FUNCTIONAL AND STRUCTURAL STUDIES OF ALGINATE LYASE FROM Persicobacter sp. CCB-QB2
SIM PEI FANG
UNIVERSITI SAINS MALAYSIA
2017 FUNCTIONAL AND STRUCTURAL STUDIES OF ALGINATE LYASE FROM Persicobacter sp. CCB-QB2
by
SIM PEI FANG
Thesis submitted in fulfillment of the requirements for the degree of Master of Science
November 2017
ACKNOWLEDGEMENT
I wish to convey my sincere thanks to my supervisor, Dr. Teh Aik Hong, for his detailed and constructive comments. I am very grateful for his guidance, advice and directed me in protein purification and protein crystallization studies for this work. I owe many thanks to Dr. Go Furusawa who gave me guidance during my first steps into molecular work studies and always giving great opinions during the studies.
Many thanks to my lab members for the stimulating discussions and companions, and no less way did I learn a lot from them.
I would like to deliver my appreciation to MyMaster program for the financial support. Finally, my special gratitude to my family, without their encouragement and understanding it would have been impossible for me to complete my studies.
ii
TABLE OF CONTENTS
Acknowledgement ii
Table of Content iii
List of Tables vi
List of Figures vii
List of Abbreviations ix
Abstrak xi
Abstract xiii
CHAPTER 1 – INTRODUCTION
1.1 Introduction 1
1.2 Objectives 3
CHAPTER 2 – LITERATURE REVIEW MATERIALS AND
METHODS
2.1 Persicobacter sp. 4
2.2 Alginate 4
2.3 Alginate Lyase 6
2.3.1 Alginate lyase degradation mechanism 8
2.3.2 Application of alginate lyase 9
2.4 Carbohydrate-binding module (CBM) 10
2.4.1 Application of Carbohydrate-binding module 12
2.5 Crystal Structures of Carbohydrate Binding Module and Alginate 13
Lyase
CHAPTER 3 - MATERIALS AND METHODS RESULTS
3.1 Overview of Methodology 18
3.2 BLASTp Search, Cloning and Transformation 19
iii
3.2.1 BLASTp Search 19
3.2.2 Polymerase Chain Reaction cloning and PCR purification. 19
3.2.3 Restriction Enzyme Digestion 20
3.2.4 Extraction of DNA from Agarose Gels 21
3.2.5 Ligation of the fragment of PCR and expression vectors 21
3.2.6 Transformation of BL21 DE3 and DH5α Competent cells and 22
plasmid isolation
3.3 Storage of Strains 23
3.4 Protein Expression and Purification 23
3.4.1 Protein Expression 23
3.4.2 Protein Extraction by Sonication 24
3.4.3 Protein Purification 25
3.4.4 Sodium Dodecyl Sulfate Polyacrylamide Gel Eletrophoresis 26
(SDS-PAGE)
3.5 Preparation of Poly(M) and Poly(MG) and Poly(G) blocks of Alginate 26
3.6 Enzyme Characterization 27
3.6.1 The effect of different pH and different temperatures 27
3.6.2 The effect of additional SDS 27
3.6.3 The effect of additional EDTA 27
3.6.4 Kinetic constant determination 28
3.6.5 Binding Assay 29
3.6.6 Affinity Electrophoresis Assay 29
3.7 Protein Crystallization 29
3.8 Data collection 31
3.9 Data processing 31
iv
CHAPTER 4 – RESULTS
4.1 BLASTp search and Cloning of Alginate Lyase gene from 33
Persicobacter sp. CCB-QB2
4.2 Protein expression and purification profile 34
4.3 Binding Assay 38
4.4 Affinity Electrophoresis Assay 40
4.5 Thin Layer Chromatography assay 41
4.6 Alginate lyase activity assay 42
4.6.1 Alginate lyase substrate preference assay 42
4.6.2 The effect of different pH 43
4.6.3 The effect of different temperature 44
4.6.4 The effect of adding different concentration of SDS 45
4.6.5 The effect of adding EDTA 45
4.7 Alginate lyase Kinetic Assay 46
4.8 Protein Crystallization and data collection 48
4.9 Data Processing 51
CHAPTER 5 – DISCUSSIONS
5.1 BLASTp search 56
5.2 Enzyme Characterization 56
5.3 Crystallization and Structure Determination 56
CHAPTER 6 – CONCLUSIONS AND FUTURE DIRECTIONS 66
REFERENCES 68
v
LIST OF TABLES
Page
Table 2.1 Alginate lyase types based on polysaccharide lyase family 8
Table 2.2 CBM types 12
Table 3.1 PCR Cycling Protocol 19
Table 3.2 Crystal X-ray data collection parameters 32
Table 4.1 Kinetic Parameters of AlyQ, AlyQBC and AlyQC 48
Table 4.2 Data collection and refinement statistic of the AlyQB and 53
AlyQBC protein
vi
LIST OF FIGURES
Page
Figure 2.1 Chemical structure of alginates 5
Figure 2.2 Schematic representation of catalytic mechanism of 9 G-specific Lyases Figure 2.3 Ribbon diagram of CBM structures 14
Figure 2.4 Ribbon diagram of alginate lyase structures 17
Figure 3.1 Flowchart of the methodology 18
Figure 3.2 Diagram of the vapour diffusion method 31
Figure 4.1 Sequence of AlyQ 34
Figure 4.2 Purification profile of AlyQ 35
Figure 4.3 Purification profile of AlyQBC 36
Figure 4.4 Purification profile of AlyQC 36
Figure 4.5 Purification profile of AlyQA 37
Figure 4.6 Purification profile of AlyQB 37
Figure 4.7 Substrate binding by AlyQB with size-exclusion 39
Chromatography
Figure 4.8 Affinity Electrophoresis assay of AlyQB 40
Figure 4.9 Thin Layer Chromatography assay of AlyQ, AlyQBC and 41
AlyQC proteins against sodium alginate Figure 4.10 Bar chart for substrate preference activity of AlyQ 42
Figure 4.11 Graphs of the effect of different pH 43
Figure 4.12 Graphs of the effect of different temperature 44
Figure 4.13 Bar charts of the effect of additional SDS 45
Figure 4.14 Bar charts of the effect of additional EDTA 46
vii
Figure 4.15 Lineweaver-Burk plots of the recombinant His-tagged 47 AlyQ,
AlyQBC and AlyQC protein Figure 4.16 Protein crystal image 49
Figure 4.17 X-ray diffraction pattern of the crystal of AlyQBC protein 50
Figure 4.18 Diagram structure of AlyQB 54
Figure 4.19 Diagram structure of AlyQBC 55
viii
LIST OF ABBREVIATION
A280 absorbance at 280nm bp base pair
CBM carbohydrate-binding module
CD circular dichroism
C-terminal carboxy-terminal
DP degree of polymerisation
IPTG isopropyl β-D-1-thiogalactopyranoside kb kilobase kDA kilodalton
L litre
LB Luria-Bertani
M molar mg milligram min minute mm millimetre mM millimolar
MW molecular weight ng nanogram nm nanometer
N-terminal amino-terminal
OD optical density rpm revolution per minute
PDB protein data bank
PCR polymerase chain reaction
ix pH potential hydrogen pI isoelectric point poly-G polyguluronate poly-M polymannuronate s second
SDS sodium dodecyl sulfate
SEC size exclusion chromatography sp. species
V volt w/v weight per volume
x
KAJIAN TERHADAP FUNGSI DAN STRUKTUR ‘ALGINATE LYASE’
DARIPADA Persicobacter sp. CCB-QB2
ABSTRAK
Gen AlyQ daripada Persicobacter sp. CCB-QB2 mengekodkan ‘alginate lyase’ yang mengandungi dua domain modul pengikat karbohidrat, domain A dan B, di terminal-N domain ‘alginate lyase’, domain C. ‘Alginate lyase’ AlyQ tergolong dalam keluarga polisakarida lyase 7 (PL7) di mana domain pertama modul pengikat karbohidrat mempunyai persamaan dengan module pengikat karbohidrat 16 (CBM16) manakala domain kedua pula mempunyai persamaan dengan modul pengikat karbohidrat 32 (CBM32). Kajian-kajian sebelum ini lebih tertumpu kepada pencirian
‘alginate lyase’ atau modul pengikat karbohydrat secara individu, tetapi jarang pada kajian terhadap pencirian selepas pengabungan ‘alginate lyase’ dengan modul pengikat karbohydrat, bahkan lebih kurang pada kajian struktur selepas pengabungan kedua-dua domain tersebut. Oleh it, kajian ini memberi tumpuan kepada perbezaan aktiviti enzim ‘alginate lyase’ semasa kehadiran dan ketiadaan modul pengikat karbohidrat, dan menjelaskan hubungan struktur antara modul pengikat karbohidrat dan ‘alginate lyase’. Metodologi projek ini bermula dengan pencarian BLASTp asas diikuti dengan pengklonan dan penulenan protein. Protein terhasil akan dikaji mengunakan kristalografi sinar-X dan pencirian enzim. Dengan kehadiran modul pengikat karbohidrat pertama- CBM16, aktiviti enzim AlyQ adalah lebih cekap dengan nilai kcat/Km berbanding dengan enzim AlyQBC dan AlyQC. Kajian pencirian enzim menunjukkan bahawa AlyQB mampu mengikat kepada oligomer ‘alginate’ terurai di bahagian hujung. AlyQ, AlyQBC dan AlyQC menunjukkan produk degradasi dan aktiviti optimum yang sama pada pH 7.0, namun suhu optimum AlyQ adalah
xi
50°C, manakala AlyQBC dan AlyQC adalah pada 40°C. Struktur kristal AlyQB menggambarkan pertalian antara asid
‘4-deoxy-alpha-L-erythro-hex-4-enopyranuronic’ yang merupakan hasil penguraian oleh ‘alginate lyase’. Struktur AlyQBC menunjukkan bahawa kedua-dua domain B dan C tidak berinteraksi antara satu sama lain. Dengan perbandingan mekanisme
‘alginate lyase’ lain yang diketahui, menunjukan terdapat tiga asid amino terpulihara di dalam enzim ‘alginate lyase’ keluarga PL7 iaitu (Gln436, His 438 dan Tyr541), tetapi terdapat dua asid amino lain (Asp446 dan Asp447) yang bercanggah dengan tapak pemangkin enzim. Oleh itu kaedah pemangkinan AlyQ diramal berbeza dengan
‘alginate lyase’ lain yang telah dikaji setakat ini. Sebagai kesimpulan, domain
CBM16 meningkatkan aktiviti enzimatik ‘alginate lyase’ dan meningkatkan suhu optimumnya. CBM32 boleh mengenal pasti substrat ‘alginate’ dan ‘alginate lyase’ keluarga PL-7 mengandungi 2 asid amino tambahan yang mungkin bertanggungjawab dalam aktiviti enzimatik.
xii
FUNCTIONAL AND STRUCTURAL STUDIES OF ALGINATE LYASE
FROM Persicobacter sp. CCB-QB2
ABSTRACT
AlyQ gene from Persicobacter sp. CCB-QB2 encodes alginate lyase which is comprised of two carbohydrate-binding domains, domains A and B, at the
N-terminus of the alginate lyase domain, domain C. Alginate lyase domain from
AlyQ belongs to the polysaccharide lyase 7 (PL7) family, while the first domain of the carbohydrate-binding module resembles carbohydrate-binding module 16 (CBM
16), and the second domain a CBM 32. Previous studies had mainly focused on activity characterization of alginate lyase or carbohydrate-binding modules individually but rarely on studies of the enzyme characteristics after combining these two domains and even less on the structural studies between alginate lyase and CBM domains. Therefore, this study focused on the alginate lyase enzymatic activity differences with or without the inclusion of the two carbohydrate-binding domains, and to elucidate the structural relationship between carbohydrate-binding domains and alginate lyase. The methodology of this project started with basic BLASTp studies followed by cloning of the targeted domains, and after protein purification, the proteins were subjected to X-ray crystallography studies and enzyme characterization. Comprising the CBM16, AlyQ enzyme had led to a higher kcat/Km value compared to the truncated versions, AlyQBC and AlyQC enzymes. Substrate binding assay shows that AlyQB protein was able to bind the non-reducing end of degraded alginate oligomers. The AlyQ, AlyQBC and AlyQC showed similar degradation product and similar optimum activity at pH 7.0, however the optimum
xiii temperature of AlyQ was 50°C, while AlyQBC and AlyQC 40 °C. The crystal structure of AlyQB illustrates its affinity towards
4-deoxy-alpha-L-erythro-hex-4-enopyranuronic acid, the degraded unsaturated alginate substrate. The domains B and C from the AlyQBC structure showed that both are independent and do not interact. From the comparison with other known alginate-binding mechanisms, the active sites of alginate lyase domain consist of three conserved catalytic amino acids (Gln436, His 438 and Tyr541), however there are two additional amino acids (Asp446 and Asp447) found to be in proximity with the predicted substrate active site. Hence, AlyQ’s mode of binding is expected to be different from that of presently known alginate lyases. In conclusion, having a
CBM16 domain enhances the enzymatic activity of alginate lyase and increases its optimal temperature. The second CBM belongs to CBM32 family that binds to degraded alginate substrate, and the alginate lyase domain belongs to PL-7 family and contains two additional amino acids that might be responsible for its enzymatic activity.
xiv
1.0 INTRODUCTION
1.1 Background of Research
Alginates are a major constituent in the cell walls of brown algae and exopolysaccharides in marine bacteria (Jagtap et al., 2014; Kim et al., 2011 and
Uchimura et al., 2010). Alginates are either made up of homopolymeric blocks of poly α-1,4-L-guluronate(poly-G) and poly β-1,4-D-mannuronate(poly-M), or heteropolymeric blocks (poly-MG) with random arrangements of both monomers.
Alginates are depolymerized to oligomeric alginate via enzymatic hydrolysis of alginate lyases. These oligomeric alginates have been shown to possess various biological activities such as enhancing the germination in plants and stimulating production of cytokines (Hu et al., 2004 & Iwamoto et al., 2005).
Alginate lyase enzymes can be found in a wide range of organisms, including algae, marine invertebrates, and marine and terrestrial microorganisms and most of the organisms that produce alginate lyase use depolymerized alginates as carbon and energy sources. (Wong et al., 2000). Alginate lyases exhibit poly-M and poly-G specific activity which can either cleave the alginate polysaccharide internally
(endo-type) or cleave at the end of polysaccharide to form monosaccharide (exotype) by a β-elimination mechanism which targets the glycosidic bond (1→4 O linkage) and produce an unsaturated oligosaccharide with a double bond at the non-reducing end (Kim et al., 2011; Wong et al., 2000, Zhu & Yin, 2015).
Carbohydrate-binding modules (CBM) are non-catalytic carbohydrate-binding accessory modules from larger modular enzymes such as xylanase, alginate lyases, and chitinase that are enzymes that breakdown polysaccharides (Abbott et al., 2007).
1 CBMs have been found in polysaccharide degrading enzymes, and the enzymatic complexes are found to work more efficiently with CBMs, and the enzymatic activity decreases dramatically when the CBMs are removed (Dutta & Wu 2014; Mingardon et al., 2011). However, not many research have been conducted to analyze the role of
CBM towards the enzymatic activity of alginate lyase, with only a recently published research by Li et al., 2015 that demonstrates CBM13 indeed aids in alginate lyase enzymatic activity by enhancing thermostability and altering the substrate preferences. Besides that, currently the CBM domain and alginate lyase crystal structures were studied separately, and no crystal structure of CBM and alginate lyase has ever been studied together, hence posing a research gap to elucidate the structural relationship of CBM with alginate lyase.
The AlyQ gene in this experiment containing three domains was obtained from
Persicobacter sp. CCB-QB2, an agarolytic bacterium isolated from seaweed (genus
Ulva) collected from a coastal area of Malaysia (Furusawa et al., 2016). The genome sequence of Persicobacter sp. CCB-QB2 could be obtained in
DDBJ/EMBL/GeneBank database with the accession number LBGV00000000
(Furusawa et al., 2016). This report aims to express and purify the targeted proteins – full-length protein containing domain A, B and C (AlyQ), domain B and C (AlyQBC), domain A (AlyQA), domain B (AlyQB) and domain C (AlyQC) to elucidate the relationship between carbohydrate-binding domains and alginate lyase by studying the enzymatic activity and the structure of the protein.
2 1.2 Objectives
1. To clone, express and purify stable targeted proteins - AlyQ, AlyQBC, AlyQA,
AlyQB and AlyQC.
2. To investigate the role of the carbohydrate-binding modules (CBM) in the
catalytic function of AlyQ.
3. To study the structure of AlyQ by X-ray crystallography.
4. To elucidate the binding mechanism of carbohydrate-binding modules (CBM)
and the alginate lyase domain.
3 2.0 LITERATURE REVIEW
2.1 Persicobacter sp.
Persicobacter sp. is a rod shaped, Gram-negative, exhibiting gliding motility and salmon-pink pigmented bacterium, and also requires seawater or NaCl for growth
(Muramatsu et al., 2010, Furusawa et al., 2016). According to Muramatsu et al.,
(2010) the Persicobacter genus belongs to the family ‘Flammeovirgaceae’ of the phylum Bacteroidetes. Persicobacter sp. CCB-QB2 grows aerobically at 30 °C, and were isolated from seaweed (genus Ulva) from the Queens Bay of Penang Island,
Malaysia (Furusawa et al., 2016). Persicobacter sp. CCB-QB2 DNA sequence analysis showed that it was closely related to Persicobacter diffluens and
Persicobacter psychrovividus which are all known to degrade agar (Muramatsu et al.,
2010, Furusawa et al., 2016).
2.2 Alginate
Alginate or alginic acids are linear polysaccharides of β-D mannosyluronic acid and C5 epimer α-L-gulosyluronic acid that are covalently (1-4)-linked (Figure 2.1).
Alginate can be arranged in three forms, that is homopolymeric G block, homopolymeric M block and heteropolymeric G/M blocks (Wong et al., 2000). The content of guluronic acid monomer plays an important role in rigidity and flexibility of the alginate (Kim et al., 2011). The ratio of the M and G residues differs depending on the sources of the alginates, with a higher content of guluronic acid in alginates increases the rigidity and gel strength (Swift et al., 2014). Due to alginates ability as gelling and viscosifying agent, it applications are wide across many industries including printing, medical, texture and food industry (Kim et al., 2011;
Zhu & Yin 2015).
4
Figure 2.1: Chemical structure of alginates. Alginate is a linear polysaccharide in which β-D-mannuronate (M) and its C5 epimer, α-L-guluronate (G), are covalently
(1-4)-linked in different sequences (Kim et al., 2011).
Commercial alginates are mostly derived from brown seaweed with the major seaweed species being from Macrocystis, Laminaria, and Ascophyllum (Kim et al.,
2011; Swift et al., 2014). In the food industry, alginates extracted from seaweeds are mainly used as food additives as a thickening or gelling agent, as well as a stabilizer.
While in the medical industry, alginate oligosaccharides are shown to stimulate proliferation of human endothelial cells. For example, alginate hydrogels are used in some bandages for treating burns, besides that alginate hydrogel capsules can be used as a drug delivery system through oral route due to alginate’s ability to interact with the mucus gastrointestinal tract, hence enhancing the performance of drug by prolonging the time of drug in the gastrointestinal tract. (Sosnik 2014; Lee et al.,
2012).
In addition, a research done by Takeda et al., (2011) showed that a genetically modified microorganism that contained both alginate lyases gene and ethanologenic bacteria, did successfully produce ethanol solely from unsaturated uronic acid that
5 was broken down from alginate carbon source. Alginate can bind divalent cations such as Ca2+ and Mg2+ to develop gel formation. Alginate gel forming ability is temperature independent and biocompatible hence it is used for many biotechnology applications such as immobilization of cells. However, alginate gel formation is greatly affected by pH, because the pH could change the ionic form of the uronic acid residue (Kim et al., 2011).
2.3 Alginate lyase
Alginate lyases come from a subgroup of polysaccharide lyase family including
PL5, PL6, PL7, PL14, PL15, PL17, and PL18 families (Table 2.1). The alginate lyase are divided base on their enzyme specificity towards alginates, mode of degradation and the sources or origins of the enzymes. There are two types of alginate lyase enzyme, one is poly(α-L-guluronate) lyase (EC 4.2.2.11), and the other one is poly(β-D-mannuronate) lyase (EC 4.2.2.3), while most reported alginate lyase preferred poly-M, and fewer poly-G preferred alginate lyase is found (Wong et al.,
2000; Zhu & Yin, 2015). Although the alginate lyase is divided poly-M or poly-G specific lyases, they still possess low to moderate ability to degrade their opposite homopolymer, (Zhu & Yin, 2015).
Alginate lyases, also known as alginases or alginate depolymerase, have been isolated from a wide range of organisms, including algae, marine mollusks, and marine and terrestrial microorganisms. Alginate lyases have been extracted from several species of microorganism such as Pseudoalteromonas sp. (Chen et al., 2016; Li et al.,
2011), Vibrio sp. (Badur et al., 2015; Kim et al., 2013; Li et al., 2016), and
Microbulbifer sp. (Swift et al., 2014). Most of the organisms that produce alginate lyase are able to incorporate M and G units from depolymerized alginates as carbon
6 and energy sources. Interestingly, some of the alginate lyase producing bacteria also synthesize alginate. The majority of alginate lyases is endolytic that cleave the polymer with an endo-mode of action to form end product of 2-4 degree of polymerization, while only a few alginase possesses an exo-mode of action to cleave unsaturated and saturated monomers from the nonreducing end to form end products with 1 degree of polymerization, most endolytic lyases were group into PL-5 and PL-7 while exolyases were group into PL-15 and PL-17 (Wong et al., 2000).
Microorganisms that feed on alginate, utilizes extracellular alginate lyase to degrade alginate then transport into cytoplasm of the cell (Kim et al., 2011).
Besides, alginate lyase may differ in molecular mass, and are divided into three groups: 20-35kDa, ~40kDa and ~60kDa. PL-7 alginate lyase family is the most studied group and the sequence analysis has showed that it has three highly conserve sequences that are (R/E) (S/T/N) EL, Q (I/V) H, YFKAG (V/I) YNQ. The YFKAG
(V/I) YNQ is observed in the C-termini of both poly-M lyases and poly-G lyases, these different substrates recognizing lyases propose that this conserve region is an important region that is responsible in maintaining the stable three-dimensional conformation of the lyases (Wong et al., 2000). Alginate lyases with the conserved
QVH regions are reportedly specific to poly-M alginates while having the conserve
QIH regions are responsible for alginate lyases to degrade poly-G or poly-MG alginates (Zhu & Yin 2015).
7 Table 2.1 Alginate lyase types based on polysaccharide lyase family (Zhu & Yin 2015) PL family Fold family Common Characteristics
PL-5 (α/α)6 barrel family Endotype degradation mechanism, Poly-M specific PL-6 Parallel β-helix family Endotype degradation mechanism PL-7 β-jelly roll family Endotype degradation mechanism, Ability to degrade poly-MG, Poly-G and Poly-M, PL-14 β-jelly roll family Endotype degradation mechanism PL-15 (α/α)6 barrel family Exotype degradation mechanism PL-17 open α-barrel and Exotype degradation mechanism β-sheets (Park et al., 2014) PL-18 β-jelly roll family Endolytic degradation mechanism, Ability to degrade poly-MG, Poly-G and Poly-M
2.3.1 Alginate lyase degradation mechanism
Alginate lyase catalyses the degradation of alginate polymers by -elimination mechanism was first proposed by Gacesa (1987). Firstly, by targeting the glycosidic
1-4 O-linkage between monomers and resulting in a double bond between C4 and C5 carbons of the sugar ring, hence forming
4-deoxy-L-erythro-hex-4-enopyranosyluronic acid as the non- reducing terminal moiety (Alekseeva et al., 2004; Lambard et al., 2010). With several alginate lyase
3-dimentional structures having been elucidated (Dong et al., 2014; Thomas et al.,
2013), the catalytics mechanism to depolymerize alginate are shown in three steps
(Figure 2.2). Firstly, the carboxyl group is neutralized by the charge of a salt bridge
(Histidine or Lysine), next is via general base-catalyzed abstraction of the proton on
C5, one residue (Aspartic acid or Cystine) act as the proton abstractor and another residue as the proton donor or one residue act as both proton donor and acceptor.
Finally, transfer of an electron from the carboxyl group forms a double bond between
C4 and C5, causing the elimination of the 4-O-glycosidic bond.
8
Figure 2.2: Schematic representation of catalytic mechanism of G-specific lyases
(Thomas et al., 2013)
2.3.2 Applications of alginate lyase
The ability of alginate lyase to degrade alginate substrate into oligosaccharides that possessed various biological activities has made alginate lyase a crucial enzyme across various disciplines (Kim et al., 2011). In the plantation industry, alginate oligomers degraded by alginate lyase acted as root growth promoters, germination promoters and aided in shoot proliferation for plantation such as lettuce, red amaranth, rice, and peanut seed (Hien et al., 2000; Iwasaki & Matsubara, 2000;
Qualhato et al.,2013)
In the medical field, alginate as a microcapsule could act as an effective drug delivery system (Cañibano-Hernández et al., 2017). The alginate oligosaccharides also could stimulate secretion of cytokines in human macrophage cells and stimulate the bioactivity of VEGF in human endothelial cells (Iwamoto et al., 2005). Moreover, studies by Cotton, Graham and Lee (2009) showed that alginate lyases had been effective on cystic fibriosis patients due to these patients have mucus building up in the respiratory tract produced by Pseudomonas aeruginosa, and alginate lyase’s ability to degrade extracellular alginate that was produced by Pseudomonas aeruginosa.
9 In the biofuel industry, alginates consist of up to 40 % dry weight in algae cells could act as feedstocks for bioconversion into biofuels. Alginate lyases could contribute to bioethanol and biofuel because it could convert alginate into unsaturated monosaccharide. The monosaccharide would then spontaneously rearrange into 4-deoxy-L-erythro-5-hexoseulose uronic acid (DEH) then be converted into 2-keto-3-deoxygluconate (KDG) via DEH reductase and further converted to pyruvate and glyceraldehydes-3-phosphate via Entner-Doudoroff (ED) pathway, and then the pyruvate could be converted into biofuels (Wargacki et al.,
2012).
2.4 Carbohydrate-binding module (CBM)
Carbohydrate-binding modules (CBM) were first identified as cellulose binding domain (CBD) in cellobiohydrolase from Trichoderma reesei (Tomme et al., 1988) and cellulases from Cellulomonas fimi (Gilkes et al., 1988). The truncation of CBD domains causes the ability of the catalytic enzyme to hydrolyse cellulose substrate decreases significantly, hence it was proposed that this domain is responsible to target substrate and enhances the enzyme activity. It quickly became apparent that
CBDs are not only attached to cellulases but also other types of enzymes that degrade carbohydrates such as xylan, plant cell wall, starch, chitin and mammalian glycans. Hence, carbohydrate-binding modules (CBM) were assigned to represent these proteins that bind to carbohydrate in a non-catalytic way (Boraston et al.,
1999).
According to the carbohydrate active enzyme (CAZy) database (Cantarel et al.,
2009), to date, carbohydrate-binding modules have been divided into 81 families, and they are a non-catalytic polysaccharide-recognizing module that promotes the
10 association of enzyme with the substrate. CBMs may play an important role in enzyme targeting by prolonging the association of the catalytic domain to the substrate and are sometimes involved in substrate presentation for catalysis.
Currently, due to the expanding diversity of the ligand specificity, the CBM families are now divided by their amino acid sequence similarity, structure, and variation of ligand specificity (Duan et al., 2016). CBMs could range from 30-200 amino acids and exist as a single domain, double domains, or triple domains in one protein.
Besides, alginate lyase enzymes has been found to work more efficiently together with presence of CBM 13 and the enzymatic activity decreases dramatically when
CBM domain is removed (Li et al., 2015).
Studies have also shown that CBMs could alter the surface properties of fibers by disrupting the tightly packed polysaccharides and reduction of surface polarity of the fiber causing the substrate to go loose and become more exposed to the catalytic enzyme for more efficient degradation (Shoseyov et al., 2006). Besides that, Duan et al., (2016) showed that CBMs have also large ligand specificity because they contain three aromatic amino acid that are responsible for ligand recognition.
CBMs are grouped into three types based on their function and structure (Table
2.2) (Boraston et al., 2004, Gilbert et al., 2013). Type A is a surface binding CBM, its platform like-binding site is described to be complementary to the flat surface of cellulose or chitin crystals. Type A CBM shows non-to little affinity towards soluble carbohydrate. Type B is a glycan chain binding CBM that contains grooves or clefts and several subsites to bind the sugar units of polymeric ligands. Type B CBM shows increase affinities towards substrates with higher degree of polymerization (DP) up to hexasaccharides, while showing decreased affinity towards oligomers with three
DP or less. Type C is a small-sugar binding CBM, which shows optimum affinity in
11 binding mono-, di- and tri-saccharides (Gilbert et al., 2013).
Table 2.2 CBM types (Boraston et al., 2004, Gilbert et al., 2013)
Type Fold Family CBM families A β-Sandwich, Cysteine knot, Unique, 1, 2a, 3, 5, 10, 16 oligonucleotide/oligosaccharide binding folds B β-Sandwich 2b, 4, 6, 15, 17, 20, 22, 27, 28, 29, 34, 36 C β-Sandwich, β-Trefoil, hevein-like fold 9, 13, 14, 18, 32
2.4.1 Applications of Carbohydrate-binding module
Carbohydrate-binding modules have many practical applications in biotechnology due to three main basic properties that is, an independent folding unit, multiple attachment sites, and multiple binding specificities, hence CBM can be easily adapted to address the needs of certain application (Shoseyov et al., 2006). In the bioprocess industry, CBMs have been reported to fuse to targeted protein for usage as affinity purification tags (Kiyohara et al., 2009). This purification technique took advantage of CBM affinity towards cellulose hence enable effective purification of targeted protein at a lower cost (Rodriguez et al., 2004). Furthermore, Haynes et al., (2000) presented a novel protein purification technique that took advantage of
CBM4 ability to bind with water-soluble cellulose, separating the targeted protein with two different phases of solution, hence the invention of two-phase liquid separation system. CBM also plays an important role in bioethanol production from lignocellulose, which is needed to increase the catalytic activity of the enzymes to breakdown the cellulosic material (Doi et al., 2004).
In addition, carbohydrate-binding modules are also involved in the bioremediation process that involves bioengineering of CBMs and organophosphorus hydrolase into bacteria cell, CBMs function as immobilization for bacteria to bind to
12 cellulose, and the active enzymes are used to hydrolyse nerve gas (Wang et al., 2002).
Moreover, CBMs had been used as a diagnostic tool to detect pathogenic microbes in food samples, the CBM appended to the bacterium specific monoclonal antibody was able to capture the bacteria cell, hence enabled the rapid detection (Shoseyov et al.,
1999). McCartney et al., (2004) introduced CBM as a probe to detect various polysaccharide on plant cell wall by using different types of recombinant CBM.
Besides that, a recent study by Nardi et al., (2015) showed that overexpression of CBM in plant cell wall could alter the structure and composition of the plant cell wall by decreasing the catabolism of pectin, causing a higher amount of pectin in the cell wall. In turn, this higher cell wall integrity by pectin reduces the plant susceptibility to fungal growth known as Botrytis cinerea.
2.5 Crystal Structures of Carbohydrate Binding Module and Alginate Lyase
There are up to 81 families in carbohydrate binding modules according to CAZy database, however to date only a handful of CBMs are found to be associated with alginate lyase which are CBM13 (Li et al., 2015), CBM16 (Li et al., 2011) and
CBM32 (Badur et al. 2015; Thomas et al.,2013). According to Fujimoto (2013),
CBM13 usually contains 150 amino acid and possesses a β-trefoil fold meaning it contains three repeated homologous sequences, where each of the sequence is composed of four β-strands that fold into a Y-shaped β-hairpin (Figure 2.3A), examples of CBM13 structures include, 1KNL (Notenboom et al., 2002), 1ISX
(Fujimoto et al., 2002) and 4OWJ (Kaus et al., 2014).
13
Figure 2.3: Ribbon diagram of CBM structures. A. Ribbon diagram of CBM13 structure with lactose moieties bound in all three subsites of the trefoil fold (PDB code: 1KNL) (Notenboom et al., 2002). B. Ribbon diagram of CBM16-1 structure (PDB code: 2ZEW), the purple sphere represents the calcium ion. (Bae et al., 2008). C. Ribbon diagram of CBM32 structure (PDB code: 2V72) with the violet sphere representing calcium ion and stick figure as a bound galactose. (Boraston et al., 2007).
14 To date only two CBM16 structure were define, CBM16-1 (PDB code: 2ZEW) and CBM16-2 (PDB code: 2ZEZ) from Caldanaerobius polysaccharolyticus by Bae et al., (2008). Su et al., (2010) reported the mutational studies of CBM16-1 derived from Bae at al., (2008) that could bind to cellopentaose PDB code: 3OEA) and mannopentaose (PDB code: 3OEB). Both CBM16-1 and CBM-2 proteins fold into a compact domain of β-sandwich that contains two layers of five antiparallel β-sheets, besides that it also contains a calcium ion that bestow stability towards the structure
(Figure 2.3B) (Bae et al., 2008). In the mutational studies by Su et al., (2010) demonstrates that two tryptophan amino acids as a critical player to the ligand binding via hydrophobic stacking interaction.
CBM32 is one of the most diverse and valuable model families of CBMs, due to its variability of binding specificity, which extends to both plant cell wall polysaccharides and eukaryotic glycans (Grondin et al., 2014). The first crystal structure of CBM32 was found in the N-terminus of a galactose oxidase from F. graminearum (Ito et al., 1991). CBM32 mainly binds to galactose and its various isomers such as CBM32 from Yersinia enterolitica was found to bind to polygalacturonic acid (Abbott et al. 2007), and CBM32 from Clostridium perfringens was found to bind beta-D-glcNAc-beta(1,3) galNAc (Ficko-Blean &
Boraston, 2009). CBM32 structure is a β-sandwich fold and consists of a metal ion usually a calcium ion presumeably as a structural component (Figure 2.3C)
(Boraston et al., 2007).
Alginate lyases are divided into seven groups, PL-5, 6, 7, 14, 15, 17 and 18.
Where according to Carbohydrate Active Enzymes database (http://www.cazy.org/) to date PL-7 alginate lyase is the most studied alginate lyase comprising of six
15 crystal structures, while PL-5, 14 and 18 each consists of two crystal structures and
PL-6, PL-15 and 17 each having one defined structure. The overall structure of PL-5 is made up of alpha helixes and has a deep tunnel-like cleft in a novel (a/a)-barrel structure as the catalytic active domain (Figure 2.4A). The only crystal structure of
PL-6 was recently studied by Xu et al., (2017), it formed an asymmetric unit of four monomeric molecules, with only two of the four have interactions. The monomeric
PL-6 enzyme was built by parallel β-helixes fold forming a ‘twin tower like’ structure with a calcium ion bound to it (Figure 2.4B). The PL-7 structure was a
β-sandwich fold like structure with a large active cleft covered by two short flexible loops (Figure 2.4C). The PL-14 overall structure was two antiparallel β-sheets with a deep cleft showing a β-jelly roll fold (Figure 2.4D). The PL-15 overall structure is consisted of N-terminal small β-sheet and (α/α)6 barrel and a C-terminal anti-parallel
β-sheet fold (Figure 2.4E). The overall structure of PL-17 is a combination of (α/α)6 barrel and β-sandwich fold containing a zinc ion (Figure 2.4F). Both the PL-15 and
PL-17 possess similar structures and exolytic degradation mechanism hence correlation between the structure similarity and the degradation mechanism is significant. Lastly, the overall structure of PL-18 displays a β-jelly roll scaffold composed mainly of 2 anti-parallels β-sheets, and a calcium ion chelating in the structure (Figure 2.4G).
16
Figure 2.4: Ribbon diagrams of alginate lyases. A. PL-5 structure, black stick figure represents the ligand product and yellow stick figure represents sulfate ion (PDB code: 1HV6) (Yoon et al., 2001) B. PL-6 monomeric structure, grey sphere represents calcium ion (PDB code: 5GKD) (Xu et al., 2017). C. PL-7 structure (PDB code: 1UAI) (Osawa et al., 2005). D. PL-14 structure (PDB code: 5GMT) (Qin et al., 2017). E. PL-15 structure (PDB code: 3A0O) (Ochiai et al., 2010). F. PL-17 structure, the red sphere represents a zinc ion (PDB code: 4NEI) (Park et al., 2014). G. PL-18 structure, with grey sphere representing calcium ion (PDB code: 4Q8K) (Dong et al., 2014)
17 3.0 MATERIALS AND METHODS
3.1 Overview of Methodology
BLASTp search
Cloning and Transformation
Protein Expression Protein purification
Crystallization Enzyme Characterization
AlyQ Data Collection CBM CBM Alginate Lyase 16 32 (PL7)
Structure AlyQBC Determination CBM Alginate Lyase 32 (PL7)
AlyQC Alginate Lyase (PL7)
AlyQA CBM 16
AlyQ B CBM 32
Figure 3.1: Flowchart of the methodology.
18 3.2 BLASTp Search, Cloning and Transformation
3.2.1 BLASTp Search
The AlyQ gene sequence (Appendix 1) were translated and subjected to NCBI
BLASTp search program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The gene sequence was then divided into three domains and cloned into five different protein by truncating the full-length AlyQ to AlyQBC, AlyQC, AlyQA and AlyQB. The detail of the gene sequences could be found from Appendix 1 to Appendix 5.
3.2.2 Polymerase Chain Reaction cloning and PCR purification.
The genomic DNA of Persicobacter sp. CCB-QB2 was used as a template in
PCR for obtaining the alginate lyase gene. High-fidelity PCR was performed using
KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems). The primers, template and KAPA HiFi HotStart Ready Mix were added together then followed by the PCR cycling protocol suggested from technical data sheet from KAPA HiFi HotStart
Ready Mix. The AlyQ, AlyQBC, AlyQA, AlyQB and AlyQC. genes were added with extra six Histidine site at the C-terminal to enable nickel beads purification. The PCR cycling protocols are summarise in (Table 3.1).
Table 3.1 PCR Cycling Protocol Step Temperature Duration Cycles
Initial Denaturation 95°C 3 min 1
Denaturation 98°C 20 sec 30
Annealing AlyQ :65°C 15 sec
AlyQBC :67.7°C
AlyQA :65.5°C
19 AlyQB :68.9°C
AlyQC :66.7°C
Extension 72°C 1 min/kb
Final Extension 72°C 1 min/kb 1
QIAquick PCR Purification Kit (Qiagen, Germany) was used to purify PCR
DNA fragments. The PCR product was mixed with five volumes of PB buffer, applied to a QIAquick spin column, and centrifuged for 1 minute at 13,000 rpm. The flow-through was discarded and the bound DNA was washed with 750 µl of PE
Buffer by centrifugation. After the flow-through was discarded, the column was centrifuged for an additional 1 minute to remove the residual ethanol. The QIAquick column was placed in a clean micro centrifuge tube. To elute the DNA, 30 µl of EB buffer was added to the centre of the QIAquick membrane, allowed to stand for 1-2 minutes, then centrifuged for 1 minute, this step was repeated at least three times using the same eluted EB buffer to maximize the concentration of DNA product.
3.2.3 Restriction Enzyme Digestion
The PCR product contain NdeI restriction site at the N-terminal, and HindIII restriction site at the C-terminal. Hence, these PCR products were digested with both restriction enzymes to facilitate the cloning of genes into vector. The restriction enzyme and the enzyme buffer were purchased from Fermentas, USA. The preparation of the digestion reaction was set up and incubated in 37°C incubator for
1 hour for PCR product and 5 minutes for plasmid DNA. The plasmid DNA used was pColdIII and pET21A (Appendix 6 and 7). Next, the digested product was incubated in 80°C for 20 minutes to inactivate the enzyme. AlyQ and AlyQA were
20 cloned in pET21A vector while AlyQBC, AlyQC and AlyQB were cloned in pColdIII vector due to protein solubility issues.
3.2.4 Extraction of DNA from Agarose Gels
The QIAquick gel extraction kit (Qiagen, Germany) was used to purify DNA from agarose gel. The digested DNA was run on an agarose gel and the desired bands of DNA were cut out and placed in a 1.5 ml tube. About 600 µl of QG Buffer was added to the sliced agarose gel that weight around 0.1 g in the Eppendorf tube and heated at 50°C, shaken at 500 rpm using thermomixer for 10 minutes. After the gel slice had completely dissolved, 1 gel volume of isopropanol was added to sample. To bind the DNA, the sample was applied to a QIAquick spin column and centrifuged at
13,000 rpm for 1 minute. Next for the washing step, the flow-through was discarded and 750 µl of PE buffer was added to the column and centrifuged at 13,000 rpm for 1 minute. Then to dry out the column, the QIAquick spin column was spin for an additional 1 minute. To elute the DNA, the column was applied to a new microcentrifuge tube and 30µl of TE buffer was added to the membrane filter and allowed to stand for 1 minute, then centrifuged for 1 minute.
3.2.5 Ligation of the fragment of PCR and expression vectors
The DNA purified by QIAquick gel extraction kit (Qiagen, Germany) was ligated overnight at 16°C using ligation reaction setup. The T4 ligase and its buffer were purchased from Promega, USA by using 1:3 molar ratio of vector: insert DNA when cloning.
21 3.2.6 Transformation of BL21 DE3 and DH5α Competent cells and plasmid isolation
DE3 and DH5α E. coli cells were used during bacterial transformation process for routine cloning. DH5α cells are used for transformation of ligation mixture before isolating the successful clones to be transformed to BL21 DE3 cells. This is because
DH5α can transform efficiently by reducing homologous recombination and intracellular endonuclease activity, hence increase the stability of plasmid to store in the cell. While BL21 DE3 is used for protein expression. The competent cell was taken incubated on ice for 10 minutes after taken out from -80°C freezer, and then added with 100 µg of ligation mixture or DNA plasmid. The cells were further incubated on ice for 30 minutes before heat shocked at 42°C for 1 minute. Then it the heat shocked cells were incubated on ice for 2 minutes then added with 200µl of LB broth and incubated at 37°C for 1 hour with 200 rpm shaking. Then 100 µl of the sample was spread onto a LB agar plate containing ampicilin. The plates were incubated at 37°C overnight.
Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen). Single colonies were inoculated into 2ml of LB broth with 100 µg/ml of ampicilin and grown overnight at 37°C with 200 rpm shaking. The cells were harvested by centrifugation, cell pellets were resuspended with 250 µl of P1 Buffer, then 250 µl P2
Buffer was added to the mixture and gently inverted 7-8 times to mix. After 2 minutes of room temperature incubation, 350 µl of N3 Buffer added and mixed by inverting the tubes. The tubes were incubated for 10 minutes on ice, and then centrifuged at 13,000 rpm for 10 minutes at 4°C to remove the precipitated cell debris, proteins, and genomic DNA. The supernatant was transfer to a QIAprep spin column (Qiagen, Germany) and centrifuged at 13,000 rpm for 1 minute, the flow
22 through was discarded. The column was then washed by adding 750 µl of PE Buffer and centrifuged for 1 minute. The column undergoes another set of centrifuging for 1 minute to dry the column. The plasmid DNA was eluted with 30 µl of TE buffer of
EB Buffer. The construct was analysed by restriction enzyme digestion and DNA sequencing.
3.3 Storage of Strains
DH5α strains harbouring the plasmids encoding the correct fusion protein were maintained as glycerol stock. A single colony was inoculated into 2 ml LB broth containing ampicillin and incubated with shaking at 37°C until the OD600 reached
0.6-0.8 and 1 ml was removed from the culture and transferred to a cryovial. 0.5 ml of 50% glycerol was added, mixed well, and stored at -80°C freezer.
3.4 Protein Expression and Purification
3.4.1 Protein Expression
Solubility of protein and molecular weight estimation were analysed in small-scale expression. 50 ml LB medium with ampicillin were inoculated with 500
µl of an overnight preculture. Cells grew for 2 hours at 37°C with 200 rpm agitation until the OD600 reached 0.4-0.6. 1 ml of culture was removed and labelled as uninduced. The remaining culture was induced with IPTG with a final concentration of 0.1 mM-1 mM of IPTG to test the protein solubility. The culture was then incubated at 15°C overnight.
After stabilizing the protein expression and solubility, the clones were ready for large scale expression. 1L of LB broth containing 100 μg/ml of ampicilin and
23 inoculated with 10 ml of an overnight culture. The culture was grown at 37 °C until the OD600 reached 0.5-0.6 then incubated at 15 °C for 30 minutes before adding isopropyl-β-D-thiogalactopyranoside (IPTG). For AlyQ and AlyQBC, the final IPTG concentration is 1 mM, AlyQA and AlyQB IPTG concentration is 0.2 mM, while for
AlyQC the final IPTG concentration is 0.1 mM. The induced culture was the incubated in 15 °C with agitation of 200 rpm overnight for AlyQ, AlyQBC, AlyQA and AlyQB culture. AlyQC was cultured in 15 °C with agitation of 100 rpm for 40 hours.
3.4.2 Protein Extraction by Sonication
The induced culture was centrifuged at 8000 rpm for 20 minutes to collect the cell pellets. The cell pellets were then washed with phosphate buffered saline (PBS) to wash the excess LB broth in the cell. Supernatant was discarded after centrifugation. Next the cell pellets were resuspended in 50 ml of buffer A (100 mM
NaCl, 50 mM Tris, pH 8.0) and lysed by sonication. The samples were sonicated in ice bucket to prevent denaturation of protein, with five sets of 1 second on 1 second off for 1minute and amplitude of 35 %. In between the sets, 1 minute resting period was provided to prevent extensive frothing of the sample. After sonication, the samples undergo centrifugation at 14,000 rpm for 15 minutes at 4 °C. The supernatant would contain the soluble protein.
3.4.3 Protein Purification
The AKTA explorer (GE healthcare, USA) was used to perform all the purification techniques (Affinity chromatography and Gel filtration). The column
(HiTrap IMAC HP 5 ml, GE healthcare, USA) was prepared and charged by washing
24 with cobalt(II) chloride solution. The cobalt-chelating column was stored in 20 % ethanol to prolong column life-span. Cobalt-charged column could bind to
His-Tagged protein construct. Before usage of the column, 5 CV of distilled water was used to rinse of the ethanol, next the column would be washed by 5 CV of buffer
A to create a homogenous condition for the protein sample. A flow rate of 1 ml/min was used for all the washes. The protein sample after sonication was filtered using
0.22 µm minisart filter before loaded to the machine and the column. Stringent washing was performed using buffer A to remove unbound proteins. Proteins were eluted by linear gradient of buffer B (1 M of Imidazole, 100 mM NaCl, 50 mM Tris, pH 8.0) from 0 to 100% in buffer A and the protein was collected in 1.4 ml fraction tubes. The fractions eluted from cobalt-charged column were examined using
SDS-PAGE, fractions containing more targeted protein and less non-specific protein was chosen for gel filtration.
Fractions containing the targeted protein were concentrated using Pall Advance centrifugal device (3k, 10k, 30k MWCO, Pall, USA) before loading onto Superdex
200 high-load gel filtration column. Fractions were eluted using buffer A. Fraction containing the protein, which eluted from gel filtration column, were examined by
SDS-PAGE and Zetasizer-UV (Malvern, UK). The purified protein with targeted size was then stored in 4 °C refrigerator for further studies.
3.4.4 Sodium Dodecyl Sulfate Polyacrylamide Gel Eletrophoresis (SDS-PAGE)
The Mini-PROTEAN II system (Bio-Rad, USA) was used for running
SDS-PAGE. The molecular weight of the target protein was estimated using a standard protein marker (Biorad, USA). Gel sandwich were assembled by complying the manufacturer’s instructions. 10 % separating gel and stacking gel was prepared.
25 The cell was connected to power supple and run initially at 90 V for 20 minutes then
140 V for 50 minutes. After electrophoresis, the gel was stained by Coomassie Blue for 30-60 minutes. The gel was de-stained with de-staining solution until the bands were visible.
3.5 Preparation of Poly(M) and Poly(MG) and Poly(G) blocks of Alginate
Sodium alginate (Macrocystis pyrifera origin) was purchased from Sigma-Aldrich (St.
Louis, MO, USA). Limited acid hydrolysis method described in Haug et al. (1967), was used to make poly-M, poly-MG and poly-G blocks from sodium alginate. One part of alginate was suspended in 20 parts of 0.3 M HCl and hydrolyse in boiling water bath for
30 minutes. After centrifugation, the supernatant containing poly-MG block was collected, neutralized, and precipitated with ethanol in a final concentration of 60 %. The insoluble materials were hydrolyzed with 20 parts of 0.3 N HCl for 24 h. After 24 h, the insoluble materials were collected using centrifugation and added with 10 parts of distilled water and small amount of 1 M NaOH to dissolve the pellets, the suspension were then adjusted to pH 2.85 with 1 M HCl. After centrifugation, the precipitant (poly-G block) were neutralized in dilute NaOH and then precipitated in ethanol. While the supernatant
(poly-M block) was neutralized with dilute NaOH and precipitated in ethanol. The polymeric blocks were then freeze-dried for storage. The poly-G, poly-MG and poly-M blocks were then sent for block structure characterization using circular dichroism,
JASCO J815. The purity mannuronate and guluronate contents in the substrates were estimated by method stated in Morris et al., (1980). The mannuronate content in the original alginate was ~61 %, while in the poly-M-rich substrate and the poly-MG substrates were estimated as 90 % and 60 %, respectively. The guluronate content in the poly-G-rich substrate was ~80 %.
26 3.6 Enzyme Characterization
3.6.1 The effect of different pH and different temperatures
Activity of alginate lyase was determined by the increase in absorbance at 235 nm due to the formation of carbon-carbon double bond at the end of the product. This method was based on Jagtap et al., 2014 with slight modification. For determining the affinity of alginate lyase towards different types of substrates, 1 mg/ml of sodium alginate poly-MG, poly-G and poly-M were dissolved in 20 mM Tris buffer and 500 mM NaCl pH 7.0, the activities were determined in room temperature and by using
AlyQ. For determining optimal pH and NaCl, the conditions were set at 30 °C and 1 mg/ml alginate is prepared in sodium 20 mM citrate buffer with 500 mM NaCl (pH
3-6) and in 20 mM Tris buffer with 500 mM NaCl (pH 7-9) to determining optimal pH. To determine the optimal temperature, the substrate and the quartz cuvette are incubated in temperature range from 10 °C to 70 °C for 5 minutes before adding enzyme.
3.6.2 The effect of additional SDS
AlyQ proteins were incubated in SDS ranging from 0.00001 % to 1 % for 1 hour in room before adding to 3 mg/ml alginate and the activity was done in 3 replicates at
20 mM Tris buffer 500 mM NaCl in pH 7 at 50°C. The SDS test was based on Cao et al., 2007 with slight adjusdtment.
3.6.3 The effect of additional EDTA
AlyQC proteins were incubated in EDTA with 1 mM and 5 mM concentration in ice before adding to 3 mg/ml alginate and the activity was done in three replicates at 20 mM Tris buffer 500 mM NaCl pH 7 at 40°C. The EDTA activity test was based on
27 Shimokawa et al., 2014 with slight adjustment.
3.6.4 Kinetic constant determination
Based on protocol by Swift et al., 2014 with modifications, reactions in 700 µl volumes were set up in triplicates using quartz cuvette. Alginate substrates were in
20 mM Tris, 500 mM NaCl, pH 7. Substrate concentration ranging from 3 mg/ml to
0.05 mg/ml. The quartz cuvette and substrate were equilibrated to 30 °C, followed by the addition of enzyme to obtain a final protein molar concentration at around 70 µM.
The protein concentration was based on the BSA standard curve for Bradford protein assay (Appendix 8). Initial velocities of the reactions were determined over a 100 second run. To determine the enzyme kinetics, the averaged initial velocities in milli-absorbance units (mAU) at 235 nm per minute versus the substrate concentrations were determined. As alginate is a polymer that consist of random combinations of mannuronic acid and guluronic acid residues, and both have the same molecular weight (MW). Hence the substrate molarity was calculated using the
MW of 176 g/mol for each monomer of uronic acid in the polymer (i.e. 194 g/mol monomer MW – 18 g/mol for the loss of H2O during polymerization). Velocity (V) at the tested substrate concentration was calculated as follows: V (mol/s) = (absorbance unit AU/min × min/sec × 1 cm)/ (6150 M-1 cm-1) × (7×10-4 liters). The turnover number, kcat, for AlyQ, AlyQBC and AlyQC. was calculated as follows: kcat (s-1) =
Vmax/E, where E is defined as the mols of alginate lyase enzyme in the assay. The
Km and kcat values were determined from the Lineweaver–Burk plots, using an extinction coefficient of 6,150 M-1 cm-1 for determining the uronic acid product concentrations (Swift et al., 2014).
28 3.6.5 Binding Assay
AlyQA and AlyQB protein binding profiles were shown using gel filtration chromatogram. 200 µl of 10 mg/ml substrate (sodium alginate, poly-M, poly-G, and poly-MG) was degraded using AlyQC protein and then 200 µl of 3 mg/ml AlyQB protein was added and incubated for 20 minutes before running the gel filtration chromatography. The chromatogram of each substrate with AlyQA and AlyQB protein were recorded and compared with the chromatogram profile of AlyQA and AlyQB protein without any substrate. The binding assay test was based on Abbott et al.,
2007 with slight modification.
3.6.6 Affinity Electrophoresis Assay
0.1% (w/v) sodium alginate broken down by AlyQC were incorporated into native polyacrylamide gel. Then AlyQA and AlyQB protein were loaded to the Native PAGE gel and using BSA as a control to check the binding affinity of AlyQA and AlyQB.
The affinity electrophoresis was based on Abbott et al., 2007 with slight modification.
3.7 Protein Crystallization
The protein crystallization protocol was based on Dessau and Modis (2011). The protein samples were concentrated to 10 mg/ml using then filtered through 0.22 µm filter units to eliminate precipitates or dust before crystallization process. Initial crystallization screening was performed using the crystal screening kits from
Molecular Dimension Limited (PGA screen, Structure screen 1 and 2), Hampton research (Crystal screen, Crystal screen 2, Index screen, PEG/Ion Screen, PEG/Ion 2
Screen, SaltRx 1, SaltRx 2, Grid screen ammonium sulfate, Grid screen MPD, Grid
29 screen sodium malonate and Quik screen), Jena Bioscience (Pi-minimal screen) and
Emerald Biosystem (Wizard 1 and 2). Sitting drop vapor diffusion method was used for initial screening process (Figure 3.2). Drops were set in sitting drop plate. For each crystallization plate, 1 µl of protein was mixed with 1 µl of reservoir per well.
For optimization process, hanging-drop vapour diffusion method was used. The plate was sealed with sealing tape (or each well sealed with a siliconized cover slide, if in hanging drop plates). The crystallization plate was stored at 4 °C and 20 °C. The plates were examined each day during the first week, one or twice every week during the first 2 months and once every two weeks thereafter. Condition that yielded potential crystals were selected for further parameter optimization. The conditions that yielded potential crystals were further optimized by changing the parameters such as the pH of the buffer, types of the buffer, types of precipitants, percentage of the precipitant, types and concentration of the salt, and the addition of the additives were screened to fine-tune the crystal formation.
30 A B
C
Figure 3.2: Diagram of the vapour diffusion method. (A) Sitting drop crystallization plate. (B) Hanging-drop crystallization plate. (C) Overview of the sitting drop crystallization technique. 1µl of protein mixed with 1µl of buffer in the reservoir placed on the platform of the sitting drop plate. The mixed drop contains a lower reagent concentration compared to reservoir. Water vapour leaves the drop and eventually ends up in the reservoir, increasing the relative supersaturation of the drop, then the equilibrium achieved as the concentration of the drop and the reservoir becomes similar.
3.8 Data collection
The diffraction data was collected at 100 K on a Rigaku MicroMax-007 HF X-ray generator equipped with an R-AXIS IVV++ area detector, and processed with XDS
(Kabsch, 2010). The crystal was flash cooled prior to the data collection. There were
4 different crystal protein data collected, that was AlyQB protein, AlyQB protein co-crystalized with 1 % sodium alginate, AlyQBC protein, and AlyQBC protein co-crystallized with 1 % sodium alginate. The crystal data collecting process is summarized at Table 3.2.
31 Table 3.2 Crystal X-ray data collection parameters Crystal to Exposure Start angle to end Image detector distance time (min) angle (°) width (millimetre) (°) AlyQB 120 2 175-253 1
AlyQB + 100 2 0-69.5 0.5 Sodium alginate AlyQBC 140 4 0-89.5 0.5
AlyQBC + 140 5 0-82.5 0.5 Sodium alginate
3.9 Data processing
The structure was solved with Molrep (Vagin, 1989) using structure of a pectin binding protein from Yersinia enterolitica (PDB entry 2JD9) as initial model for molecular replacement for AlyQB. Then using the solved model structure of AlyQB and structure of alginate (poly-α-L-guluronate) lyase from Corynebacterium sp.
(PDB entry 1UAI) as initial model for molecular replacement for AlyQBC. Phenix
(Adams et al., 2010) was used for automatic model building and a structure was then manually built and refined using Phenix and Coot (Emsly et al., 2010). Dali server was used for structural comparison (Holm & Rosenström, 2010). All figures were generated using PyMOL (Schrödinger, 2016).
32 4.0 RESULTS
4.1 BLASTp search and Cloning of Alginate Lyase gene from Persicobacter sp.
CCB-QB2
Alginate lyase gene was cloned from DNA gene of Persicobacter sp. CCB-QB2.
According to the on-line BLAST web interface provided by NCBI, the targeted AlyQ gene contained three putative domains, namely carbohydrate-binding domain from amino acid residue 1 to 154, carbohydrate-binding domain residue 160 to 296 and an alginate lyase catalytic domain from residue 301 to 552. The first domain protein sequence identities showed resemblances with CBM16 family proteins (PDB code:
2ZEW) (Bae et al., 2008) and (PDB code: 3OEA) (Su et al., 2010) with protein sequence similarities of 33%. The second domain was found to have high similarities with protein crystal structure of CBM32 extracted from Yersinia enterolitica (PDB code: 2JD9) (Abbott et al.,2007) that binds to polygalacturonic acid with protein sequence of 32% similarities. The third domain showed significant similarities with
PL-7 alginate lyase extracted from Sphingomonas sp. A1 by Yamasaki et al., 2005
(PDB code: 2ZAA) and a poly-α-guluronate lyase from Corynebacterium sp. By
Osawa et al., (2005) (PDB code: 1UAI) with similarities level at 29% and 35% respectively. The first domain is labeled as A, second domain is labeled as B and third domain is labeled as C for simplicity (Figure 4.1a). Hence the full gene will be named AlyQ, while other truncated domains are AlyQBC, AlyQA, AlyQB and AlyQC
(Figure 4.1b). AlyQ, AlyQA and AlyQC the genes were cloned in pET21A plasmid while AlyQBC and AlyQB gene were cloned in pColdIII plasmid before being transformed into BL21 DE3 competent cells. His tag was added to the C-terminal of each construct to enable nickel beads purification.
33 A
B
Figure 4.1: Sequence of AlyQ. A. Diagram representing the domains in AlyQ protein based on the BLASTp search result. The first domain labeled as A from residue 1-154, second domain labeled as B from residue160-296 and third domain is labeled as C from residue 300 to 552. B. Agarose gel electrophoresis showing PCR amplification products with the targeted size. Lane M: 100bp plus DNA ladder marker. Lane 1: AlyQ (1656 bp), Lane 2: AlyQBC (1179 bp), Lane 3: AlyQC (756 bp), Lane 4: AlyQA (402 bp), Lane 5: AlyQB (432 bp).
4.2 Protein expression and purification profile
All the protein constructs were successfully expressed in soluble form and purified using Nickel beads and gel filtration method as shown in SDS-PAGE. Gel filtration chromatogram showed that proteins eluted were in monomeric form while corresponding to targeted size. Proteins eluted in other peaks were not the targeted protein.
34 AlyQ has the size of 59.7 kDa (Figure 4.2), AlyQBC has the size of 43.2kDa (Figure
4.3), AlyQC has the size of 28.4 kDa (Figure 4.4), while AlyQA (Figure 4.5) and
AlyQB (Figure 4.6) have the size of 14.2 kDa and 15.3 kDa respectively. Usually
after nickel purification, there were still unspecific protein bands in the fractions,
hence the proteins were pooled and subjected to gel filtration to obtain the protein at
the specific size and contained only the band of interest.
Figure 4.2: Purification profile of AlyQ (A) Diagram of the protein elution profile of gel filtration for His-tagged AlyQ using 24ml Superdex 200 Increase 10/300 GL column. The targeted protein was eluted at 14.97ml peak, which correlated to the targeted size of AlyQ (59.7 kDa). (B) SDS-PAGE analysis of the expression profile of AlyQ. Lane M represents the protein ladder. Lane 1: soluble crude protein. Lane 2: Nickel beads purification. Lane 3: Elution from gel filtration Superdex 200
35
Figure 4.3: Purification profile of AlyQBC (A) Diagram of the protein elution profile of gel filtration for His-tagged AlyQBC using 120ml Superdex 200 Increase 10/300 GL column. The targeted protein was eluted at 86.92ml peak, which correlated to the targeted size of AlyQBC (43.2 kDa). (B) SDS-PAGE analysis of the expression profile of AlyQBC. Lane M represents the protein ladder. Lane 1: Nickel beads purification. Lane 2: Elution from gel filtration Superdex 200
Figure 4.4: Purification profile of AlyQC (A) Diagram of the protein elution profile of gel filtration for His-tagged AlyQC using 24ml Superdex 200 Increase 10/300 GL column. The targeted protein was eluted at 16.32ml peak, which correlated to the targeted size of AlyQC (28.4 kDa). (B) SDS-PAGE analysis of the expression profile of AlyQC. Lane M represents the protein ladder. Lane 1: Soluble crude protein. Lane 2: Nickel beads purification. Lane 3: Gel filtration elution
36
Figure 4.5: Purification profile of AlyQA (A) Diagram of the protein elution profile of gel filtration for His-tagged AlyQA using 24ml Superdex 200 Increase 10/300 GL column. The targeted protein was eluted at void volume, meaning that AlyQA form large oligomers and could not be separated by gel filtration. Other peaks that contain protein elution do not correlate to the size of the AlyQA (14.2 kDa). (B) SDS-PAGE analysis of the expression profile of AlyQA. Lane M represents the protein ladder. Lane 1: soluble crude protein. Lane 2: Elution from gel filtration Superdex 200
Figure 4.6: Purification profile of AlyQB (A) Diagram of the protein elution profile of gel filtration for His-tagged AlyQB using 24ml Superdex 200 Increase 10/300 GL column. The targeted protein was eluted at 17.45 ml peak, which correlated to the targeted size of AlyQB (15.3 kDa). (B) SDS-PAGE analysis of the expression profile of AlyQB (15.3 kDa). Lane M represents the protein ladder. Lane 1: soluble crude protein. Lane 2: Elution from gel filtration Superdex 200.
37 4.3 Binding Assay
AlyQB was first hypothesized to be able to bind to sodium alginate, poly-MG, poly-G and poly-M substrates. Gel filtration using Superdex 200 Increase 10/300L column was used to observe the UV280 peak shift. When there is no binding of
AlyQB towards substrates, the peak was predicted to remain the same where AlyQB were eluted. In contrast, if there is binding of AlyQB towards substrates, the peak was predicted to shift towards the front beacuse AlyQB would eluted earlier, due to the working principle of gel filtration beads where molecules are eluted according to their sizes and larger molecules will be eluted first.
The gel chromatogram results showed that after the substrates (sodium alginate, poly-MG and poly-G) were broken down into smaller oligomers by AlyQC, AlyQB was then able to bind with degraded sodium alginate substrate. Hence, a significant
UV280 peak shift was observed when the substrates were added together with AlyQB, because AlyQB could bind with the substrate oligomers forming a larger size and eluted earlier in the gel chromatography (Figure 4.7). AlyQB could not bind with poly-M were probably due to the degradation rate of AlyQC towards poly-M substrate are not as high as degrading sodium alginate, poly-MG and poly-G substrates. This binding assay showed that indeed AlyQB could bind to alginate substrates.
Binding assays for AlyQA was tested using similar approach to AlyQB. However,
AlyQA does not show binding towards degraded alginate substrates and the protein still form oligomers and eluted at void volume. Hence, it could not be concluded that
AlyQA could recognize or binding to the substrate, because the active side of AlyQA might not be available for the binding assay when large oligomers are formed. In the future, adding urea or other types of detergent could be incorporated to prevent
38 oligomers formation of AlyQA.
Figure 4.7: Substrate binding by AlyQB with size-exclusion chromatography. The substrates were degraded with minute amounts of AlyQC before mixing with AlyQB. The elution volume is plotted against normalized A280 reading.
39 4.4 Affinity Electrophoresis Assay
AlyQB were hypothesized to bind alginate substrates. However binding effects of
AlyQB towards native gel, gel incorporated with sodium alginate or gel incorporated with degraded alginate substrate, demonstrate no obvious band shift (Figure 4.8). Figure 4.8C showed that there was a light smearing band of AlyQB towards degraded alginate substrate gel, however generally a positive binding would result with the protein band higher up in the gel compared the controlled protein band. Hence, the affinity electrophoresis assay did not demonstrate conclusive results on the binding activity of AlyQB towards sodium alginate substrates and the degraded sodium alginate substrates.
A B C
Figure 4.8: Affinity Electrophoresis assay of AlyQB. A. 15% Native gel without any substrate. B. 15% Native gel containing 0.1% sodium alginate substrate. C. 15% Native gel containing 0.1% degraded sodium alginate lyase. First lane of each picture is a BSA standard, while second lane is the AlyQB.
40 4.5 Thin Layer Chromatography
TLC was used to test AlyQ, AlyQBC and AlyQC degrading ability towards sodium alginate and checking the final uronic acid product. Glucose (a hexose ring), maltose (2 hexose ring) and acarbose (3 hexose ring and 1 pentose ring) were used to determine the degree of polymerization (DP) of the oligomers, because a single uronic acid molecule contains a hexose ring. The smallest DP of sodium alginate hydrolysate was found between maltose and acarbose, hence it can be deduced that sodium alginate was degraded into trimers or tetramers (Figure 4.9). The smearing line from lane 1 to lane 3 below the single spot, represents a group of larger degraded oligomers that contains bigger DP number than tetramers. While the dark spot on the base line from lane 1 to 4 means undegraded sodium alginate, and lane 4 showed visible darker spot compared to lane 1 to 3 because no alginate lyase enzyme was added to degrade the substrate. The results showed that containing the additional carbohydrate binding module do not contribute to the degradation ability alginate lyase to breakdown substrate into a smaller DP oligomers.
Glucose Maltose
Acarbose
M 1 2 3 4
Figure 4.9: Thin Layer Chromatography of AlyQ, AlyQBC and AlyQC against sodium alginate. Lane 1 represents the product of sodium alginate degraded by AlyQ, Lane 2 represents the product of sodium alginate degraded by AlyQBC, and Lane 3 represents the product of sodium alginate degraded by AlyQC. Lane 4 represents sodium alginate substrate without any added enzyme, showed that the undegraded sodium alginate remained on the base line. Lane 1 to 3 showed that all alginate lyase enzymes degraded sodium alginate into similar oligomers that is into trimers or tetramers.
41 4.6 Alginate lyase activity assay
4.6.1 Alginate lyase substrate preference assay
To determine the AlyQ alginate lyase specificity, the substrate preference assay was done to determine it could degrade sodium alginate, poly-G block, poly-M block, or poly-MG block. AlyQ was shown to be able to degrade all the substrates but have the preference on degrading poly-MG block and sodium alginate. AlyQ showed highest degradation preference towards Poly-MG substrates followed by sodium alginate substrate and poly-G substrate. However, the relative degradation efficiency of AlyQ towards poly-M substrate drops to 20 % (Figure 4.10). The results showed that alginate lyase from AlyQ could degrade all the substrate types (poly-MG, poly-G and poly-M) which is one of the characteristic of PL-7 alginate lyase. The data representing the averages obtained from three independent experiments. The results of the ANOVA test for activity values of the AlyQ (df = 3, F = 616, p < 0.01) were significant.
Figure 4.10: Bar chart for substrate preference activity of AlyQ at room temperature using Tris buffer pH 7.0. 4.6.2 The effect of different pH
His-tagged AlyQ, AlyQBC and AlyQC proteins all showed an optimum catalytic activity at pH 7.0. All three proteins exhibited a significant drop of activity towards a high acidity environment, while still performing above 50% of the catalytic activity at pH 9.0.
The data are representing the averages obtained from three independent experiments. The
42 results of ANOVA test for activity values of the AlyQ (df = 5, F = 746.3, p < 0.01),
AlyQBC (df = 5, F = 290.5, p < 0.01), and AlyQC (df = 5, F = 3130.1, p < 0.01), were significant. The results indicate that having the extra CBMs on the N-terminal cause no changes on pH preference nor widens the pH range (Figure 4.11).
A B
C
Figure 4.11: Graphs of the effect of different pH on the relative enzyme activity of recombinant His-tagged AlyQ (A), AlyQBC (B) and AlyQC (C) at 30°C.
43 4.6.3 The effect of different temperature
AlyQ acted optimally in 50°C, while AlyQBC and AlyQC acted optimally in 40°C (Figure
4.12). This data implies that AlyQ having an extra CBM domain had led to the enzyme working effectively at 10°C higher temperature compares to AlyQBC. On the other hand,
AlyQBC having a central CBM domain do not aid in increasing the optimal enzyme working temperature compared to AlyQC. The data are representing the averages obtained from three independent experiments. The results of ANOVA test for activity values of the
AlyQ (df = 6, F = 163, p < 0.01), AlyQBC (df = 5, F = 853.8, p < 0.01), and AlyQC (df = 5,
F = 549.3, p < 0.01), were significant. The results showed that having an additional CBM
(domain A) on the N-terminal did increase the temperature preference of AlyQ yielding a wider temperature activity range compared to AlyQBC and AlyQC.
Figure 4.12: Graphs of the effect of different temperature on the relative enzyme activity of recombinant His-tagged AlyQ (A), AlyQBC (B) and AlyQC (C) at pH7.
44 4.6.4 The effect of adding different concentration of SDS
When the concentration of SDS added was lower than 0.001%, the enzyme activity did not observe noticeable effect compared to the controlled sample. There was 30% increase in relative activity when 0.001% SDS was added into the AlyQ, while concentration larger than that had hugely decreases the relative enzyme activity by retaining only 40% or less of the controlled sample activity (Figure 4.13). The results of ANOVA test for the activity values of SDS pre-treated AlyQ enzyme (df = 5, F = 116.2, p <0.01) were significant. This result showed that in SDS addition in a small amount could increase the activity of alginate lyase significantly, however with larger amount of SDS added the enzymatic activity would go down.
Figure 4.13: Bar charts of the effect of additional SDS on the relative enzyme activity of AlyQ in pH 7.0 at 50°C after incubation for 1hour.
4.6.5 The effect of adding EDTA
EDTA is a type of chelating agent that could remove metals or minerals such as calcium in the protein. The enzyme activity of enzyme added with 1mM and 5mM EDTA observed a noticeable effect compared to the controlled sample. The relative activity of AlyQC drop to
37% when 1mM of EDTA was added, while after added with 5mM of EDTA the activity
AlyQC retained approximately 25% of the controlled sample activity (Figure 4.14). The results of ANOVA test for the activity values of EDTA pre-treated AlyQ enzyme (df = 2, F
45 = 771.95, p <0.01) were significant. This result showed that there might be metal ions that are crucial in maintaining the structure of alginate lyase hence affecting the activity of alginate lyase enzyme.
Figure 4.14 : Bar charts of the effect of additional 1mM and 5mM of EDTA on the relative enzyme activity of AlyQC in pH 7.0 at 40°C after incubation for 30 minutes.
4.7 Alginate lyase Kinetic Assay
AlyQ, AlyQBC and AlyQC differed in efficiency as shown by their difference in the enzyme kinetic parameters, Km and kcat, that were obtained using the Lineweaver-Burk plot
1 1 (Figure 4.15). AlyQ had the highest kcat/Km value at 13229.7 M s which was double the efficiency of AlyQC. However, kcat/Km of AlyQBC do not differ much from AlyQC, means that the B domain do not play a role in the efficiency of alginate lyase enzymatic assay.
The Km and kcat values were summarized in Table 4.1.
46
Figure 4.15: Lineweaver-Burk plots of AlyQ (A), AlyQBC (B) and AlyQC (C) proteins. The data are representing the averages obtained from the three independent experiments.
47 Table 4.1: Kinetic Parameters of AlyQ, AlyQBC and AlyQC 1 1 1 Km (mM) kcat (s ) kcat/Km (M s ) AlyQ 2.419 32 13229.7
AlyQBC 1.446 10.7 7399.7
AlyQC 1.345 9.1 6766.3
4.8 Protein Crystallization and data collection
AlyQ, AlyQBC and AlyQC, AlyQA and AlyQB had undergone crystallization trials using pre-ordered crystallization kits and undergone further optimization to obtained crystals. However only AlyQBC and AlyQB could yield diffract-able crystals. The
AlyQBC and AlyQB also formed crystals when co-crystallization with sodium alginate, poly-M, poly-G and poly-MG substrates. All the crystals were formed at 20 °C within 1 week to 4 weeks.
AlyQBC crystals and its co-crystalized protein crystals produced rod shape crystals at 0.1 M sodium acetate trihydrate pH 4.0, 30% w/v PEG 3350 and 0.2 M potassium phosphate dibasic (Figure 4.16A & 4.16B). The AlyQBC protein crystals diffracted to a resolution up to 2.3Å (Figure 4.17A & 4.17B).
AlyQB protein formed a rod-shaped protein (Figure 4.16C) in this condition -
0.1M sodium HEPES pH 7.5, 20% w/v PEG 10000, forming a good quality diffracting resolution at 1.75 Å (Figure 4.17C). AlyQB protein produced a hexagonal protein crystal when co-crystallize with the substrates in this condition - 0.1 M sodium HEPES pH 7.5, 2% v/v PEG 400 and 2.0 M ammonium sulfate (Figure
4.16D). AlyQB co-crystallized protein has a good quality diffracting to a resolution of up to 1.6 Å (Figure 4.17D).
48 A B
C D
Figure 4.16: Protein crystal image. A. AlyQBC protein crystal. B. AlyQBC protein co-crystallized with the sodium alginate substrate. C. AlyQB protein crystal. D. AlyQB protein co-crystallized with the sodium alginate substrate.
49 A B
C D
Figure 4.17: X-ray diffraction pattern of crystals. A. X-ray diffraction pattern of the crystal of AlyQBC protein (~2.3 Å). B. X-ray diffraction pattern of the crystal of AlyQBC protein co-crystallized with sodium alginate (~2.8 Å). C. X-ray diffraction pattern of the crystal of AlyQB protein (~1.75Å). D. X-ray diffraction pattern of the crystal of AlyQB protein co-crystallized with sodium alginate (~1.6 Å).
50 4.9 Data Processing
. The structure of AlyQBC and AlyQB was solved successfully and the data collection and refinement statistic were summarized in Table 4.2. AlyQBC crystal is tetragonal crystal and belongs to space group P41212 with unit-cell parameters a = b
= 74.32 and c = 179.73 Å. While AlyQBC co-crystalized with alginate substrate crystal data was not good enough. Both AlyQB crystal and AlyQB co-crystalized with alginate substrate crystal is orthohombic crystal and belonged to space group P212121 with AlyQB crystal unit-cell parameters a = 43.44, b = 55.66 and c = 58.50 Å and
AlyQB co-crystallized crystal having unit-cell parameters a = 43.61, b = 55.77 and c
= 58.43 Å. The structure of AlyQB and the co-crystallized crystal protein (residue
188-314) was solved to a resolution 1.75 Å and 1.59 Å respectively using molecular replacement, with pectin binding protein as a model (PDB: 2JD9). The AlyQB structure was made up of an α loop 9 and strand of β strands that formed a β sandwich structure. The AlyQB structure (Figure 4.18A) is a carbohydrate-binding module that binds a ligand, 4-deoxy-alpha-L-erythro-hex-4-enopyranuronic acid that is the non-reducing end of the alginate substrate. The residue responsible for holding the ligand in place is Asp-200, Tyr-243, Arg248, Asn301 and Trp303 (Figure 4.18B).
The structure of AlyQBC (residue 188 - 573) was solved to a resolution of 2.3 Å using molecular replacement of AlyQB structure and an alginate lyase protein structure deposited in the Protein Data Bank (PDB) as 2ZAA, orginated from
Sphingomonas sp. as template (Ogura et al., 2008). The binding link between AlyQB and AlyQC was disordered (residue 312 – 330). The AlyQBC protein structure shows that the B domain and C domain of the protein do not interact with each other and are independent (Figure 4.19A) and the structure of B domain remains the same with
AlyQB. While the C domain of AlyQBC where mainly formed by β-strands and
51 forming a large β sandwich which consisted of 16 β-strands and 3 short α-loops at the surrounding of the C domain. The catalytic domains are predicted to be (Gln436,
His438 and Tyr541) based on the proximity with the substrate, however there seems to be two additional amino acid (Asp446 and Asp447) that might contribute to the catalytic mechanism (Figure 4.19B). The crystal protein of AlyQBC co-crystalized with substrate do not yield sufficient data to elucidate the electron density map of the substrate at the catalytic alginate lyase domain, however the structure of AlyQBC and
AlyQBC complex remains the same, hence the substrate binding site was found by superimposing the 2ZAA protein structure with the structure obtain from AlyQBC crystal protein.
52 Table 4.2: Data collection and refinement statistic of the AlyQB and AlyQBC protein
AlyQB AlyQB with sodium alginate Data Collection Space group P212121 P212121 Cell dimensions (Å) a = 43.44, b = 55.66, c = a = 43.61, b = 55.77, c = 58.50 58.43 Resolution 1.75 (1.81-1.75) 1.59 (1.65-1.59) Rmerge 0.022 (0.059) 0.042 (0.182) I/σ (I) 34.6 (15.1) 23.4 (7.8) Completeness (%) 94 (83.4) 92.9 (75.5) Redundancy 3.17 (3.05) 6.75 (6.24) Refinement No. of reflections 13271 17464 Rwork 0.149 0.169 Rfree 0.187 0.194 RMSD Bond length (Å) 0.022 0.026 Bond angle (°) 1.950 2.231
AlyQBC
Data Collection Space group P41212 Cell dimensions (Å) a = b = 74.32, c = 179.73 Resolution 2.30 (2.38-2.30) Rmerge 0.101 (0.427) I/σ (I) 6.1 (2.2) Completeness (%) 99.6 (99.9) Redundancy 3.65 (3.69) Refinement No. of reflections 21500 Rwork 0.226 Rfree 0.279 RMSD Bond length (Å) 0.016 Bond angle (°) 1.762
53 A
B
Figure 4.18: Diagram structure of AlyQB. A. The ribbon diagram represents the AlyQB, while the stick structure labeled MAW represents the bound ligand which is a type of uronic acid named 4-deoxy-alpha-L-erythro-hex-4-enopyranuronic acid. The sphere ball represents the predicted Ca2+ bound in the structure. B. Close-up structure view of AlyQB, showing the amino acids responsible for the binding activity towards the non-reducing end of the alginate substrate.
54 A
B
Figure 4.19: A. Diagram structure of AlyQBC. The ribbon diagram represents the AlyQBC, while the structure showed that the CBM32 domain and alginate lyase domain are independent without interacting with each other. The stick structure labeled GGMG represents predicted the bound ligand of the GGMG tetramers. The three sphere balls represent the predicted Ca2+ bound in the structure. The dotted line connecting the B and C domain represents the disordered linkage. B. Close-up structure view of AlyQBC, showing the amino acids responsible for the catalytic activity towards the alginate substrate. The stick structure labeled -1, +1, +2 and +3 represents predicted the bound ligand tetramers and its predicted degrading sites.
55 5.0 DISCUSSIONS
5.1 BLASTp Search
The NCBI BLASTp searches of AlyQ protein from Persicobacter sp. CCB_QB2 provided a fundamental characteristic of each domains belonging to CBM16,
CBM32 and PL7 alginate. The CBM family of AlyQ concurs with Hutcheson et al.,
(2011) & Li et al., (2015) studies that suggested CBM attached to alginate lyase enzymes were mostly from CBM14, CBM16 and CBM32.
The PL-7 alginate lyases have three highly conserve amino acid site (R/E)
(S/T/N) EL, Q (I/V) H, and YFKAG (V/I) YNQ sites which coincidentally similar to the alginate lyase domain of AlyQ protein (Wong et al., 2000). This alginate lyase domain of AlyQ protein which is consist of the QIH amino acid conserve site have preference towards poly-G block and poly-MG block compared to poly-M block.
This data was supported by a review from Zhu & Yin (2015) showing multiple alginate lyases containing isoleucine on Q (I/V) H sites were predicted to be responsible to the affinity towards poly-G and poly-MG blocks and alginate lyases having valine amino acids on the Q (I/V) H site indeed have preference towards poly-M. Hence, adding evidence that the alginate lyase domain of AlyQ protein is a new member that belongs to a PL-7 alginate lyase family.
5.2 Enzymatic Characterization
The catalytic activity of AlyQC is inferior in comparison with alginate lyase from
Microbulbifer sp. 6532A (Swift et al., 2014) and Pseudomonas aeruginosa (Farrell & Tipton,
-1 -1 -1 -1 2012) with recorded kcat/Km value at 12300 M s and 3100000 M s respectively. However,
AlyQ was found to be more efficient in the catalytic degradation activity than the
-1 -1 other counterparts – AlyQBC and AlyQC, by possessing kcat/Km value of 13229.7 M s hence significantly increase the alginate lyase catalytic efficiency. This might due to the presence of the CBM16 on the N-termini of the protein may encourage the catalytic activity
56 by in capturing the alginate molecule, making the proximity of the substrate closer to the catalytic domain. Although the catalytic efficiency of AlyQBC are merely higher that AlyQC by 8%, the AlyQB X-ray structure data showed that the central CBM32 do bind to non-reducing end of an uronic acid ligand
(4-deoxy-alpha-L-erythro-hex-4-enopyranuronic acid) which was a product of degraded alginate substrate. This might due to the nature form of AlyQ gene that needed both CBM domain to induce the optimum function of alginate lyase, CBM16 and CBM32 protein worked together in capturing the alginate molecule for enzyme degradation, hence dismissing one of the CBM proteins may affect the alginate lyase efficiency. Although enzymatic studies on dismissing the CBM32 middle domain have not been done, it could be an interesting study for the future. The thin layer chromatography results shown that alginate lyase enzyme from AlyQ degrades alginate substrate endolytically, producing uronic acid oligomers with the lowest degree of polymerization at only trimer or tetramer, which concurs with another endo-type alginate lyase that have product up to dimer, trimer and tetramer
(Inoue et al., 2014; Thomas et al., 2013; Zhu et al., 2015). While exo-type alginate lyases would have cleaved the alginate substrate into unsaturated monomeric product (Jagtap et al.,
2014; MacDonald et al., 2016). There was no visible difference of degraded alginate substrate product between AlyQ and its truncated species, though Clostridium thermocellum mannanase yielded a smaller DP product (a monomer) when CBM32 was tethered with the active enzyme, comparing with the active mannanase enzyme, which yielded a dimer product (Mizutani et al., 2014). Hence, AlyQ alginate lyase is a type of endolytic alginate lyase.
The affinity electrophoresis results of AlyQB shown that there is a no affinity binding towards both sodium alginate substrate and sodium alginate substrate that was added with AlyQC to obtain degraded alginate oligomers. However, one might argue that AlyQB have some transient binding shown on Figure 4.8 (C) (see result section 4.4) towards degraded sodium alginate, because there is some smearing
57 compared to undegraded sodium alginate gel and the native page gel. This might be due to innately CBM32 have weaker binding affinity (Ficko-Blean et al., 2012;
Mizutani et al., 2014). Despite this, the result from affinity binding of AlyQB towards degraded sodium alginate was not convincing because a positive binding in the affinity electrophoresis would result in the targeted protein band in the native gel containing the substrate to be situated higher than the controlled native gel
(Kinoshita et al., 2015).
Fortunately, binding affinity of AlyQB towards alginate was shown using gel filtration chromatography. The AlyQB protein was eluted relatively earlier when degraded alginate or poly-G were incubated together but not with undegraded sodium alginate substrate with AlyQB indicated that it could interact with smaller oligomers or degraded uronic acid ends. This very well corresponds to properties of
CBM32 protein that is a type of small sugar binding domain such as mono-, di- or tri-saccharides (Baroston et al., 2004), showing that AlyQB could bind to smaller molecule but not the long polymer chain of alginate. Meanwhile AlyQB does not show any visible binding affinity towards poly-M substrate that was also treated with minute amount of AlyQC enzyme. This perhaps was the nature of AlyQC having a higher activity towards poly-MG and poly-G, hence AlyQC needed longer degradation time to cleave poly-M. Therefore, a longer degradation period was essential for poly-M, to ensure formation of viable degraded uronic acid from poly-M substrate for AlyQB binding to illustrate a peak shift in the gel chromatogram.
AlyQA protein that was predicted to be CBM 16 family according to BLASTp amino acid similarities search was eluted at void volume in gel chromatography separation by size, meaning that it aggregates and form large soluble oligomers with
58 each other. Hence, on this basis, it is hypothesized that AlyQA protein could dissociate with each other and interact with alginate substrate thus eluted much later in the chromatogram. However, AlyQA proteins do not demonstrate any peak shift when added with alginate, degraded alginate or degraded poly-G substrate. Hence, no concrete results showing that AlyQA having affinity towards the alginate substrate.
Nevertheless, having an additional AlyQA domain on the N-terminal of AlyQ enzyme contributes to the increase of alginate lyase activity and the optimal enzyme temperature. Hence, this characteristic attribution was speculated that AlyQA might interact with AlyQC domain, further structural studies are yet to be done to provide reasonable insights.
SDS had marked a significant effect towards AlyQ, as addition of 0.1% and
0.01% of SDS has dramatically decreased the enzyme activity, despite that the activity increases by 30% when 0.001% of SDS is added. This might due to SDS being a detergent, in a small amount it could prevent aggregation of protein hence increases its activity, however in a larger quantity SDS is an ionic detergent that could denature protein consequently decrease of enzyme activity (Bischoff, Shi and
Kennelly 1998). Although SDS had been proven to increase enzyme activity of plant polyphenoxidase (Moore and Flurky 1990), however effects of SDS in alginate lyase was less studied. Cao et al., (2007) has reported alginate lyase had decrease in enzyme activity when added with 0.01M of SDS and Nakagawa et al., (2010) showed that no visible change when added with 0.01% of SDS. AlyQ is the only alginate lyase enzyme to date that showed increase activity with addition of minute amount of SDS at 0.001%.
The EDTA studies demonstrate that the alginate lyase domain is dependent towards metal ions for catalytic activity which concurs to a recent study by Thomas
59 et al., (2013) also recorded an PL-7 alginate lyase extracted from Zobellia galactanivorans, also decreased in activity when EDTA was added, suggesting that alginate lyase activity is dependent on calcium due to their adaptation towards their natural substrate of brown algae that contains calcium ions. Besides that, the crystal structure of AlyQBC showed that there are two calcium ions in the alginate lyase domain, hence hinting that calcium might play a role in the enzyme structure integrity.
All three recombinant proteins derived from AlyQ showed the optimal enzyme ability to degrade sodium alginate between pH 7-8 but diminished activity on the higher acidity buffer (Figure 4.11), this result corresponds to most reported alginate lyases having optimum activity from pH 7 to pH 8.5 (Wong et al., 2000). AlyP1
(Duan et al., 2009), AlgMsp (Swift et al., 2014) have the optimum activity at pH 8
Tris buffer. AlyDW11 (Sim et al., 2012) have optimum activity at pH 7 which is similar to AlyQ, AlyQBC and AlyQC that having the highest activity at pH7.
According to Li et al., (2015) that discussed the difference in optimal pH activity on full-length alginate lyase containing CBM 13 (AlyL2-FL) that had the highest activity in pH 9 and alginate lyase (AlyL2-CM) had the highest activity at pH 7.
Evidently, AlyQ having an additional CBM16 or the CBM32 at the N-termini of the alginate lyase protein does not contribute to alginate lyase enduring a wider pH range.
The full-length AlyQ give optimal enzyme activity in 50°C and possesses stable activity at 60°C, at 70°C the activity weakens close to zero, however both AlyQBC and AlyQC protein highest reaction was at 40°C and the activity diminished close to zero at 60°C (Figure 4.12). Alginate lyase from bacteria usually have optimal temperature between 25°C to 50°C (Dou et al., 2013; Swift et al., 2014; Wong et al.,
60 2000). This result reveals that having an additional CBM16 at the N-termini does contribute to a higher and wider temperature activity range of AlyQ, yet not much studies had done for CBM16 that supports effects towards optimal temperature of catalytic enzyme. Alginate lyase from Agarivorans sp. L11 (Li et al., 2005) reported the optimal temperature of full-length alginate lyase containing CBM 13 (AlyL2-FL) at 45°C and still possesses activity at 60°C while AlyL2-CM that only contain the catalytic module is optimum at 35°C and possess almost no activity at 60°C. This optimal temperature profile of Agarivorans sp. L11 was similar to the optimal temperature profile of AlyQ, AlyQBC and AlyQC, indicating that CBM16 too had the ability to increase optimal temperature of alginate lyase enzyme as CBM13.
Km value of AlyQ at 2.4mM, AlyQBC is 1.4mM, and AlyQC is 1.3mM that falls within the average range of most of the endolytic alginate lyases showing lower Km value ranging from 0.1mM to 6.0mM (Gacesa, 1992). For example, AlgMsp protein from Microbulbifer sp. 6532 A shows a Km value of 3.4mM towards alginate substrate (Swift et al., 2014), while alginate lyase from Vibrio sp. YKW34, have recorded a Km value as low as 0.0068mM towards alginate substrate (Fu et al., 2007).
The kcat/Km or the catalytic efficiency of the proteins depicts that AlyQ had the highest
4 -1 -1 efficiency with a kcat/Km value 1.323 x 10 M s that had doubled the efficiency of
3 -1 -1 3 -1 -1 both AlyQBC and AlyQC with a kcat/Km value of 7.4 x 10 M s and 6.766 x 10 M s respectively. AlyQBC has only slightly at about 8% higher efficiency compared to
AlyQC. While alginate lyase from other species kcat/Km value differs dramatically compared to AlyQC. For example Vibrio sp. YKW34 had recorded kcat/Km value of 1.7
6 -1 -1 4 x 10 M s (Fu et al., 2007), Microbulbifer had recorded kcat/Km value of 1.23 x 10
-1 -1 6 -1 -1 M s (Swift et al., 2014) and Pseudomonas kcat/Km value of 3.1 x 10 M s (Farrell
& Tipton, 2012). Though AlyQ catalytic efficiency was shown to be less competent
61 towards other alginate lyase, this might reflect that different adaptation mechanism is displayed by Persicobacter sp. CCB-QB2 that primarily utilized agarases to degrade agarose for cell growth (Furusawa et al., 2016), hence the alginate lyase domain displayed a less competent catalytic efficiency.
The catalytic efficiency results also indicate that having CBM16, on the
N-Terminal had significantly increases the catalytic efficiency of alginate lyase. This might be due to CBM16 inherently binds to β-1,4-linked glucose polymers such as cellulose (Bae et al., 2008; Gilbert, 2010), whereas poly-M and poly-MG polysaccharides were form via β-1,4-linkage (Figure 2.1). CBM16 might be able to target the β-1,4-linkage of the alginate substrate then increase the proximity of the substrate towards the enzyme, thus increasing the kinetic efficiency. However, this deduction was not strong enough for the verification of higher catalytic efficiency of
AlyQ, because cellulose and alginate substrate comprised of different molecular constituent, hence further studies of the binding mode of AlyQA towards alginate substrate should be examined.
5.3 Crystallization and Structure Determination
Crystallization trials of AlyQ were done in various crystallization kits and optimization buffers, however no refractable crystal was form in the process. The well-ordered crystal lattices for multi-domain protein were generally harder to achieve, because linkers between domains creates flexibility for the protein (Rupp,
2010). As the N and C termini of the B domain were in close proximity (Figure 4.18a) along with the increase of catalytic activity at the presence of A domain, indicating A domain’s pivotal role and possibility of interacting with C domain, hence elucidating the AlyQ structure is essential.
AlyQB and AlyQBC yielded protein crystals for both its native states and
62 co-crystalized complex with sodium alginate substrate. AlyQB is the first CBM32 that demonstrate protein structure with its binding substrate, compared to previous studies by Abbott et al., (2007) only presented the CBM32 protein structure without the substrate. The structure of AlyQB co-crystalized complex gave the best x-ray diffraction data (~1.59Å resolution) compared to x-ray diffraction of AlyQB data
(1.75Å resolution), deducing it may contribute to the stabilization of crystal formed.
The DALI searches of AlyQB have 32% resemblance to the structure of CBM32 derived from Yersinia enterolitica (PDB code: 2JD9) (Abott et al., 2007), by forming a β-sandwich structure with eight β-sheets anti-paralleling each other and an α-helix separating two β-sheets. However, different from 2JD9 protein, AlyQB interact with the non-reducing end of polyguluronic acid, while the former binds to polygalacturonic acid polymers. AlyQB consists of a Trp303 site which primarily serves as a binding platform for the unsaturated monosaccharide, however AlyQB does not seem to effect much on the catalytic activity of alginate lyase, and generally
CBM32 have a lower binding affinity towards its substrate (Ficko-Bean et al., 2012;
Mizutani et al., 2014), and bindings towards monosaccharide, hence AlyQB might act as a temporary anchor to the unsaturated uronic acid termini, for intermediate transportion of uronic acid to the cell. However, more data on growth mechanism of
Persicobacter sp. CCB-QB2 utilizing uronic acid needed to be studied for this deduction.
Previous structural studies had only focus on elucidating alginate lyase or CBM protein alone such as PL-7 alginate lyase from Sphingomonas sp. A1 (PDB code:
2ZAA) (Ogura et al., 2008), alginate lyase from Corynebacterium sp. (PDB code:
1UAI) (Osawa et al., 2005) and PL-7 alginate lyase from Pseudomonas aeruginosa
(PDB code: 1VAV) (Yamasaki et al., 2004). AlyQBC is the first protein structure of
63 carbohydrate binding module and alginate lyase, showing that CBM32 and PL-7 alginate lyase are two independent protein that do not interact with each other in the absence or presence of the substrate ligands. The binding site of AlyQB is situated far from the catalytic site of AlyQC. and the catalytic efficiency of AlyQBC was merely
8% higher compared to AlyQC, suggesting that domain B does not play a pivotal role on enzymatic degradation of the alginate lyase, in the environment consisting of soluble alginate. However, alginates being a main constituent of seaweed are insoluble in nature, hence the experiment that involves solely on soluble alginate substrate do not reflects on the function of B domain when interacting with insoluble alginate existing in the cell wall nature. Supposing AlyQ was excreted nearby the seaweed, B domain could help AlyQ to concentrate on cleaving a single site by targeting the degraded alginate substrate instead of the enzyme spreading over a large area.
The structure of alginate lyase domain from AlyQBC resembles the PL-7 alginate lyase which is a jellyroll structure (Figure 4.19a) which is similar to PL-7 alginate lyase from Sphingomonas sp. A1 (PDB code: 2CWS) by Yamasaki et al., (2005) and
PL-7 alginate lyase from Pseudomonas aeruginosa (PDB code: 1VAV) by Yamasaki et al., (2004). From the structure (Figure 4.19b), the amino acid responsible for degrading the ligand is conserve from +1 to the +3 substrates, the degradation mechanism is then speculated based on the first proposed mechanism by Gacesa
(1987), first the Gln436 neutralize the carboxylate anions of the +1 substrates. Next,
His438 acts as a general base to donate electron to the C5 atom of the +1 substrates, lastly, Tyr541 as a general acid to donate proton at the O4 atom of the +1 substrates, hence forming a double bond between C4 and C5, and the elimination of
4-O-glycosidic bond which was also observed by other PL-7 family alginate lyases
64 (Ogura et al., 2008; Osawa et al., 2005). However, at the Asp446 and Asp447 of
AlyQ seems to be clashing with the -1 substrate site, the carboxylic end of the -1 substrate were physically too close to the carboxylic end of Asp446 and Asp447, the
-1 substrate is predicted to repel away from the amino acid, hence it is speculated that the Asp446 and Asp447 could be important for the C domain degradation mechanism, however mutational studies need to be done by replacing negatively charge amino acid into an uncharged amino acid that would not react with the substrate to uncover the importance of these amino acids towards the AlyQ degradation mechanism.
65 6.0 CONCLUSIONS AND FUTURE DIRECTIONS
AlyQ gene and its truncated genes (AlyQBC, AlyQC, AlyQA and AlyQB) from
Persicobacter sp. CCB-QB2 into suitable expression vectors with additional His-tag were expressed, purified, and characterized on enzymatic activities and the crystal structures of the AlyQBC and AlyQB is solved successfully. Previous studies had only focus on crystallization of alginate lyase protein and CBM separately, AlyQBC protein is the first protein where both CBM32 and PL-7 alginate lyase domain crystalized together showing that they both work independently without obstructing each other’s active site. AlyQB is the first CBM32 protein structure that demonstrates the binding of unsaturated uronic acid, which is only found when alginate substrates are degraded. These findings lead to deduction where in the nature environment CBM32 targets and binds to alginate, causing alginate lyase enzyme being in close proximity with the alginate substrate, hence focusing on the degradation on the targeted site.
The AlyQBC structure also shows that the three conserved amino acid site of alginate lyase (Gln436, His438 and Tyr541) are also predicted to be the amino acids responsible for the catalytic degradation of alginate substrate similar to other PL-7 alginate lyase. However, the crystal structure shows Asp446 and Asp447 which are close to the predicted active site might contribute to different mode of binding of
AlyQC compared to presently known alginate lyses. Hence, mutation on these two amino acid sites could be done to study the enzyme activity.
There are three metal ions likely to be calcium in the AlyQBC crystal structure based on the electron density with one in CBM32 and the other two in PL-7 alginate lyase protein. The EDTA studies showed that addition of EDTA did decrease the alginate lyase activity hence Ca2+ might play an important role in the alginate lyase structure. Ca2+ ion is important for the maintenance of the structure in CBM32.
66 AlyQ, AlyQBC and AlyQC that contains the same PL-7 alginate lyase gene showed the same degradation product using TLC and also showed similar optimum activity at pH 7.0. However, AlyQ demonstrate an optimum activity at 50°C that was
10°C higher than AlyQBC and AlyQC. Although the alginate lyase activity was on the lower range compared to other reported alginate lyases, AlyQ protein had a higher efficiency compared to both AlyQBC and AlyQC. This is the first report that showed
CBM16 could increase the optimum temperature and increase the catalytic efficiency of alginate lyase. However, due to the nature of AlyA that is prone to forming oligomer proteins, further optimization needed to be done in order to study the functional and structural characteristics of this protein. To date, the full-length protein (AlyQ) and the truncated protein species (AlyQA and AlyQC) are in the progress of crystallization. By obtaining the structure data of AlyQ in the near future, we could substantially decipher the relationship between the CBM16, CBM32 and
PL-7 alginate lyase altogether.
67 REFERENCES
Abbott, D. W., Hrynuik, S., & Boraston, A. B. (2007). Identification and characterization of a novel periplasmic polygalacturonic acid binding protein from Yersinia enterolitica. Journal of molecular biology, 367(4), 1023-1033.
Adams, P. D., Afonine, P. V., Bunkóczi, G., Chen, V. B., Davis, I. W., Echols, N., ... & McCoy, A. J. (2010). PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D: Biological Crystallography, 66(2), 213-221.
Badur, A. H., Jagtap, S. S., Yalamanchili, G., Lee, J. K., Zhao, H., & Rao, C. V. (2015). Alginate lyases from alginate-degrading Vibrio splendidus 12B01 are endolytic. Applied and environmental microbiology, 81(5), 1865-1873.
Bae, B., Ohene-Adjei, S., Kocherginskaya, S., Mackie, R. I., Spies, M. A., Cann, I. K., & Nair, S. K. (2008). Molecular basis for the selectivity and specificity of ligand recognition by the family 16 carbohydrate-binding modules from Thermoanaerobacterium polysaccharolyticum ManA. Journal of Biological Chemistry, 283(18), 12415-12425.
Bischoff, K. M., Shi, L., & Kennelly, P. J. (1998). The detection of enzyme activity following sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Analytical biochemistry, 260(1), 1-17.
Boraston, A. B., Bolam, D. N., Gilbert, H. J., & Davies, G. J. (2004). Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochemical Journal, 382(3), 769-781.
Boraston, A. B., Ficko-Blean, E., & Healey, M. (2007). Carbohydrate recognition by a large sialidase toxin from Clostridium perfringens. Biochemistry, 46(40), 11352-11360.
Boraston, A. B., McLean, B. W., Kormos, J. M., Alam, M., Gilkes, N. R., Haynes, C. A., ... & Warren, R. A. J. (1999). Carbohydrate-binding modules: diversity of structure and function. SPECIAL PUBLICATION-ROYAL SOCIETY OF CHEMISTRY, 246(1), 202-211.
Cañibano-Hernández, A., Saenz del Burgo, L., Espona-Noguera, A., Orive, G., Hernandez, R. M., Ciriza, J., & Pedraz, J. L. (2017). Alginate microcapsules incorporating hyaluronic acid recreate closer in vivo environment for mesenchymal stem cells. Molecular Pharmaceutics.
Cantarel, B. L., Coutinho, P. M., Rancurel, C., Bernard, T., Lombard, V., & Henrissat,
68 B. (2009). The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic acids research, 37(suppl 1), D233-D238.
Cao, L., Xie, L., Xue, X., Tan, H., Liu, Y., & Zhou, S. (2007). Purification and characterization of alginate lyase from Streptomyces species strain A5 isolated from banana rhizosphere. Journal of agricultural and food chemistry, 55(13), 5113-5117.
Cotton, L. A., Graham, R. J., & Lee, R. J. (2009). The role of alginate in P. aeruginosa PAO1 biofilm structural resistance to gentamicin and ciprofloxacin. J. Exp. Microbiol. Immunol, 13, 58-62.
Dessau, M. A., & Modis, Y. (2011). Protein crystallization for X-ray crystallography. Journal of visualized experiments: JoVE, (47).
Doi, R. H., & Kosugi, A. (2004). Cellulosomes: plant-cell-wall-degrading enzyme complexes. Nature Reviews Microbiology, 2(7), 541-551.
Dong, S., Wei, T. D., Chen, X. L., Li, C. Y., Wang, P., Xie, B. B., ... & Zhang, Y. Z. (2014). Molecular insight into the role of the N-terminal extension in the maturation, substrate recognition, and catalysis of a bacterial alginate lyase from polysaccharide lyase family 18. Journal of Biological Chemistry, 289(43), 29558-29569.
Dou, W., Wei, D., Li, H., Li, H., Rahman, M. M., Shi, J., ... & Ma, Y. (2013). Purification and characterisation of a bifunctional alginate lyase from novel Isoptericola halotolerans CGMCC 5336. Carbohydrate polymers, 98(2), 1476-1482.
Duan, C. J., Feng, Y. L., Cao, Q. L., Huang, M. Y., & Feng, J. X. (2016). Identification of a novel family of carbohydrate-binding modules with broad ligand specificity. Scientific reports, 6.
Duan, G., Han, F., & Yu, W. (2009). Cloning, sequence analysis, and expression of gene alyPI encoding an alginate lyase from marine bacterium Pseudoalteromonas sp. CY24. Canadian journal of microbiology, 55(9), 1113-1118.
Dutta, S., & Wu, K. C. W. (2014). Enzymatic breakdown of biomass: enzyme active sites, immobilization, and biofuel production. Green Chemistry, 16(11), 4615-4626.
Emsley, P., Lohkamp, B., Scott, W. G., & Cowtan, K. (2010). Features and
69 development of Coot. Acta Crystallographica Section D: Biological Crystallography, 66(4), 486-501.
Farrell, E. K., & Tipton, P. A. (2012). Functional characterization of AlgL, an alginate lyase from Pseudomonas aeruginosa. Biochemistry, 51(51), 10259.
Ficko-Blean, E., & Boraston, A. B. (2009). N-acetylglucosamine recognition by a family 32 carbohydrate-binding module from Clostridium perfringens NagH. Journal of molecular biology, 390(2), 208-220.
Ficko-Blean, E., Stuart, C. P., Suits, M. D., Cid, M., Tessier, M., Woods, R. J., & Boraston, A. B. (2012). Carbohydrate recognition by an architecturally complex α-N-acetylglucosaminidase from Clostridium perfringens. PLoS One, 7(3), e33524.
Fu, X. T., Lin, H., & Kim, S. M. (2007). Purification and characterization of a Na+/K+ dependent alginate lyase from turban shell gut Vibrio sp. YKW-34. Enzyme and Microbial Technology, 41(6), 828-834.
Fujimoto, Z. (2013). Structure and function of carbohydrate-binding module families 13 and 42 of glycoside hydrolases, comprising a β-trefoil fold. Bioscience, biotechnology, and biochemistry, 77(7), 1363-1371.
Furusawa, G., Lau, N. S., Suganthi, A., & Amirul, A. A. A. (2017). Agarolytic bacterium Persicobacter sp. CCB‐ QB2 exhibited a diauxic growth involving galactose utilization pathway. MicrobiologyOpen, 6(1). Gacesa, P. (1987). Alginate-modifying enzymes: a proposed unified mechanism of action for the lyases and epimerases. FEBS letters, 212(2), 199-202.
Gacesa, P. (1992). Enzymic degradation of alginates. International Journal of Biochemistry, 24(4), 545-552.
Gilbert, H. J. (2010). The biochemistry and structural biology of plant cell wall deconstruction. Plant physiology, 153(2), 444-455.
Gilbert, H. J., Knox, J. P., & Boraston, A. B. (2013). Advances in understanding the molecular basis of plant cell wall polysaccharide recognition by carbohydrate-binding modules. Current Opinion in Structural Biology, 23(5), 669-677.
Gilkes, N. R., Warren, R., Miller, R. C., & Kilburn, D. G. (1988). Precise excision of the cellulose binding domains from two Cellulomonas fimi cellulases by a homologous protease and the effect on catalysis. Journal of Biological Chemistry, 263(21), 10401-10407.
70
Grondin, J. M., Chitayat, S., Ficko-Blean, E., Houliston, S., Arrowsmith, C. H., Boraston, A. B., & Smith, S. P. (2014). An unusual mode of galactose recognition by a family 32 carbohydrate-binding module. Journal of molecular biology, 426(4), 869-880.
Haug, A., Larsen, B., & Smidsrod, O. (1967). Studies on the sequence of uronic acid residues in alginic acid. Acta Chem Scand, 21, 691-704.
Haynes, C. A., Tomme, P., & Kilburn, D. G. (2000). U.S. Patent No. 6,048,715. Washington, DC: U.S. Patent and Trademark Office.
Hien, N. Q., Nagasawa, N., Tham, L. X., Yoshii, F., Dang, V. H., Mitomo, H., ... & Kume, T. (2000). Growth-promotion of plants with depolymerized alginates by irradiation. Radiation Physics and Chemistry, 59(1), 97-101.
Holm, L., & Rosenström, P. (2010). Dali server: conservation mapping in 3D. Nucleic acids research, gkq366.
Hu, X., Jiang, X., Hwang, H., Liu, S., & Guan, H. (2004). Promotive effects of alginate-derived oligosaccharide on maize seed germination. Journal of Applied Phycology, 16(1), 73-76.
Hutcheson, S. W., Zhang, H., & Suvorov, M. (2011). Carbohydrase systems of Saccharophagus degradans degrading marine complex polysaccharides. Marine drugs, 9(4), 645-665.
Inoue, A., Takadono, K., Nishiyama, R., Tajima, K., Kobayashi, T., & Ojima, T. (2014). Characterization of an alginate lyase, FlAlyA, from Flavobacterium sp. strain UMI-01 and its expression in Escherichia coli. Marine drugs, 12(8), 4693-4712.
Ito, N., Phillips, S. E., Stevens, C., Ogel, Z. B., McPherson, M. J., Keen, J. N., ... & Knowles, P. F. (1991). Novel thioether bond revealed by a 1.7 Å crystal structure of galactose oxidase. Nature, 350(6313), 87-90.
Iwasaki, K. I., & Matsubara, Y. (2000). Purification of alginate oligosaccharides with root growth-promoting activity toward lettuce. Bioscience, biotechnology, and biochemistry, 64(5), 1067-1070.
Iwamoto, M., Kurachi, M., Nakashima, T., Kim, D., Yamaguchi, K., Oda, T., ... & Muramatsu, T. (2005). Structure–activity relationship of alginate oligosaccharides in the induction of cytokine production from RAW264. 7 cells. FEBS letters, 579(20), 4423-4429.
71 Jagtap, S. S., Hehemann, J. H., Polz, M. F., Lee, J. K., & Zhao, H. (2014). Comparative biochemical characterization of three exolytic oligoalginate lyases from Vibrio splendidus reveals complementary substrate scope, temperature, and pH adaptations. Applied and environmental microbiology, 80(14), 4207-4214.
Kabsh, W. 2010. XDS. Acta Crystallographica Section D, 66, 125-132.
Kaus, K., Lary, J. W., Cole, J. L., & Olson, R. (2014). Glycan specificity of the Vibrio vulnificus hemolysin lectin outlines evolutionary history of membrane targeting by a toxin family. Journal of molecular biology, 426(15), 2800-2812.
Kim, D., Baik, K. S., Hwang, Y. S., Choi, J. S., Kwon, J., & Seong, C. N. (2013). Vibriohemicentroti sp. nov., an alginate lyase-producing bacterium, isolated from the gut microflora of sea urchin (Hemicentrotus pulcherrimus). International journal of systematic and evolutionary microbiology, 63(10), 3697-3703.
Kim, H. S., Lee, C. G., & Lee, E. Y. (2011). Alginate lyase: structure, property, and application. Biotechnology and Bioprocess Engineering, 16(5), 843-851.
Kinoshita, E., Kinoshita-Kikuta, E., & Koike, T. (2015). The Cutting Edge of Affinity Electrophoresis Technology. Proteomes, 3(1), 42-55.
Kiyohara, M., Sakaguchi, K., Yamaguchi, K., Araki, T., & Ito, M. (2009). Characterization and Application of Carbohydrate-binding Modules of β-1, 3-xylanase XYL4. Journal of biochemistry, 146(5), 633-641.
Lee, K. Y., & Mooney, D. J. (2012). Alginate: properties and biomedical applications. Progress in polymer science, 37(1), 106-126.
Li, J. W., Dong, S., Song, J., Li, C. B., Chen, X. L., Xie, B. B., & Zhang, Y. Z. (2011). Purification and characterization of a bifunctional alginate lyase from Pseudoalteromonas sp. SM0524. Marine drugs, 9(1), 109-123.
Li, S., Wang, L., Hao, J., Xing, M., Sun, J., & Sun, M. (2016). Purification and Characterization of a New Alginate Lyase from Marine Bacterium Vibrio sp. SY08. Marine drugs, 15(1), 1.
Li, S., Yang, X., Bao, M., Wu, Y., Yu, W., & Han, F. (2015). Family 13 carbohydrate-binding module of alginate lyase from Agarivorans sp. L11 enhances its catalytic efficiency and thermostability, and alters its substrate preference and product distribution. FEMS microbiology letters, 362(10), fnv054.
72
MacDonald, L. C., Weiler, E. B., & Berger, B. W. (2016). Engineering broad-spectrum digestion of polyuronides from an exolytic polysaccharide lyase. Biotechnology for biofuels, 9(1), 43.
McCartney, L., Gilbert, H. J., Bolam, D. N., Boraston, A. B., & Knox, J. P. (2004). Glycoside hydrolase carbohydrate-binding modules as molecular probes for the analysis of plant cell wall polymers. Analytical biochemistry, 326(1), 49-54.
Mingardon, F., Bagert, J. D., Maisonnier, C., Trudeau, D. L., & Arnold, F. H. (2011). Comparison of family 9 cellulases from mesophilic and thermophilic bacteria. Applied and environmental microbiology, 77(4), 1436-1442.
Mizutani, K., Sakka, M., Kimura, T., & Sakka, K. (2014). Essential role of a family‐ 32 carbohydrate‐ binding module in substrate recognition by Clostridium thermocellum mannanase CtMan5A. FEBS letters, 588(9), 1726-1730.
Moore, B. M., & Flurkey, W. H. (1990). Sodium dodecyl sulfate activation of a plant polyphenoloxidase. Effect of sodium dodecyl sulfate on enzymatic and physical characteristics of purified broad bean polyphenoloxidase. Journal of Biological Chemistry, 265(9), 4982-4988.
Morris, E. R., Rees, D. A., & Thom, D. (1980). Characterisation of alginate composition and block-structure by circular dichroism. Carbohydrate Research, 81(2), 305-314.
Muramatsu, Y., Takahashi, M., Kaneyasu, M., Iino, T., Suzuki, K. I., & Nakagawa, Y. (2010). Persicobacter psychrovividus sp. nov., isolated from shellfish, and emended descriptions of the genus Persicobacter and Persicobacter diffluens. International journal of systematic and evolutionary microbiology, 60(8), 1735-1739.
Nakagawa, A., Ozaki, T., Chubachi, K., Hosoyama, T., Okubo, T., Iyobe, S., & Suzuki, T. (1998). An effective method for isolating alginate lyase‐ producing Bacillus sp. ATB‐ 1015 strain and purification and characterization of the lyase. Journal of applied microbiology, 84(3), 328-335.
Nardi, C. F., Villarreal, N. M., Rossi, F. R., Martínez, S., Martínez, G. A., & Civello, P. M. (2015). Overexpression of the carbohydrate binding module of strawberry expansin2 in Arabidopsis thaliana modifies plant growth and cell wall metabolism. Plant molecular biology, 88(1-2), 101-117.
NCBI, R. C. (2014). Database resources of the National Center for Biotechnology
73 Information. Nucleic acids research, 42(Database issue), D7.
Notenboom, V., Boraston, A. B., Williams, S. J., Kilburn, D. G., & Rose, D. R. (2002). High-resolution crystal structures of the lectin-like xylan binding domain from Streptomyces lividans xylanase 10A with bound substrates reveal a novel mode of xylan binding. Biochemistry, 41(13), 4246-4254.
Ochiai, A., Yamasaki, M., Mikami, B., Hashimoto, W., & Murata, K. (2010). Crystal structure of exotype alginate lyase Atu3025 from Agrobacterium tumefaciens. Journal of Biological Chemistry, 285(32), 24519-24528.
Ogura, K., Yamasaki, M., Mikami, B., Hashimoto, W., & Murata, K. (2008). Substrate recognition by family 7 alginate lyase from Sphingomonas sp. A1. Journal of molecular biology, 380(2), 373-385.
Osawa, T., Matsubara, Y., Muramatsu, T., Kimura, M., & Kakuta, Y. (2005). Crystal structure of the alginate (poly α-L-guluronate) lyase from Corynebacterium sp. at 1.2 Å resolution. Journal of molecular biology, 345(5), 1111-1118.
Park, D., Jagtap, S., & Nair, S. K. (2014). Structure of a PL17 family alginate lyase demonstrates functional similarities among exotype depolymerases. Journal of Biological Chemistry, 289(12), 8645-8655.
Qin, H. M., Miyakawa, T., Inoue, A., Nishiyama, R., Nakamura, A., Asano, A., ... & Tanokura, M. (2017). Structure and Polymannuronate Specificity of a Eukaryotic Member of Polysaccharide Lyase Family 14. Journal of Biological Chemistry, 292(6), 2182-2190.
Qualhato, T. F., Lopes, F. A. C., Steindorff, A. S., Brandao, R. S., Jesuino, R. S. A., & Ulhoa, C. J. (2013). Mycoparasitism studies of Trichoderma species against three phytopathogenic fungi: evaluation of antagonism and hydrolytic enzyme production. Biotechnology letters, 35(9), 1461-1468.
Rodriguez, B., Kavoosi, M., Koska, J., Creagh, A. L., Kilburn, D. G., & Haynes, C. A. (2004). Inexpensive and generic affinity purification of recombinant proteins using a family 2a CBM fusion tag. Biotechnology progress, 20(5), 1479-1489.
Rupp, B. (2009). Biomolecular crystallography: principles, practice, and application to structural biology. Garland Science.
Schrödinger, L. (2016). The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC
Sim, S. J., Baik, K. S., Park, S. C., Choe, H. N., Seong, C. N., Shin, T. S., ... & Kim,
74 D. (2012). Characterization of alginate lyase gene using a metagenomic library constructed from the gut microflora of abalone. Journal of industrial microbiology & biotechnology, 39(4), 585-593.
Shimokawa, T., Yoshida, S., Takeuchi, T., Murata, K., Kobayashi, H., & Kusakabe, I. (1997). Purification and characterization of extracellular poly (β-D-1, 4-mannuronide) lyase from Dendryphiella salina IFO 32139. Bioscience, biotechnology, and biochemistry, 61(4), 636-640.
Shoseyov, O., Shpiegl, I., Goldstein, M. A., & Doi, R. H. (1999). Methods of detection using a cellulose binding domain fusion product (No. US 5856201). University of California.
Shoseyov, O., Shani, Z., & Levy, I. (2006). Carbohydrate binding modules: biochemical properties and novel applications. Microbiology and Molecular Biology Reviews, 70(2), 283-295.
Sosnik, A. (2014). Alginate particles as platform for drug delivery by the oral route: state-of-the-art. ISRN pharmaceutics, 2014.
Su, X., Agarwal, V., Dodd, D., Bae, B., Mackie, R. I., Nair, S. K., & Cann, I. K. (2010). Mutational insights into the roles of amino acid residues in ligand binding for two closely related family 16 carbohydrate binding modules. Journal of Biological Chemistry, 285(45), 34665-34676.
Swift, S. M., Hudgens, J. W., Heselpoth, R. D., Bales, P. M., & Nelson, D. C. (2014). Characterization of AlgMsp, an alginate lyase from Microbulbifer sp. 6532A. PloS one, 9(11), e112939
Thomas, F., Lundqvist, L. C., Jam, M., Jeudy, A., Barbeyron, T., Sandström, C., ... & Czjzek, M. (2013). Comparative characterization of two marine alginate lyases from Zobellia galactanivorans reveals distinct modes of action and exquisite adaptation to their natural substrate. Journal of Biological Chemistry, 288(32), 23021-23037.
Tomme, P., Tilbeurgh, H., Pettersson, G., Damme, J., Vandekerckhove, J., Knowles, J., ... & Claeyssens, M. (1988). Studies of the cellulolytic system of Trichoderma reesei QM 9414. European Journal of Biochemistry, 170(3), 575-581.
Uchimura, K., Miyazaki, M., Nogi, Y., Kobayashi, T., & Horikoshi, K. (2010). Cloning and sequencing of alginate lyase genes from deep-sea strains of Vibrio and Agarivorans and characterization of a new Vibrio enzyme. Marine biotechnology, 12(5), 526-533.
75
Vagin, A. A. (1989). New translation and packing functions. Newsletter on protein crystallography., Daresbury Laboratory, 24.
Wang, A. A., Mulchandani, A., & Chen, W. (2002). Specific adhesion to cellulose and hydrolysis of organophosphate nerve agents by a genetically engineered Escherichia coli strain with a surface-expressed cellulose-binding domain and organophosphorus hydrolase. Applied and environmental microbiology, 68(4), 1684-1689.
Wargacki, A. J., Leonard, E., Win, M. N., Regitsky, D. D., Santos, C. N. S., Kim, P. B., ... & Lakshmanaswamy, A. (2012). An engineered microbial platform for direct biofuel production from brown macroalgae. Science, 335(6066), 308-313.
Xu, F., Dong, F., Wang, P., Cao, H. Y., Li, C. Y., Li, P. Y., ... & Chen, X. L. (2017). Novel Molecular Insights into the Catalytic Mechanism of Marine Bacterial Alginate Lyase AlyGC from Polysaccharide Lyase Family 6. Journal of Biological Chemistry, 292(11), 4457-4468.
Wong, T. Y., Preston, L. A., & Schiller, N. L. (2000). Alginate lyase: review of major sources and enzyme characteristics, structure-function analysis, biological roles, and applications. Annual Reviews in Microbiology, 54(1), 289-340.
Yamasaki, M., Moriwaki, S., Miyake, O., Hashimoto, W., Murata, K., & Mikami, B. (2004). Structure and Function of a Hypothetical Pseudomonas aeruginosa Protein PA1167 Classified into Family PL-7: a novel alginate lyase with a β-sandwich fold. Journal of Biological Chemistry, 279(30), 31863-31872.
Yamasaki, M., Ogura, K., Hashimoto, W., Mikami, B., & Murata, K. (2005). A structural basis for depolymerization of alginate by polysaccharide lyase family-7. Journal of molecular biology, 352(1), 11-21.
Yonemoto, Y., Tanaka, H., Yamashita, T., Kitabatake, N., Ishida, Y., Kimura, A., & Murata, K. (1993). Promotion of germination and shoot elongation of some plants by alginate oligomers prepared with bacterial alginate lyase. Journal of fermentation and bioengineering, 75(1), 68-70.
Yoon, H. J., Hashimoto, W., Miyake, O., Murata, K., & Mikami, B. (2001). Crystal structure of alginate lyase A1-III complexed with trisaccharide product at 2.0 Å resolution. Journal of molecular biology, 307(1), 9-16.
Zhu, B., Tan, H., Qin, Y., Xu, Q., Du, Y., & Yin, H. (2015). Characterization of a new endo-type alginate lyase from Vibrio sp. W13. International journal of
76 biological macromolecules, 75, 330-337.
Zhu, B., & Yin, H. (2015). Alginate lyase: Review of major sources and classification, properties, structure-function analysis and applications. Bioengineered, 6(3), 125-131.
77 APPENDICES
Appendix 1: The AlyQ gene sequence of Persicobacter sp. CCB-QB2 with added start codon and 6His tag (1656 bp)
ATGTGTAGCAAAAATGAAACACTTAATGAATTGAGTGCACTTTCCcCCAGC AACATCACTGCTTTGGGGAATGAGATCAGCCTGAACAACCCGGGTTTTGA AGCTGATTTTGATTCCTGGACGGATATCGATCCTTCTGCCATTTCCGGAGAT GCCCGCAGCGGGTCTAAATCCGCCAAAATCACCGGAAGCGCAGGCAAAG TAACACAAACGGTATCCCTGAACCAAAACACCGACTATCAGCTTTCAGCC TGGATTTTAGGGCAGGGAAAAATCGGGGTGACCAATGGCAATGATACCTT CGAGACCACTGCCGCTAGTGATGACTGGACCCAATACAAGGTAGATTTCA ATTCCGGGAACAGCACGAGCATAACCATTTATGCTGCCTATGGCGGTGGAG AGGGGCGCTTCGATGATTTCAGCCTTTTTGAGGGAGCTGATTCCTCCCCTC AGGACCCCTCGGTCACCACCACCGTTCAATATGATATTGTAGCGGTCACCG CTAGTGCTCATGATGGCAATTTACCTGAAAATACCATTGACGGTAACCTCT CCACCCGATGGTCCGCCAATGGCTCCGGACAATACATTACCTTTGATTTGG GCAGCGCGAAAACCGTCAATCAGGTAAAAGCAGCCTGGTACAATGGCGAT TCCAGAACTTCCGGCTTCTCCATTAGCCTGGGAAGTGATCCCGCCAGCCTT ACGGAAGTCTATAGCGGTACCAGCAGTGGACAAACCAATGCACTGGAGTC CTATTCCTTTACCGCTACTACTGCGCGCTACATTCGCATCACGGGTTTTGGC AACTCCAGCAACACTTGGAACAGTATTACCGAAGTAGCGATTTTTCATGCC GGGGAGGAAGGGGATGGAAATGAAGAAGCACCGGGAACCGCTCAAATTC CCTCGGATTTAATGAGTAACTGTAATCAGTGGAAAATCACTTATCCGGACG GATCTGAAGACAAAACGCTTTGCGGGGAAGCCAATAATGAGTACTGGTTT GTGAATGAGGACAAAAATGCCATGGTTTTCAGAGCCCCCATCAGAAGTAA TAACGGCACCACCCCAAATTCCTCCTATGTTCGATCCGAACTCAGGGAAA GAAAAGAAGATGGAAGCGCCGACATCTACTGGACCACAACCGGAACCCA TGTGGTCTATGTAAAACAGGCGATTACGCAATTGCCCATCGTAAAAGACCA TCTGGTGGCCACACAAATCCATGGAGATAAATCCGCAGGCATTGATGATGC CATGGTCATGAGACTAGAAGGCAATCACCTCTTTGCCAGTTTCAATGGTGG AAAATTAAGAAGTGATCTGACCATCAAAACCAATTACAACTTAGGTACCGT GCACGAAGTAATATTTGAAGTTATCAATGGTAAGCACTATTTATATTATAGT GAAGATGGAAAACTGGCAGAGGCTTATGCCAATGGTTCCGCAGCGGCTTA TCTGATCAAAGACGGAGGAAATGATTATGTGATGGACTTGAATTATGACCA ATCCTATTTCAAAATTGGCAACTATACCCAAAGTAATTCCGAAAAAGAAGG CAGCTATACCGGGGATCCGAATAATTACGGGGAAGTAGTCGTTTACGATTA TTTTGTCTCCCATCAACACCATCACCATCACCATTAG
TAG-Stop codon
Appendix 2: The AlyQBC gene sequence of Persicobacter sp. CCB-QB2 with added start codon and 6His tag (1179bp)
ATGCAATATGATATTGTAGCGGTCACCGCTAGTGCTCATGATGGCAATTTAC CTGAAAATACCATTGACGGTAACCTCTCCACCCGATGGTCCGCCAATGGCT CCGGACAATACATTACCTTTGATTTGGGCAGCGCGAAAACCGTCAATCAG GTAAAAGCAGCCTGGTACAATGGCGATTCCAGAACTTCCGGCTTCTCCATT AGCCTGGGAAGTGATCCCGCCAGCCTTACGGAAGTCTATAGCGGTACCAG CAGTGGACAAACCAATGCACTGGAGTCCTATTCCTTTACCGCTACTACTGC GCGCTACATTCGCATCACGGGTTTTGGCAACTCCAGCAACACTTGGAACA GTATTACCGAAGTAGCGATTTTTCATGCCGGGGAGGAAGGGGATGGAAAT GAAGAAGCACCGGGAACCGCTCAAATTCCCTCGGATTTAATGAGTAACTG TAATCAGTGGAAAATCACTTATCCGGACGGATCTGAAGACAAAACGCTTT GCGGGGAAGCCAATAATGAGTACTGGTTTGTGAATGAGGACAAAAATGCC ATGGTTTTCAGAGCCCCCATCAGAAGTAATAACGGCACCACCCCAAATTCC TCCTATGTTCGATCCGAACTCAGGGAAAGAAAAGAAGATGGAAGCGCCGA CATCTACTGGACCACAACCGGAACCCATGTGGTCTATGTAAAACAGGCGA TTACGCAATTGCCCATCGTAAAAGACCATCTGGTGGCCACACAAATCCATG GAGATAAATCCGCAGGCATTGATGATGCCATGGTCATGAGACTAGAAGGC AATCACCTCTTTGCCAGTTTCAATGGTGGAAAATTAAGAAGTGATCTGACC ATCAAAACCAATTACAACTTAGGTACCGTGCACGAAGTAATATTTGAAGTT ATCAATGGTAAGCACTATTTATATTATAGTGAAGATGGAAAACTGGCAGAG GCTTATGCCAATGGTTCCGCAGCGGCTTATCTGATCAAAGACGGAGGAAAT GATTATGTGATGGACTTGAATTATGACCAATCCTATTTCAAAATTGGCAACT ATACCCAAAGTAATTCCGAAAAAGAAGGCAGCTATACCGGGGATCCGAAT AATTACGGGGAAGTAGTCGTTTACGATTATTTTGTCTCCCATCAACACCATC ACCATCACCATTAG
Appendix 3: The AlyQA gene sequence of Persicobacter sp. CCB-QB2 with added start codon and 6His tag (402 bp)
ATGTGTAGCAAAAATGAAACACTTAATGAATTGAGTGCACTTTCCcCCAGC AACATCACTGCTTTGGGGAATGAGATCAGCCTGAACAACCCGGGTTTTGA AGCTGATTTTGATTCCTGGACGGATATCGATCCTTCTGCCATTTCCGGAGAT GCCCGCAGCGGGTCTAAATCCGCCAAAATCACCGGAAGCGCAGGCAAAG TAACACAAACGGTATCCCTGAACCAAAACACCGACTATCAGCTTTCAGCC TGGATTTTAGGGCAGGGAAAAATCGGGGTGACCAATGGCAATGATACCTT CGAGACCACTGCCGCTAGTGATGACTGGACCCAATACAAGGTAGATTTCA ATTCCGGGAACAGCACGAGCATAACCATTCACCATCACCATCACCATTAG
Appendix 4: The AlyQB gene sequence of Persicobacter sp. CCB-QB2 with added start codon and 6His tag (432bp)
ATGCAATATGATATTGTAGCGGTCACCGCTAGTGCTCATGATGGCAATTTAC CTGAAAATACCATTGACGGTAACCTCTCCACCCGATGGTCCGCCAATGGCT CCGGACAATACATTACCTTTGATTTGGGCAGCGCGAAAACCGTCAATCAG GTAAAAGCAGCCTGGTACAATGGCGATTCCAGAACTTCCGGCTTCTCCATT AGCCTGGGAAGTGATCCCGCCAGCCTTACGGAAGTCTATAGCGGTACCAG CAGTGGACAAACCAATGCACTGGAGTCCTATTCCTTTACCGCTACTACTGC GCGCTACATTCGCATCACGGGTTTTGGCAACTCCAGCAACACTTGGAACA GTATTACCGAAGTAGCGATTTTTCATGCCGGGGAGGAAGGGGATGGAAAT GAAGAACACCACCACCACCACCACTAG
Appendix 5: The AlyQC gene sequence of Persicobacter sp. CCB-QB2 with added start codon and 6His tag (756bp)
ATGCAAATTCCCTCGGATTTAATGAGTAACTGTAATCAGTGGAAAATCACT TATCCGGACGGATCTGAAGACAAAACGCTTTGCGGGGAAGCCAATAATGA GTACTGGTTTGTGAATGAGGACAAAAATGCCATGGTTTTCAGAGCCCCCAT CAGAAGTAATAACGGCACCACCCCAAATTCCTCCTATGTTCGATCCGAACT CAGGGAAAGAAAAGAAGATGGAAGCGCCGACATCTACTGGACCACAACC GGAACCCATGTGGTCTATGTAAAACAGGCGATTACGCAATTGCCCATCGTA AAAGACCATCTGGTGGCCACACAAATCCATGGAGATAAATCCGCAGGCAT TGATGATGCCATGGTCATGAGACTAGAAGGCAATCACCTCTTTGCCAGTTT CAATGGTGGAAAATTAAGAAGTGATCTGACCATCAAAACCAATTACAACTT AGGTACCGTGCACGAAGTAATATTTGAAGTTATCAATGGTAAGCACTATTTA TATTATAGTGAAGATGGAAAACTGGCAGAGGCTTATGCCAATGGTTCCGCA GCGGCTTATCTGATCAAAGACGGAGGAAATGATTATGTGATGGACTTGAAT TATGACCAATCCTATTTCAAAATTGGCAACTATACCCAAAGTAATTCCGAA AAAGAAGGCAGCTATACCGGGGATCCGAATAATTACGGGGAAGTAGTCGT TTACGATTATTTTGTCTCCCATCAACACCATCACCATCACCATTAG
Appendix 6: Vector map of pColdIII and gene insertion site between NdeI and HindIII
Appendix 7: Vector map of pET21A and gene insertion site between NdeI and HindIII
Appendix 8: BSA standard curve for Bradford protein assay.
Figure: The BSA standard curve for Bradford protein assay
Appendix 7:
Summary of the results of ANOVA test:
1. The substrate preference of AlyQ
Source of Variation SS df MS F P-value F crit Between Groups 10706.86 3 3568.953 616.0196 8.48E-10 4.066181 Within Groups 46.34857 8 5.793571
Total 10753.21 11
2. The effects of adding SDS
Source of Variation SS df MS F P-value F crit Between Groups 26505.91 5 5301.183 116.2202 9.8E-10 3.105875 Within Groups 547.359 12 45.61325
Total 27053.27 17
3. The effect of adding EDTA
Source of Variation SS df MS F P-value F crit Between Groups 0.020695 2 0.010348 771.9455 5.8E-08 5.143253 Within Groups 8.04E-05 6 1.34E-05
Total 0.020775 8
4. The effect of different pH
a. AlyQ
Source of Variation SS df MS F P-value F crit Between Groups 24629.03 5 4925.806 746.2821 1.58E-14 3.105875 Within Groups 79.20553 12 6.600461
Total 24708.23 17
b. AlyQBC
Source of Variation SS df MS F P-value F crit Between Groups 20279.63 4 5069.908 290.4847 2.69E-10 3.47805 Within Groups 174.5327 10 17.45327
Total 20454.16 14
AlyQC
Source of Variation SS df MS F P-value F crit Between Groups 26183.46 5 5236.693 3130.063 2.96E-18 3.105875 Within Groups 20.07637 12 1.673031
Total 26203.54 17
5. The effects of different temperature
a. AlyQ
Source of Variation SS df MS F P-value F crit Between Groups 20731.28 6 3455.214 163.0455 3.91E-12 2.847726 Within Groups 296.6841 14 21.19172
Total 21027.97 20
b. AlyQBC
Source of Variation SS df MS F P-value F crit Between Groups 22664 5 4532.8 853.809 7.09E-15 3.105875 Within Groups 63.70698 12 5.308915
Total 22727.71 17
c. AlyQC
Source of Variation SS df MS F P-value F crit Between Groups 18829.44 5 3765.887 549.3177 9.88E-14 3.105875 Within Groups 82.26687 12 6.855573
Total 18911.7 17