lJN/VERS/"fY OF HAW.';''' LIBRARY
RESEARCH ON THE DIVERSITY AND THE BIOMEDICAL POTENTIAL OF MARINE FUNGI IN HAWAII
A THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAII IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE IN MICROBIOLOGY
AUGUST 2007
By Mingxiao He
Thesis Committee: Dr. Guangyi Wang, Chairperson Dr. Paul Patek Dr. Philip Williams We certify that we have read this thesis and that, in our opinion, it is satisfactory in scope and quality as a thesis for the degree of Master of Science in Microbiology.
THESIS COMMITTEE
Chairperson
11 ACKNOWLEDGEMENTS
I am extremely grateful to my advisor, the other professors in my committee, and people in my lab for their help in my research and my life. I especially want to thank Dr. Guangyi Wang. Without his guidance and funding, I would never have been able to have this project done; I also want to thank Dr Paul Patek, for teaching me the techniques of cell culture and cytotoxic assay, for allowing me to perform cytotoxicity assays in his laboratory, and for advising me in this project, and to thank Dr Philip Williams for his help and suggestion regarding natural products screening.
I would also like to thank all the current and former lab members for their valuable help in teaching me new techniques, making suggestions for the experiments, and ordering materials and instruments for the project.
I would also want to show my gratitude to Dr Susan Ayin in Microbiology Department and Stephanie Christensen in Post 07 for proofreading my thesis writing. Without their help, I could not have finished my thesis.
Lastly, I would like to thank my new friends in US and myoid friends in China, without their comfort and support, life would have been harder here.
Again, please allow me to express my gratitude to all those who have helped me in the past two years.
iii ABSTRACT
This study was designed to survey the diversity of marine fungi in Hawaiian waters using molecular biological methods and to do preliminary screening for biological isolates with pharmaceutical potential based on biological activities. 106 marine fungal isolates were isolated from nine algae species from eight different locations around the coast of the Hawaii Island in Hawaii. These fungal isolates were classified based on the ribosomal intemal transcribed spacer regions, and were found to represent 10 orders including 57 species of Ascomycota, and 2 orders including 3 species ofBasidiomycota. Two isolates, Haw 3BII and Haw 7A3, representing long phylogenetic distances from known sequences in Genbank, are potential new species.
Anti-bacterial assays were performed with the crude extracts obtained from the cultures of 70 algae associate fungi in Hawaii. In total, eight extracts shown inhibitory activity to Bacillus subtilis and four to Staphylococcus aureus, respectively. None inhibited activity to the gram negative bacteria Pseudomonas aeruginosa and E.coli K12. Anti-tumoral assays using murine cell lines BCN (non-tumorgenic) and L88 (tumorgenic) were performed with the crude extracts of the cultures of 70 algae associated fungi and 58 sponge-associated fungi. In total, four extracts, one from algae- associated fungi and three from sponge-associated fungi, showed strong inhibition of L88 and slight or no inhibition of BeN. Those isolates will be further studied for their potential in drug discovery.
iv TABLES OF CONTENTS
Acknowledgement ...... iii
Abstract ...... iv
List of Tables ...... viii
List of Figures ...... ix
Lists of Abbreviations ...... x
Chapter 1. Introduction and literature review ...... 1
1.1 Definition of Marine fungi ...... 1
1.2 Historical perspective ...... 1
1.3 Marine fungal research in Hawaii...... 3
1.4 Identification and taxonomy of fungal species ...... 3
1.5 Molecular DNA targets for fugal identification, diversity and phylogeny
studies ...... 5
1.6 PCR Primers to amplify the ITS regions ...... 8
1.7 Pharmacological activities of the secondary metabolites from marine fungi .. 10
1.7.1 History ...... 10
1.7.2 Anti-bacterial activity ...... 11
1.7.3 Anti-viral activity ...... 13
1.7.4 Anti-tumor and cytotoxic activity ...... 14
1.7.5 Anti-protozoal activity ...... 15
1.7.6 Antifungal activity ...... 16
v Chapter 2. Survey for the biodiversity of marine fungi on algal substrates around the
coast of the Island of Hawaii (Big Island) ...... 18
2.1. Materials and methods ...... 18
2. I. I Sampling of marine algae ...... I 8
2.1.2 Extraction of Genomic DNA from fungal isolates ...... 18
2.1.3 Marine Fungi isolation ...... 18
2.1.4 PCR amplification of ribosomal internal transcribed spacer regions ... 19
2.1.5 Sequencing of the PCR products and analyses ...... 19
2. 2 Results ...... 20
2.2.1 Results of PCR. sequencing and BLAST analyses ...... 20
2.2.2 ClassifYing of selected sequences in phylogenetic trees ...... 24
2. 3 Discussions ...... 28
Charter 3. Biological activity assays of the Hawaiian marine fungal isolates ...... 33
3.1 Materials and Methods ...... 33
3.1.1 Culturing of marine fungi...... 33
3.1.2 Culture extracts ...... 33
3.1.3 Bacterial strains and murine cell lines ...... 33
3.1.4 Anti -bacterial assay ...... 34
3.1.5 Cytotoxicity assay ...... 35
3.2 Results ...... 35
3.2.1 Antibacterial assay ...... 35
3.2.2 Cytotoxicity assay ...... 37
vi 3. 3 Discussions ...... 33
Appendix 1...... 42
Appendix 2 ...... 43
Appendix 3 ...... 45
Appendix 4 ...... 47
References ...... 50
vii LIST OF TABLES
Table Page
1. Common ITS primers and their sequences ...... 9
2. BLAST results of ITS sequences of fungal isolates from algae collected in
the Island of Hawaii ...... 21
3 Isolates which shown antibacterial activity against B. subtilis strain ...... 36
4. Isolates which shown antibacterial activity against S. aureus strain ...... 37
5. Isolates which shown cytotoxic activities ...... 38
viii LIST OF FIGURES
Figure Page
I. The number of distinct fungal genera based on the marine source ...... 2
2. Schematic map of a repeat unit of eukaryotic rDNA ...... 7
3. Internal transcribed spacers (ITS) region primers ...... 9
4. The distribution of new compounds reported from marine-derived fungi is
shown as a function of the fungal source ...... 11
5. Neighbor-Joining tree of algae-derived fungi in the Island of Hawaii based
on ITS sequences ...... 24
6. Neighbor-Joining tree of Group I ...... 25
7. Neighbor-Joining tree of Group 2 ...... 26
8. Neighbor-Joining tree of Group 3 ...... 27
9. Neighbor-Joining tree of Group 4 ...... 28
10. Inhibition zones of B. subtilis ...... 36
II. Inhibition zones of S. aureus ...... 36
12. Morphology of BeN cell line and L88 cell line with treatments
and controls ...... 39
ix LIST OF ABBREVIATIONS
J,lglml: microgram per milliliter mgl ml: milligram per milltliter
DNA: Deoxyribonucleic acid
PCR: Polymerase chain reaction
DGGE: Denaturing gradient gel electrophoresis
TGGE: Temperature gradient gel electrophoresis
FISH: Fluorescent in situ hybridization.
TRFLP: Terminal Restriction Fragment Length Polymorphism rDNA: Ribosomal DNA
ITS: internal transcribed spacers
MIC: minimum inhibitory concentration
IC50: 50% Inhibition Concentration
GPY: glucose peptone yeast dNTP: Deoxyribonucleotide triphosphate
BLAST: Basic Local Aligmnent Search Tool
FBS: Fetal bovine serum
DMSO Dimethyl sulfoxide
MTT: 3-(4, 5-Dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide
x Chapter 1 Introduction and Literature Review
1. 1 Definition of Marine fungi
The generally accepted broad ecological definition of marine fungi is that one Kohlmeyer
published in 1979: Obligate marine fungi are those that grow and sporulate exclusively in
a marine or estuarine habitat; Facultative marine fungi are those from freshwater or terrestrial milieus and are able to grow (and possible also to sporua1te) in the marine
environment [I].
Mycologists also classify marine fungi as primary marine fungi or secondary marine
fungi. Primary marine fungi are obligate parasites, and have envolved in the oceans;
secondary marine fungi are free living and are inferred to have evolved from terrestrial ancestors [2, 3].
1.2 Historical perspective
Marine fungi are important intermediaries of energy flow from detritus to higher tropic
levels in the marine ecosystem and are promising sources of pharmacologically active metabolites [4, 5]. Evolving biologically and bio-chemically in a diverse manner, marine
filamentous fungi have been reported on a variety of substrates: decaying woods, leaves,
seaweeds, sea grasses, calcareous and chitinous substrates, and in marine animals, in all
I the four maj or Oceans. Those in the tropical Asia Ocean are the most deepl y investigated.
Figurel.1 shows the number of di stinct fungal genera based on the marine sources [6].
18 16 14 :: 0 12 e ~ 10 •0 :; 8 .D E ..:> 6 4 2 0 ~., (, ..it' ~..
Figure 1. 1 The number of distinct funga l genera based pn the marin e source
Compared to their terrestrial relatives, marine-derived ftmgi are much less well known and described. The first marine fun gus was described 150 years ago and the seriolls collecting fungi in marine habitats started in 1944 [7]. By 2003, 465 marine filamentaous fungi had been described [8]. Hi gher marine fungi constitute Ascomycotina, Basidio- mycotina and Deuteromycoti na. The ascomycetes are the most diverse and abundant phylum.
2 1.3 Marine fungal research in Hawaii
Tropical locations are believed to be centers of interest for understanding fungal abundance and diversity [I, 9]. The Hawaiian Islands are located in the tropical Pacific
Ocean and are the most isolated islands from the mainland. The surrounding 4508 square Ians of ocean has been shown to contain a high diversity of marine organisms.
According to the records of Bishop Museum, 5,500 species of marine plants and animals have been documented [10]. However, comparing to marine plants and animals, the marine fungi are very poorly studied. Since Anastasiou et al first collected some marine fungi on the shores of the Hawaiian Islands in 1963 [II, 12], so far only 53 species of marine filamentous fungi have been found in this ocean area [13].
To date, publications on Hawaiian marine fungi are still very scarce and fragmentary.
Therefore, it is necessary to survey and document their biodiversity systematically by investigating the various possible substrates and geographic locations at different seasons.
Additionally, marine fungi are a new source of commercially important fungal metabolites, which serves as an additional motivation for investigating on the diversity and taxonomy of marine fungi in the Hawaiian waters.
1.4 Identification and taxonomy of fungal species
Scientists estimated that there are aroundl.5 million species of fungi in Nature, with more than 77,000 identified and documented. Proper identification and classification of fungal species is critical for the documentation and study of the huge number of fungi, including marine fungi.
3 The classic identification method based on different morphological patterns of fungal fruiting bodies has been used for almost two hundred years. In the past decade, with the development of molecular biological techniques, new molecular classification approaches based on DNA sequences have been applied to facilitate fungal identification, taxonomic and phylogenetic studies, diagnostic applications, and community samples study, including those of unculturable fungi.
Compared to molecular approaches. traditional methods are laborious and time consuming for poorly differentiated filamentous fungi. Some fungal taxa are difficult to be identified and classified by traditional methods since the fruiting body is not obvious or even absent, so data from traditional methods for identification are somewhat variable and do not always provide sufficient taxonomic resolution (14]. Molecular methods are universally applicable to solve such problems. Those most common techniques used in fungal classification, diversity and phylogenetic research are described below.
Polymerase chain reaction (PCR) and direct sequencing. A conserved target DNA region is amplified and sequenced. Sequencing includes PCR products sequencing and clone sequencing.
Denaturing gradient gel electrophoresis (DOOE) or temperature gradient gel electrophoresis
(TOOE).These similar techniques also involve PCR, however the primers differ from the regular PCR primers by a tail of 40bps or so made up of only 0 and C, prevents denature even at high temperatures or with denaturing chemical compounds, e.g., urea and formaldehyde.
4 Fluorescent in situ hybridization (FISH). FISH is a relatively new technology utilizing
fluorescently labeled DNA probes to detect or confirm genes. The probe signal is
detected with a fluorescent microscope and the sample DNA scored for the presence or
absence of the signal. FISH can be used to identify microorganisms and is widely used in the field of microbial ecology.
Terminal Restriction Fragment Length Polymorphism (TRFLP). TRFLP is a molecular biology technique initially developed for characterizing bacterial communities in mixed
species samples. The technique has also been applied to other groups including soil fungi.
TRFLP works by PCR amplification of DNA using primer pairs that have been labeled
with fluorescent tags. The PCR products are then digested using restriction enzymes. The
results are analyzed either by simply counting and comparing bands or peaks among
different samples, or by matching bands from one or more TRFLP runs to a database of
known species.
Usually DGGE , TGGE, FISH and TRFLP are appropriate for research on environmental
fungal samples and widely used in this field.
1.5 Molecular DNA targets for fugal identification, diversity
and phylogeny studies
All molecular approaches of fungal identification and diversity research are based on
DNA sequences, therefore conserved DNA target regions are necessary when these
techniques are applied. Ribosomal DNA (rDNA) is the most commonly used target for
5 this purpose in academic publications. rDNA genes are in the most widely sequenced regions in fungi.
Ribosomal DNA is the repeat gene family in a genome with transcription activity. The
4 3 copy repeats are from 10 ___ 10 • The copy number may vary among different species of
fungi, but not significantly [15, 16]. rDNA consists both transcribed and untranscribed region. The transcribed regions of rDNA, that encode5S, 5.8S, 18S, and 28S ribosomal
subunits are separated by internal transcribed spacers (ITS) and intergenic spacers (lOS).
ITS regions are located between 18S and 5.8S (lTSl) and 5.8S and 28S (ITS2).
Additionally, the external transcribed spacer (ETS) exists upstream ofthe18S region and
in the downstream of the 28S region. The transcribed products of both ITS and ETS, which include the information to regulate the post transcription process of precursor rDNA, play critical roles in the maturing process of rRNA and will be degraded during the procedure. The schematic map of a repeat unit of eukaryotic rDNA is shown in Figl.2. rDNA regions have been used to access the taxonomic relationships in fungi, from high taxonomic level to the species level.
Since ribosomal units of 5S. 5.8S. 18S and 28S are processed into mature ribosomes that
synthesize proteins for the survival and replication of the cells, highly conserved physical
parameters and characteristics are required for these four encoding regions during the life
of eukaryotic organisms. Studies have shown that the 5S, 5.8S, and 18S gene sequences reveal only minor variation in zygomycetes [17, 18]. ITSI and ITS2 show higher
divergence in sequences since they do not code for the proteins in a mature ribosome.
6 Due to the different biological characteristics of these regions, they have been used to identify different taxonomic levels.
1 rONA repeatunlt
EctA I EctA I Bg II I I I IGS' IGS2 68 RNA-
Figure 1.2 Schematic map of a repeat unit of eukaryotic rDNA
Since the 18S and 28S regions contain both conserved and variable regions, they have been used to assess the taxonomic relationships from high taxonomic level to species level. However among closely related groups, sequences of these two regions are highly conserved, which makes them unsuitable for identification at species level [19]. Usually, the 18S region is used to access higher level taxonomic relationships [20].
The 5.8S and 5S regions are short in length (- 160bp in fungi) and so are unable to provide sufficient conserved and variant sequences for comparative analysis. Plus, 5.8S and 5S are also highly conserved in sequences. Therefore, these two regions are not appropriate for phylogenetic studies and fungal identification.
The ITSI and ITS 2 regions flank the 5.8 S rDNA region in the genomes of all eukaryotes. They are not transcribed into proteins and therefore lack environmental
7 selective pressures. This resulted in higher mutation rates and more polymorphism during the long evolutionary history of organisms. On the other hand, the ITS regions of eukaryotes are in approximate sizes, varying from around 1000bp in human cells to less than 300bp in some yeast. This allows scientists to obtain sufficient data for identification and polymorphism studies of species in the same genus or different groups within one species, without performing long sequencing. Generally, the similarity and diversity of the ITS region can be used as a molecular marker for fungal identification and phylogenic studies at a species or sub-species taxonomic level. Since the purpose of this research is to study marine fungal down to the species levels, peR primers focusing on the ITS regions will be discussed next.
1.6 peR Primers to amplify the ITS regions
The ITS regions are now perhaps the most widely sequenced regions of DNA in fungi. It has typically been most useful for molecular systematics at the species level, and even within species (e.g., to identify geographic races). The standard ITS I +ITS4 primers are used by most labs. Table 1.1 lists of commonly used ITS primers and their sequences while figure 1.3 shows the locations of these primers [21].
8 ITS primers
11S1F ITS5 IIS1 I1S3 LSURNA SSURHo!. ~ 5.8SfI 7 -+ ,r • • t;ITS2 \~11S4R 200 bp I 5.BS - rr5-1 RHo!. rr5-2 Prim "" for rolJln.sequ"",lng are shcrwnln bd d
Figure 1.3 Internal transcribed spacers (ITS) region primers
Table 1.1 common ITS primers and their sequences
primer sequence (5'->3') comments reference '\name ITS 1 TCCGTAGGTGAACCTGCGG White et aI, 1990 ITS2 GCTGCGTTCTTCATCGATGC (is similar to White et aI, 5.8S below) 1990 ITS3 GCATCGATGAAGAACGCAGC (is similar to White et al, 5.8SR below) 1990 ITS4 TCCTCCGCTTATTGATATGC White et al, 1990 ITS5 GGAAGTAAAAGTCGTAACAAGG (is similar to White et al, SR6R) 1990 ITSI-F CTTGGTCATTTAGAGGAAGTAA Gardes& Bruns, 1993 Gardes & ITS4-B CAGGAGACTTGTACACGGTCCAG Bruns, 1993 5.8S CGCTGCGTTCTTCATCG Vilgalys lab 5.8SR TCGATGAAGAACGCAGCG Vilgalys lab SR6R AAGWAAAAGTCGTAACAAGG Vilgalys lab
9 1. 7 Pharmacological activities of the secondary metabolites from marine fungi
1.7.1 History
The marine environment is a rich source of both biological and chemical diversity, containing nearly 300,000 described species which comprise a rich source of novel compounds with great potential as pharmaceutical products, nutritional supplements, and enzymes with high market values. Among the marine organisms, marine fungi have become an important source of pharmacologically active compounds.
The earliest report describing the medical activity of marine fungus can be traced back to the 1870s. In 1976 Cephalosporin C was isolated from marine derived fungi and was approved for clinical use in 1983. Since then scientists have been discovering new bioactive compounds from marine derived fungus. Although it always happened that compounds isolated from marine fungi have been previously isolated from terrestrial species, scientists have discovered some new ones with novel structures. To date, more than 272 new compounds have been often discovered from fungi isolated from marine environments, and this number is still increasing [6]. Distribution of the new compounds reported from the marine derived fungi is shown in the figure 1.4 [6].
Research and preclinical tests indicate that marine fungi are a promising source for novel drugs in various areas, particularly in the areas of antibiotic prosperities including
10 anti-bacterial, anti-viral, anti-fugal including and anti-protozoal, as well as in the areas of anti-tumor and cytotoxic prosperiti es .
New Compounds
other
mollusc 6% spong& 28%
tunic ate 7% grass/plant 3%
Figure 1.4 T he distribution of new compounds reported from marine-derived fungi is shown as a function of the fun gal source [6].
1.7.2 Anti-bacterial activity
Presently, the development of anti biotic resistance in pathogens is a severe problem for human health. Since pathogens were first fo und to be resistant to peni cillin in the late
1940s, more and more pathogens, for example methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus, are now resistant to the common antibiotics. Developing novel antibacterial drugs may help al leviate thi s probl em.
Secondary metabolites from marine fungi have shown promi sing activity in thi s fi eld [22 ,
23,24].
I I Pestalone is a chlorinated benzophenone antibiotic from a fungal strain of Pestalotia genus which was isolated from the surface of the brown alga Rosenvingea sp. collected in the Bahamas Islands. It shows potent antibacterial activity against methicillin-resistant
Staphylococcus aureus (MIC = 37 nglmL) and vancomycin-resistant Enterococcus faecium (MIC = 78 nglmL), indicating that this compound should be evaluated in advanced models of infectious diseases [22].
Speradine A is a congener of cyclopiazonic acid with a I-N-methyl-2-oxindole ring isolated from the cultured broth of a facultative marine fungus Aspergillus tamari which was separated from driftwood at seashore in Okinawa, Japan. This compound shows antibacterial activity against Mycrococcus luteus with a MIC of 16.7 j.lglmI [23].
Zopfiellamide A, a class of compound belonging to pyrrolidinone derivatives isolated from the facultative marine ascomycete Zopjiella lalipes, inhibits gram-positive Bacillus brevis, Bacillus subtilis, B. licheniformis, Corynebacterium insidiosum, Micrococcus luteus, Mycobacterium phlei, Arthrobacter citreus and Streptomyces sp, and gram negative bacterium Acinetobacter calcoaceticus with minimal inhibitory concentrations ranging between 2 and 10 j.lg ImI [24]
1.7.3 Anti-viral activity
Viral pathogens are responsible for some of the most serious lethal diseases in human and animals such AIDS, Bird Flu, Viral Hepatitis B and SARS. Only in the field of HIV, an estimated 1,039,000 to 1,185,000 people in the United States were living with HIV/AIDS
12 at the end of 2003; in 2005, an additional 38,096 cases of HIV/AIDS in adults, adolescents, and children were diagnosed in the 33 states. CDC estimated that approximately 40,000 persons in the United States become infected with HIV each year
[25]. In the last two decades, the search for antiviral compounds from marine fungi has yielded some promising results and these compounds have shown potentials in solving the problem of viral pathogens.
Compounds like equisetin, phomasetin, and integric acid have shown significant anti-
HIV activities in bioassay-based experiments [26]. Sansalvamide A, a cyclic depsipeptide isolated from the marine fungus Fusarium sp, inhibits topoisomerase catalyzed DNA relaxation, DNA-binding and covalent complex formation (ICso=124 J.!M) in pathogenic poxvirus Molluscum contagiosum (MCV) [27].
A series of novel linear peptides, Halovirs A-E, isolated from the marine fungus
Scytidium sp. have shown potent antiviral activity against herpes viruse (HSV) 1. The
EDso values (Ih duration) for Halovirs A, B, C, D, E were 1.1,3.5,2.2,2.0 and 3.1 pM - respectively. In addition, Halovir A also inhibited HSV 2. This compound equally inhibited the replication of HSV -I and HSV -2 with an EDso value of 280 nM in a standard plaque reduction assay [28]. The mode of action is still not clear; however it is presumed that these compounds render HSV non-infectious by possible membrane destabilization [28].
Stachyflin, a novel terpenoid isolated from fungus Stachybotrys, contains a pentacyclic moiety including a novel cis-fused deca1in, and that demonstrated potent anti-influenza A
13 activity with an ICso value of 3 nM, significantly better than the known inhibitors amantadine and zanamivir. This activity is mediated through the inhibition of fusion between the viraJ envelope and the host cell membrane, also unique among antiviral compounds [29, 30].
1.7.4 Anti-tumor and cytotoxic activity
Cancer is second only to heart disease as the leading cause of death in the United States.
Cancer kills one in four Americans and is the leading cause of death for women aged 40 to 79 and men aged 60 to 79. About 1.4 million new cases of cancer are diagnosed each year in this country, and about 570,000 Americans will die of this disease [31].
Developing effective anti-tumor agents may help to lower the death rate of cancer
patients.
A marine-derived Myrothecium roridum obtained from a submerged woody sample
produced 12, 13-deoxyroridin E, a new member of the roridin family [32]. 12, 13- deoxyroridin E showed IC", values of25 and 15 ng mL- 1 in HL-60 and Ll210 cell lines, respectively.
Novel cytotoxic sesquiterpenoid nitrobenzoyl esters were isolated from a culture of • Aspergillus versicolor isolated from the surface of the Caribbean green alga Penicillus capitatus [33]. One of these esters, 9a, 14-dihydroxy-6~-p-nitrobenzoylcinnamolide,
showed a mean LC", of 1.1 Ilg mL- 1 in the National Cancer Institute's 60 cell-line panel.
This compound was also isolated from an Aspergillus insulicola that was obtained from
14 several samples in the Bahamas including a Penicillus sp. green alga and was named
Insulicolide A by Rahbaek et al [34].
A new deuteromycete, Acremonium neocaledoniae, was obtained from a driftwood sample. The ethyl acetate extract of the culture filtrate of this strain exhibited potent cytotoxicity that was attributed to the known metabolites verrucarin A, isororidin A, and the new verrol 4-acetate. Verrol 4-acetate showed fairly potent cytotoxic activity against a KB cell line (IC", = 400 ng mL-') [35].
1.7.5 Anti-protozoal activity
Parasitic diseases such as malaria, South American Chagas disease, and sleeping sickness disease cause high rates of fatality in parts of Africa, Asia, and South America
According to the World Health Organization, malaria is responsible for over 300 to 500 million clinical cases in 105 countries and more than a million deaths each year. Most deaths occur in young children [36]. Natural products from marine fungi have shown promising anti-protozoal activities against the pathogens of parasitic diseases.
Aigialomycins A-E, new l4-membered resorcylic macrolides, was isolated together with a known hypothemycin from the mangrove fungus, Aigialus parvus BCC 5311.
Hypothemycin and aigialomycin D exhibited in vitro antimalarial activity with ICso values of2.2 and 6.6 Jolg ImL, respectively [37].
15 AscosaIipyrrolidinone A, a tetramic acid metabolite has shown a significant level of anti plasmodial activities against two strains of P. !alciparum, namely K I (resistant to chioroquinone and pyrimethamine) and NF54 (ICso=736 ngfm! for KI, 378 ngfm! for
NF54). This compound has been isolated from the obligate marine fungus Ascochyta salicorniae found in association with a marine green alga Ulva sp [38].
AscosaIipyrrolidinone A. isolated from the obligate marine fungus A. salicorniae, has also shown significant activity against the haemoflagellate Trypanosoma cruzi and
Trypanosoma brucei subspecie rhodesiense, causal agents of South American Chagas disease and sleeping sickness disease respectively, with an MIC of I.1 Ilg 1m! and 30 Ilg
Iml, respectively [39].
1.7.6 Antifungal activity
There has been a sharp increase in fungal infections among patients suffering from HN and those receiving cancer and immuno-therapy. Compounds from marine fungi have shown potential for further clinical trials and drug development.
Byun et al reported a novel diketopiperazine metabolite of marine fungus M-3 isolated from laver Porphyra yezoensis. This compound showed potent activity against P. oryzae with MIC of 0.36 J.1M [39].
A new lactone compound, YM-202204, was found in the culture broth of marine fungus
Phoma sp. Q60596. This compound exhibited potent antifungal activity against Candida
16 albicans, Cryptococcus neoformans, and Aspergillus fomigatus, and also inhibited glycosyl-phosphatidyl-inositol (GPI) -anchoring in yeast cells [40].
17 Chapter 2. Survey for the biodiversity of marine
fungi on algal substrates around the coast of the
Island of Hawaii (Big Island)
2.1 Materials and methods
2.1.1 Sampling of marine algae
Algae samples were collected from eight different sites around the coast of the Island of
Hawaii (Big Island) on Feb 12 and 13 2005. The species of these algae are listed in
Appendix 1.
2.1.2 Marine Fungi isolation
Algal samples were cut into small pieces using sterile blades and then placed onto the surface of glucose peptone yeast (GPy) sea water agar plates (lOgIL glucose, 2 gIL peptone, 19IL yeast extract, 25g/ L of Ampicillin). These plates were incubated at room temperature for a few days. Once the fungi grew on the agar, isolated colonies were transferred aseptically to another GPY plate to obtain pure cultures. Isolated pure cultures were kept on GPY agar plate at 4 ·C.
2.1.3 Extraction of Genomic DNA from fungal isolates
18 Pure cultures of the fungal isolates were inoculated into GPY liquid media and incubated
at room temperature for I week. Mycelia were collected and ground into fine powder in
liquid nitrogen. Genomic DNA was extracted with a DNAeasy kit (QIAGEN, Valencia,
CA) and loaded onto 1% agarose gel in TAB buffer to check the quality by agarose gel
electrophoresis. Genomic DNA obtained were used as templates in the PCR reactions
described in section 2. I .4.
2.1.4 PCR amplification of ribosomal internal transcribed spacer
regions
PCR primers used are listed bellow:
Forward primer ITS I: TCCGTAGGTGAACCTGCGG
Reverse primer: ITS4: TCCTCCGCTTATTGATATGC
These primers were purchased from the Operon Company, Huntsville, Alabama. Figure
1.2 shows the schematics of these primers. PCR reactions were performed in a 96-well
MyCycler thermal cycler (BioRad, Hercules, CA) as follows: 5 minutes at 94°C,
followed by 35 cycles of 30 seconds at 94 °c, 45 seconds at 50°C and 45 seconds at
72 °c, with a finally extension of 1000nutes at 72 °C. The PCR reaction system
employed a totally volume of 50 III containing IX PCR buffer, 1.5 mM of MgCh, 2.5
unit of Taq polymerase and 0.5 mM of dNTP (Promega, Madison, WI).
2.1.5 Sequencing of the PCR products and analyses
19 The peR products to be sequenced were first determined to be approximate 0.5 kb fragments using agarose gel electrophoresis, and then purified by a PCR products purification kit. (Promega Madison WI). Purified products were sequenced with ITSl and
ITS4 from both ends in Dr. Alam's lab, Department of Microbiology, University of
Hawaii. In total 106 isolates were sequenced.
The sequencing data were assembled by Seqman Program (DNAstar Inc, Madison, WI) and compared to known sequences in Genbank using BLAST analyses to get the closest match and the percentage of identity. If more than one sequences' closest matches in
Genbank belonged to the same species, then only one sequence will be loaded into the phylogenetic tree to avoid replicates. Selected sequences were then analyzed by clustral
X (1.81) and the paup 4.0 program (Sinaure, Sunderland. MA) using the Neighbor
Joining method with a bootstrap value of 1000. First, selected sequences were classified into different groups by clustral X (1.81) and the paup 4.0 program ( Sinaure, Sunderland.
MA) using Neighbor-Joining method with a bootstrap value of 1000. Then, sequences in each individual group were analyzed together with their closest match using clustral X
(1.81) and paup 4.0 again.
2.2 Results
2.2.1 Results of peR, sequencing and BLAST analyses
Amplifying genomic DNA isolated from each fungal isolate using ITSI and ITS4 ribosomal region primers yielded a band of the expected size from 500bp to 700bp. PCR
20 products were purified and sequenced then BLAST in Genbank. Table 2.1 showed the
BLAST results. A total of 106 sequences were obtained as listed in this table.
Table 2.1 BLAST results of ITS sequences of fungal isolates from algae collected in the Island of Hawaii
Sequence The closest Accession No. Specie of the closest Accession Similarity No. in Genbank No. in Genbank (%) Haw IA2 AJ876880 Asperlrillus iaPOnicus 100 Haw IA7 AY213655 Fusarium chlamydosporum 99 var.fuscum Haw IAll AY361965 Cladosporium cladosporioides 100 Haw3AI AY373908 Penicillium citreonigrum 99 Haw3A2 AF393720 Cladosporium sp. 100 Haw3A3 AM176695 Articulospora sp 96 Haw3A5 AY669327 Bionectria ochroleuca 99 Haw3A7 AJ132505 Monolmlphella albescens 98 Haw3A8 AY361964 Cladosporium cladosporioides 100 Haw3A9 AF125944 Penicillium SP 100 Haw3AIO AY373931 Penicillium sclerotiorum 98 Haw3Ali AJ230675 Trichoderma viride .100 Haw3A12 AY632667 Emericellopsis pa11ida 97 Haw3A14 AY373925 Penicillium olsonii 99 Haw3Bl AF125944 Penicillium sp 100 Haw3B2 AF393720 Cladosporium oxysporum 100 Haw3B3 AF125944 Penicillium sp 100 Haw3B4 AY373925 Penicillium olsonii 99 Haw3B5 AF393720 Cladosporium oxYSPOrum 100 Haw3B8 AF380354 Penicillium minioluteum 100 Haw3B9 AY254160 Myrothecium atrum 100 Haw3BIO AJ132505 Monographella albescens 98 Haw3Bll AY787674 Hypochnicium vellereum 96 Haw3B12 AY373897 Penicillium brevicompactum 100 Haw3B13 AJ876880 Aspergillus japonicus 94 Haw3B14 AF393720 Cladosporium oxysporum 100 Haw3B16 AY831562 Phorna pinodella 98 Haw3B17 AF176660 Penicillium pinophilum 98 Haw3B18 AF502780 Leaf litter ascomycete 99 Haw3Cl AY373897 Penicillium brevicompactum 100 Haw3C2 AF280758 Schizophyllum commune 99 Haw3C3 AY373925 Penicillium olsonii 99 Haw3C4 AY687299 Pestalotiopsis cryptomeriae 100
21 Haw3C5 DQ235784 Aspergillus awamori 100 Haw3C6 AF393720 Cladosporium sp. 100 Haw3C9 AY373854 AsperJtillus ochraceus 99 Haw 3ClO AB096264 Paraphaeosphaeria sp 100 Haw3C11 AY293804 Didymella cucurbitacearum 97 Haw3CI2 AY373925 Penicillium olsonii 99 Haw3CI4 AY336132 Leptosphaeria sp 98 Haw3D4 AF125944 Penicillium sp 100 Haw3D5 AF4439 13 Trichoderma harzianum 100 Haw3D6 AFooI025 Diaporthe phaseolorum 98 Haw3D7 AY213655 Fusarium chiamydosporum 99 var. fuscum Haw3DlO AY37393I Penicillium sclerotiorum 98 Haw3DI2 AY632667 Emericellopsis pa11ida 96 Haw3E4 DQ491491 Botryotinia fuckeliana 93 Haw3E6 DQOOl007 Pestaiotiopsis sp 100 Haw 3EI3 DQ000992 Pestaiotiopsis neglecta 100 Haw3EI6 DQ092506 Penicillium sp 98 Haw4AI DQ223761 Annulohypoxylon stygium 97 Haw4A2 AJ876880 Aspergillus japonicus 100 Haw4A6 DQ083009 Trichoderma erinaceum 99 Haw4A8 AY261369 Beauveria felina 91 Haw4BI DQ117959 Apiosporaceae sp 98 Haw4B2 AY373871 Aspergillus terreus 99 Haw4B3 DQ092522 Paraphaeosphaeria sp 100 Haw4B5 AF071333 Cochliobolus verruculosus 100 Haw4BlO DQ092522 Paraphaeosphaeria sp 99 Haw4D2 AY214459 Aschersonia sp 97 lIaw4D4 AF297228 Didymella bryoniae 98 Haw4D5 AF125944 Penicillium sp 100 Haw4D8 AY213655 Fusarium chiamydosporum 99 var. fuscum Haw4DIO DQ219433 Nigrospora oryzae 98 Haw4Dl2 AY633745 Fusarium incarnatum 99 Haw4DI3 AYI54948 Trichoderma harzianum 100 Haw5A8 AJ390409 Hypoxylon stygium 99 Haw5A11 AFI58106 Cochliobolus dactyloctenii 99 Haw5AI4 AY219373 Phanerochaete australis 99 Haw5B3 AF413049 Fungal endophyte 99 Haw5B5 AY213655 Fusarium chiamydosporum 99 var.fuscum
22 Haw5B12 U61695 Fusariumsp 99 Haw5B15 AY138848 Acremonium strictum 99 Haw5B17 DQ156345 Alternaria sp. 99 Haw5C4 AJ301998 Myrothecium sp 98 Haw5C5 AJ853741 Exserohilum rostratum 99 Haw5C6 AY755609 Alternaria sp 99 Haw5C7 AY213655 Fusarium chlamydosporum 99 var.fuscum Haw5CIO AJ853741 Exserohilum rostratum 100 Haw5C12 AF413049 Fungal endophyte 99 Haw6B2 AF158 106 Cochliobolus dactyloctenii 99 Haw6B6 AF393720 Cladosporium sp. 100 Haw6BI0 AY924267 Pestalotiopsis microspora 100 Haw6Bll AF413049 FunJ!;al endophyte 97 Haw6B14 AY373883 AsperJ!:illus versicolor 100 Haw6B19 D0499661 Alternaria sp 99 Haw7A2 AY751455 Alternaria tenuissima 100 Haw7A3 DQ018093 Dictyosporium toruloides 97 Haw7A4 AY266377 GIomerella cingulata 100 Haw7Bl AJ853755 Epicoccum nigrum 97 Haw7B4 AY373870 Gibberella zeae 99 Haw7B5 AY293804 Didymella cucurbitacearum 99 Haw7B6 AJ853741 Exserohilum rostratum 100 Haw7B7 AY303601 Acremonium sp. 91 Haw7B8 AJ853741 Exserohilum rostratum 100 Haw7BIO AF413049 Fungal endophyte 96 Haw7Bll AY373870 AsperJ!:illus tamarii 100 Haw7B14 DQ235784 Aspergillus awamori 100 Haw7B16 AY755609 Alternaria sp 100 Haw7B17 AJ853741 Exserohilum rostratum 99 Haw8Al DQ092524 Bartalinia sp 96 Haw8A3 D0491513 Microascus trigonosporus 96 Haw9A5 DQ384571 Leptosphaerulina chartarum 94 Haw9A9 U78881 Trichoderma harzianum 99 Haw9A19 DQ092534 Ascomycete sp 100 Haw llA3 AY373856 Aspergillus ochraceus 100
23 2.2.2 Classifying of selected sequences in phylogenetic trees
According the analysis method mentioned in 2.1.5, all selected sequences were fIrst
classifIed in to 4 large groups. Each group is showed in Figure 2.1 and bootstrap values
supporting each group were also listed.
Ha~UBS .,. l 100. Mi 6B19 11111 I> •!'Wa;' Afcs Hala3CM 1 no St::::-- w 3 16 Groupl I/:,w4D4 - w7Bl \':w3'lR 1 ~-:1~O I ~w7w3 5 aw7B 1 I/;.G/A3 ~ Haw :,wr.;4 11 5 Inn:...... JI::HtU ,.u H~J1k ,...-- """1-- ~w 3&.\6 Group 2 100 6S w3 0 Haw3BIHawW Inn. I/:,w llB8 ~, w B17 (l Inn. ~wli'i1 • Ha,,; ~~Z Ha 1 I: J 3 Haw Wa wSBlS 97 q HN:JIl1s HaH;'3 lYlZ 61 4 100. Haw~SC 8 Group 3 ~w4DlZ '--- w7B4 HaJlJBf'lZ .. Haw l1a~sA3 HllW3C4 ls.B Innr Haw3EI3 lnor"'-! tt. ~tFIO Inn paw8Al Haw6Bl -Haw4Dlo 100 Haw3Bll I !'ri::~ b~ Group 4 ____ 0.05 substitutions/site
Figure 2.1 Neighbor-Joining tree of algae-derived fungi in the Island of Hawaii based on ITS sequences
24 2.2.3 Analysis of each group with the closest matches in Genbank
According to the analysis method mentioned in section 2.1.5, sequences in each group of section 2.2.2 were analysis by paup 4.0 individually with their closest matches in
Genbank in Neighbor-Joining method. Figure 2.2, 2.3, 2.4 and 2.5 show the Neighbor-
Joining trees of each group.
Leaf Utter IISCOmycele AF502788 Haw3BI8 UptDsphomwJJna chortarum DQ384571 I...--Haw9AS 100
.----- Haw7A3 L-___ D.rulryphklla Pinosa DQ307316
1 Haw4B5 CMhliobo/as • ...... Josus AF072l333 Haw3A3 HeIoJku:IIIlQ sp EF060565 HawSAll Coehliobo/as tkld]- AF158I06 Group 1 HawSe! 95 L-__1JIILj IUserohilum rosJmtam AJ 853741 Pleosporales Haw7A2 A1umuuIa temdsslma AY7S1455 L-_..lIWjOO,A1umuuIa Iongipes AY7S1457
Haw6B19
Haw7BI I Bp/cQc Phol1UJ p1notklJa AY831S62 Haw3C14 L-_...... Uptosp_sp. AY336132 L-______CrambecmmbeAY3ll1410 - 0.01 suhstItutloDBIs Figure 2.2 Neighbor-Joining tree of Group I. Sponge Crambe crambe ITS sequence ( Genbank Accession No. AY319410) was used as an outgroup. 25 Ii2 BawlA1 Cladel ,..------1 CItuIoaporlum cltulosporlo1d88 AY36196S Baw3B2 ~ycosphaerellales 84 CIIUIosporlum oxysporum DQ912837 Baw3B17 I Penicillium pinophlJum AFI76660 Baw3B8 100 P.nIcIl1Jum mInlo/ul<1um AF3803S4 58 Baw11A3 .---""""'-1 Aspergillus ochrac.us A Y3738S6 100 BawfiB14 '---~=-t Aspergillus .er.dcolor AY373883 100 Baw7Bll '---":;;;'iAsperglllus tamarU AY373870 100 Baw3A14 100 P.nIcIl1Jum olsonll DQll7963 00 Baw3B1 100 Penicillium bl'lll'ico11lJ'lU'flU1l A Y373897 Clade2 Eurotiales 100 Baw3A1 ...... "1. P.nkllllum cltreonlgrum A Y373!108 00 Baw3A10 !l5 t--"""L P.nIcIl1Jum ._rum A Y373931 91 Baw3A9 Penicillium sp. AFl2S944 Baw3E16 Penicillium sp DQl23664 Baw3CS .---""'1 Aspergillus awamorl DQ23S784 100 Baw4B2 L--~1II Aspergillus _ AY373871 77 100 Baw1A2 100 Asp.rgi11usJaponkus AJ876880 Baw3B13 Baw3E4 L----..JlI!If--:==,Botrymlnlofuckellana DQ491491 I Clade3 Helotiales '--______Cmmb.crumbeAYll9410 _ 0.01 substitutions/site Figure 2.3 Neighbor-Joining tree of Group 2. Sponge Crambe crambe ITS sequence ( Genbank Accession No. AY319410) was used as an outgroup. 26 100 Haw8A3 I Clade1 ScopukuWpsIs chtu10rum AY62506/i M1croasca1es 100 Haw7A4 GW_dn~ EF221828 I Clade 2 PhyUachorales 74 Haw4A 100 Haw3Al1 7i'rh:ho Figure 2.4 Neighbor-Joining tree of Group 3. Basidiomycota SchizophyUum commune ITS sequence ( Genbank Accession No. AF280758) was used as an outgroup. 27 114w3Bll 100 Clade 1 Aphyllophorales H]pDdJnldum vdlemumA Y/81614 I14wSA14 100 92 Phaneroduu!te sonIltm AB210018 Clade 2 AgaricaIes - 114w3C2 100 SdJho Crambecrumbe Anl9410 ---O.OS substltut_tt. Figure 2.5 Neighbor-Joining tree of Group 4 • Sponge Crambe crambe ITS sequence ( Genbank Accession No. AY319410) was used as an outgroup. 2.3 Discussions ITS ribosomal regions have been applied in fungal identification, diversity and phylogenetic research for years. The ITS! and ITS2 regions flanking in the 5.8S rDNA 28 gene family in all eukaryotic genomes. Presumably because they are not transcribed into proteins, therefore, there is a lack of environmental selective pressures, resulting in higher mutation rates and more polymorphism during the long evolution history of organisms. By using ITSI and ITS2 primers, the total ITSI region and ITS2 region including the 5.BS region can be amplified. Because the 5.BS region is of short length (-160bp) and highly conserved, introducing this region into the ITS region would not affect the analysis when applying the ITSI and ITS2 sequences in the study of the mutations in evolution. ITS sequences in this study were analyzed by the paup 4.0 and several phylogenetic trees were created basing on these sequences and their closest relatives in Genbank database. Figure 2.2 shows that all isolates selected can be classified into four large groups in the phylogenetic tree. The bootstrap values for the four branches are 100, 9B, 100 and 100 respectively. Bootstrap values higher than 50 mean that the topology of the tree makes some senses and even higher bootstrap values indicate greater reliability. Therefore, the high bootstrap values of 100, 9B, 100 and 100 indicate that classification the isolates into these four groups as shown in the Figure 2.2 is very reliable. Figure 2.3 presented the phylogenetic tree for isolates in group I and their closest relatives in Genbank. Sponge ITS sequence was used as an outgroup. There are a total of IB isolates in this group. All belong to the order Pleosporales. Each isolate was classified into one most outside group with its closest match. Most of these isolates showed very short distance from the closest relatives, which means they are very close in phylogeny 29 with very low substitution and belonged to the same species. However, isolate Haw7 A3 showed considerable phylogenetic distance from its closet relative Dictyosporium toruloides (Genbank accession No. DQ018093). By using the MegAlign program (DNAstar Inc, Madison, WI), these two sequences have a low similarity value of 71 %, which indicated that Haw 7A3 is quite likely to be a different species, and a potential new species. In Figure 2.3, 18 isolates from group 2 were classified into 3 clades with their closest relatives in Genbank. Clade 1 had two isolates which belong to the order of Mycosphaerellales; Clade 2 is the biggest one in group 2, including 15 isolates which belong to the order of Eurotiales. Clade 3 is the smallest one with only one isolate, belonging to the order of Helotiales. Eurotiales has the highest frequency in the result which might be due to the ability of this order to form spores or perhaps better adaptation of this order to the substrates. All isolates in this clade are Penicilium sp. and Aspergillus sp. Figure 2.4 shows the Neighbor-Joining tree of group 3, the biggest and most divergent group in Figure 2.1. In total 24 isolates were classified into 5 clades: Microascales. Phyllachorales Hypocreales, Xylariales and Diaporthales. Although five independent orders existed in this group, they all belonged to the same class, Sordariomycetes Class. Clade3, Hypocreales (14 isolates) is the second biggest order in the result. It is not clear if fungi in this order have a greater capability to attach to and get used to the algal substrates or this is only merely by chance. 30 To summarize, all the isolates in the fIrst three groups all belong to Ascomycota, the biggest fungal phylum. This result is consistent with other classifIcations since Ascomycota constitutes more than 80% of documented fungal species. Finally, as shown in Figure 2.5, three isolates in group 4 belong to another fungal phylum, Basidiomycota. In this phylogenetic tree, there are two orders, Aphyllophorales and Agaricales. Isolate Haw 3Bll, which shows a long distance from its closest match in Genbank, might be a potential new species. This is also supported by the low similarity, 82% (by MegAlign program), between these two sequences. To determine whether Haw 7 A3 and Haw 3B 11 are new species, more identifIcation approaches, including traditional morphological methods are needed. Using molecular methods, except ITS rONA regions, 18S rONA region and mitochondrial genes can also be employed to back- up the classifIcation and identifIcation [41]. Further work need to be performed to determine if these two isolates are new species. The Hawaiian Islands are the most isolated land in the world, which offer a distinctly unique location for the study of marine fungi. It is highly possible that the ecology of marine fungi in Hawaii Ocean may have specifIcity compared to other ocean areas. However, the research on marine fungi in Hawaii ocean area is still very fragmentary and limited. The goal for the project including what has been done so far and what will be done in the near future, is to survey the diversity of Hawaii marine fungi systematically. Research presented in this charter is only a preliminary survey and more systematic 31 samplings from different sources, such as a variety of algae or sponges, and from more geographic locations will be carried in out the future. 32 Charter 3. Biological activity assays of the Hawaiian marine fungal isolates 3.1 Materials and Methods 3.1.1. Culturing of marine fungi 70 isolates obtained on algal substrates and 58 isolates from sponge substrates around the Hawaiian coast were inoculated individually into 50 m1 of GPY sea water media and incubated still at room temperature for 3 months. 3.1.2. Culture extracts An equal volume of ethyl acetate was added to the culture and the mixture was shaken at a speed of 200rpm for 5 minutes. After shaking the organic phase was separated using a separation funnel. This procedure was repeated twice, each time adding an equal volume of ethyl acetate to the aqueous phase. After three times of extraction, organic phases were combined, purified with MgS04• filtered and transferred into a vacuum flask and evaporated in a 37"C water bath by vacuum. Finally the compounds were dissolved in approximately 3ml of ethyl acetate and vacuumed again in a rotary evaporator at 37'C to evaporate all the organic solvents. The extracted compounds were stored at -20 'C. 3.1.3 Bacterial strains and murine cell lines Bacillus subtilis, Staphylococcus aureus (ATCC No. 25923), Pseudomonas aeruginosa (ATCC No. 27853) and were obtained from Department of Microbiology, University of 33 Hawaii (courtesy); E.coli Kl2 (MG1655) are preserved in our lab. Murine cell line BCN (ATCC No. TlB-73) is not tumorgenic in nonnal mouse. Murine cell line L88 is tumorgenic in nonnal mouse. These cell lines are preserved in Dr. Patek's lab, Department of Microbiology, University of Hawaii. Both cell lines were maintained at 37 'C in Dulbecco's Modified Eagle high glucose medium (invitrogen, Carlsbad, CA) supplemented with 10% FBS, I~ penicillin / streptomycin (IOOX), 1% glutamine ( 20mM) in an humidified incubator with 5% C02 in air. 3.1.4 Anti-bacterial assay Paper disc diffusion was perfonned by the standard method of National Committee for Clinical Laboratory Standards (NCCLS, 2000) [42] to test the anti-bacterial activity of the marine fungi extracts. Three distinct colonies of each bacterium with similar morphology were picked and cultured in LB media at 37·C. The inoculums were adjusted with LB to obtain a turbidity comparable to that of a 0.5 McFarland turbidity standard. Next, 100!li of inoculums was spread onto the dry surface of Muller Hinton agar plates (Difco, BD Company, Sparks, MD USA). Paper discs (1/2 inch, No.1, Whatman) were placed on the plates and crude extracts dissolved in DMSO to a concentration of 20mglml, were loaded onto each paper disc at 500llgl disc. Control paper discs were loaded with 251ll ofDMSO without crude extracts. Plates were incubated in 30'C for 16 hours and the diameters of inhibition zones were measured to the closest millimeters with a millimeter ruler. Strains with a clear inhibition zone were considered susceptible to the samples; those without such a zone were considered resistant. Crude extracts of 70 isolates from algal substrates in Hawaii waters were tested with the four bacterial strains listed above. 34 3.1.5 Cytotoxicity assay Cytotoxicity assay of the crude extract was measured by the MIT assay. First, cells were treated with 0.4 % EOTA in Hank's Balanced Salt Solution to obtain individually isolated cells. 100 III of cells was seeded into each well of a 96 well plate (flat bottom, cell culture quality) corresponding to around 1.0 x 104 cells/well. Samples with a concentration of 200Ilg/mJ in a mixed organic solvent (60% methanol, 20% ethyl acetate and 10% methyl tert-butyl ether) were added into each treatment well at 1Ill/ well. Wells with cells and I III of organic solvent but without samples were included as control. After 24 hours of incubation, 10 fll of MIT (5 mg/mJ) was added into each well. After another 4 hours of incubation, 100 III of MIT solubilization buffer (10% SOS, O.OIN HCl) was added into each well and the plates were incubated overnight at 30·C. The data of absorbance of each well was measured on a multi-plate reader (Biorad, Hercules, CA) with a test wavelength of 570 nm. The assays were in triplicates and repeated. Crude extracts of 70 isolates from algal substrates and 58 isolates from sponge substrates from Hawaiian waters were tested. Cell growth inhibition was estimated with the following formula: Growth inhibition (%) =1-A570nm (treated cells)/A570nm (control cells) xIOO%. [43] 3.2 Results 3.2.1 Antibacterial assay After 16 hours of incubation, the diameters of the inhibition zones on Muller Hinton agar plates were measured to the closest millimeter. If no inhibition zone was present, the diameter was recorded as zero. Table 3.1 and Table 3.2 show of the diameters of the inhibition zones for Bacillus subtilis and S. aureus, respectively, of those extracts which 35 inhibition zones fo r Bacillus sublilis and S. aureus, respectively, of those extracts which caused visible zones on the plates. Figures of the diameters in these two tables refer to the arithmetic means of the repeats. Eight and four extracts of algae-derived fungi have shown inhibitory activity against Bacillus sub/ilis and S. aureus, respectively. However no samples showed inhibitory activity against the E.coli K I2 and Pseudomonas aeruginosa lI sed in the test. For the control discs, no zones occurred. Figure 3. 1 and Figure 3.2 shows the bigger inhibition zones occurred in thi s test. Figure 3.11nhibition zoncs Figu,·c 3.2 I.nhibition zones of B. sub/ilis of s. (lureus 1. Haw 4D8 3. Control 2. Haw 4D8, 3. Haw 3D7, 6. Control Table 3.1 Isolates which shown antibactcrial llctivity against B. SIIb/i1is strain B sub/ilis Diameters of Closet Accession No. Species of the closet Similarity inh ib ition zO llc(mm) in Genbank match (%) Haw 3Bl3 19 AJ876880 Aspergill us japonicus 94 Haw3Bl7 15 AF 176660 Penicillium pinophilul11 98 Haw 3C 9 16 AB096264 Aspergi llus ochracells 99 36 Haw3CI0 16.3 AB096264 Paraphaeosphaeria sp 100 Haw3D7 18.3 AY213655 Fusarium 99 chlamydosporum var. fuscum Haw 408 23.3 AY213655 Fusarium 99 chlamydosporum var. fuscum Haw5C7 18.6 AY213655 Fusarium 99 chlamydosporum var. fuscum Haw5ClO 15.6 AJ853741 Exserohilum rostratum 100 Table 3.2 Isolates which shown antibacterial activity against S. aureus strain S. aureus Diameters of Closet Accession No. Species of the closet Similarity inhibition zone(mm) in Genbank match (%) Haw3C 9 14 AB096264 Aspergillus ochraceus 99 Haw3D7 18.3 AY213655 Fusarium 99 chlamydosporum var. fuscum Haw4D8 22.6 AY213655 Fusarium 99 chlamydosporum var. fuscum Haw5C7 20.3 AY213655 Fusarium 99 chlamydosporum var. fuscum 3.2.2 Cytotoxicity assay By testing 129 samples of crude extracts from the cultures of Hawaiian marine fungi, four samples, one from algae associated fungi and three from sponge-associated fungi showed strong inhibition on the tumorgenic cell line L88 and slight or no inhibition on 37 The inhibition rates of these four samples were shown in Table 3.3. The figures of inhibition rates in Column 2 and Column 3 in Table 3.3 refer to the arithmetic means of the triplicates. Pictures of the cultures of cell line BCN and L88 with and without treatments are presented in Figure 3.3 in next page. Table 3.3 Isolates which shown cytotoxic activities Isolates Inhibition rate Inhibition rate Closet match in Species of the Similarity for L88 (%) for BCN (%) Genebank closet match (%) Kau5BR 60.5 7.5 AYI72092 cf. Trichoderma sp 100 Lan3BA 73.6 0 AF502787 Leaf litter ascomycete 91 Haw4D8 51.6 1.4 AY213655 Fusarium chlamydosporum 99 var. fuscum Lan3CA 44.9 2.5 AF455493 Trichoderma viride 99 3.3 Discussions Numerous compounds derived from marine fungi have been reported to present biological activities, including antibiotic and anti-tumoral prosperities. The goal for the research described here is to conduct preliminaty screening with some marine fungal isolates for antibacterial activity or antitumoral activity. In the antibacterial assay, the isolated Haw 4D8 Fusarium sp. showed high inhibitory activity on both Bacillus subtilis (23.3 mm) and S. aureus (22.6mm), which suggests that the crude extract of this isolate may contain compounds with potent antibacterial activity. Several other isolates also show antibacterial activity on B. subtillis or S. aureus, or both. 38 Figure 3.3 Morphology of BeN cell line and L88 cell line with treatments and controls (X 200) I : Control of BCN 2,3,4,5: BCN treated with Kau 5BR, Lan 3BA, Haw 408, Lan 3CA, respectively. 6. Contro l of L88 7,8,9, 10: L88 treated with Kau 5BR, Lan 3BA, Haw 408, Lan 3CA, respecti vely. 39 No extracts presented antibacterial activity on Pseudomonas aeruginosa and E.coli K12, the two gram negative bacteria in this test. It is not surprising that such results occurred since gram negative bacteria have been found to be less susceptible to drugs than gram positive bacteria [44, 45, and 46]. One possible explanation may be that the structure and compositions of the cell walls of gram negative bacteria make it more difficult for drugs to enter the cells than to enter gram positive cells. Usually gram negative bacteria are enveloped by a thick layer of lipid-polysaccharide (8-1 Onm) (LPS) which locates outside the cell wall. The LPS layer can block the drugs to enter the cells like a natural barrier. On the contrary, gram positive bacteria lack the LPS structure therefore small molecules can pass through the cell waIl of G+ microbes and enter the cells. Another factor could be resistance plasmids (R plasmids). R plasmids have been shown to contribute to multiple drug-resistances in gram-negative bacteria. R plasmids are carried by most gram negative pathogens with multiple drug-resistances but are rare in G+ bacteria. The MIT assay is a standard colorimetric assay for measuring cellular proliferation .It is used to determine cytotoxicity of potential medicinal agents and other toxic materials. The principle of this assay is that yellow MIT (3-(4, 5-Dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide, a tetrazole) can be reduced to purple formazan in the mitochondria of living cells. This reduction takes place only when mitochondrial reductase enzymes are active, and therefore conversion is directly related to the number of viable (living) cells. A solubilization solution is added to dissolve the insoluble purple formazan product into a colored solution. The absorbance of this colored solution can be quantified by measuring Ill: a certain wavelength (usually between 500 and 600 nm) by a spectrophotometer. 40 Since the in vivo mammalian cell cultures are so fragile and sensitive to organic compounds, any compounds might be toxic to the cell. The goal of this research is to look for some samples which can inhibit the growth of the tumorgenic cell line but either do not inhibit the growth of the non-tumorgenic cell line or only slightly inhibit these cells at certain concentrations. In this test. four samples, one from algae associated fungi and three from sponge-associated from fungi, showed strong inhibition on the tumorgenic cell line L88 and slight or no inhibition on the nontumorgenic cell line BCN, under the fInal treatment concentration of 200f,tg/ml. The results shown in Figure 3.3 indicate that the active samples can visually affect both cell density and morphology of the L88, but do not obviously affect the BCN cell lines, compared to both controls. On the other hand, results shown in Table 3.3 also indicate these four samples might contain active compounds which can inhibit the growth of tumorgenic cell line L88 with good specifIcity. Future detailed research will be done to assess the antitumoral ability and specifIcity of these four extracts. The research which has been done so far is only a preliminary screen for some possible interesting samples. We did not determine the values of minimum inhibitory concentration (MlC) and lCSO. Since the samples are all crude extracts, a mixture of compounds, it would not be particularly useful to obtain the MlC and lCSO data of the mixtures. Future research needs to be done including obtaining larger amounts of extracts from those isolates listed in Table 3.1, 3.2 and 3.3 and separation of fractions of the extracts will be tested to fInd out if they can provide interesting enough biological activities. Further samplings will also be carried out for more marine fungal species to perform the additional screening. 41 Appendix 1. Species of the algae sampled around the coast of the Islaud of Hawaii in session 2.1.1 Algae classified by Algal species sampling sites 1A Unidentified 3A Unidentified 38 Chaetomorpha atennina 3C Sargassum spp 3D Enteromorpha spp. 3E Ulva spp 4A Unidentified 48 Pterocladiella ca/oglossoidea 4C Sargassum spp 40 Asteronema breviarticulatum 5A Ahnfeltiopsis concinna 58 Sargassum spp 5C Amphiroa sPP. 6A Unidentified 68 Asteronema breviarticulatum 7A Unidentified 78 Asteronema breviarticulatum 8A Enteromorpha spp. 9A Asteronema breviarticulatum 11A Unidentified **** All species labeled as unidentified are different In morphology. 42 Appendix 2. Fungal isolates from algae which did not present visible inhibitory zones in the antibacterial assay against B. subtills in session 3.1.4 Sequence The closest Accession No. Specie of the closest Similarity No. in Genbank Accession No. In Genbank (%) Haw 3AI AY373908 Penicillium citreonigrum 99 Haw3A3 AM I 76695 Articulospora sp 96 Haw3A7 AJI32505 Monographella aIbescens 98 Haw3A8 AY36 1964 Cladosporium cladosporioides 100 Haw3A9 AF125944 Penicillium sp 100 Haw3AIO AY37393I Penicillium sclerotiorum 98 Haw 3AI2 AY632667 Emericellopsis paIlida 97 Haw3B2 AF393720 Cladosporium oxy~orum 100 Haw3B4 AY373925 Penicillium olsonii 99 Haw3B8 AF380354 Penicillium minioluteum 100 Haw3B9 AY254 I 60 Myrothecium atrum 100 Haw3BJI AY787674 Hypochnicium vellereum 96 Haw 3BI8 AF502780 Leaf litter ascomycete 99 Haw 3CI AY373897 Penicillium brevicompactum 100 Haw3C2 AF280758 Schizophyllum commune 99 Haw3C4 AY687299 Pestalotiopsis cryptomeriae 100 Haw3C5 DQ235784 Aspergillus awamori 100 Haw 3CII AY293804 Didymella cucurbitacearum 97 Haw 3CI4 AY336132 Leptosphaeria sp 98 Haw3D4 AF125944 Penicillium sp 100 Haw3D6 AFOOI025 Diaporthe phaseolorum 98 Haw3D12 AY632667 Emericellopsis pallida 96 Haw3E4 DQ491491 Botryotinia fuckeliana 93 Haw3E6 DQOOI007 Pestalotiopsis sp 100 Haw 3EI6 DQ092506 Penicillium sp 98.4 Haw4AI DQ22376I Annulohypoxylon stygium 97 Haw4A8 AY261369 Beauveria felina 91 Haw4BI DQI17959 Apiosporaceae sp 98 Haw4B3 DQ092522 Paraphaeosphaeria sp 100 Haw4B5 AF071333 Cochliobolus verruculosus 100 Haw4D2 AY214459 Aschersonia sp 97 Haw4D4 AF297228 Didymella bryoniae 98 Haw4DIO DQ219433 Nigrospora oryzae 98 Haw4DI2 AY633745 Fusarium incarnatum 99 Haw5A8 AJ390409 Hypoxylon stygium 99 Haw5AI4 AY219373 Phanerochaete australis 99 Haw5B3 AF413049 Fungal endophyte 99 Haw 5BI2 U61695 Fusarium sp 99 43 Haw 5BI5 AYI38848 Acremonium strictum 99 Haw 5BI7 DQI56345 Alternaria spo 99 Haw5C4 AJ301998 Myrothecium sp 98 Haw5C6 AY755609 Alternaria sp 99 Haw6B6 AF393720 Cladosporium spo 100 Haw 6BII AF4I3049 Fungal endophyte 97 Haw6BI4 AY373883 Aspergillus versicolor 100 Haw 6BI9 DQ499661 Alternaria sp 99 Haw7A3 DQOl8093 Dictyosporium toruloides 97 Haw7A4 AY266377 GIomerella cingulata 100 Haw7BI AJ853755 Epicoccum nigrum 97 Haw7B4 AY373870 Gibberella zeae 99 Haw7B6 AJ85374I Exserohilum rostratum 100 Haw7B7 AY303601 Acremonium spo 91 Haw7B8 AJ853741 Exserohilum rostratum 100 Haw7BIO AF4I3049 Fungal endophyte 96 Haw7BIl AY373870 Aspergillus tamarii 100 Haw 7BI6 AY755609 Alternaria sp 100 Haw8AI DQ092524 Bartalinia sp 96 Haw8A3 DQ491513 Microascus trigonosporus 96 Haw9A5 DQ384571 Leptosphaerulina chartarum 94 Haw9A9 U78881 Trichoderma harzianum 99 Haw9AI9 DQ092534 Ascomycete sp 100 Haw IIA3 AY373856 Aspergillus ochraceus 100 44 Appendix 3. Fungal isolates from algae which did not present visible inhibitory zones in the antibacterial assay against S. aureus in session 3.1.4 Sequence The closest Accession Specie of the closest Similarity No. No. in Genbank Accession No. In Genbank (%) Haw3A1 AY373908 Penicillium citreonigrum 99 Haw3A3 AM176695 Articu1ospora sp 96 Haw3A7 AJ132505 Monographella a1bescens 98 Haw3A8 AY361964 Cladosporium c1adosporioides 100 Haw3A9 AF125944 Penicillium sp 100 Haw3AI0 AY373931 Penicillium sclerotiorum 98 Haw 3A12 AY632667 Emericellopsis pallida 97 Haw3B2 AF393720 Cladosporium oxysporum 100 Haw3B4 AY373925 Penicillium olsonii 99 Haw3B8 AF380354 Penicillium minioluteum 100 Haw3B9 AY254160 Myrothecium atrum 100 Haw 3B11 AY787674 Hypochnicium vellereum 96 Haw 3BI3 AJ876880 Aspergillus japonicus 94 Haw 3B17 AF176660 Penicillium pinophilum 98 Haw 3B18 AF502780 Leaf litter ascomycete 99 Haw 3C1 AY373897 Penicillium brevicompactum 100 Haw3C2 AF280758 Schizophyllum commune 99 Haw3C4 AY687299 Pestalotiopsis cryptomeriae 100 Haw3C5 DQ235784 Aspergillus awamori 100 Haw 3CI0 AB096264 Paraphaeosphaeria sp 100 Haw3C11 AY293804 Didymella cucurbitacearum 97 Haw3C14 AY336132 Leptosphaeria sp 98 Haw3D4 AF125944 Penicillium sp 100 Haw3D6 AFOOI025 Diaportbe phaseolorum 98 Haw3DI2 AY632667 Emericellopsis pallida 96 Haw3E4 DQ491491 Botryotinia fuckeliana 93 Haw3E6 DQ001007 Pestalotiopsis sp 100 Haw 3EI6 DQ092506 Penicillium sp 98.4 Haw4AI DQ223761 Annulohypoxylon stygium 97 Haw4A8 AY261369 Beauveria felina 91 Haw4BI DQ117959 Apiosporaceae sp 98 Haw4B3 DQ092522 Paraphaeosphaeria sp 100 Haw4B5 AF071333 Cochliobolus verruculosus 100 Haw4D2 AY214459 Aschersonia sp 97 Haw4D4 AF297228 Didymella bryoniae 98 Haw4D10 DQ219433 Nigrospora oryzae 98 Haw4D12 AY633745 Fusarium incarnatum 99 Haw5A8 AJ390409 Hypoxylon stygium 99 45 Haw 5AI4 AY219373 Phanerochaete australis 99 Haw5B3 AF413049 Fungal endophyte 99 Haw 5BI2 U61695 Fusarium sp 99 Haw 5BI5 AYJ38848 Acremonium strictum 99 Haw 5BI7 OQI56345 Alternaria spo 99 Haw5C4 AJ301998 Myrothecium sp 98 Haw5C6 AY755609 Alternaria sp 99 Haw5CIO AJ85374I Exserohilum rostratum 100 Haw6B6 AF393720 Cladosporium spo 100 Haw6BII AF4J3049 Fungal endophyte 97 Haw 6BI4 AY373883 Aspergillus versicolor 100 Haw 6BI9 OQ499fi61 Alternaria sp 99 Haw7A3 OQOl8093 Oictyosporium toruloides 97 Haw7A4 AY266377 Glomerella cingulata 100 Haw7BI AJ853755 Epicoccum niJuum 97 Haw7B4 AY373870 Gibberella zeae 99 Haw7B6 AJ85374I Exserohilum rostratum 100 Haw7B7 AY303601 Acremonium spo 91 Haw7B8 AJ853741 Exserohilum rostratum 100 Haw 7BI0 AF413049 Fungal endophyte 96 Haw7BII AY373870 Aspergill us tamarii 100 Haw 7BI6 AY755609 Alternaria sp 100 Haw8AI OQ092524 Bartalinia sp 96 Haw8A3 OQ491513 Microascus trigonosporus 96 Haw9A5 OQ384571 Leptosphaerulina chartarum 94 Haw9A9 U78881 Trichoderma harzianum 99 Haw9A19 OQ092534 Ascomycete sp 100 Haw 11A3 AY373856 Aspergillus ochmceus 100 46 Appendix 4. Samples which presented negative results in MIT assays with BeN cell line and L88 cell line in session 3.1.5 Isolates Inhibition rate Inhibition rate Closet Species of the closet match Similarity for L88 (%) fur BCN (%) match in In Genbank (%) Genebank Haw3AI 33.1 26.3 AY373908 Penicillium citreonigrum 100 Haw3A3 12.8 9.3 AMI76695 Articulospora sp 99 Haw3A7 37.2 30.1 AJ132505 Monographella albescens 100 Haw3A8 22.9 18.7 AY361964 Cladosporium 99 cIadosporioides Haw3A9 13.2 9.3 AF 125944 Penicillium sp 100 Haw3AI0 11.3 10.1 AY37393I Penicillium sclerotiorum 96 Haw3AI2 12.3 11.7 AY632667 Emericellopsis pallida 99 Haw3B2 32.1 24.8 AF393720 Cladosporium oxysporum 98 Haw3B4 79.2 71.4 AY373925 Penicillium olsonii 100 Haw3B8 54.7 46.6 AF380354 Penicillium minioluteum 100 Haw3B9 31.2 32.5 AY254160 Myrothecium atrum 98 Haw3BII 33.8 27.6 AY787674 Hypochnicium vellereum 100 Haw 3B13 18.9 16.6 AJ876880 Aspergillus japonicus 97 Haw 3BI7 55.4 52.4 AFI76660 Penicillium pinophilum 99 Haw3BI8 25.7 18.5 AF502780 Leaf litter ascomycete 100 Haw 3CI 8.6 11.3 AY373897 Penicillium brevicompactum 100 Haw3C2 34.6 29.2 AF280758 Schizophyllum commune 99 Haw3C4 61.2 56.1 AY687299 Pestalotiopsis cryptomeriae 100 Haw3C5 50.2 30.5 DQ235784 Aspergillus awamori 100 Haw3C9 27.6 19.9 AY373854 Aspergillus ochraceus 100 Haw3CIO 5.7 5.1 AB096264 Paraphaeosphaeria sp 98 Haw 3CII 24.5 13.9 AY293804 Didymella cucurbitacearum 96 Haw3CI4 14.5 11.9 AY336132 Leptosphaeria sp 100 Haw3D4 56.8 50.1 AF125944 Penicillium sp 94 Haw3D6 86.1 83.7 AFOOlO25 Diaporthe phaseolorum 100 Haw3D7 16.7 13.7 AY213655 Fusarium chlamydosporum 98 var. fuscum Haw3DI2 19.1 18.5 AY632667 Emericellopsis pallida 98 Haw3E4 8.6 11.3 DQ491491 Botryotinia fuckeliana 99 Haw3E6 28.6 19.9 DQOOI007 Pestalotiopsis sp 100 Haw 3EI6 61.2 56.1 DQ092506 Penicillium sp 99 Haw4Al 50.4 30.5 DQ223761 Annulohypoxylon stygium 99 Haw4A8 17.2 13.9 AY261369 Beauveria felina 100 Haw4BI 5.7 5.1 DQI17959 Apiosporaceae sp 100 Haw4B3 50.2 30.5 DQ092522 Paraphaeosphaeria sp 100 Haw4B5 27.6 19.9 AF071333 Cochliobolus verruculosus 99 Haw4D2 5.7 5.1 AY214459 Aschersonia sp 100 Haw4D4 9.8 12.1 AF297228 Didymella brYoniae 97 47 Haw4DIO 54.5 55.0 DQ219433 Nigrospora oryzae 98 Haw4DI2 2.1 2.3 AY633745 Fusarium incarnatum 100 Haw5A8 14.5 11.0 AJ390409 Hypoxylon styldum 100 Haw 5AI4 48.2 30.5 AY219373 Phanerochaete australis 98 Haw5B3 27.6 19.0 AF4 I 3049 Fungal endophyte 99 Haw 5BI2 5.7 5.1 U61695 Fusarium sp 98 Haw 5B15 6.2 8.3 AY138848 Acremonium strictum 96 Haw 5B17 28.5 15.3 DQ I 56345 Alternaria sp. 93 Haw5C4 39.1 27.9 AJ301998 Myrothecium sp 100 Haw5C6 31.4 26.4 AY755609 Alternaria sp 100 Haw5C7 24.7 24.1 AY213655 Fusarium chlamydosporum 98 var. fuscum Haw 5CIO 28.6 19.9 AJ853741 Exserohilum rostratum 97 Haw6B6 50.2 30.8 AF393720 Cladosporium sp. 100 Haw6Bll 24.6 19.9 AF413049 Fungal endophyte 99 Haw 6BI4 5.7 5.1 AY373883 Aspergillus versicolor 91 Haw 6BI9 6.9 4.2 DQ49966I Alternaria sp. 98 Haw7A3 19.1 16.9 DQOl8093 Dictyosporium toruloides 99 Haw7A4 6.2 3.5 AY266377 Glomerella cingulata 100 Haw7B1 12.8 10.6 AJ853755 Epicoccum niwum 100 Haw7B4 8.4 5.2 AY373870 Gibberella zeae 99 Haw7B6 33.9 30.8 AJ853741 Exserohilum rostratum 97 Haw7B7 9.8 10.5 AY303601 Acremonium sp. 98 Haw7B8 21.8 18.9 AJ853741 Exserohilum rostratum 100 Haw7BIO 54.7 46.6 AF413049 Fungal endophyte 99 Haw7BII 31.2 32.5 AY373870 Aspergillus tamarii 98 Haw 7BI6 33.8 27.6 AY755609 Alternaria sp 99 Haw8AI 18.9 16.6 DQ092524 Bartalinia sp 100 Haw8A3 55.4 52.4 DQ491513 Microascus trigonosporus 99 Haw9A5 25.7 18.5 DQ384571 Leptosphaerulina chartarum 99 Haw9A9 19.1 18.5 U7888 I Trichoderma harzianum 99 Haw9AI9 8.6 11.3 DQ092534 Ascomycete sp 99 Haw IIA3 34.6 29.2 AY373856 Aspergillus ochraceus 99 HKBI 16.4 8.9 AF502880 Leaf litter ascomycete 99 HKBIO 27.1 25.2 AF033405 Penicillium herquei 99 HKB13 50.6 31.2 unidentified HKB22 62.1 50.0 unidentified HKB28 24.0 19.5 unidentified HKB32 43.8 25.8 unidentified HKB33 36.5 10.2 unidentified HKB34 35.5 19.6 unidentified Kau5BG 36.4 15.3 DQ123664 Penicillium sp. 100 Kau5BH 54.1 40.6 unidentified Kau 5BJ 43.6 17.8 AY373897 Penicillium brevicompactum 99 48 HKCI8 70.1 58.5 unidentified HKC20 45.4 36.4 unidentified HKC23 59.6 51.5 AF502880 Leaf litter ascomycete 95 GA5 50.5 40.2 unidentified Kau5BO 31.3 14.8 AF46 1746 Paecilomyces fumosoroseus 100 Kau 5BE 37.8 23.8 AF443923 Hypocrea lixii 99 Kau5BK 19.4 14.9 unidentified Kau 5BP 27.9 17.1 AY687299 Pestalotiopsis cryptomeriae 100 Kau 5Bl 25.2 23.9 unidentified Kau5BM 19.2 16.3 AJ301991 Hypocrea rufa 98 MAl 38.1 26.8 unidentified CCN5 55.5 46.1 unidentified CCNIO 69.8 53.6 unidentified CCNII 71.3 72.2 unidentified CCNI2 45.6 27.0 unidentified CCNI9 34.6 10.7 unidentified CCN22 47.1 40.3 unidentified CCN27 44.7 27.9 unidentified CCN34 32.3 31.2 unidentified Kau2CB 24.9 20.8 DQOOI002 Pestalotiopsis microspora 99 Kau2BJ 56.9 48.3 AF035779 Ampelomyces humuli 98 Kau2CH 22.8 8.1 AF443920 Hypocrea lixii 100 Kau2CF 30.9 22.9 U61695 Fusarium sp. 98 Kau4AA 35.0 31.6 AY702072 Uncultured fungus 99 Kau4AD 56.4 39.1 AF455502 Trichoderma inhamatum 99 Kau4AE 79.0 82.1 AJ876880 Aspergillus japonicus 93 Kau4BC 4.1 2.7 AY510420 Preussia africana 99 Kau4CA 35.7 22.06 AY373870 Aspergillus tamarii 99 Kau4CE 61.3 41.9 AY373925 Penicillium olsonii 99 Kau4AF 24.4 7.3 DQOOI007 Pestalotiopsis sp. 100 Kau5BG 18.4 17.1 DQ123664 Penicillium sp. 100 Lanl AA 27.5 9.5 DQ336712 Aspergillus ochraceus 99 Lan IAF 79.4 62.3 AY265328 Pyricularia costina 94 Lan IBA 82.7 77.9 AY273297 Uncultured ascomycete 99 Lan2CA 2.1 2.4 AF393720 Cladosporium oxysporum 100 Lan2CE 47.6 28.6 AF455426 Aspergillus terreus 100 Lan3AC 12.4 10.3 AJ312356 Diaporthe helianthi 99 Lan3CD 53.7 28.4 AY513965 Phomasp. 95 Lan4AC 31.5 26.0 unidentified Lan4BA 46.4 17.1 unidentified HKAIO 61.8 48.2 AY213655 Fusarium chlamydosporum 99 HKAI5 32.2 29.0 DQ535186 Nectria haematococca 99 HKAI2 18.3 11.3 AFI58106 Cochliobolus dactyloctenii 98 HKA29 76.9 69.7 AY373872 Aspergillus unguis 99 49 References 1. Kohlmeyer, J., and Kohlmeyer, E. 1979. Marine mycology: the higher fungi. Academic Press, New York: 690 2. Kohlmeyer, J. 1986. Taxonomic studies of the marine Ascomycotina. S. T. Moss (ed.), Cambridge University Press. The biology of marine fungi: 23~257. 3. Spatafora, J. W., Volkmann-Kohlmeyer, B. and Kohlmeyer, J. 1998. Independent terrestrial origins of the Halosphaeriales (marine Ascomycota). Am. J. Bot. 85( II): 1569-1580 4. Hyde, K.D and Lee, S.Y. 1995. Ecology of mangrove fungi and their role in nutrient cycling: what gaps occur in our knowledge?: Hydrobiologia 295(1-3): \07-118 5. Jensen, P.R. and Fenical, W. 2002. Secondary metabolites from marine fungi. In: Hyde, K.D. (Ed) Fungi in Marine Environments. Fungal Diversity Research Series 7:293-315 6. Bugni, T.S. and Ireland, C.M. 2004. Marine -derived fungi, a chemically and biological diverse group of microorganism. Nat. Prod Rep 21 (I): 143-163 7. Barghoom, E.S. and Linder, D.H. 1944. Marine fungi: their taxonomy and biology. Farlowia 1(3): 395-467 8. Shearer, C. 2007. Fungal biodiversity in aquatic habitats. Biodivers Conserv. 16(1): 49-67 9. Jones, E.B.G. 1993. Tropical marine fungi. In Aspects of Tropical Mycology (S. Isaac, J.C. Frankland, R. Watling and A.J.S. Whalley, eds): 73-89. Cambridge: Cambridge University Press. 10. http://hbs.bishopmuseum.org 11. Anastasiou, C. J. 1963. Fungi from salt lakes II. Ascomycetes and Fungi Imperfecti from the Salton Sea. Nova Hedwigia. 6(1-2): 243-276 12. Anastasiou, C. J. 1964. Some aquatic Fungi Imperfecti from Hawaii. Pacif Sci. 18(2): 202-206 13. Kohlmeyer, J, and Volkmann-Kohlmeyer, B. 1993. Biogeographic observations on pacific marine fungi. Mycologia 85 (3): 337-346 50 14. Wang, Z., Binder, M., Schoch, C.L., Johnston, P.R., Spatafora, J.W. and Hibbett, D.S. 2006. Evolution of helotialean fungi (Leotiomycetes, Pezizomycotina): a nuclear rDNA phylogeny. Mol Phylogenet Evo!. Nov; 41(2): 295-312. IS. Cassidy J.R. and Pukkila, P.J. 1987. Inversion of5S ribosomal RNA genes within the genus Coprinus. 12(1): 33-36. 16. Vos, P., Hogersn, R., Bleeker, M., Reijans, M, van de Lee, T. and Homes, M. et al. 1995. AFLP: a new technique for DNA fingerprinting .Nucleic Acids Research. 23(21): 4407-4414 17. Walker,W. F. 1984. 5S ribosomal RNA sequences from Zygomycotina and. evolutionary implications. Systematic Applied Microbiology. 5(4): 448-456 18. Nagahama, T., Sato, H., Shimazu, M., and Sugiyama, J. 1995. Phylogenetic divergence of the entomophthoralean fungi: evidence from nuclear 18S ribosomal RNA gene sequences. Mycologia 87(2): 203-209 19. Buchan, A., Newell, S.Y., Moreta, ll. and Moran, M.A. 2002.Analysis of internal transcribed spacer (ITS) regions of rRNA genes in fungal communities in a southeastern U.S. salt marsh. Microb Eco!. 43(3): 329-40. 20. Kurtzman, C.P. and Robnett, C.J. 1997. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large subunit (26S) ribosomal DNA gene J Clin Microbio!' May; 35(5): 1216-23. 21. http://www.biology.duke.edulfungilmycolab/primers.htm 22. Cueto, M., Jensen, P.R., Kauffman, C., Fenical, W., Lobkovsky and E., Clardy, J. 2001. Pestalone, a new antibiotic produced by a marine fungus in response to bacterial challenge. J Nat Prod. 64(11): 1444-6. 23. Tsuda M.; Mugishima T.; Komatsu K.; Sone T.; Tanaka M. and Mikarni Y. et 01. 2003. Speradine A, a new pentacyclic oxindole alkaloid from a marine-derived fungus Aspergillus tamari. Tetrahedron 59(18): 3227-3230 24. Dafemer, M., Anke, T. and Sterner, O. 2002. Zopfiellamides A and B, antimicrobial pyrrolidinone derivatives from the marine fungus Zopfiella lotipes. Tetrahedron 58(39): 7781-7784 25. http://www.cdc.govlhiv/resources/factsheetslAt-A-Glance.htm 51 26. Tziveleka, L.A., Vagias, C. and Roussis, V. 2003. Natural products with anti-HI V activity from marine organisms. CUIT Top Med Chern 3(13): 1512-1535 27. Hwang, Y., Rowley, D., Rhodes, D., Gertsch, J., Fenical, W. and Bushman, F.1999. Mechanism of inhibition of a poxvirus topoisomerase by the marine natural product sansalvamide A. Mol Pharmacol. 55(6): 1049--1053 28. Rowley, D.C., Kelly, S., Kauffinan, C.A., Jensen, P.R. and Fenical, W. 2003. Halovirs A-E, new antiviral agents from a marine-derived fungus of the genus Scytalidium. Bioorg Med Chern. 11(19): 426~274 29. Minagawa, K., Kouzuki, S., Yoshimoto, J, Kawamura, Y., Tani, H. and Iwata, T. et al. 2002. Stachyflin and acetylstachyflin, novel anti-influenza A virus substances produced by Stachybotrys sp. RF-7260. I. Isolation, structure elucidation and biological activities. J Antibiot (Tokyo) 2002,55(2): 155-164 30. Minagawa, K., Kouzuki, S. and Kamigauchi, T. 2002. Stachyflin and acetylstachyflin, novel anti-influenza A virus substances produced by Stachybotrys sp. RF-7260. II. Synthesis and preliminary structure-activity relationships ofstachyflin derivatives. J Antibiot (Tokyo). 55(2): 165-171 31. http://www.intelihealth.comlIHlihtlHIWSIHWOOO/8096/24516/362246.htmI?d=d mtContent 32. Namikoshi, M., Akano, K., Meguro, S., Kasuga, 1., Mine, Y. and Takahashi, T. et al. 2001. A new macrocyclic trichothecene, 12, 13-deoxyroridin E, produced by the marine-derived fungus Myrolhecium roridum collected in Palau .Journal of Natural Products. 64(3): 396-398 33. Belofsky, G. N., Jensen P.R., Renner, M.K., and Fenical, W. 1998. New cytotoxic sesquiterpenoid nitrobenzoyl esters from a marine isolate of the fungus Aspergillus versicolor. Tetrahedron. 54(9): 1715-1724. 34. Rahba:k, L., Christophersen C., Frisvad, J., Bengaard, H.S., Larsen S., and Rassing, B.R. 1997. Insulicolide A: A New Nitrobenzoyloxy-Substituted Sesqui terpene from the Marine Fungus Aspergillus insulicola.1. Nat. Prod., 60 (8): 811 - 813 35. Laurent, D., Guella, G., Roquebert, M.F., Farinole, F., Mancini, 1. and Pietra, F. 2000. Cytotoxins, mycotoxins and drugs from a new deuteromycete, Acremonium 52 neocaledoniae, from the southwestern lagoon of New Caledonia. Planta Med. 66(1): 63-6 36. http://www.searo.who.intlenlSectionI0/Section21/Section334.htm 37. Isaka, M., Suyarnsestakorn, C. and Tanticharoen, M. 2002. Aigialomycins A-E, New Resorcylic Macrolides from the Marine Mangrove Fungus AigiaZus parvus. 1. Org. Chem.67 (5): 1561 -1566 38. Osterhage, C., Kaminsky, R., Ktlnig, G.M., Wright, A.D.2000. Ascosalipyrro lidinone A, an antimicrobial alkaloid, from the obligate marine fungus Ascochyta salicorniae. J Org Chern 65(20): 6412--6417 39. Byun, H.G., Zhang, H., Mochizuki, M., Adachi, K., Shizuri, Y., Lee, W,J., Kim, S.K. 2003. Novel antifungal diketopiperazine from marine fungus. J Antibiot (Tokyo). 56(2): 102-6 40. Nagai, K., Kamigiri, K., Matsumoto, H., Kawano, Y., Yamaoka, M. and Shimoi, H. et aZ. 2002. YM-202204, a new antifungal antibiotic produced by marine fungus Phoma sp. J Antibiot (Tokyo) 55(12): 1036-1041 41. Pryor, B.M. and Gilbertson, R.L. 2000. Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mt SSU rONA sequences. Mycological Research 104(11): 1312-1321 42. NCCLS. 2000. Performance standards for antimicrobial disk susceptibility tests. Approved standard, 7th ed. NCCLS document M2-A7. NCCLS, Wayne, Pa. 43. Zheng, Z., Zeng, W., Huang, Y., Yang, Z., Li, J., Cai, H. and Su, W. 2000. Detection of antitumor and antimicrobial activities in marine organism associated actinomycetes isolated from the Taiwan Strait, China. FEMS Microbiol Lett. 188(1): 87-91 44. Verpoorte, R., Ruigrok, C.L., Svendsen, A.B. 1982. Medicinal plants of Surinam. II: Antimicrobial active alkaloids from Aspidosperma marcgravianum. Planta Med. 46(3): 149-52 45. Verpoorte, R., Kos-Kuyck, E., Tsoi, A.T., Ruigrok, C.L., de Jong, G. and Baerheim Svendsen, A. 1983. Medicinal Plants of surinam III: Antimicrobially Active alkaloids from Aspidosperma excelsum. Planta Med. 48(4): 283-289 53 \ I 46. Sanches, N.B., Garcia Cortez, D.A. and Schiavini M.S. 2005. An evaluation of antibacterial activities of Psidium guajava (L.). Braz. arch. bioI. technol. 48(3): 429-436 54