) and for HIV was 0.63% Mineiro region, MG, from 2006 to 2010. Twelve samples (2/313), none of the samples was positive for anti-HCV. positive for astrovirus and thirty three samples positive Only 4.2% (14/333) of the population had serological for adenovirus were subjected to nucleic acid extraction, evidence of previous vaccination against hepatitis B virus. The susceptibility to HBV, characterized by the sequences were compared to that from reference and absence of all serological markers, was observed in amplification by RT/PCR and sequencing. The viral 82% of the population. Only one sample positive for obtained from GenBank and submitted to phylogenetic anti-HIV was also positive for anti-HBc and anti-HBe. fieldanalysis. strains Partial circulating sequence in Brazil from andadenovirus other countries, hexon The results from this study reveal the presence of HBV protein gene has been determined and samples were and HIV serological markers in the population studied, demonstrating the importance of the development of subgroups F, C, B, E and A. Adenoviruses type F were the strategies for prevention and care for these infections in dividedmost prevalent into five (60.6%); different viruses clusters of types corresponding C (21.2%) and to long-term facilities. B (12.2%) represent the second and third types most HV447 - Neutralizing Antibodies For commonly found in these samples. Astrovirus samples Mayaro Virus In Horses From The Pantanal clustered into three classic groups: seven samples Wetlands, Brazil clustered within the branch corresponding to serotype Pauvolid-Corrêa, A., Juliano, R., Velez, J., Schatzmayr, H., 1; four samples fell into branch of serotype 2 and one Nogueira, R.M.R., Komar, N. sample clustered within the branch of serotype 3. These results provide information on the genetic diversity 1. Empresa Brasileira de Pesquisa Agropecuária of viral agents and aspects associated with infantile September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

142 Human Virology: HV

Pantanal, Embrapa Pantanal, Rua 21 de Setembro 1880, HV453 - Detection Of Respiratory Virus Corumbá, MS 79329-900, Brasil And S. Pneumoniae In Pediatric Patients 2. Fundação Oswaldo Cruz, Fiocruz, Av. Brasil 4365, Attended In A Terciary Hospital Of Rio de Janeiro, RJ 21045-900, Brasil Fortaleza- Ceará Post Pneumococcal 3. Centers for Disease Control and Prevention, CDC, Conjugate Vaccine (10-Valent) Silva, F.E.R., Oliveira, N.S., Ocadaque, C.J., Alves, A.A., 3150 Rampart Road Ft. Collins, CO 80521, United States Moura, F.E.A. The Brazilian Pantanal hosts large concentrations of Universiade Federal do Ceará, UFC, R. Cel Nunes de diverse wildlife species, including migratory birds, and therefore this region is potentially important for arbovirus Melo, 1315 Cep 60430-270 Rodolfo Teófilo Fortaleza - Ceará studies in South America. Neutralizing antibodies for Pneumonia is responsible for high rates of mortality equine encephalitis viruses have been reported in in infants and toddlers in developing countries with Pantanal equines. To better understand the alphavirus nearly 1,4 million deaths annually. Pneumococcal circulation in the region, a serosurvey for Mayaro virus pneumonia is responsible for many of these deaths. The (MAYV) was conducted with 760 equines from 15 beef pneumococcal conjugate vaccine (10-valent) is included cattle ranches of the Brazilian Pantanal. The sera were in the childhood immunization schedule of the Health titrated by 90% plaque-reduction neutralization test Ministery since March of 2010. The present study has as (PRNT90) for MAYV and the positive samples then objectives: (1) Identify the respiratory virus and the S. tested for three other alphaviruses previously reported pneumoniae serotypes in the nasopharyngeal aspirates in Brazil, including Eastern equine encephalitis virus of patients attended for pneumonia in the Hospital (EEEV), Western equine encephalitis virus (WEEV) Infantil Albert Sabin from January of 2011 to May of 2013 and Venezuelan equine encephalitis virus. Serum was (2) Compare the S. pneumoniae circulating serotypes in considered seropositive when it reduced at least 90% the study population with the ones within the vaccine. of the formation of plaques of MAYV and its neutralizing Methodology: The viruses were detected through antibody titre was four-fold greater than what was observed for the other tested alphaviruses. From a total were isolated in sheep blood agar with gentamicin for of 760 equines, of which 277 were immunized with indirectposterior immunofluorescence serotyping through andmultiplex the S. PCR. pneumoniae During bivalent vaccine composed of EEEV and WEEV and 483 this period 674 samples were collected in which were were unvaccinated, 45 (5.9%) had neutralizing reactivity virus in 189 samples (28.04%) and co-infection of S. status. Employing the criterion of four-fold greater titre identifiedpneumoniae 172 and S. virus pneumoniae in 41 samples (25.52%), (6.08%). at leastThe most one (PRNT90among all titrealphaviruses ≥ 1:10) fortested, MAYV four regardless (0.5%) horses of vaccine from detected virus were the Respiratory Sincicial Virus (126 three different ranches and with no history of equine encephalitis viruses vaccination were seropositive for – 5.79%) and Adenovirus (28 samples – 4.15%). Among MAYV. Three out of four MAYV-seropositive horses had samplesthe 39 serotypes – 18.69%), of S.followed pneumoniae by Influenza researched, A (39 the samples most monotypic neutralization reactions, with PRNT90 titre found were 6A/B, 14, 19 A and 19F with 22%, 6.9%, 6.3% and 4.4%, respectively. Between the four main tested. While a serosurvey of non-human primates and/ serotypes of S. pneumoniae found, three (6B, 14 and 1:40or local for human MAYV andresidents < 1:10 would for all be other more alphaviruses instructive 19F) are present in the pneumococcal conjugate vaccine for MAYV studies, due to the conservative criteria used (10-valent) composed by the serotypes 1, 4, 5, 6B, 7F, 9V, for interpreting serologic results, we consider that the 14, 18C, 19F and 23F. Financial support: CNPq e FUNCAP detection of monotypic neutralization reactions to MAYV – PPSUS 2009 in Pantanal horses, which lacked travel history outside the region, is evidence of MAYV circulation in the region. HV454 - Comparative Study Of Nosocomial Because cross-reactivity among arboviruses may occur, Infections Viral Detection In Young we encourage more encompassing serosurveys using Children In Fortaleza- Ceará, Brazil. other Brazilian alphaviruses, including Pixuna and Oliveira, S.B., Ocadaque, C.J., Alves, A.A., ‘, Thomazelli, Mucambo viruses, as well as efforts to isolate virus to L.M., Durigon, E.L., Moura, F.E.A. and consequently, identify vectors and vertebrate hosts 1. Universidade Federal do Ceará, UFC, R. Cel Nunes definitivelythat are involved confirm in thethe circulation its local maintenance of MAYV in the cycle region, and de Melo,1315. Cep:60430-270 Rodolfo Teófilo - Fortaleza -CE transmission. Financial support: CNPq, CAPES, Fulbright 2. Universidade de São Paulo, USP, Av. Prof. Lineu Prestes, 1374, Cidade Universitária-São Paulo-SP. Cep: 05508-900

143 Human Virology: HV

Laboratory tests are extremely important in the predominantly represented by males (66.24%) and respiratory infections. There is great diversity of admission diagnostic in NRI cases were pneumonia correctdiagnosis etiology methods identification that include ofmolecular the viral and nosocomial immune child(40%), in theneurologic first year ofdisease life (42.85%). (13.33%), The mostosteomyelitis frequent techniques available. The objective of this study was (8.33%) and surgery (8,33%). The main symptoms to perform the comparison between the results of the observed in the patients with NRI were coughing (94.80%), coryza (68.83%), fever (66.23%), nasal in the investigation of respiratory viruses in samples of obstruction (51.94%), dyspneia (50.64%) and sneezing indirectnasopharyngeal immunofluorescence aspirates of patientsassay (IFA) with and nosocomial qRT-PCR (48.05%). The presence of several associated symptoms respiratory infection attended in wards of the Hospital was frequent. Out of the total, 71.67% of the NRI were Infantil Albert Sabin in the year of 2013. Methodology: diagnosed as upper respiratory tract infections of which samples were analyzed by IFA and qRT-PCR for research 40% of the patients manifested symptoms during the of respiratory syncytial virus (HRSV), adenovirus the understanding of the role of viruses in the etiology of firstthe NRI week in a of country hospitalization. where the Theimportance study contributes of this theme to (HAdV),(56,66%) influenza for at least A andone virus B (FluA which and 17 FluB). were Outfor HRSV, of 60 is underestimated. Financial support: UFC. analysed2 for Ad, samples,13 for FluA, IFA noneidentified for FluB 34/60 and positive 3 coinfections: samples FluA+ HAdV, FluA+FluB, FluA + HRSV. The qRT-PCR HV458 - Detection Of Human Rhinovirus assay detected 52/60 positive samples for at least one And Coronavirus In The Infant Pneumonia virus (86,66%); 23 HRSV, 4 HAdV, 8 FluA, none FluB and In An Equatorial City Of Brazil 17 co-infections which were represented by HRSV+FluA Florêncio, C.M.G.D., Oliveira, F.M.S., Silva, F.E.R., (6/17), HRSV+ HAdV (5/17), HRSV+FluA+ HAdV (4/17) Durigon, E.L., Thomazelli, L.M., Moura, F.E.A. and HAdV +FluA (2/17). Overall, the rate of detection 1. Universidade Federal do Ceará, UFC, R. Cel Nunes of viruses increased 30% with use of qPCR. There are de Melo, 1315 Cep 60430-270 Rodolfo Teófilo Fortaleza - few published studies on viral respiratory nosocomial infections in Brazil, therefore the choice of good method Ceará 2. Universidade de São Paulo, USP, Av. Prof Lineu Financial support: USP, UFC. Prestes,1374,sl 225,Cid. Universitária São Paulo SP Cep is crucial for the identification of the viruses involved. 05508-900 HV457 - Epidemiological And Clinical Profile Of Viral Nosocomial Respiratory Pneumonia is important cause of morbidity and Infections In A Children’s Terciary mortality in young children, mainly in developing Hospital In Fortaleza –Ce, Brazil. countries. The respiratory viruses are noteworthy as Oliveira, S.B., Ocadaque, C.J., Alves, A.A., Florêncio, etiologic agents of this disease. The human rhinovirus C.M.G.D., Moura, F.E.A. (HRV) and coronavirus (HCoV) are associated generally to common colds, but its role in the etiology of Universidade Federal do Ceará, UFC, R. Cel Nunes de pneumonia has been reported in some recent studies. Melo,1315. Cep:60430-270 Rodolfo Teófilo - Fortaleza -Ce Nasopharyngeal aspirate were collected from children with pneumonia attended in the emergency rooms Nosocomial respiratory infections (NRI) constitute a and pediatric ward of Hospital Infantil Albert Sabin in serious public health problem. The main objective of Fortaleza,Ceará (Northeast Brazil), from January 2011 to this study was to identify the respiratory viruses in the October 2012. The samples were submitted to indirect nasopharyngeal aspirates of children hospitalized that presented NRI in the wards of a children’s hospital in Fortaleza, from January to May of 2013. Metodology: immunofluorescence assays to detect seven respiratory virusessamples (respiratory for this test weresyncytial selected virus, and influenza submitted A and at the B, detect Respiratory Sincytyal virus (HRSV), Adenovirus adenovirusreal time- PCR and (qPCR) parainfluenza for HRV 1,and 2 forand all 3). four The serotypes negative Indirect immunofluorescence assay was carried out to of HCoV (OC43, NL63, 229E e HKU1). A total of 425 (PIV1,2,3) antigens. Results: 77 samples were collected samples were analyzed for qPCR resulting in 142 positive (HAdV),and 46 (59.74%) Influenza of (FluA them e were FluB) positive and Parainfluenza for at least samples for HRV (33,4%) and 84 positive samples for one virus. HRSV (20/46) and the FluA (13/46) were HCoV (19,7%). Twenty cases of co-infection HRV-HCOV predominant over the other researched viruses. There were seven cases of co-infection: HAdV + PIV3 (2 emphasize the importance of the HRV and HCoV in the cases), HRSV+PIV3 (2 cases); FluA+FluB, HAdV +FluA, wereetiology observed of childhood in the samplespneumonia analyzed. as single These agent findings or in RSV+FluA (one case each). The study population was

144 Human Virology: HV co-infection. Financial support: CNPq e FUNCAP-PPSUS Conventional Rt-Pcr For Dengue Virus 2009 Detection In Distinct Periods Of Dengue Infections. HV467 - Preliminary Analysis Of Panbio Abrão, E.P., Silva, F.M.F., Castro-Jorge, L.A., Feitosa, A.L.P., Dengue Elisa Kit In The Detection Of Ns1 Sobral, M.C.M., Espósito, D.L., Fonseca, B.A.L. Antigen In Association With Igm Elisa Costa, V.G., Policarpo, O.F., Novaes, D.P.S., Moreli, M.L. 1. Fac Med Rib Preto - Universidade de São Paulo , FMRP - USP, Av. Bandeirantes 3900, 14049-900, Centro de 1. Laboratório de Virologia, Universidade Federal de Pesquisa em Virologia Goiás, UFG, Rodovia BR 364, km 192, Parque Industrial, 2. Health Center of Sumarezinho, Ribeirão Preto, SP, 3.800, Jataí-GO Brazil 2. Laboratorio Elzevir Ferreira Lima, , Rua Joaquim Caetano esq/Rua Caçu, Setor Divino Espirito Santo, Jatai -GO Background: Dengue is the most important arthropod- borne disease in the tropical and subtropical areas Dengue is a re-emergent disease, and it is one of the worldwide. Dengue results from any of the dengue major public health concerns in the world. The estimate virus (DENV) infection and is characterized by a is that annually 230 million cases take place, resulting in broad spectrum of clinical manifestations, ranging from asymptomatic infection to severe dengue. Aim: genus, is an increasing endemy in Brazil; therefore, it The present study aimed to compare two molecular 21.000triggers deaths major per national year. Dengue public virushealth (DENV), campaign flavivirus that techniques (conventional RT-PCR and real time RT- focuses on the control of its main transmitter, known PCR) for the detection of DENV in samples collected as Aedes aegypti mosquito. This vector is today found from patients in different periods of disease onset. all over the country. DENV is able to affect anyone and Methodology: Samples were collected from 273 patients attended at the Health Centers of Ribeirao Preto city (Sao for control purposes. Here, study aimed to report on Paulo, Brazil) with a probable diagnosis of dengue. Blood doesthe performance not have a specific of commercial treatment dengue or available NS1 detection vaccine samples were forwarded to the Laboratory of Molecular test in samples collected belatedly and in combination Virology for dengue diagnosis up to 8 days from the with a dengue IgM ELISA. The study site was in Jataí county, state of Goias, which recently reported a by a conventional RT-PCR (Lanciotti et al., 1992) and dengue epidemic. The samples were available from the beginningby an in-house of the real-timedisease. DENV RT-PCR genomes using thewere QuantiTect amplified serum bank of the medical center municipal health by Virus kit (Qiagen) and detected according each method. permission of responsible. Subsequently, the samples Results: The real-time RT-PCR assay was able to detect suspected dengue, and collected from the sixth day of up to an equivalent of 10 RNA copies for all the tested symptom onset were processed by ELISA Dengue NS1 serotypes. Particularly in DENV-1 and DENV-3 samples and IgM ELISA in the laboratory of Virology, Federal it was possible to detect as few as 4 RNA copies. Due to University of Goiás. So far were processed by ELISA 94 this high sensitivity, some samples considered negative samples, of which 55% were men and 45% women. from the conventional RT-PCR assays turned-out to be Participants’ age ranged 01-85 years and sample positive in the real-time RT-PCR analyses. Conclusions: collection occurred in the years 2011 and 2012. 13 We conclude that the real-time RT-PCR technique is of samples were positive for dengue IgM by ELISA and much higher sensitivity and may be of high relevance for only two these were positive by ELISA test, which dengue diagnosis. Financial Support: FAPESP, CNPq. detects NS1 antigen. The most common symptom were fever, headache and myalgia and laboratory aspects HV471 - Mutations Associated To Antiviral were leukocytosis and thrombocytopenia mild. The Drug Resistance In The Ns3 And Ns5b sensitivity (15%) of ELISA dengue NS1 declined rapidly Genomic Regions Of Hcv In Treatment- as the samples were collected more later, probably this Naïve Patients From Southern Brazil is due to drop in viremia and an increase in antibody Vidal, L.E.L., Germano, F.N., Basso, R., Oliveira, N., titer. Our results showed that NS1 ELISA technique is Silveira, J., Martínez, A.M.B., Soares, M.A., Santos, A.F. not advisable to use it from the sixth day of symptoms, and should be employed IgM ELISA. In conclusion, the 1. Universidade Federal do Rio de Janeiro, UFRJ, Rua availability of these two methods are a powerful tool in Professor Rodolpho Paulo Rocco, s/nº. Ilha do Fundão the diagnosis of DENV. 2. Universidade Federal do Rio Grande, FURG, Rua Gen. Osório, s/nº - Centro - Rio Grande HV468 - An In-House Real Time Rt-Pcr 3. Instituto Nacional do Câncer, INCa, Rua André Protocol Is More Sensitive Than Cavalcante 37, Lapa, Rio de Janeiro September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

145 Human Virology: HV

The combination of pegylated-interferon and ribavirin nonenveloped, DNA viruses, members of the family has been used in the treatment of hepatitis C virus (HCV) infection. However, most patients infected with genotype into 6 subgroups (A to F); enteric adenoviruses are 1 do not achieve sustained virological response (SVR). In Adenoviridae,members of subgroup genus Mastadenovirus. F, serotypes 40 and They 41. are Astroviruses classified view of these limitations, intense investigation on drugs are nonenveloped viruses with RNA genome, members targeting viral enzymes resulted in the development of Astroviridae family, genus Mamastrovirus; human of over 40 new compounds: the direct acting antivirals (DAA). To characterize baseline resistance-associated 8). Informations on variability of these agents are scarce polymorphisms for DAA, we obtained plasma samples astrovirusesin Brazil, so havethe aim been of classified this study in eightwas toserotypes characterize (1 to from 159 HCV treatment-naïve patients from Rio Grande/ and analyze the genetic diversity of Adenoviruses and Brazil. Viral RNA was extracted and NS3 and NS5b Astroviruses detected in fecal samples from cases of infantile gastroenteritis occurred in the Triangulo Mutation analysis was carried out through inferred Mineiro region, MG, from 2006 to 2010. Twelve samples regionsamino acid were translation PCR-amplified, and phylogeny sequenced was and performed aligned. positive for astrovirus and thirty three samples positive using Neighbor-joining. Prevalence of subtype 1a was for adenovirus were subjected to nucleic acid extraction, 41% (65/159) and 1b was 18% (29/159). Prevalence of subtypes 2b and 3a were 7% (3/159) and 27% (43/159), sequences were compared to that from reference and respectively. We found three resistance-associated amplification by RT/PCR and sequencing. The viral polymorphisms in NS3, two of these related to approved obtained from GenBank and submitted to phylogenetic drugs, and eight polymorphisms in NS5b. Two resistant fieldanalysis. strains Partial circulating sequence in Brazil from andadenovirus other countries, hexon amino acid genetic signatures were characterized in protein gene has been determined and samples were NS3: 175L (1a) and 176G (1b). In NS5b, two resistance signatures (71V and 499A) were only detected in subgroups F, C, B, E and A. Adenoviruses type F were the subtype 1a. There were no genetic barrier differences dividedmost prevalent into five (60.6%); different viruses clusters of types corresponding C (21.2%) and to towards resistance between genotypes 1 and 3 in NS3, B (12.2%) represent the second and third types most except for codon 175, which is a signature of subtype commonly found in these samples. Astrovirus samples 1b. In NS5b, we characterized 13 polymorphisms in clustered into three classic groups: seven samples genotypes 1 and 3, which could predict higher or lower clustered within the branch corresponding to serotype barrier to resistance acquisition in these genotypes. We 1; four samples fell into branch of serotype 2 and one further obtained active wild-type and double mutant sample clustered within the branch of serotype 3. These (T54A e V170I) NS3 protease expression, which will results provide information on the genetic diversity be used in phenotypic assays with NS3 newly approved of viral agents and aspects associated with infantile inhibitors. Our data suggest that the mutations and gastroenteritis, contributing to a better monitoring and natural polymorphisms associated to resistance found control of these infections. Financial support: FUNEPU/ could harm future treatment of patients with DAA, UFTM, FAPEMIG, Plataforma sequenciamento ILMD- and this demonstrates the necessity to carry out HCV Fiocruz Amazônia. subtyping. HV480 - Prevalence And Genetic HV473 - Molecular Characterization Of Characterization Of Human T-Cell Adenoviruses And Astroviruses Associated Lymphotropic Virus Type 1 Among To Infantile Gastroenteritis In Triangulo Oncohematologic Patients In Central Mineiro Region, Brazil. Brazil Bueno, L.M.T., Dulgheroff, A.C.B.,Figueiredo, E.F., Silva, Kozlowski, A.G., Carneiro, M.A.S., Matos, M.A.D., G.A.V., Naveca, F.G., Domingues, A.L.S. Marinho, T.A., Pessoni, G.C., Silva, A.M.C., Oliveira, M.P., Andrade, A.A., Araújo, L.A., Martins, R.M.B. 1. Universidade Federal do Triângulo Mineiro, UFTM, Praça Manoel Terra, 330 CEP:38025-015 , Uberaba, MG - 1. Instituto de Patologia Tropical e Saúde Pública, Microbiologia/DMIP / ICBN UFG,GOIÂNIA, IPTSP/UFG, Rua 235 - s/n - Setor 2. Instituto Leônidas e Maria Deane / Fiocruz - Universitário - CEP: 74605050 - Goiânia - Goiás Amazônia, ILMD, R. Terezina, 476, Manaus/AM. CEP: 2. Faculdade de Enfermagem, UFG, GOIÂNIA, FEN/ 69.057-070 - Lab. de Biodiversidade em Saúde UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário - Goiânia - Goiás Enteric adenoviruses and astroviruses are agents of diarrheal disease, a common cause of morbidity and Human T-cell lymphotropic virus type 1 (HTLV-1) is mortality in developing countries. Adenoviruses are the etiological agent of major diseases such as adult September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

146 Human Virology: HV

T-cell leukemia/lymphoma (ATL), HTLV-1-associated Horizonte was reported in 1998 with predominance myelopathy/tropical spastic paraparesis (HAM/TSP), of DENV-2 and co-circulation with DENV-1. The Health Department from Minas Gerais State reported in the the HTLV-1 long terminal repeat (LTR) region, 7 genetic and other inflammatory diseases. Based on analyses of in Belo Horizonte. The current dengue epidemiological subtype is the most widespread. There is currently very firstsituation months in ofMinas 2013 State more isthan characterized 29.161 cases by of thedengue co- subtypeslittle data have on HTLV-1 been defined prevalence (a-g). among The 1a oncohematologic or Cosmopolitan circulation of the four serotypes and it is considered patients. In Brazil, a high prevalence was reported among an area of high endemicity. In order to determine the these patients in Rio de Janeiro (9.01%). The aims of this circulation of DENV in Belo Horizonte, we have analyzed study were to estimate the prevalence of HTLV-1 among random samples of A. aegypti and A. albopictus larvae patients with oncohematologic diseases in Central Brazil collected from November 2012 to February 2013 in and to carry out genetic characterization of respective nine districts in the city. The total of 4.393 larvae A. isolates. A total of 345 patients attended at Hospital aegypti and 91 larvae A. albopictus were splitted up Araújo Jorge/ACCG, from June 2011 to February 2012, into 242 pools formed of up to 30 larvae each. The pools and at the Hospital das Clínicas/UFG, from June to August were macerated in 500 µl Leibowitz L15 medium and 2012 in Goiânia City, were studied. Blood samples were centrifuged. The RNA of each pool was extracted using collected from all individuals and screened by ELISA for RNA Qiamp Kit (QIAGEN, USA), a RT-PCR was performed the presence of antibodies to HTLV-1/2. Positive samples to detect viral RNA using primers described by Lanciotti were also tested by polymerase chain reactions (PCR), et al. (1992). The total infection rate reached 3.7% of the followed by sequencing and phylogenetic analysis. Of analyzed pools with prevalence of 56% DENV-1, 22% 345 patients, 6 were found to be anti-HTLV-1/2 positive DENV-2 and 22% DENV-3 in A. aegypti. Although the DENV transovarial transmission rate is low the larvae being infected by HTLV-1. Sequencing and phylogenetic infection is important for circulation and maintenance andanalysis 3 (0.87%; of the 95%HTLV-1 CI: LTR 0.22-2.73) region weredemonstrated confirmed that as of DENV in nature. these isolates belonged to the Transcontinental (A) subgroup of the Cosmopolitan (a) subtype. Although the HV484 - Genetic Variability Of Hepatitis HTLV-1 infection was more frequent in this population B Virus And Hepatitis C Virus In than in the local blood donors, it was lower than that Brazilian Patients With And Without reported in oncohematologic patients in Rio de Janeiro, Hepatocellular Carcinoma Brazil. Financial Support: FAPEG Araujo, O.C., Barros, J.J.F., Do Ó, K.M.R., Nabuco, L.C., Moraes, M.T.B., Niel, C., Villela-Nogueira, C.A., Araujo, HV483 - Detection Of Dengue Virus In Larvae N.M. Of Aedes Aegypti In Belo Horizonte, Minas Gerais In 2012-2013 1. Departamento de Hepatologia, HUCFF, UFRJ, Figueiredo, L.B., Rosa, J.C.C., Martins, C.P.S., Miranda, RJ, Brasil., HUCFF-UFRJ, Rua Rodolpho Paulo Rocco, 255. D.P.J., Brito, C.B., Rocha, E.S.O., Pessanha, J.E.M., Kroon, Cidade Universitária, Ilha do Fundão, RJ, Brasil E.G. 2. Laboratório de Virologia Molecular, IOC-FIOCRUZ, RJ, Brasil., IOC-FIOCRUZ, Av. Brasil, 4365. Manguinhos, Rio Universidade Federal de Minas Gerais, UFMG, Av. de Janeiro, RJ, Brasil Antônio Carlos, 6627 - Pampulha Caixa Postal 486 31270- 901 - Belo Horizonte Hepatocellular carcinoma (HCC) is one of the commonest cancers worldwide. The major risk factors for developing Dengue is the most important arboviruses disease in HCC are chronic hepatitis B virus (HBV) and hepatitis humans in tropical areas of the world. Dengue virus C virus (HCV) infections. Several mutations in these (DENV) belongs to the Flavivirus genus in the Flaviviridae viruses have been associated to hepatocarcinogenesis. In family and it consists of four serotypes, DENV-1, DENV- this study, we investigated and compared the prevalence 2, DENV- 3 and DENV-4. The virus is the causative agent of HBV and HCV genotypes and mutations in patients of dengue fever and dengue hemorrhagic fever. DENV with and without HCC and their association with clinical is transmitted to humans mainly by Aedes aegypti outcome. A cohort of 51 HBV chronic patients (12 HCC mosquitoes but also by Aedes albopictus. The mosquitoes and 39 non-HCC) and 106 HCV chronic patients (40 acquire the infection through blood-feeding on infected HCC and 66 non-HCC) were enrolled in the study. HBV core promoter (CP) and pre-S/S regions, as well as, HCV dengue epidemic in Belo Horizonte, Brazil was reported core region, were analyzed by PCR-direct sequencing individualsin 1996, where or by DENV-1 transovarial were detected transmission. and associated The first method. HBV subgenotypes A1 (61.1%), A2 (16.7%), with dengue cases. However, a major epidemic in Belo D1 (2.8%), D6 (5.5%), D7 (2.8%), F2 (5.5%), F4 (2.8%) September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

147 Human Virology: HV and a coinfection F4/G (2.8%) were found in non-HCC, 1.5 and 1.7kb fragments. For nested PCR it was used whereas A1 (90.0%) and A2 (10.0%) were detected in HCC-patients. CP mutations C1653T, T1753V, A1762T fragment correspondent to RT/S region from viral and G1764A and pre-S/S deletion were more prevalent 2uLgenome of amplicons and posteriorly using primersthe fragments that amplifies were sequenced. a 741pb in HCC-patients than in non-HCC (20.0%, 33.3%, 66.7%, The sequences’ clustering was realized using the online 50.0% and 12.5% versus 17.6%, 22.2%, 37.0%, 40.7% software ClustalW (PBIL) and the phylogenetic trees and 11.8%, respectively). In addition, mean ALT and AST was obtained using GeneBee ClustalW 1.83 version. levels were higher in patients carrying C1653T, T1753V, Of these 21 samples analyzed in this study, 12 were A1762T, G1764A, pre-S/S deletion or subgenotype positive and 09 were negative. Of these positive samples, we obtained the sequence of RT and S regions from 3 samples and we observed 81 to 91% similarity with HBV A1.subtypes However, 1a, 1b only and T1753V 3a were mutation found in was both significantly HCC and variants from primates and 83 to 95% similarity with associatednon-HCC patients, with elevated with transaminasesthe following (p<0,05).prevalences: HCV variants isolated from human. The most similarity (93 to 42.5%, 35.0% and 22.5%, and 43.9%, 40.9% and 15.2%, 95%) was observed among the samples and A2 human respectively. Prevalence of core mutation at amino acid genotype. That virus isolated by our were from New World primate, different of others already been isolated in patients with liver cirrhosis and HCC than in patients previously (Old World Primates). Phylogenetic analysis position 70 in HCV subtype 1b was significantly higher we can observe that the virus isolated by our are similar to the A2 genotype from human HBV withoutbiomarkers advanced of disease liver progression disease (p<0,05). and early Genotypes HCC anddetection. specific Financial mutations support: in HBV CAPES, and HCVFAPERJ, may FIOCRUZ. be useful HV488 - High Rate Of Dengue Virus Detection In Aedes Aegypti And Aedes Albopictus HV486 - Characterization And Phylogenetic Larvae During The Peak Of Outbreak In Analysis Of Hepatitis B Virus In Nonhuman March/2013 In Belo Horizonte. Primates Samples From Rondônia State. Rosa, J.C.C., Figueiredo, L.B., Martins, C.P.S., Marins, K.S., Cunha-Pereira, A.V., Vieira, D.S., Botelho, L.F., Zanchi, Brito, C.B., Miranda, D.P.J., Pessanha, J.E.M., Bonjardim, F.B., Araujo, M.S., Messias, M.R., Santos, A.O., Ozaki, L.S., C.A., Ferreira, P.C.P., Kroon, E.G. Pereira, L.H.S., Salcedo, J.M.V. Universidade Federal de Minas Gerais, UFMG, Av. 1. Fundação Oswaldo Cruz Rondônia, FIOCRUZ RO, Antônio Carlos, 6627 - Pampulha Caixa Postal 486 31270- Rua da Beira, 7671 Bairro - Lagoa 901 - Belo Horizonte 2. Instituto de Pesquisa em Patologias Tropicais de RO, Dengue virus (DENV) is an emerging mosquito-borne IPEPATRO, Rua da Beira, 7671 Bairro - Lagoa 3. Fundação Universidade Federal de Rondônia , UNIR, hemorrhagic fever. The DENV complex consists of 4 4. Virginia Commonwealth University flavivirusserotypes named which DENV1 causes - DENV4. dengue DENV fever is and transmitted dengue The hepatitis B virus belongs to Hepadnaviridae family to humans mainly by Aedes aegypti mosquitoes, that includes virus that infects birds and mammals, which acquire the infection through blood feeding on among these, some nonhuman primates such as infected individuals or by transovarial transmission. Chimpanzees (Pan troglodytes), woolly monkeys In the beginning of 2013, several outbreaks have been (Lagothrix lagothricha), orangutans (Pongo pygmaeus), documented in many regions of Brazil with the co- gorillas (Gorilla gorilla) and gibbon species different. circulation of four serotypes (DENV-1, DENV-2, DENV- These virus are phylogenetically distinct of other HBV 3 and DENV-4). The Health Department from Minas genotype for each primate specie. The virus transmission than 29.161 cases of dengue in Belo Horizonte. In the variants,to primates and as it from was humans suggested has that been there reported, is one however, specific Geraispresent State study, reported we present in the the first data months of DENV of surveillance 2013 more transmission from nonhuman primates to human in Aedes sp larvae collected during March of 2013 from nine districts in the Belo Horizonte city. A total of 493 larvae were collected and divided in 32 and 7 pools remains to be clarified, once there are still no published of A. aegypti and A. albopictus respectively totalizing datain nonhuman that confirms primates this hypothesis.samples from Our Rondonia study aims state. the 39 pools with up to 30 larvae in each. The samples identificationIt was analyzed and 21characterization samples of nonhuman the hepatitis primates. B virus were macerated in 500 µl Leibowitz L15 medium and We obtained the viral DNA using the lysis by guanidine centrifuged. The RNA was extracted using RNA isolation isotiacianate method (adapted). For conventional PCR the Qiamp Viral RNA Kit (QIAGEN, USA) and used to obtain the corresponding cDNA strand. A real-time PCR

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV it was use 20uL of DNA using primers that amplifies XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

148 Human Virology: HV

region (UTR) was performed in order to detect DENV in usingthe samples. two pairs The of real consensus time PCR primers data showed to 5′ untranslated high rate of were:virus. Two parainfluenza samples showed 1, parainfluenza triple infection, 2, parainfluenza 3 samples DENV detection in A. aegypti and A. albopictus larvae. 3,showed influenza dual A,infection, adenovirus, and andall respiratorythe others syncytialinvolved DENV-1/DENV-3 and DENV-2/DENV-4 were detected monoinfection. Discussion and Conclusion: The amount in 26 and 14 pools of A. aegypti (67%) respectively. We of viral agents causing IRAs detected in this study is have also detected DENV-1/DENV-3 in four from the 43.3%, which is consistent with the data from other seven pools of A. albopictus analyzed. Although in minor sampling, the DENV detection in A. albopictus larvae 1 and 2, together with the adenoviruses, followed by suggests that this mosquito may have participated as a studies.the respiratory The most syncytial prevalent virus, viruses the latter were being parainfluenza the most vector of DENV during outbreaks in Belo Horizonte. In common cause of respiratory tract infections. With this addition, it is important to improve surveillance and preliminary data, this study enables an estimation of the control systems of the A. albopictus, a competent virus frequency of viral agents responsible for IRAs in children reservoir. of the city of Porto Velho, contributing to the etiologic characterization of these pathogens. HV489 - Etiologic Identification Of Acute Viral Respiratory Infections Among HV500 - Evaluating A Commercial Kit Of Children In Porto Velho-Rondônia Dengue Virus Igm Capture Test Vieira, D.S., Santos, J.V., Ludervanhe, F.R., Cunha- Silveira, V.R., Souza, R.P., Suzuki, A., Barbosa, V.M., Pereira, A.V., Botelho, L.F., Santos, A.O., Silva Lima, N.C., Montoro, M.G., Oliveira, A.L.R., Curti, C.P., Cunha, M.S., Benevides Matos, N., Salcedo, J.M.V. Rocco, I.M., Bisordi, I. 1. Fundação Oswaldo Cruz Rondônia, FIOCRUZ RO, Centro de Virologia - Instituto Adolfo Lutz, NDTV - Rua da Beira, 7671 Bairro - Lagoa CV - IAL, Av. Dr. Arnaldo, 355 - Cerqueira Cesar CEP 01246- 2. Instituto de Pesquisa em Patologias Tropicais de RO, 000 São Paulo - SP. Brasil IPEPATRO, Rua da Beira, 7671 Bairro - Lagoa Dengue virus infection is still a serious Public Health 3. universidade Federal de Rondônia, UNIR, Problem in most of the Tropics and the demand for fast 4. Centro de Pesquisa em Medicina TRopical de RO, and precise diagnostic tools is rising as new cases are CEPEM RO, Rua da Beira, 7671 Bairro - Lagoa continually being detected. The present work evaluates Introduction: Acute respiratory infections (IRAs) the serological test for Dengue infections applying are considered public health problems, especially in an ELISA IgM Capture Dx Select Test, lot n° X 122248, developing countries, causing great morbidity and produced by Focus Diagnostics. The test was compared mortality in the pediatric population between 0 and to an in house ELISA – IgM test commonly used in the 6 years. Although IRAs can be caused by various diagnostic routine of Public Health laboratories. A total etiological agents, viruses are the main source of these of 180 sera samples were analyzed by both techniques infections. According to studies conducted in Brazil, and sensitivity, positive and negative predictive values there are few reports on the prevalence of these diseases, and Kappa concordance were calculated. The dispersion particularly in the northern region, where the state of the results was also studied and the regression of Rondônia is located. On the basis of these data, the curve of this distribution was calculated and analyzed. aim of this study was to characterize the viral etiologic The results showed high sensitivity (98.0%), negative agents responsible for these infections. Methodology: predictive values of 100% and a positive predictive The study was conducted at the Cosme and Damião value of 73.4%, indicating a good performance of this Children’s Hospital in Porto Velho-RO, a reference in kit. The Kappa Index of 0.901 using 90 samples tested pediatric care in this state. This study included children simultaneously in both tests points to a high degree of both genders, aged between 0 and 6 years, presenting of repeatability, thus indicating the methodology as a clinical symptoms of IRAs. Approximately 1 to 2 ml of robust diagnostic test. The scatter diagram showed the nasopharyngeal secretion was collected. Diagnosis correlation of absorbance data obtained for 90 samples tested against both methodologies. A positive correlation screening. All samples were subjected to molecular with the absorbance values was revealed, demonstrating by indirect immunofluorescence was used for initial that the values obtained between the tested kits present viruses responsible for IRAs. Results: Thirty samples a variation in the level of dispersion in the ratio of 1.104, tests for identification and characterization of the main which is equivalent to a variation in the order of 10.4% in were positive, of which 5 were from male and 9 from the readings obtained from comparing one test with the werefemale processed children. The by indirectviruses detected immunofluorescence; in these samples 14 other. The regression calculated an R² of 0.8168 showing September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

149 Human Virology: HV that 81.68% of the results are consistent and statistically HV512 - Dengue Cases Associated To Abiotic valid. The analyzed data suggest that the test presents And Biotics Factors In Belo Horizonte, a good sensitivity and an adequate repeatability. Based Minas Gerais From January 2010 To November 2012. IgM Capture Dx Select Test may be an appropriate tool Miranda, D.P.J., Marins, K.S., Sonoda, I.V., Nascimento, onfor theseDengue findings, serological it is possible diagnostic. to suggest Finacial that support: the ELISA the J.C., Pessanha, J.E.M., Figueiredo, L.B., Bonjardin, C.A., kits were donated by MEDIVAX. Ferreira, P.P., Kroon, E.G. HV511 - Htlv-1 Proviral Load In Ham/Tsp 1. Universidade Federal de Minas Gerais, UFMG, Av Patients And Non-Ham/Tsp Individuals Presidente Antonio Carlos 6627 Rosadas, C., Cabral-Castro, M.J., Peralta, J.M., Puccioni- 2. Laboratório de Zoonoses - Secretaria Municipal de Sohler, M. Saúde , Lab-zoonose -PBH, Avenida Afonso Pena 1212 Universidade Federal do Rio de Janeiro, UFRJ, Rua 3. Gerência de controle de zoonoses- Secretaria Rodolpho Paulo Rocco, 255 - Cidade Universitária - Ilha do Municipal de, SMSBH-GCS , Avenida Afonso Pena 1212 Fundão - Rio de Janeiro Dengue virus is the most important human arboviral HTLV-1 is a member of Retroviridae family that pathogen worldwide. It is estimates by WHO that over infects approximately 800.000 individuals in Brazil. 40% of the population is at risk of acquiring dengue and Although the majority of infected individuals remain there may 50 million of dengue infectious every year. asymptomatic this virus is the etiological agent of There are four serotypes of dengue viruses, DEN1-4, a degenerative neurological disorder called HTLV- which can be transmitted mainly by Aedes aegypti and associated myelopathy/tropical spastic paraparesis Aedes albopictus. The last twenty years dengue has (HAM/TSP). The diagnosis of HAM/TSP is based on been a problem for Brazil and a major concern for public clinical and laboratorial criteria, as proposed by WHO. health authorities. Belo Horizonte, capital of Minas This criteria consist of two levels of ascertainment: Gerais state is an important economic polo and has a large highway network allowing a large movement of slowly progressive paraparesis and anti-HTLV-I people. Since 1996, Belo Horizonte has been suffering dengue outbreaks. Many control programs have been probableantibodies and in definite.blood and The CSF. “definite” Thus, nor diagnose the detection considers of proviral DNA, neither the proviral load is included in used as source for understanding dynamics of dengue this criteria. Previous studies demonstrated a higher transmission which includes entomological surveillance. proviral load (PVL) in HAM patients then in symptomatic The Municipal Health department of Belo Horizonte individuals. The present study aim to evaluate the HTLV- had been monitored ovoposition of Ae.aegypti and Ae.Albopictus through the whole year, supporting data TSP individuals from Rio de Janeiro, Brazil. The HTLV- for wide spread dispersion of the vector, to perform better control actions. Nevertheless, many others factors 1 PVL of in PBMCs PBMCs was of definite determined HAM/TSP by TaqMan and non-HAM/ real time PCR targeting HTLV-1 tax gene of 18 HAM/TSP and 7 can be responsible for dengue transmission as spread of non-HAM/TSP individuals. The mean of PVL of HAM/ each of four serotypes, immunological state of population TSP and non-HAM/TSP individuals was 36.3 (9.5) and as well ecological and social variables. The aim of this 8.3 (3.6) /100 PBMCs, respectively. This difference was work was to show a correlation between number of eggs laid in ovitraps and cases of dengue in Belo Horizonte, non-HAM/TSP group presented proviral load similar to from January 2010 to November 2012. Oviposition traps were displayed for one week in residential areas of Belo statisticallyHAM/TSP patients significant (PVL:18.8 (P=0.02). and Two24.5/100PBMCs. individuals from One of them is a 27 year old, HAM/TSP patient’s son. The other Horizonte, four times per year: January, April, August one is a patient with clinical suspicion of lymphoma. and November. After one week of exposition, paddles Therefore, these individuals should be monitored of ovitraps were removed and sent to entomological frequently. Two HAM/TSP individuals presented a lab where eggs were counted. Statistical program was proviral load higher than 100%, indicating that there used to make the correlation between number of eggs are more than one provirus per PBMC. Conclusion: PVL and dengue cases. Results showed that there was no of HAM/TSP individuals is higher than in non-HAM/ correlation between number of eggs and dengue cases TSPindividuals. The determination of proviral load may in this period. Although the data obtained by monitoring the number of eggs was not enough to predict a dengue proviral load can be used as a prognostic tool and also outbreak, they give support and enable the adoption of integrated policies and strategies for dengue control contributeassists in monitoring to define HAM/TSPof HTLV-1 diagnosis.infected individuals. Moreover the with others biotic and abiotic factors.

150 Human Virology: HV

HV518 - Molecular And Phylogenetic 1. Laboratório de Saúde Pública Dr. Giovanni Characterization Of Dengue Virus Cysneiros, LACEN-GO, Av. Contorno, Nª 3.556, Jardim Bela Serotype 1 Circulating In Roraima State Vista - Goiânia - GO-Brasil / Cep: 74853-120 Silva, G.A.V., Sousa, D.D., Acosta, P.O.A., Granja, F., 2. Instituto de Patologia Tropical e Saúde Pública - Naveca, F.G. UFG, IPTS-UFG, Rua 235 - s/n - Setor Universitário - CEP: 1. Instituto Leônidas e Maria Deane, Fiocruz Amazônia, 74605050 - Goiânia - Goiás - Brasil Brazil, ILMD-Fiocruz 3. Faculdade de Farmácia - UFG, FF-UFG, Av. 2. Universidade Federal de Roraima, UFRR Universitária, esq. com 1ª Avenida, Setor Universitário, CEP: 74605-220, Goiás Dengue viruses (DENV) are the most important arboviruses over the world. Several reasons contribute The State of Goias located in Central Brazil, has to its worldwide dispersion; including the lack of an experienced epidemic and non-epidemic periods of effective vaccine that protects against all four serotypes DENV transmission since 1994 (DENV1), DENV2 (1998), DENV3 (2002) and DENV4 (2011). An important 1981 epidemic in the Roraima state, dengue virus outbreak is ongoing in the region with more than simultaneously.serotype 1 (DENV-1) After was its firstreintroduced introduction in 2000, during being the consequently isolated in nine of the last 13 years. This of 2013. In 2009 NS1Ag was introduced in Public work aimed to characterize the full-length envelope gene 125,000Health Laboratories cases notified in Brazil during to the increase first fourth the detection months among 13 samples collected between 2008-2010. All of DENV in early infections also as screening tool to viral strains were isolated from patients that presented classic dengue fever in C6/36 cells. After one passage, of serological and virological markers in laboratorial cell supernatant was removed for viral RNA isolation, improvedengue diagnosis the viral we isolation. analyzed To samples evaluate data the processed efficiency in LACEN-GO during January to April 2013. Data were primers, resulting in 1,724bp, encompassing the extracted from GAL lab software and analyzed by Excel cDNAenvelope synthesis gene. Sanger’s and amplification nucleotide using sequencing DENV-1 reaction specific 2010. Routinely samples from the epidemiological was conducted and the capillary electrophoresis was surveillance to dengue diagnosis were performed: (1) performed in an ABI 3130. All Roraima’s sequences were aligned with other 61 sequences available at days post onset of symptoms (DPO); (2) serum with the GenBank, representing all DENV-1 genotypes, blood (viral isolation) or serum (NS1Ag test) with ≤5 using the MAFFT algorithm implemented in Geneious screened by NS1Ag (serum) and when positive the >5DPOmatched (IgM blood test); were (3) also paired tested samples by viral with isolation. ≤5DPO Totalwere was inferred with JmodelTest 2.1.3 and a maximum of 14,164 samples from patients with dengue symptoms software.likelihood The phylogenetic evolution modelreconstruction that best wasfits theconducted dataset were received in virology section at LACEN-GO during with PhyML. All samples showed 25 variable sites in Jan-April 2013. 10,103 samples were tested by IgM (68.6% positive), 1,846 by NS1Ag (22.1% positive) and of residues substitutions. Phylogenetic inference 491 by viral isolation (35.8% positive) with DENV1 therevealed nucleotide that all sequencessamples belongs alignment, to the and genotype five sitesV, a (44.3%) and DENV4 (55.7%) detected. Among paired well-established genotype in Brazil since the eighty’s samples 257/862 (29.8%) were positive by NS1Ag and decade. Furthermore, all studied samples grouped in the matched blood were screened to viral isolation with a monophyletic clade in the lineage III, together with 203(78.9%) positive results yielding 46.3% DENV1 and Venezuelans, Colombians and Mexicans strains, as well 53.7% DENV4 detected. In our routine, IgM remains as with other Brazilians strains from Alagoas 2010 and Rio de Janeiro 2011. Continuous studies on the DENV infection with 98% of predictive positive value molecular characterization of dengue circulating strains theconsidering more efficient 70% of serological dengue prevalence marker inin detectionthe setting. of are necessary, especially in international border states Moreover this result pointed the high quality of dengue like Roraima, which may serve as an important route for diagnostic from the clinical team. The positivity of NS1Ag dispersion of epidemics lineages. ranged 22-30%. Many studies describe large range in sensibility of NS1Ag test which can vary among different HV521 - Virological And Serological serotypes, primary or secondary and timing of infection. Markers Of Dengue Infection In Central However the increased positivity in viral isolation (35.8 Brazil: An Approach Of Ns1ag Test As A to 78.9%) promoted by NS1Ag as triage tool resulted in Screening Tool For Viral Isolation greater ability to identify circulating serotypes in line Silva, V.L., Argolo, A.F.L.T., Ramos, C.H., Silva, M.M.J., with those detected by usual viral isolation beyond the Silva, L.F.F., Féres, V.C.R., Silveira, L.A., Martelli, C.M.T. best use of resources. Additionally the support by the September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

151 Human Virology: HV epidemiological surveillance was essential for this study Criado, M.F., Proença-Modena, J.L., Sesti-Costa, R., also to the constant improvement of dengue diagnosis in Santos, R.I.M., Silva, M.L., Paula, F.E., Saturno, T., Prates, Goias. Financial support:- M.C., Faria, F.M., Tamashiro, E. , Valera, F.C.P., Anselmo- Lima, W.T., Arruda, E. HV524 - Complete Genome Characterization Of A Dengue Virus Serotype 4 Isolated In Instituto Leônidas e Maria Deane, ILMD, Rua Terezina, Manaus, Am Manaus-AM Nascimento, V.A., , Silva, G.A.V., Souza, V.C., Souza, The Dengue virus (DENV) belongs to the Flaviviridae K.B.A., Naveca, F.G. family, genus Flavivirus and is recognized as four Instituto Leônidas e Maria Deane, ILMD, Rua Terezina, distinct serotypes named DENV-1 to DENV-4. Brazil Manaus-AM faces epidemics caused by DENV since 1981-82, when serotypes 1 and 4 were isolated from human cases in the The Dengue virus (DENV) belongs to the Flaviviridae Roraima State. To date few complete genomes DENV- family, genus Flavivirus and is recognized as four 4 have been described in Brazil, and all of then were distinct serotypes named DENV-1 to DENV-4. Brazil sequenced after primarily isolation in C6/36 cells. For faces epidemics caused by DENV since 1981-82, when that reason the aim of this study was to characterize, serotypes 1 and 4 were isolated from human cases in the directly from plasma, a specimen detected in Manaus- Roraima State. To date few complete genomes DENV- AM. The sample BrAM005/11 was collected in May 4 have been described in Brazil, and all of then were 2011 from a patient with classic dengue fever that was sequenced after primarily isolation in C6/36 cells. For that reason the aim of this study was to characterize, PCR. Thereafter, cDNA was produced using a primer that directly from plasma, a specimen detected in Manaus- initiallytargets the confirmed last 21nt asin the a dengue 3’UTR of case DENV-4 by multiplex genome. The RT- AM. The sample BrAM005/11 was collected in May 2011 from a patient with classic dengue fever that was amplicons, which were submitted to Sanger’s nucleotide full-lengthsequencing genomefollowed was by amplified capillary in electrophoresis eight overlapping in PCR. Thereafter, cDNA was produced using a primer that an ABI 3130 genetic analyzer. Electropherograms initiallytargets the confirmed last 21nt asin the a dengue 3’UTR of case DENV-4 by multiplex genome. The RT- were assembled on Geneious software 6.1.5 using the GenBank reference sequence. All 118 full-length DENV- amplicons, which were submitted to Sanger’s nucleotide 4 genomes available, representing the four genotypes, full-lengthsequencing genomefollowed was by amplified capillary in electrophoresis eight overlapping in were aligned with this sample using the MAFFT an ABI 3130 genetic analyzer. Electropherograms algorithm implemented in Geneious, and a neighbor- were assembled on Geneious software 6.1.5 using the joining phylogenetic reconstruction was performed with GenBank reference sequence. All 118 full-length DENV- genotyping purposes. The complete genome sequence 4 genomes available, representing the four genotypes, of BrAM005/11 is 10,649 nt long and according to the were aligned with this sample using the MAFFT phylogenetic analysis is a representative of the genotype algorithm implemented in Geneious, and a neighbor- II. With regarding to the polyprotein comparisons, joining phylogenetic reconstruction was performed with three residues substitutions, K66R (capsid); S2910G genotyping purposes. The complete genome sequence and L3327I (NS5) were observed only in this sample. of BrAM005/11 is 10,649 nt long and according to the Furthermore, when the present sequence was compared phylogenetic analysis is a representative of the genotype II. With regarding to the polyprotein comparisons, seven residues substitutions F49L and K66R (capsid), three residues substitutions, K66R (capsid); S2910G toE554G other (envelope) five DENV-4 and genomes T2492A, collected I2565V, inS2910G, Manaus L3327I 2011, and L3327I (NS5) were observed only in this sample. (NS5) were observed only in this sample. Further studies Furthermore, when the present sequence was compared are being conducted in order to evaluate those mutations and its importance for viral evolution. seven residues substitutions F49L and K66R (capsid), toE554G other (envelope) five DENV-4 and genomes T2492A, collected I2565V, inS2910G, Manaus L3327I 2011, HV532 - Respiratory Viruses Detection (NS5) were observed only in this sample. Further studies Among Young Children In Palivizumab are being conducted in order to evaluate those mutations Prophylaxis Program and its importance for viral evolution. Watanabe, A., Perosa, A.H., Moreira, L.P., Guatura, S.B., Weckx, L.Y., Monteiro, A.I., Granato, C., Bellei, N. HV527 - Human Respiratory Syncytial Virus (Hrsv) Infects Tonsils Of Patients With Universidade Federal de São Paulo, UNIFESP, Rua Chronic Adenotonsillar Disease Pedro de Toledo, 781 - 15º andar

152 Human Virology: HV

Respiratory infections are caused by a large group workers and HIV patients. The viral load evaluation was of viruses and are one of the most frequent infectious made by RT-qPCR. HRV was detected in 17.3% of the syndromes in childhood which can be followed by samples. The HRV infection was higher in symptomatic patients (20.9%, 68/325) than in asymptomatic patients major cause of consultations in primary care services. [(11.5%, 23/200; p = 0.005)]. The HRV-A was detected complicationsThe present study and analyzed a significant the occurrence morbidity. of Theyrespiratory are a in 74.5% (38/51) of the sequenced samples, followed viruses among children samples up to 2 years old by HRV-C (19.6%, 10/51) and HRV-B (5.9%, 3/51). presenting acute respiratory symptoms attended in a The mean of viral load in HRV positive samples was pediatric ward of a Sao Paulo city tertiary hospital. All 1.76 E+07 copies/mL. The group of children and HIV enrolled patients were prophylactically treated with seropositive patients presented higher and lower viral monoclonal antibody (Palivizumab®). Symptomatic load (109 and 102copies/mL) respectively. The mean of children were referred by a pediatrician to the research viral load in symptomatic patients was similar to that in team every time suspected of an acute respiratory syndrome of probable viral etiology and a nasal swab difference. The comparison between immunocompetent was collected. Conventional RT-PCR was applied for asymptomaticand immunocompromised patients with adult no patients statistically showed significant a trend detection of rinovirus (HRV), metapneumovirus (hMPV) towards higher viral load among immunocompromised.

(Flu A/B) detection. We studied 73 nasal swabs from ,children adenovirus (median (AdV) of and 1 year, real 3 timemonths PCR - 2for years) influenza attended A/B Themost viral often load detected of HRV-A in the was studies, significantly presented greater the higher when between April to September 2008. In the present study, comparedviral load when to HRV-C compared (p ˂ 0.001).with the The HRV-C HRV species. A species, In 86% of children were premature and the most frequent symptomatic patients the immune status seems to symptoms were coryza, cough, fever and wheezing. contribute to the range of viral load when comparing Among analyzed samples 39.4% were HRV positive, immunocompetent and immunocompromised 5.6% AdV, 2.8% Flu A, 1.4% hMPV and no Flu B was patients. We conclude that viral load does not seem to detected. In a previous study, with the same population, be the most relevant factor for the clinical outcome of respiratory syncytial virus (HRSV) was detected in 20% infected patients. Financial support: CAPES, FAPESP of studied samples by conventional PCR. Respiratory viral infection was frequently detected in young children Aripuanã Watanabe Arquivo: Watanabe II.doc receiving prophylaxis with Palivizumab® during 2009/17384-0 Área : Virologia Humana Apresentador: autumn and winter season. Despite the high frequency HV536 - Dengue False-Negative Cases In of HRSV (20%), others respiratory viruses (47.3%) Roraima, Brazil: An Approach About The were also detected in a high frequency contributing to High Number Of Negative Ns1 Assays respiratory viral illness among premature pediatric Nascimento, I.A.S., Meneses, C.A., Sousa, D.D., Lima Junior, W.P., Granja, F., Silva, G.A.V., Naveca, F.G., Acosta, Virologia Humana Apresentador: Aripuanã Watanabe P.O.A. patients.Arquivo: Watanabe Financial support:I.doc no financial support Área: 1. UNIVERSIDADE FEDERAL DE RORAIMA, HV533 - Rhinovirus Infection In UFRR, Campus Paricarana: Av. Cap. Ene Garcez, nº 2413. Symptomatic And Asymptomatic Patients Bairro Aeroporto. CEP: 69310-00 Camargo, C.N., Melchior, T.B., Watanabe, A., Granato, C., 2. Instituto Leônidas e Maria Deane - FioCruz - AM, Bellei, N. CpqLMD Universidade Federal de São Paulo, UNIFESP, Rua Dengue is the most important human arboviral disease Pedro de Toledo, 781 - 15º andar and the major health problem in developing countries. Dengue virus (DENV) is an arbovirus that belongs to The human rhinovirus (HRV) infections are among the most frequent causes of common colds, and antigenically distinct serotypes DENV-1-4. Roraima is asymptomatic infections occur in 9% to 30% of cases. genushyperendemic Flavivirus for family dengue Flaviviridae, and shows classified the circulation in four This study showed the occurrence of HRV in symptomatic of four serotypes after DENV4 reintroduction in 2010. and asymptomatic patients and the relationship Between 2007 and 2011,14.078 cases of febrile illnesses between viral load and rhinovirus species in respiratory were noticed in State which dengue infection was samples from adults and children, using the RT-qPCR discarded by laboratory methods of anti-dengue IgM methodology. A total of 525 samples were analysed and/or NS1 antigen-capture ELISA (NS1) and whose from symptomatic children and their asymptomatic caregivers, symptomatic and asymptomatic health care was to evaluate the accuracy of dengue diagnose in NS1 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Humanetiologic Virology: HVagent was not identified. The aim of this study XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

153 Human Virology: HV negative samples in comparison with Real-time RT-PCR vaginal cytology. HPV genotyping was performed (qPCR) in 2012. In 986 samples from patients with using Linear Array HPV Genotyping Test (Roche presumptive diagnose for dengue 78,8% were negative Molecular Systems Inc.) and all smears were evaluated by ELISA assay (Platelia™DENGUE-NS1-Ag, BIORAD®) at the Cytology Unit of the Department of Pathology used in Central Laboratory of Roraima, this is the primary according to the Bethesda system criteria. The variable diagnose method used in the health system of the state analysis associated with HPV infection was adjusted in the acute phase of disease. 150 samples were selected using a stepwise logistic regression method to analyze from the NS1 negative total to perform qRT-PCR. RNA was qualitative and quantitative variables. The software used extracted with Axygen Bioscience® kit and subjected to for that analysis was the SAS version 9.2. The observed a TaqMan qRT-PCR that detects any serotype genome, prevalence of HPV was 33.6% and the altered cervico- developed by Gurukumar, 2009 adapted by Naveca, vaginal cytology prevalence was 3.2%. The factors 2012, from these samples 21,3% were positive by this associated with HPV infection were: age under 20 years test. Among the possible causes of false-negative NS1 (OR= 6.455, CI= 1.722-24.194); being single (OR= 10.52, CI= 5.524-20.00); schooling under 8 years (OR= 2.440, the fact of Roraima be a hyperendemic state, in which CI= 1.219-4.885) and practice of passive oral sex (OR= numbera high rate are of the secondary high sensitivity/specificity infection is expected, of qPCR as know and 2.760, CI= 1.501-5.075). Therefore, by the present data, this fact decreases the sensitivity of NS1 tests due to the HPV prevalence in women at reproductive age in the immune-complexes formed. Future studies may be the city of Botucatu is higher when compared with the conducted to evaluate these hypotheses, as well as the global estimates. We believe that the understanding of relation between serotypes and negativity of NS1. The the risk factors associated with the HPV infection will data should be an alert to the health system in the sense allow the implementation of major impact measures that acute phasepatients are discarded by laboratorial to reduce the high rates regarding the infection by this assays; this phase needs constant care due to the virus. Financial support: FAPESP (2012/01278-0) and possibility of HFD/DSS, important in an endemic area. CNPq (134190/2012-2) Financial support: Univerdidade Federal de Roraima - UFRR HV547 - Real-Time Pcr Application In Diferent At Risk Population From Sao HV537 - Risk Factors Associated To Human Paulo Hospital Papillomavirus (Hpv) Cervical Infection In Moreira, L.P., Watanabe, A.S.A., Silva, E.R.M., Guatura, Women At Reproductive Age S.B., Granato, C., Bellei, N. Pinto, G.V.S., Bolpetti, A.N., Vieira, E.P., Candeias, J.M.G., Machado, M.C.H.S., Silva, M.G. Universidade Federal de São Paulo, Unifesp, Rua Pedro de Toledo, 781 - 15°andar - Vila Clementino - SP Faculdade de Medicina de Botucatu - Departmento de Patologia, FMB - UNESP, Distrito de Rubião Junior s/n - In Brazil there are few studies related to respiratory Botucatu - SP (HPIV). There is a lack of information about incidence, 2. Instituto de Biociências - Depto Microbiologia e infectionsrisk factors causedand outcomes by human among parainfluenza different patients virus Imunologia, IBB - UNESP, Distrito de Rubião Junior s/n - populations. HPIVs are divided into 4 different types, Botucatu - SP although most clinical infections are due to types 1, 2, 3. Secretaria de Saúde de Botucatu, Secretaria de and 3. The incidence of infection caused by this viral Saúde, Rua Major Matheus, 7 - Botucatu -SP agent has been reported between 2% to 7%. The aim of the study was to investigate the occurrence of HPIVs HPV is the worldwide most commonly sexually 1, 2, 3 and 4 in different patients hospitalized and non- transmitted virus with a global estimate prevalence of hospitalized with respiratory symptoms in a tertiary around 10%. Epidemiologic studies have been conducted hospital in Sao Paulo. Patients included in the study were to identify the countless factors associated with HPV in hematopoietic stem cell transplant (HSCT) program, cervical infection. So, in order to identify these, a study recipients of kidney transplants (Tx Renal), children has been done with samples collected from women at with congenital heart disease (CARDIO) and adults reproductive age, attended by the Basic Health Clinics and children hospitalized with suspected of H1N1/ of the city of Botucatu, São Paulo State, Brazil, between pdm/2009 (sH1N1) infection. Included patients were the years of 2012 and 2013. Socio-demographic, those who had a clinical picture of acute respiratory behavioral and clinical data were obtained through infection or asymptomatic patients who have contact interviews. At the each visit a cervical smear specimen with patients presenting with infection. The present was collected for HPV testing and conventional cervico- study analyzed the diagnostic for HPIV 1, 2, 3 and 4

154 Human Virology: HV by Real Time Reverse Transcription-PCR (RT-PCR) in came from pastures, suggesting a close contact among these patients. We studied 1087 samples from patients wild and domestic life. It is worth to mention that attended between March 2002 to December 2012, these Hantavirus are maintained in nature in wild reservoirs samples were HSCT (N=383), Tx Renal (N=250), Cardio as Akodon and Oligoryzomis, this last representing (N=130) and sH1N1 (N=324) and were collected in a 7,4% of our trapped rodents. Mus musculus (1,9%) ward or in the ambulatory. The virus was detected in was also suggested to be associated with Vaccinia Virus 76 samples (7%). The HPIV-3 was the most frequently natural circulation. Up to date, qPCR was realized for all detected (61.8%), followed by HPIV-2 (15.8%), HPIV- serum samples; results were negative for Dengue virus 4 (14.5%) and HPIV-1 (9.2%). The positivity for HSCT serotypes 1, 2, 3 and 4. Further experiments concerning group was of 8.4% and for sH1N1 was 7,7%, followed other viruses are currently being performed as several pathogens are possibly associated with the sampled percentage (63.2%) of positive cases had comorbidity, bydemonstrating cardio (6.9%) that and the 4.0% incidence for Tx ofrenal. infection, So, a significant mainly in potential reservoirs constitutes a strategy to minimize immunocompromised patients, is underestimated when generaand contain of mammals. the onset of The several identification viral infectious of hosts diseases and using conventional methods of laboratory detection. it reinforces the need of establishing a rapid and sensitive differential diagnosis of respiratory viruses. –HV553 the first - stepsOccurrence have been taken.Of Hp ivs 1, 2, 3 And 4 Among Hospitalized And Non-Hospitalized HV552 - Small Mammals Versus The Risk Group Patients. Emergence Of Viral Diseases: A Prospective Parmezan, S.N., Moreira, L.P., Camargo, C.N., Bellei, N. Study In Rural Areas Of Minas Gerais State Amaral, C.D., Borges, I.A., Costa, G.B., Abrahão, J.S., Universidade Federal de São Paulo, Unifesp, Rua Pedro Kroon, E.G., Vieira, F.N., Ambrósio, L.L.D., Sacchetto, L. de Toledo, 781 - 15°andar - Vila Clementino - SP , Marques, C., Paglia, A., Drummond, B.P., Leite, S.M.S., In Brazil there are few studies related to respiratory Trindade, G.S. 1. Universidade Federal de Minas Gerais, UFMG, Av. (HPIV). There is a lack of information about incidence, Antônio Carlos, 6627, Pampulha BH-MG infectionsrisk factors causedand outcomes by human among parainfluenza different patients’ virus populations. HPIVs are divided into 4 different types, 2. Universidade Federal de Juiz de Fora, UFJF, R-José although most clinical infections are due to types 1, 2, Lourenço Kelmer,Campus Universitário - Bairro São Pedro, and 3. The incidence of infection caused by this viral Juiz de Fora agent has been reported between 2% to 7%. The aim 3. Instituto Federal de Educação, Ciência e Tecnologia, of the study was to investigate the occurrence of HPIVs IFET 1, 2, 3 and 4 in different patients hospitalized and non- hospitalized with respiratory symptoms in a tertiary Emerging infectious diseases frequently present a viral hospital in São Paulo. Patients included in the study etiology and may involve humans and small rodents as were in hematopoietic stem cell transplant (HSCT) seen for several zoonotic viruses. Alterations in wild program, recipients of kidney transplants (Tx Renal), environments affect directly public health, facilitating children with congenital heart disease (CARDIO) and the emergence of unexpected zoonosis. This work adults and children hospitalized with suspected of intends to gather a fauna prospection of small mammals H1N1/pdm/2009 (sH1N1) infection. Included patients at two rural areas of Minas Gerais state and use molecular were those who had symptoms of acute respiratory approaches to identify viruses these animals have had infection or asymptomatic patients who have contact contact with, exploring their roles as hosts or reservoirs. with patients presenting with infection. The present Rio Pomba and Serro cities are currently under the study analyzed the diagnostic for HPIV 1, 2, 3 and 4 spot. From an effort of 9600 traps, 96 animals were by Real Time Reverse Transcription-PCR (RT-PCR) in caught (1%). Forest, pasture and domiciliary areas were these patients. We studied 1087 samples from patients attended between March 2002 to December 2012, these 74.5% of rodents and 25.5% of small marsupials have samples were TCTH (N=383), Tx Renal (N=250), Cardio been caught. A greater number of individuals are seen at covered. Preliminary field results demonstrated that (N=130) and sH1N1 (N=324) and were collected in a rain forest (62.7%), whereas higher diversity is observed ward or in the ambulatory. The virus was detected in at savannah. Calomys (40,7%) and Akodon (26.5%) 76 samples (7%). The HPIV-3 was the most frequently represent the genera most captured at rain forest; detected (61.8%), followed by HPIV-2 (15.8%), HPIV- both are potential hosts of arenaviruses. Marsupials as 4 (14.5%) and HPIV-1 (9.2%). The positivity on TCTH Didelphis (34.2%) and Marmosops (13.2%) were more was 8.4% and on sH1N1 was 7.7%, followed by cardio abundant at savannah. More than half of all rodents September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

155 Human Virology: HV

IOC/Fiocruz, LVRS/IOC/Fiocruz-RJ, Av. Brasil, 4365, RJ, (63.2%) of positive cases presented comorbidity, 21040360 6.9%demonstrating and 4.0% that for the Tx incidence renal. A significantof infection, percentage mainly in 3. Laboratório de Aids e Imunologia Molecular/IOC/ immunocompromised patients, is underestimated when Fiocruz-RJ, LabAids/IOC/Fiocruz, Av. Brasil, 4365, RJ, using conventional methods of laboratory detection. It 21040360 reinforces the need of establishing a rapid and sensitive differential diagnosis of respiratory viruses. acute respiratory illness requiring medical intervention HV554 - Protein Profile Of A Bacteriophage Theaffecting influenza individuals infection in isall the age most groups. frequent The causesubtype of Associated With Nosocomial Infections Caused By Multi-Drug Resistant Bacteria epidemics since 1968. Analyses suggest that the Duarte, V.S., Dias, R.S., Silva, C.C., Honda, E.R., Nunes, A(H3N2) has been dominant in most seasonal influenza M.V.M., Machado, B.L.L., Xavier, G.F., De Souza, F.O., De by a complex interaction between the high mutation Paula, S.O. evolutionaryrate of the virus, dynamics gene of rearrangements the influenza H3N2 and is selectionmodeled Universidade Federal de Viçosa, UFV, Avenida Peter exerted by the immune system. In Brazil, the knowledge Henry Rolfs, s/n - Campus Universitário - LIVM The bovine mastitis in large etiology, causes great of influenza virus epidemiology and evolution is still economic losses worldwide. Besides costly illness causes incipient.in Brazil during Thus, our 1999-2012 objective and is to to reconstruct understand the the profile role public health problems such as food poisoning and the of evolutionBrazil in andthe geographicaldynamics of spreadglobal ofvirus influenza spread. H3N2 For emergence of multi drug resistant bacteria. Looking this, a total of 205 Brazilian sequences (HA1 portion for an alternative to antibiotics, the phage, which is of HA gene) as well as sequences from other South based on the use of phage or bacteriophage, which are American countries (n = 58), Australia (n = 96), Hong viruses that infect bacteria, appears as an option for the Kong (n = 72), United Kingdom (n = 58) and New York treatment of clinical and subclinical mastitis. There was (n = 70) were analyzed by Maximum Likelihood and Bayesian methods. The phylogenetic tree of Brazilian spp. and Escherichia coli, two major etiological agent. anFrom isolated water lytic samples bacteriophage from central specific fundingfor Streptococcus network structure, with a clear increase in the genetic divergence and sewage treatment, proceeded to the viral isolation influenzaover time. A(H3N2) The mean sequences rate of evolution showed of a thestrong HA1 temporal portion of HA gene was estimated at 4.7x10-3 substitutions/ analysis by transmission electron microscopy. Ten andmicroliters viral aliquots were pipetted were confirmed over a grid by (200 morphological meshes), sequences from different countries and form different previously coated with Formvar and incubated at room site/year.Brazilian regions, Despite distribution great intermixed of viral sequences of influenza in the phylogenetic tree was not completely random and some level of geographic structure was evident. The strongest temperaturewith 2% uranyl for acetate five minutes for twenty and seconds the excess and analyzed removed supported migration events occur between southern withelectronic filter paper.microscope Viral particlesZeiss EM adhered 109 TEM were operated contrasted at 80 and southeastern Brazilian regions at the local level, and kV. We found a bacteriophage caudate belonging to the between Brazil and both other South American countries order Caudovirales, family Myoviridae with icosahedral and New York at global level. This analysis also indicates heads and short noncontractile tail. After morphological, that Brazil has less epidemiological linkages than others studies will be undertaken for further molecular and countries and possibly play a minor role as hub for serologic studies in vivo. Financial support: IOC/FIOCRUZ, DECIT/MS, CAPES HV559 - Evolutionary Dynamics Of international dissemination of influenza A(H3N2) virus. Influenza Virus A (H3n2) During 1999- HV567 - Mayaro Virus Circulation In Urban 2012 In The Southern, Southeastern And Areas During Dengue 4 Outbreak In Mato Northeastern Brazilian Regions Grosso, Brazil Born, P.S., Resende, P.C., Siqueira, M.M., Motta, F.C., Zuchi, N., Heinen, L.B.S., Santos, M.A.M., Vininski, A.E., Bello, G. Ueda, S.K., Pereira, F.C., Gondim, B.H.F., Souto, F.J.D., Dezengrini-Slhessarenko, R. 1. FUNDAÇÃO OSWALDO CRUZ, Fiocruz, Av. Brasil, 4365, RJ, 21040360 1. Universidade Federal do Mato Grosso, UFMT, Av. 2. Laboratório de Vírus Respiratórios e do Sarampo/ Fernando Corrêa da Costa, 2367 - Boa Esperança. Cuiabá - MT

156 Human Virology: HV

2. Secretaria de Vigilância em Saúde, SVS, Centro MT, Centro Político Administrativo, Palácio Paiaguas, Bloco Político Administrativo. Rua D, S/Nº - Bloco 05. Cuiabá - MT D - Cuiabá - MT 3. Secretaria Estadual de Saúde, SES, Centro Político Flavivirus genus comprises many arboviruses Administrativo, Palácio Paiaguas, Bloco D - Cuiabá - MT transmitted mainly by mosquitoes in tropical areas. 4. Laboratório Central de Saúde Pública de Mato Dengue virus serotypes (DENV1-4) are the most Grosso, MT-Laboratório, Rua Thogo da Silva Pereira, 63 – prevalent worldwide, posing an important public health Centro. Cuiabá - MT issue. Serology for Saint Louis Encephalitis (SLEV) has been described in equines from MT, however SLEV distribution is poorly unknown in the State. We tested problem for human health. Mayaro (MAYV) is an 604 serum samples collected in 2012 from patients with ArbovirusesAlphavirus belonging occur in tropicalto Togaviridae areas, posingfamily, atransmitted significant by Haemagogus janthinomys and Aedes aegypti mosquitoes. MAYV is endemic in the Amazon region, N-PCR (DENV-1 472 bp; DENV-2 316 bp; DENV-3 628 reported during human outbreaks in surrounding States. acute febrile illness in MT by RT-PCR with genus-specific bp; DENV-4 222 bp; YFV 253 bp; SLEV 232 bp; WNV 195 Serology has been demonstrated in Indians in 1967 in MT. primers to Flavivirus (958bp) and species-specific semi- bp; ROCV 230 bp; BSQV 388 bp; IGUV 254 bp; ILHV 474 We collected 604 serum samples from patients with acute bp). Positive amplicons were submitted to sequencing. febrile illness suspected of harboring dengue infection Among 604 patients, 317 (52.48%) were positive for between Jan-July/2012. Samples were submitted to DENV-4, 24 (3.97%) for DENV-1, 1 (0.17%) for DENV-2, viral RNA extraction (QIAmp viral RNA mini kit), RT- 1 (0.17%) for DENV-3 and 2 (0.33%) for SLEV. Positive PCR (Alphavirus, 433 bp) followed by semi-nested-RT- PCR (MAYV 270 bp; AURAV 98bp; EEEV 124 bp; WEEV patients, 9 were co-infected with DENV-1/4, 1 with DENV- 208 bp; VEEV 400 bp). Amplicons were sequenced and 2/4 and 2 with SLEV/DENV-4. Co-infections are frequent analyzed with MEGA/BLASTn. We found 16/604 (2.6%) results were confirmed by sequencing. From these when there is co-circulation of different serotypes, positive for MAYV in Cuiabá, Várzea Grande, Nossa Sra especially in hyperendemic areas. Most of the cases are Livramento and Sorriso: 2/16 (12,5%) positive only primoinfections in adults residents of urban areas. As for MAYV and 14/16 (87,5%) co-infected with DENV-4. Dengue febrile cases are relatively common every year Mayaro causes a mild febrile illness with a short viremic period, which is clinically mistaken with Dengue Fever. population susceptibility to infection. In this regard, of MT, probably transmitted by Aedes aegypti. These in the State, immunity to different serotypes influences being the most prevalent serotype during this epidemic. aspects, combined with absence of routine laboratorial The findings suggest MAYV is circulating in urban areas SLEV status is probably underestimated in MT. Birds are diagnose in MT to other arboviruses besides Dengue DENV-4 was identified for the first time in MT in 2012, reservoirs and mosquitoes as Culex sp., A. trianulattus serotypes, may contribute to the lack of comprehension and Sabethes belisarioi are vectors. Serology and virus of MAYV infection dynamics, emphasizing the necessity of surveillance improvement and the establishment of equines, mosquitoes and birds in the Amazon region, support: CNPq/CAPES/FAPEMAT/UFMT. identification/isolation have been described in humans, infection by SLEV in Cuiabá. Further studies involving fast and specific diagnostic tools in the State.*Financial HV568 - Dengue And Saint Louis Encephalitis SPphylogeny and South analysis Pantanal.This and entomological is the first reportsurveillance of human are Virus Circulation In Mato Grosso, Brazil necessary to comprehend Flavivirus dynamics in MT. In 2012 *Financial support: CNPq/CAPES/FAPEMAT/UFMT. Heinen, L.B.S., Zuchi, N., Santos, M.A.M., Ueda, S.K., HV569 - Cytomegalovirus (Cmv) Infection Vininski, A.E., Pereira, F.C., Gondim, B.H.F., Souto, F.J.D., In Patients Living With Hiv/Aids, Belém, Dezengrini-Slhessarenko, R., Pará, Brazil. 1. Universidade Federal de Mato Grosso, UFMT, Av. Silva, D.F.L., Arruda, L.M.F., Silva, N.F., Sagica, F.E.S., Fernando Corrêa da Costa, 2367 - Boa Esperança. Cuiabá - Moraes, M.M., Santos, T.V.R., Jr., J.L.S.A., Sousa, R.C.M. MT 1. Instituto Evandro Chagas, Iec/Svs/Ms, Br 316 Km 07 2. Laboratório Central de Saúde Pública de Mato 2. Núcleo De Medicina Tropical, Nmt/Ufpa, Av. Grosso, MT-Laboratório, Rua Thogo da Silva Pereira, 63 – Generalíssimo Deodoro S/N Centro. Cuiabá - MT 3. Faculdade De Medicina Da Ufpa, Fmufpa, Av. 3. Secretaria de Vigilância em Saúde, SVS, Centro Generalíssimo Deodoro S/N Político Administrativo. Rua D, S/Nº - Bloco 05. Cuiabá - MT 4. Secretaria Estadual de Saúde de Mato Grosso, SES/ September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

157 Human Virology: HV

Due the increase in the prevalence of HIV/aids in the area and over 50 million persons are infected each year. world, the infection by CMV became a serious problem of 1 to DENV-4) and mainly transmitted by the Aedes by HIV and the reduction TCD4+ cells. The aim of this Dengueaegypti. The virus mosquito is classified vector in has four been serotypes found (DENV-in Belo publicresearch health was becauseto describe of the the immunodeficiency clinical, epidemiological caused Horizonte since 1986 and many outbreaks already have and molecular aspects of CMV in patients living with occurred. In 2013 there was an outbreak, with almost aids admitted to the Hospital Barros Barreto, Belém-Pa. We performed serological method and PCR in Real Time 40.000showed confirmedthe highest cases number so far. of dengueIn 2012 cases.The only 558 aim cases of CMV viral load. The socio-economic data indicated high werethis study notified. was toThe detect northwest DENV indistrict larvae of of Belo Aedes Horizonte aegypti, (qPCR)frequency for of detection individuals of DNAwith andincomplete quantification level of of basic the from oviposition traps displayed at northwest region of education (35.3%) and low family income. The medical Belo Horizonte in November 2012. Eggs from 30 paddles data revealed co-infection with several pathogenic were collected and hatched in laboratory conditions. agents, the frequent ones being lung tuberculosis, neurotoxoplasmosis, extrapulmonary tuberculosis and characteristics and separated into 30 pools ranging from Each4-30 larvae.larva was Viral identified RNA was intoextracted specie and by subsequent morphological RT- IgM- (99.6%) and IgG+/IgM+ (2.1%). In the analysis for PCR, qPCR using primers to the 5 ‘UTR region and C-prM, diarrhea.qPCR, 55,8% The ofserological individual profile presented of the CMV patients viral was load IgG+/ and was performed. From the 30 pools analyzed, 3 (10%) the average was 107479,48 copies/ml. During the study, 49 individuals had died, of which 63.3% were positive in qPCR and one IgM+ by serological method. It was wereanalyzed positive and comparedin qPCR and with PCR. standard The amplified samples DNAand then was purifiedused to andconstruct sequenced. the phylogenetic The sequences tree. obtained Phylogenetic were (z=1,859; p=0,0315) of individuals who died with analysis of the sequences indicated that these samples observedpositive diagnosis significant for difference CMV by qPCR among in the relation proportions to the belonged to DENV-2 Asian-American genotype. surviving and positive individuals for the same diagnosis method. The relative risk of mortality in patients with HV571 - Orthobunyavirus Ocurrence In co-infection HIV/CMV was evaluated. This analysis Humans With Febrile Acute Illness And showed that risk increases about two times when In Culex Quinquefasciatus Mosquitoes In patients present this morbidity condition (RR=1,66; Mato Grosso, Brazil p=0,0449). The largest occurrence of positives in qPCR Cardoso, B.F., Serra, O.P., Zuchi, N., Heinen, L.B.S., was observed when the lymphocytes TCD4+ were in Gondim, B.H., Pereira, F.C., Santos, F.A.L., Santos, M.A.M., Souto, F.J.D., Dezengrini-Slhessarenko, R. the analysis registered >200 cels/mm3. These results 1. Laboratório Central de Saúde Pública do Mato demonstrated that the lymphocytes TCD4+ in levels levels <100/mm3. The individuals were negative when Grosso, MT- Laboratório, R Tenente Thogo da Silva Pereira occurrence of cytomegalovirosis. We concluded also that 63 - Centro Sul - Cuiabá/MT <100/mm3the method qPCR constitute is the best important way for diagnostic risk factor of forCMV the in 2. Universidade Federal de Mato Grosso, UFMT, Av. imunodepressed patients. Fernando Corrêa da Costa, nº 2367 - Bairro Boa Esperança. Cuiabá - MT HV570 - Dengue Virus-2 Detection In Larvae 3. Secretária de Vigilância em Saúde, SVS, Centro Of Aedes Aegypti In The City Of Belo Político Administrativo, Palácio Paiaguas, Bloco D. Cuiabá/ Horizonte In 2012 MT Marins, K.S., Miranda, D.P.J., Rosa, J.C.C., Martins, 4. Secretária Estadual de Saúde, SES, R. Treze de Junho, C.P.S., Pessanha, J.E.M., Figueiredo, L.B., Bonjardin, C.A., Ferreira, P.P., Kroon, E.G. 1055 - Centro Sul Cuiabá - MT 1Laboratório de Vírus, Departamento de Microbiologia, The genus Orthobunyavirus, family Bunyaviridae comprises several arboviruses already detected in Instit, UFMG, Av. Antônio Carlos, 6627 Brazil. Oropouche (OROV) is considered the most 2. Gerencia de controle de zoonoses- Secretaria prevalent arbovirus after Dengue virus in the country, Municipal de S, SMSBH-GCS being the most prevalent in the Amazon region. Dengue is the most important arboviral infecction Epidemiological situation of these viruses in MT is worldwide. It is a great concern in tropical and unknown. RNA was extracted with QIAmp viral RNA kit subtropical areas. The World Health Organization from serum samples of 604 patients with acute febrile estimates that 40% of the population are living in risk illness from Mato Grosso (2012). Pools of adult female

158 Human Virology: HV

Culex quinquefasciatus (n=319) and Culex sp. (n=138) 3 HC05, Enterovirus C (Sabin) and Yellow fever virus were collected with Nasci aspirators and hand net in (17D strain) were used during the initial primer tests. 200 points in Cuiabá between January and April, 2013. In order to obtain the control plasmids, the amplicons Total RNA was extracted (Trizol) from 50 pools of Culex were cloned in pGEM ®-T Easy system. These plasmids quinquefasciatus and 5 of Culex sp. RNA from human were sequenced and used to calculate the reactions samples (n=604) and mosquitoes pools (n=55) were submitted to reverse transcription (Superscript III) that mimics the CSF with known amounts of viral load with primer BUN-S (Orthobunyavirus; segment S). The efficiency.was used. The To testreactions the analytical used in this sensitivity, platform a showed matrix cDNA of 98 human samples and 55 pools of mosquitoes were submitted to N-RT-PCR with primers BUN-C/ HHV 3, 110% ENTV and 92% FLAV. When an analytical BUN-S and BS-C e BS-S, this latter amplify the segment highsensitivity efficiency114% test was performed, for HHV1 our and data HHV2, demonstrated 113% for S of Simbu group orthobunyaviruses (300 bp). Results high sensitivity, with detection limit up to 1 PFU/µl demonstrate 1/98 (1%) human sample from Cuiabá and for HHV 1, ENTV and FLAV. Therefore, the described 2/50 (4,0%) pool of Culex quinquefasciatus positive for tests showed that our platform can be useful for rapid an Orthobunyavirus from Simbu group. The sequences diagnosis of viral meningitis, in the health system. In (mosquitoes and human sample) presented 84-94% of the future, it can be used as a tool for monitoring and identity with OROV sequences from IEC/Para. In urban control of meningitis caused by virus. Financial Support: centers, Culicoides paraensis and Culex quinquefasciatus FAPEMIG, CNPq, CAPES. are considered vectors for OROV. C. quinquefasciatus is an excellent reservatory, transmitting OROV only in HV579 - The Risk For The Dengue Hemorrahgic high viremic levels. Oropouche fever is clinically similar Fever In An Association Study In Brazil but milder than Dengue Fever and, serology has been Nascimento, J.H.F., Melo, P.R.S., Rani, M.R.S., Blanton, demonstrated in humans in two cities from Pará in the R.E. border with MT, affected by Cuiabá-Santarém highway. 1. Universidade Estadual de Santa Cruz, LAFEM/ UESC, Rodovia Jorge Amado, km 16, Bairro Salobrinho, with funds from CAPES, CNPq and PROPEQ / UFMT. This is the first report of OROV in MT. * Project developed Ilhéus/BA. CEP 45662-900 HV576 - Development Of A Real-Time Pcr 2. Case Western Reserve University, CWRU/CGHD, Plataform For Viral Meningitis Diagnosis 2103, Cornell Rd. Celeveland, OH. 44106. USA Oliveira, D.B., Almeida, G.M.F., Botelho, L.M., Abrahão, J.S., Bonjardim, C.A., Trindade, G.S., Ferreira, P.C.P., The dengue virus (DENV) infection has become one Kroon, E.G. of the most important arthropod-borne diseases, particularly in Latin America and Asian where the Universidade Federal de Minas Gerais, UFMG, Avenida outbreaks occur regularly. The dengue infection outcome Antônio Carlos, 6627, Caixa Postal 486, Bloco F4, Sala 258 is a result on interactions between the virus, immune 31270-901 Bel system response and human genetic factors, as in most multifactorial biological process. Despite the severity of Meningitis is a worldwide disease, which main etiologic the DHF, only 2 – 4% of those with secondary infections agents are viruses, bacteria and fungus. Viruses are the will develop and only 1%, DSS. This observation main causes of central nervous system (CNS) infection suggests that human genetic factors may in part, at least, around the world. In Brazil, there are 11,500 cases interfere in DENV infection outcome. The post-genomic / year putative reported cases of viral meningitis. era has created new methods for understanding the role and relationship between genetic factors and diseases, etiological agent. Human Herpesvirus 1 (HHV 1), Human identifying candidate genes, however the knowledge However,Herpesvirus for 2most (HHV cases 2), Humanthere is Herpesvirus no identification 3 (HHV of the3), viruses from the Enterovirus genus (ENTV) and viruses limited. The goal of this study is to identify SNPs in from the Flavivirus genus (FLAV) are the main etiological ofcandidate the host genes genetics (IL28B, influence JAK1, CD209, on dengue MICB and severity PLCE1) is agents of viral meningitis. The objective of this work was in association with clinical presentation of Dengue in to develop a real-time PCR platform for HHV 1, HHV 2, samples from the state of Bahia and Mato Grosso (Brazil). We perform genotyping assays in 300 samples (94 DHF (CSF) of patients with clinical suspect of viral meningitis. and 206 DF), using ABI Taqman Allelic Discrimination HHVPrimers 3, ENTV were designedand FLAV (or diagnosis based on in literature), cerebrospinal targeting fluid Assay. The statistical analyses were performed using the conserved regions in the genome of these virus (HHV 1, VassarStats. Differences were assessed by chi-square HHV2, HHV 3 and HHV 5) or genus (ENTV and FLAV). test. The Fisher test was used to evaluate the association The viral isolates HHV 1 EK, HHV 2 (ATCC VR 590), HHV between IL28b, the rs12979860 TT genotype, JAK1, the September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

159 Human Virology: HV rs11208534 genotype AA, and the risk of developing HV590 - Dengue Viruses In The State Of Rio the hemorrhagic form of the fever. Tests were two-sided Grande Do Norte, Brazil, 2010-2012 Branco, M.S.D., Sousa, D.M.C., Monteiro, J.D., Costa, D.M.P., Costa, C.D., Lima, T.L.C., Almeida Junior, R.F., andancestry p<0.05 markers. were considered It’s noteworthy significant. that Furthermore, understanding to Roque, A.C.M., Aquino, A.A., Farias, K.J.S., Fernandes, evaluatethe host theresponse ancestry and influence, the pathogens in this study, mechanisms we use 10is J.V., Araújo, J.M.G. determinant in developing vaccines and drugs, relating 1. Universidade Federal do Rio Grande do Norte , improving health aspects in developing countries, which UFRN, Departamento de Microbiologia e Parasitologia, CB, tosome efficiency diseases and represent safety, besides,huge challenges it’s important to public for Campus Universitário, Natal health, such as in Brazil, where the DHF is among the 2. Laboratório Central Doutor Almino Fernandes, most severe infectious grievances. Financial Support: LACEN-RN, Rua Cônego Monte, 410 - Quintas Cep: 59.037- CNPq 170. Natal-RN HV589 - Emergence Of A New Dengue Serotype Dengue is a mosquito-borne viral infection caused by In Southeast Asia one of the four dengue virus serotypes (DENV-1 to 4), Vasilakis, N. belonging to genus Flavivirus, family Flaviviridae. In this study, we present the results of a laboratory surveillance University of Texas Medical Branch , UTMB, USA conducted in the State of Rio Grande do Norte during the Sylvatic dengue viruses (DENV) are both evolutionarily period from 2010 to 2012. A total of 1,581 cases, reported and ecologically distinct from human DENV and are between January 2010 and December 2012 at various maintained in an enzootic transmission cycle. Evidence of health centers in the state, were studied by the method sylvatic human infections from West Africa and Southeast of virus isolation and / or RT-PCR for viral detection and Asia suggests that sylvatic DENV come into regular contact with humans. Previously, we have demonstrated experimentally in surrogate models of human infection typing.the cases The studied; infection the was union confirmed of the bytwo virus methodologies isolation in and mosquitoes that adaptation was not required for 27% of the cases, while the RT-PCR confirmed 24% of urban transmission and thus emergence into the human the circulation of all four serotypes of dengue virus in transmission cycle is high. Critically, the underlying confirmedRio Grande 30% do ofNorte, the cases with studied.the circulation This study of detectedDENV-1, mechanisms of dengue emergence will provide key DENV-2, and DENV-3 in 2010, and the circulation of insights into the epidemiology and risk of arboviral DENV-1, DENV- 2, and the introduction of DENV-4 in the infections in Southeast Asia; these may also lead to the state in 2011, after a 30-year period without registration preparation of guidelines for arbovirus surveillance, in the country. In 2012, only the circulation of DENV-4 control and outbreak management. The objective of this was detected. Regarding the spatial distribution, almost study was to investigate the nature and breadth of the 60% of positive cases occurred in Natal and Parnamirim. newly emerged novel sylvatic dengue transmission by The monthly distribution showed a greater number of determining the distribution, ecology and behavior of the positive cases in the months of April (21%) and May sylvatic mosquito species that facilitate its maintenance in the zoonotic cycle. Our research focused on the age group was 0-10 years with 38% positive cases, and sylvatic transmission cycle in Sarawak, Malaysia, where (23%)only in (X2: 2012, 61.13, the dfage = group11, p <0.0001). 11-30 years The wasmost the affected most this cycle was recently detected and critically where affected with 51.33% of the cases (X2: 27, 83, df = 6, p = 0.0001). Regarding gender, females represented 52% of responsible for severe disease. Phylogenetic analysis the cases. Continuous monitoring of circulating serotype humanindicates infections that this have virus been is basal identified, to all otherincluding serotypes those is critical for dengue surveillance not only to detect the suggesting its deep ancestral origin. Serology based on introduction of a new serotype, but also to understand the plaque reduction neutralization test indicates that the transmission on disease severity and the shift from the antigenic relationship of the newly emerged virus age groups among different populations and regions. of dengue viruses. Our results indicate the isolation and HV592 - Detection Of Herpes Simplex Virus Type 1 In The Genital Tract Of Pregnant ischaracterization significantly different of a new than sylvatic any of dengue the other serotype four types that has not yet emerged and established into the human And Nonpregnant Women Lima, E.G., Miranda, C.A.N., Cobucci, R.N.O., Lima, for the long-term control of dengue using vaccines D.B.S., Fernandes, T.A.A.M., Araújo, J.M.G., Fernandes, J. V. transmissioncurrently under cycle. development. This finding has major implications

160 Human Virology: HV

1. Universidade Federal do Rio Grande do Norte, 1. Instituto de Virología-FCM.UNC, , Enfermera UFRN, Campus Universitário Gordillo s/n. Ciudad Universitaria. Córdoba, Argentina 2. Universidade Potiguar, UnP, Av Salgado filho - Natal 2. Catedra de Ginecología. Htal. Nacional de Clínicas., RN , Santa Rosa 1564. Córdoba, Argentina 3. Universidade do Estado do Rio Grande Norte, UERN, 3. Servicio de Infectología. Hospital Nacional de Mossoró - RN Clínicas, , Santa Rosa 1564. Córdoba, Argentina 4. Laboratorio de Reproducción y Androgenesis, , Herpes simplex virus (HSV) has two closely related serotypes, HSV-1 and HSV-2, which are a common Chacabuco 1123. PB. Córdoba, Argentina cause of sexually transmitted disease. HSV-1 is usually 5. Dpto de Tocoginecología Quirúrgica. Htal Materno transmitted during childhood via non-sexual contact Neonatal, , Av Cardeñosa 2900. Córdoba, Argentina and traditionally has been associated primarily with 6. Cátedra de Química Biológica. Facultad de orofacial infections. However, HSV-1 has emerged during Odontología, , Haya de la Torre s/n. Ciudad Universitaria. the last decades as the main causative agent of genital Córdoba, Argentina herpes. Recent studies have shown a greater proportion 7. Cátedra de Bacteriología y Virología. FCM-UNC, , Santa Rosa 1095. Córdoba, Argentina 1. In pregnant women the virus can reach the fetus or 8. Administración Provincial de Seguro de Salud, , M. T ofneonate, first-episodes causing ofneonatal genital herpes,herpes whichwere caused is a potentially by HSV- de Alvear 758. Córdoba, Argentina devastating disease. The aim of this study was to evaluate the prevalence of genital infection by HSV-1, 9. Facultad de Matemática, Astronomía y Física., , correlating with the results of cytologic and colposcopic Av Medina Allende s/n. Ciudad Universitaria. Córdoba, examinations and to identify risk factors. Included in Argentina this study were 236 patients- 106 pregnant and 130 10. Instituto de Educación Superior. “Dr Domingo nonpregnant attended in the screening program for Cabred”,Deodoro Roca s/n. Parque Sarmiento. Córdoba, cervical cancer, in Natal/RN, Brazil, during the period Argentina 2011-2012. The patients were examined by colposcopy, and then two cervical specimens were collected, one Most HPV studies are oriented to the etiology and for the cytologic exam and the other for analysis by natural history of the infection, and their relationship PCR to amplify a sequence of the genome of HSV-1. with cancer, however, there are few studies aimed at Statistical analysis was performed by comparison tests evaluating the population` knowledge. Objective: To of proportion and univariate logistic regression to analyze the degree of knowledge of the population about HPV and its prevention. From July to November 2012, we conducted a survey with 27 multiple-choice calculateoverall prevalence odds ratios of HSV-1 and theirinfection respective was 28.4%, confidence being intervals,21.7% in pregnant considering and significant 33.8% in non-pregnant a p-value ≤ 0.05. women, The University of Cordoba (UNC), the Institute Dr. Domingo items,Cabred; to patients first-year of service: university gynecology students of of: two National public between the presence of the virus and the occurrence of hospitals (HP), infectology of HP, a private laboratory therecervical significant changes difference.detected by No the correlation cytologic or was colposcopic observed examinations. Analysis of the relationship between biggest provincial health care insurance. The survey genital infection by HSV-1 and socio-demographic andconsisted one ofof UNC, two andsections: employees individual and affiliatescharacteristics of the variables and sexual activity revealed no association. and Basic knowledge of HPV. Volunteers aged 18 to 80 We found a high prevalence of genital infection by HSV- participated (N=1,297). Most were single, with access 1, with a higher rate among non-pregnant women, but to secondary education, jobless, heterosexual, without this was not found to be associated with the presence of history of STIs and HPV heard about through the media. cervical changes nor with socio-demographic variables The total number of correct responses (CR) was 44.92%. and sexual activity. The frequency of Pap (84.97%) was the best and the protection for condom use (9.79%), the worst. The RC HV593 - Lack Of Knowledge As A Risk Factor for relationship HPV and cervical cancer was 62.07%; In Human Papillomavirus (Hpv) Infections and with warts 40.02%. Almost 55% did not know Venezuela, R.F., Monetti, M.S., Kiguen, A.X., Frutos, M.C., about types of HPV that the vaccines protect. Statistical Mosmann, J.P., Juan Ferrari, J., Luis Kremer, L., Rosa analysis shows that: women, single people, workers, the Molina R., Hugo Bolatti, H., Javier Aguilar, J., Jorge Paván, better educated, those who have had an STI or HPV and J., Carlos Alonso, C., Alberto Wolfenson, A., Claudia receiving information through medical or educational Amusategui, C., Cecilia Cuffini, C. establishments have greater knowledge of the topic. Only

161 Human Virology: HV

0.15 % of participants answered all questions correctly. and sexual activity revealed an association with ethnicity, marital status, and number of sexual partners. knowledge about HPV among people over 18 and The women in this study had a high prevalence of genital Thisdemonstrates is the first lack study of knowledge. in Cordoba This city, lack which of knowledge assesses infection by HSV-2, with higher rates among single white is a risk factor and as such, prevention programs, not women who had multiple sexual partners over their only should emphasize diagnosis and the vaccines, but lifetime. No association with pregnancy was found. also incorporate new communication strategies that allow the arrival of information accurately, to different HV595 - Detection Of Human Papillomavirus strata of society. (Hpv) In Oral Cavity Lesions: Comparison With Other Risk Factors HV594 - Prevalence Of Genital Infection Venezuela, R.F., Angel, T., Frutos, M.C., Kiguen, A.X., By Herpes Simplex Virus Type 2 In Pregnant Monetti, M.S., Sollazo, M., De Prato, R.F., Cuffini, C. And Nonpregnant Women Miranda, C.A.N., Lima, E.G., Cobucci, R.N.O., Lima, 1. Instituto de Virología-FCM.UNC, , Enfermera D.B.S., Fernandes, T.A.A.M., Araújo, J.M.G., Fernandes, Gordillo s/n. Ciudad Universitaria. Córdoba, Argentina J. V. 2. Cátedra de Estomatología. Facultad de Odontología. UNC, , Haya de la Torre s/n. Ciudad Universitaria. Córdoba, 1. Universidade Federal do Rio Grande do Norte, Argentina UFRN, Campus Universitário 2. Universidade Potiguar, UnP, Av Salgado filho - Natal Human papillomavirus (HPV) is considered the causative RN agent of cervix cancer; however, its relationship with 3. Universidade do Estado do Rio Grande Norte, UERN, oral cancer is controversial. Objectives: To detect the presence of HPV genotypes in lesions of the oral cavity Mossoró - RN and its correlation with other risk factors. Material and Herpes simplex virus type 2 (HSV-2) is a neurotropic Methods: Presence of HPV was studied by polymerase virus, which infects epithelial cells after it is transported chain reaction in samples from benign lesions (9 cases), to the neurons, generally of the lombosacrais ganglia, potentially malignant lesions (30 cases), neoplasias where it remains latent and may be reactivated (16 cases) and healthy mucosae (30 control). The periodically. It is the most common cause of anogenital results from the different groups were compared; in ulcers and during pregnancy may cause eye or skin addition to their clinical histopathological variables and lesions, meningoencephalitis, disseminated infections, conventional risk factors (tobacco smoking and alcohol or foetal malformations. The aim of this study was consumption, mainly). Results: HPV was detected in to evaluate the prevalence of genital infection by 88.89% of the samples from oral benign lesions, 41.38% HSV-2, correlating with the results of cytologic and of oral PML samples and 56.25% of oral neoplasias. HPV colposcopic examinations, and to identify risk factors. was not detected in the control group. The most prevalent Participants included 236 women (106 pregnant and genotypes were 16 and 6. Together, these two genotypes 130 nonpregnant) enrolled in a screening program for cervical cancer in Natal / RN, in the period 2011-2012. association was observed between HPV and male gender, The patients answered a standardized questionnaire reachedtobacco smokers,55% of the alcohol total number drinkers of and cases. benign A significant lesions. and underwent a colposcopy examination. Then, two Tobacco smoking and alcohol intake were associated cervical specimens were collected—one for cytologic to neoplasias. Conclusions: Our results showed that examination and the other for analysis by PCR to amplify conventional risk factors like tobacco smoking and a sequence of the genome of HSV-2. Statistical analysis was performed by comparison tests of proportion and development of oral neoplasias; however, 56.2% of the univariate logistic regression to calculate odds ratios alcoholneoplasias drinking, tested havepositive more for influence HPV; the than percentage HPV in the of HR-HPV detection increased with the severity of the lesions, suggesting its possible involvement in malignant andHSV-2 their infection respective was 16.5%,confidence with intervals, 17.9% in consideringpregnant and a processes. PIO-MincytCba N 170/2011. significant p-value of ≤ 0.05. The overall prevalence of difference between the two groups. A higher proportion HV596 - Mutation Study Associated With 15.4%of women in non-pregnant tested positive women. for HSV-2 There among was no thosesignificant who Carcinogenesis Of Human Papillomavirus had changes in both colposcopy and cytology, with Genotype 16, Detected In Cervical Lesions. Mosmann, J., Frutos, M.C., Monetti, M., Kiguen, A.X., pregnant. Analysis of the relationship between genital Venezuela, R.F., Cuffini, C. noinfection significant by HSV-2 difference with betweensocio-demographic pregnant andvariables non- September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

162 Human Virology: HV

Instituto de Virología Dr JM Vanella, FCM-U. N. de today. However, this technology shows an important Córdoba, Ciudad universitaria. Cba. Argentina disadvantage compared to modern methods, since it is not suitable for multiplex assays, a major improvement, Human papillomavirus (HPV) is responsible for one of especially for blood centers. The multiplex bead array the most frequent sexually transmitted infections. The assays (MBBA) has proven to be a robust and modern option for the development of serological multiplexes by Ho et al. Currently, 4 variants have been described: assays. Among the options for MBBA, xMAP ® technology firstAfrican phylogenetic (Af-1; Af-2), analysis Asian-American of LCR region (AA) was and performed European (Luminex, Austin) is the one with great processing (E). Smith proposed sub-lineages of the E variant and capacity of multiple analytes in a single sample

E6 and LCR sequences could be related to persistent viral and on polystyrene microspheres of 6.5 micrometers otherinfections. investigators The aim claimof this that study specific was themutations phylogenetic in the (multliplex).in diameter as The capture technology support is based for molecules, on microfluidics, which study of HPV16 sequences of cervical samples in order to can include any type of protein. Each microsphere detect the circulating lineages and analyze the presence of mutations related to malignancies. Fifteen samples of HPV16 were studied, they were analyzed by PCR for ismicrospheres, internally filled enabling with differentsimultaneously proportions detection of two of L1, E6 and LCR regions and sequenced. Phylogenetic fluorescentdifferent targets. dyes, The which aim of creates this work different was to setsanalyze of trees were constructed by Maximum Likelihood with the performance of two instruments from Luminex (LX parameters suggested by JModelTest 3.7, with boostrap 200 and MAGPIX) for qualitative diagnosis of HIV and and 1000 pseudoreplica. The phylogenetic analysis HCV. The main advantage of LX200 is the possibility of determined that 86% of the samples belonged to the using more analytes (100) than Magpix (50). The main variant E, to AF-1 7% and to AF-2 another 7%. The advantages of Magpix over Luminex 200 are: lower cost most frequent mutation detected in LCR sequences was of purchase and maintenance, and less space required. G7521A, in 80% of the analyzed samples; it affects the These characteristics have great relevance for high binding site of a transcription factor (YY1) that could throughput laboratories , where several instruments are contribute to carcinogenesis. Other nucleotide changes required. For this study, 83 reference samples (including were detected in LCR which could affect the regulation positive samples for HIV and HCV and negative samples) positive or negative of HPV transcription. In the E6 and backgrounds were selected. The samples were sequences, the most common mutation was T350G analyzed in parallel by both instruments, and the results (L83V) in 67% of the samples, associated with increased (MFI values) were used for statistical analysis. The contribution on molecular epidemiology of HPV16 obtained (90,76%) and suggested a strong correlation riskin Cordoba. of persistent The high infection. detection These rate results of the areE variant the first is correlationbetween the coefficient two LX200 was and calculated MagPix, andcorroborating the result consistent with the patterns of human migration. The importance of the study of circulating variants and the between these instruments, according to the application analysis of the presence of changes in the nucleotide previousand laboratory findings needs, and regarding allowing multiplex for the capability. free choice epidemiology and also in the impact of these variations HV600 - Comparison Of The Directigen Ez structureon Public Health is significant, Affairs when in twothey areas:are correlated in molecular to the Flu A+B Test, The Quickvue Influenza A+B evolution towards malign processes. Test And The Bioeasy Influenza Ag A/B/A H1n1 Pandemic Test For Rapid Diagnosis Of HV599 - Comparative Analysis Between Influenza Virus Infection Two Instruments With Potential Use For Colmanetti, T.C., Barboza, J.D.B., Macedo, P.V., Thomazelli, Multiplex Assays In An Automated System L.M., Oliveira, D.B.L., Durigon, E.L. Loureiro, B.O., Silva, L.B.R., Mello, M.B., Fonseca, B.P.F., Marques, C.F.S., Silva, E.D., Pinto, A.G. Instituto de Ciências Biomédicas USP, ICB - USP, Av. Prof. Lineu Prestes, 1374 - Cidade Universitária Bio manguinhos/Fiocruz, BM/Fiocruz, Av. Brasil, 4365 - Manguinhos- Rio de Janeiro - RJ illness having outbreaks of varying severity with the Considerable progress has been observed in virological Influenzawinter months is an heavily acute, affecting typically children febrile, and respiratorythe elderly. diagnosis during the recent decades, especially in

Linked Immuno Sorbent Assay (ELISAS) represented Whilethe rates both of Influenzahospitalization type A for and lower B can respiratory cause epidemic tract regardsa remarkable to speed, breakthrough, flexibility and and operability. is still widelyThe Enzyme used outbreaks,disease amongst Influenza infants A outbreaksand children. generally Due to increasesa higher

163 Human Virology: HV mortality rate it is essential to differentiation between the Polymerase Chain Reaction Real Time (Q-CMV and Q-BKV). Which were made according to the instructions preventable by vaccination and can now be managed of the manufacturer Nanogen Diagnostics kits, the Influenza and other respiratory viruses. The virus is 7500 Real Time PCR System Apllied Biosystem. Of the the diagnostic performances of three enzyme-linked 111 treated, 70 (63,06%) were male adults. Calculating withimmunosorbent specific antivirals. assays; ThisDirectigen study aimedEZ Flu to A+B compare (BD, the average viral load of CMV (CVCMV) according to the presence or absence of symptoms, it was found to 119.673 symptomatic and 2.413 asymptomatic (t = 1,87 Maryland,Pandemic USA),(Bioeasy, QuickVue Belo Horizonte, Influenza A+BBRA) test with (Quidel, viral San Diego, USA) and Bioeasy Influenza Ag A/B/A H1N1 with the presence of symptoms, we obtain the CVCMV p = 0,03 p < 0,05). Calculating the Chi-square CVCMV culturetests were (Influenza performed A) in and accordance clinical to samples the manufacturer (Influenza B) previously quantified by Real-time RT PCR. All the greaterdetected significance in a male patient than the aged BKV 42, viral who load also (CVBKV)(X2 presented =29,19CVCMV p<0,0001).The1219,20 copies CVBKV / ml. ofComparing 46,12 copies symptomatic / ml was instructions.T-25 (ct = 23.22) For the isolated first test in we MDCK used a cellsseries with of dilutions a viral and CVCMV low or high according to the standard limit (1,load 1/5, of 1.04e5 1/10, copies 1/20, 1/40)of DNA of to thecompare Influenza the diagnostic A sample (1.034 copias/ml - 66,660 milhoes copies / ml), checked performances of the Directigen and the QuickVue. With by Fisher Test CVCMV found that high is proportional the second test we used the same methodology for to the presence of clinical manifestations observed in

(ct = 30.06) with a viral load of 4.15e3 copies of DNA abdominal pain, weight loss weight, asthenia, leukopenia, Influenzato compare B clinicalthe Directigen nasopharyngeal and the washBioeasy. sample Our R-950study patientscough among (p<0,01). others. As cadresIn this of study fever, was diarrhea, concluded vomiting, that demonstrated the effectiveness of the test by returning CMV was the main virus associated with opportunistic no invalid results (n=20) from heavily diluted samples. dilution by Directigen and 10 fold by QuickVue while infectiona study patient. among renal transplant, through its significant The detection of Influenza A ranged from a 20 fold incidence and verification of a co-infection with BKV in HV606 - P53, Cyclin D1 And P16 Protein InfluenzaDirectigen B has had a a higher 5 fold diagnosticdilution for yield both than Directgen QuickVue and Expression In Samples Of Penile Carcinoma Bioeasy assays. In conclusion, our findings suggests that Of Infected Patients By High Risk Hpv. Camilo, H.P., Mota, M.T.O., Calmon, M.F., Bonfim, C.M., forand influenza speed with virus results type Abeing and theobtained same yieldwithin that 15 Bioeasy and 20 Arruda, J.G.F., Soares, F.A., Bonilha, J.L., Rahal, P. forminutes, influenza including B virus. labor All assaysand incubate showed time.good Financialaccuracy 1. Instituto de Biociências, Letras e Ciências Exatas support: FUSP - UNESP, IBILCE/UNESP, Rua Cristóvão Colombo, 2265 HV605 - Differential Diagnosis Of Bairro: Jd. Nazareth 15054-000 São José do Rio Preto Cytomegalovirus And Bk- Virus Infections 2. Faculdade de Medicina de São José do Rio Preto , In Renal Transplant Recipients Inpatient - FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro. São José Belém / Pa, Brazil. do Rio Preto Arruda, L.M.F., Silva, D.F.L., Cruz, A.C.R., Sagica, F.E.S., 3. Departamento de Anatomia Patológica, Hospital Cavalcante, M.D., Felipe, N.S., Marluce, M.M. A.C. Camargo, , A.C. Camargo, R. Professor Antônio Prudente, Instituto Evandro Chagas, IEC/SVS/MS, Ananindeua, 211, Liberdade CEP 01509 - 010. São Paulo - SP Pará, Brasil Penile carcinoma (PC) is a rare invasive tumor with The incidence of opportunistic viruses such as high morbidity resulting from the disease itself and/or cytomegalovirus and BK virus is increasing worldwide, treatment. The human papillomavirus (HPV) is divided in there is increasingly a need for a differential diagnosis high risk (HR) and low risk (LR), according to oncogenic to identify and quantify the viral load in individuals potential. Moreover, in the last years HR HPV has been suffering from infections caused by such viruses. found as major risk factor observed to PC development. The transplanted organs such as kidney need Two viral proteins, E6 e E7, have been associated with immunosuppressant to prevent rejection of the graft, destabilization cell mechanisms in other carcinomas which can trigger CMV and / or BKV infections. The types caused by HPV; however, the involved molecular study made the differential diagnosis of CMV and BKV mechanisms in the viral replication and its host cells interaction are not elucidated yet. The aim of this project Hospital, for the period 14/06/10-11/04/13, through was to verify expressions of proteins p53, cyclin D1 and infections in 111 kidney transplant at Ofhir Loyola September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

164 Human Virology: HV p16, which are cell proteins responsible by cell cycle, in (WBC) assessed. Positive assay occurred in an average of 63.5 days after transplant, varying from 27 to 259 days. and its genotypes by INNOLiPA® kit (HR HPV: 22; LR Leukopenia related to thrombocytopenia was frequently PCHPV: samples. 11; Negative In 60 samples:27) samples was and verified from these, HPV presence36 slides seen in patients with ten or more positive cells (84%) were prepared and utilized to imunohistochemical assay and was rare in patients with less than ten positive cells to verify the quantitative expression of p16, p53 and cyclin D1 by optical desitometry. A comparative study were the most frequent symptoms. All patients with at was performed between slides from infected patients (<20%).least ten Weaknesspositive cells and were gastrointestinal treated using disturbances Gancyclovir samples by HR HPV and without infection patients. p53 in order to get a negative antigenemia. Patients with no e cyclin D1 proteins showed low expression in HR HPV symptoms and less than ten positive cells were controlled when compared with negative HPV samples, nonetheless through immunosuppression management, evolving p16 protein showed an increase expression in HR HPV to a negative assay in the follow-up. CMV quantitative other carcinoma types have been demonstrated viral monitoring of liver recipients, demonstrating a high comparingproteins capacity with negative of deregulating samples (p<0,05).cell cycle Studiesof host. with The antigenemiafrequency of active assay CMV was infection. efficient Patients in post-transplant with at least viral protein E6, has been associated to degradation ten positive cells in 200,000 WBC presented high risk of p53 protein, as well as E7 protein to destabilize of CMV disease. Immunosuppression management was phosphorylation pathway of Rb protein (pRb), which Cyclin D1 and p16 protein are closely related. However, with less ten positive cells. This study was approved by because it is a rare carcinoma, there are not many studies sufficientEthnics Committee for the control of the of CMV institutions infection involved in most patients and all with samples of PC. Therefore, our data can contribute patients signed consentiments to participate. Financial to understand PC carcinogenesis, and can also be of Support: CNPq and FAPESB great importance for patients’ diagnosis and prognosis, HV608 - Cmv And Hhv-6 Co-Infection In Liver analysis. Transplant Patient and may even define new biomarkers useful for clinical Cunha, A.M.G., Cunha, A.G., Costa, S.C.B., Andrade, P.D., HV607 - Quantitative Antigenemia Assay To Galvão-Castro, B., Meyer, R. Monitoring Cmv Therapy And Disease In Liver Transplant Patients 1. Universidade Federal da Bahia, UFBA, Capus do Cunha, A.G., Cunha, A.M.G., Solla, D.J.F., Zantieff, R., Canela Galvão-Castro, B., Meyer, R. 2. Escola Bahiana de Medicina e Saúde Pública , EBMSP, Campus Cabula 1. Universidade Federal da Bahia, UFBA, Campus do 3. Fundação Oswaldo Cruz , FIOCRUZ - LASP, Brotas Canela, Instituto de Ciências da Saúde, Pós-graduação em 4. Universidade Estadual de Campinas, UNICAMP, Imunologia Barão Geraldo 2. Fundação Oswaldo Cruz, FIOCRUZ - LASP, Rua 5. Hospital Português, HP, Graça Waldemar Falcão, 121, Candeal 3. Escola Bahiana de Medicina e Saúde Pública, Cytomegalovirus (CMV) is the leading viral infection EBMSP, Campus do Cabula e Brotas, Centro de HTLV among liver transplant recipients, contributing to morbidity and mortality. However, little is known about Active Cytomegalovirus (CMV) infection is a major cause HHV-6 and CMV co-infection in liver transplant recipients of graft loss and patient death in solid organ transplant. (LTR). We have reported a case of a 56-year-old man who Our goal was to start CMV quantative antigenemia to underwent orthotopic liver transplantation. CMV IgG monitor active infection, assessing disease development was positive. Postoperative period was uneventful. On the 21st postoperative day (POD) he was rehospitalized transplants. From march 2007 through march 2009, 33 due to high fever (38.5°C) and skin rash. He developed andliver recipients the need were of specific monitored antiviral for active therapy CMV infection. in liver Leukopenia and liver dysfunction. Serologic assays CMV seroprevalence was 89% in liver recipients were performed for detection Herpes simplex virus, and 70% in organ donors. Fluorescence quantative Dengue virus, Measles virus and syphilis, all of which antigenemia for the detection of pp65 antigen was used were negative. Nested-PCR in serum samples was for active CMV infection diagnosis (CMV-Brite-Turbo). positive for HHV-6 and CMV antigenemia was negative. Patient monitoring occurred for periods of six months to Immunosuppressive therapy was reassessed. Patient one year, and the antigenemia assay was positive in 52% presented progressive improvement of WBC and clinical (17/33) of patients, with 41% of which (7/17) presenting status, with no fever or skin rash, discharged again in at least ten positive cells in 200,000 White Blood Cells September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

165 Human Virology: HV the 34th POD. CMV antigenemia persisted negative on as control groups of pemphigus patients. It was observed the 45th POD, but became positive on the 60th POD, similar seroprevalence in the four studied groups for with high number of positive cells (465 positive cells in HSV1 (91.5 to 96.1%), and for HSV2 (18.1 to 30.8%) 200,000 WBC). A new hospitalization was needed for i.v. when compared to Brazilian population (95% and 22%, Gancyclovir, discharged on the 78th POD, with a negative respectively). In relation to HSV1, the medians of RU CMV antigenemia. Another hospitalization occurred on (relative units) resulted 176.1 for PF, 207.3 for PV, 163.6 the 116th POD due to right thigh cellulitis and fever for familiar and 184.2 for neighbor groups. Interestingly, which latter presented as muscular abscess. Drainage there was higher anti-HSV1 titers in PV group when was performed and antibiotic started, improving local infection. The last hospitalization occurred on the 190th POD, due to brain lesions and mental disorientation. comparedSearching forto PF, HSV1 familiar and HSV2and neighbor antigens groups in 47 serum(p<0.05). or Lab reports revealed Corynebacterium sp. and Candida Thereplasma was pemphigus no significance samples amongst resulted the negative groups for by HSV2. real- guilliermondii. New antibiotic treatment was performed and he evolved without neurologic sequelae. This case may be related to the pathogenesis of PV, suggesting suggests that HHV-6 active and symptomatic infection time PCR. In conclusion, the results confirm that HSV1 may be a serious and potentially life-threatening no participation of HSV1 transmission by familiars since pathogen following liver transplantation. HHV-6 thattheir probably titles of thereanti-HSV1 is a particular were lower genetic than profile the others with active infection cause fever, leukopenia and probably studied groups. contributed for CMV reactivation, bacterial sepsis and neurologic disease. Clinical manifestations of HHV-6 HV612 - Implementation Of Rt-Pcr In The infections in these patients are not subject to such a clear Confirmation And Identification Of Denv consensus and it is important to continue investigating Serotypes Circulating In Patients With HHV-6 pathogenesis in liver transplant. Financial Suspected Dengue Virus Infection At The Support: CNPq and FAPESB Hospital Das Clinicas, Unicamp, Campinas/ Sp HV611 - Seroprevalence Of Antibodies Mompean, P.V., Fajardo, T.C.G., Padovani, R., Vedovello, Against Hs1 And Hsv2 In Brazilian Patients D., Nogueira, M.L., Colombo, T.E., Araki, C.S., Bonon, With Pemphigus, Familiars And Neighbors. S.H.A., Costa, S.C.B. Machado, A.R.S.R., Dos Santos, P.V.W.G., Nascimento, M.P., De Paula, N.A., Machado, A.M., Roselino, A.M. 1. University of Campinas, UNICAMP, Cidade Universitária “Zeferino Vaz” -Distrito de Barão Geraldo Faculdade de Medicina de Ribeirão Preto - USP, FMRP- 2. Faculty of Medicine of São José do Rio Preto, USP, Av. Bandeirantes, 3900, Monte Alegre, Ribeirão Preto, SP FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro São José – 14049-900 do Rio Preto Pemphigus are autoimmune blistering diseases Introduction: According to the Health Secretary of characterized by autoantibodies against desmogleins (Dsg), responsible for intraepidermic acantholysis. 932 cases of dengue were reported, a number almost While pemphigus vulgaris (PV) affects the skin and Campinas,equal to the in 981 the cases first recordedthree months the previous of this yearyear (2013),(2012). mucous membranes, related to antibodies against The advance of the disease has been so considerable that Dsg1 and Dsg3, pemphigus foliaceus (PF) affects only by March 2013, 498 cases had already been recorded. the skin by anti-Dsg1. Our research group has been There are now six cases of dengue hemorrhagic fever, studying the epidemiology and immune and genetic versus the total of seven cases recorded over all of aspects of pemphigus in the northeastern region of Sao last year. The most important thing is that the health Paulo state, endemic region for both forms of PF and PV. network knows how to accurately and agilely diagnose Their pathogenesis has been related to viral infections, these cases in order to avoid the evolution of the disease. amongst others factors. In genetically predisposed Objectives: In order to prevent patient complications patients, the herpes simplex virus has been considered related to reinfection and to better control new as exacerbating or triggering PV. Although several outbreaks, the goal of this study is to implement a rapid studies establish a serological epidemiology against method which uses reverse transcriptase polymerase HSV1 and HSV2 in general population, there are no reports in a PF or PV population. The aim of this study suspected dengue and to identify serotypes circulating was to determine the prevalence of antibodies against chainin patients reaction - from (RT-PCR) Campinas to and detect/confirm the region - treated cases ofat HSV1 and HSV2 by ELISA assay in 149 PF and 92 PV sera HC/UNICAMP. Methods: The study are been conducted in samples, comparing with 59 familiars and 26 neighbors the Virus Laboratory of FCM / UNICAMP and utilize RT- September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

166 Human Virology: HV

PCR to detect viral RNA, identifying the DENV serotype some signs of paralysis. This protection reinforces the idea that cell mediated immunity also plays an important role in the protection of DENV infection. We are testing withserotype. which Results: the patient Utilizing is infected. plasma Highly samples specific from and others constructions of VSV-DENV1 and 2 that express sensitive,patients who this were test treatedis able tofor quickly suspected confirm DENV the infection DENV the entire prM and E proteins, aiming to construct one at UNICAMP, Campinas / SP in April 2013, a pilot study found that 50% of suspected cases were positive for DENV; of which 30% were positive for DENV-1 and 20% safeHV615 and - Sefficaciouscreening vaccine For Hbasedepatitis on VSV B platform.Virus (H bv) for DENV-4. Conclusion: For the detection and typing of In Maracanã Construction Workers suspected dengue cases, the implementation of RT-PCR Bottecchia, M., Do Ó, K.M.R., Moraes, M.T.B. will allow for appropriate treatment to be instituted and 1. Fundação Instituto Oswaldo Cruz, FIOCRUZ, Av. additional studies to be carried out. Furthermore, it will Brasil, 4365 - Manguinhos, Rio de Janeiro - CEP: 21040-360 help to increase the number of cases which are reported. Alarmingly fast and aggressive, the spread of serotype 2. Hospital Alcides Carneiro, HEAC, Rua Vigário 4 may trigger severe dengue disease, and it is only with Correas,1345 - Petrópolis - RJ, 25720320 early diagnosis that an individual can take measures to PURPOSE OF THE STUDY: The purpose of this study was prevent and/or control this phase. to screen for hepatitis B virus (HBV) in Maracanã stadium construction workers. It is part of the “Ball begins with HV613 - Antibody Response And Protection B and Champion with C” campaign that started on July Against Dengue Virus 2 In Mice Immunized 2012, with the objective of analyzing 12 stadiums that With A Recombinant Vesicular Stomatitis- will be part of the World Cup in 2014 and were under Dengue Virus Vaccine construction/renovation. METHOD: Out of the 5500 Lauretti, F., Miquelitto, F., Chattopadhyay, A., Pinto, L.B., construction workers, 1200 were tested for HBsAg. Sera Catro-Jorge, L., França, R., Rose, J. from HBsAg positive patients were collected for additional 1. Faculdade de Medicina de Ribeirão Preto, FMRP- tests. Sequencing of the HBV polymerase was carried out USP, Av. Bandeirantes 3900 in the DNA Sequencing Platform PDTIS/FIOCRUZ, using 2. Yale University, Yale, New Haven/CT BigDye Terminator model 3730 (Applied Biosystems, Foster City, CA). HBV genotyping and subtyping are been Dengue, a mosquito-borne Flavivirus infection caused conducted by using phylogenetic analyses. SUMMARY OF by four related viruses (DENV1 to 4), is a major public RESULTS: From the 1200 individuals analyzed, 8 (0,6%) health problem in the tropics and subtropics. Although were HBsAg positive. Serum HBV-DNA was detectable in the vaccine development has accelerated in recent years 6/8 (75%) patients and all these 6 patients were anti- there is no licensed vaccine yet. We are constructing a HBe positive. All of them were male with mean age of recombinant Vesicular Stomatitis-DENV (rVSV-DENVs) 50 years. CONCLUSION: The prevalence of HBV in the virus to test as a live attenuated vaccine in BALB/c mouse Maracanã construction workers was lower. The most model. The rVSV-DENV2 is based on expression of the probable route of transmission was the injection in the immunogenic domain III of envelope protein E (EDIII). army in the 80s decade. None of them heard about viral To investigate the vaccine protection, four groups of hepatitis. This kind of campaign is very important to BALB/c mice were immunized by intramuscular route prevent and educate the population. with: heat-inactivated DENV2, VSV-DENV2 EDIII, wild type VSV or mock-infected. At 15th day mice were HV616 - The Influence Of Amino Acid boosted and at 30th day blood was collected to determine Substitutions In Ns5b On Treatment antibody response. The animals were then challenged Response In Patients With Chronic with intracranial inoculation of 50DL50 of neurovirulent Hepatitis C Infection DENV2 and followed for 21 days for signs of paralysis Ramos, J.A. , Leão, F.B., Lopes, M.F. , Hoffmann, L.,De or sickness. The total antibody titers of VSV-DENV2 EDII Souza, E.V., Ürményi, T.P., Silva, R., Rondinelli, E. vaccine were similar to heat inactivated DENV2, 1:160 Instituções and 1:200 respectively. But the neutralizing antibody response, classically related to protection, was null to the Hepatitis C is a health problem which affects VSV-DENV2 EDIII vaccinees. Only animals immunized approximately 180 million people worldwide. The NS5B with heat inactivated DENV2 produced neutralizing region is an HCV’s non-structural gene that encodes the antibody response. Although, the neutralizing antibody RNA polymerase RNA dependent, a key enzyme in the response was absent, the VSV-DENV2 vaccine protected virus life cycle and an important target for drugs that 100% of animals in the challenge experiments but with aim it’s inhibition. The catalytic site is found in the B, C, D

167 Human Virology: HV and E domains, it’s a very conserved site and mutations for NoV detection. Antigen detection commercial kits in this region might interfere in it’s function and provide have also been recently developed and have been resistance to the treatment. That way, it was availed if the of these agents, especially during outbreaks. However, the response to treatment in patients infect with HCV offered as a rapid an efficient method for the detection aminogenotype acid 1. Besides substitutions that, it inwas these also availed domains the influenced presence sensibility of these tests have been reported. Therefore, of resistance mutations for drugs that act in this region. controversialthe aim of this study results was related to screen to fecal the samples specificity that andhad 55 treated patients infected with HCV genotype 1 were been previously tested positive by RT-PCR for norovirus availed. Those domains were sequenced. The response and non-response patients sequences were compared as (RIDASCREEN® Norovirus 3rd Generation, R-Biopharm, well as the resistance mutations. It was found that the and∕orDarmstadt, sapoviruses Germany), (SaV), according using a tocommercial the manufacturers’ ELISA kit response patients had a major number of substitutions instructions. For this, a panel of 60 fecal samples was than the nonresponse ones. Furthermore it was observed tested. These samples were obtained mainly from a major amino acid switching in the 2671 and 2755 asymptomatic children that attended a philanthropic positions in nonresponse patients. Relative to resistance daycare center in Goiânia, from October-2010 to mutations the found replacements were A338V and October-2011. From the total 60 samples, 40 had C223Y, with the A338V being present in 75% of the tested positive for NoVs by RT-PCR, and from these, 14 response patients with the 1a genotype and 95% of the were also positive by the ELISA Kit (sensitivity of 35% nonresponse patients with the 1b genotype and C223Y when compared to the molecular method). Therefore, being present in 10% of the response patients with the three GI NoV RT-PCR-positive samples and 22 GII NoV 1a genotype and 12% of the nonresponse patients with RT-PCR-positive samples were not detected by the kit. 1b genotype. The C316N and S368A replacements were Furthermore, one sample that was positive, by RT-PCR for both GI and GII NoVs was also not detected by the response patients and 30% of the nonresponse patients kit. None of the 20 SaV-positive samples were detected alsowith found,the 1b genotype the first oneand beingthe second present one in being 17% present of the in 7% of the nonresponse patients with the 1a genotype. RT-PCR). These results suggest that screening of fecal Therefore we can observed that in the population bysamples the ELISA by molecular kit (100% specificitytechniques, when especially compared those to the major number of substitutions were related with samples that have low viral load, such as those obtained a successful treatment, as well as the observation of from asymptomatic cases, should not be replaced by polymerase inhibitors resistance mutation in patients antigen-detection kits. that were never treated with such drugs. HV623 - Correlation Of The Presence HV620 - Screening Of Fecal Samples, Of Jc Polyomavirus (Jcpyv) And Human Obtained From Asymptomatic Children, Citomegalovirus (Hcmv) In Glioblastoma. Using A Commercial Enzyme-Linked Da Silva, G.C., Stangherlin, L.M., Silva, M.C.C. Immunosorbent Assay Santos, H.C.P., Turones, L.C., Castro, I.A., Cunha, M.P., Universidade Federal do ABC, UFABC, Av. dos Estados, Fiaccadori, F.S., Souza, M. 5001 - Bairro Bangu - Santo André -SP IPTSP, Universidade Federal de Goiás, IPTSP/UFG, The JC polyomavirus (JCPyV or JCV) belongs to Rua 235 s/n, Setor Universitário, 74605-050, Goiânia, Goiás, Polyomaviridae family, Polyomavirinae subfamily and is a ubiquitous virus present worldwide. The Brasil infection in immunologically competent individuals is Noroviruses (NoVs) are important etiological agents of normally asymptomatic and occurs in the childhood acute gastroenteritis (AGE). It is estimated that these or adolescence.At adulthood, approximately 50-80% agents are responsible for over 50% of the outbreaks individuals are seropositive. In immunocompromised worldwide. Although most cases of NoV infection present individuals the virus can reactivate and infect the with AGE symptoms, some studies have also reported central nervous system (CNS). In the CNS JCV infects NoV excretion by asymptomatic individuals. The NoVs glial cells, including astrocytes and myelin production also exhibit great genomic and antigenic variability, and cells, named olygodendrocytes. The most common the detection and characterization of the NoVs strains disease caused by this virus is the progressive multifocal is based, mainly, on molecular techniques, such as the leukoencephalopathy (PML), a fatal disease that caused Reverse Transcription Polimerase Chain Reaction (RT- by lytic infection in olygodendrocytes. Some studies PCR). However, there is still not a consensus among report a possible relation between JCV and cancer. researchers on which primer pairs are the most suitable

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - HumanHowever, Virology: HV conflicting reports of the presence of the JCV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

168 Human Virology: HV genome in brain tumours exist. In addition, a study has YMDD motif), and one with patterns L80I, L180M and demonstrated that Human Cytomegalovirus (HCMV), a M204I. All of these mutations were present in patients Beta-herpesvirus possibly implicated with brain cancer with genotype A (one A1 and two A2). Prevalence of malignancy, is capable of induce JCV replication in vitro. drug-related resistance mutations varies according to In the present study we aimed to detect the presence of treatment duration and the level of genetic barrier for JCV and HCMV viral DNA in glioblastoma tumor tissues. the drugs used. Once the drug therapy is initiated it is extremely important to monitor viral load and identify PCR for the presence of both viruses. HCMV DNA was those mutations in order to support clinical decisions Sodetected far five in all tumor samples samples (100%) were and tested JCV in by 4 real-timesamples about patient management and also to prevent the (80%). Despite a low number of tested specimens the emergence of multidrug-resistant viruses. results suggest a positive association between HCMV and JCV in glioblastoma. We are currently tested more HV628 - Surveillance Of Active Human samples for the presence of viral DNA and RNA in tumor Cytomegalovirus Infection (Hcmv) In tissues. Pediatric Renal Transplantation Patients Menoni, S.M.F., Costa, S., Bonon, S. HV625 - Mutations Associated With Drug Resistance In Patients With Chronic 1. Universidade Federal De Mato Grosso Do Sul, Ufms, Hepatitis B Infection Av: Ranulpho Marques Leal, 3484 – Três Lagoas – MS Santos, M.I.M.A., Stoecker, A., Rugieri, S.P., Dominguez- 2. Universidade Estadual De Campinas, Unicamp, • Souza, B.F.C., Rosário, M.O.H.V., Paraná, R., Reis, M.G., Endereço: Cidade Universitária “Zeferino Vaz” - Faculty Of Silva, L.K. Medical Sciences 1. Centro de Pesquisas Gonçalo Moniz, FIOCRUZ, Introduction: Renal transplantation has been widely Salvador-BA used in the last 20 years in order to promote the 2. Lab Serv de Gastro-Hepatologia / de Pesquisa e treatment and possible cure for some diseases. However, Infectologia, SGH/LAPI, Salvador-BA concerning the diversity and complexity of this kind of 3. Ambulatório Magalhães Neto, HUPES-UFBA, treatment, it is observed that it contributes to increase the number of patients infected with the so-called Salvador-BA opportunistic infections. Immunosuppression, used in Hepatitis B virus (HBV) infection is a public health issue. transplantation to prevent graft rejection, has potent The Brazilian public health system (SUS) has provided effects on cell-mediated immunity. It results in a high antiviral drugs for chronic hepatitis B treatment for over incidence of severe and prolonged infection. The active 10 years, but a system for monitoring for drug-related cytomegalovirus infection has an important role in resistance mutations is not available. This study aims complications related to pediatric kidney transplants to determine the presence of HBV mutations associated because more than half of the newly transplanted with resistance to nucleos(t)ide analogs among 55 patients are affected by this virus, and also, it is the agent patients with chronic HBV infection-naïve and treated responsible for morbidity and mortality of these patients from University Hospital Professor Edgard Santos, in about 20% of the cases. In spite of this, information about this subject is scarce in literature. Pediatric renal patients with pretransplant negative HCMV serology, Salvador-BAP genes and sequenced (HUPES-UFBA). using ABI Briefly, Prism HBV-DNA3730 (Applied was who receive an organ from a HCMV-seropositive donor PCRBiosystems, amplified USA). with Two primers to six deduced forward from and HBV reverse S and group, are particularly a high risk group for developing the disease caused by HCMV. The administration of the sites were revised using software CLC Main Workbench ganciclovir doses to patients is extremely important sequencesv. 5.0 by visual of each inspection isolate were of assembled the electropherograms. and conflicting to control active infection and subsequent disease Consensus sequence lengths ranged from 1011 to 1034 associated. This requires a laboratory surveillance bp and encompassed the entire rt domain (from amino of patients from the day of transplantation until 6 acid 1 to 344). Those sequences were submitted to months after it, using rapid and early techniques to the HBV drug resistance database (HBVrt DB, Stanford diagnose active infection caused by HCMV and providing University, USA) to retrieve each mutation according to early treatment for preventing HCMV disease and genotype and treatment. HBV genotype A1 (83.6%) was consequently rejection of the transplanted organ. This the most prevalent followed by genotype A2 (7.3%), F study aims to determine the incidence, etiology and risk (3.6%), and C1, D2 and D4 (1.8% each). Three patients factors for HCMV active infection. In order to achieve this (5.5%) exhibited resistance mutations to LAM and goal, will be studied, prospectively, 30 pediatric patients ENT, two with patterns L180M and M204V (within the who have received a kidney, consecutive, at the Service September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

169 Human Virology: HV of Nefropediatria from the Department of Pediatrics, 13/41 samples (31.7%) were positive and after 10 days, FCM / UNICAMP, from the day of transplantation until 6/41 samples (14.6%) were positive for conjunctivitis 6 months after it. At the end of the study, there will be a causing adenovirus. We conclude that PCR is a good descriptive analysis of the cases. detector of infections caused by AdvH and that the therapy was effective. HV631 - Standardization Of Human Adenovirus Detection Using Molecular HV632 - Polyomavirus Active Infections In Methods In Eye Swab Samples Of Patients Pediatric Renal Transplantation Patients With Viral Conjunctivitis Symptoms Menoni, S.M.F., Costa, S., Bonon, S. Baldi, C., Fajardo, T.C.G., Costa, S.C.B., Bonon, S.H.A. 1. Universidade Federal De Mato Grosso Do Sul, Ufms, University of Campinas, UNICAMP, Campus Av: Ranulpho Marques Leal, 3484 – Três Lagoas – MS Universitario Zeferino Vaz SN - Cidade Universitaria, 2. University Of Campinas, Unicamp, Cidade Campinas Universitária “Zeferino Vaz” - Faculty Of Medical Sciences Acute viral conjunctivitis is one of the most common Introduction: The polyomavirus (BK and JC) is an health disorders and, although it does not often cause opportunistic virus because of its ability to latency serious complications, has a strong economic impact and reactivation in conditions of immunosupression, due to its contagiousness and morbidity. The Human and, as a consequence, it is considered one of the most Adenovirus (AdvH) is of the family Adenoviridae and important pathogen in imumnossupresed patients. is a major pathogen associated with eye infections They penetrate into the respiratory tract spreading worldwide. The ophthalmologic manifestations of this through the bloodstream and are excreted in the urine virus, including severe epidemic keratoconjunctivitis of infected patients, mainly by establishing latency in the (CCE), are almost exclusively caused by serotypes urinary tract. In case of viremia, and, the consequently AdvH - D8, AdvH - D19, and AdvH - D37. The less severe establishment of the disease, it could cause infection in faringoconjuntival fever is mainly caused by serotype the central nervous system, in the case of JC virus. On B11. Therefore, a pattern for detecting AdvH in ocular the other hand, the BK virus would cause diseases in swab specimens is desirable and may aid in therapeutic the urogenital tract, and, in renal transplanted patients, management to minimize the impact of these infections. are reported to cause graft rejection. Objectives: This Thus, we analyzed 49 patients who presented the work aims to use PCR and nested PCR (N-PCR) to signs and symptoms of viral conjunctivitis to the detect polyomavirus DNA in samples of plasma and Ophthalmology Department at Hospital das Clinicas / urine from renal pediatric transplantation recipients Unicamp. Three eye swab samples were collected from to assist in the treatment of this infection. Patients and each patient: one prior to topical therapy on the day of the Methods: Were studied 40 biological samples from 10 patients, 2 samples of plasma and 2 samples of urine days after therapy. This study used a randomized design of each patient, in different periods. Carried out DNA firstwhich visit was (day created 0), one by on ophthalmologists day +5 of therapy toand study one +10the Inc.), was subsequently made a simple PCR to detect in the treatment of patients with acute viral conjunctivitis extractionviral DNA using using primers commercial that identify kits (Axygen the two Scientific, types of efficacyas well asof dexamethasonethe combination’s 0.1% effect / povidone-iodine on viral replication, 0.4% polyomavirus (JC and BK). The polymerase chain reaction where it has been shown to be effective. Dexamethasone (PCR) is considered the standard method to perform is an effective corticosteroid which has been widely used alone as a topical agent or in combination with other result, only 1/40 (2.5%) samples were positive for BK agents. Povidone-iodine is a common antiseptic used to thevirus detection (10% of and patients). identification Conclusion: of viruses. Early Results: detection As a inhibit various viruses, bacteria, fungi and even some of viremia is of extremely importance to transplanted parasites, which has been described as effective in the patients because it could ensure adequate treatment of treatment of acute viral conjunctivitis. The main goal infection by avoiding damages in the transplanted organ. of this work was to standardize the detection of AdvH infections in eye swab samples using the Polymerase HV633 - Human Herpesvirus (Hhv) As Possible Chain Reaction (PCR). This was done to determine the Etiologic Agents Of Cancer Of Head And prevalence of infections caused by AdvH in patients Neck In Adults And Elderly Patients with signs and symptoms of conjunctivitis. The results Torres, S.V.S., Bonatelli, M.Q.A., Chone, C.T., Bonon, showed that on day 0, 41/49 samples (83.7%) were S.H.A., Costa, S.C.B. positive for adenovirus conjunctivitis. After the use of dexamethasone 0.1% / povidone-iodine 0.4% on day +5,

170 Human Virology: HV

Universidade Estadual de Campinas, FCM/UNICAMP, 3. USP, Faculdade de Medicina de Ribeirão Preto, CPV- Caixa-Postal:6111 FMRP-USP, Avenida Bandeirantes, 3900, Monte Alegre, CEP 14049-900 - Ribeirao Preto, SP Introduction: Elderly people succumb to viruses more often than the young, not because they have weakened The Amazon has the highest biodiversity on the planet, immune systems, but, ironically, because their natural as well as the largest number of arboviruses isolated. defenses are working too hard. This exaggerated response means that older people are more likely to the highest rate of human diseases, such as the severity of suffer physical effects as their bodies’ battle viruses. Amongthe same. these, Dengue we highlight virus belongs the flaviviruses, to the family both Flaviviridae, produce genus Flavivirus, species Dengue virus (DENV) and has for a large proportion of these diseases have also been four serotypes: DENV-1, DENV-2, DENV-3 and DENV-4, Virusesassociated that with have various been malignant identified states. as causative Concomitantly, agents and is the main arboviruse worldwide and are of major the number of cases of oral cancer (considered to importance for our country, and its main vector in the urban cycle is the mosquito Aedes aegypti, and, in the reportedly has been increasing among young adults. The sylvatic cycle, the Aedes albopictus, both anthropophilic, occuroncogenic usually potential around of or herpesvirus after the fifthand decadetheir possible of life) and its mainly activity is diurnal, and this develops in role in the development of malignant conditions, in tropical and subtropical areas. Dengue cases only began particular cancer of head and neck has been described. to be reported in the state of Amazonas from 1998. Objective: The aim of this study is to evaluate the Currently, virological surveillance of mosquito vector is presence of DNA of human herpesvirus directly in used, and can serve as warning systems for monitoring biopsies removed surgically of tissue affected of cancer. dengue outbreaks, preventing epidemics. Mosquitoes Patients and Methods: Twenty patients, aged from 45 to 75 years old, with diagnoses of cancer of the head and up to 10 animals per well (pool), according to data of neck were included in this study. Fresh biopsy of cancer collectedcollection wereand neighborhood, identified and and grouped then stored in amounts at -70ºC. of lesion samples were removed surgically and DNA was An amount of 722 mosquitoes were captured, and, from extracted to verify the presence of DNA of Epstein-Barr these, 8 were females of Aedes albopictus, and were virus (EBV), Human Cytomegalovirus (HCMV), Human organized in 3 pools. The pools were macerated and RNA Herpesvirus 6 (HHV-6) and HHV-8 – Human Herpesvirus were extracted with the kit Axygen; these extracts were 8 (causative agent of Kaposi’s sarcoma) using Nested- subjected to RT-PCR (reverse transcription followed by PCR. Results: Four fresh samples biopsies of cancer were polymerase chain reaction) for detection of the genus analyzed for the presence of DNA of EBV, HCMV, HHV- Flavivirus, followed by a Multiplex-Nested PCR for 6 and HHV-8 and as results, 25% was positive for EBV virus and negative for the other herpesvirus. Conclusion: analyzed, we found 1 (33,3%) amplicons positive for The preliminary studies are considered promising as identificationDengue virus, of serotype viral serotype. 1 (DENV-1). Among The the 3technique samples

EBV is associated with more advanced nasopharyngeal virus direct in vectors. These results demonstrated firsttumor. findings This researchhave shown can consistency determine withthe thepresence fact that of provedthat the to circulation be effective and for transmission the identification of dengue of dengue virus herpesvirus in areas affected during the treatment and serotype 1 have been occurring in the city of Manaus by females of A. albopictus during the last year as part of a of events that may occur with the progression of the streaming situation. candisease.Financial define the plan Support: to decrease CAPES the negative effects HV648 - Identification Molecular Human T HV644 - Detection Of Dengue Virus Serotype Cell Lymphotropic Virus Tipe I/Ii (Htlv-I/ Ii) 1 In Mosquitoes Aedes Albopictus Captured By Nested Polymerase Chain Reaction(Pcr) In The Urban Zone Of Manaus, Am, Brazil In Patients With Indeterminate Serology Cardoso, A.J.L., Luz, S.L.B., Figueiredo, L.T.M., Costa, Coinfected With Tuberculosis(Mdr-Tb) C.A. Huatuco, E.M.M., Terreros, H.M., Astocondor, M.M., Mayta, P.H., Flores, A.S., Rojas, G.P., Borja, N., Barbosa, 1. Instituto Nacional de Pesquisa da Amazônia, INPA, M.L., Oliveira, D.B., Dos Santos, T.A., De Oliveira, K.E.G., Av. André Araújo, 2936, Aleixo, CEP 69060-001, Manaus – Durigon, E.L., Do Rosario, J.S.C. AM 2. Instituto Leônidas e Maria Deane / Fundação 1. Major National University of San Marcos, UNMSM, Oswaldo Cruz, ILMD/FIOCRUZ, Rua Terezina, 476. Lima , Peru Adrianópolis, CEP: 69.057-070, Manaus – AM, Brazil 2. Universidade de Sao Paulo, USP-ICB-II, Brazil 3. Universidade de Sao Paulo, USP, Brazil September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

171 Human Virology: HV

The Human T lymphotropic virus (HTLV) is mainly 7. University of Massachusetts Medical School, , spread by blood transfusion, by breastfeeding and Worcester, Massachusetts, USA sexual contact. The virus is spread in the World, in Peru there are endemic geographic regions. In the 5% infected population develops oncogenic diseases, T cell platforms to be used as antigen delivery vectors. To this leukemias in adults and neurological as tropical spastic Recombinantaim, one of the influenza most promising viruses areapproaches promising consists viral paraparesis. The virus in the host alters functional to generate recombinant viruses harboring partially behavior of the cellular immune response, can cause truncated neuraminidase (NA) segments. To date, all immunosuppression. The main problem in diagnosis studies have been pointed to safety and usefulness of this is the presence of cases indeterminate serology, not and immune responses triggered by those recombinant (ELISA, Western blot). The aim of this study was to viralviruses platform. and their However, safety some to immunocompromised aspects of the inflammatory hosts present antibodies at screening and confirmatory tests remained to be elucidated. In the present study, we determinethe Nested-PCR a prototype for HTLV-1 to define in molecularpatients indeterminate amplification seropositive.serology with Molecular multidrug-resistant amplification tuberculosis protocol used (MDR_ was generated a recombinant influenza virus harboring a TB). Was determined as a prototype technique effective truncatedrecombinant NA virussegment to wild (NA-Δ) type and or knock-outevaluated the(KO) innate mice lymphotropic virus detection in infected individuals andwith impaired inflammatory innate responses (Myd88 KO) and or theacquired safety (RAG of KO) this of tuberculosis co-infected with HTLV-1 and from immune responses. Our results showed that recombinant mononuclear cells in peripheral blood lymphocytes. It of HTLV-1 and HTLV-2, showing the presence of two influenzaresponse in virus wild type harboring mice and truncated were completely neuraminidase harmless wastypes confirmed by restriction that enzymes the technique a panel help of endonucleases. the detection segment abrogated lung and systemic inflammatory The investigation allowed us to develop the molecular could prevent unbalanced cytokine production that tostrongly KO mice. contributes We also demonstratedfor lung damage that in vNA-Δ infected infection mice. the circulation of both types of virus in Peru. Studies proviralshould continue amplification because test, of which the existence helped to of determine subtypes that should be detected timely. These results allow us to Inand addition, T CD8+ thecellular recombinant immune responsesinfluenza virus which was protected able to suggest that this technique is implemented in molecular triggerimmunized both mice local against and systemic the challenge virus specific with humorala lethal diagnostic health centers, especially when the results of close attention in endemic areas, in order to prevent the dose of homologous A/PR8/34 influenza virus. Taking diagnosisspread. with serological profiles are dubious and pay together, our findings indicate that the neuraminidase deficientchallenge virusand are results safe even in mildto immunocompromised lung inflammation, HV650 - Immunization With Neuraminidase induceshosts. Financiala strong protectivesupport: immunity FIOCRUZ/PDTIS-Vacinas, against influenza Deficient Influenza Virus Is Highly and National Institute for Vaccine Development and Immunogenic And Non-Pathogenic To Wild Technology (CNPq/FAPEMIG Nº 015/2008), CNPq/ Type And Immunocompromised Mice MAPA/SDA Nº 064/2008, and Universal FAPEMIG. CNPq Barbosa, R.P.A., Salgado, C.A.P., Garcia, C.C., Lima, provided fellowships to, RPAB, TMC, CAZ, GAOL, ACP, B.H.F., Lopes, O.G.A., Rachid, M.A., Peixoto, A.C., De BHFL, CCG, MAR, EAC, RCR, AMVM and RTG. Oliveira, D.D.B., Silva, M.A.A., Zirke, C.A., Cotrim, M.T., Costa, E.A., De Freitas, G.M.A., Russo, R.C., Gazzinelli, R.T., De Magalhães, A.V.M. 1. Laboratório de Imunopatologia, Centro de Pesquisas René Rach, FIOCRUZ, Belo Horizonte, Minas Gerais, Brasil 2. Laboratório de Imunoparasitologia 3. Laboratório de Imunofarmacologia, Departamento de Bioquímic 4. Laboratório de Imunologia e Mecânica Pulmonar, Departamento 5. Departamento de Patologia Geral 6. Laboratório de Vírus, Departamento de Microbiologia, Instit, UFMG, Belo Horizonte, Minas Gerais

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV Immunobiologicals in VIROLOGY -IV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

173 Immunobiologicals in Virology: IV

IV48 - Use Of Recombinant Envelope Proteins virus. Furthermore, the recombinant proteins applied to For Serological Diagnosis Of Dengue Virus liquid microarray platform proved to be a very promising Infection By Liquid Microarrays technique in the development of diagnostic kits, with Melo, K.M.S., Nascimento, E.J.M., Cordeiro, M.T., potential commercial applications, generating a robust Marques, E.T.A., Dhalia, R. test to analyse with high precision a large number of 1. Centro de Pesquisas Aggeu Magalhães-Fundação Oswaldo Cruz, CPqAM-FIOCRUZ, Av. Professor Moraes samplesIV69 - inRecombinant a short time, with D lowengue final cost.Virus Type 2 Rego,s/n.Campus da UFPE-Cid. Universitária,Recife/ Helicase Expressed In Escherichia Coli PE,Brazil Preserves Biological Properties Of The 2. Center for Vaccine Research, University of Pittsburgh, Native Protein CVR, Pitt, 9014 Biomedical Science Tower 3, 3501 Fifth Bizerra, R.S.P., Amorim, J.H., Alves, R.P.S., Ferreira, L.C.S. Avenue, Pittsburgh, PA, USA Vaccine Development Laboratory, University of São Dengue is one of the major viral disease transmitted by Paulo, ICB USP, Avenida Prof. Lineu Prestes, 1374, sala 118, mosquitoes, that affects tropical and subtropical areas ICB USP, São Paulo, Brazil Dengue fever is a common mosquito-born illness which is represented by four distinct serotypes (DENV1- caused by dengue virus (DENV) and constitutes a worldwide.4). Among Thethe diseaseviral proteins,is caused bythe dengue structural flavivirus, ENV global economic burden and a public health threat. protein strongly contribute to the process of immune The development of an effective vaccine for the control response triggered by the virus, and is important for of dengue fever is a priority for countries where the the development of diagnostic kits. ELISA assays used disease prevails. The nonstructural 3 protein (NS3) of for dengue diagnosis, based on antibody detection, have DENV is considered essential on viral replication and limitations such as cost and processing time, among maturation. The helicase domain (NS3H), in particular, others. Here, we performed the analyses of several contains most of epitopes recognized by cytotoxic T commercially available ENV proteins formulations lymphocytes, required for the elimination of the infected of the four DENV serotypes, plus the analysis of two cells. With this perspective, we propose to develop a home-made recombinant ENV constructions, using the vaccine based on the incorporation of a recombinant liquid microarray technique for diagnostic purposes. form of NS3H derived from a DENV serotype 2 (DENV2) The commercial proteins formulations included: full- isolate. As part of this initial proposal, we report here length proteins, domains I/II only, domain III only, the generation of a recombinant NS3H with preserved and proteins containing immunodominant regions, structural and immunological features regarding the bacterial-expressed, and were purchased from the native viral protein. The NS3H sequence was obtained companies ProSpec and MyBioSource. The two home- after reverse transcription of the genome of the DENV2 made proteins(DENV1 ENV and DENV2 ENV) were JHA1 strain followed by cloning in a pET series vector screened from sequences of South American isolates in public databases, and include the domains I/II of the original protein, bacterial-expressed. Each protein was andin the purification insoluble extract of the of recombinant the E. coli BL21 protein DE3 RIL by strain. nickel tested in multiplex assays against an human cohort affinityAttempts chromatography. to apply different Initially, refolding the protein methods was foundwere containing DENV infected sera, healthy individuals and unsuccessful but testing of different protein expression YF vaccinated patients (supported by CONEP #12138). conditions led to the production of soluble recombinant These assays were performed in 45 min and detect both immunoglobulin M (IgM) and IgG in a capture carried out with BALB/c mice resulted in the generation protein. After protein purification, immunizations sera reacted with the native protein in cells infected format.home-made The medianantigens fluorescence assays were intensity 92%-90%(DENV1 were used to ofwith NS3H-specific DENV2. Furthermore, polyclonal antibodies.the recombinant The anti-NS3H protein constructENV) and 89%-97%(DENV2ROC curves. The sensitivity-specificity ENV), respectivally. Among of the was recognized by antibodies from infected mice and the commercial proteins, the chimerical proteins humans. Further biophysical analyses indicated that the containing immunodominant regions of DENV3 recombinant NS3H protein shows structural features and DENV4 presented the best perfomance(DENV3, compatible with the native protein. Collectively, the results demonstrate that the recombinant NS3H protein respectivally). These results suggest that recombinant preserves important conformation and antigenic 87%-81%/DENV4proteins can be used 96%-81%,in diagnostic sensitivity-specificity,assays for dengue to determinants of the native virus protein and represents overcome safety issues associated with the use of whole

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

174 Immunobiologicals in Virology: IV a valuable reagent both for the future testing of vaccines transgenic mouse model could be used to complement and diagnostic tools. Financial support: FAPESP all researches in progress, helping in the establishment of new vaccines and therapeutics tools to combat the IV71 - A Mouse Model For Dynamic PPR. Characterization Of Peste Des Petits Ruminants Virus (Morbillivirus) Infection IV109 - Three Mutations In The Protein E Of In Mice In View Of Novel Therapeutic Or A Chimeric Yellow Fever Virus (Yfv-17d) Vaccine Development Expressing The Proteins Prm/E Of West Nile Comerlato, J., Minet, C., Roehe, P.M., Franco, A.C., Albina, Virus Confer Full Attenuation In Mice E., De Almeida, R.S. Arenhart, S., Kanitz, F.A., Kowalsky, A.P., Gil, L.H., Weiblen, R., Flores, E. 1. CIRAD Baillarguet , CIRAD, Campus international de Baillarguet, G-34398 Montpellier Cedex 5, France 1. Fundação Oswaldo Cruz - Pernambuco, Fiocruz, Av. 2. CIRAD Guadalupe, CIRAD, CIRAD, UMR CMAEE, Professor Moraes Rego, s/n - Campus da UFPE, Recife, Brasil F-97170 Petit-Bourg, Guadeloupe, France 2. Universidade Federal de Santa Maria, UFSM, Av 3. Universidade Federal do Rio Grande do Sul, UFRGS, Roraima, 1000, CEP 97105-900, Santa Maria, RS, Brasil Rua Sarmento Leite, 500, sala 208, ICBS. CEP 90050-170 West Nile virus (WNV) is an important emerging human 4. Institute Nacional de la Recherche Agronimique, and animal pathogen and its potential introduction in INRA, INRA, 2 place Viala 34060 MONTPELLIER CEDEX, Brazil is a major concern, urging for the development France of diagnostic tests and vaccines. As WNV can only be handled in laboratories BL-3, we used the infectious Peste des petits ruminants (PPR) is a viral disease of clone (pBSC-YFV-17D) of the Yellow Fever virus (YFV) small ruminants affecting mainly sheep and goats. Up strain 17-D to construct of a chimeric virus expressing to 80-90% of the animals infected by PPR virus (PPRV) the membrane (prM) and envelope (E) (prM/E) proteins may die. This virus is endemic mainly in Asia and Africa of WNV. As to attenuate the chimeric virus (YFV17D/ WNV- prM/E) for potential use as vaccine, three mutations were introduced in the E gene (codons Leu beingnot permit responsible to differentiate for large the economics vaccinated deficits animals in thesefrom countries.those infected An efficientby the virus. vaccine Other is available, important but factor it does is that this vaccine has a limited thermotolerance, thus →the Phe mutations) [position were 319-321], evaluated Ala →in Valvitro [946-948] and were and shown Lys constraints, new generation vaccines and therapeutic → Arg [1318-1320]). Both chimeras (with or without YFV-17D. As to ascertain their phenotype in vivo, tools are being developed. An important problem to requiring a cold chain for field delivery. To surpass these groups of six mice were inoculated intracerebraly with develop these new reagents is the inexistence of a to retain the replicative efficiency of the parental virus 104TCID50 of YFV-17D, YFV/WNV-prM/E or YFV/WNV- proper small animal model to make the in vivo proof-of- prM/E-3M) and monitored for neurological disease. All concept tests. Given the above, the main objective of this six mice (100%) inoculated with YFV-17D developed study was to develop a transgenic mouse susceptible neurological signs and died or were euthanized in for PPRV infection. Construction of a luciferase-marked extremis between days 6 and 10 post-inoculation (pi). PPRV using reverse genetics tools was another aim of Among mice inoculated with the chimeric YFV/WNV- this project. This marked virus will allow following the M/E, 5 out of 6 (83.3%) developed neurological signs dynamics of the infection by bioimaging while reducing and died or were euthanized at days 6pi (2 animals) or the number of animals necessary for that purpose. The 7pi (3). In contrast, none of the six animals inoculated method used to the transgenic mouse development with the chimeric virus containing mutations in the consists in cloning the SLAM (signaling lymphocytic E protein (YFV/WNV-preM/E-3M) developed clinical signs up to day 30 pi. These results demonstrate that the cloned fragment is secondarily inserted in a retroviral substitution of preM/E protein of YFV by the homologous vector and then introduced into mice that are back- activation molecule) goat receptor, specific to PPRV. The proteins of WNV did not reduce virulence for mice; crossed to get a SLAMgoat +/+ mouse lineage. This yet the mutations introduced in the E protein lead to lineage is crossed with IFNAR -/- mouse to generate a transgenic animal containing the PPRV receptor and intent to use these chimeric viruses as vaccine should unable to mount an interferon response. Currently, the necessarily consider the introduction of these mutations transgenic and cloning process to the mouse model and significant attenuation of the chimeric virus. Thus, any for attenuation. the marked PPRV generations are in course. Following the evaluation of the PPRV infection dynamic, this

175 Immunobiologicals in Virology: IV

IV121 - Vaccination With A Pressure Almost every two years a new Norovirus (NoV) strain Inactivated Avian Influenza Virus arises due to the changes in capsid protein (VP1) sequence Protects Mice Against Infection With having a high antigenic variability, which results in a Induction Of Humoral And Cellular new pandemic. This factor and the growth inability in Immune Response And Preservation Of Ha And Na Activity Barroso, S.P.C., Nico, D., Vicente-Santos, A.C., Couceiro, culturedwere compared: cells made Sucrose the serological gradient ultracentrifugation,diagnostic difficult. J.N.S.S., Nascimento, D., Bozza, F., Ferreira, D.F., Palatnik- Incesium this studychloride three (CsCl) methods gradient for the ultracentrifugation VLP purification De-Souza, C.B., Silva, J.L., Oliveira, A.C. and ion exchange chromatography. On the fourth day post-inoculation of bacmid containing VP1 and VP2 1. Universidade Federal do Rio de Janeiro, UFRJ genes of norovirus GII/4, the infected cell culture was 2. Instituto Oswaldo Cruz, FIOCRUZ isolated from birds, and later found in horses and dogs. clarified by centrifugation with 3000xg for 5 minutes H3N8Here, we is anused avian 12 influenzah of incubation virus thatunder was hydrostatic originally atthe 4ᵒC. pellet The was VLPs re-suspended in the supernatant in buffer. were The samplesconcentrated were pressure (HP) to achieve this virus inactivation without bythen ultracentrifugation 1) loaded into a at 10-60% 10,000xg discontinuous for 1 hour at 4ᵒCsucrose and damage to its hemagglutinin and neuraminidase gradient and ultracentrifugated at 100,000xg for 1 hour activities and study its protective capability in vaccination against H3N8 infection. Balb/c mice were gradient (35-60%). From the same VLPs suspension, treated by the intranasal route, with 3 doses of the at 4ᵒC followed by an additional discontinuous sucrose pressure-inactivated virus. Mice were challenged with a density of 1.36g/cm3 and was centrifuged for 24hrs native H3N8 on fourth week, and monitored for: virus- 2) the purification of VLP by CsCl was performed at done using a column packed with Q Sepharose XL atanion 35,000 exchange rpm. resin. 3) Chromatographic Our results showed purification that the wasion specific antibodies in serum, nasal lavage and faeces, CD4+immunization and CD8+ and virus-specific challenge we T cells,found cytokinean increase ELISA, of and preserve the intact conformation of VLPs observed clinicalIgG1, IgG2a, symptoms and IgA and antibodies. inflammatory These parameters. antibodies foundAfter exchange purification was able to achieve high purity in serum are neutralizing. The analysis of cytokine showed also differences among these treatments. production by CD4+ and CD8+ T cells showed a mixed by electron microscopy. The amount of VLPs purified Th1/Th2 pattern after vaccination. Two weeks after the method was 5µg/ml in culture medium, though high challenge, we observed an increase in the production Theimpurity. optimum Similar concentration results were of obtained purified VLPswith bysucrose CsCl of antibodies and IL-6, IFN gamma and TNF alpha. The control group (saline) showed more clinical signs when used ion exchange chromatography. In conclusion, of disease (lethargy, weight loss and huddling) than gradient. The purified VLPs were achieved 250µg/ml vaccinated animals and more Evans blue leakage than showed the best purity and yield. Area: Human Virology the vaccinated group. In the same way differential cell theFinancial purification Suport: method CAPES based on ion exchange column counts in bronchoalveolar lavage showed more cells IV202 - Construction Of Yellow Fever in control group. HP-inactivated H3N8 virus vaccine Virus 17d Chimeric Virus Expressing The Structural Proteins Of Brazilian Dengue Virus Serotype 4 of HP as an interesting tool in the development of induced significant protection against the infection Carvalho, A.G.O. , Bertani, G.R., Gil, L.H.V.G. byviral H3N8 vaccines influenza at low virus. cost and Our good work immune reaffirms response. the use Support:CAPES,PRONEX,INBEB,CNPq,FAPERJ. 1. Centro de Pesquisas Aggeu Magalhães, CPqAM, Av. Professor Moraes Rego, s/n - Campus da UFPE - Cidade IV198 - Comparision Of Three Methods For Universitária | Recife/PE Purification Of Human Norovirus Virus 2. Universidade Federal de Pernambuco, UFPE, Av. Like Particles Oliveira, L.M., Nagata, T., Lamounier, T.A.C., Noronha, Prof. Moraes Rego, 1235 - Cidade Universitária, Recife - PE - E.F., Camargo, B.R., Monclaro, A.V. CEP: 50670-901 1. Universidade de Brasília, UnB, Departamento de The genus Flavivirus is enveloped, single-stranded, Biologia Celular, Laboratório de Microscopia positive-sense RNA viruses and among its members 2. Universidade de Brasília, UnB, Departamento de important human pathogens can be found, such as dengue virus (DENV), West Nile virus (WNV) and Biologia Celular, Laboratório de Enzimologia, Brasília yellow fever virus (YFV). The viral genome consists of a September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

176 Immunobiologicals in Virology: IV simple open reading frame (ORF), which encodes a large a non-invasive, large scale and cost-effective procedure, polyprotein that is processed co- and post-translationally in comparison with immunoglobulin G. The use of IgY by viral and host cell proteases into 10 different proteins: in latex agglutination tests is useful due simplicity, low three structural proteins (C, prM and E) and seven non- cost and rapid execution for detection of rotavirus in structural (NS) proteins (NS1, NS2a, NS2b, NS3, NS4a, fecal samples. Materials and Methods: In this study, NS4b and NS5). Dengue virus has four antigenically hens were immunized with group A human rotavirus distinct virus serotypes (DENV-1, -2, -3, -4) and there and divided in three immunization groups: the group one - human rotavirus group A plus Incomplete Freund’s virus. The DENV-4 was recently introduced in Brazil and Adjuvant (IFA) plus CPG-Oligodeoxynucleotide (CPG- isnowadays no specific this treatmentserotype is orresponsible vaccine accredited for more than for half this ODN). The group two - one immunization with IFA plus of the cases of dengue in the country. Chimeric virus are CPG-ODN and others two steps with rotavirus plus highly attenuated and can be used as vaccines and as IFA plus CPG-ODN. In the group three - the hens don’t tools for the development of serological diagnostic tests. received immunogen, just IFA plus CPG-ODN. The yolk The aim of this study was to construct chimera virus using the infectious clone (pBSC-YFV-17D) from yellow by polyethylene glycol 6,000, dosed at 562 nm by fever virus strain (17D) as vector, and replacing its wasbicinchoninic separated acidfrom (BCA), the egg characterized white, the IgY by was SDS-PAGE purified structural proteins (prM/E) by DENV-4 prM/E proteins. The DENV-4 coding region was obtained by RT-PCR from a brazilian isolated strain. The chimeric plasmids were andchromatography specificity determined ion exchange by Westernby a DEAE-Sepharose Blotting. The constructed by yeast-based homologous recombination. IgYcolumn was subjectedto remove to additional an additional interfering purification proteins. using The RNAs in vitro transcribed from the plasmids were Results: It was possible to obtain a IgY with 3 mg/mL. transfected into BHK-21 cells by electroporation and The anti-rotavirus IgY was bound to carboxyl-latex beads incubated by 48, 72 and 96 hours. Rescued viruses were and tested in a rotavirus sample showing a positive agglutination in a preliminary result. Conclusions: The culture. Phenotypic characterization by viral replication confirmedkinetics and by IFAplaque and RT-PCRmorphology after threeis under passages way. in Thecell and due to the increased importance of IgY in research, chimeric virus constructed will be used to development IgYthis boundantibody efficiently is a good to method latex beads of choice by covalent that can coupling be used in immunoassays development. Financial support: IOC/ our country. FIOCRUZ, FAPERJ a chimeric vaccine specific for the DENV4 circulating in IV246 - Technological Innovation IV249 - Screening Serological Assay (Elisa) In Rotavirus Detection Using For The Evaluation Of Htlv-1 Infection Immunoglobulin Y Based On A Chimeric Prokariotic Protein Lanzarini, N.M., Vasconcelos, G.A.L.B.M., Guimarães, Santos, D.M.S., Carmo, A.P., Martins, M.L., Fonseca, F.G., J.R., Da Silva, A.S., Heinemann, M.B., Leite, J.P.G., Volotão, Stancioli, E.F.B. E.M., Heneine, L.G.D., Pinto, M.A. 1. Universidade Federal de Minas Gerais, UFMG, 1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, Campus da UFMG, Belo Horizonte, MG, Brazil, Caixa Postal 4365 - Pav. HPP - Laboratório de Desenvolv. Tecnológico em 486 -31270-901 Virologia 2. Fundação HEMOMINAS, HEMOMINAS, Fundação 2. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, HEMOMINAS, SETOR DE PESQUISA, Belo Horizonte, MG, 4365 - Pav. HPP - Laboratório de Virologia Comparada Brazil 3. Universidade Federal de Minas Gerais, UFMG, 3. Grupo Interdisciplinar de Pesquisa em HTLV, GIPH Departamento de Medicina Veterinária Preventiva 4. Fundação Ezequiel Dias, Minas Gerais, FUNED, retrovirus isolated from human and currently they Laboratório de Imunologia Aplicada Human T-lymphotropic virus (HTLV) was the first Introduction: The infection with rotavirus is responsible HTLV-1 and HTLV-2 the types correlated with severe for about 400,000 deaths annually and approximately are classified into four types: 1, 2, 3 and 4, being the 40% of hospitalizations for diarrhea in children under individual. Both viruses can be transmitted by breast inflammatoryfeeding, sexual and contact neoplasic and blooddiseases transfusion. in 5% of infectedRoutine the major antibody presented in hens serum, being laboratory procedures are performed in order to evaluate fivetransferred years worldwide. to the egg The yolk Immunoglobulin by active transport. Y (IgY) The is clinical samples and detect infected individuals by 1/2 screening of blood units is important to prevent specificSeptember polyclonal 2013 Volume antibody 18 – Supplement obtainment 1 - Abstracts/Posters from egg yolk - Immunobiologicals is using efficient in Virology: and accurate IV serological tests and HTLV- XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

177 Immunobiologicals in Virology: IV transfusion transmitted infection, being mandatory COG2: sense - CARGAR BCNATGTTYAGRTGGATGAG; in Brazil and elsewhere. In this way, a recombinant antisense - TCGACGCCATCTTCATTCACA, using HTLV-1 chimeric protein was produced in a prokaryotic plasmid DNA standards as positive control, for this system with diagnostic purposes. After production, reaction the analytical sensitivity achieved was 102 genomic copies/uL. All samples were also analyzed by chromatography column and was tested by an in house conventional touchdown PCR using primers Norogen theEnzyme recombinant Linked Immunosorbentprotein was purified Assay using (ELISA) an affinity using 2: sense - CCACAAAGACCA GAGATGT; antisense - sera of infected and non-infected patients. Were tested GGACCAATGAAGAGAGGGATA, resulting in an amplicon 80 sera, including 40 from seronegative individuals (SN) of 368 base pairs (bp). All stool samples were negative and 40 from HTLV-1 infected individuals (INF), being in both tests. Although different studies have recognized 20 presenting the mielopathy - HAM/TSP (HT) - and 20 that the NoV GII is the most prevalent and often affects sera from asymptomatic (AS) individuals. The results individuals of all ages around the world, in our study this picture was not observed. Thus, our study suggest that from those known as negative controls; only sera from the NoV GII is not circulating in the analyzed samples and showedinfected thatpeople HTLV reacted positive with samples the chimeric differ recombinantsignificantly a future monitoring is needed to evaluate the distribution of this virus in our region. Financial support: FAPERGS, TSP and asymptomatic individuals recognized equally CAPES, CNPQ. proteinthe recombinant (INF x SN; protein p<0.0001; and “Unpairedwhen were t comparedtest”). HAM/ to SN both presented statistic differences (HT x SN and AS IV294 - Human Antibody Response To Dengue Virus Is Cross-Reactive To Different These preliminary results suggest that sera from HTLV-1 Fragments Of Envelope Recombinant x SN p<0.0001; Anova OneWay with tukey post-test). Protein produced and then it can be a useful tool for routine Rocha, E.S.O., Souza, K.R., Gaspar, C.H.P., Ferreira, infectedscreening individuals diagnostic specificallytests. recognized the protein T.A.R., Cursino, A.E., Marinho, P.E.S., Figueiredo, L.B., Oliveira, J.G., Ferreira, P.C.P., Kroon, E.G. IV252 - Detection Of Norovirus In Human Stool Samples From Patients In Rio Grande 1. Laboratório de Vírus, Depto de Microbiologia da Do Sul, Brazil UFMG, LABVIRUS UFMG, Av. Antônio Carlos, 6627 - Bloco Dalla Vecchia, A., Vetter, M.R., Soliman, M.C., Bortoluzzi, F4, Sala 258 - BH (MG) Brasil M., Staggemeier, R., Giehl, I.C., Bianchi, E., Rigotto, C., 2. Laboratory of Emerging Pathogens, FDA, NIH, USA Henzel, A., Spilki, F.R. 3. Laboratório de Imunol. Celular e Molecular, FIOCRUZ, Brazil Universidade Feevale, FEEVALE, Rodovia RS 239, n2755 - sala 205, CEP:93352-000, Novo Hamburgo/RS The Dengue virus (DENV) envelope (E) protein is the main target of neutralizing antibodies on the surface Human Norovirus (HuNoVs) are responsible of the virion and it is composed of three domains (EDI, for gastroenteritis worldwide and transmission EDII, EDIII). Previous studies have determined that occurred through the fecal-oral route and by antibodies targeting EDI/II are generally more cross- ingestion of contaminated food and water. HuNoVs reactive among serotypes, in contrast to EDIII which is three genogroups: GI, GII and GIV. Genogroup GII is we aimed to assess antigenic determinants in different belongresponsible to Caliciviridaefor the majority family of diarrheal and are outbreaks. classified The in serotype-speciﬁcfragments of E protein and highly by using neutralizing. human DENV-immune In this study, present study searched to identify, through molecular serum. Six recombinant fragments (E1-395, E1-81, E1- assays, the presence of HuNoVs (GII) in stool samples. 193, E53-132, E53-395 and E298-395) comprising to Samples were obtained from one hospital in the city of the three domains of DENV-3 E protein were expressed Esteio, Rio Grande do Sul, Brazil. A total of 147 stool samples from patients of different ages were analyzed, chromatography. Out of 11 sera samples, 8 were obtained among them, 74 were collected in winter of 2011 and infrom Escherichia DENV-3 infected coli system individuals, and purified one from by nickel DENV-1 affinity and 73 in the summer of 2012. Nucleic acids were extracted one from DENV-2. A serum sample from a non-infected with a commercial kit (RTP DNA/RNA Virus Mini Kit), individual was used as negative control. The antibody according to the manufacturer’s instructions and additional step (cDNA) was performed using the kit High reduction neutralization test. An IgG-ELISA based on Capacity cDNA Reverse Transcription, and subsequently specificitythese six recombinant of the sera panel antigens was confirmedwas performed by plaque and diluted 10 fold to avoid inhibitors in PCR reactions. The the titers show that E298-395 (EDIII fragment) cross- real time PCR (qPCR) was performed using primers

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV reacts to all three DENV serotype-specific antibodies XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

178 Immunobiologicals in Virology: IV and that E1-395 (80% C-terminally truncated DENV-3) anti-HAdV (2 mg) produced in Balb / c was dialyzed and concentrated with the coupling buffer NaHCO3 0.1 M pH antibodies. It is also suggested that a common epitope 8.0 and added to gel. After addition of HAdV-2 sample, andto E1-81 E298-395 and E53-132are similarly is likely recognized an important by DENV-specific antigenic proteins was eluted with NaCl 1M pH 8.3. Protein on fractions were dosed at 280nm and analysed by SDS- proteins resulted in similar OD values. In conclusion, PAGE. determinantthis study presents detected the by differentspecific antibodies fragments since of DENV both recombinant E proteins and the IgG-ELISA as valuable IV410 - Purification And Characterization tools for humoral response understanding in DENV- Of Immunoglobulin Y Specific For Human infected individuals. Financial support: CNPq, CAPES, Rotavirus Group A Produced In Hens DECIT/MS, FAPEMIG, INCT-Dengue and PRONEX- Immunized Dengue Guimarães, J.R., Bentes, G.A., Silva, A.S., Lanzarini, N.M., Volotão, E.M., Pinto, M.A. IV343 - Production And Purification Of Hadv-2 Hexon Protein By Ion Exchange And 1. Fundação Oswaldo Cruz - Instituto Oswaldo Cruz, Afinnity Cromatography. Fiocruz-IOC, Avenida Brasil 4365 - Manguinhos, Rio de Paulini , I.J., Silva, S., Thomaz, L.,Bellei, N., Harsi, C.M., Janeiro Granato, C.F.H. 2. Centro Universitário de Serra dos Órgãos, Unifeso 1. Universidade Federal De Sao Paulo, Unifesp, Rua The rotavirus is considered one of the most important Pedro De Toledo, 781 causes of acute diarrhea in children, being responsible 2. Universidade De Sao Paulo, Usp, Rua Av. Lineu to 111 million episodes of gastroenteritis in the world Prestes, 1374 and for 611 thousands of deaths for year, especially in developing countries. The IgY antibodies production Human adenovirus (HAdV) presents 52 serotypes which can cause gastrointestinal, uro-genital, and neurological presented by this antibody such as easy achievement, system infections both in children and adults. The aim of againstlow cost, rotavirus wide scale is production justified by and several more appropriate advantages this study is to produce monoclonal antibodies against method about the bioethics aspect. The IgY is the HAdV-2 hexon protein which will be applied in a fast predominant immunoglobulin in the circulation of birds

HAdV-2 hexon protein. For this, 48 cell culture bottles of diagnostic300cm2 were test. seeded The first with step HEK-293 of this project cells wasand tothis purify cell andof IgY reptiles, anti-rotavirus and can Abe group purified (RV-A) from antibody egg yolk. made In this in monolayer was infected with 0.1 M.O.I of HAdV-2. When studyimmunized we propose hens. Hens the werepurification divided andin three characterization groups (I-III) the cytopathic effect was evident (between 2-5 days), the and immunized at intervals of one month with different cells were harvested and centrifuged at 220 g for 10 min. protocols: Group I – received three immunizations with Then the supernatants were collected and the HAdV-2 human and simian RV-A associated with incomplete precipitated by ultracentrifugation. The cell pellets were Freund adjuvant (IFA) and oligodesoxinucleotides that pooled in 10 mM HEPES buffer at pH 7.4. The viruses have C-fosfatoguanosin (CpG-ODN); Group II – received were released after three cycles of freezing and thawing. month and two immunizations at intervals of one month volume of Vertrel XF, followed by vigorous vortexing. oneof group immunization A rotavirus with plus IFA IFA plus plus CPG-ODN CPG-ODN. in Group the first III LysedCells debris cells were suspensions removed were by centrifugation clarified using at 2.619 equal – received three immunizations with IFA and CpG-ODN g for 25min at 4°C. Viral particles and soluble proteins (negative control). The study was approved in Ethics Commission in Animals Tract-UNIFESO (nº0331/11). inHAdV-2 the supernatantcomplete particles were were purified stored in at CsCl -20°C. gradients Soluble precipitation in polyethylene glycol method (PEG). The preparedproteins fraction in a 10 ofmM the HEPES gradient buffer were at analyses pH 7.4. Purifiedby SDS- The eggs were collected and the yolks purified by by the techniques of electrophoresis in polyacrylamide IgYgel waswith quantified sodium bydodecyl Lowry methodsulfate and(SDS-PAGE) characterized and PAGE,column Electronic was equilibrated Microscopy with and phosphatehexon protein buffer purified and Western Blotting. A neutralization assay in vitro byeluted ion atexchang increasing columns/ultrafiltration. concentrations of sodium At first, chloride the gel in the buffer ranging from 0,02 M to 0,5M in steps of IgY for rotavirus in MA-104 cell culture on different wasconcentrations. performed The to evaluate characterization the specificity methods of purified of IgY Cromatography. CNBr sepharose 4B (1g) was washed 0,02M.with 1 mMAditionally, HCl pH 3.0 we for perfomed activation. purification Polyclonal by antibody Affinity demonstrated specificity to the rotavirus antigens and September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicalsefficacy in inrotavirus Virology: IV neutralization in culture cells. The XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

179 Immunobiologicals in Virology: IV

IgY anti-rotavirus was successfully produced, and their 1. Universidade Federal de Minas Gerais, UFMG, Av. use in immunodiagnostic and immunotherapy need to Presidente Antônio Carlos, 6627 / Belo Horizonte - MG be tested in the future. 2. Fundação Ezequiel Dias, FUNED, Rua Conde IV442 - Baculovirus Surface Display Of Pereira Carneiro, 80 / Belo Horizonte - MG Domain Iii Of Envelope Protein (E) Of Dengue is a disease caused by Dengue virus that Yellow Fever Virus belongs to the Flaviviridae family, with four distinct Chaves, L.C.S., Ribeiro, B.M. serotypes DENV-1, 2, 3 and 4. It is associated with University of Brasilia, UnB, Institute of Biological several clinical manifestations, from asymptomatic to severe cases leading to death. Thus, tools that allow sciences rapid detection are of extreme importance, because The etiological agent of the yellow fever is the yellow in addition to patient care, also contribute to the fever virus that belongs to the Flavivirus genus in the epidemiological survey, monitoring cases, pathological Flaviviridae family. The envelope protein (E) of Flavivirus is responsible for the entrance of the virus in the host disease, which results in more relevant and objective cell and is also the main target for the immune response. studies,research. immunological The present andwork distribution aims to profileproduce of and the The domain III of the E protein (ED3) interacts with cells characterize monoclonal antibody anti-DENV, targeting receptors and has the epitopes recognized by neutralizing the development of biotechnological tools. Mice were antibodies, being, therefore, the target of the immune immunized with recombinant envelope (E) protein of response. The diagnosis of the yellow fever is made DENV serotype 1, 2, 3 and 4. They were euthanized and using immunoenzymatic tests that detect circulating IgM the splenocytes obtained were fused to P3X63-Ag8.653 during the viral infection (MAC-ELISA). For this test the mielomic cells. The hybridomas were selected through entire virus from infected mice brain is used as antigen. The production of the antigen, containing only a part immunoenzimatic assay. The ELISA positive hybridomas of a functional protein, is not only more economically HAT/HTwere subjected medium to limiting and evaluated dilution process for specificity for selection by viable but also safer than the virus produced in mice. of a single secretory cell. The fusion protocol of the The “display” of heterologous proteins in the surface cells obtained after immunization of animals with the of virus or cells is an important tool to the analysis of recombinant E protein of each serotype produced 192 these proteins and their interactions. Therefore, this hybridoma cultures. Of these, 1,5%, 19.8%, 31.8% and work has the objective to construct a recombinant 1.5%, were positive for DENV-1, 2, 3 and 4, respectively. baculovirus containing the domain III of the protein After the process of limiting dilution of some hybridomas E of the yellow fever. The domain III of the protein E culture, positive clones were obtained only for DENV- (ED3) was chemically synthetized merging the essential 3, with a total of 129 producing clones. The cells were regions of the baculovirus GP64 protein envelope, expanded and characterizations by western blotting creating the expression cassette GP64ED3 6x his-tag. This cassette was cloned into the vector pFASTBACACCI band of 45kDa, corresponding to envelope protein. The showedmonoclonal specific antibodies binding obtained of the antibody for DENV-3 produced encourages to the the baculovirus genome using the Bac-to-Bac® system us to invest in the production of these molecules for that(Invitrogen), contains creatingregions forthe specificrecombinant site transposition virus vGP64ED3. into application in the development of biotechnological The viral particles produced by this recombinant virus inputs, mainly because the technologies adopted here is the result of imports, which raises the cost of diagnostic kits used. Financial Support: FAPEMIG, FUNED. wereviral particlespurified fromwere theanalyzed supernatant for the insectpresence infected of the cells, ED3 byusing centrifugation Western blot. in The a sucroserecombinant gradient. virus Thewill purifiedbe used IV535 - Application Of Mass Spectrometry as antigen in the MAC-ELISA test, commonly used for the To Identify Contaminant Proteins In detection of the presence of yellow fever antibodies in Hepatitis B Vaccine the serum of patients. Botosso, V.F., Stuchlik, O., Prado, J.C.M., Gouvea M.N., Oliveira D.C.A., Tenório, E.C.N., Pohl, J. IV451 - Production And Characterization 1. Instituto Butantan, I.B., Av. Vital Brasil, 1500 Of Monoclonal Antibodies To Recombinant Envelope Proteins Of Dengue Virus. 2. Center for Disease Control and Prevention, CDC, Oliveira, P.C., Panisa, P.S., Ataide, A.C.Z., Silva, F.O., 1600, Clifton Road Caldas, S., Cecílio, A.B., Rocha, E.S.O., Souza, K.P.R., Instituto Butantan’s Recombinant Hepatitis B Vaccine Kroon, E.G.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicalscontains thein Virology: purified IV Hepatitis B Surface Antigen XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

180 Immunobiologicals in Virology: IV

(HBsAg) obtained by culturing genetically engineered is based on serological tests or immunohistological Hansenula polymorpha yeast cells carrying the surface antigen gene. The harvesting of cells is followed by HDV kit used for detection of hepatitis Delta is imported washing and disruption of the cells to release the identification of HDAg in the liver. Currently, the Anti- among the neglected diseases, for this reason there is froma lack Europe of interest but this for HDVthe productioninfection is ofglobally this diagnostic classified HBsAg,product whichis submitted is purified to microbiological, by several physico-chemical biological, and kit. The treatment for Hepatitis Delta is limited, mainly stepsphysico-chemical to eliminate tests, host including cell-derived the proteins. purity evaluation The final based on peguilated interferon alfa. Besides conventional by electrophoresis on SDS PAGE. The electrophoretic antibodies, camelids produce immunoglobulins devoid of light chains, in which the antigen binding site is formed to the HBsAg monomer (23 kDa), dimer (46 kDa) and by the single domain referred to VHH or nanobody. Due profile is composed of three major bands, corresponding to peculiar characteristics, several studies propose the use of nanobodies for laboratory diagnosis or viral trimerbut they (69 should kDa), identified not exceed by Western 5% of Blottingtotal protein, with anti- as activity neutralization. This work aimed to construct HBsAgrequired Mabs. by the Other WHO. nonspecific In order to bands analyze could and identifybe verified, the an immune VHH library to select clones capable to vaccine, the material was submitted to SDS PAGE, tryptic technology for production input of diagnostic kits. nonspecificdigestion of components protein bands, verified and electrosprayin one refused ionization batch of recognizeThus, a Lama specifically glama was HDAgimmunized using with phage delta antigen display (ESI) mass spectrometric analysis of the resulting (HDAg) and the immune response monitored by ELISA. peptides, performed using a Bruker model maXis ESI- Total RNA extraction was carried out using peripheral Q-TOF instrument interfaced with an on-line nanospray blood lymphocytes to perform cDNA synthesis and VHH source (Bruker Daltonics) to perform LC-MS/MS using a U3000 RSLCnano HPLC (Dionex). The collected data was processed by DataAnalysis/Proteinscape software fragmentswere inserted were into amplified pHEN1 by phagemid RT-PCR. Afterto construct digestion a (Bruker) that automatically submitted the peaklist withVHH SfiIlibrary and NotIinto HFE. restrictioncoli TG1 strains,enzymes, with the ampliconsa titer of to MASCOT search program using NCBInr database. 1,6x1012cfu/mL. VHHs were displayed fused to the surface protein PIII of M13K07 helper phage to perform bands were from the yeasts source, specially, from the the selection step using immunotubes previously Almost all the proteins identified in the “nonspecific” process did not introduce protein contaminants from clones, further experiments will be carried out aiming dehydrogenaseother source than complex, the host. showing The application that our purificationof the mass absorbedthe in vitro with and in HDAg. vivo characterization After identification and validation of specific of spectrometry technology to identify the contaminants Anti-HDAg nanobodies for production of diagnostic kits. was very important since it promoted the knowledge of FINANCIAL SUPPORT: CNPQ the physico-chemical characteristics of the contaminant proteins and consequently permitted us to optimize our IV574 - Broad Spectrum Antiviral Activity production process. Financial Support – FAPESP Of A Novel Protein From Lonomia Obliqua Hemolymph IV556 - Camelid Nanobodies As A Tool To Carmo, A.C.V., Yamasaki, L.H.T., Giovanni, D.N.S., Detect Hepatitis D Virus Figueiredo, C.A., Oliveira, M.I., Santos, F.C.P., Curti, S.P., Silva, M.P., Pereira, S.S., Botelho, L.F., Holanda, R.J., Tonelotto, M., Rahal, P., Moraes, D., Mendonça, R.Z. Salcedo, J.M.V., Stabeli, R.G., Vieira, D.S., Fernandes, C.F. 1. Universidade Estadual Paulista “Julio de Mesquita 1. Fundação Oswaldo Cruz, Rondônia, FIOCRUZ/ Filho”, UNESP, Rua Cristovao Colombo, 2265 Jd. Nazareth, RONDÔNIA, Rua da Beira, 7671, Km 3,5, BR 364 Sao Jose do Rio Preto - SP, Brasil 2. Centro de Pesquisa em Medicina Tropical, Rondônia, 2. Instituto Butantan, Instituto Butantan, Laboratorio CEPEM-RO, R: Guaporé, 215, Bairro Lagoa, Porto Velho -RO de Parasitologia e Entomologia, Sao Paulo-SP Hepatitis D virus (HDV) is a defective single-strand 3. Instituto Adolfo Lutz, IAL, Centro de Doencas RNA virus circular enveloped that requires hepatitis B Transmitidas por Vetor, Centro de Virologia, Sao Paulo -SP surface antigen (HBsAg) of the hepatitis B virus (HBV) 4. Faculdade Oswaldo Cruz, FOC, Sao Paulo-SP for replication and transmission. The HDV produces The control of viruses is of great interest to the public only the delta antigen (HDAg) as protein and can causes health area. Several studies have been conducted infection in HBsAg-positive patients. With a worldwide that show the presence of pharmacologically active distribution, HDV highly prevalent in Northern Brazil substances in the hemolymph of insects. Recently we mainly in western Amazon region. Disease diagnosis

181 Immunobiologicals in Virology: IV have demonstrated the existence of a potent antiviral on aluminum hydroxide and used to immunize BALB/c in the hemolymph of Lonomia obliqua caterpillar. This mice by intramuscular route. The control group received protein was able to reduce at 106 times the replication aluminum hydroxide without the protein. For the of herpes virus and in 10,000 fold the rubella virus. comparison of groups, unpaired student’s t-test was used Assays using RT-PCR to determine viral RNA present in no treated and rAVLO treated infected cells also showed a reduction in the same scale. The analysis of this protein andimmunoglobulin differences were G (IgG) considered response significant in mice compared when P was to by bioinformatics suggests that this protein is globular, <0.05.control The group. VP1 proteinIt is noteworthy could significantly that protocols elicit a usedspecific in secreted with a signal peptide which is cleaved between the present study were approved by Animal Care and amino acids 16 and 17. The studies also allows us to Use Committee of the Oswaldo Cruz Foundation. Our infer that this antiviral protein has the ability to bind to MHC class I. It was found that there are several protein VP1 protein from Escherichia coli expression system. binding sites on the weak and strong bases with various findingsIn addition, showed recombinant that it was VP1 possible was able to obtain to induce the HAV the HLA. The bioinformatic analysis also shows a strong create prospects to evaluate the potential of recombinant productionVP1 as prototype of specific vaccine. antibodies Financial in mice. support: These CAPES,results presencestructure, as of we α-helices detected in the the presence N-terminal of more region than 30% and Instituto Oswaldo Cruz (FIOCRUZ) and Bio-Manguinhos allowed to classify the antiviral protein as α/β type of (FIOCRUZ). protein chain. In the BLAST sequence analysis of cDNA α-helixantiviral and protein, 20 % noof β-sheetsequence found similarity separately was alongfound the in IV621 - TRANSIENT EXPRESSION OF CHIMERIC Genbank, suggesting that it is from a novel protein family. PROTEIN HBSAG/ROTAVIRUS-VP6 IN HUMAN It can be inferred by an analysis of this region that the CELLS HEK-293 T: VALIDATION OF A SYSTEM FOR possible antigenicity region would be between the 70- CHIMERIC ANTIGEN PRODUCTION. 110 amino acids, showing high accessibility. This high De Freitas, J.H.R., Jr. Mouta, S.S., Vieira, M.C.R., Pimenta, antigenic region on the surface, can be a possible region M.M.A., Monteiro, G.C.T.S., Barbosa, V.G., Lavatori, to interaction with other proteins. Financial support: M.F.H., Gomes, S.A., Moraes, M.T.B. FAPESP (08/57263-5), CAPES. Instituto Oswaldo Cruz-Fiocruz, IOC, Prédio Helio e IV587 - Expression, Purification And Peggy Pereira,Av.Brasil,4365,Manguinhos,Rio de Janeiro-RJ, Evaluation Of The Immunogenicity Of Vp1 Brasil Protein Of Hepatitis A Virus HBsAg is the surface antigen of hepatitis B. It indicates Da Silva Junior, H.C., De Azevedo, M.L.B., Galler, R., current infection with the hepatitis B virus (HBV). Medeiros, M.A. HBsAg is a complex of three proteins called small (S) Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil, (GP27 and P24), the middle protein (M) (GP36 and 4365, Manguinhos, Rio de Janeiro - RJ, Brasil GP33), and large protein (L) (GP42 and P39). All forms are present in glycosylated or non-glycosylated. The The hepatitis A virus (HAV) is the primary etiologic agent main commercial vaccines against HBV protein contains of acute viral hepatitis and causes, annually, 1.4 million only a small protein and has been successfully integrated new infections worldwide. Currently, effective vaccines into the childhood vaccination schedule, contributing to against HAV, based on inactivated and attenuated a 96% reduction in the incidence of acute hepatitis B in viruses, are commercially available. However, the high children and adolescents worldwide. HBsAg particles cost of production hinders the introduction of these also called hybrid chimeras have been shown in different vaccines into the routine of developing countries. In this context, the use of recombinant proteins of presentation of viral epitopes. Our study was initially HAV may represent an alternative model to existing experimentsbased on achieving such as proteinthe plasmid immunization vector tovery express efficient a vaccines. The aim of this work was to express, purify chimeric protein HBsAg/E2. The E2 protein corresponds and evaluate immunogenicity of HAV VP1 protein. The to 132 nucletídeos present in hypervariable region of the HCV (HVR1). This region was inserted into the unique into pET-100/D-TOPO expression vector. The VP1 restriction site in the gene for the small protein of HBsAg. HAVwas expressedVP1 gene, HM175in BL-21 strain, (DE3) was Escherichia amplified andcoli clonedin the However, the detection of the epitope of HCV epitope

the chimeric system, a second vector was constructed formby SDS-PAGE of inclusion and bodies Western and purifiedblotting bytechniques. nickel affinity To provedcontaining to bean epitope very difficult. of VP6 Thenrotavirus in order protein to which validate is chromatography.evaluate immunogenicity, The purified VP1 protein protein was was characterized adsorbed easily detectable. As a result, this second plasmid vector

182 Immunobiologicals in Virology: IV was capable of expressing the protein of HBsAg epitope fused to VP6. This may be evidenced using a commercial ELISA detection and Western Blot using a polyclonal VP6 rotavirus antibody. Both the VP6 protein and HBsAg can be detected. We hope that this system is versatile enough to use in diagnosis and generation of bivalent vaccines, and to detect the epitope E2/HCV hereafter we will use the sera of patients with HCV infection.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV Plant and Invertebrate Virology - PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

184 Plant and Invertebrate Virology: PIV

PIV28 - Segregation Of Citrus Tristeza Virus PIV36 - Coat Protein Phylogenetic Analysis (Ctv) Isolates Based On Early Removal Of Of Cowpea Aphid-Borne Mosaic Virus The Inoculum Source Passion-Flower Isolates From Brazil. Giampani, J.S., Silva, C.C., Pissinati, A., Bersaneti, G.T., Rodrigues, L.K., Da Silva, L.A., Garcez, R.M., Chaves, A.L., Tazima, Z.H., Leite Jr, R.P. Duarte, L.M.L., Giampani, J.S., Colariccio, A., Harakava, R., Eiras, M. Instituto Agronômico do Paraná, IAPAR, Rod. Celso Garcia Cid km 375, C.P. 301, CEP 86047-902, Londrina, PR, 1. Instituto Biologico, IB, Avenida Conselheiro Brasil Rodrigues Alves 1252 2. Instituto Agronômico do Paraná, IAPAR Citrus tristeza, caused by Citrus tristeza virus (CTV), is an endemic disease in Brazil. The control of this disease Cowpea aphid-borne mosaic virus (CABMV) causes has been achieved by using tolerant rootstocks, as well as by cross protection in citrus cultivars with certain the main viral disease of this crop in Brazil. In order intolerance to the virus, such as ‘Pera’ sweet orange woodinessto evaluate fruitthe genetic of passion-flower variability of (Passiflora Brazilian passion- edulis), (Citrus sinensis L. Osbeck). However, the breakdown of the cross protection has been reported. Further, this breakdown may be related to the segregation of the CTV flowerPaulo (municipalities CABMV isolates, of leaves Adamantina, showing mosaicAlvinlândia, and complex. In this work, we examined the segregation of blisterFernão, fromGarça passion-flower and Jacupiranga), crops Paraná in the states(São José of Sãoda CTV isolates based on tissue grafting and early removal Boa Vista) and Goiás (Planaltina) were submitted to of the inoculum source. Buds of different clones of ‘Pera’ molecular analysis. After total RNA extraction and RT- sweet orange from the Citrus Active Germplasm Bank of PCR, DNA fragments correspondent to part of NIb, the Instituto Agronômico do Paraná - IAPAR were used full-length of CP gene and 3’UTR were successfully as inoculum source and virus free ‘Pera Bianchi’ sweet orange was used as indicator. A bud of the inoculum accession codes KC777401 to KC777407. Comparisons source was grafted on Rangpur lime (Citrus limonia amplified,with other sequenced complete and CP deposited nucleotide into sequences the GenBank were as Osbeck) tree and a bud of the indicator ‘Pera Bianchi’ done using BLASTn and multiple alignments were was grafted above them. The buds used as inoculum done manually. Trees were constructed by maximum were removed at 3, 5, 7, 10, 12 and 14 days after parsimony (MP) and by maximum likelihood (ML), grafting. However, the buds were kept in the citrus trees TRN+G (0.5689) nucleotide substitution model, using PAUP 4.0b10. Passionfruit woodiness virus sequence by RT-PCR and segregation of the viral complex was was used as outgroup and bootstrap percentage values usedexamined as positive by SSCP control. of the coat CTV protein infection gene. was Segregating confirmed were computed after 1,000 re-samplings. Phylogenetic and positive control samples of the CTV were cloned in the pCR®2.1-TOPO® vector and maintained in the isolates from São Paulo, including those sequenced in Escherichia coli strain DH10B for DNA sequencing. The analysisthis work, showed formed foura monophyletic well defined group clusters. supported CABMV by nucleotide sequences were analyzed by using the DNA 93% of bootstrapping. Other group was divided into Baser Sequence Assembler software and Clustal W. The 4 subgroups: Fabaceae isolates from Northeast and initial CTV transmission was observed as early as 7 days after bud inoculation. However, partial transmission of the CTV complex was observed for a period ranging Zimbabwe;isolates from passion-flower Goiás and Paraná isolates clustered from Sãoin a Paulo,clade from 7 to 12 days after inoculation. The sequences of the Espíritowith other Santo Goiás and isolate Sergipe. and TheNortheast CABMV CABMV passion-flower passion- segregant isolates, in which inoculum was removed up to 12 days after grafting, reached 99% identity to each analysis methods, we found a high genetic variability other, whereas for the positive control sequences ranged flower isolates. Based on two different phylogenetic Differently of previously reported, we did not observe viral complex when the inoculum source was removed amonga consistent Brazilian clustering CABMV based on passion-flower geographical origin isolates. or fromin early 92 tostages. 99%. TheseThe segregant data confirm isolate the willsegregation be studied of the in host adaptation. The origin of CABMV in Brazil remains regard to the protective effect for cross protection in the to be elucidated. Financial Support: FAPESP (Proc. control of citrus tristeza. Financial support: Fundação 2011/11796-5) Fellows of *CAPES and **CNPq

Tecnológico do Paraná. PIV52 - Absolute Quantification Of Araucária de Apoio ao Desenvolvimento Científico e Grapevine Leafroll-Associated Virus 4 By Taqman Real Time Rt-Pcr In Infected Grapevines

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

185 Plant and Invertebrate Virology: PIV

Catarino, A.M., Fajardo, T.V.M., Pio-Ribeiro, G., Nickel, PIV56 - Detection And Coat Protein Gene O., Revers, L.F. Characterization Of Grapevine Virus B Isolates From Different Grapevine Species 1. Embrapa Uva e Vinho , CNPUV, Rua Livramento, Catarino, A.M., Fajardo, T.V.M., Eiras, M., Pio-Ribeiro, G., 515 - Bento Gonçalves, RS. CEP 95700-000 Nickel, O. 2. Universidade Federal Rural de Pernambuco, UFRPE, Dept. de Agronomia-Av. Dom Manoel de Medeiros,s/n. Dois 1. Embrapa Uva e Vinho, CNPUV, Rua Livramento, Irmãos. Recife-PE 515 - Bento Gonçalves, RS. CEP 95700-000 2. Instituto Biológico de São Paulo, IB, Av. Conselheiro Grapevine viruses induce reduction of productivity and Rodrigues Alves, 1252 - São Paulo, SP. CEP: 04014-002 quality of grapes. Grapevine leafroll-associated virus 3. Universidade Federal Rural de Pernambuco, UFRPE, 4, GLRaV-4 (Closteroviridae, Ampelovirus) causes leaf Dept. de Agronomia-Av. Dom Manoel de Medeiros, s/n-Dois the absolute amount of a target (expressed as a copy Irmãos. Recife-PE rollnumber in grapevine.or concentration). Absolute The quantification objective of determines this study Corky bark, a component of the grapevine rugose was to generate a standard curve for GLRaV-4 absolute wood complex, caused by Grapevine virus B, GVB

production, incomplete ripening of grapes and quantificationpreviously described. in infected To generate grapevines. a standard Reagents curve, and 5 (Betaflexiviridae,progressive decline. Vitivirus), Cultivars and induces rootstocks decrease differ in of reactionor 6 different set amounts up for (tenfold GLRaV-4 diluted) amplification of the standard were their susceptibility to the corky bark disease. Some are symptomless carriers or exhibit mild symptoms, were carried out in triplicates and standard curves while others suffer rapid decline. The objective of this were quantifiedgenerated byby TaqMantwo independent real time RT-PCR. experiments. Reactions For work was to characterize partially three isolates of GVB collected from different grapevine species and Brazilian containing part of the GLRaV-4 genome (300 bp covering geographical regions: GVB, the isolate named CS, was quantification of RNA molecules as standard, a fragment collected from cv. Cabernet Sauvignon (Vitis vinifera) RT-PCR) was transcribed in vitro from a previously exhibiting dark red spotted leaves and mild curling 94obtained bp hHSP70 transcriptional DNA fragment recombinant amplified vector. by This real clone time down of leaf edges, maintained in Bento Goncalves, Rio carries partial sequences of 14 viruses, fused in tandem, Grande do Sul State; the isolate IS-SVF was collected including GLRaV-4. After in vitro transcription, plasmid from cv. Isabel (V. labrusca) showing bark swelling DNA template was removed with DNase and transcribed and longitudinal cracking of mature canes in Sao RNA concentration was measured by spectrophotometry. Vicente Ferrer, Pernambuco State, and the isolate CO was collected from symptomless cv. BRS Cora (hybrid of the reverse transcription reaction into account. The grapevine) in Jales, Sao Paulo State. The symptoms could Thecopy usenumber of RNA of standard standard GLRaV-4 takes the RNA variable molecules efficiency was not be associated with a single virus, since these plants could be infected by two or more virus. Total RNA was RNA / [transcript length in nucleotides x 340]) x 6.022 x extracted from infected grapevines by capture on silica calculated10^23 (Qiagen using Handbook, the formula: 2011). Y molecules/μl After a standard = (X curve g/μl and the complete coat protein (CP) gene of GVB was was generated, 76 infected grapevine samples were evaluated to determine GLRaV-4 titre. The standard curve sequenced (two clones/isolate). An expected fragment (plot of CT value, threshold cycle, against log of amount RT-PCR-amplified,of 594 nucleotides cloned(bp) (coding into pGEM-T for 197 Easy deduced vector amino and of standard) was generated: y = -1.509ln(x) + 41.202; in which R2 = 0.9999, y = CT value and x = RNA molecules/ for GVB (6445v and 7038r), from the three different acids)infected was grapevine amplified sources. by RT-PCR, The using obtained specific sequences primers standard curve (used as a reference in all subsequent showed a low variability of coat protein genes among the μl.reactions), The CT allowing value of thecalculation target wasof the compared GLRaV-4 with amount the three GVB isolates. Nucleotide and amino acid identities in the samples. The absolute amount of GLRaV-4 were higher than 99% among themselves. GVB GenBank nucleic acid in analyzed samples was determined and accession codes are KF040331 (CO), KF040332 (IS-SVF) and KF040333 (CS). Different grapevine symptoms vary This result can improve virus diagnosis by accurately according to combinations of cultivar or host species rangedquantifying from virus ca. 1000 titre variationsto 150,000 in copies grapevines. of GLRaV-4/μl. Financial with viral isolates, strains or species. In this work, support: Embrapa high homologous coat protein sequences of three GVB isolates from symptomatic and symptomless grapevines and from distant geographical regions are involved in a

186 Plant and Invertebrate Virology: PIV very different range of symptoms. Despite the limited (NCLDV), comprised by others giant virus. The IIV6 is extention of this viral variability study, in this case, it morphologically complex and posses a large genome could be indicative that GVB grapevine symptoms (or its (212,482 bp) cody to 468 ORF’s (Open Reading Frame). absence) are more related to grapevine genotypes than The IIV6 infect a wide range of insect hosts, being coat protein nucleotide sequence. Financial support: vertically transmitted, and leading to a high mortality Embrapa rate of the infected larvae. This fact has stimulated the use of the IIV6 as biopesticides, being important in PIV98 - Molecular Characterization Of agronomy and in economy. Despite its economic and Virus Isolated Collected In Commercial ecologic relevance, few studies have been conducted Plantings Of Watermelon In The State Of to elucidate these issues, as well as to understanding Tropical Várzea Tocantins the evolution of IIV6 and their relationships with their Tavares, A.T., Chaves, P.P.N., Tavares, M.T., Carvalho, hosts and other NCLDV. The aim of this study was to A.L.A., Gellen, L.F.A. analyze the occurrence of horizontal (HGT) and lateral 1. Universidade Federal do Tocantins, UFT, Rua (LGT) gene transfer in the IIV6 genome. For this, all IIV6 genes (GenBank: NC_003038.1) were subjected to Badejós, L 7 Chácara 69/72 Zona Rural Cx Postal 66 CEP: similarity analysis in the NCBI protein database (BlastP 77402-970 Gurupi-TO program) using pre-set parameters, considering hits 2. Universidade Federal de Lavras, UFLA, Caixa Postal 3037 Campus Universitário Cep: 37.200-000 Lavras – MG thatshowed met hitsthe followingthat met criteria:the criteria e-value for initial≥ 10-5, screening. coverage inoculation, the phenotypic response of plants pumpkin ≥After, 30% phylogenetic and similarity trees ≥ 10%. were Results: built 50using (10,7%) maximum ORF’s Withcv. ‘Caserta’ this work,to isolates aimed of ZYMV to verify and (ZYMV)+SqMV through artificial and parsimony methods implemented by MEGA 5 program. also check the phenotypic reaction in four genotypes Among these genes, 13/50 indicated high probability of of melon from an isolated mixed (ZYMV+SqMV), both involvement in HGT and LGT, especially genes of cellular coming from watermelon producing regions in the state metabolism. Phylogenetic analysis has revealed that IIV6 of Tocantins. The study was conducted in a greenhouse has more than one source of HGT, especially invertebrates with a screened proof aphid. The experimental design and bacteria. The results show, in an unprecedented way, three replications. The inoculated plants were observed evolution of IIV6 genome, similarly as described for wasfor symptoms completely as randomized at 28, 33 and with 38 daysfive plants after germination. per plot and theothers events NCLDV. of HGT The andability LGT of have “obtain” directly the genesinfluenced from the Pumpkin plants, inoculated with simple isolate, the host and from ecologically sympatric organisms suggests predominant symptoms exhibited were mosaic and parallel veins. In mixed infections there were more host range of the members of this viral family. Financial aggressive symptoms, progressing to narrowing and thesupport: versatility FAPEMIG, of iridovirus, CAPES, CNPq,influencing MAPA, the PRPq evolution and leaf deformation, and bubbles, parallel ridges and spur, PIV126 - Identification Of Melon Cultivars compromising much of the leaf area of plants evaluated. Resistant To Mixed Infection With Viruses In melon genotypes, the symptoms observed were Zymv And Sqmv more aggressive in Sunshine and Yellow. Genotypes in Silva, C.P., Silva, E.N., Dos Santos, G.R., Carline, G.J.V., Eldorado genotype was observed only mosaic and melon Arruda, E.L. Valenciano was not observed symptoms. Universidade Federal do Tocantins, UFT, Rua Badejós, PIV100 - In Silico Analysis Of The Lote 7, Chácaras 69/72, Zona Rural. Cx.postal 66. CEP: Occurrence Of Horizontal Gene Transfer 77402-970 (Hgt) And Lateral Gene Transfer (Lgt) In Invertebrate Iridescent Virus 6 (Iiv6) Although Brazil is considered as one of the biggest Pereira, A.F., Assis, F.L., Bonjardim, C.A., Trindade, G.S., producers of melon in South America, with 17% of the Ferreira, P.C.P., Kroon, E.G., Abrahão, J.S. total production over there; there is a need to seek new technologies and knowledge which can increase the Universidade Federal De Minas Gerais, UFMG, Av. quantity and quality of melon production in Brazil, in Antonio Carlos, 6627 - Pampulha - Belo Horizonte - MG. order to supply the national and international market. CEP: 31270-901 Diseases constitute one of the largest barriers for its Invertebrate Iridescent Virus 6 (IIV6) belongs to development, and viral diseases are among the most Iridovirus genus, Iridoviridae family, and was recently important melon diseases, occurring with high incidence grouped into the Nucleo-Cytoplasmic Large DNA Viruses and distinct severities; causing a drastic reduction in September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

187 Plant and Invertebrate Virology: PIV the total production and product quality as well. The Clones corresponding to one and a half copies of the occurrences of mixed infections, infections caused by the viruses Zucchini yellow mosaic virus (ZYMV) and were constructed by stepwise restriction digestions to Squash mosaic virus (SqMV), are very common in the DNA-Agenerate and “0.5mers”, DNA-B, flanked monomers by two and origins “1.5mers”, of replication, which melon crop. The infected plant presents a severe yellow were then transformed into E. coli. The clones were mosaic, a large reduction in leaf blade and rickets; also used for inoculation of N. benthamiana by particle it can produce deformed fruits and leads to total loss of production. The genetic resistance in some kind of cultivars is the most effective way to control virus. The bombardment.now be used as Infectiona tool for was the biologicalconfirmed characterization by rolling circle aim of the study was to identify melon cultivars resistant amplificationof ToMlMV. Financial followed support: by RFLP. Fapemig The infectious e Capes clone can to mixed infections with (ZYMV) e (SqMV). The tests were performed with 9 melon cultivars varieties by PIV141 - Effects Of Chemical Products subjecting them to the mixed infection of ZyMV+SqMV. And Extracts From Medicinal Plants On The experimental design was completely randomized, Infectivity Of Papaya Lethal Yellowing containing 11 treatments with 3 repetitions and with 9 Virus In Papaya plants per replication. The symptoms of the virus were Lima, J.A.A.L. analyzed visually using a scale of severity from zero to Instituições to 1% of the leaf with symptoms; grade 2, low severity, Papaya (Carica papaya) is an important tropical five.from Grade 1% to 0,5% no of symptom; the leaf with grade symptom; 1, severity grade too 3, medianlow, up fruit crop and production is increasing every year severity, from 5% to 25% of the leaf with symptom; in Northeastern Brazil. Papaya lethal yellowing is a grade 4, high severity, from 25% to 50% of the leaf with disease caused by Papaya lethal yellowing virus (PLYV) symptom; and grade 5, very high severity, over 50% of that occurs only in Northeastern Brazil. The symptoms the leaf with symptom. The melon cultivars: Sunshine, are characterized by progressive leaf yellowing and Eldorado, Gaúcho Casca de Carvalho and Melão Amarelo greenish circular spots on the fruits. The virus is very were susceptible to virus ZyMV+SqMV; however, the stable and can be detected in dried roots and leaves Melão Amarelo and the Sunshine were the most affected maintained in laboratory conditions for up to 120 days. by the viruses; over 50% of their leaves got very high The present study had the objective to evaluate the severity, graded as 5. The cultivars Jangada, Valeciano, distribution and movement of PLYV in mechanically Mossoró, Melão Rei, and the cultivar from Formoso do inoculated plants. Serological studies with antiserum for Araguaia were highly resistant to the virus, with no PLYV were performed using equal amount of tissue from presence of symptoms. each part of infected papaya plants to demonstrate the virus distribution in the plants and how long it takes to PIV129 - A Infectious Clone Of Tomato Mild infect systemically a mechanically inoculated plant. The Mosaic Virus absorption readings in enzyme linked immunossorbent Godinho, M.T., Zerbini, F.M. assay (ELISA) for PLYV were very similar when equal Universidade Federal de Viçosa, UFV, Av Ph Rolfs s/ N amount of each part of systemically infected plants were tested demonstrating that the virus is uniformly Diseases caused by begomoviruses (genus Begomovirus, distributed in the young, intermediate and older leaves, family Geminiviridae) are serious problems in stem and roots. On the other hand, the presence of the economically important crops such as beans, cotton, virus in inoculated plants was detected by indirect cassava and tomatoes, in many tropical and subtropical ELISA in the inoculated leaves 72 h after inoculation, regions of the world. Several studies have been and only seven and ten days later the virus was detected conducted seeking to molecularly characterize these in the stem and in the roots, respectively. Sixteen days pathogens. However, it is also important to determine after inoculation the virus was detected in the younger their biological characteristics. Begomoviruses are leaves but the plants were systemically infected only 20 to 25 days after inoculation. This is in agreement with not sap-transmitted. Fortunately, their circular, ssDNA which has been proposed that virus moves from cell notoriouslygenomes facilitates difficult the to construction purify and of most infectious of them clones are to cell, multiply in most of them and after reaching the phloem cells it is rapidly transported over long distance within the plant. According to the obtained results, PLYV whichwork wascan becarried used forout artificial to construct inoculation an infectious in host rangeclone started to replicate inside the inoculated cell as soon as assays,of Tomato and mild can mosaic be stored virus indefinitely (ToMlMV), ata -80oC.molecularly This it is inoculated, but it took approximately 20 to 25 days characterized tomato-infecting begomovirus from Brazil.

188 Plant and Invertebrate Virology: PIV to infect systemically the entire plant. Financial Support: that the six isolates represent a distinct CPMMV strain CNPq and PRONEX/FCPC/FUNCAP. denominated as CPMMV-BR. The recombination occurred mainly in the polymerase gene, and may occur PIV145 - Molecular And Biological less frequently in other regions of the CPMMV genome. Characterization Of Six Cowpea Mild Funding: Fapemig, CNPq. Mottle Virus Isolates Infecting Soybean In Brazil PIV147 - Movement And Distribution Zanardo, L.G., Silva, F.N., Milanesi, D.F., Castillo-Urquiza, Of Papaya Lethal Yellowing Virus In G.P., Lima, A.T.M., Almeida, A.M.R., Zerbini, F.M., Mechanically Inoculated Papaya Carvalho, C.M. Anselmo, G.C., Lima, J.A.A., Nascimento, A.K.Q. 1. Universidade Federal de Viçosa, UFV, Av. P.H. Rolfs, Universidade Federal do Ceará, Laboratório Virologia s/n - Viçosa - MG Vegetal, UFC - LabVV, Depto Fitotecnia, Laboratório 2. Empresa Brasileira de Pesquisa Agropecuária, Virologia Vegetal, Fortaleza, CE – 60.440.554 Embrapa Soja, Rod. Carlos João Strass - Distrito de Warta - Papaya (Carica papaya) is an important tropical Londrina - PR fruit crop and production is increasing every year Cowpea mild mottle virus (CPMMV, family in Northeastern Brazil. Papaya lethal yellowing is a disease caused by Papaya lethal yellowing virus (PLYV) in Brazilian soybean. The virus is associated with that occurs only in Northeastern Brazil. The symptoms Betaflexiviridae,soybean stem necrosis genus Carlavirus)disease and is hasa serious been foundproblem in are characterized by progressive leaf yellowing and greenish circular spots on the fruits. The virus is very complete genome of CPMMV has been determinated. stable and can be detected in dried roots and leaves fieldsThe aims from of different this study Brazilian were to states. report Until the biological now only andone maintained in laboratory conditions for up to 120 days. molecular characterization of six isolates of CPMMV. The present study had the objective to evaluate the Soybean plants with mosaic and stem necrosis were distribution and movement of PLYV in mechanically collected in Bahia, Goias, Mato Grosso and Minas Gerais inoculated plants. Serological studies with antiserum for states, Brazil. For host range studies the sap from PLYV were performed using equal amount of tissue from infected soybean leaves was mechanically inoculated each part of infected papaya plants to demonstrate the into 21 species/cultivars belonging to Amaranthacea, virus distribution in the plants and how long it takes to Chenopodiaceae, Cucurbitaceae, Solanaceae and infect systemically a mechanically inoculated plant. The Fabaceae. Symptoms were evaluated and indirect ELISA absorption readings in enzyme linked immunossorbent assay (ELISA) for PLYV were very similar when equal amount of each part of systemically infected plants wasCD206, used followed to confirm by RT-PCR.infection. The Complete nucleotide genomes sequences were were tested demonstrating that the virus is uniformly amplifiedobtained werefrom totalassembled RNA extracted using DNA of soybeanBASER v.3.5,plants and cv. distributed in the young, intermediate and older leaves, the ORF’s were determined using ORF Finder. Pairwise stem and roots. On the other hand, the presence of the nt comparisons were analyzed in MEGA v.5.0 and virus in inoculated plants was detected by indirect pairwise aa comparisons in DNAMAN v.7.0. Phylogenetic ELISA in the inoculated leaves 72 h after inoculation, trees were constructed using Bayesian Inference. and only seven and ten days later the virus was detected Potential recombinant sequences were performed using in the stem and in the roots, respectively. Sixteen days RDP v.3.44. The viral isolates were able to infect Glycine after inoculation the virus was detected in the younger max (cvs. CD206 and Pintado), Phaseolus vulgaris leaves but the plants were systemically infected only 25 (cvs. Jalo and Manteigao), Vigna unguiculata, Nicotiana to 30 days after inoculation. This is in agreement with benthamiana, N. debney, N. glutinosa, Chenopodium which has been proposed that virus moves from cell quinoa and C. amaraticolor. Complete genomes of the to cell, multiply in most of them and after reaching the CPMMV isolates are 8,180-8,198 nt long, excluding the phloem cells it is rapidly transported over long distance 3’-poly(A) tail, and have 67-68% nt sequence identity within the plant. According to the obtained results, PLYV with a Ghana CPMMV isolate. The replicase has only started to replicate inside the inoculated cell as soon as 60-61% nt identity with the Ghana isolate, and the coat it is inoculated, but it took approximately 25 to 30 days protein is highly conserved (79% nt identity and 95- to infect systemically the entire plant. Financial Support: 96% amino acid identity). The high CP identity and the CNPq and PRONEX/FCPC/FUNCAP. isolates as CPMMV. Biological and molecular differences phylogenywith the Ghana supported CPMMV the isolate classification were found of andthe indicatedBrazilian September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

189 Plant and Invertebrate Virology: PIV

PIV148 - Synergistic Interaction Between Universidade Federal de Viçosa, UFV, Av. P.H. Rolfs, Squash Mosaic Virus And Virus Species From s/n - Viçosa - MG The Genus Potyvirus In Melon Silva, F.R., Barbosa, G.S., Nascimento, A.K.Q., Lima, J.A.A. Soybean stem necrosis disease is caused by CPMMV Universidade Federal do Ceará, Laboratório Virologia of viral infection in soybean plants are highly variable Vegetal, UFC - LabVV, Depto Fitotecnia, Laboratório (Family Betaflexiviridae, Genus Carlavirus). Symptoms Virologia Vegetal, Fortaleza, CE – 60.440.554 producing Brazilian states. The aim of this study was to anddetermine the viruses the molecular have been variability found in offields eighteen from isolatesseveral The Northeastern Brazil has a great potential for production of melon (Cucumis melo) and watermelon (Bahia, Goiás, Maranhão, Mato Grosso, Minas Gerais (Citrullus lanatus), but virus infections can seriously ofand CPMMV Pará) during from the fields years of differentof 2001-2010. Brazilian Symptoms states affect their yield. The most important virus species were evaluated in soybean plants cv. CD206 and the found naturally infecting melon and watermelon in Northeastern Brazil belong to the genus Potyvirus: Papaya ringspot virus, type Watermelon (PRSV-W); infectionRNA extracted confirmed of soybean by indirect cv. CD206,ELISA. Partial followed sequences by RT- Watermelon mosaic virus (WMV) and Zucchini yellow ofPCR. genomes The nt sequences (ORF2-3’end) obtained were were amplified assembled from using total mosaic virus (ZYMV); and genus Comovirus: Squash DNA BASER v.3.5 and the ORFs were determined using mosaic virus (SQMV). Considering the natural infection ORF Finder. Pairwise nt comparisons were analyzed in of two or more viruses in the same plant, the present MEGA v.5.0 and pairwise aa comparisons in DNAMAN research had the objective to evaluate the effects of mixed v.7.0. Detection of potential recombinant sequences infection of SQMV with species of the genus Potyvirus. was performed using RDP v.3.44. Phylogenetic trees Groups of 12 plants were inoculated with the following were constructed using Bayesian Inference for partial virus combinations: A- Plants inoculated with a mixture genomes and for each ORF individually. Descriptors of of SQMV and PRSV-W; B- SQMV and WMV; C- SQMV and molecular variability were estimated using the DnaSP ZYMV; D- Plants inoculated only with SQMV; E- Plants inoculated only with PRSV-W; F- Plants inoculated only implemented in the Datamonkey server. The isolates with WMV and G- Plants inoculated only with ZYMV. The softwareshowed av.5.10 variety and of site-specific symptoms selection in soybean, analysis ranging was study also included non-inoculated plants as control. from mild (crinkle/blistering of leaves, mosaic and vein Synergistic effects were observed when SQMV was mixed inoculated with either PRSV-W, WMV or ZYMV, but necrosis). Only one CPMMV isolate had a recombinant all mixed inoculated plants started to present the typical clearing)portion toamong severe the (bud eighteen blight, dwarfism, evaluated. leaf andPairwise stem SQMV symptoms seven days after inoculation, and only comparisons and phylogenetic analysis showed that three days later they showed more severe symptoms the isolates are distinct and form two distinct groups, than those exhibited by the plants with single infections. showing the existence of two strains, with molecular All mixed infected plants also presented delay of the variability between them. The phylogenetic tree did not show clustering based on the year of collection or of leaves, and fresh and dried weights when compared geographical origin; some groupings were based on floweringwith healthy period, and reduction single infected in size, plants. reduction Nevertheless, of number symptoms. Selection analyses showed that all ORFs were the interaction of SQMV with PRSV-W caused the under purifying selection. Funding: Fapemig, CNPq. greatest reduction. All single and mixed infections were PIV154 - Interfering Rna As A Strategy For that all control measures involving the development of Silencing The Rep Gene Of Begomoviruses confirmedresistant genotypes by serology. should These consider results the effects demonstrated of mixed Infecting Tomato (Solanum Lycopersicum) infections of virus in melon and watermelon. Financial In Brazil Support: CNPq and PRONEX/FCPC/FUNCAP. Paula, N.T., Albuquerque, L.C., Aragão, F.J.L. PIV149 - Molecular Variability Of Two Universidade de Brasília, UNB, Campus Universitário Cowpea Mild Mottle Virus (Cpmmv) Strains Darcy Ribeiro CEP: 70910-900 Infecting Soybean In Brazil Zanardo, L.G., Silva, F.N., Milanesi, D.F., Lima, A.T.M., The Begomovirus (Family Geminiviridae) represents an Castillo-Urquiza, G.P., Carvalho, S.L., Zerbini, F.M., important group of pathogens that infect a wide range of Carvalho, C.M. These viruses are transmitted to dicotyledonous plant species and cause signiﬁcant losses in agriculture.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant andplants Invertebrate by whiteﬂy Virology: PIV Bemisia tabacci, whose control XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

190 Plant and Invertebrate Virology: PIV

PIV195 - Potato Virus Y And Pepper Mild control a more promising management. In this study, Mottle Virus Dual Infection In Capsicum byNicothiana insecticides benthamiana is difficult was and used costly, as a model making to geneticobtain Baccatum ‘Aji Amarillo’ plants with wide resistance to different begomoviruses Chaves, A.L.R., Duarte, L.M.L., Eiras, M., Ramos, A.F., infecting tomato in Brazil, through the use of molecular Colariccio, A., Harakava, R. mechanism of interfering RNA (RNAi). A chimerical sequence of 432 nucleotide within the rep gene Instituto Biológico, IB, Av. Cons. Rodrigues Alves, 1252. from two important Brazilian begomovirus species, V. Mariana, SP. CEP 04014-002 Tomato yellow vein streak virus (ToYVSV) and Tomato Among peppers (Capsicum baccatum), the cultivar chlorotic mottle virus (ToCMoV) was used to generate ‘Aji Amarillo’, native to the Andes, South America, is an intron-hairpin construction. Following ligation considered the basis of Peruvian cuisine. In Brazil, of the construct into binary vector pCAMBIA 3300, there are no cultivars that match ‘Aji Amarillo’. Plants Agrobacterium tumefaciens cells (strain EHA-105) of pepper ‘Aji Amarillo’ from a commercial crop in were transformed. The bar gene was used as selection Piedade, State of São Paulo, showing leaf mosaic and marker and regenerated plants tested for the presence distortion of leaves and fruits, were examined in the of PAT protein. A total of 21 N. benthamina plants were transmission electron microscope and subjected to selected. Currently, progenies arising therefrom are biological, serological and molecular tests. Viral particles being challenged with ToYVSV and ToCMoV and degree with two kinds of morphology, i.e. rigid helical rod- of resistance are being evaluated. rod-shaped with approximately 700 nm in length, PIV156 - PHENOTYPIC REACTION OF PUMPKIN were observed by sap negative staining. Viruses were AND MELON PLANTS TO INFECTION OF ISOLATED shaped with 300 nm in length, and elongated flexuous biologically isolated by sap mechanical inoculation in SINGLE AND MIXED ZYMV ZYMV+SQMV Nicotiana glutinosa and Datura stramonium. Potato Tavares, A.T., Tavares, M.T., Nunes, P.P., Gellen, L.F.A., Carvalho, A.L.A. presumable Tobamovirus isolate was serologically 1. Universidade Federal do Tocantins, UFT, Rua virusrelated Y to (PVYO) Pepper was mild identified mottle virus by DAS-ELISA (PMMoV) andin PTA- the Badejós, L 7 Chácara 69/72 Zona Rural Cx Postal 66 CEP: ELISA. DNA fragments with 850 bp were successfully 77402-970 Gurupi-TO 2. Universidade Federal de Lavras, UFLA, Caixa Postal coat protein (CP) ORF of the tobamovirus subgroup I. The sequenced DNA products presented percentage of 3037 Campus Universitário Cep: 37.200-000 Lavras – MG amplified by RT-PCR with specific primers flanking the nucleotide identity higher than 94% with homologous sequences of PMMoV deposited in databases. The inoculation, the phenotypic response of plants pumpkin deduced CP aminoacids sequence showed a methionine Withcv. ‘Caserta’ this work,to isolates aimed of ZYMV to verify and (ZYMV)+SqMV through artificial and instead of asparagine at 139 position, indicating that, also check the phenotypic reaction in four genotypes probably, this isolate is not capable to overcome L3 of melon from an isolated mixed (ZYMV+SqMV), both gene resistance. Phylogenetic analysis using maximum coming from watermelon producing regions in the state likelihood criterion was performed using PAUP program of Tocantins. The study was conducted in a greenhouse after nucleotide substitution model determination [HKY with a screened proof aphid. The experimental design + G (=1.07)] and comparisons with PMMoV homologous sequences from different geographical regions. PMMoV three replications. The inoculated plants were observed Brazilian isolate (named PMMoV-Piedade) clustered in wasfor symptoms completely as randomized at 28, 33 and with 38 daysfive plants after germination. per plot and the monophyletic group comprising European, Asian Pumpkin plants, inoculated with simple isolate, the and Brazilian isolates. It is suggested that PMMoV- predominant symptoms exhibited were mosaic and Piedade should have been introduced from Peru through parallel veins. In mixed infections there were more imported seeds, since it did not share the same common aggressive symptoms, progressing to narrowing and ancestor of Brazilian isolates available in databases. leaf deformation, and bubbles, parallel ridges and spur, compromising much of the leaf area of plants evaluated. PIV231 - The Relative Contribution Of In melon genotypes, the symptoms observed were Recombination And Mutation To The more aggressive in Sunshine and Yellow. Genotypes in Genetic Variability Of Begomovirus Eldorado genotype was observed only mosaic and melon Populations Valenciano was not observed symptoms. Financial Lima, A.T.M., Silva, J.C.F., Silva, F.N., Urquiza, G.P.C., support: CAPES, CNPq e UFT Silva, F.F., Seah, Y.M., Pereira, H.M.B., Mizubuti, E.S.G., Duffy, S., Zerbini, F.M.

191 Plant and Invertebrate Virology: PIV

1. Universidade Federal de Viçosa, UFV, Viçosa, MG 3. Research Faculty of Agriculture, , Hokkaido 36570-000, Brazil University, Sapporo, Hokkaido, Japan 2. The State University of New Jersey, Rutgers, New Plants represent ideal system for production of Brunswick, NJ 08901, USA heterologous proteins. However, transgenic plant-based Begomoviruses are single stranded DNA plant viruses protein production systems showed many disadvantages responsible for serious agricultural threats. Previous as low protein production and long term development studies have shown that begomovirus populations required. Thus, the use of plant viruses as vehicles for exhibit a high within-host molecular variability and foreign protein production is the good alternative. Plant may evolve as quickly as RNA viruses. Although the virus-based protein production systems in binary vector recombination-prone nature of begomoviruses has been offer many advantages as the short developing time and exhaustively demonstrated, no work has attempted to the higher yield. Cucumber mosaic virus (CMV) is one determine the relative contribution of recombination of the viruses that has been used for protein production and mutation to the standing molecular variability of in plants and has an extremely wide plant host range. begomovirus populations. We estimated the molecular The tripartite CMV based vector was developed using variability levels of begomovirus datasets collected from Agrobacterium tumefaciens system. Each cDNA of RNA around the world and observed that they were similar 1, RNA 2 and RNA 3 genome segment was cloned into to some plant RNA virus populations, even though these binary vector pBI121 and transferred to Agrobacterium viruses replicate using the supposedly proof-reading DNA polymerases from their hosts. An uneven distribution of in Nicotiana benthamiana produced CMV systemic molecular variability levels across the length of the CP GVinfection 3101. with Agro-infiltration symptoms as ofwild these type three virus. constructs In order and Rep genes due to recombination was readily evident to develop CMV-based protein expression vector, the of this evolutionary mechanism to the standing introduce additional restriction enzyme sites for easier frommolecular our analyses, variability. suggesting We mapped a significant all substitutions contribution over cDNA of RNA 2 was modified by PCR using primers to CP and Rep maximum likelihood trees and counted 121 and transferred to Agrobacterium GV 3101, the three the number of substitutions on branches which were cloning. The modified RNA2 (cDNA) was cloned into pBI

Agrobacterium constructs (RNA1, RNA3 and modified associatedaddition, we to alsorecombination estimated the(ηr) per and generation mutation relative(ημ), in RNA2)development, were co-infiltrated though the in Nicotianasymptom benthamiana,was attenuated and order to estimate their relative contribution (ηr/ημ). In aftermaybe three due to days, the deletion infection of was 2b gene confirmed in RNA2 by which symptom was a PTGS supressor. The presence of CMV infection was rates of both evolutionary mechanisms (r/μ) as the ratio betweenthese sequences the population-scaled are targeted by recombination recombination (ρ =relative 2Ner) andto mutation. mutation Werates showed (θ = 2Neμ), that tothe express relative how contribution frequently confirmedCMV-based by vector Dot-Blot is a Immunobidingviable system. assayThe capacityusing anti- of of recombination and mutation is not, necessarily, a CMVexpression antibody. foreign This proteins result, confirmwill be evaluated that the with tripartite GFP function of their relative rates. In addition, although a expression. large fraction of the molecular variability levels could be assigned to recombination, it was always lower than PIV242 - Management Of Zucchini Lethal Chlorosis Virus Disease In Cucurbita Pepo of begomovirus populations is predominantly driven Caserta Treated With Bougainvillea thatby mutational due to mutation, dynamics. indicating Financial that support: the diversification FAPEMIG, Spectalis And Mirabilis Jalapa Leaf INCTIPP Extracts Duarte, L.M.L., Alexandre, M.A.V., Chaves, A.L.R., PIV241 - Tripartide Cucumber Mosaic Virus Azevedo Filho, J.A. Based Vector Development For Expression 1. Instituto Biológico, IB, Av. Cons. Rodrigues Alves, Foreign Proteins In Plants 1252, São Paulo, SP Souza, A.C., Inoue-Nagata, A.K., Chikara, M., Nagata, T. 2. APTA- Pólo Leste Paulista, APTA, Estrada Nelson 1. Universidade de Brasília, Unb, Instituto de Biologia, Taufic Nacif, Km 03, CP-01, 13910-000 Monte Alegre do Sul- Campus Universitário Darcy Ribeiro - Asa Norte, 70910-900 SP 2. Embrapa Hortaliças, CNPH, Rodovia Brasília/ Plant extracts containing inhibitors of viral infection Anápolis BR 060 Km 09 Gama - DF Caixa Postal 218 CEP have been tested in some systems in which systemic 70351-970 reaction was induced by viruses. The inhibitory action

192 Plant and Invertebrate Virology: PIV of Bougainvillea spectabilis and Mirabilis jalapa foliar ‘Caserta’. The extracts were proven to be effective in extracts has been evaluated against Tomato spotted inhibiting infection by these viruses by up to 70% when wilt virus (Tospovirus) on tomato plants and Zucchini prepared at a concentration of 1/50 (W/V). In recent yellow mosaic virus (Potyvirus) on Cucurbita pepo years the incidence of lethal chlorosis disease caused by ‘Caserta’. The extracts were proven to be effective in the tospovirus Zucchini lethal chlorosis virus (ZLCV) is inhibiting infection by these viruses by up to 70% when increasing and worrying cucurbit crop producers due to prepared at a concentration of 1/50 (W/V). In recent crop losses. Symptomatic plants are severely stunted and years the incidence of lethal chlorosis disease caused by die before they bloom. In order to evaluate the inhibitory the tospovirus Zucchini lethal chlorosis virus (ZLCV) is effect of B. spectabilis and M. jalapa on infection caused increasing and worrying cucurbit crop producers due to by ZLCV the extracts were prepared by grinding leaves crop losses. Symptomatic plants are severely stunted and in the proportion of 1g per 50mL of distilled water die before they bloom. In order to evaluate the inhibitory and sprayed on C. pepo plants 24, 48, 72 and 96 hours effect of B. spectabilis and M. jalapa on infection caused before inoculation (BI) with the virus. As well as TSWV x by ZLCV the extracts were prepared by grinding leaves tomato system, leaf extract from B. spectabilis showed to in the proportion of 1g per 50mL of distilled water and sprayed on C. pepo plants 24, 48, 72 and 96 hours inhibition percentage was observed when the extract before inoculation (BI) with the virus. As well as TSWV x bewas more applied efficient until than 24 that (70%) one fromand 48M. jalapa.(50%). A highestExtract tomato system, leaf extract from B. spectabilis showed to applications carried out 72 and 96h BI did not induce any inhibitory effect. It is noteworthy that the appearance of inhibition percentage was observed when the extract mosaic symptoms in treated plants manifested 20 days bewas more applied efficient until than 24 that (70%) one fromand 48M. jalapa.(50%). A highestExtract after virus inoculation (AI) as compared to control plants, applications carried out 72 and 96h BI did not induce any which presented mosaic and leaf deformation at the 7th inhibitory effect. It is noteworthy that the appearance of day AI. In addition, the inhibitor must have affected the mosaic symptoms in treated plants manifested 20 days translocation of the virus in the plant, once some plants after virus inoculation (AI) as compared to control plants, showed symptoms on one leaf only, usually the 3dr or which presented mosaic and leaf deformation at the 7th 4th above the cotyledon leaves. These results open a day AI. In addition, the inhibitor must have affected the new perspective on management of lethal chlorosis translocation of the virus in the plant, once some plants disease, since the infection with ZLCV until early fruiting showed symptoms on one leaf only, usually the 3dr or prevents the production of zucchini marketable fruits. 4th above the cotyledon leaves. These results open a new perspective on management of lethal chlorosis PIV259 - Dwv: Deforming Wing Virus Or Bees disease, since the infection with ZLCV until early fruiting Immunodeficiency Virus? prevents the production of zucchini marketable fruits. Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F., Barcellos, C.D.L. PIV243 - MANAGEMENT OF ZUCCHINI LETHAL CHLOROSIS VIRUS DISEASE IN CUCURBITA PEPO Universidade Federal do Pampa, UNIPAMPA, Avenida CASERTA TREATED WITH BOUGAINVILLEA Antônio Trilha 1847 SPECTALIS AND MIRABILIS JALAPA LEAF The bees are social insects and take part in the EXTRACTS pollination of various plants that provide food for man. Duarte, L.M.L., Alexandre, M.A.V., Chaves, A.L.R., Azevedo Filho, J.A. and producing a swarm local, which increases the 1. Instituto Biológico, IB, Av. Cons. Rodrigues Alves, Inproduction Brazil the of African honey ininfluence the country. of bees Various made diseases them highly have 1252, 04014-002, São Paulo, SP been undermining the apicultural production, mostly caused by viruses. Viruses that infect bees are within 2. APTA - Pólo Leste Paulista, APTA, Estrada Nelson the order Picornavirales, these translate its genetic Taufic Nacif, Km 03, CP-01, 13910-000 Monte Alegre do Sul- information generating one or more polyprotein that SP are later cleaved by a protease called 3 c. In the case of Plant extracts containing inhibitors of viral infection have been tested in some systems in which systemic sites, AKPE, AVPE, AIPE and AFPE. The protease is the reaction was induced by viruses. The inhibitory action virusfunction DWV of (Deformingthe polyprotein Wing cleavage, virus) it butcleaves also in attacking specific of Bougainvillea spectabilis and Mirabilis jalapa foliar antiviral proteins of the host. In the present work we extracts has been evaluated against Tomato spotted have reviewed on proteome of the bee, the possible wilt virus (Tospovirus) on tomato plants and Zucchini targets of 3 c protease. Of more than 10000 proteins that yellow mosaic virus (Potyvirus) on Cucurbita pepo are part of the proteome of bees only 104 were target of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

193 Plant and Invertebrate Virology: PIV

and Tomato chlorotic mottle virus (ToCMoV). Virus 3 of 4 Apidaecinas described and the DICER protein. accumulation was evaluated with Southern Blot assays 3The c protease.apidaecinas Among have theantibiotic targets function identified for werethe bee, found the using a universal probe. ‘Viradoro’ displayed severe virus to infect the bee and cleave some apidaecinas will symptoms and high virus DNA accumulation in all inactivate your natural antibiotic, allowing the entry of assays. The line ‘H-24’ (source of Ty-2 locus from S. other pathogens in your body and, therefore generating habrochaites) displayed a susceptible reaction to ToSRV an incubator of these within the hives. On the other hand, and ToRMV. The accession ‘LAI 132’ displayed a peculiar protein DICER, has among its functions the recognition and degradation of double-stranded RNAs. According to and the accessions ‘LAM 100’, ‘LAM 156’ and ‘Ty-198’ our hypothesis, the 3 c protease to cleave the DICER will species-specificwere resistant to resistance all virus species,to ToCMoV. being The recommended ‘TX-468-RG’ enable the body to recognize the virus DWV, allowing the for wide spectrum resistance breeding. Analyses with occurrence of new viral infections by other viruses RNA a panel of molecular markers linked to all currently and also infection with pathogenic microorganisms due characterized begomovirus resistance loci in tomato to lack of Apidaecinas. These data still need experimental (Ty-1, Ty-2, Ty-3, Ty-4 e Ty-5/ty-5) indicated that these validation; however they are of great value because they lines are sources of either new genes or alleles related provide data that will allow the understanding the viral to begomovirus resistance. Financial support: Fundo infection mechanism of DWV and the development of Embrapa/Monsanto, CNPq, INCT-Interações Planta- antiviral agents, contributing with the apiculture health Praga, FapDF and increasing productivity of the apiaries. Financial support: CNPq PIV301 - New Begomoviruses Associated With Malvaceous Weed In Brazil’s Northeast PIV282 - Evaluation Via Biolistic Assays Of Nascimento, L.D., Silva, S.J.C., Ferro, M.M.M., Assunção, The Spectrum Of Efficiency Of New Tomato I.P., Zerbini, F.M., Lima, G.S.A. Resistance Sources Against Four Bipartite Begomovirus Species 1. Universidade Federal de Alagoas, UFAL, Centro de Machado, M.R., Mendonza, L.L., Pereira-Carvalho, R.C., Ciências Agrárias - CECA, BR 104 Norte, Km 85, CEP 57100- Lacerda, A.L., Fonseca, M.E.N., Ribeiro, S.G., Boiteux, L.S. 000 2. Universidade Federal Rural de Pernambuco, UFRPE, 1. Departamento de Fitopatologia, UnB, Dept. Rua Dom Manoel de Medeiro, s/n, Dois Irmãos Recife - PE, Fitopatologia , Campus Universitário Darcy Ribeiro, Brasília 52171-900 CEP 70910-900 3. Universidade Federal de Viçosa, UFV, Avenida P H 2. Embrapa Hortaliças, CNPH, Rodovia Brasília/ Rolfs, s/n - Campus Universitário, Viçosa - MG, 36570-000 Anápolis BR 060 Km 09 Gama - DF CEP 70351-970 3. Embrapa Recursos Genéticos e Biotecnologia, Begomovirus (Family Geminiviridae) cause serious CENARGEN, Parque Estação Biológica - PqEB - Av. W5 problems on crops production of many tropical and Norte (final) 70770-917 – Brasilia subtropical areas around the world, including Brazil. In Brazil, a bipartite Begomovirus species complex have circular single-stranded DNA and are frequently transmitted by Bemisia tabaci biotype B has been Theassociated begomoviruses with weeds, are transmittedwhich can byserve whiteflies, as natural they reported infecting tomatoes. The amount of information reservoirs of virus being able to cause epidemics on available about the phenotypic expression as well as crops plants. Therefore, this study aimed to characterize the begomoviruses associated with weeds from to Brazilian begomoviruses is still limited. So far, the Malvaceae family in Brazil’s Northeast and to evaluate theTy-1 spectrum and Ty-3 of loci efficiency are the of mostdistinct frequently resistance employed sources their diversity and importance as source of new virus for resistance factors. Five new accessions (‘LAM 100’, crops plants. Malvaceous weeds with typical symptoms ‘LAM 156’, ‘LAI 132’, ‘H-24’ and ‘Ty-198’) without the of begomoviruses infection were collected in Alagoas, Pernambuco and Bahia state during the years 2010 to 2012. A total of 22 genomic components (13 DNA-A and Ty-1 and Ty-3 loci were identified as promising sources of(susceptible resistance control) after preliminary and ‘TX-468-RG’ field assays. (resistant Individual due to and sequenced. Analysis of the sequences indicated the plantsthe locus of tcm-1) these were five accessionsevaluated in as biolistic well as assays ‘Viradoro’ with 9presence DNA-B) ofwere 5 begomoviruses amplified by RCA, species, after from they which were 3cloned were infective clones of four begomovirus: Tomato severe new. The phylogenetic analysis indicated that the new rugose virus (ToSRV); Tomato rugose mosaic virus species were grouped with Brazilian begomoviruses. (ToRMV); Tomato yellow vein streak virus (ToYVSV) Multiple evidences of recombination were detected.

194 Plant and Invertebrate Virology: PIV

PIV357 - Diversity Of Badnavirus Sequences was observed. The begomoviruses from Sida spp. Infecting Yam (Dioscorea Cayanensis)In No evidence for intra specific recombination events Alagoas, Brazil indicate that malvaceous’ weeds are major reservoirs Guimarães, K.M.C., Silva, S.J.C., Melo, A.M., Assunção, andof begomoviruses tomato were identifiedand that asevents parents. of recombination These results I.P., Lima, G.S.A. apparently have contributed to the emergence of new species on these hosts. Universidade Federal de Alagoas, UFAL, Centro de Ciências Agrárias - CECA, BR 104 Norte, Km 85, CEP 57100- PIV351 - Identification Of Putative Plant- 000 Potyvirus Interactions Using Systems Biology Viruses of the genus Badnavirus (family Caulimoviridae) Bruckner, F.P., Silva, J.C.F., Barros, A.P.O., Alfenas-Zerbini, are pararetroviruses, characterised by non-enveloped P. bacilliform particles containing circular dsDNA genomes of 7.0-7.6 kb. Badnaviruses are reported infecting a wide Universidade Federal de Viçosa, UFV, Campus range of economically important tropical crops such universitário, Viçosa, MG as cacao, banana, rice, sugarcane, citrus, and yam. The Brazilian Northeast accounts for 90% of the national Plant viruses have small genomes of simple organization, production of yams. This crop has great economic and encoding 3 to 10 viral proteins. Successful infection social importance in Alagoas, being the main activity of depends on cell manipulation by the virus, with complex family farming in the region. The sequence diversity was interactions occurring between viral and host factors. analyzed in the reverse transcriptase (RT)/ribonuclease To understand the processes of tomato infection by H (RNaseH) coding region of 50 badnavirus isolates the potyvirus Pepper yellow mosaic virus (PepYMV) infecting yam (Dioscorea cayanensis) in the counties of Arapiraca, Chã Preta e Viçosa in Alagoas during 2012. differentially expressed during viral infection. Analyzing athree subtractive overexpressed library genes, identified TCTP, Gal83 several and genesDnaJ, we as TotalPCR wasDNA wascarried extracted out using from leafthe tissuedegenerate using Doyleprimer & in viral accumulation. However, the exact role of these Doyle protocol. To confirm the presence of badnaviruses, identifiedproteins during that the infection silencing and of themtheir causesrelationship a decrease with genera. PCR fragments obtained were sequenced. viral proteins and other host-factors remain unknown. setNucleotide Badna-FP sequences and Badna-RP, were subjected specific to fora BLAST Badnavirus search To identify the connections between these proteins, for preliminary species assignment based on the 80% other plant proteins and viral proteins involved in threshold level established by the Caulimoviridae Study PepYMV infection, a network based on interactions Group of the ICTV. Additional nucleotide pairwise described for several pathosystems was build using comparisons were performed with DNAMAN version 4.0. homologous proteins from A. thaliana. Previously Multiple alignments were done using MUSCLE program, described plant-potyvirus interactions were compiled, available in MEGA 5.1 package, and a phylogenetic tree was performed with Maximum Likelihood method. in the TAIR database, and putative interactor proteins Bootstrap analysis of the 5.000 replications was carried A. thaliana homologues were identified by WU-BLAST results show a large network of proteins with multiple comparisons and phylogenetic analysis revealed the wereways identifiedin which bypotyviruses STRING database might onlinemanipulate search. plant The outpresence to verify of theat leastsignificance three species, of each treeincluding branch. Dioscorea Pairwise bacilliform alata virus (DBALV), and two new probable Hsp90, were connected to Hsp70 whose interaction species represented by isolates CH412 e CH612, cells.with NIb Two has proteins been reported. identified Previously in the library, demonstrated DnaJ and which are more related with Dioscorea bacilliform interactions between VPg and translation factors such sansibarensis virus (DBSNV). as eIF4E and PABP were also detected. Although direct PIV359 - Molecular Characterization Of silico analysis suggests that TCTP may interact with a Begomoviruses Associated To Hyptis Sp. connectionrange of ribosomal were not proteins. identified Other for proteins TCTP and appear Gal83, to bein And Physalis Sp. directly or indirectly linked to HC-Pro, such as the 20S Nascimento, L.D., Silva, S.J.C., Ferro, M.M.M., Oliveira, proteasome, calnexin, and a calmodulin-related protein. M.H.C., Assunção, I.P., Lima, G.S.A. The in vivo occurrence and relevance of these and other interactions remains to be analyzed. Universidade Federal de Alagoas, UFAL, Centro de Ciências Agrárias – CECA, BR 104 Norte, Km 85, CEP 57100- 000

195 Plant and Invertebrate Virology: PIV

Begomoviruses (family Geminiviridae) cause serious diseases in several economically important crops and Papaya ringspot virus (PRSV). These leaves extracts are also associated with a wide range of weed plants. plantswhen inoculated and by RT-PCR mechanically test with in specific plants primersof papaya for Weeds can act as reservoirs or sources of new species reproduced the symptom of similar mosaic to the of begomoviruses which arise from recombination observed one in papaya cv. Sunrise Solo. It was possible events or pseudo-recombination because of its frequent co-infection with more than one viral species. Here, for this virus was reported in the states of Bahia, Ceara, we report the detection of novel species associated toEspirito amplified Santo, specific Minas fragmentGerais, Parana, for the Pernambuco, PRSV. Infection Rio with the weeds Hyptis sp. (Lamiaceae) and Physalis sp. de Janeiro, Rio Grande do Sul, Roraima, Sao Paulo and (Solanaceae). A sample of Physalis sp. and two samples of Hyptis sp. showing typical symptoms of viral infection virus on papaya in the Amazonas state. Control strategy were collected in Rio Largo, state of Alagoas. Total DNA Distritoshould beFederal. developed This is toapparently reduce the firsteconomic report oflosses this was extracted from each sample and complete viral resulting from the action and dissemination of these pathogen in this plant of high value to agribusiness in phage phi29, cloned into plasmid vectors and completely the Amazonas state. genomessequenced. were Six amplified clones were using obtained the DNA polymerase(5 DNA-A and from 1 DNA-B). Pairwise sequence comparisons indicated the PIV370 - Molecular Characterization Of presence of three novel species whose proposed names Begomovirus That Infect The Weed Gaya are: Hyptis rugose mosaic virus 1 (HyRMV1) and Hyptis Guerkeana rugose mosaic virus 2 (HyRMV2), obtained from the Tenorio, A.A.R., Vieira, M.C.B., Lima, J.S., Silva, S.J.C., same Hyptis sp. sample; while Physalis yellow spot Assunção, I.P., Lima, G.S.A. virus (PhYSV), was found initially from Physalis sp. and Universidade Federal de Alagoas, UFAL, Campus Delza subsequently detected on another Hyptis sp. sample. In a Gitaí, BR 104 Norte, Km 85, CEP: 57100-000, Rio Largo-AL phylogenetic tree, the novel species clustered with other Brazilian begomoviruses, indicating their indigenous Begomoviruses (family Geminiviridae) have a circular, origin. Since HyRMV1 and HyRMV2 were found in co- single-stranded DNA genome encapsidated in twinned infection, added to the fact of PhYSV infect both Hyptis icosahedral particles that are transmitted in nature by sp. and Physalis sp., we tested the hypothesis of these species have arisen from recombination events. Strong the begomovirus have emerged as one of the major plant evidence of recombination was found among HyRMV1 thepathogens, whitefly mainly Bemisia in tabaci. tropical During and thesubtropical last two decadesregions and HyRMV2, identifying HyRMV1 as probable parental. worldwide, causing severe economic losses. In Brazil, the most severely affected crops are bean and tomato, as possible parental to the HyRMV1 and PhYSV species. although there are reports of begomovirus infection in TheThese Tomato results rugose indicate mosaic that virus Physalis (ToRMV) sp. and was Hyptis identified sp. others important crops such as soybean and pepper. are reservoirs of begomoviruses and that recombination In addition to the cultivated plants, many wild species events have apparently contributed to the emergence of and/or weeds have been reported as alternative hosts new species of virus in these hosts. for begomoviruses, in several countries, including Brazil. The aim of this study was to realize the molecular PIV369 - Natural Infection Of Papaya characterization of Begomovirus that infect the weed Ringspot Virus In The State Of Amazonas species Gaya guerkeana in the northeast region of Brioso, P.S.T., Souza, M.G., Pereira, J.C.R., Gasparotto, L. Brazil. Leaf samples of G. guerkeana showing typical 1. Universidade Federal Rural do Rio de Janeiro, UFRRJ, symptoms of viral infection were collected in Caruaru, Caixa Postal 74585, Seropédica, RJ, 23897-970 Pernambuco during 2012. Total DNA was extracted from 2. EMBRAPA Amazônia Ocidental, EMBRAPA, Rodovia AM-10, Km 29, Caixa Postal 319, Manaus, Amazonas eachvectors sample and completely and complete sequenced. viral genomes The sequences were amplified were In crops of papaya (Carica papaya L.) cv. Sunrise Solo byused rolling for comparisoncircle amplification with other (RCA), begomovirus cloned into plasmid and to in the state of Amazonas, was observed that 10-20% of phylogenetic analysis. From the G. guerkeana samples the plants presented symptoms of mosaic on leaves and was obtained a DNA-A clone, which was more related to soaked lesions on stalk, causing loss of the production. Sida mottle Alagoas virus (SiMoAV JX871383), showing To identify the pathogen involved, leaves samples were 85% of nucleotide identity, therefore, representing a collected from these plants and analyzed by mechanical new viral species with the suggested name Gaya yellow inoculation (0.1 M phosphate buffer pH 7.5, containing

mosaic virus (GaYMV). This study is the first report of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - 0.5 % of sodium sulfite and 0,1% of celite) on papayaPlant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

196 Plant and Invertebrate Virology: PIV the occurrence of a begomovirus infecting the species G. 2. Universidade Federal de Viçosa, UFV, Departamento guerkeana. de Fitopatologia/BIOAGRO, UFV, Viçosa, MG, Brasil PIV383 - Genetic Diversity Of A Population Brazil is one of the biggest yams producer, with the main Of Tomato Chlorosis Virus, An Emerging crops located in the Northeast region, where the viruses Crinivirus Infecting Tomato In Brazil have been highlighted by the frequency which occur in Albuquerque, L.C., Paula, N.T., Inoue-Nagata, A.K., commercial plantations, mainly by vegetative propagation Aragão, F.J.L. by tuber-seeds, which results in virus accumulation and perpetuation during successive cultivations. A simple 1. Embrapa Recursos Genéticos e Biotecnologia, Cenargen, Brasília, DF (RCA) of bacteriophage Phi29 polymerase was used in 2. Departamento de Biologia Celular, Universidade de methodthis work of to cloning verify thebased occurrence on rolling of circle circular amplification DNA virus Brasília, UnB, Brasília, DF in cultures located in the Alagoas, Pernambuco and 3. Embrapa Hortaliças, CNPH, Brasília, DF Paraíba states. DNA was extracted from symptomatic plants and used as template in RCA, the obtained DNA Tomato chlorosis virus (ToCV, genus Crinivirus, family was digested independently with selected restriction Closteroviridae) is an emerging threat to tomato crops endonucleases Kpn I. Among the samples drew attention worldwide. ToCV has two single-stranded RNA molecules from one Viçosa-AL, which resulted a fragment of about (RNA1 and RNA2) of positive polarity. The 8.5 kb RNA1 3.0 kb, which was cloned into pKS. The recombinant codes for proteins likely involved in viral replication, whereas the 8.2 kb RNA2 codes for viral movement and inserts completely sequenced. The nucleotide sequences plasmidsobtained werewere identified submitted by torestriction a BLAST analysis search and for viral the preliminary assignment of species based on criteria encapsidationand it is now spread proteins. over The the presence major tomato of ToCV production was first established by the ICTV and were then aligned using confirmedareas. The mainin Brazil aim ofin thistomato study plants is to provide collected an inanalysis 2006, the Muscle module in the program Mega 5.0, with other of the ToCV population structure with information on sequences deposited in Genbank. The clone obtained 40 isolates obtained from various geographical areas of Brazil. Here, the preliminary results obtained from 2.930 nucleotides and 97% identity with a mild isolated 20 isolates of two areas with high ToCV incidence, was identified as belonging to the genus Curtovirus, with Goianápolis (GO) and Taquara (DF), are shown. The by phylogenetic analysis that grouped the isolates in Beet curly top virus (AY134867). This was confirmed length RdRp and P22 (RNA1), and Hsp70h (RNA2) infecting yam in Brazil. Financial support: CAPES, CNPq sequencegenes was of analyzed. cloned RT-PCRGenetic amplifieddistances productswere estimated of full- the same branch. This is the first report of a Curtovirus from sequence data using the PBL method. The ratio of PIV389 - Genomic Analysis Of A Potato Virus Y non-synonymous substitution per non-synonymous site (Pvy) Isolate Evidence A New Intra-Specific (dNS) over synonymous substitutions per synonymous Variability In Brazil site (dS) was used as the indicator of protein selection Galvino-Costa, S.B.F., Figueira, A.R., Geraldino Duarte, P.S., Karasev, A.V. proteins studied were under negative (RdRp and Hsp70h) pressure.or neutral Nucleotide (p22) selection. diversity Additionally, was low (<0.4%) no evidence and the of 1. Universidade Federal de Lavras , UFLA, Campus selection associated with geographical area adaptation UFLA, Dept. de Fitopatologia (DFP), C.P.3037, CEP 37200- was found. However, the isolates were collected in areas 000, Lavras-MG of relative close proximity, and it is expected that a 2. University of Idaho , UI , AGRICULTURAL detailed study, including distant geographical areas and BIOTECHNOLOGY BUILDING 422, room 105, P.O. Box a higher number of isolates, could be useful to estimate 442339 the true genetic diversity of these viruses. A wide diversity of genotypes and serotypes of Potato PIV386 - Yam Infection (Dioscorea virus Y (PVY) had been frequently reported in Brazil. Cayennensis) By Curtovirus In Brazil Among the 32 isolates recently studied, all belonging Lima, J.S., Silva, S.J.C., Assunção, I.P., Lima, G.S.A., to the Virology Virus Collection of DFP/UFLA, the Zerbini, F.M. unusual Y-BR isolate was selected to be completely sequenced in order to investigate the unique RT-PCR 1. Universidade Federal de Alagoas, UFAL, Centro de Ciências Agrárias, UFAL, Rio Largo, AL, Brasil profilethe two amplified characteristic during bands its molecular of PVYO and characterization. the PVYNA-N This unexpected RT-PCR profile includes only one of September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

197 Plant and Invertebrate Virology: PIV band (267 and 328bp, respectively). Based on the clear PVYO serological typing performed with monoclonal was used as template for PCRs containing primers pair antibodies, all the possibilities of contamination were from Doyle & Doyle with modifications. The total DNA discarded. Several primers (36 in total), covering the of a fragment of about 580 nt domain RT / RNaseH ORF entire genome and generating overlapping fragments, BadnaFP3 of several and Badnavirus BadnaRP, genomewhich directs described. the amplification A total of 75 were used to obtain the whole genome sequence of samples (37.5%) were positive, among which some of Y-BR. The complete genome contains 9.682 nucleotides, the genotypes used in the crosses. The PCR fragments were sequenced and the sequences used for preliminary regions, the amino acids sequence, and the recombinant excludingevents for the this poly-A genome tail. hadThe specificbeen analyzed. primer annealingThe coat as well as phylogenetic analysis. The results suggest protein (CP) gene showed high similarity (99%) with identificationthe presence byof comparisonat least three with species GenBank of Badnavirus, sequences, other PVYO CP sequences from GenBank, which explain and Sugarcane virus baciliform the most common. The the O serotype reported previously. Six extra nucleotides incidence of Badnavirus Station was considered high and the possibility that the disease resulting in the loss positions 7131 to 7136 (5’TCGGAA3’) inside the NIb of more susceptible varieties is worrying, lacking actions weregene. Due identified to those in additional the Y-BR six genome, nucleotides located the at Y-BR the to stop the spread of these pathogens and replacement protein sequence is two amino acids (S2321E2322) longer than the regular proteins of all representative PVY strains. The higher amino acids similarity of Y-BR ofPIV406 infected - T hematerials. Role O financialf Chitinase support: And CAPES, Cathe CNPqpsin with the database was 97% with PVYO isolates while Enzymes In Pathology Of Baculovirus the higher nucleotide similarity was 94% shared with Lima, A.A., Ribeiro, B.M. both PVYN and PVYO. This high similarity with PVYN Universidade de Brasília, UnB, Instituto de Biologia, isolates and the presence of the PVYNA-N band suggest Bloco K Laboratório de Virologia Brazil stands out for being one of the largest exporters that this isolate is not a regular PVYO type. No significant of agricultural products in the world, therefore the use modificationfound. So far, inpreliminary the primer results annealing of the regions,recombination which of pesticides impacts on both the environment and couldanalysis be correlatedsuggest that with Y-BR the atypicalmay be amplifications,considered a newwas public health. An alternative to this practice is the use genetic variant of PVY. Financial support: Capes, CNPq, of biological agents to control pests. An example is the FAPEMIG use of baculovirus Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) in the control of PIV392 - Badnavirus Incidence In velvetbean caterpillar, A. gemmatalis, which is the Germoplasm Bank Of Sugarcane In Murici- greatest global example of successfully using a virus as Alagoas Jordão, L.J., Santos, J.M.S., Lima, J.S., Assunção, I.P., Lima, double-stranded DNA viruses. One of the interesting G.S.A. afeatures bio-insecticide. of the AgMNPV-2D Baculoviruses isolateviral are arthropod-specific genome is the Universidade Federal de Alagoas, UFAL, Centro de absence of chitinase (chiA) and cathepsin (v-cath) Ciências Agrárias, UFAL, Rio Largo, AL, Brasil genes. This absence can be responsible for the lack of liquefaction and larval melanization in A. gemmatalis Flowering and Crossing Station Serra do Ouro, located killed by AgMNPV-2D infection. This study intended to in the municipality of Murici, Alagoas, has a collection analyze the effect of these proteins expression in insects of more than 2,000 hits and is considered one of the infected by recombinant AgMNPV containing these genes most important genebanks of sugarcane in the world. derived from two baculovirus (Choristonera fumiferana This collection, linked to the Federal University of DEF multiple nucleopolyhedrovirus - CfDEFNPV e Alagoas, forms the basis for the Genetic Improvement Autographa californica multiple nucleopolyhedrovirus Program of sugarcane, initiated in 1960 by then IAA - AcMNPV). The recombinant viruses containing the / Planalsucar. However, despite its importance, no genes v-cath and chiA from the baculovirus CfDefNPV survey on the incidence of Badnavirus was held in (vAgp2100Cf.chiA/v-cath) was able to promote the collections, although preliminary observations found liquefaction and melanization of A. gemmatalis larvae plants showing chlorotic streaking, yellowing and bodies after their death, although the vAgp2100Ac. stunting. Thus an initial survey of the incidence of chiA/v-cath virus prepared in this study, did not Badnavirus was conducted by collecting 200 samples present the same effect. Bioassays with third-instar from genotypes used in the crosses. The leaves DNA and neonate larvae of A. gemmatalis infected with the extraction was performed according to the protocol vAgp2100Cf.chiA/v-cath recombinant virus showed

198 Plant and Invertebrate Virology: PIV higher insecticidal activity. The LC50 of the recombinant PIV415 - Detection Of Coffee Ringspot Virus virus was from 3 (for neonate larvae) to 4 times (for 3rd (Corsv) In Western Bahia larval stage) lower than the LC50 of the wild-type virus. Almeida, J.E.M., Figueira, A.R. The expression of v-cath and chiA genes during infection of insect cells by the recombinant virus was analyzed by Universidade Federal de Lavras, UFLA, UFLA-Dept. qPCR, which detected both the presence and the increase Fitopatologia, C.P.3037, 37200-000 Lavras MG of gene transcripts from 6 h to 72 h p.i. Brazilian commercial crops of coffee (Coffea arabica) were inspected in December 2012, in the following PIV413 - Molecular Analysis Of A Potyvirus properties: Joá Farm, 900 ha planted with cv. IAC 144 Polyprotein Cleavage Site For Coat Protein (plots 2,3 and 4), and Agronol Farm, 1300 ha planted Expression In Soybean with cv. IAC 144 (areas 9 and 17), located in Eduardo Geraldino Duarte, P.S., Figueira, A.R., Galvino-Costa, Magalhães region; Farm of Uemura Group (3 plots, 01 S.B.F., Teixeira, J.V.L. and 02 with 25 ha each, planted with cv. Sachimor and Universidade Federal de Lavras, UFLA, Campus 1 plot with 100 ha planted with cv. IAC 144) located Universitário, C.P. 3037 CEP: 37200-000 in São Desidério region. Both places are located in the western region of the state of Bahia. On the Joá Farm detected in 1984 in an experimental area of EPAMIG 04, with incidences of 45.6% and 6.6%, respectively. Thein Lavras, Soybean Minas yellow Gerais. shoot In preliminary virus (SYSV) studies was it firstwas plantsIn plot with02, there symptoms were wereno plants identified with insymptoms. plots 03 The and characterized as a Potyvirus infecting soybean, more characteristic symptoms of ringspot disease were seem severe but with different biological, molecular and in leaves and fruits, and an intense defoliation from the serological characteristics of others Potyvirus already inside of the plants, showing a hollow at the center of the described. Further sequence analysis showed that this cup and a low bloom of the coffee tree were detected in is an unknown potyvirus, never described before, and all properties except for the Agronol Farm, where CoRSV the highest nucleotide identity (65%) was found with was absent. On the Uemura Group Farm, the incidence Glycine virus Y, a potyvirus described in Australia. In of ringspot in plot 03 was 8%, and in the other plots this work the C-terminal of the SYSV was analyzed to the disease was not found. It was observed that the identify the cleavage site of the coat protein (CP), aiming symptoms were prevalent in part of the plant facing the the construction of a vector for coat protein expression sun, indicating a higher multiplication of CoRSV in this area. The symptoms observed in plants mechanically inoculated with the extract of infected coffee leaves were inand soybean universal plants. primers This designed region was in conservedamplified bynucleotide RT-PCR, usingregion the of nuclearRNA extracted inclusion from b (NIb)partially and purified CP. The virionsamino ambrosioides, and chlorotic local lesions plus systemic necrotic local lesions on the plants of A. deflexus and C. GeneRunner program. The C-terminal proteolytic by CoRSV. Despite the fact that ringspot disease has acidcleavage (aa) sequencedomains wasof the deduced sequence using were ORFfinder analyzed and infectionalready been in plants reported of C. inquinoa Minas confirming Gerais and the São infection Paulo based on the cleavage sites detected were designed and Bahia. This demonstrates that the CoRSV has great accordingused to amplify to the thefamily sequences Potyviridae to be and cloned specific into primers vectors state,ability this to spread is the first by its report vector, of itsand occurrence may be present in Western in all to express the protein in soybean plants. Three regions multiplication. Financial support: Capes, CNPq, FAPEMIG coffee fields where the temperature is suitable for viral wereE/L generating identified aas CP sites with recognized 279 aa. Another by the NIa possible protease, site PIV417 - Efficient Detection Of Squash the first possible cleavage site detected was between Mosaic Virus In Infected Squash Seeds resulting in a 271 amino acid CP and the third site, Q/G, Almeida, J.E.M., Figueira, A.R., Alencar, N.E., Pompeu, wouldwas 7 aa be after Q/N, the seven second aa aftersite detected the first and site originates identified, a D.C., Lucas, M.A. coat protein with 264 aa. These fragments cloned into vector capable of systemic expression of foreign genes Universidade Federal de Lavras, UFLA, UFLA-Dept. in soybean will help a precise description of this virus Fitopatologia, C.P.3037, 37200-000 Lavras MG and the construction vector containing the CP of SYSV The choice of technique for the detection of viruses in that can be used in future studies of plant-virus protein pumpkin seeds, and its practical application, is greatly interaction. Financial support: CAPES, CNPq, FAPEMIG important to support phytosanitary surveillance in Brazil. The objective of this work was verifying the

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV efficiency of different techniques to detect Squash mosaic XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

199 Plant and Invertebrate Virology: PIV virus (SqMV) in seeds, using several procedures. Four infection were analyzed by DAS-ELISA, using polyclonal methods were compared for SqMV detection in squash seeds: biological, DAS-ELISA, IC-RT-PCR and RT-PCR. diagnostic species: lettuce (Lactua sativa L.) cv. Regina, The testes were done with different tissue extracts: non antibodiesChenopodium specific quinoa, for the C. LMV, amaranticolor by inoculation Gomphena assays in germinated seeds: the whole ground seeds, the tegument and cotyledon; seeds germinated in boxes or paper towel primers for LeMoV and LMV. The results of DAS-ELISA at 26ºC with 16h light: the primary leaves analyzed in globosaand RT-PCR and Zinnia were elegansnegative and for by RT-PCRLMV, discarding using specific an combined samples and separately. In the biological tests, infection by this virus. In the mechanical inoculation in the primary leaves of seedlings growing in greenhouse diagnostic species, both viruses did not induce symptoms were tested by DAS-ELISA. Each biological test was in Zinnia elegans, however the virus was recovered from performed with 1000 seeds with three replicates. The this plant by mechanical inoculation of the plant extract obtained antigens were used for DAS-ELISA, PCR and IC- in lettuce cv. Regina, which is typical of LeMoV. Finally, PCR. When the extracts of nom germinated seeds were employed as antigen all the DAS-ELISA and also the IC-RT- PCR tests were positive, either when the whole seeds or theas happened presence ofin LeMoVother places infection where was LeMoV confirmed have by been RT- the tegument and cotyledon were analyzed, showing that PCRdetected, using its primers infection specific is being for confusedthis virus. with Probably, a break such of SqMV particles were present in 100% of the tissues from resistance to LMV in lettuce cultivars. Based on these seeds produced by infected squash plants. The RT-PCR results, the occurrence of LeMoV in south Minas Gerais tests. In primary leaves, coming from seeds germinated testsin boxes had or no paper the same towel, efficiency using composite showed bysamples IC-RT-PCR with waslettuce, registered aiming forto preventthe first thetime, introduction indicating the and need spread for 10 seeds in each sample, neither DAS-ELISA nor IC-RT- additional measures of control in commercial fields of PCR detected the virus. However, when each seedling FAPEMIG was sampled separated, the DAS-ELISA detected the of this virus in field. Financial support: CAPES, CNPq e virus in 1,33% and IC-RT-PCR in 15% of primary leaves. PIV422 - Evaluation Of Internal Damages Of Zucchini Seeds Infected With Squash than DAS-ELISA to detect SqMV incidence in germinated Mosaic Virus Using X-Ray Therefore,squash seeds IC-PCR and was test able was to predict more efficientthe transmissibility and faster Alencar, N.E., Figueira, A.R., Lucas, M.A., Galvino-Costa, of SqMV from seeds to plant. DAS-ELISA and IC-PCR was S.B.F., Santos, H.O. Universidade Federal de Lavras, UFLA, Departamento does not represent the virus transmissibility from seeds de Fitopatologia, Caixa Postal 3037, CEP 37200-000, Lavras highlyto plants. efficient Finantial to detect Support: SqMV CNPq, in the Capes whole e Fapemig seeds, but it MG PIV420 - First Report Of Lettuce Mottle Oleraceous species such as zucchini (Cucurbita pepo cv Virus (Lemov) In South Of Minas Gerais Caserta) usually present seeds with empty and damage Lucas, M.A., Figueira, A.R., Santos, B.A., Alencar, N.E., structures due to problems correlated with the seed Teixeira, J.V.L., Almeida, J.E.M. malformation in addition to the occurrence of infection Universidade Federal de Lavras, UFLA, Campus by pathogens. These damages in this type of seeds are Universitário, Lavras - MG, Brasil not commonly detected due to its tissue density, which prevents the visualization of internal structures. The Among the viral diseases detected in Brazilian lettuce objective of this work was to verify the potential use crops, the two main viruses able to cause relevant of the X-ray in the evaluation of internal seed damages losses are Lettuce mosaic virus (LMV), belonging to produced by zucchini plants infected with Squash mosaic the genus Potyvirus, and Lettuce mottle virus (LeMoV), virus (SqMV)as an auxiliary tool for the seed selection a Sequivirus species. The LeMoV induces mottling in which will be subsequently used in the evaluation of seed transmissibility rate of this virus. Four lots with in the Federal District, causing symptoms quite similar hundred seeds each, produced by infected and healthy lettuce plants and was first detected in Brazil in 1982, plants, were submitted to X-ray analysis using Faxtron distinguish between these two viruses based only in HP MX-20 with 22kv intensity and exposure time of tothe thosesymptoms. induced In addition, by LMV. mixed Therefore, infections it is of difficult LMV and to 15 seconds. The analysis of the X-ray images allowed LeMoV cannot be discarded. In this work was analyzed one virus isolate from lettuce, collected in the region of empty and damaged seeds. Among seeds produced by Tres Pontas, located in the south of Minas Gerais State the separation of the seeds into three categories: filled, - Brazil. Leaves showing typical symptoms of virus and 29.1% were damaged. In the seeds from the healthy infected plants 58.33% were empty, 12.5% were filled September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

200 Plant and Invertebrate Virology: PIV

1. Embrapa Recursos Genéticos e Biotecnologia, , Pq were damaged, showing that the virus infection strongly Estação Biológica, Brasilia, DF, Brazil plants only 1% was empty, 84% were filled and 15% 2. Departamento de Fitopatologia, Universidade de being tested to determine its viability in comparison with Brasília, UnB, Brasília, DF, Brazil the seeds produced by healthy plants and, in addition, influences the seed quality produced. These seeds are 3. Departamento de Biologia Celular, Universidade de the SqMV seed transmissibility rate, when the seed is viable, for each category is also being done. The X-ray Brasília, UnB, Brasília, DF, Brazil analysis was considered a useful tool for evaluation of 4. Embrapa Hortaliças, , Brasília, DF, Brazil the quality of seeds produced by SqMV infected plants. Tomato (Solanum lycopersicum) is an important Financial Support: CNPq, CAPES, FAPEMIG. vegetable crop in Brazil. Due to the diversity of bipartite begomovirus species infecting tomato in the country, PIV441 - Broad Resistance To Brazilian Embrapa Hortalicas has an active breeding program Bipartite Begomoviruses Confered By The aiming the development of tomato genotypes resistant Locus Ty-1 In Tomato Lam 144r Line to these viruses. Near-isogenic lines (NILs) differing Mendoza, L.L., Ribeiro, S.G., Resende, R.O., Boiteux, L.S. for the presence of the begomovirus resistance locus Pereira-Carvalho, R.C. Ty-1 were recently obtained and named LAM 144R 1. Departamento de Fitopatologia, Universidade de (resistant) and LAM 144S (susceptible). Since resistance Brasília, UnB, Brasília, DF, Brazil can be the result of the interference with pivotal stages 2. Departamento de Biologia Celular, Universidade de of the virus cycle such as replication, cell to cell or Brasília, UnB, Brasília, DF, Brazil long distance movement, the aim of this research was to compare the replication rate of ToCMoV in the two The tomato crop has a high economic and social importance in Brazil. The cultivation throughout the year tumefaciens harboring the DNA-A of ToCMoV cloned in favors the appearance of various diseases, especially NILs.a binary Plant vector. leaves Samples were infiltrated were collected with Agrobacterium0, 2, 6 and 10 diseases caused by begomoviruses. The best option of the control these diseases is the use of resistant cultivars. Breeding programs seek sources that have broad, days(qPCR) post using infiltration primers (dpi) for theand coatthe viralprotein DNA gene. load Datawas durable and stable resistance. In this work, to study quantifiedwas analyzed by quantitativeby Kruskal-Wallis polymerase nonparametric chain reaction test. the breadth of genetic resistance conferred by the gene Ty-1 in the LAM 144R line, plants were inoculated by the samples collected 0, 2 and 6 dpi between LAM 144R biolistics with viral DNA of four begomoviruses: Tomato Thereand LAM was 144S. no significant However, difference at 10dpi, inthe the viral viral titer load was in chlorotic mottle virus (ToCMoV), Tomato rugose mosaic virus (ToRMV), Tomato severe rugose virus (ToSRV) and LAM144S, showing at least twice as low virus molecules. Tomato yellow vein streak virus (ToYVSV). As control, significantlyThis result suggests lower in that LAM144R the resistance plants, conferred compared by with the we used plants of the susceptible near isogenic line LAM locus Ty-1 may be related to the impairment of virus 144S. Assessment of symptoms were done at 21 and replication. 40 days post inoculation (dpi) and viral accumulation was evaluated at 30 (dpi) by Southern blot. For the four PIV452 - Establishment Of A Unit Of begomoviruses tested, LAM 144R plants showed very Reference In Diagnosis Of Quarantine And mild symptoms in comparison to LAM 144S and low or Non Quarantine Regulated Plant Viruses sometimes no viral accumulation was observed. These Pompeu, D.C., Figueira, A.R., Sotero, A.J., Geraldino results demonstrate that LAM144R can be considered Duarte, P.S., Galbino-Costa, S.B.F., Fernandes, J.R.C. promising for the use in breeding programs. Financial Universidade Federal de Lavras, UFLA, Departamento support: CNPq, Fap-DF, Rede EstRESCe, INCT-Interacoes de Fitopatologia, Campus Universitário, UFLA, Lavra-MG Planta-Praga, CAPES The growth of the Brazilian domestic and foreign trades PIV444 - Restriction Of Tomato Chlorotic Mottle Virus (Tocmov) Long-Distance states and countries increase the risk of pests and diseases Movement In Tomato Lam 144r Line andintroduction the large in flux disease of goods free exchangeregions. Therefore, between different there is Containing The Ty-1 Resistance Locus a great demand for reliable laboratories and diagnostic Mendoza, L.L., Ribeiro, S.G., Resende, R.O., Boiteux, L.S. techniques to certify the sanity of plant propagation Pereira-Carvalho, R.C. material in Brazil. This study aimed to create a bank of positive control for PCR and RT-PCR diagnostic tests, by cloning genomic fragments containing the coat protein, September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

201 Plant and Invertebrate Virology: PIV of quarantine and non-quarantine regulated virus, into PIV513 - A New Strategy For Heterologous plasmids, without risk of contamination or pathogen Expression Of Coat Protein From Garlic introduction in the country. The genetic material of the Virus D (Garv-D) In Insect Cells Using A quarantine viruses was obtained with the collaboration Modified Baculovirus Vector To Easy Purification by RT-PCR and / or PCR, using primers designed based Andrade, M.S., Ardisson-Araújo, D.M.P., Resende, R.O., ofon researchersthe coat protein from sequences many parts from of GenBank,the world, and amplified cloned. Ribeiro, B.M. the genomic fragments and then new inner primers were Universidade de Brasília, UnB, UnB Campus Darcy Thedesigned plasmids to be were used sequenced in RT-PCR/PCR to confirm diagnostic the identity tests. of Ribeiro - IB - Bloco K, Brasília, DF, CEP 70910-900 Garlic virus D (GarV-D) infects Allium sativum causing the viruses fragments, they were multiplied and stored “garlic mosaic disease” which reduces the overall Afterat -80°C. checking A bank the efficiencycontaining of 39 the positive plasmids controls containing for crop production. The GarV-D belongs to the genus quarantine virus, 2 viroid, and 12 viruses not quarantine Allexiviruses with a single-stranded RNA genome, regulated was created. This material will be multiplied positive sense, encoding six open reading frames (ORF). periodically to maintain the viability, in order to use the plasmids as a positive control in routine diagnostic tests protein that surrounds the viral genome and forms a of imported plant propagation material, from countries One of those is the coat protein ORF that codifies a where quarantine virus for Brazil have been reported. Garlic virus D coat protein fused with the main occlusion filamentousbody protein capsid. (polyhedrin) In previous of Autographawork we expressed californica the laboratory of MAPA, being an important support for multiple nucleopolyhedrovirus (AcMNPV) in the amino The positive controls will be available for every official of imported plant material. Financial support: CAPES, the recombinant protein. This work aims a new strategy theCNPq, Official FAPEMIG Plant Protection Service in the inspection terminalto express portion, and purify but the we didGarV-D not coat successfully protein (CP) purified for antibody production to be used for detection of garlic- PIV470 - Unique Sequence Characteristics infected plants. For this propose, we reconstructed Of Rna 2 Genome Segment Of New Pepper a recombinant baculovirus derived from AcMNPV Ringspot Virus, Tobraviruses Isolated In using the commercially available Bac-to-bac system Brazil (Invitrogen). This recombinant virus has the Garlic virus Batista, A.R.S., Nicolini, C., Rodrigues, K.B., Vasques, D coat protein gene (GarV-Dcp) inserted into its genome R.M., Macedo, M.A., Inoue-Nagata, A.K., Nagata, T. as a fused gene with polyhedrin gene of AcMNPV, a 1. Universidade de Brasília, UnB, Campus Universitário his-tag, both under the command of pSym and pXIV Darcy Ribeiro - Asa Norte- Departamento de Biologia Celular promoter. Furthermore, has another copy of polyhedrin 2. Universidade de Brasília, UnB, Campus Universitário gene under the command of its own promoter .The Darcy Ribeiro - Asa Norte - Departamento de Fitopatologia recombinant virus was used to infect insect cells and the expression of the recombinant protein was analyzed Two new isolates of pepper ringspot virus (PepRSV) by SDS-PAGE and Western-blot using a commercially (Tobravirus) were corrected and the sequence of available anti-his antibody. We successfully constructed complete RNA 2 segment and 3’ UTR of RNA 1 of both the recombinant virus containing the fused gene and isolates were determined. Although the sequences of when used to infect insect cells, a protein band of the coat protein genes of these two and the isolate corrected expected size was detected by SDS-PAGE and western- in 1970’s were highly conserved, the both UTRs blot. The recombinant protein is now being produced were distinct. The original CAM isolate showed twice in a large scale in insect larvae for the production of impaired repeat sequences (AA’BB’) in 5’ UTR, however, polyclonal antiserum in rabbits. This antiserum will then new isolates did not possess the repeat sequence (AB). be tested for its potential to detect this important plant The 3’ end of CAM isolate (the stretch of 459nt) had been pathogen. Financial support: CNPq, FAPDF reported as a recombination between RNA 1, while new isolates possessed only 279 nts stretch almost identical PIV514 - Minimum Approach To Construct The to 3’ end of RNA 1 of their isolates. In addition, the RNA 2 Infectious Cdna Clone Of A Tobamovirus In sequences of these isolates showed inserted sequences, Binary Vector resulting in longer RNA 2 sequences compared to CAM Junqueira, B.R.T., Nicolini, C., Lucinda, N., Nagata, T. Universidade de Brasília, UnB, Lab. Microscopia e of RNA 2 sequence of PepRSV, a tobravirus naturally Virologia, IB Bloco-K, Brasília, DF isolate.occurring This only is in the Brazil. first report showing the diversity September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

202 Plant and Invertebrate Virology: PIV

Pepper mild mottle virus (PMMoV) is a tobamovirus, Bean Necrotic Mosaic Virus (BeNMV) is a new tospovirus which consists of a monopartite single-stranded found in Brazil naturally infecting Phaseolus vulgaris L., RNA genome in positive polarity. The RNA genome is representing a new evolutionary lineage of tospoviruses surrounded by coat proteins forming rod-shaped rigid circulating in the American continent. The objective of particles. The genome is capped at 5 terminus and it has this work is to verify whether the NSs protein of BeNMV a tRNA-like structure at 3 terminus and it possesses four also acts as a RNA silencing suppressor, even though the open reading frames (ORFs). Aiming to study the virus- level of amino acid identity between BeNMV and TSWV host interactions and the functions of viral proteins the is quite low (18.4%). To evaluate a possible differential development of infectious clone was attempted. To obtain RNA silencing suppressor mechanism in an apparently cDNA of full-length PMMoV genome, polymerase chain resistant host (N. benthamiana) and in a susceptible one reaction (PCR) was performed to amplify the PMMoV to BeNMV (D. stramonium), RT-PCRs were performed genome from a cDNA previously cloned in pCR4TOPO to obtain the NSs genes of both BeNMV and TSWV The vector. The cDNA of full-length genome of ~6.3 kb was amplicons were cloned into pGEM-T easy, subcloned intopENTR-2B vector and translocated (recombination to join the whole genome was pCAMBIA 0390. PCR was by LR clonase) to pDEST-17 (expression vector in E. coli) successfullyperformed to amplified amplify bythe PCR.binary The vector, binary which vector length used and PK2 (binary vector). Escherichia coli BL 21 was used was 7.0 kb. Overlap extension PCR was performed to join to express the NSs fused to 6xHis tag. The expression was the two fragments and the expected length was 13.3kb. The resulted plasmid was electroporated in E. coli confirmedand used to by immunized SDS-PAGE andmice Western for polyclonal Blot. The antibodies proteins wereproduction. purified The on genes chromatography will be used for column agroinoculation of nickel STBL4Aiming strain.the transient The profile expression, of the clones the selected was confirmed clones by the binary vectors via Agrobacterium tumefaciens bywere restriction elestroporated enzyme profile,in Agrobacterium PCR and DNA tumefacienssequencing. for further analysis of protein localization and function GV3101 strain. Nicotiana benthamiana plants were by UV and Northern Blot. Financial support: UnB, CNPq, Capes, FAP-DF, RedeEstRESCe, INCT Praga-Hospedeiro agroinfiltratedobservation and and Dot maintained immunobinding in green assay house (Dot-ELISA). for up to PIV529 - Wild Ipomoea Spp. Are Alternative tenN. benthamiana days. The virus plants recovery showed was confirmedsevere mottle by symptom and top Hosts For Begomoviruses In Brasil And Nigeria Rossato, M., Melo, F.L., Ogunwenmo, K.O., Aragão, F.J.L., distortionsymptoms symptomscaused by wildin five type clones virus. out The of positive seven selected signals Resende, R.O. byin restrictionDot-ELISA enzymeobserved profile, in plants which with were recovered very similar virus to 1. Embrapa Hortaliças, CNPH, Brasília, DF, Brazil were as strong as in plants with wild type virus. This 2. Universidade de Brasília, UnB, Brasília, DF, Brazil study showed an effective and simple protocol based on overlap extension PCR to construct an infectious clone of 3. Embrapa Recursos Genéticos e Biotecnologia, tobamovirus. Cenargen, Brasília, DF, Brazil 4. Babcock University, Babcock University, Ilishan, PIV519 - Heterologous Expression And Nigéria Functional Analysis Of Non-Structural Proteins (Nss) Codified By Two Tospovirus In recent years, several begomovirus species have been Species Vasconcelos, A.F., Oliveira, A.S., Lima, R.N., Resende, R.O. and other countries. It is also known that wild Ipomoea identifiedspp. can be in infected sweet potato naturally (Ipomoea and experimentally batatas) in Brazil by Universidade de Brasília, UnB, Dept. de Biologia begomoviruses, indicating that these plants can be Celular, Instituto de Biologia inoculum sources of begomoviruses for the cultivated sweet potato. However, wild Ipomoea spp. have not yet Tospovirus is the only genus of plant viruses within family Bunyaviridae. Its members present a tripartite RNA America or Africa. The objective of this study was to beenidentify identified all possible as naturalIpomoea-infecting begomovirus begomoviruses hosts in South in M (medium) and L (large) RNAs. The S segment encodes Ipomoea spp. plants collected in Brazil and Nigeria using genomea non-structural classified, protein according (NSs) to involved their sizes, in RNA-silencing in S (small), suppression, as already demonstrated for Tomato Spotted (RCA) reaction products from 14 Ipomoea spp. samples Wilt Virus (TSWV). The RNA silencing is a conserved nextcollected generation in Brazil sequencing. (from the States Rolling of circleCeará, amplification Pernambuco mechanism in plants and other organisms associated and the Distrito Federal) as well as 9 samples collected to gene regulation and defense against viral infections. in Nigeria were polled separately by country origin and September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

203 Plant and Invertebrate Virology: PIV sequenced using the Roche 454 GS FLX platform. The EYFP in two fragments, C-terminus and N-terminus. two libraries, IPOBRA and IPONIG, were sequenced in Each fragment was fused to one of the proteins studied 1/8 th of a plate. IPOBRA resulted on 44,433 reads with an average length of 653 bases, and IPONIG had a total RT-PCR and then were inserted in pSAT vectors which number of 75,318 reads with an average length of 708 (NSmwere andtransformed N). The genes in A.of Ntumefaciens and NSm were (CV3101) amplified and by bases. Sequence assembly and analysis were performed with the program Geneious6.0. Blast searches with the contigs obtained revealed identity with several sweet agroinfiltratedresults showed in the N. interactionsbenthamiana between leaves. After proteins 36 hours N-N, potato-infecting begomoviruses: Sweet potato leaf curl ofNSm-NSm the agroinfiltration and N-NSm, the which micrographs demonstrated were taken.that these The virus, Sweet potato mosaic associated virus, Sweet vectors can be used to study interactions between potato golden vein associated virus, Ipomoea yellow vein proteins in planta during tospovirus infection. The virus. It is worthy to note that, the diversity of viruses interactions between the nucleoprotein were observed in the cytoplasm forming small yellow spots. The N-NSm and NSm-NSm interactions weres observed throughout identifiedin each sample in the willsamples be performed was much byhigher amplifying in Nigeria viruses than in Brazil. Further identification of the virus(es) present support: CNPq, FAP-DF, Rede Centro Oeste de Pesquisa each virus followed by molecular analysis. Financial the cytoplasm, specifically at cell periphery. Financial bysupport: inverse Embrapa, PCR using CNPq, back-to-back Fap-DF, Rede specific EstRESCe, primers INCT- for PIV555 - Analysis Of The Interaction Of Interacoes Planta-Praga, CAPES Movement Protein (Nsm) Of Tospovirus With Host Proteins PIV539 - Study Of The Interactions Paula, D.F., Silva, M.C.B., Lima, R.N., Leastro, M.O., Between The Movement Protein And The Resende, R.O. Nucleocapisid Protein Of Groundnut Ringspot Virus (Grsv) In Nicotiana Universidade de Brasília, UnB, Campus Universitario Benthamiana Using Bimolecular Darcy Ribeiro, S/N, Asa Norte, Brasilia, DF 70910-900 Fluorescence Complementation Plant viruses have evolved various mechanisms for Silva, M.C.B., Lima, R.N., Resende, R.O. virus movement inside the host. These mechanisms may Universidade de Brasília, UnB, Campus Universitario be grouped into two general strategies: the genome is Darcy Ribeiro, S/N, Asa Norte, Brasilia, DF 70910-900 transported as (1) a nucleoprotein complex, and (2) as encapsulated nucleic acids forming a viral particle. The genus Tospovirus belongs to the Bunyaviridae family. Tospovirus. Tospovirus is the only genus that infects All members of this genus have a genome organized as Groundnutplants in the ringspot family virus Bunyaviridae. (GRSV) is classified The virus in the species genus three single stranded RNA segments named S, M and L within the genus are responsible for several economic RNA for small, medium and large RNA, respectively. A impacts in a wide range of crops mainly in tomatoes, sweet viral movement protein NSm has an important role for peppers and onions. GRSV has three RNA segments that the spread of viral infection in the plant, and there are are called L (large), M (medium ), and S ( small). The L few studies that show the molecular interactions of this segment codes the viral polymerase in negative polarity. protein both in plant and in vitro. A study by Soellick The M segment codes the movement protein (NSm) and et. al., (2000) suggests an interaction between the viral the glycoproteins precursor and the S segment codes protein NSm with the DnaJ protein, present in plants the RNA-silencing suppressor protein (NSs) and the such as A. thaliana and N. tabacum. The interaction nucleocapsid protein (N), both in an ambisense coding of NSm with DnaJ could involved the binding of viral strategy. The understanding of the interactions among structures to the elements of the plant machinery the proteins of GRSV and host proteins can contribute directing the intercellular transport of the virus through plasmodesmata. This project aim to investigate the these proteins during the process of viral infection, association of DnaJ protein and NSm protein through significantlyreplication and to viral elucidate transmission. the biological This project functions aimed of Complementary Bimolecular Fluorescence technique the constructions of vectors for transient expression pSAT of the proteins NSm and N of GRSV fused with the (BiFC)from N. and tabacum demonstrate and NSm how from this Groundnut interaction ringspot can benefit virus localization and the interaction of these proteins in plant the(GRSV) viral genes cell to and cell inserted movement. in BiFC We amplifiedvectors developed the DnaJ fluorescentcells. The technique protein EYFP, used whichto analyze were these used tointeractions study the by Martin et.al (2009). N. benthamiana leaves were was the Bimolecular Fluorescent Complementation for transient expression of these proteins fused to C and agroinfiltrated with A. tumefaciens (GV3101) extracts September(BiFIC) that 2013 consists Volume 18in –separate Supplement the 1 -fluorescent Abstracts/Posters protein - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

204 Plant and Invertebrate Virology: PIV

Universidade de Brasília, UnB, Lab. Microscopia Eletrônica e Virologia - Instituto de Ciências Biológicas N terminus of yellow fluorescent protein (YFP). After 36 hoursThe merged post agroinfiltration, micrographs by showed the BiFC technique,cytoplasmatic we The baculovirus expression vector system is a widely confirmedaggregates thenext interaction to plasmodesmata between thesewich twocan proteins.support, in vivo, the evidence previously proposed for these two baculovirus containing the gene of interest under the proteins. Financial support: UnB, CNPq, Capes, FAP-DF, usedcontrol set of of a strong tools that promoter comprise and ainsect genetically cell lines modified grown Rede EstRESCe. in vitro that are susceptible to the virus. This allows the expression of relevant proteins in an eukaryotic PIV558 - Genome Sequence And Organization environment. The amount and quality of the expressed Of A Baculovirus Isolated From Lonomia proteins is dependent of a series of factors, such as Obliqua (Lepidoptera: Saturniidae). the time of protein extraction, the multiplicity of virus Aragão-Silva, C.W., Ribeiro, B.M., Melo, F.L., Ardisson- per cell (MOI) and the density of cells at the time of Araújo, D.M.P., Wolff, J.L.C. infection. The baculovirus AgMNPV is best known as the bioinsecticide used to control the soy bean eating 1. Universidade de Brasília, UnB, Campus Universitário larvae Anticarsia gemmatalis, but it may also be used as Darcy Ribeiro, Brasília - CEP 70910-900 an expression vector. We constructed, by homologous 2. Universidade Presbiteriana Mackenzie, CCBS, Rua recombination, a recombinant AgMNPV containing the da Consolação, 896 - Pr. 38 Consolação 01302-907 - Sao FLUC gene, encoding the chemiluminescent protein Paulo, SP - Brasil Luciferase, under the control of the AgMNPV polyhedrin gene promoter, this virus was named vAgPOLHFLUC. Lonomia obliqua (Lepidoptera: Saturniidae) is a This was used to infect the Trichoplusia ni derived insect poisonous larvae of medical importance due to the cell line BTI-Tn5B1-4, and by using a special technique, it severity of accidents occurred in Brazil caused by the was possible to track the production of Luciferase in real contact with the human skin. The possibility of controlling time and so quantify total protein production along the the population of these larvae is being evaluated by infection. By varying the MOI at the time of infection the using pathogens such as a single nucleopolyhedrovirus optimal conditions for protein expression was estimated. isolated from L. obliqua (LoobMNPV). In this work Optimal protein expression was achieved by infecting we have sequenced the genome of LoobMNPV using at MOI 10, the peak expression was reached at 54 the pyrosequencing technique (454 Life Sciences hours post infection. Below MOI 1 there was an intense Technology). The genome is approximately 120.000 bp, delay on timing and amount of protein production, for with a 30.9% GC content, containing seven homologous instance, a MOI of 0.1 yield only half total FLUC activity, regions (HRs). The genome comprises 169 putative in relation to MOI 10, at 140 hours post infection. open reading frames, out of which 31 are unique genes, Above MOI 10 there was little difference in timing and 4 came from organisms from other kingdom, and amount of FLUC expression, showing a faster but lower 134 genes are correspondingly encountered in other expression relative to MOI 10. This work shows that by baculovirus. Phylogenetic analysis using the polyhedrin manipulating the multiplicity of infection parameter it gene suggests that LoobMNPV is basal to group I from Alphabaculovirus, and it is related to ThorNPV, BmNPV, vector systems in terms of a greater amount of protein and AnfaNPV, in agreement with previous studies. isexpression possible toin aoptimize faster time. the efficiency of the baculovirus Interestingly, the referred genome does not have two common baculovirus genes that are responsible for the PIV566 - Quantitative Real-Time Rt-Pcr For host liquefaction: the cathepsin and chitinase genes. Chrysanthemum Stunt Viroid Detection The elucidation of the complete genome of LoobMNPV Gobatto, D., Chaves, A.L.R., Harakava, R., Eiras, M., oblique, as well as support further studies on baculovirus Instituto Biológico - São Paulo, IB, Av. Conselheiro willevolution. benefit studies related to the biological control of L. Rodrigues Alves, 1252 - Vila Mariana - SP PIV560 - Effect Of The Multiplicity The stunting disease induced by Chrysanthemum Of Infection On Protein Expression stunt viroid (CSVd) has become a serious problem in Based On The Polyhedrin Promoter Of chrysanthemum production systems worldwide. CSVd The Anticarsia Gemmatalis Multiple Nucleopolyhedrovirus (Agmnpv) many situations the plants are symptomless, facilitating Morgado, F.S., Silva, L.A., Ribeiro, B.M. incites colour-break and retards flowering, however in sensitive diagnostic system based on quantitative RT- its spread in the field. Our work aimed to develop a September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

205 Plant and Invertebrate Virology: PIV

PCR (RT-qPCR). Young leaves from chrysanthemum virus (SPFMV), Sweet potato latent virus (SPLV), Sweet infected by an isolate of CSVd were ground with liquid potato mild speckling virus (SPMSV), Sweet potato virus nitrogen, homogenized in water-saturated phenol and G (SPVG), Sweet potato mild mottle virus (SPMMV), Sweet extraction buffer, followed by alcohol precipitation. The virus (C-6), Sweet potato chlorotic stunt virus (SPCSV), to a microtube in presence of 1 µL (50 pmoles/µL) of potatoSweet potato chlorotic collusive fleck virusvirus (SPCFV),(SPCV) e Cucumber Sweet potato mosaic C-6 purifiedantisense RNAs primer (approximately [CSVd-I(c)]. After 100 ng)incubation were transferred for 3 min virus (CMV). Eight antisera were obtained from the at 95oC, it was added 2.5 µl of reverse transcriptase International Potato Center (Lima, Peru) and the other buffer (Roche), 0.5 µl dNTPs (10 mM), 200 units (1 µL) of two (for SPFMV and CMV) were produced in Embrapa reverse transcriptase (Roche), being the mix incubated for 60 min at 37oC. The analyses were performed in samples submitted for analysis. Infected plants were using the 7500 Fast Real Time PCR System (Applied Vegetables.observed for Single only oneand kindmixed of infectionsvirus (4.6%), were two identified (7.2%), Biosystems). The reaction was carried out adding 2 µl of each cDNA sample, 5.2 µl of sterile deionized water, seven (9.1%), eight (15%), nive (13.7%) and ten species 7.5 µl Universal FastStart SYBR Green Master (ROX) (2X threeof viruses (4.6%), (17.7%), four that (5.2%), is, most five plants (11.8%), of sweet six (11.1%), potato concentrate) (Roche) and 0.3 µl of each primer [CSVd- are infected by virus complex (composed of different II(s) and CSVd-I(c)] (10 µM). Serial dilutions of 1:10 combinations of viruses). The following percentages of up to 1:100,000 of the cDNA were prepared to check infection were found: SPFMV, 77.8; SPLV, 28.1; SPMSV, detection threshold of the RT-qPCR, and to calculate the 75.2; SPVG, 62.1; SPMMV, 80.4; SPCFV, 64.1; C-6, 54.2; SPCSV, 61.4; SPCV, 84.3 and CMV, 75.8. The data obtained amplification efficiency. The specificity was confirmed by report of detection of SPVG, SPMMV, Sweet potato C-6 thea duplication dissociation of thecurves amount for each of DNA reaction. copies The in each efficiency cycle. indicatedvirus, SPCV a highand CMV virus in incidence sweetpotato and genotypesrepresent growingthe first of amplification was 102%, which means that there was in Brazil.

Amplificationthis technique was for observed CSVd detection. even for theFinancial highest support: dilution PIV578 - Begomovirus Species Diversity In ofFAPESP cDNA (2011/02721-1) (1:100,000), confirming and CNPq the (471796/2011-5). high sensitivity of Tomato Crops And Weeds In Ecuador Paz-Carrasco, L., Xavier, C.A.D., Lima, A.T.M., Castillo- PIV573 - Novel Plant Viruses Infecting Urquiza, G.P., Ramos-Sobrinho, R., Vivas-Vivas, L., Sweetpotato In Brazil Zerbini, F.M. Fernandes, F.R., De Souza, J.M., Silva, K.F.O. 1. Dep. Fitopatologia/BIOAGRO, Universidade Federal 1. Embrapa Vegetables, CNPH, Rod. Brasília/Anápolis de Viçosa, Bioagro/UFV, Avenida Peter Henry Rolfs, s/n. BR 060 Km 09 Caixa Postal 218 CEP 70351-970. Brasília, DF Campus Universitário, 36570-000,Viçosa, MG 2. Catholic University of Brasilia, UCB, QS 07 Lote 01 2. Instituto Nacional Autónomo de Investigaciones EPCT, Águas Claras CEP: 71966-700 .Taguatinga, DF Agropecuarias, INIAP, Km 26 Vía Durán-Tambo, al Oeste de Virus diseases are important constraints for sweetpotato Guayaquil, Cantón Yaguachi, Guayas, Ecuador (Ipomoea batatas (L.) Lam.) production. Knowledge on the distribution, economic impact, and control of are responsible for serious agricultural threats in Latin sweetpotato viruses is still limited (Clark et al., 2012). Whitefly-transmitted geminiviruses (begomoviruses) In many cases, infection of sweetpotato by two or infestations of Bemisia tabaci in the late 1990’s, only very more different virus species causes greater damage America.recently has In a Ecuador, begomovirus, despite Tomato reports leaf of deformation significant than does infection by each of the viruses separately. virus (ToLDeV), been reported in tomato. ToLDeV had previously been reported in neighboring Peru, and great importance for the design of crop management Identificationstrategies and offor virus indexing species arrays that of occur sweet in potato Brazil virus- is of originated in the Americas. In the years 2010 and 2011, free production programs. A total of 153 samples from wasleaf tissue shown from to beindividual the first tomato monopartite plants were begomovirus collected in the provinces of Chimborazo, Galapagos, Guayas, from Sergipe, three from Rio Grande do Sul and one from Loja, Manabí and Santa Elena. Weed samples were also differentMinas Gerais) regions and (144 genotypes samples werefrom Federaltested. ScionsDistrict, from five collected in Guayas and Manabí. A total of 71 full-length sweetpotato plants were grafted onto Ipomoea setosa, a clones were obtained from 44 begomovirus-positive nearly universal indicator plant for sweetpotato viruses, tomato samples collected in Guayas, Manabí, Santa and leaves were tested by NCM-ELISA for ten viruses Elena and Loja. Pairwise nt identities of 67 of these infecting sweet potato: Sweet potato feathery mottle complete genomes were >94% with ToLDeV isolates September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

206 Plant and Invertebrate Virology: PIV from Peru. One sample collected in Manabí showed a coverage greater than 20x. The genome of Chrysodeixis triple infection. One clone from this sampled displayed chalcites (Chch) NPV, closely related virus to PsinSNPV, 98% nt identity with ToLDeV, a second clone displayed 92% nt identity with Rhynchosia golden mosaic Yucatan frames (ORFs) of the PsinSNPV genome. The ORFs were virus (RhGMYuV), and a third clone displayed 93% nt was used as reference for identification of open reading identity with the second clone from this same sample. PsinSNPV-IE was performed. This virus has a genomic Recombination analysis indicated a strongly supported confirmedsequence distinct using from BLASTX other and baculoviruses genomic mapping sequenced of recombination event in this third component, with so far and has a high ability to multiply and infect in its RhGMYuV as the major parent and ToLDeV from Santa host, which makes of PsinSNPV an excellent target for Elena as the minor parent. Furthermore, from two studies of genes related to pathogenicity and for future different samples from Manabí, one clone was obtain with development of biopesticides for the control of the P. 92% nt identity with RhGMYuV, and one corresponded includens pest. to a new begomovirus species with a maximum nt identity of 81% with Tomato golden leaf distortion virus PIV622 - Genetic Variability Of The (ToGLDV). Begomovirus clones were also obtained from Begomoviruses Euphorbia Yelllow Mosaic six samples of Rhynchosia sp. collected in Guayas and Virus And Macroptilium Yelllow Vein Manabí. All six DNA-A components showed >91% nt Virus In Their Respective Natural Hosts, identity with RhGMYuV. Together, these results indicate Euphorbia Heterophylla An Macroptilium a low species diversity of begomovirus in tomato in Lathyroides Ecuador. Financial support: FAPEMIG, INIAP, CAPES Lemos, P.P.F., Ramos-Sobrinho, R., Lima, A.T.M., Xavier, C.A.D., Zerbini, F.M. PIV603 - Complete Genome Sequence Of A Field Isolate Of Pseudoplusia Includens BIOAGRO - Universidade Federal de Viçosa, BIOAGRO Single Nucleopolyhedrovirus - UFV, BIOAGRO, Universidade Federal de Viçosa, CEP Craveiro, S.R., Mello, F.L., Ribeiro, Z.M.A., Ribeiro, B.M., 36570-000, Viçosa - MG Báo, S.N., Castro, M.E.B. Begomoviruses (genus Begomovirus, family 1. Programa de Pós-graduação em Biologia Molecular, Geminiviridae) comprise a group of replant viruses of UnB, Brasília, DF, Brasil great economic importance causing serious economic 2. Universidade de Brasília , UnB, Brasília, DF, Brasil losses in tropical and subtropical crops. It is believed that the emergence of begomoviruses in Brazil occurred 3. Embrapa Recursos Genéticos e Biotecnologia, through horizontal transfer of viruses previously Cenargen, Brasília, DF, Brasil restricted to non cultivated plants by the B biotype Pseudoplusia includens single nucleopolyhedrovirus is of Bemisia tabaci. Little is known about the genetic a baculovirus pathogenic for P. includens caterpillars, a pest that causes considerable economic losses. The The study of this variability is important to understand natural occurrence of P. includens larvae killed by virus variabilityhow viruses of evolveweed begomovirusesin order to adopt present strategies in the for field. the emerged as prospect for use of this virus in soybean pest development of crop cultivars with durable resistance, or control in the country. Seven PsinSNPV (IA to IG) isolates weed control practices. In this study we investigated the obtained from Pseudoplusia includens larvae in soybean genetic variability of two weed begomoviruses, Euphorbia and cotton crops in Brazil and Guatemala have been yellow mosaic virus (EuYMV) and Macroptilium yellow compared and characterized by high degree of genetic vein virus (MaYVV) that infect Euphorbia heterophylla variability. In this study, the complete genomic sequence and Macroptilium lathyroides, respectively. Our results, of one of these isolates (PsinSNPV-IE) was described and based on 19 sequences of EuYMV and 18 of MaYVV, cloned partially analyzed. DNA samples were sequenced using from samples collected in 2011 and 2012, support the Technology Next Generation (NGS) with the equipment hypothesis that the genetic structure of begomoviruses 454 GS FLX automated sequencer (Roche) and 34,988 can be modulated by their hosts by common processes reads were obtained from pyrosequencing and used for of selection, mutation and recombination. We observed genome assembly. The compilation and analysis of data distinct degrees of genetic variability between the two were performed using Geneious v.6.1 and CLC Genomics viruses. EuYMV presented a higher diversity, similar Workbenck (CLC bio) programs. For each read, the to other weed-infecting begomoviruses, while MaYVV regions corresponding to the adapters and regions with presented a low variability. The nucleotide diversity 0.1% error probability were trimmed. The contigs were of EuYMV (0.00819) was ~4 fold higher than MaYVV’s assembled and the PsinSNPV-IE genome sequence was (0.00197). The mutation frequency of EuYMV (2.5x10- obtained with approximately 140 kbp and sequence 3) was higher than MaYVV (4.2x10-4). This difference September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

207 Plant and Invertebrate Virology: PIV can be supported by the higher diversity of all genes of PIV647 - Stuffing Cucumber (Cylanthera EuYMV compared to MaYVV. The diversity of the ORF’s Pedata): A New Host Of Papaya Ringspot of EuYMV was higher for the CP (~3 fold), Rep (~7 fold), Virus (Prsv-W) And Cucumber Mosaic Virus Trap (~46 fold), Ren (~4 fold), AC4 (~8 fold). The higher (Cmv) diversity of EuYMV can be explained mostly by the Trap. Lima, M.F., Madeira, N., Barriolli, C. The lower diversity observed for MaYVV could be due to its recent emergence compared to EuYMV, reported 1. Embrapa Hortaliças, CNPH, C.P. 23 70359-970, since the 1950s in Brazil. Brasília, DF 2. Embrapa Hortaliças, CNPH, C.P. 23 70359-970, PIV646 - High Infection Rate Of Whitefly- Brasília, DF Transmitted Tomato Chlorotic Virus 3. Universidade Paulista, UNIP, Brasília-DF (Tocv) In Potato In Brazil Lima, M.F., Barriolli, C. edible fruits, consumed in some regions of Brazil. In 2012 1. Embrapa Hortaliças, CNPH, C.P. 23 70359-970 Stuffingit has been cucumber described is a asspecies a host of of cucurbit geminivirus. that produce During Brasília-DF 2. Universidade Paulista, UNIP, Taguatinga-DF L. Schrad.) showing symptoms of leaf malformation, 2013,with reduction stuffing cucumberof leaf blade plants and, (Cyclanthera mosaic, blistering, pedata and plant stunting, with almost 90% of infection rate, B has been detected on high population levels in the main InBrazilian the last potatofour years growing whitefly areas, (Bemisia especially, tabaci L.)Northeast, biotype Embrapa Vegetables, Brasília-DF, Brazil. The objective of werethis work observed was toon identify a planting the in cause the experimental of those symptoms field at transmitted geminivirus has already been detected. MidwestIn 2012-2013, and potato Southeast plants regions, exhibiting where symptoms whitefly- of of infection. Fourteen plants were sampled and leaf chlorosis and undulate margins on apical leaves, that also onextracts stuffing were cucumber prepared plants and tested and, by determine dot-blot theanalysis rate exhibited margins slightly rolled upward were observed using polyclonal antisera against the most important viruses that infect cucurbit species: Papaya ringspot of Goiás and Brasilia, Federal District, Brazil. Incidence virus-type W (PRSV-W), Zucchini yellow mosaic virus inof commercialsymptoms potatoon 45-50-day-old fields, at Cristalina potato County,plants Statewas (ZYMV), Watermelon mosaic virus-2 (WMV-2), Zucchini nearly 15% and symptoms always occurred associated lethal chlorosis virus (ZLCV), and Cucumber mosaic virus (CMV). In addition, all samples were also rub-inoculated this work was to perform diagnosis on plants showing onto the following indicator hosts, using phosphate buffer withthe symptoms high populations previously of described whiteflies. and The estimate objective the of solution pH 7.0: Nicotiana benthamiana, N. tabacum infection rate of the causal agent. Fifty one symptomatic (TNN), N. rustica, Physalis spp., Solanum lycopersicon potato plants were sampled from three potato growing (cv. Santa Clara), Cucurbita pepo (cv. Caserta), Nicandra areas and subjected to analysis including dot-blot physaloides, Datura stramonium, Chenopodium muralha, analysis using polyclonal antibodies against Potato virus C. amaranthicolor and, C. quinoa. Serological results Y (PVY), Potato virus X (PVX), Potato virus S (PVS) and, on sampled plants revealed they were infected with Potato leafroll virus (PLRV). Also, preparations of total PRSV-W at an infection rate of 85% and also with CMV RNA were used in Polymerase chain reaction (PCR) using at infection rate of 30%. Symptoms on indicator plants detection primers MA380/MA381 for Tomato chlorosis were observed at about 10-15 days after inoculation virus (ToCV; genus Crinivirus; family Closteroviridae), on C. pepo, N. physaloides, S. lycopersicon, N. rustica, N. tabacum (TNN), and D. stramonium. Symptomatic samples were also subjected to total DNA extraction indicator plants tested positive in dot-blot test for whichand geminivirus amplifies a fragmentdetection ofwith ca. 436universal bp. In addition,primers PRSV-W (12 isolates) and/or CMV (4 isolates), indicating pALv1978/pARc496. A very small number of PVY, PVS, PVX and PLRV infected plants was recorded. However, PRSV-W and/or CMV. These data indicate the importance 33 (64.7%) out of 51 samples tested positive for ToCV thatof this indeed species stuffing of cucurbit cucumber on epidemiologyplants were infected of diseases with primers, amplifying a DNA fragment of the expected size. No geminivirus positive samples were detected. This high infection rate of ToCV in the sampled potato causedFinancial by support: PRSV-W Embrapa and CMV. This is the first report of PRSV-W and CMV infecting stuffing cucumber in Brazil. cultivation and, in addition, also indicate the urgent need fields indicate the importance of the virus to potato well. Financial support: Embrapa of efficient control measures for ToCV and its vector, as September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV Veterinary Virology - VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

209 Veterinary Virology: VV

VV2 - Serological And Molecular Evidence VV23 - Hobi-Like Virus: Clinical Signs, Cross- Of Vaccinia Virus In Argentina Reactivity And Detection By Diagnostic Franco, L., Pereira, A.F., Costa, G.B., Alves, P.A., Oliveira, Tests Used For Bovine Viral Diarrhea Virus D.B., Trindade, G.S., Gonzalez, E.T., Panei, C.J., Galosi, Bauermann, F.V., Ridpath, J.F., Flores, E.F., Weiblen, R., C.M., Abrahão, J.S., Kroon, E.G. Harmon, A. 1. Universidade Federal de Minas Gerais, UFMG, Av. 1. Universidade Federal de Santa Maria, UFSM, Av Antônio Carlos, 6627 Bloco F4, Sala 258 Roraima, 1000- Santa Maria,RS 2. Universidad Nacional de La Plata, UNLP, La Plata 2. National Animal Disease center - NADC/USDA, 1900, Buenos Aires, Argentina NADC/USDA, Ames, Iowa 3. National Research Council , CCT-CONICET, La 3. Novartis Animal Health, Novartis, Larchwood, IA Plata 1900, Buenos Aires, Argentina Hobi-like or atypical pestiviruses comprise a newly 4. Scientific Research Commission of Buenos Aires recognized group of pestiviruses whose origin, Province , CIC-PBA, , La Plata 1900, Buenos Aires, Argentina epidemiology and pathogenesis are begining to be Bovine vaccinia (BV) is a viral disease that affecting dairy understood. This study aimed at comparing the clinical presentation, antigenic cross reactivity between HoBi zoonosis. This disease has as etiologic agent the Vaccinia like viruses and bovine viral diarrhea viruses (BVDV) cattlevirus (VACV), and milkers, which being belongs classified to the asPoxviridae an occupational family, and detection tests for these viruses. For this, colostrum Orthopoxvirus genus. Infected dairy cattle usually deprived calves were infected with a HoBi like virus present ulcerative lesions on their teats and udders. Rural works, when infected, presented lesions on their clinical presentation following acute infection of cattle hands, lymphadenopathy, high fever and prostration, or with field BVDV isolates of different virulences. The among other symptoms. Therefore, BV has a great noncytopathic BVDV and included low grade pyrexia and economic impact, compromising the milk industry and withreduction a HoBi-like in circulating virus was lymphocytes. very similar We to alsofield compared strains of public health services. In the last 14 years, outbreaks the the detection of pestiviruses BVDV, border disease BV have been detected and/or described across Brazil. virus, bungowannah virus and pronghorn virus using a Despite BV impacts in Brazil, there is no data regarding commercial ELISA for BVDV Erns protein and by RT-PCR VACV circulation in Argentina. We investigated for the using panpestivirus primers. Detection of a HoBi-like presence of OPV-neutralizing antibodies and VACV virus using the ELISA kit was statistically similar to that DNA in 100 sera samples from different Argentinian of BVDV1 and BVDV2. In contrast, RT-PCR tests using provinces (50 from dairy cattle/50 from beef cattle). Of the panpestivirus primers had lower sensitivity for the 50 dairy cattle samples, neutralizing antibodies against detection of HoBi-like strains compared to detection of OPV were detected in 4 sera (2%); of these, 3 (1.5%) had four recognized species of pestivirus. Two commercial titers of 100 NU/ml, and 1 (0.5%) had a titer of >200 ELISA kits designed to detect antibodies against BVDV, NU/ml. Of the 50 beef cattle, 8 (4%) had antibodies to missed 22.2% and 77.7% of serum samples containing OPV; of these, 2 (1%) had titers of 100 NU/ml, 2 (1%) low to moderate levels of HoBi virus neutralizing had titers of 200 NU/ml, 3 (1.5%) had titers of 400 NU/ antibodies. Finally, cross reactivity of serum antibodies ml, and 1 (0.5%) had a titer of >800 NU/ml. Five of 100 produced by animals vaccinated against BVDV to HoBi serum samples were positive in PCR assays: 3 beef and like viruses was examined. Sera of cows vaccinated using 2 dairy cattle sera samples. The hemaglutinin gene (HA) PCR product of a PCR positive bovine sample was directly and BVDV2 antigens had low neutralizing activity against sequenced in both orientations using the M13 universal killedtwo HoBi-like or modified viruses, live vaccineindicating containing that these both vaccines BVDV1 primers. The alignment of the obtained HA sequence would provide limited protection against infection with revealed that the Argentinian sample is highly similar a HoBi-like virus. These results indicate that Hobi-like to the homologous gene from other VACV. Although no virus produce clinical signs similar to BVDV and indicate exanthematous VACV outbreaks have been described in that suggest that new diagnostics tests and/or reagents bovines in Argentina, our results suggest that dairy and are needed to properly identify these new viruses. beef herds may be exposed to VACV in areas surrounding Financial support: CRADA ARS-Novartis Animal Health the Brazilian border and therefore may be at risk for VV24 - Mapping The Sites Of Latency And VACV infection. Reactivation By Bovine Herpesvirus 5 (Bohv-5) And By A Thymidine Kinase-Deleted Bohv-5 In Lambs

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

210 Veterinary Virology: VV

Cadore, G.C., Weiss, M., Anziliero, D., Brum, M.C.S., Bovine herpesviruses types 1 (BoHV-1) and 5 (BoHV-5) Weiblen, R., Flores, E.F. are very closely related pathogens of cattle, associated with respiratory/genital and neurological disease, 1. Universidade Federal de Santa Maria, UFSM, Av. respectively. Nonetheless, cases of encephalitis caused Roraima, 1000, Santa Maria/RS BoHV-1 have been occasionally reported. Envelope 2. Universidade Federal do Pampa, UNIPAMPA, BR glycoprotein D of BoHV-1 (gD1) and BoHV-5 (gD5) are 472, km 592, Caixa Postal 118. Uruguaiana/RS involved in attachment, penetration and cell fusion, and also seem to participate in viral neuropathogenesis. In Bovine herpesviruses types 1 (BoHV-1) and 5 (BoHV-5) addition, gD gene is well conserved and, as such, may be are very closely related pathogens of cattle, associated used for phylogenetic analysis. Thus, a phylogenetic study with respiratory/genital and neurological disease, was performed to investigate genetic divergences at the respectively. Nonetheless, cases of encephalitis caused 3’ region of gD gene of respiratory/genital BoHV-1 (n=7), BoHV-1 have been occasionally reported. Envelope neurological BoHV-5 (n=7) and neurological BoHV-1 glycoprotein D of BoHV-1 (gD1) and BoHV-5 (gD5) are (n=7) isolates, and whether these differences would be involved in attachment, penetration and cell fusion, and associated with the respective clinical presentations. The also seem to participate in viral neuropathogenesis. In isolates/strains were initially differentiated as BoHV- addition, gD gene is well conserved and, as such, may be 1 or BoHV-5 by a differential PCR, then, a nucleotide used for phylogenetic analysis. Thus, a phylogenetic study (nt) region of the gD 3’ was sequenced and analyzed; was performed to investigate genetic divergences at the and the amino-acid (aa) sequence was deduced. The 3’region of gD gene of respiratory/genital BoHV-1 (n=7), phylogenetic reconstruction based on nt and aa allowed neurological BoHV-5 (n=7) and neurological BoHV-1 the clear differentiation of BoHV-1 (n=14) and BoHV-5 (n=7) isolates, and whether these differences would be (n=7) in different clusters. The seven BoHV-1 isolates associated with the respective clinical presentations. The from neurological disease grouped within BoHV-1 isolates/strains were initially differentiated as BoHV- branch. A consistent alignment of 310 nt revealed a high 1 or BoHV-5 by a differential PCR, then, a nucleotide conserved region within each type and a least conserved (nt) region of the gD 3’ was sequenced and analyzed; between 3’ of gD1 and 3’ of gD5. The nt and aa similarity and the amino-acid (aa) sequence was deduced. The levels were on average 98.3% among gD1; 97.8% and phylogenetic reconstruction based on nt and aa allowed 95.8% among gD5 and 73.7% and 64.1% between the clear differentiation of BoHV-1 (n=14) and BoHV-5 both viral types. Thus, the phylogenetic and identity (n=7) in different clusters. The seven BoHV-1 isolates from neurological disease grouped within BoHV-1 of BoHV-1 and BoHV-5 types. However, no conclusion of branch. A consistent alignment of 310 nt revealed a high similaritya possible involvement levels allowed of gD differentiation/classification 3’ nucleotide sequence in conserved region within each type and a least conserved determination of the neurovirulent phenotype could be between 3’ of gD1 and 3’ of gD5. The nt and aa similarity drawn. Financial support: CNPq levels were on average 98.3% among gD1; 97.8% and 95.8% among gD5 and 73.7% and 64.1% between VV26 - Evaluation Of Diagnostic Tests To both viral types. Thus, the phylogenetic and identity Detect Calves Persistently Infected With Hobi-Like Pestiviruses of BoHV-1 and BoHV-5 types. However, no conclusion of Bauermann, F.V., Falkenberg, S.M., Decano, N., Weiblen, similaritya possible involvement levels allowed of gD differentiation/classification 3’ nucleotide sequence in R., Flores, E.F., Ridpath, J.F. determination of the neurovirulent phenotype could be drawn. Financial support: CNPq 1. Universidade Federal de Santa Maria, UFSM, Av. Roraima, 1000, Santa Maria/RS VV25 - Glicoprotein D-Based Phylogeny 2. National Animal Disease Center, NADC/USDA, Of Typical And Neurological Bovine Aimes, Iowa Herpesviruses Types 1 And 5 3. University of Bari, University of Bari, Valenzano, Traesel, C.K., Sá e Silva, M., Weiss, M., Weiblen, R., Flores, Italy E.F., 1. Universidade Federal de Santa Maria, UFSM, Av. The emergence of a new group of pestiviruses, the HoBi- like viruses, presents potential problems for diagnosis Roraima, 1000, Santa Maria/RS due to the similarities in clinical presentation, genetic 2. Southeast Poultry Research Laboratory, USDA/ARS, and antigenic similarity with bovine viral diarrhea 934 College Station Road, Athens, GA, USA virus (BVDV). Because BVDV persistently infected (PI) calves are the major reservoirs and source of virus dissemination in nature, they constitute the main September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

211 Veterinary Virology: VV targets of BVDV detection efforts in the U.S. and other phylogenetic analysis of the amplicons indicated 97- countries undertaking control and/or eradication 99% of similarity with pseudocowpox virus in samples measures. Thus, calves persistently infected with HoBi- from three herds; samples from another herd presented like virus (HoBi PI) were generated by experimental the same similarity with bovine papular stomatitis infection of seven pregnant heifers with HoBi-like virus. Samples from others herds were negative for all viruses. One heifer aborted at 8 months of gestation; viruses. These results show the circulation of bovine two calves died shortly after birth and four surviving parapoxviruses in Rondonia state, and indicate the need calves appeared clinically normal. HoBi like virus was for fast and reliable diagnosis to avoid the consequences isolated from the aborted fetus and two calves that died. of restrictive measures related to foot-and-mouth Based on multiple tests performed on samples collected disease, and to control and prevent these viral infections more than 2 weeks apart, the surviving calves were as well. Financial Support: CNPq persistently infected with HoBi-like viruses. Ear notches were collected from HoBi PI calves at day of birth (DOB) VV42 - Surface Plasmon Resonance and then weekly for one month. Samples were tested Immunosensor For The Diagnosis Of Canine by ELISA, immunohistochemistry (IHC), and RT-PCR Distemper Virus Infection Basso, C.R., Pedrosa, V.A., Araújo Jr., J.P. IHC detected 100% of samples at all time points, Universidade Estadual Paulista, UNESP, Rubião Junior, ELISA missed one animal at DOB. About 80% of RT- using panpestiviruses and HoBi-like specific primers. Botucatu-SP PCR reactions using panpestivirus primers and 15% of The canine distemper virus known as CDV, affects in false negatives. These results indicate the need for carnivorous order animals and it is responsible for reactionsimproving using the HoBi-likemethods/tests virus specificfor detection primers of resulted calves persistently infected with this new group of pestiviruses. The technique of Surface Plasmon Resonance (SPR) is Financial support: CRADA ARS-Novartis Animal Health onepresented of the as canine an analytical diseases tool more that difficult can detect to diagnose. both the presence of the antigen as the antibody, and determine VV31 - Pseudocowpox And Papular the values of the adsorption and desorption kinetics of Stomatitis In Cattle In The Rondonia State, this process. For this study were used twenty positives Brazil samples of canine urine and eight negatives from Cargnelutti, J.F., Santos, B.S., Lebre, S.N., Sodré, D.N.A., animals treated at the Clinic of Infectious Diseases Silva, R.M., Weiblen, R., Flores, E.F. Animals Veterinary Hospital (FMVZ-UNESP)-Botucatu. 1. Universidade Federal de Santa Maria, UFSM, Av The SPR signal response increased in proportion to the Roraima, 1000, Santa Maria, Rio Grande do Sul concentration of CDV. The CDV binding signals were linearly related to the concentration in the range of 2. Agência de Defesa Sanitária Agrosilvopastoril do Estado de R, IDARON, Rondônia combined with a low relative error of 4.8%. The Cases of vesicular disease, initially suspected of foot- 1.1detection to 1160.0 limit ng was mL-1 calculated with Δθ using = 7.8 this + 4.28x,high sensitivity R2=0.98, and-mouth disease or vesicular stomatitis were reported domain, which is typically used for the determination of in cattle in Nova Brasilandia do Oeste county located LOD in SPR experiments. This LOD was calculated using at central-southern region of Rondonia state (Brazil), 3 times the noise on the SPR sensorgram combined between October and November of 2012. The described with the slope of the highly sensitive region, and the outbreaks occurred in 13 neighbor herds affecting 25 of detection limit for CDV was 0.1 ng L-1 and the analytical frequency can be estimated to be 240 samples per from nine herds were submitted to laboratory diagnostic. day. The saturated CDV binding at 1.1 ng mL-1 (6.7 482The animalsanimals, developed mainly calves papulo-vesicular (< six months-old). lesions, Samples mainly millidegrees) corresponds to a binding capacity of 0.05 in the oral cavity, but also in the muzzle and skin, with a clinical course of approximately 7 to 10 days. Samples to diagnose CDV by conventional methods including collected from lesions were submitted initially to ng/mm−2.electron microscopy, This result virus is comparable isolation, latexto previous agglutination, efforts diagnosis of foot-and-mouth disease, resulting negative. hemaglutination and ELISA. However, these methods Tissue fragments of lesions and swabs were submitted require multistep detection schemes. In contrast, this to diagnosis of other agents of vesicular disease: proposed methodology requires less than 2 hours for parapoxvirus, vaccinia virus, and bovine herpesvirus type 2, by virus isolation and PCR. Samples obtained The advantage of the proposed method over some from animals of four herds were positive to B2L gene aexisting complete ones diagnosis, resides in including its simplicity, the modificationlow consumption step. of parapoxvirus by PCR. Nucleotide sequencing and of reagents, higher sample frequency and the possibility

212 Veterinary Virology: VV of automation. The method has been satisfactorily Argentina, Bolivia, Colombia and Peru. This work will applied to the measurement of CDV concentrations analyze samples in Pantanal region, using molecular in urine samples. Financial support: FAPESP- process and serological test and viral isolation in embryonated 2012/15666-1 chicken eggs, to verify of the presence the AIV, in wild birds. The current study was conducted to elucidate the VV46 - Equine Infectious Anemia: Risk Factors Detected In A Prevalence Study Of through the both Northern and Southern hemispheres. Working Equids In Minas Gerais influenzaIn December shade (2012), virus bythe birds expedition that migrate, took annually,place in Almeida, V.M.A., Gonçalves, V.S.P., Haddad, J.P.A., Poconé region, Pantanal-MT, Brazil. This region there Martins, M.F., Dias, R.A., Leite, R.C., Reis, J.K.P. 1. Universidade Federal de Minas Gerais, UFMG, Av. conservation. Mist nets were placed inside the forest. We Antônio Carlos, 6.627, Belo Horizonte, MG, CEP: 31.270-901 is low human influence and is very difficult to access incaptured times of 45 flood, different which species contributes of wild to birds,the good accounting state of 2. Instituto Mineiro de Agropecuária 144 samples collected by orotracheal/cloacal swabs 3. Universidade de Brasília storages in the VTM medium and immediately stored in 4. Universidade de São Paulo liquid nitrogen. Total Blood was also collected and sera Risk factors for the occurrence of equine infectious anemia (EIA) were studied in 6,540 animals from 1,940 conducted RNA extraction (cotton swabs), using QIAamp randomly sampled farms in 853 municipalities of Minas wereViral separatedRNA kit (Qiagen), on field. Immediatelyfollowing by afterreal-time collected, one-step was Gerais after administering a questionnaire to farmers during a seroepidemiological survey from September real-timein 20 samples RT-PCR for for initial the detectiontest. All twenty on field samples (Smart Cycle).tested mules are 1.94 times more likely to acquire EIA than Inwere December, negative theto AIV procedures by one-step were real-time performed RT-PCR. on fieldThis 2003 to March 2004. Stratified analyses indicated that surveillance of wild birds in Pantanal is interesting, 8.24 times more likely to develop EIA than purebred horses,animals, thatand that horses animals of undefined aged from breeds 61 to animals120 months are are in constant migration from North to South. Brazil are 2.90 times more likely to develop the disease than becausecontinues these to be a birds country has free not of nationality AIV, while don’t defined, detect and in domestics poultry. Therefore, these movements deserve regression model indicated that vaccination and the use special attention, particularly by the incidence of recent animalsof the same aged horse 13 to harness 24 months. on more The final than multiple one animal logistic are outbreaks of AIV in others continents. Key words: Avian risk factors for EIA. The disease appears to be related to transit, as the out-of-state origin of animals and their use Financial support: FAPESP Influenza virus, Brazil, Pantanal, Poconé, wild birds. in breeding, which are indirect indicators of the greater VV88 - Molecular Epidemiology Of movement of animals, were associated with increased Outbreaks Of Rabies In Cattle In The disease risk. Financial support: FAPEMIG,CNPq and Central Rio Grande Do Sul, 2012 INCT Pecuária Kanitz, F.A., Kowalski, A.P., Batista, H.B.C.R., Carnieli-Jr., VV60 - Study Of Avian Influenza Vírus (Aiv) P., Oliveira, R.N., Weiblen, R., Flores, E. In Wild Birds In Pantanal, Brazil. 1. Instituto Pasteur, Instituto Pasteur, Av Paulista 393, Araujo, J., Thomazelli, L.M., Ometto, T.L., Seixas, M.M., São Paulo, SP 01311-000 Brasil Aguiar, D.M., Pinho, J.B., Durigon, E.L. 2. Universidade Federal de Santa Maria , UFSM, Av 1. Instituto de Ciências Biomédicas- USP, ICB II, Av. Roraima 1000, Santa Maria, RS 97105-900 , Brasil Prof. Lineu Prestes, 1374 CEP: 05508-900,2° andar sala 225 Rabies is a fatal infection of the central nervous 2. Laboratório de Virologia e Rickettsioses, HOVET- system, caused by rabies virus (RABV). The disease is UFMT, Cuiabá, MT, Brasil generally acquired through virus-contaminated saliva 3. Laboratório de Ornitologia, Universidade Federal de and transmitted by the bite of rabid animals. In Brazil, MT, UFMT, Mato Grosso, Cuiabá, MT, Brasil vampire bats Desmodus rotundus are the main sources of RABV for livestock. The aim of the present study was to Wild birds are considered the major natural reservoir describe a molecular and epidemiological investigation of bovine rabies outbreaks in the central region of the second country with the highest biodiversity in State of Rio Grande do Sul, southern Brazil, in 2012. forspecies avian of migratory influenza birds. viruses AIV (AIV) have andbeen Brazil sporadically is the From June to August , 27 cases of rabies were reported isolated in South America in neighboring countries, like in 22 small herds, located at most 11 km apart, in the

213 Veterinary Virology: VV county of Pinhal Grande. The disease affected 45 cattle same batch were reconstituted and inoculated in Frey – age 12 to 48 months – from which 27 samples were broth liquid and plating in the solid medium (agars) after 3,7 and 14 day and read after 7 days of incubation of each passage, using the Lupe. During the study period submittedand mouse toinoculation rabies diagnosis. test. In a RABV second was stage, identified 11 samples in a 60 vaccine batches were tested: 16 of ND, 16 of IB, 14 of total of 22 samples by direct fluorescence antibody test IBD, 07 of Combined and Complexes vaccines. The results chain reaction (RT-PCR) with primers targeting the showed that one batch of IB vaccine (1 of 60=1.7%) was werenucleoprotein amplified gene by reverse(N) of RABV. transcription/polymerase In addition, 1218 contaminated as revealed by the Sterility test (aerobic nucleotides (nt) of the N gene from these samples were agent and fungus). This batch showed 2.2colonies/ sequenced and submitted to phylogenetic analysis. Nine dose, above what is permitted by the Brazilian law out of 11 samples yielded almost identical sequences, (1.0 colonies/dose). No batches revealed the presence with a few synonymous, non-coding mutations, of Mycoplasma and Salmonella. This result shows the indicating a common origin of the virus. However, two importance of testing avian vaccines used in the country other samples presented nt mutations resulting in amino in order to preserve the national poultry production. acid changes, suggesting a different origin of the virus. In Financial Support: Ministério da Agricultura, Pecuária e summary, these results suggest that at least two RABV Abastecimento strains were involved in the outbreaks, regardless their geographical cluster. Investigations on the circulation of VV123 - Molecular Characterization Of both genotypes in bats in the region are underway. The Vp1, Vp2, And Vp3 Genes From Porcine Group A Rotavirus Strains Circulating In VV122 - Evaluation Of Tests Sterility, Brazil Mycoplasma And Salmonella From Avian Gregori, F., Brandão, P.E., Espinoza, L.R.L., Richtzenhain, Live Vaccines Submitted Of Official L.J., Silva, F.D.F. Quality Control During Septembry/2012 To May/14/2013 Fac. Med. Vet. e Zootecnia - Univ. São Paulo, FMVZ Orsi, M.A., Fortunato, E.C., Ashimine, R., Ribeiro, S.A.M., - USP, Av.Prof. Dr. Orlando Marques de Paiva, 87 CEP 05508- Reischak, D. 270 São Paulo SP LABORATÓRIO NACIONAL AGROPECUÁRIO, Rotavirus A (RVA) causes acute enteritis in young Lanagro-SP, Rua Raul Ferrari S/N- Jardim Sta Marcelina- Campinas,SP of neonatal diarrhea. Recently, other genes besides pigletsVP4 and and VP7 is have responsible been used for in a a significant more comprehensive proportion Brazil is the top exporter and the third producer of chicken in the world. The prophylaxis of the Newcastle disease relationships among RVAs and providing a framework (ND), infectious bursal disease (IBD) and infectious classificationin which unusual system genotype allowing combinations a better insight can in be genetic more bronchitis (IB) are based on active immunization with easily detected. According to VP1, VP2, and VP3 group live vaccines, which are controlled by manufactures and also by analyses by government staff, before they respectively. VP1 is the viral RNA dependent RNA are approved for the commercial use. As part of the Apolymerase rotavirus (RdRp) are classified that functions as R, C,as andviral Mtranscriptase genotypes, success of the vaccination, in the vaccine quality control, and replicase. VP2 surrounds the dsRNA genome and it the vaccine are tested for sterility, and presence of is essential for replicase activity and virus like particles Mycoplasma and Salmonella ssp. Live vaccines produced (VLPs) formation. The VP3 acts as guanylyltransferase or imported by Brazil, either monovalent, combined and and methyltransferase. The R, C and M genotypes of complexes vaccines were submitted to quality control at three strains from pigs reared in farms from Sao Paulo the Avian Health Unit, Lanagro-SP. The objective of this nucleotide sequencing and phylogenetic analysis. Viral from September to May.13. Sterility tests on 10 vials of and Minas Gerais states, Brazil, were defined by partial studysame batches was to evaluateof vaccines the were Official done Quality in medium Control liquids data RT-PCR using primers developed in this study. The PCR Casoy, Sabouraud and Thioglicolate. The reading was RNAproducts was wereextracted subjected from tostool bidirectional samples and sequencing amplified and by done on the 14th days, and if 2 of 10 tubes were positive, analyzed with Neighbor-Joining algorithm, Maximum a new test was required, and counting of bacteria was Composite Likelihood as substitution model, and 1,000 done in solid media plates. In parallel, vials of same batch bootstrap replicates. All strains were phylogenetically of vaccine, were inoculated in selective broth enrichment close to other homologous strains belonging to R1, medium, for isolation of Salmonella (EMB Levine and C1, M1; in fact, this is in accordance with previously Salmonella Shigella agars). Other vaccine vials from the described genotypes for this animal specie. Monitoring

214 Veterinary Virology: VV genotypes is essential to a better understanding of VV153 - Genetic Characterization Of rotavirus epidemiology. Financial support: FAPESP Hepadnavirus In Pigs Destined For Human 2011/00870-0 Consumption In Rio De Janeiro, Brazil. Vieira, Y.R., Santos, D.R.L., Pinto, M.A., De Paula, V.S. VV132 - Orf Virus Infection In Goat Herds Of Semiarid Region, Bahia, Brazil. 1. Instituto Oswaldo Cruz IOC, FIOCRUZ, IOC, Tigre, D.M., Sardi, S.I., Neto, A.L.M., Oliveira, A., Agapito, FIOCRUZ, Laboratório de Desenvolvimento Tecnológico em R., Sampaio, M., Serafim, W., Muller, C., Torres, J.A., Virologia Campos, G.S. 2. Instituto de Zootecnia, UFRRJ, Departamento de 1. Universidade Federal da Bahia, UFBA, Av. Reitor Produção Animal Miguel Calmon, s/n, ICS, Vale do Canela, Salvador, Bahia The hepatitis B virus (HBV) belongs to the 2. Universidade Estadual do Sudoeste da Bahia, UESB, Hepadnaviridae family, which can be found in both Campus- Jequié, Bahia mammals and birds. This family includes HBV that 3. Agencia Estadual de Defesa Agropecuária da Bahia, infects humans and non-human primates, including ADAB, Setor de Sanidade Animal, Salvador, Bahia chimpanzees, gibbons, gorillas, orangutans and woolly 4. Serviço Nacional de Aprendizagem Rural, SENAR, monkeys, and HBV-related viruses circulating in rodents, such as woodchuck and squirrels, and avian hosts, Salvador- Bahia like ducks, geese, herons, storks. Increasing the list of 5. Escola de Medicina Veterinaria e Zootecnia, EMEV-Z/UFBA, Campus- Ondina, Salvador, Bahia of serological markers of HBV in swine herds in China 6. Instituto Federal de Sergipe, IF-SE, Campus- Glória, putativeand the molecular hosts, recent detection studies of hepadnavirus confirm the in presence serum Sergipe samples from swine herds in Santa Catarina State, Brazil. Contagious pustular dermatitis is a viral disease of The aim of this study was to genetically characterize the worldwide distribution, caused by ORF virus belonging hepadnavirus in bile samples from domestic pig herds in to the family Poxviridae. The virus causes acute pustular Rio de Janeiro, Brazil. For this purpose, 36 domestic pigs lesions in sheep and goats on the muzzle and lips from slaughterhouses located in Petrópolis, Itaocara although lesions within the mouth, affecting gums and and Itaperuna (North and Hill region of Rio de Janeiro tongue can occur. Human infection can occur among State, Brazil) were screened for Hepadnavirus-DNA. workers exposed occupationally (zoonosis). In Bahia the Analyses were performed in bile samples after DNA viral frequency of ORF virus infection seems to be higher than extraction (QIAamp DNA Mini Kit, Qiagen®), partial 36 bile samples analyzed, 4 samples showed a positive thatin herds officially of goats reported. in Bahia. This It was study reported is the thefirst occurrence report on genome amplification and genome sequencing. From (972 bp). Futhermore, phylogenetic reconstruction theof an ORF epithelial virus identification disease in goats and laboratory in the locality confirmation of Araci. The lesions were characterized by the occurrence of resultusing thefor thesame semi-nested partial nucleotide PCR specific sequences for HBV of ORF S scabs around the labial fold or being restricted to the showed a close relationship of hepadnavirus strains udders. These scabs and crusts were collected and sent from pigs and hepadnavirus nucleotide sequences from to the Laboratory of Virology of the Institute of Health non-human primates (from 77.3 to 85.2%), rodents Sciences, Federal University of Bahia. The material from (from 55.6 to 59.2%) and birds (from 39.6 to 42.4 %) the lips and teats were submitted to tripsine 0.025% Besides, these data also reveal that distinct strains might treatment and subjected to DNA extraction or the scabs be responsible for the infection in domestic pigs. Thus, were macerated with sterile sand in PBS to isolament additional studies are needed to determine a probable in cell culture. The DNA obtained was submitted to the infectivity of this agent, as well as evaluating possible technique of polymerase chain reaction (PCR) to amplify epidemiological risks. Financial support: IOC/Capes the genes ORFV 011 (B2L, 1022 base pairs [bp]) and Area: Animal Virology ORFV 059 (F1L, 1062bp). All of the samples showed VV164 - Multiplex Pcr For Simultaneous positive PCR reaction and the isolament in ovine kidney Detection Of Five Single-Stranded Swine Dna Viruses goat herds of Bahia state. Financial Support: FUNDECI- Gava, D., Ibelli, A.M.G., Schaefer, R., Ciacci-Zanella, J.R. cellBanco cultures do Nordeste. confirmed the ORF virus infection of in the Embrapa Suínos e Aves, Embrapa, BR 153, Km 110, 89700-000, Concórdia-SC, Brazil

215 Veterinary Virology: VV

Porcine parvovirus (PPV1) and porcine circovirus The Avian Health Unit from Lanagro-SP performs the type 2 (PCV2) cause clinical disease in swine. Porcine Quality Control of avian live vaccines commercially parvovirus type 4 (PPV4), torque teno virus 1 (TTV1) available in Brazil. The objective of this study was to and torque teno virus 2 (TTV2) circulate among swine evaluate experimental seroconversion assays carried in association with PPV1 and PCV2 infections, although out from Sept.2012 to May 2013. Seroconversion test their epidemiology and pathology in pigs remains was performed using two glasses of live vaccines. Vaccines were reconstituted in phosphate buffer saline, pigs in the same reaction, a multiplex polymerase inoculated in SPF chicks according manufacturer’s unclear.chain reaction In order (PCR) to detect was thesedesigned. five DNAEach viruses DNA target from recommendations and kept in BSL3-isolators. Around 21-28 days after immunization chicks were bled via (PPV4), 341bp (TTV2), 284bp (PCV2) or 101bp (TTV1). cardiac puncture, serum was obtained and serological producedAmplicons a were specific cloned amplicon into pCR4 of 561bp plasmid (PPV1), (TOPO 440bp TA tests (HI and/or ELISA) were performed. Fifty-six batches of live vaccines were tested: 16 batches of infectious Quick Plasmid Miniprep Kit (Invitrogen). All cloned bursal disease (IBD), 14 batches of infectious bronchitis Cloning Kit, Invitrogen) and purified using the PureLink (IB) disease, 6 batches of Newcastle disease (ND), 5 of a ND-1000 spectrophotometer and 10 serial dilutions combined vaccines (4 batches with ND+ IB fractions amplicons were verified by sequencing, quantified using and 01 Marek + IBD), and 5 of complexes vaccines (IBD + antibodies). The results showed that ND vaccines had of 1.2×1010 up to 1.2×100 DNA copies/μL were done. geometric mean titers (GMT)/HI = 22 to 84.4 and GMT/ Theparameters. multiplex The PCR reaction was performed contained in4mM a 30μL MgCl2, reaction 1.5× Elisa = 3,581. IBD vaccines had GMT = 3,274 to 14,594; and carried out with all five primer pairs with optimized IBD vaccines produced with strong strains had biggest values of GMT. The results of complexes vaccines showed PCR1.8U Buffer,Platinum 0.4mM Taq dNTP, DNA 0.05μMPolymerase TTV1, (Invitrogen). TTV2 and PCV2 The GMT = 4,587 to 5,917. Considering results obtained primers,PCR cycling 0.16μM conditions PPV1 consistedprimer, 0.4μM of an PPV4initial primerdenaturing and with ND, IBD and complexes vaccines, all batches have at 95°C for 30s followed by 35 cycles at 95°C for 1 min, been approved. However, 85.7% of IB vaccines (GMT = 0 to 470.6) and 80% of the combined vaccines that extension at 72°C for 10 min. The amplicons were have the fraction IB, were failed. These results show the 60°Canalyzed for 1by min electrophoresis and 72°C for through 1 min followed a 2% agarose-TBE by a final importance of seroconversion test for the quality control gel and stained with ethidium bromide. The sensitivity of avian live vaccines used in the country to assure that good veterinary vaccines are available for commercial use. Financial Support : Ministério da Agricultura, of the multiplex PCR was 1.2×103 DNA copies/μL. Pecuária e Abastecimento Theobserved. specificity Therefore, of the the multiplex multiplex PCR PCR wasdeveloped tested in using this influenza A virus and PCV1 and no amplification was VV182 - Implementation Of Pcr And Rt-Pcr For Diagnosis Of Feline Herpesvirus (Fehv) workand can showed provide to bea usefula rapid, tool sensitive, for clinical specific analysis and cost- and And Feline Calicivirus (Fcv) Infection In effectiveepidemiology method of thesefor the viruses detection in swine of five herds. swine Financial viruses Rio De Janeiro. support: Embrapa (Process nº. 02.11.10600-03) Baumworcel , N., Leal, R.M., Costa, E.M., Cubel Garcia, R.C.N., Castro, T.X. vv178 - Experimental Evaluation Of Vaccine-Induced Seroconversion Of Avian Universidade Federal Fluminense, UFF, Rua Professor Live Vaccines Submitted To The Official Hernani Melo n.º 101, São Domingos - Niterói RJ - CEP: Quality Control During September 2012 To 24210-130 May 2013 Feline calicivirus (FCV) and herpesvirus (FeHV) are the Orsi, M.A., Fortunato, E.C., Camillo, S.C.A., Reischak, D. main agents of conjunctivitis and upper respiratory tract Laboratório Nacional Agropecuário, Lanagro-SP, Rua disease in domestic young cats and these agents are Raul Ferrari S/N- Jardim Sta Marcelina-Campinas,SP widespread in the domestic cat population, despite the use of the vaccines. Previous reports in southern part of The prophylaxis of many avian diseases is mainly based Brazil have shown that FCV and FeHV-1 were detected in on active immunization through the employment of live about 39% and 53% of the cats, respectively. However, vaccines. One of the most important test on the quality the occurence of FCV or FeHV have not been described in control of vaccines is the seroconversion. Seroconversion the State of Rio de Janeiro yet. In this study, conjunctival swabs were collected from 16 unvaccinated kittens (up to the antigen were produced, after immunization. to one year) with clinical signs of conjunctivitis from 3 is carried out to verify if detectable specific antibodies September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

216 Veterinary Virology: VV different shelters in Rio de Janeiro city between April (ORF2) of CaAstV were used. All the PCR amplicons were to May 2013. The genome extration was performed sequenced and nucleotide (nt) similarity with sequences immediately after collection using the PureLink™ Spin deposited in the GenBank database was assessed using Column-Based Kit (Invitrogen®). For FHV detection, a the BLAST tool. Faecal samples were also screened for fragment of 287 bp of the thymidine kinase enzyme (TK) the presence of CPV and CCoV by either PCR or RT-PCR and sequencing. According to sequence analysis of RdRp transcriptase PCR (RT-PCR) using random primer gene(Invitrogen®) was amplified was performed. by PCR. For The FCV target detection, sequence reverse for (20.0%). Four CaAstV capsid sequences presented region,enough CaAstVquality infection for phylogenetic was confirmed analysis. in 7/34These samples strains ORF2 region, tha encodes the VP1 capside protein. These displayed 77.1-95.8% nt identity to other CaAstV strains FCVproducts RT-PCR were amplification subjected to was a seconda 924 bp reaction fragment (Nested- of the previously deposited from China, France and Italy. Two PCR) using internal primers able to amplify a fragment puppies from the same litter were infected with CaAstV alone. One puppy was coinfected with both CaAstV and Animal Health, USA), was used as a positive control. FeHV CCoV-I. One puppy with CCoV-II and CPV-2b; Two puppies ofDNA 467 was bp. detected A commercial in 10/16 vaccine (62,5%) Felocell conjuntival CVR-C samples. (Pfizer were coinfected with CaAstV, CCoV-I and CPV-2a. Lastly, FCV genome was detected in 4/16 (25,0%) conjuntival one puppy was coinfected with CaAstV, CCoV-I, CCoV-II samples by conventional RT-PCR and in 7/16 (43,7%) samples using nested RT-PCR. Co-infection of FeHV and specimens from dogs in South America. This fact suggests FCVinfection was detected in only one cat. This is the andthat CPV-2a.CaAstVs This is circulating is the first in report Brazil of and CaAstV may infection play a role in as enteric pathogens in young dogs. Finnancial Support: from cats in Rio de Janeiro and revealed that these Faperj ; PROPPI -UFF , IOC-FIOCRUZ; CNPq. firstviruses molecular are circulating detection in of the FCV feline and FeHVpopulation. in specimens These results reinforce the need for further studies relating VV210 - Fatal Outcome Of Mixed Canine to the molecular characterization of these viruses and Coronavirus And Canine Parvovirus the monitoring of FCV and FeCV in vaccinated cats with Infection In Puppies With Enteritis In Rio clinical signs of conjunctivitis. Finnancial Support: Faperj De Janeiro, Brazil ; PROPPI -UFF; CNPq. Costa, E.M., Bottino, F.O., Domingues, C.F., Castro, T.X., Cubel Garcia, R.C.N. VV183 - Molecular Characterization Of Canine Astrovirus In Puppies With Enteritis Universidade Federal Fluminense, UFF, Rua Prof. Castro, T.X., Cubel Garcia, R.C.N., Costa, E.M., Xavier, Hernani Melo 101, São Domingos, Niterói, RJ, Brasil M.P.T., Leal, R.M., Leite, J.P.G. Canine parvovirus (CPV) and canine coronavirus (CCoV) 1. Instituto Oswaldo Cruz, IOC, Av. Brasil, 4365 - are considered the main pathogens responsible for Manguinhos - Rio de Janeiro - RJ - Brasil CEP: 21040-360 acute gastroenteritis in young dogs. In recent years, both viruses have given rise to new genotypes or variants with 2. Universidade Federal Fluminense, UFF, Rua higher pathogenicity. Other studies have shown that the Professor Hernani Melo n.º 101, São Domingos - Niterói RJ - severity of clinical signs may be more pronounced in CEP: 24210-130 dogs that had both CPV and CCoV. The aim of this study Canine parvovirus (CPV) and canine coronavirus (CCoV) was to report the fatal outcome of mixed CCoV/CPV are considered to be the main pathogens responsible infection in puppies from Rio de Janeiro, Brazil. A total of for acute gastroenteritis in young dogs. Recently, 25 fecal samples from diarrheic puppies were examined. canine astroviruses (CaAstV) have been associated Genomic RNA/DNA was extracted from 10% fecal with outbreaks of enteritis in puppies that were either suspensions using the PureLink™ Spin Column-Based Kit singly infected or coinfected with CCoV and/or CPV. (Invitrogen®). For CPV detection, PCR was performed The purpose of this study was to perform the molecular with primers 555F/555R (4003-4585) that amplify a characterisation of CaAstV in faecal samples from 593bp fragment of the VP2 capsid gene. For CCoV, the puppies showing clinical signs of gastroenteritis. Fecal reverse transcription was performed with random samples from 34 diarrheic puppies, up to 8 months of age, primer (Invitrogen®) and Superscript III enzyme collected between 2008 and 2013 were tested. Nucleic (Invitrogen®). Differential primers directed to the spike acids were extracted from 10% fecal suspensions using (S) gene were used in PCR assays for CCoV genotyping/ the PureLink™ Spin Column-Based Kit (Invitrogen®). subtyping: EL1F/EL1R (3538-3883) to amplify CCoV-I Molecular detection was carried out using the One-Step whereas S5F/S6R(3486-4179) and CEPol-1/TGSP-2 RT-PCR System (Invitrogen®). Two sets of primers, (20168-20537) for CCoV-IIa and CCoV-IIb. Mixed CCoV/ targeting the RdRp (ORF1b) and the capsid region CPV infection was detected in 15 samples. For ten samples, September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

217 Veterinary Virology: VV one type of CCoV was associated with CPV: CCoV-I/CPV VV215 - Expanded Screening For Simian Foamy Virus (Sfv) In New World Primates samples two CCoV subtypes (CCoV-I/IIa) were detected. Identifies Two Novel Sfv Lineages In (2),Based CCoV-IIa/CPV on clinical reports, (7), CCoV-IIb/CPV four CCoV-I (1)positive while puppies for five Tamarin And Uakari Monkeys From Brazil presented mild enteric signs (soft diarrhea), while two Muniz, C.P.R., Santos, A.F., Hongwei, J., Troncoso, L., Faria, CCoV-IIa positive puppies showed more severe clinical L.T., Augusto, A., Fedullo, L.P., Pissinatti, A., Switzer, W., signs (vomiting, hemorrhagic diarrhea) and one died. In Soares, M.A. puppies with mixed infection, the clinic signs varied from 1. Universidade Federal do Rio de Janeiro, UFRJ, Rio CCoV (CCoV-I/IIa) along with CPV was detected in three de Janeiro mild to severe with five fatal outcome. Dual infection of 2. Fundação Jardim Zoológico do Rio de Janeiro, infections caused by CCoV-I/IIa and CPV. These results RIOZOO, Rio de Janeiro non-survivorssuggest that dual puppies. CCoV Thisinfection is the associated first report to of CPV multiple may 3. Centers for Disease Control and Prevention, CDC, affect the severity and outcome of the disease. Financial Atlanta, Georgia, USA support: FAPERJ, CNPq, PROPPI-UFF. 4. Centro de Primatologia do Rio de Janeiro, CPRJ, Rio de janeiro VV211 - Detection Of Canine Herpesvirus Type 1 In The Blood Samples Using Qpcr And 5. Instituto Nacional do Câncer, INCA, Rio de Janeiro Determination Of Viral Load. Kurissio, J.K., Araújo Jr., J.P. in almost all Old World primates and have been shown 1. Universidade Estadual Paulista Campus Botucatu, Whileto cross simian into humans, foamy viruses little is (SFV)known have about been SFV identified infection in New World primates (NWP) and their ability engaging Unesp, Distrito de Rubião Júnior s/n° into zoonotic transmissions. Expanded screening of 2. Faculdade de Medicina Veterinaria e Zootecnia, additional NWP genera and species using both serology FMVZ, Distrito de Rubião Júnior S/N° and PCR is necessary to better understand the distribution 3. Instituto de Biociências de Botucatu, IBB, Distrito de and prevalence of SFVs in NWPs. Blood samples were Rubião Júnior S/N° collected from 99 captive NWPs at the Primatology The canine herpesvirus is a contagious infectious agent Center of Rio de Janeiro and the Rio de Janeiro Zoo. that is transmitted through direct contact with infected Plasma was screened for SFV antibodies by EIA and animals. The viruses are eliminated by oronasal and Western blot assays. Genomic DNA was tested by PCR for genital tract secretions. It is a virus with a latent feature polymerase and LTR-gag regions. Phylogenetic inference which maintains its infectivity and dissemination to was used to determine genetic relationships. Total SFV other animals. This work aims apply qPCR to identify seroprevalence was 37% (37/99). SFV antibody was canine herpesvirus type 1 (CHV-1) infection quantifying detected in seven genera. In contrast, a lower prevalence viral load. For this, it was used qPCR reaction directed of 17% (17/99) was found using generic PCR methods to thymidine kinase gene, previously standardized, in with sequences detected in seven genera. Phylogenetic dog blood samples. Were tested 138 DNA extracted analysis inferred co-speciation of SFV and NWPs, from dog whole blood samples collected in Botucatu including new SFVs in uakaris (SFVuak) and tamarins was performed comparing with absolute standard the Pitheciidae family of primates. Our results indicate that serology is more sensitive than PCR for detection region,curve made São Paulo,using Brazil.recombinant The viral plasmidial load quantification DNA. Nine (SFVtam). SFVuak is the first example of SFV infecting samples were positive showing single melting curve of SFV in NWPs, suggesting that studies using only PCR and viral load from 15,35 to 2,48x105 copies/µl. To may underestimate prevalence and species distribution. sequencing showing results with 100% of identity viruses in uakaris and tamarins. Our results suggest that checkto CHV-1 specificity, (acession PCR AF361075). products were Therefore, submitted this to DNAdata Our finding demonstrates further the broad distribution ofhumans SFV in exposed NWPs, including to NWPs the are identification at risk for infection of divergent with of assays used. Thus, we observe that qPCR showed high will facilitate development of better molecular assays for supports the identification of the agent and specificity load at low level. Considering that there are no reports diversethe detection SFVs. of The these new viruses. SFV sequences identified here analyticalwith detection sensitivity of HCV-1 and in specificityblood samples, quantifying the qPCR viral is VV218 - Evaluation Of Nested And Semi Nested Pcr In Detection Of Equine Financial Support: FAPESP (2011/04795-2). an important tool for CHV-1 viral load quantification. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

218 Veterinary Virology: VV

Infectious Anemia Virus Infection In Universidade Federal do Rio de Janeiro, UFRJ, Av. Horses Of Pantanal Region, Brazil Carlos Chagas Filho - 373, C. Universitária, I. Fundão, R Cavalcante, R.V., Lima, M.F.T., Araújo Jr., J.P. Janeiro, 21941-972 1. Universidade Estadual Paulista “Júlio de Mesquita Rotavirus (RV) infections pose a major concern to the Filho”, UNESP/Botucatu, IBB - Distrito de Rubião Jr, s/n, poultry industry due to substantial losses caused by Botucatu-SP decreasing in productivity. The frequency of RV infections 2. Empresa Brasileira de Pesquisa Agropecuária, among wild birds however, is poorly understood. RV EMBRAPA Pantanal, Rua 21 de Setembro, 1880, Nossa belongs to the Reoviridae family. The viral particle Senhora de Fátima - Corumbá/MS possesses a nonenveloped capsid surrounding a genome composed of 11 dsRNA segments. The antigenic Equine infectious anemia (EIA) is caused by a retrovirus properties of the 6th segment (VP6), classify RV into and its primary mode of transmission comprises transfer 8 species A - H. RV belonging to the species A-C and H of blood from infected animals to healthy ones. In Brazil, infect humans and animals while species H only infect humans. Species D-F infect only in animals, particularly is based in serological tests followed by euthanasia birds. This study evaluated the frequency of RV infections EIAof infected notification animals. is mandatoryAGID and ELISA and its are confirmation serological among poultry and wild, migratory or resident, birds in techniques recommended because have good accuracy the state of Rio de Janeiro. Thus far, 403 fecal samples and reliable results for detection of positive animals; were collected from wild birds from 2005 to 2010 and 63 however, some cases may display false results. The cloacae swabs collected from poultries in 2012. Screening importance of this disease in the national context, make was performed by real time and conventional RT-PCR the development of direct diagnostic techniques very using primers that amplify the VP6 encoding gene of avian RV species A (RVA) and D (RVD). Among wild birds such PCR, including those recommended by OIE, were RVA was detected in 12.1% (49) of the samples; RVD was importantdesigned using to confirm laboratory-adapted disease. Molecular virus strains; techniques thus detected in 4 samples (1%). The RV-positive samples were obtained from birds from the Charadriidae and isolates of EIA virus, which in turn rises the possibility Scolopacidae families that are considered to be migratory theseof false-negative methods are and not false-positive suitable for results. detection Dong of et field al. in our country. Among poultries, RVA was detected in 6 (9.5%) samples. The VP6 encoding gene of 4 of those of EIAV proviral sequences using outer primer pair, samples was submitted to sequencing. Those samples (2012)EIAVltr-1F/EIAVltr-1R proposed a nested and inner PCR forprimer the pair, amplification EIAVltr- were also inoculated in MA-104 cells for virus isolation. 2F/EIAVltr-2R amplifying from the LTR to the tat gene. The results showed that RV infections are common Based on that, the aim of this study was to evaluate among wild migratory birds - a fact that can impact the nested PCR technique in samples from Brazil. We tested ecology of RV infections as such birds could disseminate the virus to long distance regions. Characterization of samples extracted from positive horses from Pantanal RV stains detected among migratory birds is of utmost five(endemic combinations area) in both of theseserological primers, techniques. using The 12 DNAbest importance for understanding the ecology, distribution results were obtained with the semi-nested method and evolution of RV infections. Moreover, the knowledge using the outer primers EIAVltr-2F and EIAVltr-1R and of the epidemiology RV infections among poultry is of inner primers EIAVltr-2F and EIAVltr-2R. The technique great interest to reduce such infections and therefore allow us to detect ten (83,3%) positive samples, while improve the production of poultry farms. Financial support: FAPERJ, CNPq. Two samples were sequenced showing a high variable inregion the of nested the EIAV PCR proviral only six DNA. samples In conclusion were amplified. semi- VV251 - Molecular Epidemiology Of Bovine nested PCR was better for use in Brazilian samples. Also Vesicular Diseases In The Southeast, it is necessary further standardization of molecular Northeast And Midwest Of Brazil techniques for use in conjunction with the herein Figueiredo, P.O., Alves, P.A., Almeida, G.M., Oliveira, D.B., described. Financial support: FAPESP Abrahão, J.S., Ferreira, P.C.P., Kroon, E.G., Trindade, G.S.

VV235 - Rotavirus Infections Among Universidade Federal de Minas Gerais, UFMG, Av. Poultries And Wild Birds In Rio De Janeiro Antônio Carlos, 6627, Campus Pampulha, CEP: 31270-901. State Belo Horizonte, Minas Gerais Fornells, L.A.M.G., Soares, M.V.M., Amorim, A.R., Rojas, The cattle industry is one of the highlights of Brazilian M.A., Santos, N. agribusiness on the world stage. One important factor

219 Veterinary Virology: VV which negatively interferes on the country’s cattle is the phylogenetic analysis. Nucleotide (nt) analysis showed infectious vesicular diseases. There is a large clinical that all strains belonged to the genotype G6P[5]. In the similarity among these diseases, which is a constant phylogenetic analysis of VP7 gene the Uberaba wild type concern for both the international meat products samples clustered with reference strains of G6 lineage trade and public health. Among the viruses that cause IV (UK, NCDV-Lincoln, WC3), but they formed a different vesicular diseases are the Bovine herpesvirus 1 (BoHV- sub-cluster with high support. The percentage of nt and 1) and Bovine herpesvirus 2 (BoHV-2), Vesicular amino acid (aa) similarity with these prototype strains stomatitis virus (VSV) and Bovine viral diarrhea virus (BVDV). Despite the large economic impact they cause, to G6 lineage IV, varied between 90.0 to 95.3% and 94.1 an epidemiological study of these viruses has not been andto 97.9%, others respectively. field samples Uberaba of different P[5] countries genotype that samples belong done in Brazil. The aim of this study was to analyze grouped with another Brazilian sample but formed a the molecular epidemiology of these viruses in the distinct cluster of P[5] prototype strains (CP-1, UK, WC3, southeast, northeast and midwest of Brazil. For this B641, VMRI and 61A) in phylogenetic tree of VP4 gene purpose a total of 130 bovine sera and crusts samples and nt and aa similarity varied from 87.9 to 93.5% and collected from the states of Espírito Santo, Bahia and 94.1 to 97.7%, respectively. This study provides valuable Goiás were tested. A total of 30 samples were analyzed information for understanding the evolution of BoRV-A for BVDV with a prevalence of 27%. For VSV, 6% were strains in Brazil and demonstrated that Brazilian P[5] positive from 66 samples. For BoHV-1 44 samples genotypes are from a different genetic lineage from the were tested, with a prevalence of 33%. All 35 samples others already shown in the world. Financial support: were negative for BoHV-2. Coinfections between VSV Plataforma sequenciamento ILMD-Fiocruz Amazonia, and BVDV were also detected. These studies are still FUNEPU in progress and are important for the epidemiological surveillance of these viruses in Brazilian cattle, thus VV279 - Genetic Analysis Of Caev Env allowing a better understanding of biology, circulation Sequences Demonstrates Limites and control strategies of these viruses. Compartimentalization Between Blood And Milk In Infected Goats. VV261 - Genetic Diversity Of Bovine Tigre, D.M., Brandão, C.F., Torres, J.A., Fernandes, F.M.C., Rotavirus Vp7 And Vp4 Genes In Uberaba Campos, G.S., Sardi, S.I. Region, Brazil Dulgheroff, A.C.B., Figueiredo, E.F., Silva, G.A.V., Gouvea, 1. Universidade Estadual do Sudoeste da Bahia, UESB, V., Naveca, F.G., Domingues, A.L.S. Campus- Jequié, Bahia 2. Universidade Federal da Bahia, UFBA, Campus- 1. Universidade Federal do Triângulo Mineiro, UFTM, Ondina, Salvador, Bahia Av. Frei Paulino, 30. Bairro: Abadia, Uberaba-MG 3. Instituto Federal de Sergipe, IF-SE, Campus- Glória, 2. Instituto Leônidas e Maria Deane - Fiocruz - Sergipe Amazônia, ILMD - Fiocruz 4. Instituto Federal Baiano, IF-Ba, Campus Santa Inês- 3. Universidade Federal do Rio de Janeiro, UFRJ Bahia Caprine arthritis-encephalitis virus (CAEV) is a rates of morbidity and mortality of calves under one Lentivirus, Retroviridae family, responsible of severe Acutemonth infectious of age. Group diarrhea A bovine is associated rotavirus with (BoRV-A) significant are progressive polyarthritis of carpal joints, pneumonia considered one of the main causes of diarrhea in these and mastitis in young and adult goats. The major route of animals worldwide. Viral particle is formed by a triple CAEV transmission is through the milk of infected mother capsid; the outer layer is composed of VP7 and VP4 to their offspring, while horizontal transmission may play an important role in older goats. The monocytes/ macrophages and dendritic-cells are the main target cells proteinsG10 and whichP[5], P[11]are used and for P[1] a dual are classificationthe most commonly system, for CAEV however others cell types, such as endothelial definingfound infecting G and calves P types, around respectively. the world. GenotypesStudies on the G6, cells, mature and immature luminal epithelial cells, molecular epidemiology of rotavirus infected calves in Brazil are scarce, so the aim of this study was to gland are susceptible to CAEV infection. This study aimed investigate the genetic diversity of VP7 and VP4 genes fibroblaststo analyze the and sequences myoepithelial of gene cells env from virus goat of CAEVmammary from from BoRV-A detected in the Uberaba-MG, Brazil, period samples of blood and milk. Blood and milk samples of 2008 to 2009. Five rotavirus samples were selected, three young and naturally infected goats were collected submitted to nucleic acid extraction, VP7 and VP4 gene to obtain the peripheral blood mononuclear cells

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV amplification by RT-PCR, followed by sequencing and XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

220 Veterinary Virology: VV

(PBMC) and somatic cells (SC) from milk. All PBMC and analyzed are native from the same geographic region and SC samples were submitted to extraction of the DNA to therefore, less susceptible to infection with pestivirus. amplify the env gene (fragment of 350bp) by Nested-PCR. Future studies shall be conducted in order to determine The env gene fragments were submitted to nucleotide the genomic sequences of ELISA-positive samples. sequence analysis and the topology of the tree obtained Financial support: CAPES after the analysis of env sequences, showed that most of the isolates form a unique clade well supported with VV293 - Epitope Mapping Of The Envelope CAEV-Cork the reference strain but phylogenetically Protein Of Equine Infectious Anemia Virus different from other brazilian isolates. When comparing By Spot Synthesis Technique the sequences of env gene intra-host in blood and milk Naves, J.H.F.F., Oliveira, F.G., Galinari, G.C.F., Bicalho, from two goats it is observed the similarity between J.M., Oliveira, C.H.S., Rodrigues, A.P.S., Avila Machado, R.A., Olortegui, C.D.C., Leite, R.C., Reis, J.K.P. between the isolates of its blood and milk suggesting Universidade Federal de Uberlândia, UFMG, Escola de that different sites of replication (blood or milk) may the isolates. The third goat showed different profile Veterinária da UFMG Avenida Antônio Carlos 6627 Campus research is needed to study the variation in the env gene UFMG – Pampulha involveand the compartmentalization viruses with specific of characteristics.CAEV species present More Equine Infectious Anemia (EIA) is a persistent lentivirus in the blood or milk of goats naturally infected that can infection of equids which causes a chronic clinical condition with worldwide distribution and importance colostrum or milk. Financial support: FAPESB in veterinary medicine. This study aims to map and influence the transmission from mother to kid through identify the immunodominat sequences of the equine VV284 - Pestivirus In Captive Camelids In A infectious anemia virus (EIAV) env protein through Spot Zoo In Rio Grande Do Sul Synthesis Technique for subsequent peptide synthesis Garcia, A.W.A., Chiappetta, C.M., Campos, F.S., and application in immunoassays for diagnosis of EIA Comerlato, J., Franco, A.C., Roehe, P.M. in horses, donkeys and mules. Based on EIAV env amino Universidade Federal do Rio Grande do Sul, UFRGS, acids sequences database peptides of 15 amino acids ICBS/UFRGS Rua Sarmento Leite, 500. Cep: 90010-170 - covering all env protein region were synthesized on a Porto Alegre - RS membrane of cellulose using the equipment Abimed Spot Synthesis - ASP222, Langenfeld - Germany. The genus Pestivirus of the family Flaviviridae comprises The distribution plane of amino acids, as well as the pathogens of great importance in veterinary medicine. determination of protocols for synthesis of peptides The most relevant pestiviruses are the classical swine on the membranes was set by bioinformatics using the fever virus (CSFV), bovine viral diarrhea virus (BVDV) program Multipeps (Intavis, Germany). The detection of and border disease virus (BDV). Eventually, pestiviruses immunodominant epitopes was performed with pooled have been detected in captive or free living wild animals. sera of horses, donkeys and mules positive for EIA., The The characterization of pestivirus isolates obtained from serum of each specie was also tested separately, following wild animals samples revealed that most belonged to BVDV-1 genotype. The CSFV, BVDV, Giraffe-pestivirus, Alkaline phosphatase conjugated (Sigma). The reactivity BDV-2, BDV-4 and Pronghorn-pestivirus are the species reactionof spots withwas detectedrabbit anti-horse by addition IgG (wholeof substrate molecule) which − contains alkaline phosphatase BCIP (5-bromo-4-chloro- wildlife. The potential of these viruses to spread among 3-indoilfosfato) and MTT 3 -(4,5-dimethylthiazol-2-yl) andpopulation genotypes of wild that and have domestic been identified animals isso a far major amongst issue -2,5 - (difeniltetrazolium bromide) in the presence of in the epidemiology of such viruses. In the present study, MgCl2 1 mol/L. It was selected an immunodominant the prevalence of pestivirus in captive wild animals peptide of 20 amino acid that was highly reactive for from a zoo in Rio Grande do Sul was investigated. Serum the three species tested (horse, donkey and mule). samples were collected from 52 cervids and 24 camelids, The spot synthesis technique allows the mapping and of both genders and at different ages. The presence of viral antigens in the serum samples was analized with protein region that may be useful in development of the aid of an enzyme-linked immunosorbent assay identificationmore accurate ofimmunoassays immunodominant or effective EIAV vaccine envelope for (ELISA; IDEXX® BVDV Ag/Serum Plus Test). None of the EIA . samples from cervids were found to contain pestivirus antigens, whereas 12 out of the 24 camelid samples VV297 - Identification Genetic Lineages (50%) gave rise to resulted positive in the assay. This Of Bat Rabies Viruses In The State Of Rio may be due to the fact that most of the cervid species Grande Do Sul, Southern Brazil

221 Veterinary Virology: VV

Batista, H.B.C.R., Oliveira, R.N., Carnieli-Jr., P., Ferreira, 1. Universidade de São Paulo, USP, Av. Prof. Lineu J.C., Rosa, J.C.A., Castilho, J.G., Fahl, W.O., Sales, E.F., Prestes, 1374 sala 225 Pacheco, S.M., Maletich, D.J., Carrieri, M.L., Kotait, I., 2. Universidade do Vale do Rio do Sinus, UNISINUS, Roehe, P.M. Av. Unisinus, 950 1. Instituto Pasteur, IP, Avenida Paulista 393 2. Instituto de Pesquisas Veterinárias Desidério epidemic and pandemic in humans, and also causes Finamor, IPVDF, Estrada do Conde 6000 Theweakness avian and influenzavirus mortality in (AIV)other hasanimal been species. caused Wild flu 3. Universidade Federal do Rio Grande do Sul , UFRGS, aquatic birds are considered natural reservoir of this Sarmento Leite 500 virus, and migratory birds can play an important role in 4. Instituto Sauver, IS, Avenida Pernambuco the wide spread of AIV. There is 164 species of migratory birds in Brazil, which 77 (46%) of them breed in areas of Rabies virus (RABV), a single stranded RNA virus of the Southern hemisphere and Antarctica. It is estimated negative polarity, is the causative agent of rabies. The that 100 millions of seabirds have been living in the cost virus is maintained in different natural reservoirs of Antarctica and adjacent islands, where they come making the epidemiological scenarios quite variable into contact with migratory birds that nest in these in function of the reservoirs which inhabit a particular islands. Furthermore, the contact between humans and geographical region or niche. In the State of Rio Grande animals have been increased in this continent over the do sul (RS), southern Brazil, rabies transmitted by years, due to research bases and tourism. From 2010 to domestic dogs (the urban cycle) has been controlled for 2012, 291 penguins belonging to two species Chinstrap more than 30 years. Nevertheless, rabies transmitted by penguin Pygoscelis antarcticus (n=121) and Papua haematophagous and non haematofagous bats remains penguin Pygoscelis papua (n=170) were captured using endemic. The aim of this study was to sequence the dip net in Elephant Island, Antarctic region. Orotracheal nucleoprotein (N) gene of RABV isolates recovered from and cloacal sterile swabs were collected from each bird different species of bats indigenous to Rio Grande do Sul and placed in sterile cryotubes containing 500µL of in order to investigate the circulation of genetic lineages. transport media (glycerol 5% in phosphate buffered The isolates were recovered from haematophagous saline with penicillin and fungizone). All samples were (Desmodus rotundus) and insectivorous bats (Tadarida brasiliensis, Myotis nigricans, Histiotus velatus and and stored at freezer -70ºC until processing. Until now, immediatelywe have tested transferred 114 penguins to liquid (57 nitrogen P. antarcticus in the fieldand a morphological dichotomous key. For sequencing, total P. papua) and Real time RT-PCR revealed 4 positive LasiurusRNA was sp).extracted Bat species from werebrain confirmed tissues of withinfected the aidmice, of samples of P. antarcticus from 2010. These samples have with Trizol and submitted to reverse transcription- not been characterized by molecular biology because the polymerase chain reaction (RT-PCR) with primers project is underway. Pygoscelis antarcticus species has a targeting the N gene. The amplicons obtained were circumpolar distrubution, and they can be found in the sequenced and subsequently analyzed with the Bioedit Antarctic and Sub-Antarctic regions sharing the same environment with other seabirds and migratory birds. circulating in RS, each one named after the natural host The direct contact amongst these birds may introduce software.from which Five it has distinct been recovered RABV lineages (Desmodus were rotundus, identified pathogens of economical, public health or conservation Tadarida brasiliensis, Myotis nigricans, Histiotus velatus viruses. The potential impact for introduced diseases to RABV lineages circulate in bats in Rio Grande do Sul; importance,Antarctica has such been as theknown influenza by the and Antarctic Newcastle Treaty, disease but and Lasiurus sp). Therefore, at least five different it remains to be determined whether migratory birds or human activity are able to introduce disease into thehighlight lineages the importance so far identified of maintaining seem to a close have vigilance evolved Antarctic species. While this gives cause for concern, the independentlyon RABV isolates in eachin order of the to hostaccompany species. such These viruses findings in role of any of this virus in disease causation in Antarctic its relations with potential host species. penguins is unknown. Exciting challenges lie ahead in our attempts to understand virus ecology in Antarctica. VV299 - Molecular Detection Of Influenza Financial support: CNPq and FAPESP 2012/14255-8 A Virus By Real Time Pcr In Penguins From Elephant Island, Antarctica VV308 - Detection And Genotyping Of Seixas, M.M.M., Araujo, J., Ometto, T., Hurtado, R., Petry, Rotavirus Associated To Diarrhea In M.V., Durigon, E.L. Neonatal Alpacas (Vicugna Pacos) From The Southern Mountains Of Peru

222 Veterinary Virology: VV

Rojas, M.A., Silva, R.C., Mendes, G.S., Amorim, A.R., monitoring of RVA intragenotypes diversity is critical Manchego, A., Rivera, H., Pezo, D., Santos, N. to understand how it could affect vaccine effectiveness. Financial support: CAPES, CNPq, FAPERJ 1. Universidade Federal do Rio de Janeiro, UFRJ, Av. Carlos Chagas Filho - 373, I Fundão, R Janeiro - RJ, 21.941- VV316 - Novel H1n2 And H3n2 Influenza A 902 Viruses In Swine In Brazil 2. Universidad Nacional Mayor de San Marcos, Schaefer, R., Gava, D., Simon, N.L., Silveira, S., Schiochet, UNMSM, Lima - Peru M.F., Ciacci-Zanella, J.R. 3. Instituto Veterinario de Investigaciones Tropicales y Embrapa Suínos e Aves, Embrapa, BR153, Km 110, de Alt, IVITA, Cuzco - Peru 89700-000, Concórdia/SC, Brazil Rotaviruses (RVs) are members of the Reoviridae Brazil. Previous serological studies have indicated the species A (RVA) are the main etiologic agents of acute Influenza A virus (IAV) infection is endemic in swine in family,gastroenteritis and classified and responsible into eight for species nearly (A-H). 400,000 RV deaths worldwide. The viral genome is enclosed within circulationobserved in ofpigs H1N1, before H3N2 2009. and This H1N2 scenario influenza has changed virus a three-layered particle and consists of 11 segments subtypes, although no signs of influenza infection was dsRNA. The outer capsid proteins VP7 and VP4 carry (pdmH1N1) in pigs in 2009. Since then, outbreaks of mild independent neutralization and protective antigens. afterto moderate the onset respiratory of pandemic disease H1N1 have been influenza frequently virus A binary system is used to classify RVA into P and G 1875 nasal swabs and 86 lung tissue samples collected encoding genes, respectively. Thus far, 37 P genotypes observedfrom pigs infrom growing-finishing 2009 to 2012. Fifty pigs. IAVs We havewere analyzed isolated genotypes based on the specificity of the VP4 and VP7- in SPF chicken eggs or in MDCK cells and 25 IAVs were genotypes, P[8] accounts for 73.8% of global prevalence submitted to DNA sequencing. So far, the analysis of the and,of human 27 G genotypes RVA infections have been and identified.hence its Amongimportance the VP4 as HA, NA and M gene segments showed a high identity an effective vaccine candidate. VP4 is a trimeric protein and clustered with gene sequences from the pdmH1N1. involved in cell attachment and membrane penetration. High-level infectivity requires that VP4 be cleaved by trypsin into two fragments, designated VP8* and VP5*. One H1N2 influenza virus isolated in early 2011 was Five important epitopes have been mapped on the VP8* groupedisolated from with pigs samples during of 2011 influenza and analized viruses by of subtype- human peptide: M1L10 (aa 1-10), I35R44 (aa 35-44), I55D66 origin (δ cluster). Seventeen other influenza viruses, (aa 55-66), V115G123 (aa 115-123) and L223P234 (aa 223-234). A major challenge in immunization is the specific RT-PCR were identified as being of subtypes vast inter- and intragenotypic diversity accomplished H1N2 and H3N2. We have detected eight H1N2 influenza by RVA. Two currently available RVA vaccines includes viruses and one H3N2 influenza virus, isolated for the P[8] as an antigenic component. Therefore, it is possible first time in pigs in Brazil. Eight virus isolates had or that genetic mutations and antigenic variations on the HAhave or the NA matrix not subtyped (M) gene by derivedRT-PCR (threefrom the H1N* pdmH1N1, and five H*N2).indicating Furthermore, that a reassortment these novel event influenza between virus endemic isolates RVA vaccines. The polymorphism of RVA-P[8] strains VP4circulating gene of in P[8] Rio strains de Janeiro will influence between the 1996 efficacy and of2004 the in Brazil. More information about the gene segments was evaluated. The partial VP4 encoding gene of 20 influenza viruses and the pdmH1N1 has occurred in pigs P[8] strains was sequenced and compared to reference be available with the whole genome sequencing that is strains. The deduced amino acid sequences were used as compositionin progress at of Embrapa the novel Swine swine and influenza Poultry. virusesThe results will basis for in silico analysis of the VP4 protein. We observed the circulation of three major P[8] lineages during the viruses circulating in pigs are in constant evolution studied period. Comparison between the VP8* trimeric generatedleading to theso faremergence allow us of to new conclude virus subtypes.that influenza So, the A structures of a RVA reference strain (Wa) and Brazilian monitoring of pigs is very important to detect changes in P[8] strains showed mutations at amino acid residues located at the epitopes I55D66 (aa 64) and V115G123 (Process nº. 02.11.10600-01) (aa 120-121). Although the RVA vaccine program has influenza viruses over time. Financial support: Embrapa clearly been successful in Brazil, these results suggest VV324 - Rt-Pcr Identification Of Infectious the possibility of the emergence of P[8] strains that could Myonecrosis Virus (Imnv) In Farmed Shrimp evade the immune response elicited by a RVA vaccine and In The State Of Santa Catarina cause a vaccine breakthrough. Consequently, continuous

223 Veterinary Virology: VV

Espíndola, J.C., Lenoch, R., Claus, M.P., Dezen, S., Alfieri, from Nova Iguaçu. Sample from Duque de Caxias were A.F., Alfieri, A.A. negative for all tested viruses. One sample presented mixed infection by RVA and RVC. RVB was not detected 1. Instituto Federal Catarinense, IFC, BR280, Km 27, in the study. Sequences of two RVC-positive samples bairro Colégio Agrícola showed >90% similarity with reference strains of RVC. 2. Universidade Estadual de Londrina, UEL, Rodovia For KoV was observed a positivity of 5.3% (16/300); Celso Garcia Cid, Pr 445 Km 380 10 (63%) of the positive samples were from Santos Dumont KoV and 6 (37%) were from Nova Iguaçu. No co- Among the infectious diseases of farmed shrimp in infection of RV to KoV was observed. Sequence analysis northeastern Brazil, infectious myonecrosis has had the of the 3D protein of a KoV positive sample suggests that greatest economic impact on Brazilian shrimp farming this virus have a high similarity with the Aichi virus, the since 2003. The objective of this study was to identify prototype of the human KoV. The results obtained in this infectious myonecrosis virus (IMNV) in samples of study demonstrate the circulation of these pathogens marine shrimp (Litopenaeus vannamei) farmed on the among asymptomatic animals. Such animals could Santa Catarina coast using RT-PCR, sequencing, and become a source of contamination in the environment, histopathological techniques. A nested RT-PCR assay resulting in the transmission of the virus to the heard using a commercial kit (IQ2000, Farming IntelliGene causing diarrhea and consequent economic losses. It also could transmit the virus to swine workers leading bp and 255 bp products from IMNV in 10% (1/10) of the interspecies infection and allowing the emergence the adult shrimp samples and in 21.2% (14/66) of the Technology Corporation, TaiwanTM) amplified 510 of new viral variants. Financial support: FAPERJ, CAPES, post-larvae samples evaluated. Nucleotide sequence CNPq. product, which exhibited 99% similarity to IMNV. In a VV333 - Detection And Quantification Of analysishistopathological demonstrated examination, the specificity lesions ofcompatible the amplified with Adenovirus Species In Water Runoff And Swine Manure Wastewater Soliman, M.C., Staggemeier, R., Fabres, R.B., Luz, R.B., De those caused by IMNV infection were identified, revealing Souza, G., Jesus, L.F., Kluge, M., Sá, M.F., Aita, C., Rigotto, the necrosis of muscle fiber groups and the infiltration C., Spilki, F.R. ofthe polymorphonuclear State of Santa Catarina. cells. For the first time, we have identified IMNV infection in farmed marine shrimp in 1. Universidade Feevale, FEEVALE, ERS 239, 2755 VV332 - Detection Of Rotavirus And Novo Hamburgo - RS, 93352-000 Kobuvirus Among Asymptomatic Piglets 2. Universidade Federal de Santa Maria, UFSM, Av. Rezende, D.J., Mendes, G.S., Amorim, A.R., Reis, F.C., Roraima, 1000 - Camobi Santa Maria - RS, 97105-900 Lima, D.P., Santos, N. The swine population in Brazil is estimated at about 335 Universidade Federal do Rio de Janeiro, UFRJ, Cidade million, making the country the fourth largest producer Universitária - Ilha do Fundão - CCS - RJ and exporter (600,00 tons/year) in the world. Swine Everywhere pigs are farmed intensively, rotaviruses production in Brazil is concentrated in the southern part of the country. Consequently, swine facility water usage diarrhea in the suckling and weaning periods. Kobuvírus (RV)(KoV) are has identified been associated as a major with infectious infection agentsin pig farms causing in disposal of manure directly onto the soil without previous several parts of the world. This study aimed to contribute andtreatment manure is notproduction recommended, has increased mainly significantly.due to the height The to the monitoring of RV and KoV circulating among pigs presence of microorganisms and pollutions. Enteric slaughtered in abattoirs in the cities of Santos Dumont- MG and Duque de Caxias-RJ, and a warehouse in Nova present in swine manure. They can be excreted in high Iguaçu-RJ. Three hundred fecal samples were collected virusesconcentration are a significantin animals partfeces. of Adenoviridae the microorganisms family from healthy piglets between 5 and 6 months of age. The comprehend a widely diverse population of virus samples were subjected real-time and conventional RT- that infect various species, including humans, swine, PCR for detection of KoV and RV, respectively. Of the 300 and cattle. The aim of this study was to evaluate, after samples analyzed 41 (13.6%) were positive for at least precipitation, the presence of different AdV species ( canine, CAV; aviary, EDS; veal, BAV; human, HAdV and were positive for rotavirus of which 5% were positive for porcine AdV) in water runoff and soil leachate after oneRVA and of the 3% viruses to RVC; tested.72%; (18/25) Twenty-five of these samples samples (8.3%) were from the city of Santos Dumont-MG and 28% (7/25) were fertilizer, between the months of December, January and addingFebruary manure 2012. Experimentalinjected liquid soil swine destinated and superficial for planting as September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

224 Veterinary Virology: VV corn at a University Facility was used for the application gene; respectively. As for wild bird samples, three out of of swine manure as fertilizer, control without the addition 211 tested samples were detected by using the RRT-PCR. of manure was also performed. After each rainfall was These samples have different wild bird origins: pigeon, collected through lysimeters of leachate and surface Peregrine Falcon, Southern Caracara. The sample from water through gutters collecting. Fifty two samples Southern Caracara was positive by class I and II tests; were submitted to DNA extraction though a commercial while the other two samples were positive only by class kit and the quantitative PCR was performed (qPCR). II test. Moreover, our preliminary results shows the The oligonucleotides designed enable the detection of highest APMV-1 detection rates in oropharyngeal swabs different species of AdV, including human and animal. when compared to cloacal swabs. The DNA sequencing Out of 52 samples, 16 were positive for CAV (30.7%); of these viruses will be done to perform phylogenetic 16 for BAV (30.7%); 10 for HAdV (19.2%); 19 for EDS (36.5%), and 19 for porcine AdV (36.5%). These results Therefore, we expect to increase the knowledge about indicate contamination by different species of AdV in soil analysisthe epidemiology for identification of AMPV-1 in ofBrazil. APMV-1 Financial genotypes. support: that may have swine manure as the source, advocating FAPESP (number: 2011/09019-0). the need for monitoring and disposal methods virologic, thus allowing the proper use of manure for agronomic VV341 - Isolation And Molecular reasons. Characterization Of Bohv-5 In Vaginal Secretion Of Bovines From The State Of VV338 - Detection Of Avian Paramyxovirus Goiás, Brazil Type 1 In Wild Birds By A Multiplex Real Silva, A.M., Dias, R.C., Wong, L., Silva, D.A., Castro, M.C., Time Rt-Pcr Spilki, F.R., Roehe, P.M., Brito, W.M.E.D. Scagion, G.P., Cantergi, D.C.M., Caserta, L., Carval, R.D., Felippe, P.A.N., Martini, M.C., Santos, M.M.A.B., Arns, 1. Faculdades Integradas UPIS , UPIS , SEP Sul E.Q. C.W., Ferreira, H.L. 712/912 - Conjunto A - 70390-125 2. Universidade Federal de Goiás, UFG, Campus II - 1. Departamento de Medicina Veterinária- FZEA- Samambaia, Cx. Postal 131, CEP.: 74001-970 - Goiânia, GO, USP, FZEA- USP, Av Duque de Caxias, 225- Pirassununga, SP BRAZIL 2. Departamento de Genética, Evolução e Bioagentes- 3. Universidade Feevale, FEEVALE, Estrada RS-239 n IB- UNICAMP, IB- UNICAMP, Rua Bertrand Russel, s/n, 2755, Vila Nova, 93352-000 - Novo Hamburgo, RS - Brasil Caixa Postal 6109- Campinas, SP 4. Universidade Federal do Rio Grande do Sul, UFRGS, 3. Depto de parasitologia, microbiologia e imunologia- Av. Sarmento Leite, 500 - Centro - 90050-170 - Porto Alegre, ICB- UFJF, ICB- UFJF, Rua José Lourenço Kelmer, s/n - Juiz RS - Brasil de Fora, MG 4. Instituto de Ciências da Saúde- UNIP, ICS- UNIP, The bovine herpesvirus types 1 and 5 are important Campinas- SP pathogens of cattle which are associated with high economic losses. Serological data attest the presence The avian paramyxovirus type 1 (APMV-1) belongs to of infection by these agents in Goiás, however there family Paramyxoviridae, subfamily Paramyxovirinae, are no data characterization in different clinical genus Avulavirus. Wild birds seem to be an important specimens. This study aimed to identify and characterize reservoir of these viruses. Recently, analysis of the herpesvirus in bovines from the state of Goiás. Thus, genome sizes and sequences of genes has revealed 343 samples were analyzed, among which 123 vaginal two distinct clades within APMV-1: class I and II. A secretion, 117 nasal secretion and 103 semen samples. recent study point the RT-PCR validated targeting the The samples were submitted to DNA extraction with matrix (M) gene failed to detected almost 73% of class phenol and analyzed by nested PCR to amplify the I viruses. The present study aims to identify the APMV- carboxyterminal region of the glycoprotein C gene of 1 in wild birds by using a real time RT-PCR (RRT-PCR) BoHV. It was demonstrated high occurrence of BoHV for simultaneous molecular detection of class I and class the state of Goiás, with positivity in 54.7% of nasal II viruses targeting the polymerase (L) gene and the M secretion samples, 56.9% of vaginal secretions and 52.4% of semen samples. BoHV-1 was detected in 18.4% and FAM. To do so, this test was initially evaluated by of the samples and BoHV-5 in 24.8%. Both virus types gene,using respectively,reference strains. based Afterwards, on 2 fluorescence 211 samples probes: (106 VIC were detected in 12.0% of the samples, indicating the oropharyngeal and 105 cloacal swabs) from wild birds occurrence of concomitant infection. In nasal secretions were tested. The sensitivity of RRT-PCR was 83.9ng/mL it was found a higher percentage of BoHV-5 (33.3%), and 0.766ng/mL using a plasmid containing the L and M

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinarybut Virology: in the VV semen there was no significant difference XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

225 Veterinary Virology: VV between the two viral types. In vaginal secretions it was observed 24.4% of samples positive for BoHV-1 andmucosa 26.0%. is not The considered identification a site of BoHV-5 of replication in this clinicalof this specimenvirus. We conclude is an important that bovine finding, herpesvirus because thetype vaginal 1 and andmucosa 26.0%. is not The considered identification a site of BoHV-5 of replication in this clinicalof this 5 are circulating widely in the state of Goiás in bovines, specimenvirus. We conclude is an important that bovine finding, herpesvirus because thetype vaginal 1 and with special attention to the occurrence of type 5 in cow 5 are circulating widely in the state of Goiás in bovines, genital infections. The concomitant infection detected in with special attention to the occurrence of type 5 in cow the tested samples alert to the need for adequate control genital infections. The concomitant infection detected in programs, since infection with a type does not guarantee the tested samples alert to the need for adequate control adequate protection against infection with another. programs, since infection with a type does not guarantee adequate protection against infection with another. VV346 - Migratory Birds And West Nile Virus In Brazil VV345 - Herpesvirus Types 1 And 5 Ometto, T., De Araujo, J., De Azevedo, S.M.J., Neto, Identification In Vaginal Secretions, I.S., Serafini, P., Hurtado, R.F., Rodrigues, R., De Seixas, Nasal And Semen Of Bovines From The State M.M.M., Durigon, E.L. Of Goiás, Brazil Silva, A.M., Dias, R.C., Wong, L., Silva, D.A., Castro, M.C., 1. Instituto de Ciências Biomédicas - Universidade de Roehe, P.M., Brito, W.M.E.D. São Paulo, ICB II - USP, Av. Prof. Lineu Prestes, 1374 - São Paulo - SP 1. Faculdades Integradas UPIS, UPIS, SEP Sul E.Q, 2. Universidade Federal Rural de Pernambuco , UFRPE, 712/912 - Conjunto A - 70390-125 - Brasília, DF, Brasil Rua Dom Manoel de Medeiros, s/nº Dois Irmãos – Recife – PE 2. Universidade Federal de Goiás, UFG, Campus II 3. Centro Nacional de Pesquisa e Conservação de Aves - Samambaia, Cx. Postal 131, CEP.: 74001-970 - Goiânia - Silvestres, CEMAVE, BR 230 - KM 10 Floresta Nacional da Goiás -Brasil Restinga de Cabedelo - PB 3. Universidade Federal do Rio Grande do Sul, UFRGS, Av. Sarmento Leite, 500 - Centro - 90050-170 - Porto Alegre, The West Nile Virus (WNV) became known in 1937 in RS, Brasil Uganda, Africa, and appeared in the American continent only in 1999. Since then, evidence of circulation was 4. Universidade Feevale, Feevale, Estrada RS-239 n obtained in a growing number of countries in North 2755, Vila Nova, 93352-000 - Novo Hamburgo, RS - Brasil America, Central and recently in the Brazilian Pantanal. The bovine herpesvirus types 1 and 5 are important From this moment, the interest in the investigation of pathogens of cattle which are associated with high this agent has increased. Therefore, this study focuses economic losses. Serological data attest the presence on the comparison of the serological and molecular of infection by these agents in Goiás, however there results by ELISA and One-Step Real-Time RT-PCR for the are no data characterization in different clinical presence or absence of the WNV antibodies and virus in specimens. This study aimed to identify and characterize samples of the two main stop-overs wintering points for herpesvirus in bovines from the state of Goiás. Thus, migratory birds in Brazil. During the period of November 343 samples were analyzed, among which 123 vaginal 2008 to November 2010, we conducted a surveillance of secretion, 117 nasal secretion and 103 semen samples. biological samples from wild migratory birds, collecting The samples were submitted to DNA extraction with 1092 samples on the Canela’s Island, State of Pará. phenol and analyzed by nested PCR to amplify the During the period of November 2009 to November carboxyterminal region of the glycoprotein C gene of 2011, we conducted a surveillance of biological samples BoHV. It was demonstrated high occurrence of BoHV from wild migratory birds, collecting 483 samples in the the state of Goiás, with positivity in 54.7% of nasal Lagoa do Peixe National Park (PNLP), in the state of Rio secretion samples, 56.9% of vaginal secretions and Grande do Sul. This national park is today recognized as 52.4% of semen samples. BoHV-1 was detected in 18.4% the largest migration point of birds in Brazil, because of of the samples and BoHV-5 in 24.8%. Both virus types the quantity and diversity of animals found in the area. were detected in 12.0% of the samples, indicating the Both sites were monitored and sampled twice a year, occurrence of concomitant infection. In nasal secretions always on the arrival of migratory birds in the country it was found a higher percentage of BoHV-5 (33.3%), and when these same birds are going back to North America. We detected one Arenaria interpres in the between the two viral types. In vaginal secretions it Canela’s Island and three Sterna hirundo in the PNLP butwas inobserved the semen 24.4% there of wassamples no significantpositive for difference BoHV-1 with positive results by ELISA to the presence of WNV

226 Veterinary Virology: VV antibodies and all samples tested by real-time RT-PCR VV356 - Verification Of Diagnostic were negative to the presence of the WNV. These results Method For Vesicular Stomatitis By Virus show that probably the migratory birds from North Neutralization Technique America had contact with WNV outside of Brazil, but are Oliveira, T.F.P., Thomaz, M.M., Oliveira, A.M., Camargos, not coming to the South America carrying the virus on M.F. this migratory route. Financial support: FAPESP Laboratório Nacional Agropecuário de Minas Gerais, VV355 - Phylogenetic Analysis Of Bovine LANAGRO-MG, Avenida Rômulo Joviano, s/n. Centro. CEP Virus Diarrhea Virus (Bvdv) Isolates In 33600-000 – Pedro Leopoldo, MG Cell Cultures And Fetal Bovine Serum Oliveira, T.F.P., Freitas, M.E., Camargos, M.F., Oliveira, The aim of this study was verify the virus neutralization A.M., Lima, N.F., Cottorello, A.C., Heinemann, M.B., technique employed in the diagnosis of vesicular Fonseca Júnior, A.A. stomatitis (VSV) used in the National Agricultural Laboratory of Minas Gerais, laboratory belonging 1. Laboratório Nacional Agropecuário de Minas Gerais, to the network of laboratories of the Ministry of LANAGRO-MG, Avenida Rômulo Joviano, s/n. Centro. CEP Agriculture, Livestock and Supply. We evaluated the 33600-000 – Pedro Leopoldo, MG 2. Escola de Veterinária da UFMG, EV-UFMG, Av. testing, calculation of repeatability and calculation Antônio Carlos 6627, Campus da UFMG CEP 30123-970, followingof measurement parameters: uncertainty. participation In the participation in proficiency in Belo Horizonte, MG reference laboratory for VSV of World Organization Bovine virus diarrhea virus (BVDV) belongs to the proficiencyfor Animal testing,Health (OIE),20 samples National were Veterinary received fromServices the genus Pestivirus, family Flaviviridae and can acutely Laboratory (NVSL, Ames, EUA) to be evaluated with or persistently infect bovine cells or other cell lines serotypes New Jersey (NJ) and 1 Indiana (IND 1). The exposed to raw materials of animal origin such as fetal samples were evaluated with virus strains originating bovine serum. Cell contamination caused by BVDV is from the Pan American Center for Foot and Mouth Disease (PANAFTOSA-PAHO/WHO) and NVSL using This can cause small changes in cell growth rate and also two protocols described in the Manual of Diagnostic difficultinterfere to in be the detected growth orof mayother go viruses, unnoticed but consideringindefinitely. Tests and Vaccines for Terrestrial Animals of the OIE. We that the virus is non-cytopathic, macro and microscopic selected two positive sera (low titer and loud title) for changes will not be detected. The aim of this study was each of the serotypes (NJ, IND 1 and IND 2 IND 3) for to sequence and phylogenetically analyze BVDV detected in cell cultures and fetal bovine serum. Partial sequences Sera were titrated with six replicates per serum, on three of 5 ‘UTR region of 12 samples of BVDV isolated from calculationdifferent days, of the totaling coefficient 18 replicates of variation per (repeatability). sample. The cell cultures of different species, 2 BVDV detected in calculation of measurement uncertainty for each of the fetal bovine serum and 16 reference BVDV strains were serotypes was performed from seven samples assayed in obtained from automated sequencing with the Sanger duplicate and on two different days, based on the results method on equipment ABI3130. The electropherograms of control sera used in the tests and on the results of were analyzed and contigs assembled in the program Bioedit then subjected to phylogenetic analysis in MEGA testing were satisfactory, independent of protocol and 5.0 program along with pestivirus references sequences thestrain samples. used. However,The results the of antibody participation titers in were proficiency higher available in GenBank. The phylogenetic trees were when using the protocol with 10e2±0,5 TCID50/100 µL reconstructed using the models Tamura 3 parameters and Neighbor Joining method with 1000 bootstrap of variation CV of the samples showed CV less than 10%, replications. The results showed different types of ofwhich virus. is Mostconsidered of the indicativeresults of calculatingof a good operation the coefficient of the pestiviruses contaminating cell cultures. Bootstrap method. The uncertainty values for samples tested were lower (around 0.2) for all serotypes than the uncertainty discrimination of these samples. The BVDV-1 was found values of the controls (about 0.4), which can be caused valuesin most above cells, 90% but indicate were also the confidencerecorded contamination in the genetic by variation in the number doses of virus in the different examples for BVDV-2 , BVDV3 and a virus similar to days of data were obtained. Based on these results, CSFV in swine cells. The results demonstrate that we propose the use of virus neutralization with 10e2 cellular contamination is not from the same origin. The ± 0.5 TCID50/100 µL of virus strains originating from sources of contamination are varied because as bovine PANAFTOSA-PAHO/WHO or NVSL. The method showed or porcine raw materials were used in the preparations adequate repeatability values. of cell cultures over the years. September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

227 Veterinary Virology: VV

VV358 - Determination Of Measurement 1. Instituto de Ciências da Saúde- UNIP, ICS- UNIP, Uncertainty Of Cfl Elisa For Foot-And- Campinas- SP Mouth Disease 2. Departamento de Genética,Evolução e Bioagentes- Oliveira, T.F.P., Azevedo, I.C., Oliveira, A.M., Camargos, IB- UNICAMP, IB- UNICAMP, Rua Bertrand Russel, s/n- M.F. Caixa Postal 6109- Campinas, SP Laboratório Nacional Agropecuário de Minas Gerais, 3. Departamento de Medicina Veterinária- FZEA - LANAGRO-MG, Avenida Rômulo Joviano, s/n. Centro. CEP USP, FZEA- USP, Av Duque de Caxias Norte, 225, Campinas- 33600-000 – Pedro Leopoldo, MG SP CEP:13635-900 4. Depto de parasitologia, microbiologia e imunologia- The liquid-phase competition ELISA (CFL) is used for titration of structural antibodies to foot-and-mouth ICB-UFJF, ICB- UFJF, Rua José Lourenço Kelmer, s/n- Juiz de disease virus (FMDV) to evaluate the potency of vaccines Fora, MG- CEP: 36036-900 Newcastle disease virus (NDV), also known as avian uncertainty is a parameter associated with the result paramyxovirus serotype 1 (APMV-1), is a major economic orof ato measurement, assess efficiency that of characterizesvaccination field. the Measurementdispersion of concern for poultry producer world worldwide. This the values that could reasonably be attributed to the measurand. The expanded uncertainty of measurement Paramyxoviridae, subfamily Paramyxovirinae, genus is stated as the standard uncertainty of measurement virusAvulavirus. is classified Genetic intoanalysis order of Mononegavirales,globally isolated viruses family multiplied by the coverage factor k = 2, which for a normal has revealed the existence of two main clades, namely distribution corresponds to a coverage probability of approximately 95 %. Currently, the determination of II viruses belonging to genotype I and II. The present the measurement uncertainty of analytical methods classesstudy aims I and to II. characterize In Brazil, several the APMV- studies 1 identified detected classby a have been requested to laboratories wishing to be multiplex real time RT-PCR (RTT-PCR) targeting class I accredited by INMETRO. This accreditation gives greater credibility of the analyzes performed in Brazil before the positive samples were tested using a conventional RT- international authorities that assess the country’s export and II viruses by direct genetic sequence. To do so, five processes food, because the INMETRO is a internationally The cleavage site in the fusion protein from two out recognized accrediting body. The aim of this study PCR targeting the fusion (F) gene after RNA purification. was to determine the measurement uncertainty of the pathogenicity of the strain. The fusion gene from one CFL ELISA assay for serotypes O, A and C of the FMDV. of five positive samples was amplified to predict the The calculation of the uncertainty of measurement sequenced; the sequencing of the other sample is in was performed as recommended by the European co- positiveprogress. sampleThe virulence of pigeon of originthis pigeon was amplified sample was and operation for Accreditation (EA-4/02, 1999) from the results obtained from seven sera titrated in duplicate on the F protein, only one basic amino acid at residue 116 two different days (repeatability) and by two analysts classifiedplus a leucine in lentogenic at residue based 117 andon amino a basic acid amino sequence acid (R) of (reproducibility). The CFL ELISA for serotype A had the at residue 113: 113R-Q-G-R-L117. Phylogenetic analysis expanded measurement uncertainty (95.45 %) of 0.359, k = 2.0043. The CFL ELISA for serotype O presented the from class II viruses of APMV-1. Further studies will be uncertainty of 0.383, k = 2.0047 and for serotype C, the revealeddone to sequence that this the virus cleavage was classified site of class into I viruses genotype as the II uncertainty was 0.402, k = 2.0090. The control sera, the kit and the samples used each representing for an we expect to increase the knowledge about the genetic approximate 30 % uncertainty in the value of ELISAS for currentdiversity test of AMPV-1seems to in failed Brazil to Financialamplified support:them. Therefore, FAPESP the three serotypes. The results indicate the uncertainty (number: 2011/09019-0). of the method, which meets the quality assurance testing, and can be a parameter to be followed by laboratories VV384 - Use Of Transgenic Mice Expressing that use CFL ELISA for FMDV. Human Slam (Hslam) To Study Peste Des Petits Ruminants Pathogenesis VV362 - Molecular Characterization Of A Comerlato, J., Minet, C., Kwiatek, O., Libeau, G., Horvat, Brazilian Avian Paramyxovirus Type 1 Of B., Albina, E., Almeida, R.S. Pigeon Origin Scagion, G.P., Alencar, A.L.F., Caserta, L.C., Durães- 1. CIRAD Baillarguet, CIRAD Baillarguet, CIRAD, Carvalho, R. Martini, M.C., Santos, M.M.B., Felippe, UMR CMAEE, F-34398 Montpellier, France P.A.N., Cantergi, D.C.M., Arns, C.W., Ferreira, H.L. 2. CIRAD Guadeloupe, CIRAD Guadeloupe, CIRAD, UMR CMAEE, F-97170 Petit-Bourg, Guadeloupe, France September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

228 Veterinary Virology: VV

3. Institut National de la Recherche Agronomique, Universidade Estadual de Londrina, UEL, Rod. Celso INRA, INRA, UMR1309 CMAEE, F-34398 Montpellier, Garcia Cid PR445, Km380. CEP:86057-970 France Rotavirus (RV), a member of the family Reoviridae, is 4. Institut National de la Santé et de la Recherche the most common cause of severe viral gastroenteritis Médicale, INSERM U758, ENS de Lyon, 46 Allée d Italie 69364 Lyon CEDEX 07 seven groups, A-G, based on the antigenicity and genetic 5. Universidade Federal do Rio Grande do Sul, UFRGS, in humans and animals. RVs have been classified into Rua Sarmento Leite, 500 Porto Alegre – RS 90050-170, Brasil characteristicsgel for the 11 RNA of VP6.segments. Each groupRecently, displays it was aproposed specific Transgenic mice expressing the human protein SLAM profilethe creation of electrophoretic of a new RV group migration H (RVH), in polyacrylamide based on VP6 (signaling lymphocytic activation molecule) (hSLAM), analysis that includes the porcine strain SKA-1 isolated were previously developed by Sellin and colleagues in from Japan. In this present study, we determined the 2006 to conduct studies with the measles virus (MV). VP6 nucleotide sequence for three positive RV diarrheic This transgenic mouse model was used to analyze samples from piglets with 12-35 days of age from the MV-induced pathology and test novel preventive and same farm in Mato Grosso do Sul, Brazil. These samples therapeutic approaches against measles. Peste de petits showed similar group B RNA pattern on PAGE and ruminants virus (PPRV) belongs to the Morbillivirus were selected for molecular analysis. The RT-PCR were genus like MV and is responsible for a disease affecting carried out using two primer pairs designed based on sheep and goats. To date there is no small animal the complete sequence of the VP6 gene of the porcine RV model available for experimental infection with PPRV. strain SKA-1 that amplify products of 590bp and 716bp. Although differ among host species, SLAM is the The sequence analysis showed that the three samples principal receptor for morbilliviruses infection and BR59, BR60, and BR63, shared 100% of identity between themselves and amino acid identity ranging between human and ruminant SLAMs. Therefore, the goal of this 75.4% (human strain) and 96.9% (porcine strain) when astudy significant was to aminotest transgenic acids identity mice existsexpressing between hSLAM the compared with group H RV and are thus considered to for potential infection with PPRV. Fifteen hSLAM-mice belong to the novel group H RV. The phylogenetic tree were divided in three groups, two infected groups and inferred from the VP6 sequences could be subdivided one negative control group. For each infected group, into two major clusters, one containing RVA and RVC and different challenge routes and doses were employed: the other containing RVB and RVH. The samples grouped 1.2 x 104 DICC50 by intranasal route and 105.6 DICC50 closest to the cluster containing the novel RVH strains, by intraperitoneal route. Mice were submitted to serum independent of group A, B, and C RV, but were segregated collections 2, 4, 6, 8, 10, 14, 17 and 20 days post-infection into a new branch. Prior to this study only one porcine (dpi). Clinical signs of disease and weight of mice were RVH strain, the SKA-1 strain detected in Japan, had been assessed on the sampling days. Determination of PPRV- reported. Although the sequence analysis was performed using representative VP6 sequences from group A, B, C, the commercial serological test IDVET PPRV kit. Among specificall sera analyzed,antibodies only by threecompetitive of them ELISA collected was atmade 20 dpi by BR59, BR60, and BR63 suggested that these viruses had antibodies for PPRV and a fourth one was doubtful. andare alsoH RV, distinct the RNA from electrophoretic other RV groups profiles (D-G). for Financial samples All those samples belong to the group infected by the Support: FINEP, CAPES, CNPq, and Fundação Araucária/ intraperitoneal route. Loss of weight and clinical signs PR. susceptibility of hSLAM-mice to PPRV infection. Absence VV396 - Pb1 Segment In Swine Influenza A wereof intracellular never observed. factors, Thesenecessary findings to viral show infection, a poor Virus Subtype H1n2 Contributes To Viral and/or molecular differences among the human and Pathogenesis In Mice ruminants SLAMs receptors could be the responsible Metreveli, G. by this poor susceptibility. However, it needs to be more investigated. 1. Department of Biomedical Sciences and Veterinary Public Heal, SLU, P.O.Box 7084, 750 07 Uppsala, Sweden VV393 - First Detection Of Porcine Group H 2. Department of Microbiology, Icahn School of Rotavirus Outside The Asian Continent Medicine at Moun Molinari, B.L.D., Otonel, R.A.A., Lorenzetti, E., Possatti, F., Leme, R.A., Freitas, L.F., Balbo, L.C., Rodrigues, W.B., Current data indicate that swine is the key species in Alfieri, A.F., Alfieri, A.A. pandemics are postulated to have evolved in swine the event of novel human influenza pandemics. Previous September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

229 Veterinary Virology: VV from a mix of viral genes derived from viruses in birds, produce virokynes as a viral escape, being the gG a humans and swine. The new PB1 gene segments have binder of chemokines of the types CXCR and CCR both as soluble or as membrane-anchored. Interestingly, it was as well as into swine viruses circulating since 1998. Here beenwe investigate introduced the into function human pandemicof the PB1 influenza gene segment viruses reactivity. We hypothesize that the rabbits used in the provenexperiments that this could recognition have been has previously an inter-specific infected cross- with herpesvirus, what would explain the recognition of Rec- withinA/swine/Sweden/1021/2009(H1N2) the context of swine influenza subtype (sw 1021) H1N2. and We A/ gG. New assays will be conduct using others chimerical focusedswine/Sweden/9706/2010(H1N2) on two H1N2 subtype swine (sw influenza 9706), viruses: where constructions from different viruses to support this the sw 1021 has shown to be more pathogenic in mice. hypothesis. By using reverse genetics, we swapped the PB1 gene between the two viruses and our results showed that VV426 - Standardization And Application the chimeric sw 1021 virus carrying the PB1 gene from Of Indirect Elisa Using Recombinant the sw 9706 virus was attenuated in mice, while the Nucleocapsid Protein Of Feline sw 9706 virus with a PB1 gene from sw 1021 became Coronavirus (Fcov) For Antibodies more pathogenic. Our study demonstrates that the PB1 Detection In Sera From Naturally Infected Cats contributes to viral virulence. Finnancial support: SLU Almeid, A.C.S., Tozato, C.C., Hora, A.S., Brandão, P.E., gene segment in swine influenza virus subtype H1N2 Araújo Jr., J.P. VV404 - Diagnostic Tools Supporting The Evaluation Of Experimental Vaccines. 1. Universidade De São Paulo, Usp, Cidade Leocádio, V.A.T., Barbosa, A.A.S., Souza, J.G., Laguardia- Universitária, Cep: 05508-900 Nascimento, M., Da Fonseca, F.G., Barbosa-Stancioli, E.F. 2. Universidade Estadual Paulista Julio De Mesquita Filho, Unesp - Botucatu, Distrito De Rubião Junior, S/N Universidade Federal de Minas Gerais, UFMG, Av. Antônio Carlos, 6627, Pampulha Belo Horizonte - MG, The Feline Coronavirus (FCoV) is a member 31270-901 of the Nidovirales order, Coronaviridae family, Alphacoronavirus genus, which is responsible for The production of heterologous proteins has been causing Feline Infectious Peritonitis (FIP). Among the widely used for the production of molecules with serological tests used in the disease diagnosis, ELISA is biotechnological potential. Recombinant proteins the most sensitive and recommended assay. FCoV has containing epitopes of three proteins of viruses BoHV-1 and BoHV-5 were developed for vaccination requiring the use of recombinant antigens in the ELISA. purposes. A major challenge for vaccine development characteristicsThe FCoV nucleocapsid that difficult protein their (N) cell is conserved, culture growing, highly is the differentiation of the immunized animals from immunogenic and is the most protein produced during those naturally infected. Searching for a tool to do this viral infection, being a great recombinant antigen in differentiation, a recombinant protein was produced serological tests. The aim of this study was to standardize in a prokaryotic system based on the glycoprotein’s and apply the indirect ELISA using recombinant N G encoding gene (different from the three others protein to detect anti-FCoV antibodies in sera from contained in chimeric protein used in the vaccine). For naturally infected cats. A kidney fragment of died the development of this assay, New Zealand rabbits feline FIP positive was used for extraction of viral RNA, were vaccinated in a prime-boost protocol, and had their serum collected. An ELISA in house was developed The N protein sequence was synthesized with optimized and sera from rabbits and naturally infected cattle were amplificationcodons for expression by RT-PCR in and Escherichia sequencing coli of theand protein inserted N. tested for recognition of the multiepitope vaccine, total viral antigen of BoHV-1 and 5 and recombinant gG (Rec- and the Western blotting was performed with sera from gG). Sera from rabbits placebo and pool sera of negative into pGS21a plasmid. The protein was produced, purified bovines (NEG) were not reactive to any of the antigens protein. To indirect ELISA standardization, the antigen naturallyconcentration, infected serum cat dilution to confirm and the blocking reactivity reagent of the that sera from naturally infected bovines recognized were determined. Four hundred cat’s sera were tested. used,both theconfirming viral antigens its specificity. and the The recombinant results also proteinsshowed The obtained results showed that the protein presented (chimeras multiepitope and Rec-gG). At least, the good reactivity in indirect ELISA. The A450 differences immunized rabbits recognized all antigens, including from 0.1 to 1.8 showed the quantitative feature of the Rec-gG that should differentiate them. It is well known assay. The standardized indirect ELISA for detection in literature that members of the family Herpesviridae

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinaryof anti-FCoVVirology: VV using recombinant N protein is efficient XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

230 Veterinary Virology: VV

VV437 - Equine Infectious Anemia Diagnosis FAPESP (processo 2011/04677-0) By Pcr, Elisa And Agid In Urban Equids From and can be applied in field samples. Financial support: Corumbá And Ladário, Ms, Brazil VV433 - Necromys Lasiurus Rodent As A Samaniego, R.D., Cavalcante, R.V., Nociti, D.L.P., Petzold, Potencial Reservoir Of Oliveros Virus H.V., Esnarriaga, E.S., Araújo Jr., J.P., Nogueira, M.F. (Arenaviridae: Arenavirus) In Brazil Fernandes, J., Oliveira, R.C., Guterres, A., Serra, F., 1. Empresa Brasileira de Pesquisa Agropecuária, Bonvicino, C.R., D’Andrea, P.S., Levis, S., Lemos, E.R.S. Embrapa Pantanal, Corumbá, MS- Brasil - 79320-900, 1880 2. Universidade Federal de Mato Grosso, UFMT, 1. InstitutoOswaldo Cruz - Fundacao Oswaldo Cruz, Cuiabá, MT- Brasil - 78060-900 IOC - FIOCRUZ, Av. Brasil 4365, Manguinhos CEP: 21040- 3. Universidade Estadual de São Paulo, UNESP, 900 Rio de Janeiro - RJ Botucatu,SP- Brasil - 18618-970 2. Instituto Nacional de Enfermedades Virales Humanas INEVH, INEVH Dr Julio I Maiztegui Pergamino, Argentina Equine infectious anemia (EIA) is an equine disease 3. Instituto Nacional de Câncer, INCA caused by a retrovirus within the lentivirus genus. The equine infectious anemia virus (EIAV) is considered Arenaviruses are members of the family Arenaviridae endemic in the Pantanal region and shows high that consists of a unique genus (Arenavirus) that prevalence among working equines and mules used in currently comprises 25 species. New World Arenavirus beef cattle ranches. In urban zones, there are many people belong to the Tacaribe sorocomplex and are genetically who use equids for recyclable garbage collection as their divided in four groups: Clade A, A-recombinant, B main work. This disease is incurable, the basic care is to and C. Until now Clade C is the smallest group within South America Arenavirus, being composed only by OIE, and proceed with euthanasia or isolation in areas Latino (LATV) and Oliveros virus (OLVV), hosted by the findwhere the the seropositives EIAV is endemic. by the AGID An alternative test, recommended for the EIA by sigmodontine rodents Calomys callosus and Necromys diagnosis is the ELISA test, but since both are serologic benefactus (formely Bolomys obscurus), respectively. tests, only the presence of antibodies are detected and OLVV was discovered in central Argentina in ecological not the presence of the virus itself. PCR test can be a studies of rodents hosts of Junin virus. In our study, the very useful tool to remove doubts given by the serologic presence of OLVV was investigated among N. lasiurus tests in cases where the results are unsure as shown in rodents from Sidrolândia and Cassilândia municipalities. previous papers. To evaluate a LTR region semi-nested Those municipalities are situated in Mato Grosso do PCR method for EIA diagnosis, blood of 70 equids Sul State where there is no description of arenavirus- from Corumbá and Ladário, used in animal traction associated hemorrhagic fever, although they are near vehicles, were collected in March, 2013. Samples were areas where circulation of those viruses are well processed by taking the serum for serologic tests and documented. Fieldworks were conducted independently the leukocytes for DNA extraction. After tested, 37% during different years for rodent trapping (2005, 2008 of samples were positive in ELISA rgp90, 23% were and 2009). The rodents were captured in Sherman and positive by p26-AGID test and 21% were nested PCR Tomahawk live traps, and processed in a laboratory positive. Eleven AGID negative and 10 PCR negative samples were ELISA positive. All ELISA negatives were also PCR and AGID negatives and all PCR positives were installedRodent spleen in the field.or liver All trappedsamples rodentswere submitted were submitted to RT- positives in the serologic tests too. PCR results may to kariological and morphological identification. be caused by different viral strains, since it’s known oligonucleotide primers of the S segment of Junin that this type of virus is very susceptible to mutations PCRvirus. amplification A total of 62 of N. partial lasirus S rodents segment were using captured specific and the primers weren’t designed for horses from this and 12 animals were test positives (19,3%) by RT-PCR. region. The PCR method showed 90% correlation with The nucleotide sequence of the obtained amplicons p26-AGID and 84.30% with ELISA rgp90. In conclusion, showed high similarity 82% with OLVV strains. This is the ELISA shows high sensitivity and is the best to be used as screening, but positive samples should be tested by AGID or nested PCR. thespecie first infected record withof OLVV this outside virus. Our Argentina, results andsuggest also that the firstN. lasiurus genetic is descriptiona potencial ofreservoir a rodent for of Oliveros the N. lasiurusvirus in VV460 - Bovine Papillomavirus Type 13 Dna Brazil and that Mato Grosso do Sul State seems to be a In Equine Sarcoids hot zone for arenaviruses. Financial support: CNPq and Lunardi, M., De Alcântara, B.K., Otonel, R.A.A., Rodrigues, FIOCRUZ W.B., Alfieri, A.F., Alfieri, A.A.

231 Veterinary Virology: VV

1. Universidade de Cuiabá, UNIC, Avenida Beira Rio, Coronaviruses, which are single stranded, positive sense 3100, Jardim Europa, Cuiabá - MT. Cep: 78065-900 RNA viruses, is the causative agent of a variety of existing 2. Universidade Estadual de Londrina, UEL, Rodovia and emerging diseases in humans and other animals. Celso Garcia Cid, Pr 445 Km 380, Campus Universitário, The wide range of hosts is due to the diversity whiting Londrina - PR RNA-dependent RNA polymerase, high frequency of thehomologous Coronaviridae RNA recombination, family, a result and of the the infidelity large genome. of its neoplasms considered to be the most common skin Among all hosts, the diversity of coronaviruses is most Equinetumors sarcoidsof horses areworldwide. locally aggressiveThese tumors fibroblastic rarely evidenced in bats and birds, which may be a result of regress and very often recur after therapy. Investigations aiming to identify papillomavirus strains, aside from bovine papillomaviruses (BPVs) 1 and 2, which might theirstudy speciesaimed to diversity, detect the ability presence to fly,of coronavirus environmental in be associated with sarcoid lesions, are lacking. The aim pressures,samples of different and habits bats of species, roosting collected and flocking. at the urban This area of Campinas, Brazil. Viral RNA was investigated by BPV type, BPV 13, in equine sarcoids. Six sarcoids were RT-PCR assay for the gene coding polymerase protein of ofcollected this study from was diverse to report anatomical the identification sites on two of ahorses third coronavirus in tracheal swabs collected from 250 bats. from southern Brazil. To detect a broad spectrum of papillomavirus strains, eight degenerate primer pairs reaction mixtures. All PCR products for polymerase designed to detect conserved regions on L1 and E1 genes Forgene the (397 RT-PCR, bp) were 2,5 μL then of cDNAanalyzed were by used electrophoresis in a 22,5 μL were tested on the DNA samples. Direct sequencing on 1% agarose gel. Viral RNA was detected in 8 samples was then performed on the obtained amplicons, and of the Molossidae (Molosus molossus (4), Tadarida sp., sequence identities were compared with sequences Molossus rufus, Eumops glaucinus) and Vespertilionidae from all bovine papillomavirus types. The FAP59/ (Myotis sp.) families. Cross-infection between the huge FAP64, MY09/MY11, and AR-E1F2/AR-E1R4 sequences number of bat species may generate new viruses which generated from the sarcoids were shown to present 99- are able to jump the trans-mammalian species barrier 100% identity with BPV 13, a new BPV type previously described in cattle. The partial nucleotide sequences of natural reservoir or introductory host, the amplifying the putative E1 gene obtained presented identities of morehost, the efﬁciently. epidemic Forcentre this and reason,at-risk human understanding populations of the 90.7% and 91.5% with BPV1 and -2, respectively. The are crucial in the control of emerging zoonosis. As a complete L1 nucleotide sequences presented identities complement to this study, positive RT-PCR products will of 85.3 and 88.7% with the BPV1 and -2. Phylogenetic be sequenced in the future to classify the viruses. analysis based on the complete L1 nucleotide sequence from BPV13 obtained from equine sarcoid samples and VV469 - Antiviral Inhibition By Extracts the corresponding sequences from all other previously Of Bacteria Isolated From Soils Mounds described BPV types and from other even-toed ungulate Against Importance Viruses In Felines Padilla, M.A., Kohn, L.K., Barnabé, A.C.S., Moraes, A.P., with other Deltapapillomavirus representatives. The Morandi, B.C., Menezes, C.B., Fantinatti-Garboggini, F., PVresults types from confirmed this study that suggestthis viral that strain there can is be a groupedneed to Uetanabaro, A.P.T., Bomfim, G.F., Arns, C.W. identify BPV type 13 and other papillomavirus strains 1. Universidade Estadual De Campinas that might be associated with sarcoids in diverse 2. CPQBA/UNICAMP geographical areas; such investigations could establish the frequency of occurrence of this viral type in this 3. Universidade Estadual de Santa Cruz, UESC common tumor of equids. Financial support: CAPES, 4. Universidade Estadual de Feira de Santana, UEFS CNPq, FINEP, and Fundação Araucária (FAP/PR). This study demonstrated the antiviral properties of 40 extracts from bacteria isolated from soils mounds in VV461 - DETECTION OF CORONAVIRUS IN BATS Brazilian northeast against feline herpesvirus type 1 Durães-Carvalho, R., Martini, M.C., Fellipe, (FeHV-1) and feline calicivirus (FCV), two importance P.A.N.,Drumond, B.P., Santos, M.B., Arns, C.L. viruses in felines. Microorganisms isolated from land 1. Universidade federal de juiz de fora, UFJF, Rua José of termite were incubated in culture medium for four Lourenço Kelmer, sn - Juiz de Fora-MG - CEP: 36036-900 week at 30°C and these inoculums were extracted by 2. Universidade estadual de campinas, UNICAMP, Rua liquid-liquid extraction with ethyl acetate. Antiviral activity was measured by virus titration technique and Monteiro Lobato, Sn - campinas-SP - CEP 13081970 calculated the percentage of viral inhibition (PI) for with virus treat with samples. The extracts were considered

232 Veterinary Virology: VV active when PI is higher than 97%. From all extracts associated with a mixed infection with BoHV-1 as well as tested, one of them, LC22_CM, showed activity against the presence of H. somni acting in synergism with others both viruses, with PI equal to 99%. Furthermore, two other extracts, LC16_Ac and LC16_met, showed PI of that infectious agents that are not frequently included in 99% against FCV. Against FeHV-1 also had two extracts BRDvaccination agents inprograms Brazil. These to control findings respiratory support theinfections theory that were active, the LC04_Ac with 99% of inhibition and of cattle, such as BCoV and H. somni are present in MC25_met that inhibited in 97%. These initial results of Brazilian herd. Therefore, these agents must be included this work were promising; however additional studies in the diagnosis of BRD, and additional preventative and are necessary to evaluate the mechanisms of action and control measures must be adopted. Financial Support: the chemical compounds responsible for the activity. CNPq; CAPES; FINEP; Fundação Araucária/PR. Financial Support: FAPESP/ CNPq VV474 - Active Surveillance For Avian VV472 - Coinfections Of Bovine Coronavirus, Influenza And Newcastle Disease In Bovine Herpesvirus-1 And Histophilus Slaughtered Chickens In Brazil During Somni In Brazilian Feedlot Cattle With 2011 Bovine Respiratory Disease Complex Reischak, D., Orsi, M.A., Domingues, C.S., Camillo, Oliveira, V.H.S., Beuttemmüller, E.A., Bronkhorst, D.E., S.C.A., Bronzato, C.V.O., Catharino, A.M.R., Nascimento, Jesus, T.L.M., Otonel, R.A.A., Fritzen, J.T.T., Headley, S.A., M.L.J., Pessamilio, B., Richtzenhain, L.J. Alfieri, A.A. 1. Laboratório Nacional Agropecuário em São Paulo, 1. Universidade Estadual de Londrina, UEL, Rodovia CGAL/SDA, Lanagro-SP, Rua Raul Ferrari s/n, Campinas - Celso Garcia Cid, Km 380 - Caixa Postal 10.011 - CEP 86057- SP, CEP 13100105 970 2. Coordenação de Sanidade Avícola - MAPA, CSA/ 2. Universidade Norte do Paraná, UNOPAR, PR 218 - CGCD/DSA/SDA, Esplanada dos Ministérios, Brasília - DF Km 01 - Jd. Universitário - Arapongas-PR 3. Universidade de São Paulo, VPS/FMVZ-USP, Av. The Bovine respiratory disease (BRD) complex is Prof. Dr. Orlando Marques de Paiva, Cidade Universitária, a multifactorial disorder associated with several São Paulo - SP infectious agents and environmental stress-induced The National Poultry Health Program (PNSA) carries conditions. Cattle commingled from different sources when exposed to adverse factors at feedlots such as transportation, nutrition, temperature, and sanitary out permanent surveillance for avian influenza and management aspects may lead to immunosuppression Newcastle disease, monitoring commercial flocks based and increased susceptibility to respiratory pathogens. onmortality IN 32 and rates on thewithin Contingency more than Plan fora 72-hour Avian Influenza period Viruses are usually the primary agents of BRD, followed andmust Newcastle be sampled Disease. before Broiler slaughtering chicken flocksfor the with Federal high by bacterial infections. This study characterized mixed Inspection Service (SIF) located at slaughterhouses, and infections with two viruses and a bacterium from deep samples must be forwarded to the National Agriculture nasal swabs obtained from 12 unvaccinated adult feedlot and Livestock Laboratory in São Paulo. Samples include cattle, located in Paraná state. All animals demonstrated serum, cloacal and tracheal/oropharyngeal swabs. Serum respiratory manifestations of pulmonary distress. samples were screened using commercial indirect ELISA All samples were analyzed by molecular techniques (PCR, RT-PCR, nested and semi-nested RT-PCR) for the detection of Bovine Herpesvirus-1 (BoHV-1), bovine kitssamples to detect for AIV specific antibodies antibodies by ELISA for Newcastlewere subjected disease to virusadditional (NDV) serologic and avian testing influenza (AGID virus and/or (AIV). HI)Any in positive order type 3, Bovine respiratory syncytial virus, Mycoplasma viralbovis, diarrheaMannheimia virus haemolytica, (BVDV), and Bovine Histophilus parainfluenza somni. swabs were pooled, submitted to automated nucleic acid toisolation obtain and a confirmatory screened by result.means Cloacalof real-time and trachealreverse and one animal for BoHV-1. Within these animals, four transcriptase-polymerase chain reaction (rRT-PCR) Eightwere animalscoinfected were (three positive with for BCoV BCoV, and five H. for somni; H. somni, one with BCoV, BoHV-1 and H. somni). The other infectious F of NDV. In 2011, samples from broiler chickens were agents evaluated were not detected in any sample. specificcollected for in slaughterhouses type A influenza located viruses in and the genesstates Mof andGO, Positive results for BoHV-1 and/or BVDV were expected, MG, MS, MT, PR, RS, SC e SP. From 6.742 serum samples since these viruses are endemic within Brazilian cattle. tested by ELISA for NDV antibodies, 1.365 (20,2%) were Nevertheless, only one sample was positive for BoHV-1. positive. For AIV antibodies, 4% (276) from 6.741 serum

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV These results represent the first in vivo detection of BCoV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

233 Veterinary Virology: VV samples were positive. Only two ELISA positive samples Leme, R.A., Lorenzetti, E., Ribeiro, J., Molinari, B.L.D., for AIV tested positive by AGID, but none of them could Silva, D.R., Freitas, L.A., Sato, B.E.M., Facimoto, C.T., be subtyped for HI. A total of 1.416 pools from cloacal Alfieri, A.A. and tracheal/oropharyngeal swabs were tested by rRT- PCR; only 1% (15) of them resulted positive for gene M Universidade Estadual de Londrina, UEL, Rod. Celso of NDV but negative for gene F. No positive results were Garcia Cid, PR445 Km380, Campus Universitário, Londrina- found for AIV. These results show that virulent NDV and PR, 86057-970 and reinforce the importance of active surveillance in this Betacoronavirus 1 species, genus Betacoronavirus, population to maintain Brazilian sanitary status before AIV are not circulating in broiler chicken flocks in Brazil BovineCoronaviridae coronavirus family. BCoV (BCoV) is the second is most classified important as meat chicken importers. Financial support: Ministério viral agent involved in neonatal diarrhea in calves da Agricultura, Pecuária e Abastecimento. worldwide, after BOVINE rotavirus group A (BoRVA). The VV475 - In Vitro And In Vivo Virucidal reports on the frequency of BCoV infection in beef cattle Activity Of An Ethanolic Extract Of Green herds under extensive management are uncommon in Propolis Against Newcastle Disease Virus Brazil. The aim of this study was to evaluate the BCoV Nunes, C.F., Finger, P.F., Castro, C.C., Fischer, G., Hübner, presence in diarrheic fecal samples, previously known S.O., Marcucci, M.C., Urbano, P.R., Gerhardt, D., Soares, as negative for bovine BoRVA, of beef calves managed M.P., Piovesan, M., Boff, A., Vargas, G.D. extensively in different geographical regions of Brazil. This study evaluated 93 diarrheic fecal samples of calves 1. Universidade Federal de Pelotas, UFPEL, Campus up to 60 days of age from 13 commercial beef cattle herds Universitário s/n cx postal 354. cep 96010-900. Pelotas RS located in the states of Mato Grosso, Mato Grosso do Sul, 2. Instituto de Medina Tropical, IMT, r. Dr. Eneas Minas Gerais, Paraná, and Rondônia. Fecal samples were Carvalho de Aguiar, 460. Predio 1. Segundo Andar. São Paulo, collected during 2009-2012 and selected according to SP consistency, age of the animals, cattle breed, state of origin, and previous results for BoRVA infection by the 3. Universidade Bandeirante de São Paulo, UNIBAN, PAGE technique. Nucleic acid extraction was performed Rua Maria Cândida, 1.813. São Paulo - SP CEP: 02071- 013 using a combination of phenol/chloroform/isoamyl Currently, the pharmaceutical industry is searching new alcohol and silica/guanidinium isothiocyanate methods. drugs based on natural products aiming the production PCR and semi-nested PCR assays were performed of more effective drugs, for which the microorganisms do not develop resistance, both for humans and for animals. One of the natural products that has been the subject of with33.3% specific (31/93) primers, of calf diarrheictargeting fecalthe N samples gene of analyzed. the viral intense pharmacological and chemical studies in order genome.Four of the Expected 5 states products evaluated of 251presented bp were BCoV amplified positive in to control diseases is propolis. Chemical studies revealed results. The results revealed that BCoV has disseminated its complex composition, including several bioactive in different beef cattle-producing regions. The BCoV phenolic compounds responsible for the virucidal detection from fecal samples of diarrheic calves activity. In this study, we evaluated virucidal activity in demonstrates that the viral infection has been frequent vitro and in vivo of an ethanolic extract of green propolis in extensively managed beef cattle over the last 4 years. (EEGP) against a lentogenic strain of Newcastle Disease The results showed that coronaviruses has important (NDV) virus. We used two different temperatures (22 participation in the neonatal diarrhea complex of and 37 °C), 5 incubation period (0, 1, 2, 4 and 8 hours) of beef cattle raised under extensive breeding system in NDV at 5 different dose concentrations of EEGP (4000µg, 400µg, 40µg, 4µg e 0µg). The virucidal activity was found health programs and orientation of professionals and according concentration and incubation. Doses of 4000 differentfarm workers geographical should beregions established of Brazil. in Specifican attempt animal to µg and 400 µg, after incubation for 2 hours, presented prevent productive/economic losses. Financial support: total inhibition of viral counts. The inhibitory activity of FINEP, CAPES, CNPq, and Fundação Araucária/PR. EEGP for a lentogenic strain of NDV suggests the use of this natural agent as a therapeutic alternative against VV479 - Molecular Evaluation Of Ocular NDV infections. Canine Herpesvirus-1 Excretion In An Adult Dog VV476 - Bovine Coronavirus (Bcov) As Silva, A.P., Bodnar, L., Alcântara, B.K., Facimoto, C.T., Etiological Agent Of Neonatal Diarrhea Saporiti, V., Sato, B.E.M., Balbo, L.C., Freitas, L.A., In Beef Calves Headley, S.A., Alfieri, A.A.

234 Veterinary Virology: VV

Universidade Estadual de Londrina, UEL, Rod. Celso mainly in 6–12 week-old pups; whereas, younger dogs are Garcia Cid, PR 445, km 380, Caixa postal 10011. CEP 86057- generally protected from CPV-2 infection by maternally- 970 derived immunity. CPV-2 spreads from infected to susceptible dogs by the fecal oral route, and reaches Canine herpesvirus-1 (CaHV-1) belongs to the high titers in the feces of infected dogs. CPV-2 emerged Alphaherpesvirinae subfamily, with its host range around 1978 as a major pathogen of dogs worldwide. In restricted to dogs and wild canids. CaHV-1 produces the mid-1980s, the original CPV-2 had evolved and was fatal disease in neonates, and reproductive, respiratory, completely replaced by 2 variants, CPV- 2a and CPV-2b. In and ocular disease in adult dogs. This report investigated 2000, a new variant of CPV (named CPV-2c) was detected the ocular lesions associated with CaHV-1 in a 5-yearin Italy and now co-circulates with types 2a and 2b in old female, mongrel dog from Londrina, Paraná, Brazil, that country. This study was conducted to determine the and evaluated the duration of ocular viral excretion prevalence of CPV type 2c in dogs which showed clinical by molecular techniques. The bitch obtained from the signs of enteric diseases and the main clinical suspicion street by a shelter and adopted by the owner since is CPV infection. Twenty six blood samples were she was a puppy. Initially, the attending veterinarian collected from dogs which came to the State University diagnosed disseminated bacterial dermatitis and the of Londrina Veterinary Hospital (HV-UEL) and showed dog was treated with oral cephalexin for 7 days. Two clinical signs of gastroenteritis. For DNA extraction the days after the end of the treatment, the dog started to Trizol® technique was performed and conventional PCR exhibit congestion of the ocular mucosa and serous was carried out with a primer pair that is able to amplify ocular discharge of the right eye. The clinician collected a 583 bp fragment of the gene encoding for the capsid an ocular swab and prescribed tobramycin eye drops for protein (VP2). The ages of the dogs tested ranged from 7 days. Another four swabs were collected with intervals one month to two years. The CPV-2 DNA was detected of 1 week totalizing 5 swabs, even though the dog was no in 53,8% (14/26) samples in dogs between two months longer presenting clinical signs of ocular illness. A PCR and one year old and 35,7% (5/14) that tested PCR- assay designed to amplify the 450 bp fragment of the positive for CPV-2 were then subjected to sequence analysis to determine the viral type and showed to be CPV glycoprotein B of CaHV-1 successfully amplified viral DNA of CPV-2c in dogs which demonstrated clinical signs of fromthe forward the first, and second, reverse and primers, fourth demonstratedswabs. Further, that direct the subtypeenteric diseases 2c. These and results indicate confirmed that is theprobably participation widely sequencingsequence had of 99% the PCRidentity product with ofsimilar the first strains swab, of CaHV-using distributed according to data from several countries 1 deposited in GenBank. As the animal was adopted from which have shown the presence of CPV-2c. Is important the street by the owner and since then has produced to continuously monitor the occurrence of novel genetic clinical signs of opportunistic diseases, it is supposed and antigenic types of viruses, such as CPV, that appear to continuously evolve because this virus still represents that CaHV-1 was reactivated due to immunosuppression, a threat to dogs. Financial support: CNPq, CAPES, and thatafter this the wasonset not of ageneralized first infection. dermatitis. These findings Since the suggest third Fundação Araucária/PR. swab was negative for CaHV-1 by PCR, it is suggested that the collection of the ocular secretion with the swab was VV490 - Analysis Of Single Nucleotide not effective, or that the elimination of the virus by the Polymorphisms In The Feline Apobec3h ocular route is intermittent. Financial suppport: CNPq, Gene And Their Effect On The Frequency Of CAPES, FINEP, and Fundação Araucária/PR. Hypermutations In Fiv And Felv Proviral Dna. VV482 - Detection Of Canine Parvovirus Castro, F.L., Rabello, T., Knak, M.B., Costenaro, J.G., Subtype 2c In Blood Samples From Dogs Slongo, J., Junqueira, D.M., Medeiros, R.M., Campos, F.S., From Londrina, Southern Brazil Finoketti, F., Almeida, S.M., Roehe, P.M., Franco, A.C. Bodnar, L., Silva, A.P., Miyabe, F.M., Massi, R.P., Pereira, F.L., Florentino, K., Alfieri, A.F. 1. Fundação Estadual de Produção e Pesquisa em Saúde, FEPPS, Av. Ipiranga, 5400. Porto Alegre. Universidade Estadual de Londrina, UEL, Rod. Celso 2. Instituto de Pesquisas Veterinárias Desidério Finamor Garcia Cid, PR 445, km 380. Caixa Postal 10011. CEP 86057- , IPVDF, Estrada Municipal do Conde, 6000. Eldorado do Sul 970 3. Universidade Federal do Rio Grande do Sul, UFRGS, Canine parvovirus type 2 (CPV-2) is one of the most Av. Sarmento Leite, 500. Porto Alegre common viruses responsible for acute hemorrhagic APOBEC3H (A3H) is a member of the APOBEC3 family enteritis in dogs. CPV-2 induced disease is observed of cytidine deaminases which display different activities September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

235 Veterinary Virology: VV against retroviruses. Based on these functions, they control in piglets is composed by G4P[6] (Gottfried have been named restriction factors. These proteins strain) and G5P[7] (OSU strain) genotypes of RVA. The induce hypermutations during reverse transcription, aim of this study was to identify the cause of three leading to the formation of premature stop codons in neonatal diarrhea outbreaks in vaccinated pig herds that the proviral DNA. Mutations in the APOBEC3H gene can alter the stability and cellular localization of APOBEC3H homologs in mammals, thus interfering with their occurred7 (n=1), 14 in (n=2),Rio Grande and 18 do (n=2) Sul State days in old; 2013. in theIn the second first outbreakwere collected were collected three fecal five samplesfecal samples of piglets of piglets with with 10 virus (FIV) and feline leukemia virus (FeLV) are (n=1), 14 (n=1), and 18 (n=1) days old; in the third were anti-retroviralretroviruses which function. are widely Both feline distributed immunodeficiency and induce collected four samples of piglets with 1-7 (n=1), 10-12 (n=1), and 15-20 (n=2) days old. The extraction was animals. Considering the importance of APOBEC3H performed using a combination of phenol/chloroform/ ain significantthe immunity immunosuppressive against retroviruses, effect the inaim infected of this isoamyl alcohol and silica/guanidinium isothiocyanate study is to describe the variability of the APOBEC3H methods. All fecal samples were tested in PAGE and gene in domestic cats infected with FIV and/or FeLV. submitted to RT-PCR to detect the VP7 and VP4 genes of RVA. Five RT-PCR products of RVA detected in piglets of cats and sixty-two FIV and FeLV negative cats were DNAused fromas templates peripheral to bloodamplify collected two different from fifty regions positive of were sequenced, and analyzed using the BLASTn and the APOBEC3H gene, with subsequent sequencing and theRotaC first v2.0 (n=2), software. second In (n=1), PAGE, and the third fecal (n=2) samples outbreaks were sequence alignment using BioEdit and SeqMan (DNAStar positive for RVA or inconclusive (n=2). In the RT-PCR, of the gene, and the second, correspond to a 590 bp second (n=1) outbreaks were negative for VP7 and VP4 software).product between The first nucleotides region comprehends 707-1296, comprehending the first 300bp onlygenes. two The fecal genotypes samples thatG5P[13]; belong G9P[6]-M37-like; to the first (n=1) and exon 2 and parts of introns 1 and 2. All the sequences that it is conserved among the 112 samples analyzed. G4P[6]-M37-likerespectively. The andRVA G9P[6]-M37-like was the causal agent were identifiedof the three in obtainedOn the other from hand, the first the secondregion wereregion identical, of the APOBEC3H indicating theneonatal first, diarrheasecond and outbreaks third neonatal and all genotypesdiarrhea outbreak, detected gene showed single nucleotide variation points, e.g. G/T in this study are different from the genotypes of vaccine. exchanges within exon 2. The effect of these nucleotide variations on the protein activity are at the moment circulating in Brazilian vaccinated pig herds. Financial being assessed through the analysis of hypermutations TheseSupport: findings FINEP, demonstrate CAPES, CNPq, the and diversity Fundação of Araucária/genotypes in FIV and FeLV proviral DNA obtained from the positive PR. samples, thus contributing to the knowledge on the function of APOBEC3H as a restriction factor of feline VV492 - Molecular Characterization Of retroviruses. Financial support: CNPq/FAPERGS Equine Group A Rotavirus In Brazil Lorenzetti, E., Silva, D.R., Ribeiro, L.V.P., Ribeiro, M.G., VV491 - Group A Rotavirus As Cause Of Leme, R.A., Campanha, J.E.T., Freitas, L.A., Balbo, L.C., Three Neonatal Diarrhea Outbreaks In Massi, R.P., Alfieri, A.A. Vaccinated Pig Herds Lorenzetti, E., Campanha, J.E.T., Freitas, L.A., Ribeiro, 1. Universidade Estadual de Londrina, UEL, Rod. Celso J., Possatti, F., Voltarelli, D.C., Balbo, L.C., Pereira, F.L., Garcia Cid, PR445 Km480, Campus Universitário, Londrina- Saporiti, V., Sato, B.E.M., Alfieri, A.A. PR, 86057-970 2. Universidade Estadual de Maringá, UEM, Estrada Universidade Estadual de Londrina, UEL, Rod. Celso da Paca, Bairro São Cristóvão, Umuarama-PR, 87507190 Garcia Cid, PR445 Km480, Campus Universitário, Londrina- 3. Universidade Paranaense, UNIPAR, Rod. PR 480, PR, 86057-970 S/N Km14 - Bonfim, Umuarama-PR, 87502-970 Group A rotavirus (RVA) infection is the main cause Brazil has the third largest herd of equines at the world of acute gastroenteritis in children and many animal and the largest in Latin America with approximately 8 species worldwide, including piglets. Rotaviruses are million head of equidae, while there are few Brazilian studies about viruses that cause enteric neonatal and antigenic diversity of the two outer capsid proteins, diseases in equines. The rotavirus is the most common classifiedVP7 and intoVP4, G respectively. and P genotypes, The accordinggenotypes to G3, the G4,genetic G5, cause of diarrhea in foals up to three months of age and in pigs. The commercial vaccine for neonatal diarrhea in equine RVA (EqRVA) strains around the world are G11, P[6]-Gottfried, and P[7] are commonly identified September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinarythe Virology: main combinations VV of G e P genotypes identified XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

236 Veterinary Virology: VV

G3P[12] and G14P[12]. In Brazil, there are no studies of snorting and coughing while feeding, which may release molecular characterization of EqRVA strains. This study oral and nasal discharges. In the case of breeding, was developed to identify the VP7 (G type) and VP4 (P besides the sexual contact itself, courtship behavior type) genes of one RVA positive fecal sample in PAGE with the female performed previously to copulation detected in a foal with diarrhea in Brazil. The diarrheic may favor further transmission of CAEV. Thus, the aim fecal sample belongs to a foal with 8 days old Quarter of this study was to verify the presence of pro-viral DNA Mile of a farm located in Parana State. The extraction was in the saliva of seropositive males for CAEV. Samples performed using a combination of phenol/chloroform/ were collected from the whole saliva by suction method isoamyl alcohol and silica/guanidinium isothiocyanate in seven naturally infected breeders, and submitted methods. The detection of VP7 and VP4 genes of RVA to DNA extraction and a Nested Polymerase Chain were carried out using RT-PCR. RT-PCR products were Reaction (nPCR). DNA extractions were performed with sequenced, and the nucleotide identity matrix and a NaCl-based protocol, and subjected to two rounds of the phylogenetic tree were realized using the Bioedit (ClustalW) and MEGA 5.05 software, respectively. The bp of proviral DNA, corresponding to a small region amplificationof the CAEV (nPCR)gag gene. to obtainThe products a final fragment were analyzed of 187 Sequence analysis of VP7 and VP4 genes characterized by electrophoresis in 2% agarose gel, stained with VP7the andBrazilian VP4 genes wild-type were amplifiedEqRVA strain in the RT-PCR(BRA04/2012- for RVA. ethidium bromide and visualized in an ultraviolet light Eq) as G14P[12]. The BRA04/2012-Eq strain showed transilluminator. Of the seven samples, two (28.5%) were high VP7 (99.6%) and VP4 (99.8%) nucleotide (nt) positive to CAEV proviral sequences, demonstrating that identity with the Italian EqRVA strains (B-Ita/10 and the infected animals might use the salivar route to CAEV 16Ita/09); and Italian (32Ita/09) and South African elimination, therefore representing an important mode (EqRV-SA1) strains, respectively. In the phylogenetic of transmission. However, more studies are needed to tree the BRA04/2012-Eq strain clustered with European standardize this diagnostic technique. Furthermore, it and South African strains. To our knowledge, this is the is also important to study the characteristics of virus elimination by saliva and the degree of CAEV infectivity genes of one EqRVA strain in Brazil. Financial Support: in this medium. Financial support: FUNCAP, CNPq, UECE; firstFINEP, study CAPES, of molecular CNPq, and characterization Fundação Araucária/PR. of VP7 and VP4 Embrapa Goats and Sheep. VV502 - Detection Of Proviral Dna Sequences VV503 - Sequence Analysis And Genotyping In Saliva Of Male Breeders Infected With Of Borv-A Vp7 And Vp4 Genes In Brazilian Caprine Arthritis Encephalitis Virus Herds From 2005-2012 Souza, K.C., Andrioli, A., Sider, L.H., Pinheiro, R.R., Medeiros, T.N.S., Pereira, F.L., Lorenzetti, E., Ribeiro, J., Bezerra Junior, R.B., Souza, T.S., Batista N.J.M., Teixeira, Oliveira, V.H.S., Leme, R.A., Campanha, J.E.T., Balbo, M.F.S. L.C., Saporiti, V., Alfieri, A.F., Alfieri, A.A. 1. Universidade Estadual do Ceará, UECE, Av Universidade Estadual de Londrina, UEL, Rod. Celso paranjana, 1700, Campus Itaperi, 60.740000 Fortaleza-Ceará Garcia Cid, PR 445 Km 380, CEP 86.057-970, Londrina-PR 2. Empresa Brasileira de Pesquisa Agropecuária, The Brazilian cattle herd represents a substantial EMBRAPA Caprinos, Estrada Sobral/Groairas km 04, commercial activity with 200 million head, mostly 62010970-Sobral Ceará created in extensive management. Neonatal diarrhea is 3. Universidade Federal da Bahia, UFBa, Avenida one of the main important diseases in calves worldwide, Adhemar de Barros 40170-110 Salvador Bahia causing economic losses in both dairy and beef cattle 4. Instituto Superior de Teologia Aplicada, INTA, Rua herds. Bovine group A rotavirus (BoRV-A) is the most Cel.Antonio Rodrigues Magalhães,359. 62050100 Sobral -Ce important viral agent of neonatal diarrhea in calves throughout the world. The outer layer VP4 and VP7 Caprine Arthritis Encephalitis Virus (CAEV) can be found proteins of rotavirus group A (RV-A) strains determine in blood, milk and semen. However, there is no report common combination of G and P genotypes of BoRV-A inabout most the body presence fluids. of Its this presence virus in has cell been discharge demonstrated derived thestrains binary isolated viral classificationfrom diarrhea in in genotypes. calves are The G6P[1] more from the respiratory and / or digestive systems, although (NCDV-Lincoln), G10P[11] (B223), G6P[5] (UK) and the direct and prolonged contact between animals G8P[1] (A5). However other G and P genotypes are represent an important factor in the transmission of detected sporadically. The present study had the aim CAEV. In goats, the risk of occurrence of this type of to characterize the genotypes G (VP7) and P (VP4) transmission is high due to their behavioral habits of

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinaryof theVirology: diarrheic VV fecal samples previously identified XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

237 Veterinary Virology: VV by PAGE technique (silver-stained polyacrylamide acids residues and epitope formation was analyzed. The gel electrophoresis) with rotaviruses collected in all BLAST analysis of the proteins had produced and overall the geographical Brazilian regions, during the period identity higher than 90% for the sequences chosen of of 2005-2012. It was received 69 RV-A positive fecal the aMPV subtype A. The Ramachandran Plot of the samples from dairy and cattle herds from a 166 proteins tested had shown less than 15% non glycine sampling. It was submitted extraction and RT-PCR assay residue in the disallowed region, therefore it showed the using rotavirus VP7 and VP4 consensus primers. The solid stability of the proteins. The ITASSER generated models of the proteins correlates with similar structures using commercial kits and sequenced in ABI 3500. It was productsperformed of sequence the RT-PCR analysis were with purified Phred, and CAP3, quantified Bioedit Conformational and linear epitopes were found in and MEGA 4.1 (CLUSTAL W) softwares. The RT-PCR determinedall predicted experimentallystructures allowing with for verified distinct functions. vaccine was useful to amplify VP7 and VP4, and 69 strains were strategies to be tested. he estimated tridimensional structures of the aMPV proteins will serve as a platform (68%) G6P[5], (29%) G6P[11], and (3%) G10P[11]. for further sequence, structural and function analysis sequencedThese results analyzed. showed Thethat genotypesthe diversity identified of genotypes were and will stimulate new experimental advances. It could in bovine cattle herds was smaller as other production be inferred from this research that conformational species such as swine. The G6P[5] genotype remained epitopes from proteins found in the virion can be used as high compared with another studies performed in Brazil, targets for vaccine design, based on recent observations but the G6P[11] had increased substantially. Moreover, it on antigen kinectis and epitope presentation within the was interesting the absence of the G6P[1] genotype and infected cell. This research could be applied for the wet only 3% of G10P[11], the commercial vaccine genotypes. laboratory and computerized vaccine design. Financial Support: CAPES, CNPq, FINEP and Fundação Araucária (FAP/PR). VV505 - Search For Ruminant Herpesvirus Dna In Trigeminal Ganglia Of Cattle VV504 - Three Dimensional Models For Firpo, R.M., Campos, F.S., Oliveira, M.T., Strelczuck, G., Avian Metapneumovirus Proteins And Fontoura, F.E., Arantes, T.S., Franco, A.C., Spilki, F.R., Conformational Epitope Prediction Silva, D.S., Hubner, S.O., Roehe, P.M. Bonafe, C.F.S., Lima Neto, D.F. 1. Universidade Feevale, Feevale, Rodovia RS-239 2755, 1. Universidade Estadual de Campinas, UNICAMP, Novo Hamburgo, CEP 93352-000, Rio Grande do Sul, Brasil Rua Zeferino Vaz, Cidade Universitaria, Campinas 2. Universidade Federal do Rio Grande do Sul, UFRGS, 2. Deutsche Zentrum für Neurodegenerative Av. Sarmento Leite 500, Porto Alegre, CEP 90050-170, Rio Erkrankungen, DZNE, Sigmund-Freud Straße, Bonn, Grande do Sul, Brasil Deutschland 3. Embrapa CNPSA, Embrapa CNPSA, BR 153, Km Avian Metapneumovirus (aMPV) is considered one 101, Concórdia, CEP 89700-000, Santa Catarina, Brasil of the most dangerous pathogens infecting birds 4. Universidade Federal de Pelotas, UFPel, Campus 354, Pelotas, CEP 96010-900, Rio Grande do Sul, Brasil The virus is highly diverse and four distinct genotypes 5. Instituto de Pesquisas Veterinárias Desidério worldwide,have already along been withdescribed. coronavirus The isolates and influenza display a virus. wide Finamor, IPVDF, Estrada do Conde 6000, Eldorado do Sul, range on symptoms on infected birds, ranging from CEP 92990-000, Rio Grande do Sul, Brasil mild respiratory symptoms to swollen head syndrome (SHS) and death. However, little is known about the Bovine herpesvirus 2 (BoHV-2), Bovine herpesvirus structure and adaptive B cell responses to this virus 4 (BoHV-4) and Ovine herpesvirus 2 (OvHV-2) are and, therefore, the role of individual proteins in host- members of the family Herpesviridae. BoHV-2 is an pathogen interactions. The nucleotide sequences for alphaherpesvirus that causes bovine mamillitis and all aMPV proteins (fusion, attachment, nucleoprotein, pseudo-lumpy skin disease in cattle. BoHV-4 is a phosphoprotein, M2-1, M2-2 and polymerase) obtained gammaherpesvirus and is associated to a variety of from isolates varying in symptomatology and geographic clinical signs, specially related to postpartum metritis. origin have been analyzed. The tridimensional structure OvHV-2 is a gammaherpesvirus and is the causative of the proteins has been modeled de novo using the agent of sheep-associated malignant catarrhal fever (SA- ITASSER algorithm. The predicted structures were MCF). The aim of the present study was to search for DNA tested against B cell linear and discontinuous epitopes of BoHV-2, BoHV-4 and OvHV-2 on ganglia of abattoir prediction algorithms via Expasy and IEDB servers cattle. Fragments of two hundred TGs were collected from one hundred beef cattle and submitted to DNA

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV . The correlation between location of specific amino XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

238 Veterinary Virology: VV extraction. A set of PCRs, one of which was nested (BoHV- curve showing better performance in CDV infection 4) and two semi-nested (BoHV-2 and OvHV-2), were diagnosis. Financial support: FAPESP 2011/50889-9 designed to amplify part of the genes coding for BoHV- 2 and BoHV-4 glycoprotein B (gB). To detect OvHV-2, VV508 - Occurrence Of Group D Rotavirus the “phosphoribosylformylglycinamidine synthase-like In Broilers, Layers And Broiler Breeders protein” gene (FGAM –synthetase) was targeted. BoHV- From Brazilian Poultry Farms 2 DNA was detected in 2% (2/100) of the examined Gregori, F., Bernardes, N.T.G.C., Brandão, P.E., Beserra, population, whereas BoHV-4 DNA was detected in 9% L.A.R. (9/100) of the cattle. No OvHV-2 DNA could be detected. Fac. Med. Vet. e Zootecnia - Univ. São Paulo, FMVZ The amplicons of BoHV2 and BoHv-4 were sequenced - USP, Av.Prof. Dr. Orlando Marques de Paiva, 87 CEP 05508- and deposited in GeneBank (BoHV-2: JQ958307 and JQ958306; BoHV-4: KC540702, KC540703, KC895399 270 São Paulo SP and KC895400). This study provides evidence that Rotaviruses are members of the Reoviridae family and genomes of BoHV-2 and BoHV-4 can be detected in they are a major cause of acute diarrhea in several TGs of apparently healthy cattle. Moreover, this is the mammalian and avian species. They are non-enveloped icosahedral particles and its genome comprises 11 naturally infected cattle. segments of double-stranded RNA, which encodes six first report on the detection of BoHV-4 DNA in TGs of structural proteins (VP1 to VP4, VP6 and VP7) and VV507 - Evaluation Of Three Kits Of One Step six nonstructural proteins (NSP1 to NSP6). Based on Rt-Qpcr To Canine Distemper Diagnosis antibody reactivity or genetic sequencing of structural Tozato, C.C., Almeida, A.C.S., Araújo Jr., J.P. groups A to G. In avian species, rotavirus groups A, D, F, The Canine distemper virus (CDV) is a Morbillivirus proteinand G have VP6, been rotaviruses detected haveso far. been Despite classified its importance, into the belonging the Paramyxoviridae family that causes the data on avian Group D rotaviruses (RVD) are scarce, canine distemper. Considering the high spread and especially in Brazil. In doing so, a total of 111 pools of intestinal contents of broilers, layer and broiler diagnosis is necessary. In CDV infections, early diagnosis breeders pools from 8 Brazilian states were processed nonspecificcan have an signsimportant of the role disease in treatment specific and laboratory sanitary control. Real-time RT-quantitative PCR (RT-qPCR) assays VP6 gene, generating a 742 bp amplicons, followed by have been applied successfully to detect CDV in clinical usingthe nucleotide a RVD-specific sequencing RT-PCR of these technique products. targeting Out of 111 the specimens and currently is effective presenting good cost pools of intestinal contents tested, 4 showed positive results (3.6%) for RVD. Two samples were detected in commercial one step RT-qPCR kits for CDV diagnosis. broilers, one in layer and one in broiler breeder farm, benefitTen urine ratio. samples The aim from of this dogs study presenting was to compare clinical threesigns respectively from Paraná, Goiás and São Paulo State. suggesting distemper were selected after positive results The neighbor-joining phylogenetic tree based on 669- in RT-qPCR. The RNA of samples was extracted using nt long fragment of VP6 sequences depicted that all four Brazilian rotavirus strains clustered together with qPCR was performed with QuantiFast Sybr Green RT-PCR RVD representatives, while the topology maintained TotalKit (Qiagen); RNA Purification Sybr Green Kit Quantitative (Norgen). The RT-PCR one step(Sigma) RT- group segregation, supported by high bootstrap values. and GoTaq 1-Step RT-qPCR System (Promega) according Three of the sequences were identical in terms of amino each manufactures instructions. The RT-qPCR reactions acid composition whereas one showed 99.5% identity were carried out with a previously described primer with the others using as reference rotavirus D strain pair. All samples were positive in the one step RT-qPCR JN034682. As a conclusion, it was demonstrated the of the three manufacturers. The RT-qPCR reaction times RVD circulation among Brazilian poultry farms and it and average CT values were 2:00h/27.8, 3:20h/24.3 and may play a role on the etiology of enteric disease in this 2:45h/29.3, for Qiagen, Sigma and Promega, respectively. specie. The Sigma kit presented the lowest average CT of samples. However, in melting curve analysis, the sigma VV509 - Influence Of Seropositivity To Arthritis Encephalitis Virus I On The Serum temperature variation of 1.2ºC. In Promega and Qiagen Protein Biochemistry Of Lactating Goats kit was show observed a broad melting base, nonspecific temperature peaks variation and of melting 1.5ºC Dias, R.P., Brito, R.L.L., Rodrigues, A.S., Andrioli, A., Pinheiro, R.R., Teixeira, M.F.S. conclusion, the Qiagen kit was faster, with better melting and 1.0ºC, respectively, but no nonspecific peaks. In 1. Laboratório de Virologia, Universidade Estadual

239 Veterinary Virology: VV do Ceará, LABOVIR -UECE, Av paranjana, 1700, Campus One of the proteins encoded by the chicken anemia virus Itaperi, 60.740000 Fortaleza-Ceará (CAV) is called VP3, also known as apoptin. This protein 2. Universidade Estadual Paulista, (UNESP-FCAV), is able to induce apoptosis in tumor cells; however, the Via de acesso Prof Paulo Donato Castellane, S/N Jaboticabal, same does not occur in normal cells. Thus, this protein appears as a promising candidate for anticancer therapy. 14884900 São Paulo The recently discovered avian girovírus 2 (AGV2) has 3. 3Embrapa Caprinos e Ovinos/Laboratório de homology with CAV and encodes CAV-homologous Patologia Clínica , EMBRAPA Caprinos, Estrada Sobral/ proteins, including VP3. The comparison of the AGV2 VP3 Groairas km 04, 62010970-Sobral Ceará amino acid sequence with apoptin shows an identity of Continued growth of farm goats for milk and dairy 32.2% and the presence of functional domains that seem increased the risk of metabolic disorders in goats due to imbalances between the supply of nutrients to the body’s activity. Variability in the AGV2 VP3 coding region has ability to metabolize these components, the high level of tobeen be described important in for different its tumor-specific isolates, suggesting pro-apoptotic that production achieved and the introduction of diseases AGV2 variants may show different potentials to induce infectious such, as the caprine arthritis-encephalitis apoptosis. This study aimed to construct recombinant (CAE), a chronic and incurable disease by lentiviruses, adenoviruses expressing three AGV2 VP3 variants. which affects goats of all races, ages and genders. Clinical evaluation of livestock production can be complemented TOPOplasmid and recombined with pAd/CMV/V5-DEST VP3vector. genes The correct were nucleotide amplified, sequence cloned into and pCR8/GW/orientation byin theprotein analysis biochemical of metabolic constituents profiles. The of objectivegoats blood was analysis and sequencing. Vectors were transfected into toduring study lactation. the influence Therefore, of caprine 38 arthritismatrices encephalitisF1 Anglo- of293A the cells inserts using were lipofectamine. confirmed byViral restriction replication enzyme was Nubian x Saanen, aged between 14 and 38 months and checked by visualization of the characteristic cytopathic body condition scoring between two and three, were effect in cell culture. The adenoviruses obtained were previously tested by AGID and Western Blot division in successively inoculated in 293A cells to reach the titer of seropositive individuals (n = 19) and seronegative (n = 107 PFU/ml. Finally, VP3 gene transcripts were detected 19). The groups were kept in separate paddocks, with no by RT-PCR. Recombinant adenoviruses expressing AGV2 physical contact, getting the same nutritional and health VP3 variants were successfully generated and will be used handling. Blood was collected by jugular venipuncture to infect human normal and tumor cells lines in order every 30 days in vacuntainer tubes without anticoagulant to assess their potential to induce apoptosis in tumor from birth to the end of lactation. Mean values were cells. With these experiments we started to evaluate the determined from total protein and albumin in blood potential of these proteins as new antineoplasic agents. serum collected from these animals. The results obtained VV516 - Outbreak Of Vaccinia Virus from serum biochemical constituents were subjected to Infection In Horses In Minas Gerais State, statistical test “t” test at 5% for comparison of means. Brazil The average total protein seronegative group was 9.67 Matos, A.C.D., Guedes, M.I.M., Rehfeld, I.S., Rodrigues, ± 1.74 g / dL and the seropositive group was 9.66 ± 1.61 N.F.S., Costa, A.G., Alves, P.A., Madureira, M.C., Abrahão, g / dL, with no statistical difference (P > 0.05) between J.S., Trindade, G.S., Kroon, E.G., Alves, G.E.S., Lobato, groups. The average albumin in seronegative group was Z.I.P. 2.5 ± 0.61 g / dL and the seropositive group was 2.16 ± 1. Universidade Federal de Minas Gerais, UFMG, Av. groups. Albumin values found in seropositive lactating Antônio Carlos, 6627 Pampulha, BH, MG 31.270-901 0.47animals g / dLshown with to statistical be below difference the reference (P < 0.05) values between for the 2. Instituto Mineiro de Agropecuária, IMA, Cidade goats. Financial support: Funcap; EMBRAPA; LABOVIR/ Administrativa Tancredo Neves Ed. Gerais 10º andar 31.630- FAVET/UECE 901, BH, MG VV515 - Generation Of Recombinant An outbreak of vesicular disease in horses that occurred Adenovirus Expressing Avian Gyrovirus 2 in June/July of 2011 in the southeastern region of Minas Vp3 Protein Gerais state, Brazil was investigated. The animals were Arantes, T.S., Knak, M.B., Costenaro, J.G., Slongo, J., mixed breed horses and belonged to three different Castro, F.L., Santos, H.F., Roehe, P.M., Franco, A.C. properties, totaling 24 affected animals. The major Universidade Federal do Rio Grande do Sul, UFRGS, clinical sign was the presence of ulcerative lesions in the oral mucosa, internal lips and tongues of affected animals. Sarmento Leite, 500, centro Porto Alegre, Brasil During clinical inspection, lymphoid hyperplasia was September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

240 Veterinary Virology: VV detected in the oral mucosa of some animals. Serum and oral swabs were taken from all affected animals, and there was cranoiventral consolidation of most lungs that kept refrigerated until processed. Differential diagnosis thedemonstrated detection an of increased influenza consistency. A (flu A) viruses. Histopathology Grossly, was made for vesicular stomatitis, which was negative. As it was previously reported that an outbreak of severe bronchopneumonia. Eight samples were positive for vesicular disease associated with Vaccinia virus (VACV) revealed areas of interstitial pneumonia and fibrinous infection in horses occurred in southern Brazil, the samples were submitted for VACV diagnosis. The swabs flu(HA), A, using and were RBCs used of guinea for viral pigs isolation and a multiplex in MDCK cellRT- were washed in 1 mL of 1x PBS with antibiotics, and then lineage.PCR were To performed confirm isolation, on the supernatant. the hemagglutination Three pairs test of submitted to DNA extraction with phenol: chloroform. primers targeting three distinct SIV hemagglutinin (H) Next, the samples were submitted to a nested PCR for genes (classical H1, avian-like H1, and H3) were used. the detection of vgf gene, which is conserved among the Four of the eight samples were positive by multiplex viruses of the genus Orthopoxvirus. Fourteen out the 24 RT-PCR during passage in cell culture. The H3 gene was samples (58.3%) were vgf PCR-positive. Sequencing of detected in three samples; classical H1 and H3 were simultaneously detected in one sample. These isolates homology with Horsepox virus and VACV was observed. ranged from 1:128 to 1:512 by the HA assay. BLAST theMoreover, amplified the fragmentvgf PCR positive was performed, samples were and asubjected 96% of analysis demonstrated that the H1 and H3 sequences presented the highest identity with H1N1 and H3N2 tofragment a real timein eight PCR samples for detection out the 14of hasubmitted gene, specific (57.1%), of VACV.belonging It was to possible animals to detectof three amplification studied properties.of ha gene humanof a H3 influenzaSIV subtype strains, in Brazil. respectively. Financial To Support: the best FINEP,of our Furthermore, some of the PCR-positive animals were knowledge,CNPq, CAPES, these Fundação findings Araucária/PR represent the first isolation seropositive in the immunoperoxidase monolayer assay (IPMA). The origin of the virus remains unknown. VV522 - Molecular Characterization Of However, these results corroborated previous studies Bovine Leukemia Virus In Samples Field Of about the circulation of VACV in Brazilian horses, and Dairy Cattle In Santa Catarina State raise the awareness that VACV should be included in the Rodakiewicz, S.M., Lenoch, C.Y., Urio, M., Munhoz, M.L., differential diagnosis of horses with vesicular disease. Yamakawa, F.H.S., Duarte, C.R.A., Portes, V.M., Martini, Financial support: FAPEMIG, CNPq and CAPES C.L., Forell, F., Costa, U.M.

VV520 - Isolation Of H1 And H3 Influenza 1. Universidade do Estado de Santa CAtarina, UDESC, Viruses From Single And Mixed Infection Av Luis de Camões 2090 Of Pigs With Pneumonia 2. Empresa Catarinense de Pesquisa Agropecuária, Fritzen, J.T.T., Beuttemmüller, E.D., Saporiti, V., Otonel, EPAGRI, Chapecó R.A.A., Florentino, K.E., Massi, R.P., Sato, B.E.M., Alfieri, Bovine leukemia virus (BLV) is a member of the A.F., Alfieri, A.A. family Retroviridae, genus Deltaretrovirus and it is an Universidade Estadual de Londrina, UEL, Rod Celso important agent in dairy cattle. Currently, several studies Garcia Cid KM 380 Caixa Postal 10011 Cep 86057-970 7 genotypes, in samples of different parts of the world. haveThe aim been of madethis study about was of BLVthe molecular genotypes, characterization finding at least of morbidity and reduced mortality in pigs. Although of samples of BLV from seropositive dairy cattle in TypeSIV circulates A swine influenzawithin pig virus herds (SIV) throughout causes high the levelsyear, Santa Catarina State, Brazil. Were collected 454 blood most outbreaks occur during late fall and winter samples with and without anticoagulant by puncture of the tail vein in dairy cattle of the 31 properties. in humans. In Brazil, the subtype H1N1 was previously Initially, the animals were tested by serology using agar months,isolated, withand there similar is serological seasonal occurrence evidence of as the influenza H3N2 gel immunodiffusion test (AGID). The blood collected SIV within pig herds. This study evaluated pulmonary with anticoagulant, in laboratory, was washed with a samples from 10 pigs that were maintained on a farm Tris EDTA solution for removed erythrocytes and was located at Paraná state and with clinical manifestation of immediately reserved in -80 degrees until obtain the pulmonary distress. Seven samples were collected from results of AGID test. The samples of seropositive animals, 30-40 days old piglets and three from 100-170 days old containing proviral DNA, were submitted to polymerase pathological evaluation. The samples were submitted gene env fragment. At least one sample each properties growing-finishingto a generic RT-PCR, pigs; targeting all lungs the matrix were submitted (M) gene, for chainthat showed reaction positive (PCR) animals for amplification in PCR, were of submitted the 440 bpto September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

241 Veterinary Virology: VV restriction fragments polymorphism analysis (RFLP) by Alegre, RS and Sorocaba, SP. To conclude the assessment digestion for 5 restriction endonucleases, BamHI, HaeIII, of the Brazilian isolates, further antigenic evaluations are Tru9I, TaqI and MwoI. The results obtained in serology being performed in comparison with OIE recommended demonstrated 42% seropositive animals (191/454) strains of vaccine composition. Financial Support: FINEP, and 68% positives properties (21/31). In RFLP analysis CNPq, CAPES, Fundação Araucária/PR were detected 5 circulating genotypes in State, and that the genotypes 1 e 2 were described by Inoue et al. VV526 - Metagenomics Analyses Of A (2011) and three new genotypes called 8, 9 and 10, not Pustular Wound Collected From A Dairy Cow From Rondonia State, Brazil us to know what are the types of viruses present in the Hoffmann, L., Sales, E.B., Penha, L.L., Damaso, C.R., Silva, previouslystate and servedescribe, as awere basis identified. for future This epidemiological study allows R. studies. Samples with different genotypes will be also 1. Universidade Federal do Rio de Janeiro, Inst de subjected to sequencing along with other tissue samples Biofísica, UFRJ, IBCCF, Av. Carlos Chagas Filho, 373, CCS, bl (tumor) obtained in our laboratory. G, sl G1050, Ilha do Fundão, RJ, 21941902 VV525 - Partial Molecular Analysis Of The 2. Inst Nac para Pesquisa Translacional em Saúde e H3n8 Equine Influenza Virus From The 2012 Ambiente, INCTINPeTAm/CNPq/MCT, Av. Carlos Chagas Brazilian Outbreak. Filho, 373, CCS, Ilha do Fundão, RJ, 21941902 Saporiti, V., Beuttemmüller, E.D., Fritzen, J.T.T., Florentino, K.E., Oliveira, V.H.S., Alcântara, B.K., Facimoto, C.T., INTRODUCTION: Brazil is one of the largest milk Miyabe, F.M., Ferraz, L.E.S., Alfieri, A.F., Alfieri, A.A. producers in the world. In the past decade, outbreaks of Vaccinia virus (VACV) infection in dairy cows and 1. Universidade Estadual de Londrina, UEL, Rod Celso dairy workers have been reported. Previous work Garcia Cid KM 380 Caixa Postal 10011 Cep 86057-970 investigated outbreaks of poxvirus-related disease on 56 2. Laboratório Vencofarma do Brasil Ltda, Vencofarma, dairy farms of Mato Grosso and Rondônia States, which R. Dalva de Oliveira, 237 Londrina - PR, 86030-370 were associated with infection by VACV Cantagalo strain. virus spreading throughout the states. Nevertheless, respiratory disease in equines worldwide. The disease Subsequentother Vaccinia trading virus andstrains human are responsible translocation for amplified a variety Equineis endemic influenza in the Americas virus (EIV) and isEurope. the major The EIV cause H3N8 of of related outbreaks of infection in Brazilian cattle has been the unique subtype isolated in the last 30 causing economic loss and reduction in production of years. Frequent mutations have occurred since the H3N8 emerged in the 80’s, originating new phylogenetic or subsequent mastitis. Rondonia has approximately lineages with distinct antigenic characteristics, some milk by dairy cows due to the inflammatory condition of which are already extinct. Currently, the OIE expert OBJECTIVE: The aim of this study is to assess the infectious surveillance panel on EIV recommended two distinct 11.2scenario million of a cattlepustular and lesion has a on significant a cow’s udder milk andproduction. teats by a metagenomics approach to verify the microbiome and strain represents a different Clade (1 and 2), both within virome related to the infection. METHODS: Sample from strainsthe Florida based lineage. on influenza Unlike the vaccine USA and composition. some Europeans Each the wounded udder was collected at Jaru city, Rondonia countries, there is no epidemiologic surveillance of State, Brazil (JA-03). DNA was extracted using silica- EIV in Brazil to identify the current circulating strains within Brazilian horses. In April 2012, during the last was determined using Qubit. DNA was fragmented membrane-basedusing enzymatic shear DNA procedurespurification performedkit. The DNA according amount collected from symptomatic Lusitano breed of horses to Ion Torrent™ PGM protocol. The shotgun library Brazilianin Itapira, EIV São outbreak, Paulo. All five horses nasopharyngeal were about swabs6 years were old and previously vaccinated. A RT-PCR targeting the HA1 sequence of the hemagglutinin (H) gene was performed preparationperformed followed followed by the beads adapters enrichment ligation, and amplification sequencing andprotocol quantification using a 316 by chip.real time The PCR.Ion TorrentEmulsion PGM PCR reads was resulted positive. During the phylogenetic analysis, the were analyzed by bioinformatics tools. All reads were directlyHA1 sequence in the from nasal the samples. Itapira strains From fiveclustered samples, with twothe submitted to mapping against Bos taurus genome. The South Africa/4/2003 vaccine prototype strain (Clade 1). non-matching Bos taurus reads were assembled and a One amino acid change was detected in the antigenic site A. This result is identical to previous analysis of using the software CLC Genomics Workbench 6.0.3. our group, of isolates from the 2012 Brazilian outbreak MultiBlastRESULTS: A analysis total of 445 was thousand performed reads to findwere similarity,obtained. (unpublished) performed with samples from Porto After removal of reads from Bos taurus and quality September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

242 Veterinary Virology: VV control procedure, 13 thousand reads were assembled, pig farms. The results evidence the importance of more generating 323 contigs. 31 contigs were from Vaccinia investigations on RVC genetic diversity to determine bacteria and other viruses. Bioinformatics analyses are Financial support: FINEP, CAPES, CNPq and Fundação virus.being Otherimproved microorganisms to better understand were identified, this microbiome. especially effectiveAraucária profilatic(FAP/PR). tools in porcine RVC infections. CONCLUSIONS: This metagenomics approach was able to identify Vaccinia virus in association with other VV534 - Molecular Detection Of Bovine viruses and bacteria co-infecting the udder wound. Viral Diarrhea Virus In A Cloned Calf From Detailed analysis will add more information about the Northern Parana outbreaks of VACV in cattle. Financial Support: CNPq, Campanha, J.E.T., Headley, S.A., Voltarelli, D.C., Alcântara, INCT-INPeTAm/CNPq/MCT, CAPES, FAPERJ B.K., Bronkhorst, D.E., Jesus, T.L.M., Oliveira, V.H.S., Rodrigues, W.B., Alfieri, A.F., Alfieri, A.A.,Okano, W. VV528 - Molecular Characterization Of Vp4, Vp6 And Vp7 Genes Of Porcine Group C 1. Universidade Estadual de Londrina, UEL, Rod. Celso Rotavirus Garcia Cid, PR445 Km480, Campus Universitário, Londrina- Possatti, F., Lorenzetti, E., Molinari, B.L.D., Rodrigues, PR, 86057-970 W.B., Voltarelli, D.C., Campanha, J.E.T., Florentino, K.E., 2. Universidade do Norte do Paraná, UNOPAR, PR De Alcântara, B.K., Alfieri, A.F., Alfieri, A.A. 218 - KM 01 - Jd. Universitário, CEP 86702-670,Cx. P. 560, Arapongas-PR Universidade Estadual de Londrina, UEL, Rod. Celso Garcia Cid PR445, Km380. CEP:86057-970 Bovine viral diarrhea virus (BVDV) is considered as one of the major pathogens of cattle; the virus has worldwide Group C rotaviruses (RVC) are associated with distribution and causes major economic losses in acute gastroenteritis worldwide, both in humans affected cattle herds. The BVDV belongs to the family and animals. The molecular analysis have revealed Flaviviridae, genus Pestivirus, the genome consists of a genetic heterogeneity into RVC, however the genetic single-stranded positive-sense RNA. Although the BVDV characteristics of porcine RVC (PoRVC) circulating in is considered important predominantly as a reproductive Brazil remain limited. The Brazilian studies only analyzed disease, it can be associated with other clinical the VP6 gene. The aim of this study was to analyze the manifestations, such as respiratory and gastrointestinal genes that encode the outer capsid proteins, VP4 and VP7, dysfunctions. Females infected during pregnancy might besides the intermediary capsid protein, VP6. Diarrheic result in embryo and fetal mortality, in addition to stool samples from nursing piglets were collected of pig congenital malformations, stillbirths, and the birth of farms located in southeast Brazilian region, during 2012. weak calves. Infection of the fetus before the immune Four samples with characteristic RVC pattern migration capacity has been established, favors the generation of on PAGE were selected for analysis. The specimens immunotolerant calves persistently infected (PI). An elite were submitted to RT-PCR for amplify the VP4 (799bp), cattle holding located in northern Parana that produces VP7 (1042bp) and VP6 (1353bp) genes. The RT-PCR cloned calves is having major reproductive problems, products were sequenced and the phylogenetic trees such as miscarriages, stillbirths, the birth of weak calves were generated using the MEGA 5.05 software. The VP4 and mortality of some born alive. A 16-days-old cloned nucleotide (nt) identity among the four strains ranged Girolando, calf that died after clinical manifestations of from 86.6 to 99.7% and they grouped in the same branch, diarrhea was submitted for routine necropsy. Principal with high nt identity (83.1-86.4%) with the porcine pathological alterations included necrotizing enteritis RV0143 strain, that represents a new VP4 genotype, and and hepatitis. Selected tissue fragments were collected higher nt identity (66.9-68.9%) to bovine than to porcine for the molecular detection of principal infectious agents strains (60.6-67.2%). Based on VP7 gene, the strains of cattle: Histophilus somni, Bovine herpesvirus 1 (BoHV- of this study showed higher nt identity with porcine 1), Bovine viral diarrhea virus (BVDV), Bovine rotavirus Dublin strain (85.5-86.7%) and high nt identity with and Bovine coronavirus (BCoV). The RT-PCR assay each other (88-99.6%), all clustered in the G6 genotype. The sequence analysis of VP6 gene revealed that the Pestivirus 5’UTR-region from the myocardium sample; samples were closely related to each other (84.9-100%). successfully amplified the specific fragment (288bp) of The BRA217/12-Po strain showed high nt identity with suggest that BVDV was associated with the death of this Cowden strain (90.9%) while the others three samples allcloned other calf, PCR and assaysthis infectious were negative. agent might These be linked findings to were most closely related with BRA905/07-Po strain the frequent reproductive problems described at this cattle herd. Financial support: CAPES, CNPq, FINEP and the VP4, VP7 and VP6 genes of porcine RVC in Brazilian Fundação Araucária. (97.4-98.1%). This is the first study conducted to detect September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

243 Veterinary Virology: VV

VV546 - Evaluation Of Orthopoxvirus Zadra, V.F., Almeida, A.C.S., Hora, A.S., Brandão, P.E., Circulation Among Equids From Minas Araújo Jr., J.P. Gerais State, Brazil: Serological And Historical Implications. 1. Universidade Estadual Paulista “Julio de Mesquita Borges, I.A., Reynolds, M.G., Mccollum, A.M., Ambrósio, de Filho”, UNESP, Distrito de Rubião Junior, s/n, Botucatu-SP L.L.D., Costa, G.B., Figueiredo, P.O., Reis, J.K.P., Lobato, 2. Universidade de São Paulo, USP, Z.I.P., Bonjardim, C.A., Ferreira, P.C.P., Abrahão, J.S., The feline infectious peritonitis virus (FIPV) causes a Kroon, E.G., Trindade, G.S. fatal, multi-systemic, and immune-mediated disease,. 1. Universidade Federal de Minas Gerais, UFMG, Av. Considered a mutation of feline enteric coronavirus Antônio Carlos, 6627, Pampulha BH-MG (FECoV), antemortem diagnosis of FIP is a challenger 2. Centers for Disease Control and Prevention, CDC, and most cats are positive for FCoV in serological tests or by RT-PCR. The differentiation between FIPV and Atlanta, GA - United States of America. Eighteenth century’s Europe was unaware of Vaccinia mortem by histopathology. RT-PCR for detection of feline virus (VACV) existence. Present not only put VACV as FECoVcoronavirus infection mRNA is in difficult, peripheral being blood conclusive is a diagnostic post- test which shows the infection and replication of the the single spotlight under which cows stand since the virus. However, this test does not distinguish between a disguised possibility in Jenner’s life but also defies strains producing FIP and FECoV. In the pathogenesis in Jenner’s Inquiry, recent reports of VACV outbreaks of infection, the infected cells induce an immune firstin Brazilian smallpox horses vaccination. and everlasting Motivated debates by clues over found the exacerbated production of cytokines. Thus, the aim introduction of VACV in the Americas, a serosurvey of this study was to determine the mRNA encoding was conducted in equids from Minas Gerais state (MG), Brazil. Sera were submitted to ELISA-IgG and PRNT to animals. Therefore, blood samples from 44 cats from assess whether these animals have had contact with cytokinescatteries of profile SP and in RJcats were with collected FIP compared at 4 times to healthy within Orthopoxvirus (OPV). Serology was after correlated to 4 months. From the total RNA, we performed RT-qPCR the history of Bovine Vaccinia (BV) and Equine Vaccinia mRNA coding for feline cytokine (IL-1, IL-2, IL-6, IL-10, (EV) at the property from which each sample derived. IL-12, TNF, IFN) and normalizing with GAPDH. It was For BV and EV negative properties, 19.6% of equids observed that cytokines IL-1, IL-2, IL-6 and IL-10 were were seropositive. Aggregating BV and EV positive found increased in most animals. However, IL-12, TNF properties, a total of 32.2% of seropositive animals and IFN were increased only in some groups, which can were observed. Individual analyzes on the other hand, be characterized a marker for differentiating animals demonstrated 50% of seropositivity among equids infected with FIPV from those with FECoV. The animals from areas with BV history; 27.7% seropositive animals with high values for these cytokines had clinical signs derived from EV positive areas. A third, larger group, consistent with the disease and contact with animals lacking BV and EV information was also analyzed, that developed FIP. presenting a seropositivity of 18.2% of the 476 tested animals. At a glance, the substantial circulation of OPV VV551 - Production And Evaluation In among equids is noticed. OPV data will now be referred Immunoassays Of Polyclonal Antibodies as VACV’s as this is the single OPV currently proven to Against Bovine Viruses be circulating in Brazil. A silent circulation of VACV De Lima, T.G., Quadros, L.M., Mallmann, L.A., Brum, among Brazilian equids occurs. Jenner’s notes related to M.C.S. UNIVERSIDADE FEDERAL DO PAMPA, and then inoculated in bovine to gain human infectivity UNIPAMPA, Rodovia BR 472, Km 592, Uruguaiana-RS, – gather credibility after BV association to a greater the source of smallpox vaccine – first taken from equids 97.500-900 equid exposure to VACV and to innumerous outbreaks in which humans were involved, whether EV episodes had Immunoassays are widely used to identify and no human related so far. Further investigation over VACV characterize virus and viral proteins. These assays are entrance in the Americas is also instigated: Last century based in the reaction of antibodies and viral antigen. is a possibility, but couldn’t VACV have ridden a horse The source of antibodies are antiserum or monoclonal. along with our colonizers 500 years ago? The aim of this study was to produce polyclonal antibodies against several bovine viruses and to VV548 - Quantification Of Mrna Coding Cytokines In Cats Naturally Infected With immunoperoxidase assays. For these, bovine herpesvirus Feline Infectious Peritonitis Virus (Fipv). evaluate its reactivity in immunofluorescence and September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

244 Veterinary Virology: VV type 1, 2 and 5 (BoHV-1, -2, -5), bovine viral diarrhea bovis by the tuberculin skin test, with bacterial isolation virus (BVDV), bovine respiratory syncytial virus (BRSV), vaccinia (VACV) and bluetongue virus (BTV) were viawas theperformed Stonebrink by using method, the Agar and Gel confirmed Immunodiffusion by PCR used to immunize rabbits. Only VACV were inactivated assays(AGID) targeting Test to specificdetect anti-BLV amplicons antibodies. of M bovis.. From Serology the individuallyand administrated amplified with in cell adjuvant. culture andThe the animals supernatant were animals evaluated, 37.5% (5/16) were seropositive for anti-BLV antibodies; however most of these (62.5%; 11/16) reactive negatively. In this study, coinfections immunizedThe whole blood subcutaneously were processed five timesfor serum at intervalsseparation, of due to M. bovis and BLV were demonstrated in 37.5% 14-21aliquot days, and andstored five at days -20oC after until the test. last boostNo clinical were singsbled. of the animals; a similar study done in Pernambuco were observed after immunizations. From each animal demonstrated that 12.3% (37/299) of the animals were obtained at least 15 mL of serum. The antiserum investigated were coinfecetd by these infectious agents. was used as primary antibodies in the immunoassays. Additional studies must be done to determine the effects of BLV in predisposing affected animals to tuberculosis. several dilutions (1:100 to 1:51.200) were tested against To determine the concentration of specific antibodies, VV561 - Neutralizing Antibodies For Venezuelan Equine Encephalitis Virus In homologousbackground wasviruses considerate and heterologous to the working field isolates. dilution. The In Horses From Brazilian Pantanal higher dilution with specific positive reaction and lower Pauvolid-Corrêa, A., Juliano, R., Velez, J., Schatzmayr, H., reaction in mock-infected cells. Usually, the dilutions Nogueira, R.M.R., Komar, N. general,used for lower immunoperoxidase dilutions (< 1:800) were presented higher than unspecific those 1. Fundação Oswaldo Cruz, Fiocruz, Av. Brasil 4365, Rio de Janeiro, RJ 21045-900, Brasil to 1:25.600 for the homologous viruses. No differences used in immunofluorescence and range from 1:1.600 2. Empresa Brasileira de Pesquisa Agropecuária conclusion, all polyclonal antibodies produced were Pantanal, Embrapa Pantanal, Rua 21 de Setembro, 1880, were observed when field isolates were tested. In Corumbá, MS 79320-900, Brasil immunoperoxidase assay, making then an important 3. Centers for Disease Control and Prevention, CDC, abletoll to to detectionreact specifically and characterization in the immunofluorescence of several bovine and 3156 Rampart Road, Fort Collins, CO 80521, Brasil viruses in the routine diagnostic or research. Financial support: CAPES, FAPERGS. The Brazilian Pantanal hosts large concentrations of diverse wildlife species, including migratory birds, VV557 - Concomitant Infections Due To and therefore this region is potentially important Bovine Leukemia Virus And Mycobacterium for arbovirus studies in South America. Neutralizing Bovis In Dairy Cattle From Northern antibodies for equine encephalitis viruses, including Paraná Eastern equine encephalitis virus (EEEV) and Western Bronkhorst, D.E., Alfieri, A.A., Affonso, M.Z., Oliveira, equine encephalitis virus (WEEV) have been reported in V.H.S., Negri Filho, L.C., Okano, W., Headley, S.A., Araujo Pantanal equines. To better understand the alphavirus Junior, L.D. circulation in the region, a serosurvey for Venezuelan equine encephalitis virus (VEEV) was conducted with Universidade Norte do Paraná, UNOPAR, Rodovia 760 equines from 15 beef cattle ranches of the Brazilian PR218 Km 1 Medicina Veterinaria 86702000 Arapongas - PR Pantanal. The sera were titrated by 90% plaque- reduction neutralization test (PRNT90) for VEEV and Enzootic bovine leucosis is caused by the Bovine then the seropositive samples tested for EEEV, WEEV Leukemia Virus (BLV), Family Retroviridae. This disease and Mayaro virus. Serum was considered seropositive produces severe economic losses because of infertility, to VEEV when it reduced at least 90% of the formation reduced milk production, culling, and death, and might of plaques and its neutralizing antibody titre was four- predispose the affected animal to other diseases. Bovine fold greater than what was observed for the other tested tuberculosis (BT) is caused by Mycobacterium bovis. alphaviruses. From a total of 760 equines, of which 277 BT is a chronic disease associated with reduced milking were immunized with bivalent vaccine composed of EEEV production, carcass condemnation at slaughter, and is and WEEV and 483 were unvaccinated, four (0.5%) had an important zoonotic disease. This study evaluated the presence of EBL and M. bovis by in a herd of dairy cattle. regardless of vaccine status. Employing the criterion of During May 2013, serum samples were obtained from four-fold greater titre among all alphaviruses tested, one 16 female, Black and White Holstein cattle located in the neutralizing reactivity (PRNT90 titre ≥ 1:10) for VEEV four-year old stallion with history of vaccination was city of Jandaia do Sul, PR.All animals were positive for M. considered seropositive for VEEV with PRNT90 titre September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

245 Veterinary Virology: VV

1:160. The remaining three horses that had neutralizing than the isolates detected in healthy animals. This is the antibodies for VEEV were considered seropositive for an undetermined alphavirus because of less than domestic pigs in Uruguay. Data reported here contributes four-fold antibody titre difference. Because cross- firstto better study knowledge investigating of thethe presence molecular of epidemiologyTTSuV1 and 2 inof reactivity among arboviruses may occur, we encourage this emergent virus constituting further evidence for a more encompassing serosurveys using other Brazilian global distribution. alphaviruses, including Pixuna and Mucambo viruses, VV583 - Molecular And Serological the circulation of VEEV in the region, and consequently, Characterization Of Influenza A Isolated asidentify well as vectors efforts and to isolatevertebrate virus hosts to definitively that are involvedconfirm From Wild Birds In The State Of São Paulo, in the its local maintenance cycle and transmission. Brazil Financial support: CNPq, CAPES, Fulbright Kawamoto, A.H.N.

VV564 - Molecular Detection Of Torque 1. Laboratorio de Virologia de Desenvolvimento Teno Sus Virus Type 1 And 2 In Domestic Pigs Científico do Instituto Butantan de São Paulo; Infected And Non-Infected With Porcine 2. Laboratório Clinica Molecular de Virologia do Circovirus Type 2 In Uruguay Instituto Biomédicas, USP. Ramos, N., Mirazo, S., Castro, G., Arbiza, J. 1. Facultad de Ciencias. Universidad de la República, family. The last years several low pathogenic avian UdelaR, Iguá 4225 Avian Influenza virus belongs to Orthomyxoviridae 2. Ministerio de Ganadería Agricultura y Pesca, MGAP, in human and poultry. The wild and migrating birds Constituyente 1476 influenzamay be participating subtypes have of causedmaintenance outbreaks and and interspecies epidemic transmission of the 16 subtypes of the Hemagglutinin and Torque teno sus viruses are circular, single-stranded DNA 9 Neuraminidase in nature. Our study aimed subtyping samples positive by serological test haemagglutination species, Torque teno sus virus 1 (TTSuV1) and Torque inhibition (HI) technique and Molecular Biology. The viruses classified in the Anelloviridae family. Two distinct samples from species Elaenia mesoleuca (2), Sporophila association with disease is currently under investigation. lineola (1) Sporophila caerulescens (1), Vireo olivaceus tenoData sussuggests virus that 2 (TTSuV2) they may have participate been identified as co-adjuvant and thei in (3), Columbina talpacoti (3), Paroaria dominicana other pathological conditions; such diseases associated to Porcine Circovirus type 2 (PCV2) infections. The stations located in the São Paulo State - Brazil, during the viral genome (2.8 kb) is organized in a coding region (2), were collected in reserves and experimental field containing a major open reading frame (ORF1), two test (according WHO) using the 20 antibody patterns overlapping ORFs (ORF2-3), and an un-translated region years 1997 and 1998. The samples were identified by HI (UTR). Little information regarding the epidemiology of and RT-PCR and Sequence analysis of Hemaglutinina TTSuV species in South America is available. The main anti-influenzaand Neuraminidase A type gene. and The one HI for test the demonstrated influenza type that B purpose of this study was to investigate the presence of 12 samples presented an antigenic close relationship TTSuV 1 and 2 in Uruguay in PCV2-infected and healthy with A/HongKong/1/68 (H3N2), A/ Equine/Miami pigs. In addition, we aimed to analyze the phylogenetic /63 (H3N8) and A/Duck/ Ukraine/ 63 (H3N8) relationships among Uruguayan strains. Serum and antiserum. The sequencing analyses of Hemaglutinin organ samples of PCV2-infected and healthy animals and Neuraminidase gene of these 12 isolates revealed from different swine herds were tested for the presence a high homology with H3N2. Phylogenetic analysis and of TTVSuV DNA by a PCR approach. TTVSuV DNA was genetic variability compared with GenBank sequences representing several countries have shown that our all the animals resulted co-infected with TTSuV1 and samples showed a close homology with the virus subtypes identifiedTTSuV2. As from expected, PCV2-positive low nucleotide and negative sequence samples, identities and Siena (1991) Victoria (1990) and Beijim (1989). Amino were observed among the TTSuV1 and TTSuV2 strains acid analysis indicated that there are non-synonymous mutations in the gene of Hemagglutinin (Y153F, K172A, was detected, the TTVSuV1 strains showed a higher D175H, T264I) and Neuramidase (T55S), exclusive of (

246 Veterinary Virology: VV v586 - Isolation, Sequencing And Finoketti, F., Varela, A.P.M., Santos, H.F., Esteves, P.A., Phylogenetic Analysis Of Equine Influenza Silva, A.D., Roehe, P.M., Franco, A.C. Virus Causing The 2012 Outbreak In Sâo Paulo, Brazil. 1. Universidade Federal do Rio Grande do Sul, UFRGS, Villalobos, E.M.C., Mori, E., Lara, M.C.C.S.H., Nassar, Rua Sarmento Leite, 500, Sala 208, Cidade Baixa, Porto A.F.C., Braga, P.R.C., Daniel, G.T., Cunha, E.M.S. Alegre - RS/Brasil 2. Instituto de Pesquisas Veterinárias Desidério 1. Instituto Biológico, IB, Av. Cons. Rodrigues Alves, Finamor, IPVDF, Estrada Municipal do Conde, 6000, 1252 Eldorado do Sul - RS/Brasil 2. Instituto Pasteur, IP, 3. Empresa Brasileira de Pesquisa Agropecuária - 3. Pfizer Saúde Animal, , Unidade CNPSA, EMBRAPA - CNPSA, BR 153, Km 110, Vila Tamanduá, Concordia - SC/Brasil A genome of a new virus preliminarily named Avian (formerly equi1) and H3N8 (formerly equi2). However, Equine influenza, a viral disease of equidae due by Gyrovirus 2 (AGV2) was recently discovered in chickens outbreaks reported internationally during the last Influenza A virus, is caused by two subtypes: H7N7 in Southern Brazil. AGV2 has a 2.4 kb circular genome, three decades have been due to H3N8. Despite its similar in size and genomic organization to Chicken control, outbreak of this disease caused severe impacts Anemia Virus (CAV); in addition, these two viruses share on horse owners and industry participants. In April an overall nucleotide similarity of about 40%. Previous 2012, vaccinated horses from Sao Paulo presented studies showed that genomic variation in a small region fever, serious nasal discharge, dry cough, anorexia and of the VP2 and VP3 coding regions of different AGV2 depression. Nasopharyngeal swabs and paired sera positive samples occurs. The aim of this study was to samples were taken from equines showing acute clinical assess the genetic variability of the VP1 (capsid protein) of the virus responsible for this outbreak. Nasal swabs collected from diseased and healthy animals. Tissue were processed for virus isolation in 9-11 day-old signs. Here we describe the isolation and identification samples (liver, spleen) from 7 chickens displaying loss embryonated chicken eggs and by RT-PCR test. An coding gene amplified from AGV2 positive samples of weight and anemia and feather shafts collected from aliquot of 0.1ml was inoculated into embryonated eggs 16 healthy chickens were submitted to DNA extraction (two eggs for sample). The eggs were incubated at 35°C for 72h, after which they were killed at 4°C. The primers used in the PCR assay were designed based on the VP1 nucleotide sequence of AGV2 sample “Ave 3” The RT-PCR was performed to target the matrix and HA and polymerase chain reaction (PCR). The AGV2 specific genes. The partial nucleotide sequences of the matrix allantoic fluid was harvested and HA test was made. were subjected to sequencing, nucleotide and amino and HA genes were determined by the Sanger dideoxy acid alignment. All samples displayed at least one amino sequencing method. Serum samples (n=27) were tested (accession number HM590588). The amplified samples acid change in comparison to the VP1 sequence recorded by HI using the protocol recommended by OIE and using in HM590588. In addition, genetic variability among standard antigen EIV H3N8 A/Eq/SP/1/85. From 36 the samples of this study also occurred: amino acid nasopharyngeal swabs, viruses were isolated from 3 and differences of 0.5 to 3.5 % were detected in the analyzed 12 samples were positive by RT-PCR using matrix gene. region. Five amino acid changes in conserved positions were found among four out of seven samples obtained from diseased animals. Other variations, restricted to numbers KC620392 and KC620391, respectively). Paired Specific amplification of matrix and HA genes by RT-PCR VP1 samples of either diseased or healthy animals were serum samples (n=22) showing more than fourfold was confirmed by DNA sequencing (Genbank access not found. Although this study has shown that genetic variation in the VP1 coding gene of AGV2 occurs, the role of the observed amino acid changes in the virus equine/Sao Paulo/IB19/2012(H3N8)] shared 98% rise in antibody titers, confirmed equine influenza. The pathogenicity is not yet known. equinesequence influenza identity strain and it isisolated most closely from this related outbreak to Florida [A/ sublineage clade 1 of the American lineage. Phylogenetic VV598 - Viral Agents In Diarrheic And and molecular characterization must be performed to Asymptomatic Dogs determine that virus lineages circulate in Brazil and to Budaszewski, R.F., Pinto, L.D., Alves, C.D.B.T., Weber, provide updated information for infection control and M.N., Dupont, P.M., Antunes, J.R., Granados, O.F.O., vaccine development. Canal, C.W. VV588 - Genetic Variability Of The Vp1 Universidade Federal do Rio Grande do Sul, UFRGS, Av Coding Sequence Of Avian Gyrovirus Type 2 Bento Gonçalves, 9090, Agronomia, Porto Alegre - RS, Brasil September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

247 Veterinary Virology: VV

Numerous viral infections are known to affect the health 1. Instituto de Pesquisas Veterinárias Desidério of dogs. Canine distemper virus, a common viral threat Finamor, IPVDF, Estrada do Conde, 6000 - Eldorado do Sul, for dogs, is highly contagious and often fatal, causing RS fever, vomiting and diarrhea, respiratory symptoms, 2. Universidade Federal do Rio Grande do Sul, UFRGS, seizures and paralysis. Canine parvovirus 2 (CPV2) is Av. Sarmento Leite, 500 Porto Alegre-RS found worldwide, is highly contagious and can also be lethal, causing the symptoms of fever, vomiting and 3. Embrapa Suínos e Aves, Embrapa Suínos e Ave, hemorrhagic diarrhea. Canine coronavirus (CCoV) also Concórdia - SC causes vomiting, diarrhea and/or respiratory symptoms, causes acute respiratory disease in pigs, characterized enteric CCoVs, canine respiratory coronavirus and Swineby sudden influenza outbreaks virus (SIV)with ishigh an Orthomyxovirusmorbidity and thatlow andcanine different pantrophic strains coronavirus. have been Canine identified, rotavirus including and adenovirus are reported as potential dog pathogens, also in swine populations world wide H1N1, H1N2, and causing episodes of diarrhea. In this study, a total of 107 mortality.H3N2. Reports Three of subtypes SIV infections of influenza in Brazilian A virus swine circulate are rectal swabs were screened for these agents. The samples scarce. The present study was conducted in search for were collected from dogs with or without diarrhea, of antibodies to different subtypes of SIV in pigs from any gender, age and breed, in municipal dog shelters, commercial farms in the state of Rio Grande do Sul, Brazil. veterinary clinics, and pet shops from Rio Grande do Serum samples collected (in 2012) from six commercial Sul, Santa Catarina, Paraná, Mato Grosso and Rondônia, farms with history of respiratory disease were examined. during a 4-year period (February 2008 - June 2012). The number of samples tested was determined with Rectal swab samples were tested by using PCR (CPV2 basis on an estimated prevalence of 50% in herds and CAV) and reverse transcription-PCR (CDV, CCoV days old) were sampled from each 6 farms, totaling 60 parvovirus in 14/107 (13%) samples, canine distemper withsamples. a 95% Hemagglutination confidence interval. inhibition Ten pigs(HI) (66tests to were 120 andvirus CRV) in 20/107 with specific (18.7%) primer samples, pairs. canine We found coronavirus canine performed against classic H3N2 (strain A/sw/IA/8548- in 29/107 (27.1%) samples, canine rotavirus in 6/107 2/99-NVSL/USDA); H1N2 (strain 31/11) and pandemic (5.6%) samples and canine adenovirus in 2/107 (1.8%) H1N1pdm09 (strain 107b/10-3A), the last two isolated samples. Of total, 51 (47.6%) were negative for all agents analyzed. Mixed infections were detected in 19 (17.7%) thirteen of the samples tested (22%) had HI antibodies dogs, most of them (13 - 12.1%) infected with CCoV plus fromto H1N1pdm09; field cases of60 SIV.(100%) The resultsreacted demonstratewith high titers that one of the other viruses, being 6 of them with CDV and for H3N2 and 8 (13%) had HI antibodies to H1N2. In 5 dogs were co-infected with CPV2. Also, 2 (1.8%) dogs relation to herds, antibodies to SIV were detected in all were co-infected with 3 different viruses, being one with sampled farms, which 4 (4/6) had seropositive animals CCoV, CDV and CPV2 and the other with CCoV, CDV and to pandemic H1N1pdm09, 6 (6/6) to classic H3N2 and CRV. Analysis of different viral agents in fecal samples 4 (4/6) to H1N2. In addition, three farms were positive is needed to assess the real importance of each agent, mainly to establish a relationship with cases of diarrhea. In this study, canine coronavirus infections were the most forthe threepig population tested SIV ofsubtypes. Rio Grande These do findings Sul. These reveal results that frequent (27.1%), followed by canine distemper virus these three subtypes of influenza virus are circulating in (18.7%) and canine parvovirus (13%). Mixed infections in swine populations within the state. were found in 19 dogs, most infected with CDV/CCoV, highlight the need for continuous influenza surveillance viruses that may exacerbate disease caused by other VV602 - Phylogenetic Analysis Of Brazilian viruses, such as CPV, CRV and CAV. This study provides Chicken Parvovirus (Chpv) a snapshot of the situation of infectious diseases caused Schmidt, C., Santos, H.F., Wendlant, A., Cibulski, S.P., by CCoV, CDV, CPV, CAV and CRV in Brazil. Financial Varela, A.P.M., Scheffer, C.M., Franco, A.C., Roehe, P.M. support: CAPES, CNPq. 1. Instituto de Pesquisas Veterinárias Desidério VV601 - Co-Circulation Of Pandemic 2009 Finamor, IPVDF, H1n1, Swine H3n2 And H1n2 Influenza 2. Universidade Federal do Rio Grande do Sul, UFRGS, Viruses In Pigs In The State Of Rio Grande Do Sul. Chicken parvovirus (ChPV) belong to the Parvoviridae Schmidt, C., Schaefer, R., Wendlant, A., Santos, H.F., family. Chicken parvovirus induces enteric disease Cibulski, S.P., Varela, A.P.M., Scheffer, C.M., Almeida, in broilers and may also cause neurologic disease in L.L., Franco, A.C., Roehe, P.M. young chickens. The aim of this study was to report

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV the identification and phylogenetic analyses of ChPV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

248 Veterinary Virology: VV

do Tauá. The viral double-stranded RNA was extracted from broilers with signs of stunting, emaciation and from a 20% stool suspension and submitted to RT-PCR genomesanemia were detected collected in from Brazilian three geographically poultry flocks. distinct Livers using the primers RD6F and RD6R for the VP6 gene of RV-D. A positivity of 35.3% (30/85) was observed Total DNA was extracted of 49 liver samples with the using this technique. Of the eight municipalities studied, flocksPureLink™ within genomic the state DNA of Mini Rio Kit Grande (Life doTechnologies) Sul, Brazil. seven (87.5%) had positive samples for RV-D, and from and submitted to a PCR designed to amplify a fragment the 37 farms in 17 (45.9%) this virus was present. The of 561 bp along the ChPV nonstructural (NS) gene.Viral results obtained are of great importance for the region, DNA was detected in 23/49 (47%) samples tested. and also adds information about the occurrence and Eighteen amplicons were sequenced and compared with frequency of RV-D in Brazil. Considering the few number ChPVsequences already available at GenBank. Alignment of publications about infection by RV-D, more studies of the 18 sequences revealed 97.4% nucleotide similarity involving clinical and epidemiological data about RV-D and 96.2% aminoacid similarity. Phylogenetic analysis are necessary in Brazil and other countries. Financial grouped the 18 sequences analyzed in the same cluster. support: FAPESPA; CNPq. The present study evidenced the occurrence of ChPV in VV609 - Molecular Detection And Sul, Brazil. However, the relationship between detection Characterization Of ‘Hobi’-Like Pestivirus commercialof ChPV genomes poultry and flocks the in clinicalthe state signs of Rio observed Grande doin In Cattle In Paraíba, Brazil diseased birds remains undetermined and require Weber, M.N., Budaszewski, R.F., Dupont, P.M., Pessoa, further investigations. C.R.M., Silva, T.R., Simoes, S.V.D., Almeida, L.L., Riet- Correa, F., Driemeier, D., Canal, C.W. VV604 - Detection Of Group D Rotavirus In Broiler Chickens In Pará State, Brazil 1. Universidade Federal do Rio Grande do Sul, UFRGS, Bezerra, D.A.M., Silva, R.R., Linhares, A.C., Gabbay, Y.B., Laboratório de Virologia, Faculdade de Veterinária, Porto Mascarenhas, J.D.P. Alegre, Brazil 2. Universidade Federal do Rio Grande do Sul, UFRGS, 1. Instituto Evandro Chagas , IEC, BR 316–KM 07, Setor de Patologia Veterinária, Faculdade de Veterinária, S/N, Levilândia, 67.030-000, Ananindeua, Pará, Brasil Porto Alegre, Brazil 2. Laboratório Nacional Agropecuário, LANAGRO, 3. Universidade Federal de Campina Grande , UFCG, Avenida Almirante Barroso, 1234, Marco, 66.093-020, Belém, Hospital Veterinário, Centro de Saúde e Tecnologia Rural, Pará, Brasil Patos, Brazil The gastrointestinal disease caused by rotaviruses (RV) The genus Pestivirus of the family Flaviviridae consists affects humans and animals. The rotavirus is a non- of four recognized species: Bovine viral diarrhea virus enveloped icosahedral particle composed by a genome 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), of 11 segments of double-stranded RNA. They are Classical swine fever virus (CSFV) and Border disease virus (BDV). Recently, atypical pestiviruses (‘HoBi’-like birds, this viral agent is frequent and has been detected classifiedin duck, pheasant,into eight chicken, groups/species pigeon, designated turkey and A-H. wild In fetal calf serum and in naturally infected cattle with and birds. Among the groups that infect birds (A, D, F and pestiviruses)without clinical were symptoms. identified During in batches routine of contaminated screening of G), the group A is more commonly. In this context, it is cattle sera by panpestivirus RT-PCR assay, four samples necessary to study other groups such as the RV-D which from one farm of Pombal, Paraiba, showed traces of has only recently developed a technique more sensible pestivirus nucleic acids and was genotyped as ‘HoBi’- for its detection such as the reverse transcriptase- like pestivirus. Phylogenetic analysis base on three genome regions (5’UTR, Npro and E2 glycoprotein) showed that they were four different strains that polymeraseThe aim of this chain study reaction was to (RT-PCR)determine usingthe frequency specific grouped in two distinct terminal nodes, suggesting at primersof RV-D in that broiler increase chickens considerably come from its farms identification. located in least two independent introductions of virus in the Para State, Northern Brazilian Amazon. During the years herd. Continuous epidemiologic surveillance will help 2008 to 2011, a total of 85 “pools” of fecal samples were assess the extent to which atypical pestivirus strains are collected of broilers chickens without clinical signs of widespread in cattle populations worldwide and their disease. These specimens came from 37 farms situated impact on animal health and production, which will in eight different municipalities of Pará State: Belém, Ananindeua, Benevides, Castanhal, Santa Isabel do CNPq, FAPERGS and Propesq/UFRGS. Pará, Inhagapi, Santa Bárbara do Pará e Santo Antônio require specific control plans. Financial support: CAPES, September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

249 Veterinary Virology: VV

VV610 - Verification Of Serological Study Of A Virus Isolated From Pygmy Diagnostic Method For Infectious Marmoset Bovine Rhinotracheitis (Ibr) By Virus Scheffer, C.M., Cibulski, S.P., Schmidt, C., Varela, A.P.M., Neutralization Technique Santos, H.F., Wendlant, A., Roehe, P.M. Azevedo, I.C., Oliveira, T.F.P., Thomaz, M.M.,Oliveira, A.M., Camargos, M.F. 1. Universidade Federal do Rio Grande do Sul, UFRGS, 2. Instituto de Pesquisas Veterinárias Desidério Laboratório Nacional Agropecuário de Minas Gerais, Finamor, IPVDF, LANAGRO-MG, Av. Rômulo Joviano, s/nº Cx. Postal 35, 50 CEP.: 33600-000 - Pedro Leopoldo/MG. The present study reports the application of a newly molecular approach for virus characterization in unknown virus stocked in our laboratory. The knowledge of viral bovine rhinotracheitis (IBR) by virus neutralization diseases affecting nonhuman primates has expanded Verificationtechnique. ofThe serological aim of this diagnostic study was method to verify for Infectious the virus greatly in recent years and it has been investigated due neutralization technique for the diagnosis of Infectious of possible zoonotic potential. In September of 1987 a bovine rhinotracheitis (IBR) used in the National Pygmy Marmoset (Cebuella pygmaea) was received in Agricultural Laboratory of Minas Gerais. Reference the laboratory for routine rabies diagnosis. The animal material consisting of ED6 strain of Bovine Herpes Virus had shown clinical signs of encephalitis. Fragments of 1 was obtained from the Veterinary Laboratory Agency brain tissue were processed for virus isolation following in the UK. Reference sera were obtained from the OIE standard procedures in VERO cells. Approximately two Reference Laboratory for IBR located in Germany days after inoculation a cytophatic effect (CPE) was (Federal Research Centre for Virus Diseases of Animals). Besides the strain ED6, neutralization test were also sample (named Sagui/87) was re-inoculated in VERO performed with 5 strains of IBR in order to compare sera observed.cells for subsequent Twenty five molecular years after characterization. the isolation, The the neutralizing titres for different strains. We evaluated testing, calculation of repeatability and calculation of identificationbased on random of thismultiplex isolated PCR virus using was 3’-locked performed random by the following parameters: participation in proficiency novelprimers. method Viral for nucleic rapid virusacids detectionwere extracted and identification with Viral testing, six samples were received to be evaluated from DNA/RNA mini kit (Invitrogen) and RNA was converted measurementthe National Veterinary uncertainty. Services In participation (NVLS- Ames, in proficiency USA). We to cDNA with SuperScript III (Invitrogen). The cDNA and selected two positive sera (low titer and high titer) to DNA were used in a PCR utilizing the 5’-VVVVVVVVAA-3’ were titrated with six replicates, on three different days, were cloned into pCR2.1® TOPO® (Invitrogen) and calculatetotalizing the 18 coefficientreplicates ofper variation sample. (repeatability). The measurement Sera primerssequenced (V8AA with primers). universal Amplified M13 primers. fragments Sequences in PCR of uncertainty was performed using seven samples obtained were analyzed using Geneious software assayed in duplicate and on two different days, based on and they were compared with sequences available in the results of control sera used in the tests and on the results of the samples. There was a small variation in the Sagui/87, a pan-herpesvirus PCR was performed and a sera titres when compared with the different strains, and GeneBank. In order to further confirm the identity of the all positive samples were positive when using strains revealed that the viral segment recovered was identical Colorado, ED6 and LA. For the following tests we decide specificto human fragment herpesvirus was 1 amplified. (HHV-1) Phylogeneticgenomes. The analysis results showed that the sample Sagui/87 is a HHV-1 and that the to use the ED6 strain which has a certificate of origin. tool for the characterization of unknown viral isolates. TheCV around results 14% in proficiency in both sera. test The were uncertainty satisfactory values for five for methodology employed represents a fast and efficient samples.samples testedThe results were of0.22, coefficient lower than of variation the uncertainty showed VV624 - Transmission Electron Microscopy values of the controls (about 0.33), which may be caused Of Lytic Bacteriophage Specific For by the small number of replicates of the control. Based Streptococcus Spp. And Escherichia Coli on the results we propose the use of the method with Causing Bovine Mastitis 10e2 ± 0.5 TCID 50/100 uL with virus strains originating Duarte, V.S., De Souza, F.O., Dias, R.S., Silva, C.C., Nunes, from PANAFTOSA-PAHO/WHO or NVSL. The method has M.V.M., Xavier, G.F., Machado, B.I., De Paula, S.O. appropriate values of repeatability. Universidade Federal de Viçosa VV614 - Applying A Technique Of Dna Random Amplification To Identify Viruses: A Case in Brazil and all over the world, it’s responsible for 35 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - VeterinaryBovine Virology: mastitis VV is the main disease afflicting dairy cattle XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

250 Veterinary Virology: VV billion dollars/year in losses worldwide. The clinical and a member of the family Reoviridae, genus Orbivirus. and subclinical infections are ordinarily caused by a large number of microorganisms such as Strptococcus located in tropical and subtropical areas, affecting several spp, Corynebacterium spp, Staphylococcus spp. and 26species serotypes of domestic were identified and wild in ruminants, several countries, representing mainly a Escherichia coli. Nowadays the most used procedure for major barrier to international trade in animals and their treatment is the antibiotic therapy, but alternate ways are being envisaged due to the increase of multi-drug- list of differential diagnosis of vesicular diseases. The resistant-bacteria and antibiotic residue present on the products.objective was The to BT diagnose is a notifiable the VLA disease in 106 and sheep is onand the 4 milk, which presents risk to public health and interferes goats of different breeds, between 3-36 months of age, of on dairy products production. Therefore, the use of both sexes, 3 properties located in southeastern Brazil. bacteriophages as a natural tool, nontoxic and viable for Totaling 120 animals analyzed during the period 2008- pathogens control has become an effective alternative to 2013. Samples were taken from organs of sheep that died crusted vesicles of animals with injuries and blood for in the infection area, it presents no side effects, and the direct virus by RT-quantitative PCR (RT-qPCR), isolation mastitisbacteriophage treatment, resistant since itbacteria is very specific,remain itsusceptible replicates in embryonated chicken eggs (OEG) and sequencing to others. This study’s main goal is to isolate the lytic positive samples. The total number of animals examined virus to the etiologic agents E. coli and Streptococcus 32.5% (39/120) were positive by BTV RT-qPCR, and spp isolated from cows with mastitis. The samples used the positive 92.3% (36/39) were sheep and 7.7% for viral isolation have been gathered from the SAAE’s (3/39) were goats. The positive samples by RT-qPCR were subsequently isolated in OEG, and sequenced. The in Viçosa-MG. They have been centrifuged to 12.000xg comparison of sequences and phylogenetic analyzes (Serviçofor 15 minutes Autônomo and the de supernatant Água e Esgoto) has been sewage recovered, system resulted in serotype 4 BTV (BTV-4) in all 3 herds. concentration of 10% (m/v). the tubes have been kept isolated in the USA in 1982 in cattle exported. Brazil on 4ºC which overnight was added and then polyethylene centrifuged glycol to 11.000xg 8.000, final for Theand Argentina only report are of the BTV-4 only in countries Brazil was in South identified America and 20 minutes, the result viral precipitant emerged on 5mL of phage dilution buffer (SM) and extracted once with the same chloroform volume. The sample had wheregoats. Molecularthe BTV-4 wasstudies isolated to characterize and identified, the however,existing been centrifuged once more (4.000xg, 10 minutes, 4ºC) onlyBTV serotypes in cattle, andin Brazil this is are the fundamental first report into sheepassess andthe for chloroform and cellular residue removal purposes, epidemiological situation and thereby contribute to the where the resultant viral concentrate became a source of health control to decrease the risk of introduction of new bacteriophages for plating. The phage’s suspension had serotypes, minimize the negative impact of the disease been tested for E. coli by the overlay plating technique and facilitate the exchange of products of animal. was observed. Such plates had been isolated and plated VV629 - Standardization Of The Technique onthree Ágar-LB, more times, after 24isolated hours phages the presence were obtained. of lise plates After Of Semi-Nested Pcr For Detection Vaccinia isolation, titration was performed and the Streptococcus Virus In Milk spp. susceptibility to this virus were ascertained, Silva, T.G., Lima, M.S., Martins, M.S.N., Sousa, S.F., showing itself lytic to this parentage too. Therefore, it’s Okuda, L.H., Stefano, E., Pituco, E.M. been tried to morphologically characterize this phage by Instituto Biológico, IB, electronic microscopy of transmission, which belongs to the order Caudovirales and family Myoviridae. The vaccinia virus is a DNA virus belonging to the genus Orthopoxvirus, causes bovine vaccinia. Infectious VV626 - Isolation And Typification disease characterized by causing skin lesions in dairy Bluetongue Virus In Sheep And Goats Of cattle and is a zoonosis of occupational character. Milk Southeast Region Of Brazil is important as a source of nutrition to man as well as Lima, M.S., Martins, M.S.N., Silva, T.G., Sousa, S.F., a possible route of transmission of pathogens. The milk Okuda, L.H., Stefano, E., Pituco, E.M. contamination occurs possibly due to failure in handling Instituto Biológico , IB, Av. Conselheiro Rodrigues hygienic milking, contaminated fomites or through the milker’s hands. In this study we standardized the Alves, 1.252 - CEP 04014-002 São Paulo-SP technique of semi-nested PCR for detection of vaccinia The Bluetongue (BT) is an infectious, non-contagious, virus directly into the milk. For that unpasteurized caused by an RNA virus and transmitted by mosquitoes milk free of the virus, was experimentally infected with of the genus Culicoides sp. The bluetongue virus (BTV)

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinaryviral Virology: titer VV of 10-5TCID50/50 μL vaccinia virus, and XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

251 Veterinary Virology: VV underwent successive dilutions to assess its detection Conclude that the best extraction method for OvHV-2 limit. For the standardization of semi-nested PCR DNA with adaptations that contribute to post-mortem and used EACP-1 and EACP-2, and subsequently subjected paraffin-embeddedold cases of FCM to tissue study is the recommended molecular epidemiology by literature was extracted by phenol boil. Specific primers were and natural history of the virus contributing with a more a fragment HA80F 850 pb. Os results demonstrate that effective diagnosis, generating information for decision tothe a techniquesecond amplification has reached with a threshold a primer of that detection amplifies by

PCR is an effective and useful tool in the diagnosis of makingVV636 in- theDevelo field ofp animalment health.Of A Duplex Real- 10-3TCID50/50vaccinia virus in samples μL. We concludeof raw milk that providing the semi-nested security, Time Pcr For Simultaneous Detection Of Chicken Anemia Virus (Cav) And Avian well as avoid potential risks to public health. Gyrovirus 2 (Agv2) sensitivity and analytical specificity of the diagnosis as Wendlant, A., Varela, A.P.M., Santos, H.F., Cibulki, S.P., VV630 - Evaluation Of Methods For Scheffer, C.M., Schmidt, C., Teixeira, T.F., Santos, R.N., Extraction Of Dna With Paraffin- Franco, A.C., Roehe, P.M. Embedded Tissue For Detection Of Virus That Causes Malignant Catarrhal Fever UNIVERSIDADE FEDERAL DO RIO GRANDE DO Martins, M.S.N., Lima, M.S., Stefano, E., Okuda, L.H., SUL, UFRGS, Av. Paulo Gama, 110 - Bairro Farroupilha, Sousa, S.F., Da Silva, T.G., Pituco, E.M. Porto Alegre, Rio Grande do Sul Instituto Biológico, IB, Avenida Conselheiro Rodrigues Chicken anemia virus (CAV) and avian gyrovirus 2 (AGV2) Alves, 1252- Vila Mariana are members of the family Circoviridae, genus Gyrovirus. Both viruses can infect poultry. However, whereas CAV is Maligana catarrhal fever (MCF) acute viral disease, a recognized avian pathogen the role for AGV2 in disease widely distributed, usually fatal, affects mainly cattle remains to be determined. Here a duplex quantitative and deer. Four species are known virus group of MCF, real-time PCR (dqPCR) for simultaneous detection and all Herpesvirus, family Gammaherpesvirinae, genus Rhadinovirus. The principal in Brazil is MCF sheep- Plasmids containing copies of the full genomes of CAV associated, induced by ovine herpesvirus-2 (OvHV-2). quantificationand AGV2 were of constructed. AGV2 and Serial CAV genomes tenfold dilution is reported. (100 Is included in the list of diseases confounded with foot to 108 copies) of the plasmids was prepared to generate and mouth disease, encephalitis and encephalopathy, the assay were designed with basis on the previously the agent the PCR is the method indicated, but most standardpublished curves.AGV2 nucleotide Specific primers sequence and (variant probes ‘‘Ave-3’’) used in requiring a differential diagnosis. For identification of (NC_015396) and CAV reference sequence (NC_001427) extraction of DNA. Standardize methods of extraction using the program Primer3 from the Geneious software of the time the material is sent in formalin difficult the which accompanies the equipment used (StepOneTM retrospective studies of molecular epidemiology and Real-Time PCR system; Life Technologies). Conditions paraffin-embeddedanalysis of viral evolution tissue becomes through essentialtime. Objective to conduct was of the assay were as follows: 50 °C for 2 minutes; 95 compare the performance of four methods of extraction (15 s at 95 °C and 30 s at 60 °C). The evaluation of the commercial kit NucleoSpin® FFPE DNA, Invisorb® Spin °Csensitivity for 2 min of the followed assay was by 40performed cycles of in amplification triplicate in ofTissue DNA Mini from Kit, paraffin-embeddedinnuPREP® DNA Mini tissue. Kit performed Was used three independent assays performed in different days. according with manufacturer recommendations and determined. Quantitative analysis revealed a detection tissue with xylene, washed ethanol, suspended in Thelimit variation of 50 copies coefficient of cloned (CV) AGV2 of threshold DNA and cycle 5 copies (Ct) was of protocol the literature in which remove paraffin of cloned CAV DNA. The standard curve for AGV2 and CAV standard method phenol/chloroform and precipitation bufferin isopropanol. digestion Were add analyzed proteinase parts K, purifiedcentral nervous by the system of cattle positive and negative by PCR. The plasmidsassays was showed close to a correlation100% (slope coefficient ranging from (R2) 3.283ranging to from3.322). 0.997 The todqPCR 1 for wasboth shown templates. to be The highly efficiency sensitive of andthe to increase quality and quantity of DNA were made most efficient was recommended by the literature and specificVV638 - for Histo the identificationpathological of CAV S tudyand AGV2 Of Ygenomes.ellow somewith washes adjustments in alcohol like because do five washesit inhibits in xylenethe action at 65of Fever (17dd Strain) Infection In Gallus °proteinase C for removal K. Commercial of paraffin kits tissue failure and in extracting removing DNA. this Gallus Domesticus

252 Veterinary Virology: VV

De Abreu, L.P.P.M., Guedes, P.T., Gonçalves, I.C., De 3. Universidad de Guadalajara, UdeG, Av. Juarez N Oliveira, B.C.E.P.D., Machado, M.P. 976, Centro, 44100 Guadalajara, Jalisco, México Laboratório de Patologia - Instituto Oswaldo Cruz , 4. University of Colorado School of Medicine, IOC - FIOCRUZ, Av. Brasil 4365 Pav. Gomes de Farias UCDenver, 13123 E 16th Ave, Aurora, CO 80045, EUA The yellow fever vaccine is the only way to prevent this Bats are recognized as natural reservoirs for many viral infection. However, despite this vaccine production families of viruses which can cross species barriers and in chicken embryos for over seventy years, there are few cause emerging diseases of humans and animals. Species available pathological studies of this infection. The goal of the Chiroptera order harbor the biggest number and of this work is to elucidate the histopathological basis genetic diversity of coronavirus (CoV) and is currently of Gallus gallus infection by 17DD yellow fever virus. considered as a natural reservoir of all ancestors’ CoV Then, chicken embryos with 9 days of development of mammals. Coronaviruses are enveloped positive- were infected with this vaccine strain, collected 72 hours sense, single-stranded RNA viruses capable to infect post infection, and processed according to standard birds and mammals including humans. Over the past 10 years, two new highly pathogenic coronavirus sections were stained with HE or PAS and observed were detected in humans, CoV-SARS (Severe Acute paraffin embedding protocols. Five-micrometer thick Respiratory Syndrome) and the CoV-MERS (Middle East Respiratory Syndrome) both with a high mortality rate bynecrosis. brightfield However, microscopy. some developmental Histologically, changes the embryos were and possible originated from bats. Protection of humans showedobserved, mild by meansreaction, of withextensive no areas areas of of inflammation hematopoiesis or of natural reservoirs for such viruses and surveillance which were not observed in non-infected controls. againstfor host emergingjumping events. diseases Despite depends the great on identification diversity of andExtensive ossification areas inof the perivascular bone marrow hematopoietic of infected animals,activity CoV in bats, the large number of bat species in Brazil, were observed in the vitelline membrane of infected and the high prevalence of positive CoV species in the animals with a quantitative increase of erythrocytic world, studies about the occurrence and diversity of CoV and granulocytic populations that normally populate in bats in Brazil are scarce. We analyzed the presence this region. In addition, lung and gut epithelial cells of CoV RNA in intestinal samples from 97 bats of 10 budding was observed in some of the animals analyzed, bat species collected at the northwest Sao Paulo state which was accompanied by apparent vacuolization of in Southeast Brazil during 2007-2010. These bats had these cells. Liver, heart, spleen and kidneys showed no been submitted for rabies epidemiological surveillance. histological changes. In conclusion: a) the infection in RNA was extracted and and submitted to RT-PCR with this model is mild, lacking histopathological changes in random primers fallowed by PCR with primers targeting most organs, including the liver; b) apparently the 17DD RNA polymerase conserved gene. A possible novel alphacoronavirus was detected in Molossus rufus and hematopoiesis in the bone marrow of chicken embryos; Molossus molossus specimens both from adult male infectionand c) there anticipated was an theincrease beginning of hematopoiesis of ossification both and bats during 2010 that had been found in urban areas in yolk sac and in bone marrow of infected animals. in residential property. The 412 nucleotide sequence Altogether, the absence of hepatic response and the of this virus was most closely related to coronaviruses hematopoietic acceleration and exacerbation could be detected in Eptesicus fuscus bats in North America. of great importance to understand the virus production Continued surveillance of New World bats for novel CoVs in this model as well as the infection itself and demand and further research efforts to comprehend the genetic further investigation. diversity of CoV in different bat species and biomes from Brazil are needed. VV641 - Detection Of Coronavirus In Bats From Urban Area Of Sao Paulo State, Brazil. VV645 - Detection Of Emerging Viruses Goes, L.G.B., Durigon, E.L., Campos, A.C.A., Queiroz, Detected In Bat Populations From Morro L.H., Carvalho, C., Ruvalcaba, S.G., Dávalos, L.I.I., Jerez, Do Diabo State Park And Surrounding J.A., Dominguez, S.R. Human Settlements, São Paulo, Brazil Campos, A.C.A., Nava, A., Ferreira, F., Loh, E.H., 1. Universidade de São Paulo, USP, Av. Prof. Lineu Guimarães, M., Shimabukuro, J.S., Durigon, E.L., Daszak, Prestes, 1374, ICB-II, Cidade Universitária, São Paulo, SP P. 2. Universidade Estadual Paulista, UNESP, Rua Clovis 1. EcoHealthAlliance Organization, EHA, 460 West Pestana, 793, Araçatuba, SP, Brasil 34th Street - 17th Floor - New York, NY 10001-2320 2. Instituto de Ciências Biomédicas - Universidade de September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

253 Veterinary Virology: VV

São Paulo, ICB-USP, Av. Prof. Lineu Prestes, 1374-sala 225, CEP: 05508-900, São Paulo-SP 3. Faculdade de Medicina Veterinária-Universidade de São Paulo, FMVZ-USP, Av. Prof. Dr. Orlando Marques de Paiva, 87 CEP 05508 270 - São Paulo-SP 4. Departamento de Zoologia, Universidade Estadual Paulista, UNESP, Distrito de Rubião Junior S/N - CEP:18618- 970 - Botucatu, SP Emerging viruses are an important public health problem. Some animals, including bats, have an important role in the maintenance and transmission of viruses by acting as natural host reservoirs. The International Development Research Centre-IDRC in partnership with EcoHealth Alliance (EHA) and University of Sao Paulo-USP are conducting a research project to detect and identify different viruses that are circulating in bat populations in different-sized forest fragments in and around Morro do Diabo State Park, as well as the settlements located around these fragments. The bats were captured using horizontal and canopy mists nets and a harp trap during 10 days per month, between January and April 2013. Throat swabs, rectal swabs, blood and feces were collected, urine was also collected opportunistically. Currently, 203 individuals of different bat species have been analyzed. The samples were stored in liquid nitrogen immediately after collection, transported to the laboratory and transferred to ultra-low temperature freezer. Nucleic Acids were extracted from pooled samples using MagMax kit. The cDNA was generated with High Capacity cDNA Reverse Transciption kit. Flaviviruses and Filoviruses were tested by PCR reaction and Alphaviruses, Arenaviruses, Coronaviruses, Hantaviruses, Paramyxoviruses and Nipah viruses were tested by Nested-PCR. Coronaviruses were the most common viruses detected in seven bats (six alphacoronavirus and one betacoronavirus). Hantaviruses, Paramyxoviruses and Alphaviruses were detected by Nested-PCR and will be further analyzed by Sanger sequencing. These data are important, since these viruses could be responsible for future outbreaks and epidemics events in human populations.

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

255 Index

A Almeida, S.M. 27, 281 Araujo, O.C. 108, 192 Almeida, T.B. 181 Arbiza, J. 38, 292 Abrahão, J.S. 2, 11, 32, 36, 58, 66, 110, Almeida, T.N.V. 161 Ardisson-Araújo, D.M. 59, 77 119, 121, 122, 124, 125, 127, 130, Almeida, V.M.A. 5, 259 Ardisson-Araújo, D.M.P. 248, 251 131, 139, 200, 204, 233, 256, 265, Alves, A.A. 188, 189 Arenhart, S. 221 286, 290 Alves, C.D.B.T. 39, 293 Argolo, A.F.L.T. 196 Abrão, E.P. 186, 190 Alves, G.E.S. 32, 286 Arns, C.L. 24, 278 Abreu, C.M. 108 Alves, J.C.S. 138 Arns, C.W. 17, 20, 24, 115, 271, 274, 278 Abreu, E. 57, 70, 169 Alves, N.S. 104 Arreseigor, E. 186 Acosta, P.O.A. 152, 176, 182, 196, 198 Alves, P.A. 2, 11, 32, 122, 139, 256, 265, Arruda, E. 58, 59, 72, 77, 112, 136, 164, Affonso, M.Z. 37, 291 286 197 Afonso, L. 164 Alves, R. 181 Arruda, E.L. 233 Afonso, P.A. 102 Alves, R.P.S. 57, 65, 220 Arruda, J.G.F. 209 Afonso, P.P. 89 Alves, T.M.A. 108 Arruda, L.B. 91 Agapito, R. 7, 261 Amado, L.A.L. 166 Arruda, L.M.F. 203, 209 Aguiar, D.M. 5, 259 Amako, Y. 139 Arruda, M. 181 Aguiar, E.R.G.R. 125 Amaral, C.D. 200 Arruda, R.A. 171 Aguiar, R.S. 57, 65, 108, 144 Amarilla, A.A. 57, 64 Ashimine, R. 6, 260 Aita, C. 16, 270 Ambrósio, L.L.D. 36, 127, 200, 290 Assis, A.S.F. 153 Albanese, J.M. 123 Amorim, A.R. 11, 15, 16, 154, 172, 265, Assis, F.L. 110, 139, 233 Albernaz, F.P. 97 269, 270 Assis, R.M.S. 57, 71 Alberto Wolfenson, A. 206 Amorim, J.H. 57, 65, 220 Assunção, I.P. 240, 241, 242, 243, 244 Albina, E. 20, 221, 274 Amorim, L.M.F. 126 Assunção-Miranda, I. 107 Albuquerque, A.C.C. 160, 161 Amorim, L.S.C. 113 Astocondor, M.M. 217 Albuquerque, L.C. 236, 243 Andrade, A.A. 180, 192 Ataide, A.C.Z. 226 Alcântara, B.K. 26, 34, 35, 280, 288, 289 Andrade, J.S.R. 57, 71, 155 Attias, M. 93, 102 Alcântara, L.C. 144 Andrade, M.S. 248 Augusto, A. 10, 264 Aleluia, M.M. 144 Andrade, P.D. 210 Augusto, L.T.S. 130, 131 Alencar, A.L.F. 20, 274 Andrioli, A. 29, 31, 283, 285 Avila Machado, R.A. 13, 267 Alencar, N.E. 245, 246 Angel, T. 207 Azevedo Filho, J.A. 238, 239 Alexandre, M.A.V. 238, 239 Anselmo, G.C. 235 Azevedo, I.C. 20, 42, 274, 296 Alfenas-Zerbini, P. 59, 76, 241 Anselmo-Lima, W. 136 Azevedo, K.M.L. 151 Alfieri, A.A. 16, 21, 23, 25, 26, 28, 29, 33, Anselmo-Lima, W.T. 58, 72, 164, 197 Azevedo, M.L.B. 166 34, 35, 37, 59, 79, 80, 270, 275, 277, Antunes, E. 183 279, 280, 282, 283, 287, 288, 289, Antunes, J.R. 39, 293 B 291 Anziliero, D. 3, 87, 257 Alfieri, A.F. 16, 21, 23, 27, 29, 33, 34, 35, Baccin, T.G. 136, 174 Aquino, A.A. 205 Balbo, L.C. 21, 26, 28, 29, 59, 80, 275, 280, 59, 79, 270, 275, 277, 281, 283, 287, Aquino, V.C. 57, 64 288, 289 282, 283 Aquino, V.H. 87 Baldi, C. 215 Alfonso, H.L. 57, 64 Aragão, F.J.L. 236, 243, 249 Almeida, A.C.S. 31, 36, 285, 290 Bandeira, A. 162 Aragão, G.C. 167 Báo, S.N. 253 Almeida, A.J. 148, 151, 152, 154, 166 Aragão-Silva, C.W. 251 Almeida, A.M.R. 235 Baptista, M.L. 171 Araki, C.S. 143, 211 Barardi, C.R. 58, 67, 121 Almeida, C.M.C. 139 Arantes, T.S. 30, 32, 284, 286 Almeid, A.C.S. 22, 276 Barardi, C.R.M. 56, 61, 126, 127 Araujo, A.S. 91 Barbizan, T. 57, 65 Almeida, G.M. 11, 121, 122, 265 Araujo, G.C. 91 Almeida, G.M.F. 94, 102, 119, 204 Barbosa, A.A.S. 22, 59, 78, 276 Araujo, J. 5, 14, 259, 268 Barbosa, E.C. 108 Almeida, J.E.M. 245 Araújo, J.M.G. 205, 206, 207 Almeida Junior, R.F. 205 Barbosa, G.S. 235 Araújo Jr., J.P. 4, 10, 11, 22, 23, 31, 36, 258, Barbosa, J.E.F. 126 Almeida, L.G.N. 95, 96 264, 265, 276, 277, 285, 290 Almeida, L.L. 40, 41, 294, 295 Barbosa, M.L. 217 Araujo Junior, L.D. 37, 291 Barbosa, M.R.F. 58, 68 Almeida, L.T. 83, 84 Araújo, L.A. 160, 179, 180, 192 Almeida, R.S. 20, 274 Barbosa, R.P.A. 217 Araujo, M.S. 193 Barbosa-Stancioli, E.F. 22, 59, 78, 116, Almeida, R.W. 151 Araujo, N.M. 57, 71, 108, 192 Almeida, S.E.M. 125 178, 276 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

256 Index

Barbosa, V.G. 228 Bittar, C. 104, 142, 143 Brito, C.B. 192, 193 Barbosa, V.M. 194 Bizerra, R.S.P. 57, 65, 220 Brito, R.L.L. 31, 285 Barboza, J.D.B. 209 Blanton, R.E. 204 Brito, W.M.E.D. 17, 18, 271, 272 Barcellos, C.D.L. 239 Bodnar, L. 26, 27, 59, 80, 280, 281 Bronkhorst, D.E. 25, 35, 37, 279, 289, 291 Barcelos, C. de L. 59, 75 Boff, A. 26, 280 Bronzato, C.V.O. 25, 279 Barcelos, I.O. 112, 116 Boiteux, L.S. 59, 75, 240, 247 Bronzoni, R.V.M. 174, 181 Barletta, V.H. 153 Bolpetti, A.N. 169, 199 Brown, D. 58, 73 Barnabé, A.C.S. 24, 115, 278 Bomfim, G.F. 24, 115, 278 Brown, K. 166 Barreiros, M.A.B. 59, 79 Bonafe, C.F.S. 30, 284 Bruckner, F.P. 59, 76, 241 Barreto-Vieira, D.F. 86 Bonanno, V.M.S. 58, 68 Brum, M.C.S. 3, 36, 257, 290 Barriolli, C. 254 Bonatelli, M. 175 Brunoro, G.V.F. 180 Barros, A.P.O. 241 Bonatelli, M.Q.A. 216 Budaszewski, R.F. 39, 41, 293, 295 Barros, C.S. 112 Bonfim, C.M. 178, 209 Bueno, L.M.T. 191 Barros, J.A. 182 Bonilha, J.L. 209 Burlandy, F.M. 158 Barros, J.J.F. 185, 192 Bonjardim, C.A. 36, 57, 64, 97, 98, 119, Buzatto, G.P. 136 Barroso, S.P.C. 90, 222 122, 124, 127, 193, 204, 233, 290 Barros, R. 57, 70 Bonjardin, C.A. 195, 203 C Barros, R.J.S. 148, 169 Bonon, S. 175, 176, 214, 215 Cabral-Castro, M.J. 195 Barth, O.M. 86 Bonon, S.H.A. 211, 215, 216 Cadore, G.C. 3, 257 Basso, C.R. 4, 258 Bonvicino, C.R. 23, 277 Caetano, K.A.A. 173, 179, 180 Basso, R. 191 Boratto, P.V.M. 58, 66, 122, 124, 125 Cahú, G.G.M. 160 Bastos, R. 107 Boratto,P.V.M. 121 Caiado, B.V.R. 183 Batalha, P. 113 Borborema, S.E.T. 134 Caires, A.J. 85 Batista, A.R.S. 248 Borges, I.A. 36, 127, 130, 131, 200, 290 Caldas, G.C. 154 Batista, H.B.C.R. 5, 14, 259, 268 Borges, J. 118 Caldas, S. 226 Batista, I.C.A. 102 Borges, L.F. 184 Calmon, M.F. 89, 163, 209 Batista, M.N. 87, 99, 100 Borges, L.G.A. 156 Calzavara-Silva, C.E. 102, 108 Batista N.J.M. 29, 283 Borges, MA.G.Z. 103 Camargo, B.R. 222 Bauermann, F.V. 2, 3, 256, 257 Borja, N. 217 Camargo, C.N. 198, 200 Baumworcel , N. 8, 262 Born, P.S. 201 Camargos, M.F. 19, 20, 42, 273, 274, 296 Bazzo, M.L. 151 Bortoluzzi, M. 125, 126, 224 Camillo, S.C.A. 8, 25, 262, 279 Belgini, D.R.B. 123 Botelho, J. 146, 157 Camilo, H.P. 209 Bellei, N. 198, 199, 200, 225 Botelho, L.F. 193, 194, 227 Camini, F.C. 83, 84 Bello, G. 57, 64, 101, 108, 136, 201 Botelho, L.M. 94, 119, 204 Campanha, J.E.T. 28, 29, 35, 59, 80, 282, Benevides Matos, N. 194 Botelho, L.P. 114 283, 289 Bentes, G.A. 58, 73, 225 Botosso, V.F. 226 Campo, D.S. 143 Bernardes, C.S. 83, 84 Bottecchia, M. 212 Campos, A.C.A. 45, 299 Bernardes, N.T.G.C. 31, 285 Bottino, F.O. 9, 59, 78, 263 Campos, F.S. 13, 27, 30, 267, 281, 284 Bernardino, A. 118 Bozza, F. 222 Campos, G.M.M. 146 Bersaneti, G.T. 231 Braga, A.C.S. 87, 99, 100, 150 Campos, G.R.F. 104 Bertani, G.R. 102, 222 Braga, C.J.M. 109 Campos, G.S. 7, 12, 162, 261, 266 Beserra, L.A.R. 31, 285 Braga, P.R.C. 39, 293 Campos, R. 159 Beutemmüller, E.A. 59, 80 Braga, V.L.A. 97, 98 Campos, R.K. 58, 66, 121, 122, 125 Beuttemmüller, E.A. 25, 279 Branco, M.S.D. 205 Campos, R.M. 158 Beuttemmüller, E.D. 33, 34, 287, 288 Brandão, C.F. 12, 266 Campos, S.P.C. 57, 66, 93, 95, 104 Bezerra, D.A.M. 41, 295 Brandão, C.J.F. 162 Canal, C.W. 39, 41, 293, 295 Bezerra Junior, R.B. 29, 283 Brandão, L.R. 122 Candeias, J.M.G. 169, 199 Bianchi, E. 117, 224 Brandão, P.E. 6, 22, 31, 36, 260, 276, 285, Cañedo, A.D. 59, 75, 239 Bianconi, M.L. 97 290 Canestri, L.O.R. 178 Bicalho, J.M. 13, 267 Brasileiro, A.C.M. 59, 75 Cantergi, D.C.M. 17, 20, 271, 274 Bisch, P.M. 146 Braz, A.S.K. 140 Caprez, M. 126 Biselli, J. 158 Briggs, C. 58, 73 Cardoso, A.J.L. 216 Bisordi, I. 171, 194 Brindeiro, R.M. 181 Cardoso, B.C. 133 Bispo, S.M. 144 Brioso, P.S.T. 242 Cardoso, B.F. 132, 203 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

257 Index

Cardoso, C.C. 181 Castro, T.X. 8, 9, 59, 78, 151, 262, 263 Costa, A.G. 32, 59, 79, 286 Cardoso, D.D.P. 161, 165, 187 Catarino, A.M. 232 Costa, C.A. 216 Cardoso, E.S.C. 150, 155 Catharino, A.M.R. 25, 279 Costa, C.D. 205 Cardoso, M.C. 155 Catro-Jorge, L. 212 Costa, C.M. 141 Cardoso, S.A. 84, 96 Cavalcante, M.D. 209 Costa, D.M.P. 205 Cargnelutti, J.F. 4, 258 Cavalcante, R.V. 11, 23, 265, 277 Costa, E.A. 217 Carline, G.J.V. 233 Cavalcanti, J.F. 106, 107, 111 Costa, E.M. 8, 9, 59, 78, 262, 263 Carlos Alonso, C. 206 Cavalcanti, S. 164 Costa, E.V. 58, 67, 158 Carmo, A.C.V. 227 Cecilia Cuffini, C. 206 Costa Filho, R. 157 Carmo, A.P. 153, 223 Cecílio, A.B. 226 Costa, G.B. 2, 36, 130, 131, 200, 256, 290 Carmona, R.C.C. 56, 58, 61, 72, 172 Chagas, R.R. 159 Costa, L.C.F. 95, 96, 142 Carneiro, B.M. 87, 99, 100, 150, 163 Chattopadhyay, A. 212 Costa, M.F. 59, 75, 239 Carneiro, M.A.S. 160, 168, 173, 179, 180, Chaves, A.L. 231 Costa, M.M. 177 192 Chaves, A.L.R. 237, 238, 239, 251 Costa, S. 175, 176, 214, 215 Carnieli-Jr., P. 5, 14, 259, 268 Chaves, L.C.S. 226 Costa, S.C.B. 210, 211, 215, 216 Carrieri, M.L. 14, 268 Chaves, L.R.A. 56, 61 Costa, T.B.F. 108 Carromeu, C. 109 Chaves, P.P.N. 233 Costa, U.M. 33, 287 Carvalho, A.C. 133 Chiang, J.O. 149 Costa, V.D. 177 Carvalho, A.G.O. 102, 222 Chiappetta, C.M. 13, 267 Costa, V.G. 177, 190 Carvalho, A.L.A. 233, 237 Chiaravallori-Neto, F. 110 Costenaro, J.G. 27, 32, 281, 286 Carvalho, C. 45, 299 Chiaravalloti-Neto, F. 58, 72, 109 Cotrim, M.T. 217 Carvalho, C.A.M. 57, 64, 98, 104 Chiarini, L.B. 57, 66 Cottorello, A.C. 19, 273 Carvalho, C.M. 92, 103, 235, 236 Chikara, M. 238 Couceiro, J.N.S.S. 154, 222 Carvalho-Costa, F.A. 57, 71, 157 Chone, C.T. 216 Couto-Fernandez, J.C. 141 Carvalho, C.P.T. 181 Ciacci-Zanella, J.R. 7, 15, 261, 269 Craveiro, S.R. 253 Carvalho, E.D. 157 Cibulki, S.P. 44, 298 Criado, M.F. 59, 77, 112, 197 Carvalho, I.P. 153 Cibulski, S.P. 40, 42, 59, 81, 294, 296 Cristina, J. 58, 68, 186 Carvalho, J.V. 113 Cilli, A. 56, 61 Cruz, A.C.R. 209 Carvalho, L.W.T. 137 Cintra, A.C.O. 87 Cruz, H.M. 161 Carvalho-Mello, I.M.V.G. 143 Cirne-Santos, C.C. 112 Cruz, L.E.A.A. 174 Carvalho, N.D. 83 Claudia Amusategui, C. 206 Cruz-Oliveira, C. 107 Carvalho, S.L. 236 Claus, M.P. 16, 59, 79, 270 Cubel Garcia, R.C.N. 8, 9, 59, 78, 151, Carvalho, T.C.N. 147 Cobucci, R.N.O. 206, 207 262, 263 Carval, R.D. 17, 271 Codignoto, P.S.C. 104 Cuffini, C. 207, 208 Caserta, L. 17, 271 Coelho, H.S.M. 177 Cunha, A.C. 113 Caserta, L.C. 20, 274 Coelho, L.F.L. 95, 96, 142, 143 Cunha, A.G. 210 Cassiano, J.H. 110 Coêlho, M.R.C.D. 138, 160 Cunha, A.M.G. 210 Castanho, M.A.R.B. 107 Coimbra-Motta, A.R.C. 159 Cunha, C.A. 131 Castello-Branco, L.R. 113 Colariccio, A. 231, 237 Cunha, E.M.S. 39, 293 Castilho, J.G. 14, 268 Colina, R. 58, 68, 186 Cunha, J.M.T. 154 Castillo-Urquiza, G.P. 59, 76, 235, 236, Colmanetti, T.C. 209 Cunha, M.P. 161, 187, 213 252 Colodi, F. 111 Cunha, M.S. 194 Castro, A. 136 Colodi, F.G. 106 Cunha-Pereira, A.V. 193, 194 Castro, C.C. 26, 91, 99, 280 Colombo, T.E. 109, 135, 143, 158, 174, Cunha, R.D. 57, 65 Castro, F.L. 27, 32, 281, 286 211 Curi, B.M. 109 Castro, G. 38, 292 Comerlato, J. 13, 20, 221, 267, 274 Cursino, A.E. 224 Castro, I.A. 161, 187, 213 Conceição, A.O. 104 Curti, C.P. 194 Castro-Jorge, L.A. 186, 190 Cordeiro, J.S. 152, 176 Curti, S.P. 83, 134, 227 Castro, L.S. 172 Cordeiro, M.T. 220 Cury, A.A.F. 174 Castro, M.C. 17, 18, 271, 272 Cornélio, M.L. 84 Castro, M.E.B. 253 Corrêa, A.A. 124 D Castro, M.G. 93, 182 Correa, L.V.A. 133 Da Costa, L.A. 56, 61 Castro, P.H.G. 106 Corrêa, R.A. 91, 99 Da Fonseca, F.G. 22, 59, 78, 85, 153, 276 Castro-Souza, L. 151 Correa, V.C. 123 Daian, D.S.O. 59, 78, 153 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

258 Index

Dalla Vecchia, A. 117, 224 De Oliveira, A.S.L. 169 Dos Santos, T.A. 217 Damaso, C. 86, 89, 90, 91, 93, 102 De Oliveira, B.C.E.P.D. 45, 299 Driemeier, D. 41, 295 Damaso, C.R. 34, 288 De Oliveira, D.D.B. 217 Drummond, B.P. 200 Damazo, N.A. 126 De Oliveira, J.C. 57, 69, 165 Drumond, B.P. 24, 92, 103, 110, 146, 157, D’Andrea, P.S. 23, 277 De Oliveira, K.E.G. 217 278 Danesi, V.L.B. 183 De Oliveira, M.P. 185 Duarte, C.R.A. 33, 287 Daniel, G.T. 39, 293 De Paiva, T.M. 134 Duarte, L.M.L. 231, 237, 238, 239 Da Poian, A.T. 107, 109 De Paula, F.C. 140 Duarte, L.P. 92 D’Arc, J.P.M. 56, 61 De Paula, N.A. 211 Duarte, M.E.R. 86, 106, 111 Daròs, J.A. 56, 61 De Paula, S.O. 42, 84, 96, 123, 201, 296 Duarte, V.S. 42, 201, 296 Da Silva, A.S. 223 De Paula, V.S. 7, 57, 69, 141, 147, 148, Ducatti, D.R.B. 111 Da Silva, D.B.B. 134 149, 159, 161, 172, 261 Duffy, S. 237 Da Silva, E.E. 58, 67 Depiere, S. 158 Dulgheroff, A.C.B. 12, 184, 187, 191, 266 Da Silva, E.F. 159, 165 De Prato, R.F. 207 Dupont, P.M. 39, 41, 293, 295 Da Silva, G.C. 213 De Sá, J. 168 Duque, E. 146 Da Silva Junior, H.C. 228 De Santis, B.G. 163 Durães-Carvalho, R. 20, 24, 274, 278 Da Silva, L.A. 231 De Seixas, M.M.M. 18, 272 Durigon, E.L. 5, 14, 18, 45, 131, 189, 209, Da Silva, L.L. 113 De Souza, E.V. 213 217, 259, 268, 272, 299 Da Silva, L.L.P. 112 De Souza, F.O. 42, 201, 296 Da Silva, M.L. 146 De Souza, G. 16, 270 E Da Silva, M.R.S. 105, 117 De Souza, J.M. 252 Eiras, A.E. 58, 72, 109, 110 Da Silva, T.G. 44, 298 De Souza, L.M. 159 Eiras, M. 56, 61, 231, 232, 237, 251 Daszak, P. 45, 299 De Souza Luna, L.K. 164 Elmahdy, E.M. 121 Dávalos, L.I.I. 45, 299 Deus, D.R. 123 Elmahdy, E.M.I. 58, 67 D’Azevedo, P.A. 156 Dezengrini-Slhessarenko, R. 132, 133, Esberard, E.B.C. 177 De Abreu, L.P.P.M. 45, 299 202, 203 Escremim de Paula, F.E. 58, 72 De Aguiar, S.F. 159 Dezen, S. 16, 270 Esnarriaga, E.S. 23, 277 De Alcântara, B.K. 23, 35, 277, 289 Dhalia, R. 183, 220 Espada, S.F. 88, 103 De Almeida, A.J. 57, 69, 141, 170, 177 Dias, R.A. 5, 259 Espíndola, J.C. 16, 59, 79, 270 De Almeida, R.S. 221 Dias, R.C. 17, 18, 271, 272 Espinoza, L.R.L. 6, 260 De Araujo, J. 18, 272 Dias, R.P. 31, 285 Espírito-Santo, M.P. 151, 152, 166 De Assis, F.L. 125 Dias, R.S. 42, 123, 201, 296 Espósito, D.L. 186, 190 De Azevedo, M.L.B. 228 Dibo, M.R. 58, 72, 109, 110 Esteves, P.A. 39, 56, 59, 61, 81, 293 De Azevedo, S.M.J. 18, 272 Diminitrova, Z.E. 143 Decano, N. 3, 257 Diniz, F.A. 180 F De Carvalho, I.M.V.G. 181 Divino, F.C.P. 84 De Carvalho, L. 116 Dobao, E. 164 Fabres, R.B. 16, 125, 126, 270 De Carvalho-Mello 142 Doltrário, A.B. 164 Fabrício-Silva, G.M. 57, 69 De Carvalho, T.C.N. 56, 61 Domingues, A.L.S. 12, 184, 187, 191, 266 Fabris, D.L.N. 57, 65 De Castro, T.X. 166 Domingues, C.F. 9, 263 Faccin-Galhardi, L.C. 88, 103 De Fátima, A. 178 Domingues, C.S. 25, 279 Facimoto, C.T. 26, 34, 59, 80, 280, 288 De Filippis, A.M.B. 131, 163 Domingues, R.A.B. 106 Fagundes, E.M.S. 116 De Freitas, G.M.A. 217 Dominguez-Souza, B.F.C. 214 Fagundes, L.G.S. 143 De Freitas, J.H.R. 228 Dominguez, S.R. 45, 299 Fahl, W.O. 14, 268 Delatorre, E. 136 Do Ó, K.M.R. 159, 192, 212 Fajardo, T.C.G. 211, 215 De Lima, T.G. 36, 290 Dornas, F.P. 121, 122, 124 Fajardo, T.V.M. 59, 74, 232 Del-Rios, N.H. 160 Do Rosario, J.S.C. 217 Falkenberg, S.M. 3, 257 Del-Rios, N.H.A. 168, 179, 180 Dos Santos, A. 172 Fallavena, P.R.V. 156 Delvaux, N. 177 Dos Santos, A.E. 105 Fantinatti-Garboggini, F. 24, 115, 278 Delvecchio, R. 108 Dos Santos, F.B. 131, 163, 182 Faria, D. 118 De Magalhães, A.V.M. 217 Dos Santos, G.R. 233 Faria, F.M. 197 De Matos, M.A.D. 185 Dos Santos, M.A.C. 185 Faria, L.T. 10, 264 De Mesquita, J.F. 90 Dos Santos, M.G. 56, 61 Faria, N.R.C. 182 De Moraes, A.A. 185 Dos Santos, P.V.W.G. 211 Farias, K.J.S. 205

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

259 Index

Farias, S.L. 137 Figueiredo, P.O. 11, 36, 265, 290 Fritzen, J.T.T. 25, 33, 34, 279, 287, 288 Farinha-Arcieri, L.E. 109 Filho, L.F.P. 108 Frutos, M.C. 206, 207, 208 Fávaro, E. 135 Filho, S.A.V. 92 Fumagalli, M.J. 95, 96 Fávaro, E.A. 58, 72, 109, 110 Filho, S.L.M. 142 Fumian, T.M. 57, 70, 148, 155, 169 Fedullo, L.P. 10, 264 Filippis, A.M.B. 182 Furlan, M. 139 Feitosa, A.L.P. 186, 190 Finger, P.F. 26, 280 Furtado, A.M.B. 59, 79 Felipe, N.S. 209 Fink, M.C.D.S. 130 Felippe, L.G. 139 Finoketti, F. 27, 39, 281, 293 G Felippe, P.A.N. 17, 20, 271, 274 Fioretti, J.M. 167 Gaban, L. 177 Fellipe, P.A.N. 24, 278 Firpo, R.M. 30, 284 Gabbay, Y.B. 41, 56, 57, 61, 70, 123, 144, Féres, V.C.R. 196 Fischer, G. 26, 91, 99, 280 145, 147, 148, 167, 169, 295 Fernandes, C.A. 159 Fleck, J.D. 125, 126 Gadelha, S.R. 144, 150, 155 Fernandes, C.A.S. 151, 152 Flor, E.C. 177 Galbino-Costa, S.B.F. 247 Fernandes, C.F. 58, 74, 227 Florêncio, C.M.G.D. 189 Galinari, G.C.F. 13, 267 Fernandes, F.M.C. 12, 162, 266 Florentino, K. 27, 281 Galler, R. 228 Fernandes, F.R. 252 Florentino, K.E. 33, 34, 35, 287, 288, 289 Galosi, C.M. 2, 256 Fernandes, G.C. 157 Flores, A.S. 217 Galvão-Castro, B. 144, 210 Fernandes, J. 23, 277 Flores, E. 5, 221, 259 Galvino-Costa, S.B.F. 243, 245, 246 Fernandes, J.E.A. 59, 77 Flores, E.F. 2, 3, 4, 87, 256, 257, 258 Ganime, A.C. 58, 73, 157 Fernandes, J.R.C. 247 Flores, G.L. 165 Ganova-Raeva, L.M. 143 Fernandes, J.V. 205, 206, 207 Flores P.P. 159 Garcez, R.M. 231 Fernandes, M.C. 86 Fongaro G. 56, 61 Garcia, A.W.A. 13, 267 Fernandes, M.H.V. 91, 99 Fongaro, G. 58, 67, 121 Garcia, C.C. 217 Fernandes, M.J.B. 85, 104 Fonseca, B.A.L. 186, 190 Garcia, M. 58, 68, 186 Fernandes, T.A.A.M. 206, 207 Fonseca, B.P.F. 208 Garcia, R.C.N.C. 166 Ferraz, L.E.S. 34, 288 Fonseca, F.G. 122, 223 Garcia, S.C. 58, 68 Ferreira, D.F. 90, 105, 117, 126, 159, 222 Fonseca Júnior, A.A. 19, 273 Gardinali, N.R. 171 Ferreira, F. 45, 299 Fonseca, L.A.B.V. 123 Gaspar, C.H.P. 224 Ferreira, H.L. 17, 20, 271, 274 Fonseca, L.N. 59, 75 Gaspar, L.P. 57, 66 Ferreira, J.C. 14, 182, 268 Fonseca, M.E.N. 240 Gasparotto, L. 242 Ferreira, J.G.G. 102 Fonseca, P.D.L. 137 Gava, D. 7, 15, 261, 269 Ferreira, L.C.S. 57, 65, 220 Fontana, T. 126 Gazzinelli, R.T. 217 Ferreira, L.G. 111 Fontoura, F.E. 30, 284 Geddes, V.E.V. 144 Ferreira, M.S. 106, 149 Forell, F. 33, 287 Gellen, L.F.A. 233, 237 Ferreira, M.S.R. 155, 167 Fornells, L.A.M.G. 11, 265 Geloneze, B. 170 Ferreira, M.V.M. 104 Fortes, I.M. 59, 76 Geraldino Duarte, P.S. 243, 245, 247 Ferreira, P.C.P. 11, 36, 58, 66, 83, 84, 94, Fortunato, E.C. 6, 8, 260, 262 Gerhardt, D. 26, 280 102, 110, 119, 121, 122, 124, 125, Fossey, M.A. 84 Germano, F.N. 191 127, 130, 131, 193, 204, 224, 233, Fraiha, A.L.S. 59, 79 Giampani, J.S. 231 265, 290 França, D.D.S. 160, 173 Giehl, I. 126 Ferreira, P.N. 83, 84 França, R. 212 Giehl, I.C. 117, 224 Ferreira, P.P. 195, 203 Francisco, F.L.M. 108 Gil, L.H. 221 Ferreira, T.A.R. 224 Franco, A.C. 13, 27, 30, 32, 39, 40, 44, 59, Gil, L.H.V.G. 102, 114, 178, 222 Ferreira, T.P.S. 85 81, 221, 267, 281, 284, 286, 293, Giongo, V. 116, 118, 126 Ferro, M.M.M. 240, 241 294, 298 Giovanni, D.N.S. 227 Fiaccadori, F.S. 161, 165, 187, 213 Franco, G.M. 178 Girard, R.P. 123 Fialho, A.M. 57, 71 Franco, L. 2, 256 Glinsk, J. 108 Figueira, A.R. 243, 245, 246, 247 Franco-Luiz, A.P.M. 121, 139 Gobatto, D. 56, 61, 251 Figueiredo, C.A. 83, 227 Freire, J.M. 107 Godinho, M.T. 234 Figueiredo, C.M. 107 Freire, M.S. 57, 66, 95 Godoi, A.M. 88, 103 Figueiredo, E.F. 12, 187, 191, 266 Freitas, B.F. 97 Goes, L.G.B. 45, 299 Figueiredo, L.B. 139, 192, 193, 195, 203, Freitas, L.A. 26, 28, 280, 282 Golin, R.O. 59, 75, 239 224 Freitas, L.F. 21, 275 Gomes, A.B.V.T. 96 Figueiredo, L.T.M. 57, 64, 70, 216 Freitas, M.E. 19, 273 Gomes, A.M.O. 57, 64, 66, 93, 95, 97, 98, September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

260 Index

104 Heck, T.M.S. 125 Kanitz, F.A. 5, 221, 259 Gomes, A.V.B.T. 142, 143 Heinemann, M.B. 19, 223, 273 Kaplan, M.A.C. 116 Gomes, D.E. 84, 88 Heinen, L.B.S. 132, 133, 202, 203 Karasev, A.V. 243 Gomes, R.A. 116 Heneine, L.G.D. 223 Kassar, T.C. 102 Gomes, S.A. 108, 173, 175, 184, 185, 228 Henzel, A. 58, 68, 117, 125, 126, 224 Katz, G. 172 Gomez, M.M. 57, 71 Heringe, M. 131 Kawamoto, A.H.N. 38, 292 Gonçalves, B.S. 57, 66 Heringer, M. 163 Kawanami, A.E. 59, 77 Gonçalves, I.C. 45, 299 Hernandez, R. 58, 73 Kerr, L.R.F.S. 173 Gonçalves, M. 57, 70, 144 Higa, L.M. 109 Khudyakov, Y. 143 Gonçalves, R.B. 104 Hoffmann, L. 34, 98, 146, 156, 213, 288 Kiguen, A.X. 206, 207, 208 Gonçalves, V.S.P. 5, 259 Holanda, R.J. 227 Kluge, M. 16, 58, 68, 125, 126, 270 Gondim, B.H. 132, 133, 202, 203 Honda, E.R. 84, 201 Knak, M.B. 27, 32, 281, 286 Gondim, B.H.F. 202 Hongwei, J. 10, 264 Kohn, L.K. 24, 115, 278 Gonzalez, E.T. 2, 256 Hooper, K. 166 Komar, N. 37, 188, 291 Gorini da Veiga, A.B. 174 Hora, A.S. 22, 36, 276, 290 Koolen, H.H.F. 115 Goudouris, E.S. 154 Horvat, B. 20, 274 Kotait, I. 14, 268 Gouvea M.N. 226 Howard, J.C. 127 Kowalski, A.P. 5, 259 Gouvea, V. 12, 266 Huatuco, E.M.M. 217 Kowalsky, A.P. 221 Gozzo, F.C. 115 Hubner, S.O. 30, 284 Kozlowski, A.G. 168, 185, 192 Graeber-Gerberding, M. 159 Hübner, S.O. 26, 91, 99, 280 Kretzmann, N.A. 174 Granados, O.F.O. 39, 293 Hugo Bolatti, H. 206 Kroon, E.G. 2, 11, 32, 36, 58, 66, 92, 94, Granato, C. 198, 199 Huitt, E. 58, 73 103, 108, 110, 119, 121, 122, 124, Granato, C.F.H. 168, 183, 225 Hurtado, R. 14, 268 125, 127, 130, 131, 139, 142, 146, Granja, F. 152, 176, 182, 196, 198 Hurtado, R.F. 18, 272 157, 192, 193, 195, 200, 203, 204, Gregianini, T.S. 136, 156, 174 224, 226, 233, 256, 265, 286, 290 Gregori, F. 6, 31, 260, 285 I Kunz, A. 121 Grinsztejn, B. 147 Ibelli, A.M.G. 7, 261 Kupper, D.S. 178 Guatura, S.B. 198, 199 Igloi, Z. 139 Kurissio, J.K. 10, 264 Guedes, M.I.M. 32, 286 Inoue-Nagata, A.K. 238, 243, 248 Kuster, R.M. 105, 117 Guedes, M.I.M.C. 59, 79 Kwiatek, O. 20, 274 Guedes, P.T. 45, 299 J Guerra, S.F.S. 169 L Jácome, F.C. 86 Guerrero, M.C. 105 Lacerda, A.L. 240 Guimarães, G.F. 178 Jardim, A.C.G. 87, 139, 142, 143 Javier Aguilar, J. 206 Lacerda, A.L.M. 59, 75 Guimarães, J.R. 58, 73, 223, 225 Ladeira, L.O. 85 Guimarães, K.M.C. 241 Jerez, J.A. 45, 299 Jesus, L.F. 16, 117, 125, 270 Lago, B.V. 108, 173, 175 Guimarães, L.G.L. 85 Laguardia-Nascimento, M. 22, 59, 78, 276 Guimarães, M. 45, 299 Jesus, T.L.M. 25, 35, 279, 289 Johann, S. 94 Lamounier, T.A.C. 222 Guimarães, T. 183 Lampe, E. 151, 152, 154, 159, 161, 165, Gulin, A. 176 Jordão, L.J. 244 Jorge Paván, J. 206 166, 170, 177, 180 Guloch, R. 136 Laneuville, V.T. 113 Guterres, A. 23, 277 Jr., J.L.S.A., 203 Jr. Mouta, S.S. 228 Lanzarini, N.M. 58, 73, 223, 225 H Juan Ferrari, J. 206 Lara, M.C.C.S.H. 39, 293 Juliano, R. 37, 188, 291 La Scola, B. 121, 122, 124, 125 Hachich, E.M. 58, 68 Junior, C.J.C.Z. 142 Laura, S. 101 Haddad, J.P.A. 5, 259 Júnior, E.C.S. 148 Lauretti, F. 212 Hanson, A.M. 163 Junior, L.B.D. 137 Lavatori, M.F.H. 228 Harakava, R. 56, 61, 231, 237, 251 Junqueira, B.R.T. 248 Leal, R.M. 8, 9, 262, 263 Harmon, A. 2, 256 Junqueira, D.M. 27, 281 Leão, F.B. 213 Harris, M. 99, 100, 139 Justino, M.C.A. 56, 57, 61, 70, 169 Leastro, M.O. 250 Harsi, C.M. 225 Lebre, S.N. 4, 258 Hasselmann, B. 149 K Leitão, V.M.G. 161 Headley, S.A. 25, 26, 35, 37, 59, 80, 279, Leite, J.P. 58, 73 280, 289, 291 Kaiano, J.H.L. 167 Leite, J.P.G. 9, 57, 58, 68, 71, 155, 157, 186, September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

261 Index

223, 263 Lizasoain, A. 58, 68, 186 Marchevsky, R.S. 166 Leite, J.P.G.L. 118 Lobato, Z.I.P. 32, 36, 59, 79, 286, 290 Marcucci, M.C. 26, 280 Leite Jr, R.P. 231 Loh, E.H. 45, 299 Mariano, A.P.M. 135 Leite, R.C. 5, 13, 259, 267 Lopes, A.O. 147 Marilia, F.C. 101 Leite, S.M.S. 200 Lopes, A.Z. 148 Marinho, P.E.S. 94, 224 Leme, R.A. 21, 26, 28, 29, 275, 280, 282, Lopes, L.C. 123 Marinho, T.A. 185, 192 283 Lopes, M.F. 213 Marin, L.J. 144, 150, 155 Lemes, L.G.N. 165 Lopes, N. 88, 103 Marins, K.S. 193, 195, 203 Lemos, A.S. 141 Lopes Neto, E.P.A. 138 Marluce, M.M. 209 Lemos, E.R.S. 23, 277 Lopes, O.G.A. 217 Marque, M.J. 56, 61 Lemos Júnior, M.A. 150 Lopez, P. 186 Marques, B.L.C. 154, 159, 161 Lemos, P.P.F. 253 Lorena, L.G.M. 126 Marques, C. 200 Lenoch, C.Y. 33, 287 Lorenzetti, E. 21, 26, 28, 29, 35, 59, 80, Marques, C.F.S. 208 Lenoch, R. 16, 59, 79, 270 275, 280, 282, 283, 289 Marques, E.T.A. 178, 183, 220 Leocádio, V.A.T. 22, 59, 78, 276 Lotufo, J.P.B. 131 Marques, J.M.S. 180 Levis, S. 23, 277 Loureiro, B.O. 208 Marques, J.T. 125 Lewis-Ximenez, L.L. 57, 69, 140, 141, 149, Loureiro, E.C.B. 145 Marques, M. 155 151, 152, 154, 159, 161, 165, 166, Louzeiro, L.L. 160 Marques, V.A. 152, 161, 166, 170 170, 177, 180, 185 Lucas, C.O. 91 Martelli, C.M.T. 196 Libeau, G. 20, 274 Lucas, M.A. 245, 246 Martínez, A.M.B. 191 Libermann, T.A. 105 Lucena, M.S. 57, 70 Martini, C.L. 33, 287 Lima, A.A. 244 Lucena, M.S.S. 144, 145 Martini, M.C. 17, 20, 24, 271, 274, 278 Lima, A.T.M. 59, 76, 235, 236, 237, 252, Luchs, A. 56, 57, 61, 69, 133 Martins, C.P.S. 116, 192, 193, 203 253 Lucinda, N. 248 Martins, L.C. 149 Lima, B.H.F. 217 Ludervanhe, F.R. 194 Martins, M.F. 5, 259 Lima, C. 176 Luis Kremer, L. 206 Martins, M.L. 116, 153, 223 Lima, D.B.S. 206, 207 Luiz, M.B. 58, 74 Martins, M.S.N. 43, 44, 297, 298 Lima, D.P. 16, 172, 270 Lunardi, M. 23, 277 Martins, R.M.B. 160, 168, 173, 179, 180, Lima, E.G. 206, 207 Luque, A.L.F. 169 185, 192 Lima, F.E.S. 59, 81 Luz, R.B. 16, 125, 270 Martins, R.S. 96 Lima, G.A.D. 103 Luz, S.L.B. 216 Mascarenhas, J.D.P. 41, 57, 70, 123, 144, Lima, G.S.A. 240, 241, 242, 243, 244 145, 147, 148, 167, 169, 295 Lima, I.C.G. 144, 145, 167 M Massi, R.P. 27, 28, 33, 59, 80, 281, 282, 287 Lima, J.A.A. 235 Macedo, D.F.R. 151 Matias, F. 156 Lima, J.A.A.L. 234 Macedo, M.A. 248 Matos, A.C.D. 32, 59, 79, 286 Lima Jr., W.P. 152, 182 Macedo, P.V. 131, 209 Matos, M.A. 173, 179, 180 Lima, J.S. 242, 243, 244 Machado, A.M. 57, 70, 211 Matos, M.A.D. 168, 173, 192 Lima Junior, W.P. 176, 198 Machado, A.R.S.R. 57, 70, 211 Matos, R.P.A. 142 Lima, L.R. 149, 172 Machado, B.C. 58, 72, 172 Mayta, P.H. 217 Lima, M. 91, 99 Machado, B.I. 42, 296 Mazzarotto, G.A.C.A. 58, 74 Lima, M.F. 254 Machado, B.L.L. 201 Mccollum, A.M. 36, 290 Lima, M.F.T. 11, 265 Machado, M.C.H.S. 199 Medaglia, M.L.G. 91 Lima, M.R.Q. 131, 163 Machado, M.P. 45, 299 Medeiros, M.A. 228 Lima, M.S. 43, 44, 297, 298 Machado, M.R. 240 Medeiros, R.M. 27, 281 Lima Neto, D.F. 30, 284 Madeira, N. 254 Medeiros, T.B. 145 Lima, N.F. 19, 273 Madureira, M.C. 32, 286 Medeiros, T.N.S. 29, 59, 80, 283 Lima-Reis, A.L. 98 Magalhães, C.L.B. 83, 84 Medina-Armenteros, Y. 109 Lima, R.N. 249, 250 Magalhães, J.C. 83, 84 Medina, H.C. 159 Lima, S.T. 138 Malaquias, L.C.C. 95, 96, 142, 143 Mejido, D.C.P. 171 Lima, T.L.C. 205 Maletich, D.J. 14, 268 Melchior, T.B. 198 Linhares, A.C. 41, 57, 70, 138, 144, 147, Mallmann, L.A. 36, 290 Melgaço, F.G. 124 148, 169, 295 Manchego, A. 15, 269 Melgaço, J.G. 140 Linhares, R.E.C. 88, 103 Maranhão, A.G. 167 Mello, F.C.A. 108, 175, 185 Livonesi, M.C. 95, 96, 142 Marcelo, D.F.M. 117 Mello, F.L. 253 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

262 Index

Mello, J.C.P. 88 Monetti, M. 208 Nascimento, D. 222 Mello, M.A.G. 144 Monetti, M.S. 206, 207 Nascimento, E.J. 178 Mello, M.B. 208 Monteiro, A.I. 198 Nascimento, E.J.M. 220 Mello, S.R.G. 135 Monteiro, G.C.T.S. 228 Nascimento, I.A.S. 152, 176, 198 Mello, W.A. 137 Monteiro, J.D. 205 Nascimento, J.C. 195 Melo, A.M. 241 Monteiro, J.M.C. 84, 96 Nascimento, J.H.F. 135, 204 Melo, F.L. 59, 77, 249, 251 Montoro, M.G. 194 Nascimento-Júnior, J.A.A. 160 Melo, K.M.S. 220 Montovani, S.A. 171 Nascimento, L.D. 240, 241 Melo, M.A. 161 Moraes, A.P. 24, 278 Nascimento, M.A. 56, 58, 61, 67 Melo, M.M.M. 159 Moraes, L.C. 179 Nascimento, M.L.J. 25, 279 Melo, P.R.S. 204 Moraes, M.M. 203 Nascimento, M.P. 211 Mendanha, D.M. 165 Moraes, M.T.B. 108, 173, 185, 192, 212, Nascimento, V.A. 197 Mendes, G.S. 15, 16, 106, 107, 111, 154, 228 Nascimento, V.X. 137 172, 269, 270 Moraes, R.H.P. 83 Nassar, A.F.C. 39, 293 Mendes, M.M.B. 137 Moraes, T.C. 161, 187 Nava, A. 45, 299 Mendes-Silva, A. 97, 98 Morais, A.T.S. 114 Navas-Castillo, J. 59, 76 Mendes, Y.S. 104 Morais, L.L.C.S. 123 Naveca, F.G. 12, 152, 176, 182, 184, 187, Mendonça, L.R. 112 Morais, M.S.S. 58, 74 191, 196, 197, 198, 266 Mendonça, R.M.Z. 83 Morais, S.R.S. 151, 152 Naves, J.H.F.F. 13, 267 Mendonça, R.Z. 83, 227 Morais, V.M.S. 160 Negri Filho, L.C. 37, 291 Mendonza, L.L. 240 Morandi, B.C. 24, 115, 278 Nepomuceno, A. 126 Mendoza, L.L. 247 Moreira, E.S. 160 Neris, R.L.S. 107 Meneses, C.A. 198 Moreira, L.P. 198, 199, 200 Nery, J. 164 Meneses, L.C. 116 Moreira, L.S. 58, 74 Nery-Silva, C.R. 151 Meneses, M.D.F. 105, 159 Moreli, M.L. 177, 190 Neto, A.L.M. 7, 261 Menezes, C.B. 24, 115, 278 Moreno, E.C. 130, 131 Neto, I.S. 18, 272 Menezes, E.M.F. 145 Moresco, V. 126, 127 Neto, J.T. 131 Menezes Filho, S.L. 143 Morgado, F.S. 251 Neto, R.E. 137 Menezes, G.B. 140 Mori, E. 39, 293 Nickel, O. 59, 74, 232 Menezes, W. 164 Morillo, S.G. 56, 61 Nico, D. 222 Menoni, S.M.F. 214, 215 Mosmann, J. 208 Nicol, A. 164 Messias, M.R. 193 Mosmann, J.P. 206 Nicolini, C. 248 Metreveli, G. 21, 275 Mota, M.T.O. 209 Niel, C. 57, 71 Meyer, R. 210 Mota, R.M.S. 173 Nobre, P. 92 Miagostovich, M.P. 124, 155, 157, 167 Motta, A.S. 91, 99 Nociti, D.L.P. 23, 277 Miguel, J.C. 154, 159, 161, 165, 166, 170 Motta-Castro, A.C. 108 Nogueira, D.R.S. 59, 76 Milagres, F.A.P. 159, 161 Motta-Castro, A.R. 175 Nogueira, F.B. 182 Milanesi, D.F. 235, 236 Motta-Castro, A.R.C. 161, 172 Nogueira, M. 158 Minet, C. 20, 221, 274 Motta, F.C. 201 Nogueira, M.F. 23, 277 Miquelitto, F. 212 Moura, F.E.A. 188, 189 Nogueira, M.L. 58, 72, 109, 110, 114, 115, Miranda, C.A.N. 206, 207 Moura, L.R. 178 135, 140, 143, 174, 178, 181, 211 Miranda, D.P.J. 192, 193, 195, 203 Mukherjee, S. 163 Nogueira, R.L. 178 Miranda, J.B. 127, 130, 131 Muller, C. 7, 261 Nogueira, R.M.N. 163 Mirazo, S. 38, 292 Müller, U.B. 127 Nogueira, R.M.R. 37, 131, 182, 188, 291 Mir, D. 101 Munck, A.K.R. 153 Norma Santos, N. 167 Miura, I.K. 183 Munhoz, M.L. 33, 287 Noronha, E.F. 222 Miyabe, F.M. 27, 34, 59, 80, 281, 288 Muniz, C.P.R. 10, 264 Noseda, M.D. 86, 106, 111 Mizubuti, E.S.G. 237 Myiazaki, R.D. 132, 133 Novaes, D.P.S. 177, 190 Mohana-Borges, R. 114, 115 Nozawa, C. 88, 103 Molinari, B.L.D. 21, 26, 35, 59, 80, 275, N Nucci, A. 175 280, 289 Nabuco, L.C. 192 Nunes, B.T.D. 106 Mompean, P.V. 211 Nagata, T. 222, 238, 248 Nunes, C.F. 26, 280 Monclaro, A.V. 222 Nascimento, A.K.Q. 235 Nunes, M.V.M. 42, 201, 296 Mondini, A. 58, 72, 109, 110, 181 Nascimento, C.A. 126 Nunes-Neto, J.P. 149 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

263 Index

Nunes, P.C.G. 131, 163, 182 Oliveira, V.H.S. 25, 29, 34, 35, 37, 279, Pelajo-Machado, M. 166 Nunes, P.P. 237 283, 288, 289, 291 Pelegrini, A. 168, 183 Olortegui, C.D.C. 13, 267 Penha, L.L. 34, 288 O Ometto, T. 14, 18, 268, 272 Perales, J. 180 Ocadaque, C.J. 188, 189 Ometto, T.L. 5, 259 Peralta, J.M. 195 Ocampo, P.L. 113 Orílio, A.F. 59, 76 Pereira, A.F. 2, 233, 256 Ogunwenmo, K.O. 249 Orsi, M.A. 6, 8, 25, 260, 262, 279 Pereira, A.V.C. 114 Okano, W. 35, 37, 289, 291 Otonel, R.A.A. 21, 23, 25, 33, 275, 277, Pereira-Carvalho, R.C. 240, 247 Okuda, L.H. 43, 44, 297, 298 279, 287 Pereira, E.F. 181 Oliveira, A. 7, 261 Ozaki, L.S. 193 Pereira, F.C. 132, 133, 202, 203 Oliveira, A.C. 57, 66, 90, 93, 95, 97, 98, Ozanic, K. 58, 72, 109, 181 Pereira, F.L. 27, 28, 29, 59, 80, 281, 282, 283 104, 222 P Oliveira, A.L.R. 171, 194 Pereira, H.M.B. 237 Oliveira, A.M. 19, 20, 42, 273, 274, 296 Pacca, C. 135 Pereira, J.C. 134 Oliveira, A.P. 105 Pacca, C.C. 114, 115 Pereira, J.C.R. 242 Oliveira, A.S. 249 Pacheco, M.F.T. 183 Pereira, J.G. 117 Oliveira, C.C. 102 Pacheco, S.M. 14, 268 Pereira, J.S.O. 58, 67 Oliveira, C.H.S. 13, 267 Padilla, M.A. 24, 115, 278 Pereira, L.H.S. 193 Oliveira, C.M.C. 141 Padovani, R. 211 Pereira, L.S. 144 Oliveira, D.B. 2, 11, 94, 102, 119, 204, 217, Pádua, M. 57, 70 Pereira, M.S. 146 256, 265 Paglia, A. 200 Pereira, Patrícia V.B. 102 Oliveira, D.B.L. 131, 209 Paiva, S.R. 116 Pereira, P.S. 126 Oliveira D.C.A. 226 Paixão, C.G.S. 137 Pereira, R.F.A. 151 Oliveira, D.S. 144, 147, 167 Paixão, I.C.N.P. 112, 113, 116, 118 Pereira, S.S. 58, 74, 227 Oliveira, F.G. 13, 267 Paixão, I.C.P. 118, 126 Pereira, T.M. 171 Oliveira, F.H. 174 Palatnik-De-Souza, C.B. 222 Peres, L.R. 185 Oliveira, F.M.S. 189 Pancielli, P. 176 Perosa, A.H. 198 Oliveira, G.P. 139 Pandeló, D. 108, 144 Perse, A.S. 147, 148, 172 Oliveira, J.C. 161, 165 Panei, C.J. 2, 256 Pessamilio, B. 25, 279 Oliveira, J.G. 102, 108, 224 Panisa, P.S. 226 Pessanha, J.E.M. 192, 193, 195, 203 Oliveira, J.M. 171 Pannain, V. 57, 71 Pessoa, C.R.M. 41, 295 Oliveira, J.P. 59, 77 Pannuti, C.S. 130 Pessoni, G.C. 185, 192 Oliveira, J.S. 150 Paraná, R. 214 Pestana, C., 118 Oliveira, L.L. 84, 96 Paredes, B.D. 93 Pestana, F.N. 58, 72 Oliveira, L.M. 222 Parmezan, S.N. 200 Petrucio, M.M.M. 56, 61 Oliveira, M.C.P.V. 59, 75, 239 Parra, M.C. 181 Petry, M.V. 14, 268 Oliveira, M.D. 84, 96 Parra, M.C.P. 58, 72, 109, 110 Petzold, H.V. 23, 277 Oliveira, M.H.C. 241 Passos, A.M. 168, 183 Pezo, D. 15, 269 Oliveira, M.I. 83, 227 Patrício, G.F. 104 Pianowski, L.F. 57, 65, 108 Oliveira, M.P. 168, 192 Paula, C.R. 177 Pilotto, M.R. 121, 126, 127 Oliveira, M.T. 30, 284 Paula, D.F. 250 Pimenta, M.M.A. 228 Oliveira, N. 191 Paula, F.E. 136, 197 Pimenta, P.F.P. 57, 64, 97, 98 Oliveira, N.S. 188 Paula, F.L. 162 Pimentel, K.N. 168 Oliveira, P.C. 226 Paula, N.T. 236, 243 Pimentel, V.A. 177 Oliveira, R. 176 Paulini , I.J. 225 Pinheiro, R.R. 29, 31, 283, 285 Oliveira, R.C. 23, 277 Pauvolid-Corrêa, A. 37, 188, 291 Pinheiro, R.S. 160, 173, 179 Oliveira, R.J. 91 Pavel, S. 143 Pinheiro, S.X.S.L. 152 Oliveira, R.N. 5, 14, 259, 268 Paz-Carrasco, L. 59, 76, 252 Pinho, A.C.O. 162 Oliveira, R.R. 130 Peabody, D. 90 Pinho, J.B. 5, 259 Oliveira, S.A. 151 Peabody, D.S. 97 Pinho, M.A.B. 134 Oliveira, S.B. 189 Pedrosa, M.L. 83, 84 Pinho, R.T. 112 Oliveira, S.S. 58, 67 Pedrosa, V.A. 4, 258 Pinto, A. 107 Oliveira, T.F.P. 19, 20, 42, 273, 274, 296 Peixoto, A.C. 217 Pinto, A.G. 208 Oliveira, T.M. 157 Peixoto, I.B. 162 Pinto, A.M.V. 118 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

264 Index

Pinto, C.A. 83, 84 Ramalho, F.E.A.V. 137 Rocha, E.S.O. 108, 142, 192, 224, 226 Pinto, G.V.S. 169, 199 Ramos, A.F. 237 Rocha, P.R. 96, 142 Pinto, L.B. 212 Ramos, C.D.L. 177 Rocha, R.P. 95, 143 Pinto, L.D. 39, 293 Ramos, C.H. 196 Rodakiewicz, S.M. 33, 287 Pinto, M.A. 7, 57, 58, 69, 73, 140, 141, Ramos, J.A. 98, 146, 156, 213 Rodrigues, A.P.S. 13, 267 166, 171, 223, 225, 261 Ramos, J.S. 160 Rodrigues, A.S. 31, 285 Pio-Ribeiro, G. 232 Ramos, N. 38, 292 Rodrigues, C. 141 Piovesan, M. 26, 280 Ramos, S. 166 Rodrigues, D.S.G. 149 Piper, A. 58, 73 Ramos-Sobrinho, R. 59, 76, 252, 253 Rodrigues, E.L. 144, 145 Pires, A.F.N.P.C. 151 Rani, M.R.S. 204 Rodrigues, F.P. 124, 179 Pires, L. 158 Rasinhas, A.C. 86 Rodrigues, I.R.C. 145 Pissinati, A. 231 Ray, B. 103 Rodrigues, J.F. 57, 65 Pissinatti, A. 10, 264 Regina Raiol, M.R. 155 Rodrigues, J.S.V. 132, 133 Pituco, E.M. 43, 44, 297, 298 Rego, F.F.A. 144 Rodrigues, K.B. 248 Pohl, J. 226 Rehfeld, I.S. 32, 59, 79, 286 Rodrigues, L.K. 231 Policarpo, O.F. 190 Reis, A.F.N. 174 Rodrigues, M.F. 93 Pollo-Flores, P. 177 Reischak, D. 6, 8, 25, 260, 262, 279 Rodrigues, M.T. 126 Pompeu, D.C. 245, 247 Reis, F.C. 16, 172, 270 Rodrigues, N.F. 95, 96, 142 Porta, A. 183 Reis, J.K.P. 5, 13, 36, 259, 267, 290 Rodrigues, N.F.S. 32, 286 Porta, G. 183 Reis, M.G. 214 Rodrigues, R. 18, 272 Portal, T.M. 147, 148 Reis, N.R.S. 168 Rodrigues, R.A. 103 Portes, S.A.R. 155 Reis, T.A.V. 153 Rodrigues, R.A.L. 92, 94, 122 Portes, V.M. 33, 287 Resende, P.C. 201 Rodrigues, S.G. 106, 149 Portilho, M.M. 161, 166 Resende, R.O. 247, 248, 249, 250 Rodrigues, V.G. 92 Pôrto, L.C.M.S. 57, 69 Resque, H.R. 57, 71, 145 Rodrigues, W.B. 21, 23, 35, 59, 80, 275, Porto, P.S. 115 Retherbuch, G. 56, 61 277, 289 Possatti, F. 21, 28, 35, 275, 282, 289 Revers, L.F. 232 Roehe, P.M. 13, 14, 17, 18, 27, 30, 32, 39, Potsch, D.F.V. 165 Reymão, T.K.A. 57, 70, 148, 169 40, 42, 44, 59, 81, 221, 267, 268, Prado, E.A. 154 Reynolds, M.G. 36, 290 271, 272, 281, 284, 286, 293, 294, Prado, J.C.M. 226 Rezende, B.C. 90 296, 298 Prado, N.D.R. 58, 74 Rezende, D.J. 16, 270 Rojas, G.P. 217 Prates, M. 136 Rezende, G. 172 Rojas, M.A. 11, 15, 154, 265, 269 Prates, M.C. 197 Rezende, I.M. 103, 157 Romano, C.M. 130 Prates, M.C.M. 59, 77 Ribeiro, A.L.M. 132, 133 Romano-Passos, L.M. 186 Proença-Modena, J.L. 58, 72, 136, 164, Ribeiro, B.M. 59, 77, 226, 244, 248, 251, Romanos, M.T.V. 106, 107, 111 197 253 Romero, H. 101 Provazzi, P.J.S. 163 Ribeiro, E.M.C. 57, 64, 97, 98 Rondinelli, E. 98, 146, 156, 213 Puccioni-Sohler, M. 195 Ribeiro, J. 26, 28, 29, 280, 282, 283 Roque, A.C.M. 205 Puga, M.A.P. 150 Ribeiro, L.V.P. 28, 282 Rosa, A.G.S. 57, 71 Pugliese, R.P.S. 183 Ribeiro, M. 58, 73, 118 Rosa, C. 94 Ribeiro, M.D. 89 Rosa, C.A. 122 Q Ribeiro, M.G. 28, 282 Rosadas, C. 195 Quadros, L.M. 36, 290 Ribeiro, P.G.G. 105 Rosa e Silva, M.L. 146, 153, 157 Queiroz, A.T.L. 181 Ribeiro, S.A.M. 6, 260 Rosa, J.C.A. 14, 268 Queiroz, L.H. 45, 299 Ribeiro, S.G. 59, 75, 240, 247 Rosa, J.C.C. 192, 193, 203 Quiles, M. 58, 73 Ribeiro, Z.M.A. 253 Rosa, L.H. 94 Ricci, L.S. 110 Rosa Molina R. 206 R Richtzenhain, L.J. 6, 25, 260, 279 Rosário, M.O.H.V. 214 Ridpath, J.F. 2, 3, 256, 257 Rose, J. 212 Rabay, A.N.B.M. 108 Riet-Correa, F. 41, 295 Roselino, A.M. 211 Rabello, T. 27, 281 Rigotto, C. 16, 117, 125, 126, 224, 270 Rose, T.L. 57, 71 Rachid, M.A. 217 Rivera, H. 15, 269 Rossato, M. 249 Rahal, P. 87, 89, 99, 100, 101, 104, 139, Rocco, I.M. 194 Rossi, C. 176 142, 143, 150, 163, 178, 209, 227 Rocha, C.M. 57, 66, 95 Rugieri, S.P. 214

September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

265 Index

Ruiz, A.C.G. 94 Santos, M.M.A.B. 17, 271 Silva, B.M. 57, 64, 97, 98 Ruiz, L.G.P. 140 Santos, M.M.B. 20, 274 Silva, C.C. 42, 123, 201, 231, 296 Russo, D.H. 58, 72 Santos, M.P. 149 Silva, C.P. 233 Russo, R.C. 217 Santos, M.S. 157 Silva, D.A. 17, 18, 271, 272 Russo, R.R. 87 Santos, N. 11, 15, 16, 106, 107, 154, 172, Silva, D.F.L. 203, 209 Ruvalcaba, S.G. 45, 299 265, 269, 270 Silva, D.P.B. 177 Santos, N.C. 160 Silva, D.R. 26, 28, 59, 80, 280, 282 S Santos, R.I.M. 197 Silva, D.S. 30, 91, 284 Sacchetto, L. 92, 146, 200 Santos, R.N. 44, 298 Silva, E.D. 208 Sá e Silva, M. 3, 257 Santos, T.V.R. 203 Silva, E.E. 158 Safar, N.V.H. 96 Santos, V.A.F.F.M. 139 Silva, E.F. 154, 161, 170 Sagica, F.E.S. 203, 209 Saporiti, V. 26, 28, 29, 33, 34, 280, 282, Silva, E.M. 58, 67 Sako, K. 113 283, 287, 288 Silva, E.N. 233 Salcedo, J.M.V. 114, 193, 194, 227 Sardi, S.I. 7, 12, 162, 261, 266 Silva, E.R.M. 199 Sales, E.B. 34, 288 Sato, B.E.M. 26, 28, 33, 280, 282, 287 Silva, F.D.F. 6, 260 Sales, E.F. 14, 268 Sato, M.I.Z. 58, 68 Silva, F.E.R. 188, 189 Salgado, C.A.P. 217 Saturno, T. 197 Silva-Fernandes, A.T. 94, 139 Salles, T.S. 105 Saturno, T.H. 58, 59, 72, 77, 136 Silva, F.F. 237 Salvador, S.B.S. 171 Savassi-Ribas, F. 184 Silva, F.M.F. 186, 190 Samaniego, R.D. 23, 277 Scagion, G.P. 17, 20, 115, 271, 274 Silva, F.N. 235, 236, 237 Sá, M.F. 16, 270 Scalioni, L.P. 161 Silva, F.O. 226 Sampaio, M. 7, 261 Schaefer, R. 7, 15, 40, 261, 269, 294 Silva, F.R. 235 Sampaio, S.A. 163, 182 Schatzmayr, H. 37, 188, 291 Silva, G.A. 106 Sampaio, S.V. 87 Scheffer, C.M. 40, 42, 44, 59, 81, 294, 296, Silva, G.A.V. 12, 152, 176, 184, 187, 191, Sanches, D. 57, 66, 93, 95 298 196, 197, 198, 266 Sant’anna, F.H. 156 Schiochet, M.F. 15, 269 Silva, G.D.F. 92 Santos, A.F. 10, 191, 264 Schissi, C.D. 58, 67 Silva, I.A.S. 152 Santos, A.O. 114, 193, 194 Schmidt, C. 40, 42, 44, 59, 81, 294, 296, Silva, J.B.G. 150 Santos, A.R. 137 298 Silva, J.C.F. 237, 241 Santos, B.S. 4, 258 Schmidt-Chanasit, J. 159 Silva, J.L. 57, 64, 66, 90, 95, 97, 98, 104, Santos, C.L.S. 134 Schnellrath, L.C. 89, 93 222 Santos, C.N.D. 58, 74 Schwarcz, W.D. 104 Silva, J.L.A. 160 Santos, C.R. 182 Seah, Y.M. 237 Silva, J.S. 93 Santos, D.M.S. 223 Seda, J. 183 Silva, K.F.O. 252 Santos, D.R.L. 7, 261 Seixas, M.M. 5, 259 Silva, K.R.A. 160 Santos, D.S.A. 123 Seixas, M.M.M. 14, 268 Silva, L.A. 251 Santos, F. 113 Sena, J. 183 Silva, L.B.R. 208 Santos, F.A.L. 132, 133, 203 Serafim, W. 7, 261 Silva, L.C. 58, 66 Santos, F.C. 118 Serafini, P. 18, 272 Silva, L.C.F. 121, 122, 125 Santos, F.C.P. 227 Serra, F. 23, 277 Silva, L.D. 144, 145 Santos, F.P. 135 Serra, O.P. 132, 133, 203 Silva, L.D.A. 152 Santos, H.C.P. 165, 213 Sesti-Costa, R. 197 Silva, L.F.F. 196 Santos, H.F. 32, 39, 40, 42, 44, 59, 81, 286, Setubal, S. 151 Silva Lima, N.C. 194 293, 294, 296, 298 Shimabukuro, J.S. 45, 299 Silva, L.K. 214 Santos, H.O. 246 Shimizu, J.F. 87, 139 Silva, L.K.S. 94, 119 Santos, J.C. 138 Sichero, L. 89, 178 Silva, L.N. 160, 185 Santos, J.M.S. 244 Sider, L.H. 29, 283 Silva, L.R. 58, 67 Santos, J.V. 194 Silva, A.C. 103 Silva, M. 83, 84, 86 Santos, K.C.O. 134 Silva, A.D. 39, 293 Silva, M.A.A. 217 Santos, L.S.M. 180 Silva, A.D´A. 56, 61 Silva, M.C. 103 Santos, M.A.M. 132, 202, 203 Silva, A.M. 17, 18, 271, 272 Silva, M.C.A. 116 Santos, M.B. 24, 92, 278 Silva, A.M.C. 168, 179, 180, 192 Silva, M.C.B. 250 Santos, M.C.S.G. 95, 96, 142 Silva, A.P. 26, 27, 59, 80, 280, 281 Silva, M.C.C. 140, 213 Santos, M.I.M.A. 214 Silva, A.S. 58, 73, 225 Silva, M.C.M. 145 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

266 Index

Silva, M.F.M. 57, 71 Sodré, D.N.A. 4, 258 Stangherlin, L.M. 140, 213 Silva, M.G. 169, 199 Soliman, M.C. 16, 125, 126, 224, 270 Stefano, E. 43, 44, 297, 298 Silva, M.L. 112, 136, 197 Solla, D.J.F. 210 Stephens, P.R.S. 113 Silva, M.L.C.R. 174 Sollazo, M. 207 Stoecker, A. 214 Silva, M.M.J. 196 Sonoda, I.V. 195 Strelczuck, G. 30, 284 Silva, M.P. 227 Soriani, F.M. 140 Strottmann, D.M. 58, 74 Silva, N.F. 203 Sotero, A.J. 247 Stuchlik, O. 226 Silva-Nunes, M. 171 Sousa, C.A. 58, 72 Stuqui, B. 89 Silva, P.E. 83 Sousa, C.S. 131 Suhette, R. 123 Silva, R. 34, 98, 146, 156, 213, 288 Sousa, D.D. 152, 176, 182, 196, 198 Sutana, L.B. 157 Silva, R.C. 15, 154, 167, 172, 269 Sousa, D.M.C. 205 Suzuki, A. 194 Silva, R.M. 4, 258 Sousa, E. 59, 77 Switzer, W. 10, 264 Silva, R.R. 41, 295 Sousa, M.P. 123 Silva, S. 225 Sousa, P.S.F. 151, 152, 185 T Silva, S.D. 99 Sousa, R.C.M. 203 Tamashiro, E. 58, 72, 136, 164, 197 Silva, S.J.C. 240, 241, 242, 243 Sousa, R.C.V. 183 Tamíris, A.M. 185 Silva, T.G. 43, 297 Sousa, S.F. 43, 44, 297, 298 Tamura, R.E. 105, 109 Silva, T.R. 41, 295 Souto, F.J.D. 132, 202, 203 Tanuri, A. 57, 65, 98, 108, 181 Silva, V.L. 196 Souza, A.C. 238 Tavares, A.T. 233, 237 Silveira, D.M. 153 Souza, C.A. 172 Tavares, C. 175 Silveira, J. 191 Souza-Fagundes, E.M. 178 Tavares, F.N. 138, 158 Silveira, L.A. 196 Souza, F.G. 125 Tavares, M.T. 233, 237 Silveira, M.L. 136 Souza, F.P. 84, 88, 91 Tazima, Z.H. 231 Silveira, P.F. 57, 64, 97, 98 Souza, G.O.S. 150 Teixeira, D.M. 123, 167 Silveira, P.P. 57, 65 Souza, I.R. 59, 79 Teixeira, J.V.L. 245, 246 Silveira, S. 15, 269 Souza, J.B. 161 Teixeira, M.F.S. 29, 31, 283, 285 Silveira, V.R. 194 Souza, J.G. 22, 59, 78, 116, 178, 276 Teixeira, T.F. 44, 298 Silvestre, R.V.D. 137 Souza, J.M. 58, 72 Teixeira, T.S.P. 88 Simabuco, F.M. 105 Souza, K.B.A. 197 Teixeira, V. 118 Simões, J.B. 163 Souza, K.C. 29, 283 Teixeira, V.L. 112 Simões, J.B.S. 182 Souza, K.P.R. 226 Teles, P.H.F. 59, 77 Simoes, L.P. 57, 64 Souza, K.R. 224 Teles, S.A. 160, 168, 173, 179, 180, 185 Simoes, S.V.D. 41, 295 Souza, L.O. 177 Tenorio, A.A.R. 242 Simoni, I.C. 85, 104 Souza, M. 165, 213 Tenório, E.C.N. 226 Simon, N.L. 15, 269 Souza, M.B.L.D. 161, 187 Termini, L. 89 Siqueira, J.A.M. 56, 57, 61, 70, 147, 148, Souza, M.C. 113 Terreros, H.M. 217 167 Souza, M.C.B. 118 Thomas, M. 58, 73 Siqueira, M.M. 201 Souza, M.G. 242 Thomazelli, L.M. 5, 131, 189, 209, 259 Siqueira, T.C.S. 152, 176 Souza, N.C.C. 137 Thomaz, L. 225 Siqueira, T.R. 92, 157 Souza, R.F. 92 Thomaz, M.M. 19, 42, 273, 296 Siqueira, V.M. 123 Souza, R.P. 133, 171, 194 Tiago, S.S. 117 Slongo, J. 27, 32, 281, 286 Souza, T.C.D. 187 Tibiriça, S.H.C. 153 Smith, K. 58, 73 Souza, T.L.F. 97, 98 Tigre, D.M. 7, 12, 261, 266 Soares, A.M. 58, 74 Souza, T.S. 29, 283 Timenetsky, M.C.S.T. 56, 57, 58, 61, 69, Soares, C.C. 173, 184 Souza, V.C. 197 72, 133, 172 Soares, D.M.V. 135 Souza, W.M. 57, 64, 70 Todão, J.S. 181 Soares, F.A. 209 Spada, P.K.P. 123, 167 Todaro, A.R. 137 Soares, L.S. 57, 70, 144, 145, 169 Spears, C. 58, 73 Tonelotto, M. 227 Soares, L.W.O. 137 Spilki, F.R. 16, 17, 30, 58, 68, 87, 117, 125, Tonetta, D. 56, 61 Soares, M.A. 10, 191, 264 126, 224, 270, 271, 284 Torres, A.P,R. 123 Soares, M.P. 26, 280 Spitz, N.T.D. 173, 184 Torres, J.A. 7, 12, 261, 266 Soares, M.V.M. 11, 265 Stabeli, R.G. 58, 74, 227 Torres, S.V.S. 216 Sobral, M.C.M. 186, 190 Staggemeier, R. 16, 117, 125, 126, 224, 270 Tort, L.F.L. 58, 68, 186 Sobrinho, J.S. 178 Stancioli, E.F.B. 153, 223 Tourinho, R.S. 141 September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil

267 Index

Toutinho, R.S. 57, 69 Vidal, L.E.L. 191 Yamakawa, F.H.S. 33, 287 Tozato, C.C. 22, 31, 276, 285 Vidotto, A. 114, 115 Yamamoto, K.A. 105, 117 Traesel, C.K. 3, 257 Vieira, C.B. 167 Yamasaki, L.H.T. 142, 143, 227 Travassos, C.E.P.F. 139 Vieira, D.S. 114, 193, 194, 227 Yanagi, Y. 58, 68 Trindade, G.S. 2, 11, 32, 36, 92, 110, 119, Vieira, E.P. 199 122, 124, 127, 130, 131, 139, 200, Vieira, F.N. 200 Z 204, 233, 256, 265, 286, 290 Vieira, H.R. 58, 72, 172 Zadra, V.F. 36, 290 Trinta, K.S. 180 Vieira, M.C.B. 242 Zanardo, L.G. 235, 236 Troncoso, L. 10, 264 Vieira, M.C.R. 228 Zanchi, F.B. 193 Turones, L.C. 165, 213 Vieira, M.L.A. 94 Zanforlin, J.R. 110 Vieira, Y.R. 7, 140, 261 U Zantieff, R. 210 Vigorito, A. 176 Zeidan, G.C. 150 Uaraná, T. 177 Vilanova, B.C. 172 Zerbini, F.M. 59, 76, 234, 235, 236, 237, Ueda, S.K. 202 Vilella-Nogueira, C.A. 161 240, 243, 252, 253 Uetanabaro, A.P.T. 24, 115, 278 Villa, L.L. 89, 101, 169, 178 Zerbini, L.F. 105 Urbano, P.R. 26, 280 Villalobos, E.M.C. 39, 293 Zingali, R.B. 109 Urbano, P.R.P. 130 Villar, L.M. 154, 159, 161, 165, 166, 170, Zirke, C.A. 217 Urio, M. 33, 287 177 Zuchi, N. 132, 133, 202, 203 Ürményi, T.P. 98, 146, 156, 213 Villela-Nogueira, C.A. 57, 71, 154, 159, Urquiza, G.P.C. 237 177, 192 Vinente, C.B.G. 169 V Vininski, A.E. 202 Virgens, J. 114 Valente, D.D. 59, 76 Vitral, C.L. 140 Valentin, E.S. 98, 146, 156 Vivas-Vivas, L. 59, 76, 252 Valera, F.C. 58, 72 Vogel, V.A. 126 Valera, F.C.P. 136, 164, 178, 197 Volotão, E.M. 57, 58, 71, 73, 223, 225 Valle, D.A. 153 Voltarelli, D.C. 28, 35, 282, 289 Varela, A.P.M. 39, 40, 42, 44, 59, 81, 293, 294, 296, 298 W Varella, R.B. 184 Vargas, G.D. 26, 91, 99, 280 Wagner, S. 147 Vasconcelos, A.F. 249 Wanzeller, A.L.M. 138 Vasconcelos De Deus, D.M. 138 Watanabe, A. 198 Vasconcelos, G.A.L.B.M. 223 Watanabe, A.S.A. 199 Vasconcelos, P.F.C. 106, 149 Weber, M.N. 39, 41, 293, 295 Vasilakis, N. 205 Weckx, L.Y. 198 Vasques, A.C. 170 Weiblen, R. 2, 3, 4, 5, 87, 221, 256, 257, Vasques, R.M. 248 258, 259 Vassallo, J. 101 Weiler, C. 125 Vaughan, G. 143 Weiss, M. 3, 257 Vecchia, A. 126 Welby-Borges, M. 162 Vedovello, D. 135, 158, 174, 211 Wendlant, A. 40, 42, 44, 294, 296, 298 Veiga, A.B.G. 156 Werther, K. 59, 77 Veiga, C.S.B. 159 Wolff, J.L.C. 251 Veiga, R. 157 Wong, L. 17, 18, 271, 272 Velez, J. 37, 188, 291 X Venezuela, R.F. 206, 207, 208 Ventura, A.M. 105, 109 Xavier, A.S. 59, 76 Versiani, A.F. 85 Xavier, C.A.D. 252, 253 Vetter, M.R. 224 Xavier, G.F. 42, 201, 296 Viancelli, A. 56, 61, 121 Xavier, M.P.T. 9, 263 Vicente-Santos, A.C. 90, 222 Xavier, M.P.T.P. 155 Victoria, M. 58, 68, 124, 186 Y September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Index