Serrano Daniel Phd 2017.Pdf

Université de Sherbrooke

GIMAP5 influence la survie des cellules T naïves en participant à la régulation du calcium emmagasiné dans les organites

Par Daniel Serrano Programme d’immunologie

Thèse présentée à la Faculté de médecine et des sciences de la santé en vue de l’obtention du grade de Philosophiae Doctor (Ph.D.) en immunologie

Sherbrooke, Québec, Canada Mars 2017

Membres du jury d’évaluation

Sheela Ramanathan, Programme d’immunologie, Université de Sherbrooke Christine Lavoie, Département de pharmacologie, Université de Sherbrooke Patrick McDonald, Programme d’immunologie, Université de Sherbrooke Mercedes Rincon, Department of Immunobiology, University of Vermont

Live so that when your children think of fairness, caring, and integrity, they think of you.

H. Jackson Brown, Jr.

RÉSUMÉ GIMAP5 influence la survie des cellules T naïves en participant à la régulation du calcium emmagasiné dans les organites Par Daniel Serrano Programme d’immunologie

Thèse présentée à la Faculté de médecine et des sciences de la santé en vue de l’obtention du diplôme de Philosophiae Doctor (Ph.D.) en Immunologie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4

La survie des cellules T naïves est essentielle au bon fonctionnement du système immunitaire à long terme. Les rats BBDP (Bio-breeding Diabetes prone) sont caractérisés par une haute prédisposition au développement du diabète ainsi que par une diminution significative du nombre de cellules T naïves. Ces rats comportent une mutation de type décalage de lecture dans le gène codant pour «GTPase Immunity-Associated Protein 5» (Gimap5) ce qui entraine l’apoptose des lymphocytes T. Le mécanisme par lequel la déficience de la protéine GIMAP5 conduit les cellules T à la mort est actuellement méconnu. GIMAP5 a également été associée à différentes maladies auto-immunes, ce qui suggère son influence dans l'homéostasie des lymphocytes T. Des résultats antérieurs de notre groupe de recherche ont montré que l'absence de GIMAP5 entraîne une diminution du flux de Ca2+ ainsi qu’une réduction de la capacité mitochondriale à emmagasiner du Ca2+ suite à la stimulation du TCR. Cependant, GIMAP5 n'est pas une protéine mitochondriale. Afin de mieux comprendre le rôle de GIMAP5 dans la biologie des cellules T, au cours de mes études doctorales, je me suis concentré sur la localisation cellulaire de la protéine ainsi que sur son rôle dans l'homéostasie du Ca2+. Comme modèle d’étude, j'ai établi des lignées cellulaires HEK293T stables pour l’expression de GIMAP5, ainsi que pour différents mutants et variantes de la protéine. Ceci m’a permis d’élucider l'importance du domaine transmembranaire (TM) pour la localisation et le rôle physiologique de GIMAP5 ainsi que la différence entre les deux variantes de cette protéine.

Mes résultats ont permis de montrer que l'expression de Gimap5 ne semble pas être nécessaire après l’activation des lymphocytes T. En parallèle, j'ai confirmé nos observations antérieures qui démontrent l’influence de GIMAP5 dans l'homéostasie du Ca2+ et sa colocalization avec les microtubules. En outre, j'ai montré que GIMAP5 se trouve dans des structures de type vésiculaire, particulièrement dans la membrane lysosomale où son domaine TM est essentiel à son bon fonctionnement et localisation. Mes résultats suggèrent que les mitochondries exhibent un défaut dans leur capacité à emmagasiner du Ca2+ au niveau basal, ainsi que suite à l’activation du TCR. Enfin, j'ai démontré pour la première fois, que l'influence de GIMAP5 sur le stockage de Ca2+ lysosomal peut avoir un impact sur la survie des lymphocytes T. D’après ces observations, une des fonctions probables de GIMAP5 serait d’empêcher la fermeture prématurée des canaux de relâche calcique. Finalement, GIMAP5 pourrait être engagé dans des mécanismes visant à prolonger et raffiner la signalisation du Ca2+ dans les cellules T. Bref, la régulation du Ca2+ lysosomal médié par GIMAP5 est essentielle à la survie de cellules T naïves. Mots Clés: GIMAP5, survie des cellules T, homéostasie du Ca2+, Ca2+ lysosomal, Ca2+ mitochondrial, RE, cytosquelette.

iii

SUMMARY GIMAP5 influences naïve T cell survival through organelle calcium storage regulation.

By Daniel Serrano Immunology Program

Thesis presented at the Faculty of medicine and health sciences for the obtention of Doctor Degree diploma Philosophiae Doctor (Ph.D.) in Immunology, Faculty of Medicine and health sciences, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4

Healthy and long-term survival of naïve T cells is essential for proper functioning of the immune system. In bio-breeding diabetes prone (BBDP) rats, there is a critical decrease in the number of naïve T cells. In these rats, a recessive frameshift mutation in the GTPase of Immune-Associated Protein 5 (Gimap5) gene induces lymphocytes to undergo spontaneous apoptosis. The death of T cells driven by a deficiency of the GIMAP5 is currently not fully understood. Interestingly, different autoimmune diseases have shown an association with perturbations in the Gimap5 gene, which further suggests its influence in basal lymphocyte homeostasis. Previous findings by our group have shown that the absence of GIMAP5 results in a decrease calcium flux following TCR stimulation and an impaired capacity of the mitochondria to buffer calcium entry. However, GIMAP5 is not a mitochondrial protein. During my Ph.D. studies, I focused on clarifying the cellular localization of GIMAP5 as well as its function in Ca2+ homeostasis in order to further understand its role in T cell biology. As a model, I established HEK293T cells stable for the expression of the different mutants and variants of the GIMAP5 protein. Where I uncovered the importance of the transmembrane domain (TM) for GIMAP5 localization and physiological role, as well as the differences between the two variants of GIMAP5.

The results obtained show that the expression of Gimap5 is no longer needed after T cells activation. Moreover, our previous observations were confirmed and expanded upon regarding GIMAP5’s influence on Ca2+ homeostasis and colocalization with the cytoskeleton. It was also shown that GIMAP5 localizes to vesicular-like structures, particularly to the lysosomal membrane, where its TM domain is critical for proper functioning and localization. My results suggest that the mitochondria might be impaired to uptake as well as retain Ca2+ at their full capacity in the absence of GIMAP5. Finally, I observed for the first time that GIMAP5’s influence on lysosomal Ca2+ storage could impact lymphocyte survival. These results suggest that GIMAP5 may work as a backup mechanism to prevent premature closure of Ca2+ channels and Ca2+ influx or as a mechanism to prolong and refine Ca2+ signaling in T cells.

Keywords: GIMAP5, Naïve T cell survival, Ca2+ homeostasis, Lysosomal Ca2+, Mitochondrial Ca2+, ER, Cytoskeleto

TABLE OF CONTENTS

Résumé ...... iii Summary ...... iv Table of contents ...... v List of figures ...... vii List of Tables ...... ix List of Abbreviations ...... x 1. Introduction ...... 1 1.1. Naïve T cell homeostasis ...... 2 1.1.1. Interleukin 7 in naïve T cell survival ...... 4 1.1.2. T cell receptor in naïve T cell survival ...... 7 1.1.3. Metabolic signals that regulate T cell survival ...... 10 1.2. Ca2+ homeostasis in T cell survival ...... 11 1.2.1. The endoplasmic reticulum as the main Ca2+ store ...... 12 1.2.2. The role of mitochondria in Ca2+ homeostasis ...... 14 1.2.3. Lysosomes as new players in Ca2+ regulation ...... 17 1.2.4. The Cytoskeleton network influences Ca2+ homeostasis via organelle movement regulation ...... 19 1.3. GIMAP family of proteins ...... 22 1.3.1. GIMAP5 ...... 27

2. Rationale and hypothesis ...... 35 2.1. Rationale ...... 35 2.2. Hypothesis ...... 36 2.2.1. Aims ...... 36

3. Materials And Methods ...... 37 3.1. Constructions and Cell lines ...... 37 3.2. Reagents ...... 38

3.3. Animals ...... 38 3.4. Isolation of T cell subsets ...... 39 3.5. Immunoprecipitation and western blot ...... 39 3.6. Quantitative PCR ...... 41 3.7. Confocal Microscopy ...... 41 3.8. Calcium measurements ...... 42 3.9. Statistical analysis ...... 42

4. Results ...... 43 4.1. GIMAP5 protein constructs ...... 43 4.2. T cells express predominantly the shorter variant of GIMAP5 ...... 44 4.3. GIMAP5 variants co-localize similarly with cytoskeletal elements ...... 45 4.4. GIMAP5v2, but not GIMAP5v1, regulates cellular Ca2+ ...... 51 4.5. GIMAP5 influences mitochondrial Ca2+ uptake ...... 52 4.6. GIMAP5v2 influence Mitochondrial Ca2+ content ...... 54 4.7. GPN-induced Ca2+ release is increased in the absence of GIMAP5v2 ...... 62 4.8. Nocodazole treatment increases the Ca2+ influx following GPN treatment ..... 65 4.9. Lysosomes accumulate Ca2+ following cross-linking of TCR ...... 66 4.10. GIMAP5 variants interact with each other ...... 67

5. Discussion ...... 69 5.1. Gimap5 expression and variants ...... 70 5.2. GIMAP5 protein localizes in different vesicle-like structures ...... 72 5.3. GIMAP5 as a mediator of organelle Ca2+ regulation ...... 73 5.4. GIMAP5 protein influences mitochondrial Ca2+ homeostasis ...... 74 5.5. The intermediary role of GIMAP5v1 ...... 78

Perspectives ...... 80 Acknowledgments ...... 81 References ...... 83 Annexes ...... 105 Construction of deletion mutants of GIMAP5 ...... 105

LIST OF FIGURES

Figure 1-1: T cell development...... 3 Figure 1-2: TCR and IL-7 signaling...... 6 Figure 1-3: ER, mitochondria and lysosome Ca2+ release and uptake channels...... 15 Figure 1-4: The cytoskeleton and the motor proteins...... 21 Figure 1-5: Phylogenetic tree of IAN/GIMAP proteins expression in Arabidopsis thaliana, Homo sapiens, Mus musculus and Rattus norvegicus...... 24 Figure 1-6: GIMAP5 secondary structure in rats, mice, and humans...... 29 Figure 4- 1: Cloning of GIMAP5 variants. …………………………………………………………………...44 Figure 4- 2: Gene expression of Gimap5 variants in rat T lymphocytes...... 45 Figure 4- 3: Co-localization of GIMAP5 variants with microtubules...... 46 Figure 4- 4: Co-localization of GIMAP5 variants with actin filaments...... 47 Figure 4- 5: GIMAP5v2ΔTM diffuse cellular localization...... 48 Figure 4- 6: Co-localization of GIMAP5 variants with kinesin...... 49 Figure 4- 7: Co-localization of GIMAP5 variants with dynein...... 50 Figure 4- 8: Absence of co-localization of GIMAP5 with myosin...... 50 Figure 4- 9: GIMAP5v2 expressing vesicles move along microtubules...... 51 Figure 4- 10: Full-length GIMAP5v2 regulates intracellular Ca2+ homeostasis...... 52 Figure 4- 11: GIMAP5v2 promotes mitochondrial Ca2+ accumulation...... 54 Figure 4- 12: Influence of GIMAP5v2 on Ca2+ release from mitochondria...... 55 Figure 4- 13: GIMAP5v2 does not colocalize with mitochondria...... 56 Figure 4- 14: Co-localization of GIMAP5v2 with Lysotracker Red...... 57 Figure 4- 15: Movement of GIMAP5v2 and LAMP1 expressing vesicles in HEK293T stable cells...... 58 Figure 4- 16: GIMAP5 variants are anchored on the lysosomal membrane through the C- terminal transmembrane domain...... 59 Figure 4- 17: GIMAP5 colocalizes with the lysosomal Ca2+ channel TPC2...... 59 Figure 4- 18: GIMAP5 colocalizes with different vesicles of the endo-lysosomal system. .. 61 Figure 4- 19: GPN-mediated release of Ca2+ is increased in the absence of GIMAP5...... 63 vii

Figure 4- 20: GPN-induced lysosomes osmotic lysis is similar for Control and GIMAP5 expressing cells...... 64 Figure 4- 21: Nocodazole treatment increases the Ca2+ influx following GPN treatment. .. 65 Figure 4- 22: Lysosomes accumulate Ca2+ following activation through T cell receptor. .... 67 Figure 4- 23: GIMAP5 variants interact with each other...... 68 Figure 5- 1: Schematic representation of other the different deletion mutants from GIMAP5v1. 105 Figure 5- 2: Protein expression of the different deletion mutants of GIMAP5...... 106 Figure 5- 3: Stable HEK293T cells stable for the expression of different mutants of the GIMAP5 protein...... 107

viii

LIST OF TABLES

Table 1-1: Expression of the GIMAP family of proteins in humans, rats, and mice...... 23

LIST OF ABBREVIATIONS

ADPR Cyclic ADP-ribose AIG1 AvrRpt2-Induced Gene1 Arp2/3 Actin-related protein 2/3 ATP Adenosine triphosphate Bcl10 B-cell lymphoma 10 Ca2+ Calcium cADPR Cyclic ADP-ribose CaM Calmodulin CARMA1 Caspase recruitment domain-containing membrane-associated guanylate kinase protein 1 CHOP C/EBP-homologous protein CN Calcineurin CPA Cyclopiazonic acid CRAC Ca2+ release-activated Ca2+ channel DAG Diacylglycerol DGKs Diacylglycerol kinases DP Double positive ERMES ER-mitochondria encounter structure FCCP Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone GIMAP GTPase immunity-associated protein GPN Gly-Phe β-naphthylamide GSK3 Kinase glycogen synthase kinase 3 IkB IkB kinase IMM Inner mitochondrial membrane IP3 Inositol trisphosphate IP3R Inositol triphosphate receptors ITAMs Immunoreceptor tyrosin-based activation motifs KIF5 Kinesin-1 family LAT Linker for the activation of T cells Lck Leukocyte-specific tyrosine kinase LKB1 Liver kinase B1 LSDs Lysosomal storage disorders MALT1 Mucosa-associated lymphoid tissue lymphoma translocation gene 1 MAMs Mitochondria associated membranes MAPK Mitogen-activated protein kinase MCU Mitochondrial Ca2+ uniporter MFN2 GTPase Mitofusin 2 MHC Major Histocompatibility complex MIRO1 Mitochondrial RhoGTPase 1

mTOR Mechanistic target of rapamycin NAADP Nicotinic acid adenine dinucleotide phosphate NFAT Nuclear factor of activated T cells NF-kB Nuclear factor kappa-light-chain-enhancer of activated B cells NK Natural killer OMM Outer mitochondrial membrane PA Phosphatidic acid PIP2 Phosphatidylinositol bisphosphate PKA Protein kinase A PKCθ Protein kinase C-θ PLCγ Phospholipase C-γ RasGRP RAS guanyl nucleotide-releasing protein RyR Ryanodine receptors SERCA Sarcoplasmic/endoplasmic reticulum calcium ATPase SHP1 Tyrosine phosphatase SH2-domain-containing phosphatase 1 Slp76 SH2-domain-containing leukocyte protein of 76 kDa SOCE Store-operated Ca2+ entry SP Simple positive TCA Tricarboxylic acid TCR T cell receptor TFEB Master transcriptional regulator of lysosomal biogenesis and autophagy TG Thapsigargin TPC2 Two-pore channels TRAK Adaptor protein trafficking kinesin protein TRPML Mucolipin TRPs TSC Tumor suppressor tuberous sclerosis complex VDAC Voltage-dependent anion channel Zap 70 Zeta-activated protein 70 kDa

1. INTRODUCTION

Every minute, thousands of events and interactions occur within the human body at the cellular and molecular level. Physiological balance and homeostasis is essential in remaining alive and healthy. As living organisms, we are constantly interacting with our environment, the nutrients we consume through our diet, as well as to the pathogens we can be exposed, can directly impact our health. During evolution, defense mechanisms have developed to keep our body, as a whole, under constant surveillance to maintain balance and health during our lifespan.

To pursue this goal, the immune system has taken charge of eliminating potentially cancerous cells and fighting against external pathogens that could impact our health. During the last decades, our knowledge regarding the immune system and its functions has advanced, which has led to the eradication of certain dangerous diseases through the use of vaccines. Although the increase in knowledge has helped improve our general health significantly, there is still much left to be understood.

Studies on the immune system have enabled us to progress from learning the existence of white cells to understanding, albeit incompletely, complex systems derived from two main branches: the innate and adaptive. Furthermore, several subtypes of immune cells have been uncovered, each with specific characteristics and roles. Although we rely on the immune system to protect us, it is also understood that an unbalanced immune system can lead to undesirable consequences, such as autoimmune diseases. In addition, a perturbed immune system can significantly aggravate an ongoing illness, therefore reminding us of the importance to improve our understanding of how immune cells interact with each other and their environment, and how they respond to pathogenic conditions.

In the context of my doctoral studies, I worked on an animal model where the basal survival of T cells at their naïve stage was impaired. This condition led to a significant decrease in the number of naïve T cells in the periphery of bio-breeding diabetes prone rats, which will be describe later. Specifically, I focused on uncovering the mechanisms of how a frameshift mutation in the GTPase Immunity-associated protein 5 (GIMAP5) can significantly affect naïve T cell homeostasis, driving T cells to apoptosis. The findings obtained during my studies will help shed light on new factors that were previously not taken into account while considering the maintenance and survival of naïve T cells in the periphery.

1.1. Naïve T cell homeostasis Healthy and mature naïve T cells are crucial in maintaining a long-term balanced and functional immune system. However, T cells need to undergo a selection process before becoming functional cells. Once hematopoietic cells from a lymphoid progenitor exit the bone marrow, they populate the thymus and initiate the generation of immature thymocytes. Thymocytes, at this stage, are double negative (DN) for CD4 and CD8. Next, by somatic DNA rearrangement, they generate a β-TCR that will bind to the α-TCR to form the pre-αβTCR (Fink, 2012). Successful pairs will stop the β chain rearrangement and proceed to initiate proliferation of thymocytes that express CD4 and CD8 molecules on their surface. These thymocytes will then become double positive (DP). In the cortex of the thymus, DP thymocytes will engage different self-peptides presented by major histocompatibility complexes (MHC) I and II, which are found in epithelial cells of the thymus cortex (Germain, 2002).

Figure 1-1: T cell development. Hematopoietic cells give rise to lymphoid progenitors that migrate to the thymus. In the thymus, they turn into DN thymocytes that lack the expression of TCR, CD4 or CD8 receptor. During their maturation process, DN cells progress from DN1 to the DN4 stage where they first rearrange the TCR beta chain and then the TCR alpha chain. After correct TCR chain rearrangement, they become DP thymocytes and can express CD4 and CD8 receptors. Cells are selected positively for their capacity to recognize MHCI or MHCII. The TCR signaling force of SP CD4 or CD8 will then negatively select cells with high affinity against self-peptides. Finally, naïve T cells are exported from the thymus medulla to the peripheral lymphoid organs.

During this positive selection process, DP thymocytes that can recognize the MHC molecules will be selected and migrate to the medulla as CD4 or CD8 thymocytes, depending on whether they were selected by MHC class II or I (Swain, 1983). The thymocytes that do not interact with the MHC will go to death by neglect. Once in the medulla, thymic epithelial cells, specifically the (thymic dendritic cells that can express self-antigens from all tissues), will present different MHCI or MHCII self-peptides, to the single positive (SP) CD8 or CD4 thymocytes (Figure 1-1). SP thymocytes, whose interaction is too strong, will receive an apoptotic signal that results in cell death. Even if the vast majority of thymocytes die after their migration and selection through the thymus, this process is nevertheless necessary to acquire a polyclonal repertoire of naïve lymphocytes that would normally not overreact against self-peptides (Robey and Fowlkes, 1994).

After migration through the thymus, thymocytes undergo positive and negative selection processes prior to becoming mature naïve single positive T cells (Starr et al., 2002). Once thymocytes exit the thymus, they become mature naïve T cells that migrate to secondary

peripheral organs, where they become part of the long-term survival pool of naïve T cells (Jameson, 2002; Marrack et al., 2000; Surh and Sprent, 2008). In order to remain in a quiescent state, naïve T cells require both extracellular signals and internal pathways (Hua and Thompson, 2001). Even though the mechanisms are not entirely understood, it is known that naïve T cell homeostasis primarily requires two signals. These signals are interleukin 7 receptor stimulation by IL-7, and basal self-peptide-MHC complex engagement by the T cell receptor (TCR) (Krogsgaard et al., 2007; Park et al., 2007; Surh and Sprent, 2008). These signals help to maintain the pool of naïve CD4 and CD8 T cells in the periphery.

1.1.1. Interleukin 7 in naïve T cell survival IL-7 was first discovered as a cytokine for T cell development in the thymus and then for its role in the development and survival of other peripheral lymphocyte populations (von Freeden-Jeffry et al., 1995; Peschon et al., 1994). In the periphery, the importance of IL-7 signaling in T cell homeostasis and survival was established by T cell-restricted deletion of the α subunit of the IL-7 receptor (CD127) in mice. After approximately three days, there was a 30% decrease in the number of CD4 and CD8 T cells in the periphery of these mice, which confirmed the essential role of IL-7 signaling in peripheral T cell survival (Jacobs et al., 2010).

IL-7 is a cytokine that is mainly produced by stromal cells in the thymus and the bone marrow, as well as in the periphery by ﬁbroblastic reticular cells in secondary lymphoid organs. In the periphery, other sources of IL-7 can be keratinocytes, hepatocytes, as well as other cells in different organs such as the lung and the intestine (Kim et al., 2011; Mazzucchelli et al., 2009; Shalapour et al., 2010). IL-7 binds to its receptor IL-7R, which is composed of an α (CD127) and a γ subunit (CD132). The latter CD132 is shared by other cytokine receptors of the common γ chain family, which includes interleukin receptors 2, 4, 9, 15 and 21 (Rochman et al., 2009).

Once IL-7 binds the IL-7R receptor, CD127 and CD132 chains, which are associated with association promotes Jak1 and Jak3, to phosphorylate themselves. Once phosphorylated, activation of the transcription factor STAT5 through the JAK/STAT pathway will occur, thereby inducing the translocation of STAT5 to the nucleus. This process will result in the expression of survival genes, such as MCL1 and BCL2 (Jiang et al., 2004; Kimura et al., 2013; Takada and Jameson, 2009). Mice deficient in STAT5, CD127, or Jak3 have shown severe combined immunodeficiency phenotypes (Yao et al., 2006), which confirms the importance of these signaling events in the survival and proper function of lymphocytes. In this way, the expression of the anti apoptotic genes Bcl-2 and Mcl-1 counterbalances the induction of apoptosis by the mitochondrial pathway (Dzhagalov et al., 2008). Similarly, pro-apoptotic proteins, Bad and Bax, can induce the mitochondrial apoptotic pathway after IL-7 withdrawal (Khaled et al., 1999; Li et al., 2004). (Figure 1-2) In addition to its role in regulating anti-apoptotic and pro-apoptotic signals, IL-7 can also influence T cell survival by affecting cell metabolism through regulation of the glucose transporter GLUT1 (Wofford et al., 2008).

Different mechanisms are in place to regulate CD127 expression on the cell. IL-7 stimulation downregulates CD127 cell surface expression on the surface of the cells. The IL-7 receptor is not constantly expressed on the surface in the absence of IL-7 stimulation. Therefore, CD127 is mainly internilized through the endo-lysosomal pathway via clathrin-coated vesicles, and only a relatively small number will not be recycled but will be sorted to the lysosomal and proteasomal pathways for degradation (Henriques et al., 2010). Transcription factors, like Foxo1, can also regulate the expression of CD127 through the downstream PI3/Akt signaling pathway following TCR activation (Fabre et al., 2008). It has been shown that the survival of naïve CD4 and CD8 T cells in the periphery, as well as their ability to populate peripheral lymph organs, can be impaired when they are deficient in Foxo1 gene expression (Gubbels Bupp et al., 2009; Ouyang et al., 2009).

Even if both CD4 and CD8 cells are dependent on IL-7 stimulation for survival, it has been shown that there are certain differences in their sensitivity threshold as CD8 T cells are more dependent on IL-7 than CD4 T cells (Carrette and Surh, 2012; Tan et al., 2002). Indeed, CD8 expression in T cells can be upregulated with IL-7 in vivo IL-7 treatment, whereas IL-7 deficient mice showed a decreased CD8 expression. In fact, IL-7 signaling can regulate its receptor in a process known as “Coreceptor tuning.” For example, in the case of naïve CD8+ T cells, this process will modulate the quantity of CD8+ to fine-tune TCR engagement in a continuous feedback loop. Cytokine signaling can then upregulate CD8, whereas TCR will induce a reduction in CD8 expression. In contrast, CD4 receptor does not seem to be regulated by IL-7 stimulation (Park et al., 2007).

Figure 1-2: TCR and IL-7 signaling. Principal signaling events for naïve T cell survival. On the left part of the panel, MHC-peptide presentation triggers TCR downstream signaling. After the engagement, LCK and ZAP phosphorylate LAT, which recruits SLP-76. PLCγ is recruited to this complex and hydrolyze PIP2 into IP3 and DAG 2+ near the membrane. IP3 will finally induce an increase in [Ca ]i, which will activate CaM and CN to enable NFAT dephosphorylation and translocation to the nucleus. In parallel, DAG will induce AP-1 through the RAS, MAPK pathway and NF-κβ through PKCθ to activate survival and proliferation genes. On the right part of the panel, IL7 stimulates its receptor, engaging the phosphorylation of JAKs which will induce STAT5 translocation to the nucleus. IL7 can also induce the activation and

phosphorylation of the PI3K/AKT pathway, which can promote survival and antiapoptotic gene expression.

1.1.2. T cell receptor in naïve T cell survival In addition to cytokine stimuli by IL-7, once mature naïve CD4 or CD8 T cells are in the periphery, engagement with self-peptides on MHC is essential to induce pro-survival and proliferation signals through the T cell receptor (Takeda et al., 1996; Tanchot et al., 1997). In fact, naïve CD4 and CD8 T cells are a very rich population of cells in the context of their polyclonal expression of TCR with different affinities to a panoply of exogenous and self- peptides (Mahajan et al., 2005; Qi et al., 2014).

The TCR on each mature naïve T cell is prepared to specifically interact with a defined peptide that will transform its naïve state into an activated state and thereby initiate an immune response. Normally, T cell activation results in a strong signal from the TCR in response to an exogenous antigen/peptide presented by the MHC. Nevertheless, TCR is not constantly triggered strongly, and therefore most of the time the vast majority of naïve T cells remain in a naïve quiescent state. An important point to keep in mind is that mature naïve T cells are not dormant cells, but active physiological cells that require constant signaling to remain physiologically active in a naïve state, yet ready to respond to possible threats. In fact, self-peptide-MHC complexes are constantly weakly stimulating naïve T cells through their TCRs, initiating a set of signaling events that will end in the expression of survival and proliferation genes (Surh and Sprent, 2008). Various experiments have shown the impaired survival of T cells in the absence of TCR expression (Polic et al., 2001). Similarly, when naïve CD4 or CD8 T cells are restricted from their respective MHCI or MHCII ligands, there is a decrease in their survival rates (Labrecque et al., 2001; Tanchot et al., 1997).

Once the TCR is engaged by recognition of a peptide presented by the MHC, it initiates conformational changes in the activation motifs of the CD3 tails. Assisted by the CD4 and CD8 coreceptors, leukocyte-specific tyrosine kinase (Lck) will phosphorylate the immunoreceptor tyrosine-based activation motifs (ITAMs) of the CD3, which will lead to the

recruitment of the Zeta-activated protein 70 kDa (Zap70) (Malissen and Bongrand, 2015). Next, Zap70 can recruit and phosphorylate the linker for the activation of T cells (LAT), which is a membrane-associated protein that serves as a scaffold of multiple protein complexes (Samelson, 2002). The phosphorylation of LAT then enables the recruitment of SH2-domain- containing leukocyte protein of 76 kDa (Slp76), which binds to LAT via the Grb2-related adaptor protein 2 (Koretzky et al., 2006). Zap70 can then phosphorylate Slp76 resulting in a recruitment platform formed by LAT/SLP76, which in turn will serve for the recruitment of other signaling effectors like the phospholipase C-γ (PLCγ), which interacts directly with both of them. PLCγ activation will hydrolyze phosphatidylinositol bisphosphate (PIP2) into diacylglycerol (DAG), and inositol trisphosphate (IP3). On one side, DAG will recruit downstream proteins, which include protein kinase C-θ (PKCθ) and RAS guanyl nucleotide- releasing protein (RasGRP). RasGRP can then activate the small GTPase Ras, which in turn activates the mitogen-activated protein kinase (MAPK) signaling pathways. In parallel, phosphorylated Slp76 can recruit the (Guanine nucleotide exchange factor) GEF Vav, which activates the small GTPases Rac and Cdc42.

On the other side, DAG and IP3, IP3 initiates a cascade of events that are calcium dependent and essential for the expression of several genes involved in T cell survival and proliferation. This pathway will be described in greater detail in subsequent sections of this introduction. As for DAG, two signaling pathways are initiated which are, the Ras pathway and PKCθ pathway (Carrasco and Merida, 2004). Ras will activate, through an MAPK/Erk signaling pathway, the transcription factor Fos. As for PKCθ, it will activate the IkB kinase (IkB) through the mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1), the caspase recruitment domain-containing membrane-associated guanylate kinase protein 1 (CARMA1) and the B-cell lymphoma 10 (Bcl10) (Wegener et al., 2006). These will induce the phosphorylation of IkB, leading to its degradation by ubiquitination. Next, NF- kB, which was sequestered in the cytoplasm, translocates to the nucleus and induce the expression of proliferation genes like IL-2. The actin-related protein 2/3 (Arp2/3), which is

triggered by the LAT-Slp76 signalosome activation of Cdc42 and Rac through Vav, induces a burst of actin polymerization at the immunological synapse.

2+ In parallel to DAG, IP3 will stimulate the opening of the Ca permeable channels in the ER,

2+ known as the IP3 receptors. This process will initiate the depletion of Ca from the ER

2+ (Lewis, 2001). Decreased [Ca ]ER are sensed by the ER membrane proteins sensors stromal interaction molecule1 (STIM1) and STIM2, which will then oligomerize and translocate to interact with the plasma membrane proteins (olfactory receptor class A related 1 ) ORA1, forming the Ca2+ release-activated Ca2+ channel (CRAC) (Hoth and Penner, 1992; Zweifach and Lewis, 1993). The opening of the CRAC channels will induce entry of Ca2+ from the extracellular milieu and therefore result in a rise of the intracellular Ca2+ concentration

2+ 2+ [Ca ]i. STIM1 and STIM2 both detect different thresholds of a Ca decrease in the ER

2+ lumen. On the one hand, STIM1 responds to greater changes in [Ca ]ER. In contrast, STIM2 responds to small Ca2+ fluctuations and may be important to sustain and capacitative Ca2+ entry under basal conditions as well as to improve STIM1 recruitment to enhance Ca2+ signaling (López et al., 2012; Ong et al., 2015; Thiel et al., 2013). This increase in Ca2+ in the cytoplasm will enable the nuclear factor of activated T cells (NFAT) to translocate to the nucleus. In cooperation with other transcriptional partners, it will then induce the expression of survival and proliferation genes (Macian, 2005). In fact, NFAT which is dependent on Ca2+ concentration is sequestered in the cytoplasm when Ca2+ concentrations are low. The kinase glycogen synthase kinase 3 (GSK3) phosphorylation of NFAT induces its nuclear export. In contrast, once Ca2+ concentration increases following TCR stimulation, the Ca2+ binding protein calmodulin (CaM) will associate and activate the calcineurin (CN) phosphatase. This, in turn, will dephosphorylate NFAT and enable its translocation to the nucleus where, in conjunction with other factors from the DAG signaling, will activate survival and proliferation genes, like IL-2 (Oh-hora and Rao, 2008). (Figure 1-2)

Regulation following TCR stimulation occurs at different levels. Lck and Zap70 are dephosphorylated by the tyrosine phosphatase SH2-domain-containing phosphatase 1

(SHP1). Lck, Zap70, as well as Vav can also be the targets of the E3 ubiquitin ligase, which causes them to undergo proteasomal degradation (Duan et al., 2004). For its part, diacylglycerol kinases (DGKs) will phosphorylate DAG to obtain phosphatidic acid (PA) (Zhong et al., 2008). Costimulatory signals, which are essential for T cell activation, will not be discussed as the focus of the thesis is mainly the understanding of the quiescent naïve state of T cells.

1.1.3. Metabolic signals that regulate T cell survival As previously mentioned, IL-7 and TCR are the two most important extracellular signals that maintain the pool of naïve T cells. However, another important characteristic of naïve T cells is their metabolic status. In fact, naïve T cells remain in a quiescent, yet active catabolic metabolic state by favoring energetic and efficient processes, such as oxidative phosphorylation (OXPHOS) vs. aerobic glycolysis, which are used during the activated state of T cells (Wang and Green, 2012). By doing this via the tricarboxylic acid (TCA) cycle, they can generate around 30 to 32 molecules of ATP per molecule of glucose. Several factors are in charge of the maintenance and regulation of this metabolic state. The mechanistic target of rapamycin (mTOR) has a decisive role in T cell metabolism, and early activation of mTOR can impair T cell survival (Chi, 2012; Yang and Chi, 2013, 2012). In cell metabolism, mTOR works as a sensor of nutrients, amino acids, and oxygen availability, as well as a modulator of extracellular signals that will impact the metabolic state of the cell (Heikamp and Powell, 2012).

In naïve T cells, the protein kinase that regulates the differences in the energy status through the AMP and ATP ratio is AMPK. As mTOR activation initiates an anabolic metabolism, mTOR activity is minimal in naïve T cells. In a catabolic state, high levels of AMP versus ATP will induce AMPK to activate the tumor suppressor tuberous sclerosis complex (TSC1 and TSC2) (Fingar and Blenis, 2004). Indeed, mTOR activation is negatively regulated by activated TSC1 and TSC2 complex, which in naïve T cells serves to maintain their catabolic homeostatic state, which is essential for their survival. In fact, mice KO for the expression

of TSC1, have shown a less restricted mTOR. As a result, the basal metabolic state that is key to naïve T cell quiescence and survival is no longer maintained. As a consequence, TSC1/2’s negative regulation of mTOR is essential to maintain a quiescent state and prevent naïve T cells from undergoing apoptosis (Qi et al., 2011; Xie et al., 2012; Yang et al., 2013, 2011; Zhang et al., 2011). In addition, TCR stimulation contributes to an increase in the expression of AMPK by the liver kinase B1 (LKB1) and by an increase of the intracellular [Ca2+] (Fracchia et al., 2013). Thus, modulation of naïve T cell metabolism by maintaining a catabolic status is as important to their long-term survival as the homeostatic extracellular signals that induce the expression of pro-survival genes.

1.2. Ca2+ homeostasis in T cell survival Ca2+ influx is essential for the regulation of up to 75% genes implicated in survival and proliferation (Feske et al., 2001). Ca2+ is one of the main second messengers. Once cells receive and input through receptors on the membrane, this can lead to an increase of intracellular Ca2 concentrations. Store-operated Ca2+ entry (SOCE) through Ca2+ release- activated calcium (CRAC) channels is the principal mechanism of Ca2+ extracellular influx in lymphocytes after TCR stimulation (Lewis, 2001). An increase in intracellular Ca2 is essential for the activation of different enzymes as well as for the transcription of a panoply of genes implicated in cell survival and proliferation.

Whereas CRAC channels are the principal gates for extracellular Ca2+ flux, other channels can also contribute, to a lesser extent, to the intracellular Ca2+ concentration. Transient receptor potential channels TRPM7 and TRPM2, even if not fully understood, have been shown to play a role in T cell Ca2+ homeostasis. They can be activated by different agonists such as NAAD, ADPR, and cADPR, likely produced as a result of TCR stimulation (Beck et al., 2006; Guse et al., 1999). In T cells, some members of the voltage-gated Ca2+ channels have been reported, but their contribution to Ca2+ homeostasis remains under study (Hogan et

2+ al., 2010). L-type “voltage-dependent” Ca channel CaV1.4 has been shown to play a major role in the survival of naïve T cells by modulating intracellular Ca2+ storage and TCR

downstream Ca2+ dependent signaling events (Omilusik et al., 2009). Similarly, a recent study showed that Cav1.1 is expressed in naïve T cells and upregulated in activated T cells upon TCR stimulation (Matza et al., 2016). Another group of receptors that contribute to the influx of extracellular Ca2+ during T cell activation are the purinergic receptors (Schenk et al., 2008; Yip et al., 2009). In T cells, three purinergic receptors P2X1, P2X4, and P2X7 have been reported to influence T cell Ca2+ flux. Indeed, ATP activation of P2X7 opens the channel to Ca2+ influx which activates calcineurin, resulting in IL-2 production and T cell proliferation (Feske, 2013; Woehrle et al., 2010). Interestingly, ATP release by mitochondria near the immune synapse has been shown to play a major role in activating P2X1 and P2X4, and by doing so, prolonging Ca2+ influx.

Nevertheless, Ca2+ is not constantly available in the cytoplasm but stored by different organelles, which will release it for specific needs, even in the absence of a major extracellular flux of Ca2+. The most well-known organelle is the endoplasmic reticulum, which has been recognized for a long time for its capacity to store, regulate and trigger Ca2+ fluxes. Even if the ER remains the leading Ca2+ store of the cell, other organelles can also store Ca2+ in a significant manner and therefore influence Ca2+ dependent signaling pathways. Contribution from other organelles, such as mitochondria and lysosomes, to the regulation of Ca2+ signaling dependent pathways, is necessary to better regulate the different Ca2+ thresholds, as well as particular needs in specific regions of the cell (Raffaello et al., 2016; Srikanth and Gwack, 2013).

1.2.1. The endoplasmic reticulum as the main Ca2+ store The ER is an organelle with a multitude of functions, ranging from drug detoxification, lipid metabolism to post-transcriptional modifications and protein synthesis (Görlach et al., 2006). Moreover, it also serves as the primary Ca2+ storage compartment. ER lumen Ca2+

2+ concentration [Ca ]ER can vary from cell to cell, going from 0.3 to 0.7mM (Montero et al., 1997). The ER contributes importantly to cellular Ca2+ homeostasis and signaling. Calcium uptake is done by the Sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA) pump

and by the release channels IP3 and ryanodine receptors (Aulestia et al., 2011; Golovina and Blaustein, 1997) (Figure 1-3). In fact, mammals express three different types of SERCA proteins. The isoform SERCA2b is expressed ubiquitously. As a protein, the SERCA pump has a molecular weight of 110 kDa and can transport two Ca2+ ions for each molecule of ATP hydrolyzed (Zampese and Pizzo, 2012). SERCA activity can be regulated both physiologically and pharmacologically. Within the cells, the phospholamban protein can inhibit the SERCA pump, and its phosphorylation by the protein kinase A (PKA) stops this inhibition (MacLennan and Kranias, 2003). Artificially, three main pharmacological drugs can inhibit the SERCA pumps in a reversible and non-reversible way. Thapsigargin (TG), whose action is irreversible, is the most used SERCA inhibitor. Cyclopiazonic acid (CPA) and 2,5-di (t-butyl) hydroquinone are reversible blockers and have less affinity than TG for the SERCA pump (Pinton et al., 1998).

In order to release Ca2+ into the intracellular medium, the ER relies on two ion channels: the inositol trisphosphate receptors (IP3R) and the ryanodine receptors (RyR) (Foskett et al.,

2007). The IP3R family includes three isoforms, whose expression varies among tissues, but all of them have been detected in T cells (Akimzhanov and Boehning, 2012). To regulate

2+ different Ca signaling events, the IP3R can form homo and heterodimers that are primarily

2+ controlled and modulated via second messengers molecules, such as IP3, Ca and ATP (Chandrasekhar et al., 2016; Raffaello et al., 2016). The other important Ca2+ releasing channels are the RyR. Similarly, as IP3R, RyR have three different isoforms whose expression varies within tissues. Working as homotetramers, Ca2+ release from the RyR isoforms can be induced in various ways by PKA, calmodulin, Ca2+, voltage-gated Ca2+ channels and cyclic ADP-ribose (ADPR) (Raffaello et al., 2016; Zampese and Pizzo, 2012).

Recently, it has been suggested that Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) can also trigger RyR1 receptors and synthetic inhibition by adding NAADP to cells can attenuate survival and proliferation signals in T cells (Dammermann et al., 2009). This process, which occurs within the first milliseconds upon T cell stimulation and Ca2+ signaling,

2+ may induce Ca microdomains near the ER that in turn will serve as coactivators of IP3R channels that may later impact the final intracellular Ca2+ levels (Guse and Wolf, 2016; Wolf et al., 2015).

1.2.2. The role of mitochondria in Ca2+ homeostasis Mitochondria are commonly known as the powerhouses of the cell. One of their main roles is to ensure the production of adenosine triphosphate (ATP) generated by aerobic respiration and the Krebs cycle. Mitochondria consist of an outer mitochondrial membrane (OMM) that interacts with the cytosol and of an inner mitochondrial membrane (IMM) that forms invaginations known as cristae, that helps to increase the total membrane surface area of the mitochondria. Mitochondrial enzymes and DNA reside in the mitochondrial matrix, which is enclosed in the IMM (Heath-Engel and Shore, 2006). Mitochondria are also key players in cell death and survival, by activating apoptosis via the intrinsic pathway. However, several antiapoptotic proteins from the Bcl-2 family in the OMM prevent apoptosis by initiating the release of other proapoptotic proteins, such as cytochrome c, which reside in the IMM matrix, to the cytosol (Tait and Green, 2010; Wang and Youle, 2009).

Although mitochondria are commonly viewed as rigid organelles, they are continuously undergoing morphological changes. These changes can differ depending on the cell type, making it possible to depict single mitochondrion units in neurons, or the establishment of a vast interconnected and more rigid mitochondrial network, commonly seen on myocytes. Several proteins that ensure active status are implicated in fission and fusion processes to shape mitochondrial morphology according to cellular physiology and needs. The incorrect function of these mechanisms is linked to problems in immune cell signaling, neurodegeneration, cell lifespan and Ca2+ signaling by impairing basal physiology and cellular homeostasis (Campello and Scorrano, 2010; Sheridan and Martin, 2010).

Figure 1-3: ER, mitochondria and lysosome Ca2+ release and uptake channels. The three most important organelles that can importantly store Ca2+ are ER (in gray), mitochondria (in amber), and lysosomes (in light red). The ER is the primary Ca2+ store, storing in its lumen around 0.3 to 0.7 mM of Ca2+. The main Ca2+ entry goes through the SERCA pump, and the release is assured by the IP3R and RyR receptors. Mitochondria storage capacity ranges between 0.1 and 0.5 mM depending on the cell type and extent of the mitochondrial network. Ca2+ uptake is done on the outer membrane by the VDAC channel and more specifically to the matrix by the inner MCU channel. It has been proposed that mitochondrial Ca2+ release is done by the Na/Ca2+ exchanger. Lysosomes, which are less known for their Ca2+ storage capacity, can store around 0.5 mM of Ca2+ in their lumen. TRPML1 and TPC2 have been proposed to release lysosomal Ca2+. Lysosomal Ca2+ uptake is done by an H+ gradient through an H+/Ca2+ exchanger. Mitochondria and ER crosstalk and exchange Ca2+ in rich Ca2+ microdomains between their membranes. Proteins like MFN2 and GRP75, help to link both organelles in this mitochondrial associated membrane sites (MAMs). Multiple contact sites (MCS) have also been seen in lysosomes and the ER, primarily for lipid exchange. Lysosomal Ca2+ management and homeostasis is a research topic under development.

A less commonly associated role of mitochondria is their capacity to serve as Ca2+ storage

2+ organelles. Although their ability to buffer Ca was first uncovered in the 1960s (Deluca and Engstrom, 1961), only a few studies regarding mitochondrial Ca2+ were performed until the 2000s. Once they regained attention, the molecular components of mitochondrial Ca2+

2+ uptake started to be elucidated. Indeed, mitochondrial calcium concentration [Ca ]M in the mitochondrial matrix can range between 0.1 to 0.5mM (Arnaudeau et al., 2001; Montero et al., 2000; Suzuki et al., 2014). In lymphocytes, mitochondria play a fundamental role in sustaining Ca2+ flux through the CRAC channels following TCR stimulation and downstream signaling. In fact, CRAC channels can close prematurely, through a negative regulatory

feedback mechanism, after high Ca2+ concentrations are achieved beneath the plasma membrane. Different proteins and signaling pathways depend on a sustained Ca2+ flux to fulfill their functions. To prevent this early closure of CRAC channels, mitochondria can move near the CRAC channels and buffer some of the incoming Ca2+ . Mitochondria buffer Ca2+ through their voltage-dependent anion channel (VDAC) on the OMM and more selectively, through their mitochondrial Ca2+ uniporter (MCU) located on the IMM (Kirichok et al., 2004; Rizzuto et al., 2000) (Figure 1-3). Surprisingly, the affinity of the MCU for Ca2+ is not high. However, mitochondria can move in a [Ca2+] dependent manner to rich Ca2+ microdomains beneath the plasma membrane, where the Ca2+ flux through the CRAC channel entered the cell. This enables mitochondria to buffer the Ca2+ that is rapidly entering the cell in a nonlinear manner without saturation (Rizzuto et al., 1993). The mitochondria will then slowly release Ca2+ in the intracellular milieu via the Na+/Ca2+ exchanger (Griffiths, 1999; Santo-Domingo and Demaurex, 2010). This mechanism prevents premature closure of CRAC channels by Ca2+ feedback inhibition and assures a constant and

2+ adequate [Ca ]i (Oh-hora, 2009; Parekh, 2008; Quintana et al., 2006).

Mitochondrial capacity to detect different [Ca2+] is due to the mitochondrial outer membrane receptor protein, Rho-GTPases MIRO-1, which contains four Ca2+ binding EF- hand motifs (Fransson et al., 2006; Frederick et al., 2004; Klosowiak et al., 2013). Nevertheless, MIRO1 by itself cannot move mitochondria towards rich Ca2+ regions. As a consequence, MIRO1 is linked to the kinesin-1 family (KIF5) by the adaptor protein trafficking kinesin (TRAK). Both proteins form an adaptor/motor complex which is essential for mitochondrial motility (Fransson et al., 2003; Glater et al., 2006; Stowers et al., 2002; Wang and Schwarz, 2009). In fact, the mitochondrial movement to Ca2+ rich microdomains is ceased when elevated levels of Ca2+ stop or disassemble the MIRO1-TRAK-KIF5 complex (Macaskill et al., 2009; Wang and Schwarz, 2009). Another mechanism stopping the ceasing of mitochondrial transport is the Ca2+ induced competition for kinesin of TRAK versus syntaphilin, a microtubule docking protein (Chen and Sheng, 2013). Recently, MIRO1 has been shown to be able to associate with the dynein complex, a process that will help to

better understand mitochondrial bidirectional transport (Morlino et al., 2014). Moreover, mitochondrial movement near Ca2+ rich domains will not only contribute to sustaining longer Ca2+ fluxes after TCR stimulation by buffering Ca2+ but also to producing ATP, which will stimulate P2X purinergic receptors that work as ATP-gated Ca2+ channels (Ledderose et al., 2014).

Furthermore, mitochondria can also influence Ca2+ flux through its interaction and crosstalk with the ER. A constitutive Ca2+ transfer from the ER to the mitochondria is necessary to maintain ATP production and other organelle functions (Cárdenas et al., 2010). These interactions between the ER and the mitochondria are referred to as mitochondria- associated membranes (MAMs) (Pizzo and Pozzan, 2007; Rusiñol et al., 1994) (Figure 1-3). Different proteins, such as the outer mitochondrial membrane GTPase Mitofusin 2 (MFN2), which is expressed in both organelles’ membranes, as well as the chaperone GRP75, which links VDAC on the OMM to the IP3R, are involved in maintaining those tethering sites. Currently, their specific roles are still under debate. (Bakowski et al., 2012; de Brito and Scorrano, 2008; Lionetti et al., 2013; Singaravelu et al., 2011). Moreover, MFN2, which assists with mitochondrial tethering to ER, can also decrease STIM1 trafficking to open CRAC channels when mitochondria are depolarized, possibly to prevent overload when mitochondrial Ca2+ uptake capacity is compromised (Singaravelu et al., 2011).

1.2.3. Lysosomes as new players in Ca2+ regulation Cell requirements for Ca2+ are not always equal but differ in time, concentration, and intensity. Although the mitochondria and ER play essential roles in Ca2+ storage and signaling, other compartments have recently garnered increased attention for their role in Ca2+ regulation. The endo-lysosomal system, particularly the acidic compartments such as the lysosomes, have been established as important compartments for Ca2+ storage and regulation (Docampo and Moreno, 2011; Patel and Docampo, 2010).

Lysosomes are catabolic membrane-delimited organelles whose primary function is the degradation of cell components and breakdown of proteins. It is these main catabolic capacities that have given lysosomes their reputation as the trash cans or recycle bins of the cell. To fulfill its primary role, lysosomes use glycosidases, lipases, and proteases; containing over 60 different kinds of hydrolases (Kolter and Sandhoff, 2005). Cell nutrient status and signaling regulate the degradation catabolic pathways (Luzio et al., 2009). The cell uses two main routes for the degradation of components by the lysosomes. The extracellular components are delivered to the lysosomes via internalization to the endo- lysosomal network (Luzio et al., 2009). Other intracellular components can be targeted to the lysosomes via autophagy (Singh and Cuervo, 2011), a process that involves the formation of an autophagosome and a posterior fusion with lysosomes. Lysosomes have a very acidic lumen (pH around 4.5 to 5) that is crucial for its internal hydrolytic functions. An H+ pump in their membrane, known as the v-ATPase, constantly pumps H+ inside the lysosome to preserve its acidic environment, which is necessary for the lysosome’s catalytic functions (Forgac, 2007). In contrast, malfunction of the v-ATPase pump impairs cellular waste degradation, cargo sorting and can misbalance cellular metabolism (Saftig and Klumperman, 2009). In parallel, the acidic environment of the lysosomal compartment has been associated with the capacity of lysosomes to store higher concentrations of Ca2+, when compared with other vesicles of the endolysosomal pathway (Docampo and Moreno, 2011). Indeed, lysosomes can store up to 0.5mM of Ca2+ in their lumen (Lloyd-Evans et al., 2008; Morgan et al., 2011). The lysosomal acidic environment is one of the plausible explanations for why lysosomes can accumulate more Ca2+. Recently, one group has shown that for rapid lysosomal Ca2+ refilling, it is the ER’s close contact with lysosomes that is potentially playing an essential role for rapid lysosomal Ca2+ refilling (Garrity et al., 2016).

2+ The three most important Ca mobilizing second messengers, IP3, cyclic ADP-ribose (cADPR), and NAADP, the latter is the most potent Ca2+ release messenger (Bootman et al., 2002; Churchill and Galione, 2001; Lee and Aarhus, 2000). Interestingly, NAADP is produced after TCR engagement and is involved in the release of Ca2+ from acidic compartments

through the recently characterized two-pore channels (TPC) (Brailoiu et al., 2009; Calcraft et al., 2009; Dammermann and Guse, 2005). In addition to TPC2, another important Ca2+ release channel in lysosomes is the Mucolipin TRPs (TRPML1-3)(Cheng et al., 2010; Dong et al., 2010; Grimm et al., 2012) (Figure 1-3). Mutations in the Mucolipin1 gene lead to diseases associated with lysosomal storage (Sun, 2000). It has been shown by a patch-clamp technique that TRPML1 activation goes through a localized phosphatidylinositol biphosphate PI (3,5)P2 in the endo-lysosomal compartment (Cheng et al., 2010). Moreover, the role of lysosomal Ca2+ in the overall cellular Ca2+ homeostasis has been demonstrated in experiments where the release of Ca2+ from the lysosomes can initiate further ER Ca2+ release into the cytoplasm (Penny et al., 2015). Similarly, ER Ca2+ release has been shown to impact lysosomal Ca2+ concentration, which demonstrates that bidirectional communication is a mechanism for Ca2+ homeostasis that is constantly taken place intracellularly (López-Sanjurjo et al., 2013; Morgan et al., 2013; Ronco et al., 2015). Furthermore, lysosomal Ca2+ is known to play a role in endocytic vesicles fusion as well as in the induction of expression of genes associated with the lysosomal/autophagy pathway (Medina et al., 2015; Settembre et al., 2013). In addition, well-characterized proteins STIM1 and STIM2 have been reported to be expressed in acidic organelles (Zbidi et al., 2011).

1.2.4. The Cytoskeleton network influences Ca2+ homeostasis via organelle movement regulation In addition to provide structural support to the cell, the cytoskeleton provides a significant transit network inside the cell where many types of cargoes can transit to fulfill cellular demands. The cytoskeleton network is mainly composed of actin filaments, intermediary filaments, and microtubules, which are all complementary to each other, but with different localization and organization within the cell (Huber et al., 2015). Actin filaments are found in the periphery of the cells and are composed of G-actin monomers that can agglomerate to form F-actin microfilaments. Two parallel F-actin microfilaments can then assemble to form the actin microfilaments from the cytoskeleton (Korn et al., 1987). As microtubules are more robust than actin filaments, they are present everywhere in the cytoplasm to

provide structural support as well as to help with the communication between the cell’s interior and its periphery by facilitating intracellular transport (Figure 1-4).

Microtubules are composed of α-tubulin and β-tubulin dimers that bind GTP in order to produce polymerized tubules with a positive and negative orientation, being negative the microtubule organization center near the nucleus and positive near the plasma membrane. This characteristic is key for other proteins that interact and move along microtubules (Carlier et al., 1984; Mitchison and Kirschner, 1984; Ohi and Zanic, 2016). The main forming units of the cytoskeleton network, specifically G-actin, α-tubulin, and β-tubulin, are abundant cellular proteins that have been highly conserved during evolution across species (Erickson, 2007). This particular characteristic facilitates their study among different cell types, but could potentially make results difficult to interpret due to their abundance.

Actin filaments and microtubules are constantly used by different cargoes for transport across the cell (Kolomeisky and Fisher, 2007). The nature of these cargoes, ranging from protein complexes to whole organelles, makes this activity complex and subjected to regulation. In fact, cargoes by themselves cannot move along the different filaments that compose the cytoskeletal network. Therefore, a group of protein complexes, known as molecular motors, are in charge of this task. By hydrolyzing ATP, motor proteins can transform chemical energy into a mechanical workforce, thus generating a movement of cargoes along the filaments (Hirokawa and Takemura, 2005; Ross et al., 2008).

Myosin is the main molecular motor that takes charge of the movement of cargoes over actin filaments. Myosins are divided into two main groups, conventional myosin-II and unconventional myosins (Berg et al., 2001). While conventional myosin-II are in charge of contraction in muscle cells, unconventional myosins, such as myosin-V and myosin VI, are in charge of vesicular trafficking along actin filaments (Batters and Veigel, 2016; Lu et al., 2014; Maravillas-Montero and Santos-Argumedo, 2012) (Figure 1-4). Due to the fact that actin filaments, as well as microtubules, have a polarity, cargoes travel toward positive or

negative ends of the polymer structure. In actin filaments, cargoes can associate with myosin-V to move toward the plus-end of a filament or with myosin VI to travel towards the opposite direction. Both myosin V and VI seem to have a monomeric conformation that gives the molecular motors the capacity to tether vesicles, but they require the formation of dimers to mechanically move cargos over actin filaments (Akhmanova and Hammer, 2010).

- +

Figure 1-4: The cytoskeleton and the motor proteins. The cytoskeleton is principally composed of actin and microtubule filaments. Actin filaments are thinner than microtubules and are mainly localized at the periphery of the cell. On the other hand, microtubules are all over the cytoplasm. Both filaments shape the cell structure but also serve as a network to transport various cargos trough the cell. For actin filaments, myosin is the main motor protein in charge of cargo trafficking. As for microtubules, kinesin and dynein move cargoes in a specific direction. Kinesin is responsible for anterograde movement, while dynein performs the retrograde movement.

In contrast to actin filaments, which principally support short movements, microtubules can support short and long movements that are regulated by the interaction of cargoes with the molecular motors, kinesin and dynein (Sheetz, 1996). In general, kinesin will take charge

of anterograde movements, which means toward the periphery of the cell, while dynein will control retrograde trafficking, toward the MTOC or nucleus of the cell (Mallik and Gross, 2004). To note, movement of cargoes over filaments required more than one motor protein, depending on the size of the cargo as well as to the distance to cover. Several kinesin motors can work together to accomplish the movement of cargo from point a to point b. In parallel, the tug of war model, an existing theory, suggests that motor proteins with different polarities, like kinesin and dynein, can compete to establish where the cargo or organelle will move (Müller et al., 2008). Even if several molecular motors with different direction affinities compete, the motor that loses the battle remains attached to the organelle to regulate further movement and to help the cargo overcome possible obstacles over the microtubule track (Bryantseva and Zhapparova, 2012).

Other proteins, called adaptor proteins, also play a vital role in determining which direction cargoes may travel. It has been shown that MIRO1), an adaptor protein, has some calcium binding EF motifs, thus depending on the intracellular Ca2+ concentration can dictate the movement of mitochondria according to the intracellular Ca2+ concentration. MIRO1 in collaboration with another adaptor protein MILTON interacts with kinesin as well as with mitochondria. This leads to the formation of a mitochondrial transport machinery that can better dictate where mitochondria need to move (Wang and Schwarz, 2009). Several other adaptor proteins interact with both the organelles and motor proteins to further regulate and coordinate movement of cargoes all over the cytoplasm (Mallik and Gross, 2004).

1.3. GIMAP family of proteins GTPases of immune associated proteins (GIMAP) are coded by a set of Gimap genes located in tight clusters (Krücken et al., 2004; Nitta and Takahama, 2007). Interestingly, Gimap genes share a conserved region with the AvrRpt2-Induced Gene1 (AIG1), a gene in charge of the immune response against pathogens in plants (Liu et al., 2008). In fact, Gimap genes are present in vertebrates and plants, which shows their conserved role among species in immune responses. Gimap genes are expressed principally in immune tissues, where they

all seem to play a role at different stages of thymocyte maturation and T cell survival (Ciucci and Bosselut, 2014; Dion et al., 2005; Filén and Lahesmaa, 2010). Among the ten genes that compose the GIMAP family of proteins, humans express seven genes clustered on chromosome 7. In the same way, rats express seven genes clustered on chromosome 4, and mice express eight genes localized on chromosome 6 (Table-1) (Dion et al., 2005; Krücken et al., 2005, 2004).

GIMAP 1 2 3 4 5 6 7 8 9

Human Yes Yes Pseudogene Yes Yes Yes Yes Yes None

Rat Yes None None Yes Yes Yes Yes Yes Yes

Mouse Yes None Yes Yes Yes Yes Yes Yes Yes

Table 1-1: Expression of the GIMAP family of proteins in humans, rats, and mice.

In addition to plants, where the immune nucleotide associated genes have been studied for their importance as a defense mechanism against pathogens. In mammals, the most evolved members of the family of Gimap proteins have been investigated, principally, in rats, mice, and humans. Phylogenetical tree comparison between the IAN/GIMAP proteins in higher plants, humans, mice, and rats, show how different family members are most closely related to them, than with others and may explain why some members have been associated with similar physiological roles (Figure 1-5).

Figure 1-5: Phylogenetic tree of IAN/GIMAP proteins expression in Arabidopsis thaliana, Homo sapiens, Mus musculus and Rattus norvegicus. A phylogenetic tree is showing the evolutionary relationships among the first IAN conserved protein in plants with the GIMAP family of proteins in the three principal organisms where the proteins have been studied: humans, mice, and rats. The phylogenetic tree was generated after protein alignment of the different members of the IAN/GIMAP family of proteins with Clustal Omega bioinformatics tool (Sievers et al., 2011).

All GIMAP proteins have a molecular mass between 33 and 38 kDa, except for GIMAP8, whose molecular weight is around 75 kDa. Similarly, they contain a conserved AIG1 domain at the N-terminal, where five GTP/GDP binding motifs, G1, G2, G3, G4, and G5 have been identified (Nitta and Takahama, 2007). Despite being small GTPases, they are not categorized in the known small GTPases families, RAS, RHO or Rab, making them a new subclass of small GTPases. Although they do not classify in the regular groups of GTPases, phylogenetical studies have shown that they conserved a canonical fold on their G domain 24

structure, which relates GIMAP proteins to the septin and dynamin GTPases (Schwefel et al., 2010). With regards to their GTPase activity, few members have been studied for their capacity to hydrolyse or bind to GDP and GTP. Among the first members to be explored were mouse GIMAP3, which showed GTP binding activity (Dahéron et al., 2001) and human GIMAP4, which showed a capacity to bind GDP and GTP as well as to exhibit an intrinsic GTPase activity (Cambot et al., 2002). More detail and structural studies performed on human GIMAP2 and GIMAP7 have shown that GIMAP2 can also bind GTP. Interestingly, this group demonstrated that GIMAP7 was able to stimulate its own GTPase activity, and that of GIMAP2 by dimerization (Schwefel et al., 2013). Moreover, Schwefel et al. suggested that the ability of the GIMAP family to dimerize and form oligomers may constitute an important mechanism to activate their GTPase activity. In parallel, ongoing unpublished data by the same group attributes human GIMAP5 the capacity to bind to GTP. In parallel, ongoing unpublished data by the same group attributes human GIMAP5 the capacity to bind to GTP, in a similar way as GIMAP2 (Schwefel and Daumke, 2011).

Besides the AIG1 conserved domain, all GIMAP family members contain a coiled-coiled domain, which may serve for protein-protein interactions. GIMAP proteins 1, 3 and 5 contain one hydrophobic transmembrane region at the C-terminal and GIMAP2 contains two hydrophobic C-terminal regions, which play a major role in anchoring them to different cellular compartments. (Dion et al., 2005; Krücken et al., 2004; Nitta et al., 2006). All GIMAPs are cytoplasmic intracellular proteins localized to distinct subcellular compartments, and they seem to have principally a physiological role in the development and maintenance of different cells that belong to the immune system (Filén and Lahesmaa, 2010).

GIMAP1 localizes to the ER and is primarily expressed in the lymph nodes tissues and spleen (Stamm et al., 2002). Upregulation of Gimap1 mRNA has been observed in thymocytes development from DN to DP state, (Dion et al., 2005; Nitta et al., 2006) while it has been observed to be differently regulated in T helper cell differentiation (Filén et al., 2009).

Furthermore, conditional knockout of GIMAP1 produced a sharp decrease in T and B cells, suggesting its importance in their development (Saunders et al., 2010). Selective ablation of Gimap1 in B cells has shown that GIMAP1 is essential for their survival, independently of their activation state (Webb et al., 2015). In the context of mature T cells, GIMAP1 selective deletion induces their death by mitochondrial depolarization and apoptosis via the extrinsic pathway (Datta et al., 2016).

GIMAP2 localizes on lipid droplets, and its expression was seen to be altered in anaplastic large cell lymphoma derived cell lines (Schwefel et al., 2013, 2010). GIMAP2 was also part of a susceptibility locus for Behcet’s disease, an inflammatory disorder, as shown by genome–wide association studies (Lee et al., 2013).

GIMAP3 is localized to the ER and has been shown to modified mitochondrial DNA segregation (Jokinen et al., 2015). Furthermore, mice lacking GIMAP3 had diminished numbers in regards to their T cell production and seemed to cooperate with its paralogue GIMAP5 for the maintenance of the periphery pool of mature T cells in mice (Yano et al., 2014).

GIMAP4 has a cytoplasmic localization and associates with the trans-Golgi network, microtubules and actin filaments (Heinonen et al., 2014). Gimap4 is upregulated upon positive selection of thymocytes (Poirier et al., 1999). mRNA level is stable in mature T and B cells in the naïve state and after activation, but protein levels decreased after activation in both T and B lymphocytes (Dion et al., 2005). Whereas T lymphocytes development, selection, and activation were not perturbed by the absence of GIMAP4 in knockout mice, the kinetics of apoptosis of T cells was slower compared to control cells (Schnell et al., 2006). Interestingly, deficiency of Gimap4 expression due to an AT allele insertion in the inbred Brown Norway rat, resulted in a similar delay in apoptosis. Moreover, GIMAP4 is associated with the proapoptotic protein Bax, and ectopic expression of Bax was shown to increase apoptosis in mice thymocytes (Nitta et al., 2006). Apart from its proapoptotic function,

GIMAP4 has been shown to be regulated in CD4 T-helper cell differentiation. In fact, GIMAP4 is downregulated in Th2 and upregulated in Th1 cells (Filén et al., 2009). Moreover, siRNA depletion of GIMAP4 in activated CD4 T cells resulted in a decrease production of INF-γ, which is essential for Th1 differentiation phenotype (Heinonen et al., 2014). In the context of human diseases, GIMAP4 have been associated with Behcet’s disease (Lee et al., 2013). Furthermore, single nucleotide polymorphism (SNP) in GIMAP4 has been linked to asthma and allergic sensitization (Heinonen et al., 2015).

GIMAP6 localizes to the autophagosomes in starved cells when mTOR was inhibited. In the same study, GIMAP6 was shown to bind and modulate the levels of GABARAPL2, an autophagosome-associated protein, and the authors suggested possible implications in the autophagy pathways (Pascall et al., 2012). GIMAP6 gene expression was reduced in non- small cell lung cancer (Shiao et al., 2008). Similarly, mRNA expression and protein levels of GIMAP6 were downregulated in tumor tissues of Hepatocellular carcinoma (Huang et al., 2016).

GIMAP 7 localizes to the ER and Golgi, (Krücken et al., 2004) as well as lipid droplets (Schwefel et al., 2013).

GIMAP8 localizes to the ER and Golgi (Krücken et al., 2004). Apart from being a member of the GIMAP family due to its three AIG1 domains, knockout mice displayed minor impact on lymphocyte survival and development. Nevertheless, is importantly expressed in mature T and B lymphocytes and that it plays a role in circulating B cell and displays a regulatory role in apoptosis when expressed in vitro (Webb et al., 2014). As for GIMAP9, not much is known, only that it is present in B and T cells and is upregulated in SP thymocytes (Nitta et al., 2006).

1.3.1. GIMAP5 In rats, the Gimap5 gene codes principally for the expression of two different transcripts. The transcript that codes for the shorter protein has been shown to be more abundant in

comparison to the longer transcript (Andersen et al., 2004). As a result, two variants of GIMAP5 are present in rats, variant 1 is composed of 326 amino acids and variant 2 of 308 amino acids. Bioinformatics protein alignment of both variants showed that they share an identity of 90.8 %. Comparison of their sequences revealed that both variants differ from 32 a.a. at N-terminal. How exactly and how much these variants impact the physiology of T cells, particularly variant1, is unknown. All previous studies on rat GIMAP5 have been done using GIMAP5 variant2

Gimap5 is highly conserved among species; interestingly the human Gimap5 gene also codes for two variants of the GIMAP5 protein that differ at their N-terminal sites, similar to the rat GIMAP5 variants. The first variant and most current splicing transcript contain 307 a.a and has a molecular weight of 34.8 kDa. The second, less common splicing product codes for the variant 2, which contains 347 a.a and has a molecular weight of 39.5 kDa (Krücken et al., 2004). In contrast, in mice, where Gimap5 is also expressed in hematopoietic and B cells, there is only one single variant for GIMAP5. GIMAP5 protein has a conserved homology between rats, mice, and humans, which can be seen in Figure 1-6.

Figure 1-6: GIMAP5 secondary structure in rats, mice, and humans. Schematic representation of the secondary structure of GIMAP5 in rat, mice, and humans. Rat GIMAP5, for Lyp represent the truncated protein that results from a frameshift mutation in Gimap5 gene is also represented. UniProt: Rat v1 (Q8K3L6), v2 (Q0R3W7), Lyp (Q0R3W6), Mouse (Q8BWF2) and Human v1 (Q96F15), v2 (Q96F15-2). Structure domains prediction: InterPro (Mitchell et al., 2015) Bioinformatics design software (Liu et al., 2015), AIG: AvrRpt2-Induced Gene1, cc: coiled- coiled, TM: transmembrane.

Different localization sites have been suggested for GIMAP5. GIMAP5v2 has been principally localized on mitochondria (Pandarpurkar et al., 2003; Zenz et al., 2004), ER (Sandal et al., 2003) and lysosomes (Wong et al., 2010). GIMAP5 initial contradictory results about its localization are possibly due to overexpression of the protein, short-term transfections, as well as C-terminal protein tags, which can modify the anchorage of the protein. In addition, cellular fractionation indicated that GIMAP5 is not in the same fraction as ER or mitochondrial proteins (Keita et al., 2007). Thus the most plausible localization, as confirmed by our results are the lysosomes.

GIMAP5 was first identified by positional cloning of Iddm1/lyp in the diabetes-prone BB rat (BBDP), where it is expressed in the thymus, spleen and lymph nodes (Hornum et al., 2002;

MacMurray et al., 2002). In the BB-DP rats, a virtual absence of CD8+ T cells and a significant decrease in CD4+ T cells, which can reach up to a 10-fold reduction, arises from a homozygous lyp mutation (Elder and Maclaren, 1983; Jackson et al., 1981; Poussier et al., 1982). After thymus emigration and posterior homing of naïve lymphocytes to secondary organs, mature naïve T cells rapidly undergo spontaneous apoptosis. Compared to mature T cells from non-lymphopenic, diabetes resistant rats (BB-RD). The half-life of recent thymus emigrants from is almost 5 to 6 times shorter in BB-PD rats (Hernández-Hoyos et al., 1999; Ramanathan and Poussier, 2001; Ramanathan et al., 1998; Zadeh et al., 1995). The lyp allele originates from a frameshift mutation in the Gimap5 gene. This results in the production of a truncated protein, where 19 a.a at the end of the C-terminal will replace the last 223 a.a of the original sequence (Hornum et al., 2002; MacMurray et al., 2002) (Figure1-6).

Interestingly, strong TCR stimulation using superantigens, concanavalin A or anti-CD3 mAb, rescues the short-lived Gimap5Lyp/Lyp cells from apoptosis. This auto antigen-dependent rescue seems to expand autoreactive T cells preferentially, leading to autoimmune diabetes in BB-DP rats (Lau et al., 1998; Ramanathan et al., 1998). In line with the anti-apoptotic role of GIMAP5, hGIMAP5 was shown to protect Jurkat T cells from apoptosis induced by the protein phosphatase-directed toxin, okadaic acid (Sandal et al., 2003). Another group showed that siRNA knockdown of GIMAP5 in T cells induced apoptosis and that T cell spontaneous apoptosis in the absence of rGIMAP5 was due to a decreased in mitochondrial membrane potential. In parallel, in agreement with previous studies, T cell activation prevented apoptosis by rescuing the mitochondrial membrane potential (Pandarpurkar et al., 2003). Moreover, another explanation of what may be contributing or driving naïve T cells to apoptosis is that GIMAP5 deficiency induces T cells to a partial activation, with may suggest an implication in the modulation of the TCR signaling strength (Lang et al., 2004). Moreover, CD5 expression, which is correlated with TCR strength, is higher in GIMAP5 deficient T cells, when compared to control T cells, which suggests a problem in TCR tuning. Moreover, Dr. Scheinman group followed NF-AT and NF-κB, after TCR signaling and observed that in unstimulated GIMAP5 deficient lymphocytes NF-κB was already activated,

which suggests a more intrinsic than environmental defect due to the lack of GIMAP5 (Kupfer et al., 2007). In vitro overexpression of hGIMAP5 in Jurkat or naïve cells, as well as overexpression of rGIMAP5 in the rat T cell line C58 T can induce apoptosis. Similar results were obtained with the overexpression of the lymphopenia truncated protein (Dalberg et al., 2007). Even if these pro-apoptotic results seemed contradictory with the pro-survival role of GIMAP5 reported by others, it is important to understand the context in which the experiments were performed. Jurkat and C58 cells are tumor origin cell lines. Additionally, transfection times 5 hours) and the amount of transfected cDNA may in part explain part of the results. Nevertheless, these results help to understand that unbalanced GIMAP5 dosage inside cells can be a double-edged sword.

Furthermore, studies in mice have suggested that the antiapoptotic effect of GIMAP5 is possibly due to an interaction with anti-apoptotic protein Bcl-2 (Barnes et al., 2010; Nitta and Takahama, 2007; Zenz et al., 2004). In contrast, we have previously observed that the endogenous GIMAP5, not the overexpressed protein, failed to interact with Bcl-2 and resides in a different cellular compartment than the ER and mitochondria (Keita et al., 2007). Other studies suggest that the pro-apoptotic state of GIMAP5 deficient T cells could be a result of ER stress-mediated apoptosis through the C/EBP-homologous protein (CHOP) (Pino et al., 2009). In contrast, in the T-ALL leukemia disease, Gimap5 gene was the target of Notch (Chadwick et al., 2010, 2009). In collaboration with other mechanisms, such as mTOR activation by Notch-induced PI-3K\AKT (Mungamuri et al., 2006), c-Myc upregulation (Chan et al., 2007) and activation of the NF-κB pathway (Vilimas et al., 2007), GIMAP5 may protect T-ALL cell from apoptosis.

While GIMAP5 protein deficiency is primarily affecting peripheral mature naïve CD4 and CD8 T cells numbers, in BB-DP rats, GIMAP5 protein deficiency in mice results in greater and more significant consequences. Different strategies have been used to generate mice that are deficient for the GIMAP5 protein. In the first model of Gimap5 deficient mice, the first 130 amino acids were deleted by gene targeting (Schulteis et al., 2008). These mice not

only replicated the reduction of post thymic T cells found in the BBDP rats but also had a deficiency in natural killer (NK) T cells, an important granulocytosis and severe liver pathology that compromises their survival at around 15 weeks old. Moreover, bone marrow transfer of Gimap5-/- to wild-type recipients did not rescue the GIMAP5 deficient T cells phenotype. Additionally, another group reported that Gimap5 deficiency was affecting the survival of hematopoietic stem and progenitor cells in the same mice model (Chen et al., 2011). Furthermore, they showed that Flag-tagged mouse GIMAP5 could localize to the mitochondria and associate with the anti-apoptotic proteins Mcl-1, Bcl-xL, Bcl2 as well as to HSC70, in pre-B cells (Chen et al., 2011).

In the second mice model, a recessive germline mutation in the P-loop (G38C) of Gimap5 was developed by N -ethyl- N –nitrosourea (ENU), Sphinx (Gimap5sphinx/sphinx) (Barnes et al., 2010). This model recapitulated most of the findings in the Gimap5-/- mice, but these mice also developed intestinal inflammation and were unable to reconstitute the compartment of B cells. In contrast with GIMAP5 deficiency in rat T cells, mouse deficient GIMAP5 cells fail to proliferate after Ag receptor stimulation (Barnes et al., 2010). Subsequent studies in these mice revealed a Th17/Th1 polarization and reduced numbers of regulatory T cells, changes that are associated with the loss in Gimap5sphinx/sphinx mice of the Forkhead box group O: Foxo1, Foxo3, and Foxo4 (Aksoylar et al., 2012). Interestingly, when wild type Foxp3+ Treg cells were transferred to Gimap5 sphinx/sphinx mice, it prevented intestinal inflammation (Aksoylar et al., 2012).

A third model of Gimap5 deficient-mice was generated by interrupting the expression of Gimap5. To achieve this goal, the first 36 bps of the coding sequence of GIMAP5 was replaced by the neomycin resistance gene. In contrast to the two previously generated Gimap5 deficient mice, these mice showed a less severe phenotype, where no decrease in NK, NKT, CD4 or B cells was detected as well as no reduction in the life span of the Gimap5 deficient mice (Yano et al., 2014). The authors suggested that discrepancies may be due to the genetic background of the different mice. Although in the same paper, authors also

generated Gimap3-/- mice as well as Gimap5-/- Gimap3-/- mice (Yano et al., 2014). In fact, GIMAP3 protein is a paralogue of GIMAP5 as both of them share an identity of 80.5%. Observations in Gimap3-/- mice and both Gimap3 and Gimap5 deficient mice showed that GIMAP3 is important to maintain the production of lymphocytes. Deficiency of both proteins recapitulated previous Gimap5 KO mice and showed a cooperative function of both proteins, not only for the production of lymphocytes but in T cell survival.

Coming back to the rat model, as mentioned before, a frameshift mutation in this protein results in severe lymphopenia in BB-DP rat strains (Ramanathan and Poussier, 2001). Multiple studies have been done to elucidate the pro-survival role of GIMAP5 in naïve mature T cells. We and others have shown that mitochondrial membrane integrity is affected by the absence of GIMAP5 (Keita et al., 2007; Pandarpurkar et al., 2003). Our group also showed that Ca2+ flux was decreased in GIMAP5Lyp/Lyp primary T cells, after Thapsigargin

2+ (TG) stimulation or TCR engaging, suggesting that a decrease in [Ca ]i may be responsible for the impaired survival of these cells (Ilangumaran et al., 2009).

In concordance with these observations, we have published that the mitochondrial capacity to accumulate Ca2+ is reduced in GimapLyp/Lyp cells. Even if the GIMAP5 protein does not colocalize with mitochondria, other processes necessaries for mitochondrial Ca2+ uptake, such as mitochondrion movement along microtubules but not actin filaments, may be affected by the absence of GIMAP5. Similarly, an increase in mitochondrial Ca2+ accumulation was observed in stable HEK293T cells expressing GIMAP5 (Chen et al., 2013). In concordance, analysis of GIMAP5 capacity to interact with cytoskeletal elements showed that GIMAP5 was able to colocalize more importantly with microtubules than with actin filaments (Chen et al., 2013).

Furthermore, our group has recently published that basal Akt activity is increased in GIMAP5 deficient T cells from Gimap5Lyp/Lyp and Gimap5sphinx/sphinx, resulting in a basal increase of mTOR activation (Chen et al., 2015), which in other models has been associated

with increased apoptosis of peripheral T cells (Wu et al., 2011). Intrinsic defects that drives T cells to a premature apoptosis in the absence of GIMAP5 showed that a decrease proliferation capacity, as well as a reduction in the phosphorylation of STAT5 after IL-7 stimulation, was perturbed via signaling through TCR and IL-7 receptor (Chen et al., 2016), two of the basal pathways in naïve T cells survival.

Besides the lymphopenic role of GIMAP5 in BBDP rats. In other rats with different backgrounds, the absence of GIMAP5 has been associated with Eosinophilic bowel disease (Cousins et al., 2006), experimental autoimmune encephalomyelitis (EAE) (Fischer et al., 2016) and with an imbalance of Tregs and CD4 Th17 cells (van den Brandt et al., 2010). In humans, Gimap5 SNP has been associated with autoimmune diseases, such as type-1 diabetes and systemic lupus erythematosus (Hellquist et al., 2007; Shin et al., 2007). Moreover, GIMAP5 upregulation or overexpression have been associated with leukemia and B-cell lymphoid malignancies (Armstrong et al., 2009; Zenz et al., 2004). Additionally, recent studies have also implicated GIMAP5 in Behcet’s disease (Lee et al., 2012), asthma (Heinonen et al., 2015) and hepatocellular cancer (Huang et al., 2016). Underlining the importance of GIMAP5 in autoimmune diseases as a key regulator that helps to balance survival and death signals in immune cells.

2. RATIONALE AND HYPOTHESIS

2.1. Rationale The absence of the GIMAP5 protein has been associated with a decrease in naïve T cell survival not only in rats, where the mutation was discovered, but also in mice models where its deletion was induced. Uncovering the protein localization is critical to better understand the role of GIMAP5 in the biology of naïve T cell. Wong et al. have shown that human and mice GIMAP5 proteins can be associated with lysosomes (Wong et al., 2010). In parallel, previous work by our group has demonstrated that deficiency of GIMAP5 protein in T cells from rats carrying the Lyp mutation, leads to a decrease of Ca2+ flux to the cells. In fact, correct intracellular [Ca2+] is essential for different downstream cellular pathways n T cells that end in the activation of several genes implicated in survival and proliferation. Current knowledge of the molecular mechanisms in which GIMAP5 is playing a specific role is missing. In a similar manner, the sequence structure of GIMAP5 shows that the protein contains a TM region, important for membrane anchoring as well as coiled-coiled regions, which can serve the protein to form complexes. Furthermore, our group has shown that GIMAP5 can localize with microtubules and that this colocalization may be in part responsible for the incapacity of mitochondria to correctly uptake entry Ca2+ into the cell. Lastly, in rats and humans, two variants of the protein can be found, but currently there are no studies on the differences among the two variants, which could give more clues in the way GIMAP5 impacts T cell homeostasis. The main goal of this research project is to better define how GIMAP5 is affecting naïve T cell survival. As GIMAP5 seems to primarily impact Ca2+ homeostasis, I will focus on understanding how [Ca2+] is affected intracellularly, but also in the main organelles that contribute and regulate Ca2+ homeostasis, which are the ER, mitochondria, and lysosomes. Since organelles use the cytoskeleton to move through the cell, I will try to understand how GIMAP5 colocalization with the cytoskeleton network may impact the ability of the organelles to buffer Ca2+ correctly. To expand our understanding of GIMAP5’s role on naïve T cells, I have cloned both

of the variants as well as different deletion mutants. HEK293T cells stably expressing the constructions were used as a model, and subsequently, key findings were confirmed in primary T cells.

2.2. Hypothesis The absence of the GIMAP5 protein impairs long-term survival of naïve T lymphocytes by affecting intracellular [Ca2+] and its regulation via the buffering capacity of different organelles.

2.2.1. Aims 2.2.1.1. To elucidate which regions of GIMAP5 are implicated in Ca2+ homeostasis and cytoskeletal association Release of intracellular Ca2+ from the different deletion mutants, in the presence and absence of extra cellular Ca2+ will help to determine which regions play an important role in general Ca2+ homeostasis. Similarly, the different stable cells for the expression of the each of the mutants will be transfected or labelled for actin, tubulin or the motor proteins.

2.2.1.2. To expand the understanding of how GIMAP5 is affecting mitochondrial [Ca2+] By using FCCP to depolarize mitochondrial membrane we will follow the patterns of Ca2+ release to the intracellular media with Fura2 –AM or by confocal microscopy labelling the organelle and using rhod-2 as a specific Ca2+ dye

2.2.1.3. To confirm lysosomal localization and determine if GIMAP5 can localize elsewhere The different stable cell lines will be transfected with specific lysosomal and other vesicular markers to determine in which compartments GIMAP5 is present

2.2.1.4. To determine if GIMAP5 can influence lysosomal [Ca2+] and how it may impact naïve T cells. By using GPN that leads to loss of lysosome membrane integrity, I will determine indirectly by Fura2-AM in the absence or presence of extracellular Ca2+the role of GIMAP5 in the lysosomal compartment and its effects in naïve T cells, at time 0 and after TCR stimulation.

3. MATERIALS AND METHODS

3.1. Constructions and Cell lines Rat GIMAP5 variant 2 with an N-terminal Flag-tag, was sub-cloned using a pCDNA3.1 vector, which contained an N-terminal Myc-tag ratGIMAP5v2 (Keita et al., 2007) to PIRES-puro3 vector. Rat GIMAP5 variant 1, with an N-terminal FLAG-tag and human GIMAP5, was directly cloned from purified rat CD4 T cells or Jurkat cells into a pIRES-Puro3 vector, respectively. Deletion constructs were subcloned using their particular variants as templates. For fluorescent EGFP and mRFP GIMAP5 constructions, EGFP and mRFP proteins were subcloned into the pIRESpuro3 vector with flanking sites at the C-terminal that contain compatible restriction sites that were also designed at the N-terminal sites of GIMAP5 sequences.

The following primers were used for the cloning and sub-cloning of the different GIMAP5 constructions:

FLAG-GIMAP5V1 (Fw: GGAATTCGCCACCATGGATTACAAGGATGACGATGACAAGGAGGACCATGGCTTTG)

FLAG-GIMAP5V2 (Fw: GGAATTCGCCACCATGGATTACAAGGATGACGATGACAAGGAAGGCCTTCAGAAG)

FLAG-GIMAP5V1 and FLAG-GIMAP5V2 (Rv: CCAATGCATTGGTTCTGCAGTTTCATTTCCACCTGCCAA)

FLAG-GIMAP5V1ΔTM and V2ΔTM: (Rv: ATGCATTGGTTCTGCAGTTTCAGCAGGACGTGACTCTGCA)

EGFP (Fw: TGGGATATCGCCACCATGGTGAGCAAGGGCGAGGAG and Rv: CGGAATTCCTTGTACAGCTCGTCCAT) mRFP (Fw: TGGGATATCGCCACCATGGCCTCCTCCGAGGACGTC and Rv: CGGAATTCGGCGCCGGTGGAGTGGCG)

GIMAP5v1 to link with EGFP or mRFP (Fw: GGAATTCGAGGACCATGGCTTTGAG)

GIMAP5v2 to link with EGFP or mRFP (Fw: GGAATTCGAAGGCCTTCAGAAGAGC) human GIMAP5 (Fw: GGAATTCGCCACCATGGATTACAAGGATGACGATGACAAGGGAGGATTCCAGAGGGG) (Rv: TTGGCGGCCGCTTAAATGTAATGAAAGAT). HEK293T or HeLa cells were transfected using polyethylenimine Max 40000 (Polysciences, Inc) and the stable transfectants were selected using puromycin (2µg/ml). Protein expression was confirmed by immunofluorescence and by immunoblotting with an anti- FLAG antibody or by immunofluorescence for constructions tagged with fluorescent

proteins. Other cell lines used during the study were Jurkat cells and primary T CD4 and CD8 T cells from rats and mice. Cell lines were cultured in DMEM 5% FCS for HEK293T and HeLa or RPMI 10% FCS for Jurkat and primary cells. Both media contained 1% penicillin/streptomycin. Cells were cultured in a humidified atmosphere at 37°C in the presence of 5% CO2.

3.2. Reagents Antibodies against α-tubulin, tissue culture media, fetal calf serum, poly-D-lysine, Anti-FLAG antibody and Anti-FLAG M2 Affinity Gel, Nocodazole, Taxol, Latrunculineβ were from Sigma- Aldrich (Oakville, ON, Canada). Dynalbeads®-M450 tocyl activated beads, MitoTracker® Green, MitoTracker Deep Red, Texas Red® X-phalloidin, Fura-2, Rhod-2, Goat anti-Mouse IgG (H+L) Secondary Antibody and Alexa Fluor 633 were from Molecular Probes (Life Technologies, Carlsbad, CA, USA). GPN (Gly-Phe-β-naphthylamide) was from Santa Cruz Biotechnology. Nocodazole was obtained from Calbiochem

Plasmids pmEGFP_ α _tubulin_IRES_puro2b (Addgene plasmid # 21042) and pmCherry_ α _tubulin_IRES_puro2 (Addgene plasmid # 21043) were kind gifts from Dr. Daniel Gerlich (Steigemann et al., 2009).EGFP-IC2-FL (Addgene plasmid # 51409) was a gift from Dr. Trina Schroer (King et al., 2003). EYFP-KIF5C was a gift from Dr. Anne Stephenson (University of London, London, UK) (Smith et al., 2006). CMV-GFP-NMHC II-A was a gift from Robert Adelstein (Addgene plasmid # 11347) (Wei and Adelstein, 2000). HA-Rab1a, HA-Rab4, and HA-Rab6a were kind gifts of Dr. Jean-Luc Parent (Université de Sherbrooke) (Lachance et al., 2014). pmRFP-Rab5, pmRFP-Rab7, pDSRed-Rab9, pDSRed-Rab11 have been already described (Cayouette et al., 2010).

3.3. Animals Gimap5lyp/lyp and Gimap5+/+ rats in the ACI.1u background have been previously described (Keita et al., 2007). Rats were housed in micro-isolated sterile cages under specific pathogen-free conditions.

For some experiments, BL56 C57Bl/6 mice were purchased from Charles River Canada as controls, and Gimap5sph/sph mice were generously donated by Dr. Hoebe (Barnes et al., 2010). All experimental protocols were approved by the institutional animal ethical committee.

3.4. Isolation of T cell subsets CD4+ T lymphocytes were isolated from rat lymph nodes by negative magnetic selection, as described previously (Ilangumaran et al., 2009). In brief, lymph nodes were isolated from rats and put in cold PBS1x –FCS 2%. Next, while maintaining the lymph nodes permanently in PBS1X-FCS, lymph nodes were crushed with a 100 mesh filter size strainer. Recovered filtered solution in cold PBS1x –FCS 2% was centrifuged for 5 minutes at 1300 rpm and the supernatant was discarded. The pellet was tapped, and 1 ml of Ammonium-Chloride- Potassium (ACK) was added after 1 minute. 4 ml of PBS1x –FCS 2% were added to the tube and centrifuged at the same speed used previously. Next, in 1 ml of PBS –FCS 2%, 1:600 of OX8 antibody for CD8 depletion or W3/25 in combination with 1:500 of IgG antibody was added to the cells and incubated for 30 to 40 minutes at 4ºC. Afterwards, 4 ml of PBS1x – FCS 2% were added and the tubes were centrifuged. Following this, according to cell count, 25µl of pre-wash magnetic Dynabeads® Pan Mouse IgG were added for each 106 cells in 2 ml of PBS1x –FCS 2% and incubated at 4ºC with constant rotation for 40 minutes. Finally, using negative magnetic bead selection, tubes were incubated on a magnet for 2 minutes and the supernatant was preserved. For mice, CD4+ T cells were purified by negative selection using magnetic beads following the manufacturer’s instructions (Dynabeads, Life Technologies).

3.5. Immunoprecipitation and western blot For total protein extraction, denaturing SDS-PAGE sample buffer (50 mM Tris pH 6.8, 1% (w/v) SDS, 1 mM EDTA, 1 mM dithiothreitol) was added directly to the cells, then heated at 95 ºC for 5 minutes and charged into a 12% polyacrylamide gel. Proteins were transferred to hydrated PVDF membranes for 20 minutes at 15 volts using semidry transfer system (Bio-

Rad). Next, membranes were blocked in 5% milk TBST for 40 minutes and incubated overnight at 4 ºC with primary antibodies. After 3 washes in TBS-tween buffer, membranes were incubated 1 hour at room temperature with the appropriate HRP-conjugated secondary antibodies and developed with ECL reagent (GE Healthcare). Western blot images were captured with the VersaDOC 5000 imaging system (Bio-Rad).

For immunoprecipitation of FLAG-GIMAP5 proteins, Sigma-Aldrich Anti-FLAG M2 Affinity Gel, catalog # A2220 was used. As described in the company technical sheet: For a 70–90% confluent 100 mm dish, use 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.4, with 150 mM NaCl, 1 mM EDTA, and 1% TRITON X-100). - Remove the growth medium from the cells to be analyzed. Rinse the cells twice with PBS buffer, being careful not to dislodge any of the cells. Discard the PBS. Add lysis buffer. Next, incubate the cells for 15–30 minutes on a shaker, scrape and collect the cells. Centrifuge the cell lysate for 10 minutes at 12,000 ´ x g. Transfer the supernatant to a chilled test tube and perform all steps at 2–8 °C.

Thoroughly suspend the ANTI-FLAG M2 affinity gel in the vial, to make a uniform suspension of the resin. The ratio of suspension to packed gel volume should be 2:1. Then, centrifuge the resin at 5,000–8,200 ´ x g for 30 seconds. To let the resin settle in the tube, wait for 1– 2 minutes before handling the samples. Remove the supernatant with a narrow end pipette tip being careful not to transfer any resin. Wash the packed gel twice with 0.5 ml of TBS. Next, add 200–1,000 ml of cell lysate to the washed resin. If necessary, bring the final volume to 1 ml by adding lysis buffer. Agitate or shake all samples and controls gently (a roller shaker is recommended) for 2 hours or overnight. Then, centrifuge the resin for 30 seconds at 5,000–8,200 ´ g. Remove the supernatants and wash the resin three times with 0.5 ml of TBS. Make sure all the supernatant is removed. Finally, add 20 ml of sample buffer (125 mM Tris-HCl, pH 6.8, with 4% SDS, 20% (v/v) glycerol, and 0.004% bromphenol blue) and boil the samples for 3 minutes. Centrifuge the samples and controls at 5,000–8,200 ´ g for 30 seconds to pellet any undissolved agarose. Transfer the supernatants to fresh test tubes, ready for loading on SDS-PAGE and immunoblotting using ANTI-FLAG.

3.6. Quantitative PCR RNA was extracted and purified from primary rat CD4 or CD8 T cells. One µg/µl of RNA was converted to cDNA. The following primers were used for amplification of genes: for total Gimap5 both variants (Fw: ACACAGTCGAAGATGCCATG, Rv: TGGGTGAAGAGGACAATCATG), Gimap5v1 (Fw: CCATGACCTCAACGTCAGAA, Rv: CTCTGAGCCTGGACTCGAAC) and Gimap5v2 (Fw: AAGGCCTTCAGAAGAGCACA, Rv: CTCTGAGCCTGGACTCGAAC). Gene expression was evaluated using MyQi5® cycler (Biorad) using SYBR Green Supermix (Biorad).

3.7. Confocal Microscopy Stable HEK293T cell lines expressing the GIMAP5 constructs were grown on 15 mm coverslips and were transiently co-transfected with EGFP-αtubulin, EYFP-KFC5 (Kinesin) or EGFP-IC2-FL (Dynein). Forty-eight hours post-transfection cells were washed with PBS, fixed with 2% PFA for 13 minutes, washed, permeabilized with 0.2 % saponin for 12 minutes, washed, and blocked for 20 min with 2% milk in PBS. The slides were incubated with the appropriate primary Ab overnight at 4°C. After washing, the slides were stained with fluorochrome-conjugated secondary Abs along with DAPI that stains the nucleus. After the final wash, the slides were mounted with VectaShield (Vector Labs) before confocal microscopy. Images were acquired using an Olympus 1X81 FV1000 microscope with a 60X oil-immersion objective and images as well as Pearson coefficient was processed using Fluoview Olympus software. Pearson coefficient value over 0.5 to 1 was considered as significant colocalization.

For live cell microscopy, cells were grown on 25 mm coverslips for 48h before experiments. For mitochondrial calcium measurements, cells were loaded with MitoTraker Green (100 nM) and Rhod-2 (5µM) for 40 minutes at 37 ºC, washed and maintained in HEPES buffer supplemented with 2mM CaCl2 for de-esterification for 15 min before image acquisition. For image analysis, regions labeled for mitochondria were selected, and the Pearson coefficient of colocalization between Rhod-2 and MitoTracker was measured during the experiment time lapse. Some live cell microscopy videos were acquired using a Nikon

TE2000 microscope with a 100X oil-immersion objective and processed using HCImage imaging software (Hamamatsu Corporation).

3.8. Calcium measurements HEK293T cells grown on 25 mm coverslips for 24-72 h or primary purified T cells were plated on poly-L-lysine coated coverslips were loaded with 1µM Fura 2-AM for 30 min at 37oC. Coverslips were washed and de-esterified for 20 minutes at room temperature in Ca2+ loading buffer (120mM NaCl, 1mM Na2HPO4, 0.5mM MgCl2 6H2O, 5,5 mM glucose, 25 mM

HEPES and 2mM CaCl2, pH 7.3). Coverslips were then placed in a chamber in an Olympus IX71 microscope (Olympus Canada Inc., Markham, ON, Canada) equipped with a Lambda- DG-4 illuminator (Sutter Instrument Company, Novato, CA, USA).

2+ 2+ Cytosolic Ca [Ca ]c measurements were done over an average of 50-70 cells per coverslip per experiment for HEK293T cells and on an average of 100-150 for primary purified CD4T

2+ cells. [Ca ]c were measured at room temperature using 2 different excitation wavelengths of 340nm and 387nm and fluorescence emission was monitored at 510nm through a 415- 570nm dichroic mirror using an EvolveTM EMCCD camera (photometrics, Tucson, AZ, USA). Image digitalization was done using MetaFluor software (Universal Imaging Corporation, Downingtown, PA, USA). In experiments where there was no Ca2+ in the extracellular medium, 0.5 mM EGTA was added to the loading buffer instead of 2 mM CaCl2 to chelate any extra cellular Ca2+. For all experiments, a baseline time of 1 minute was done before

2+ treatment of cells with TG, FCCP or GPN. Free [Ca ]i was calculated using the Grynkiewicz method (Grynkiewicz et al., 1985).

3.9. Statistical analysis The values are presented as a mean and standard error (SEM). Data was analyzed by ANOVA and Student t-test. P values less than 0.05 were considered statistically significant.

4. RESULTS

4.1. GIMAP5 protein constructs Andersen et al. (Andersen et al., 2004) have previously shown that from several transcripts that can be generated from the rat Gimap5 gene; two were more abundantly expressed. Gimap5 variant 1 is composed of 326 amino acids and variant 2 of 308 amino acids. Protein alignment using the Universal Protein Resource (UniProt) showed that both proteins share 90.8% identity and that both variants only differ in the first 32 aa (Figure 4-1A). Of the 2 transcripts, variant 2 (rGIMAP5v2) which is 308 a.a in length, is more abundant (Andersen et al., 2004), and therefore was cloned easily from naïve T lymphocytes (Keita et al., 2007; MacMurray et al., 2002). Using primers that are unique to the N-terminal sequence of rGIMAP5v1, we cloned rGIMAP5v1 from cDNA prepared from CD4+ T cells isolated from the lymph nodes of ACI.1u.Gimap5+/+ rats. As GIMAP5 has a C-terminal membrane anchor, we added Flag-tag to the N-terminal region. PCR-based cloning generated the different deletion constructs into the pIRES_puro3 vector (Figure 4-1B). The accuracy of the constructs was verified by sequencing. The expression at the protein level was confirmed by immunoblotting with anti-Flag antibodies using lysates generated from the stable HEK293 cells expressing each of the constructs (Figure 4-1C). Full-length versions of rGIMAP5v1, rGIMAP5v2, and the 2 variants lacking the transmembrane domain delta TM- rGIMAP5v1 and Delta TM-rGIMAP5v2 were used in further studies (Figure 4-1B).

Figure 4- 1: Cloning of GIMAP5 variants. A) Protein sequence alignment of v1 and v2 variants of rat GIMAP5 protein. The predicted structure was obtained from http://www.uniprot.org. Accession numbers: Q8K3L6 (variant 1) and Q0R3W7 (variant2). GIMAP5 deletions were made in the C-terminal transmembrane domains by PCR cloning. AIG, AIG1-type guanine nucleotide-binding; C-C, coiled-coiled; TM, transmembrane domain. All constructs were tagged at the N-terminus with Flag, RFP or EGFP tag. C) Western blot analysis of Flag-tagged GIMAP5 constructs expressed in HEK293T cells.

4.2. T cells express predominantly the shorter variant of GIMAP5 Using universal primers that recognize both forms of rGIMAP5 (Figure 4-1A), (Dion et al., 2005) observed that transcripts for the rGIMAP5 were detected in CD4+CD8+ double positive (DP), CD4+ or CD8+ single positive (SP) thymocytes and peripheral T cells. Given that we have previously shown that the activation of T cells from Gimap5lyp/lyp rats rescued them from imminent death and resulted in their proliferation (Ramanathan et al., 1998). Therefore,, we assessed the expression of the 2 variants of Gimap5 in rat CD4+ T cells following activation with PMA and ionomycin. Twenty-four hours following activation,

Gimap5 expression was decreased in both CD4+ and CD8+ T cells from control rats (Figure 4.2B). Next, we assessed the expression of the 2 variant forms in naïve and activated T cells. The expression of the smaller variant 2 was 8-10 folds higher in comparison with the longer variant 1 (Figure 4-2A). However, activation of T cells resulted in reduced expression of both isoforms by 24 hours. These observations confirm the earlier prediction on the relative abundance of the 2 species of Gimap5 transcripts. In summary, variant 2 is expressed at a higher level than variant 1 in rat CD4 T cells. The decrease in Gimap5 transcripts following activation correlates with the functional data that activation by antigen in vivo temporarily overcomes the requirement for GIMAP5 (Ramanathan et al., 1998).

Figure 4- 2: Gene expression of Gimap5 variants in rat T lymphocytes. A) The expression of Gimap5 mRNA in primary T cells was measured by RT-qPCR. CD4+ and CD8+ T cells were purified from lymph nodes of Gimap5lyp/lyp and control rats and stimulated with PMA/Ionomycin (P/I) for 24h. Expression of the Gimap5 variants v1 and v2 in control and stimulated cells was measured by RT-qPCR using specific primers. B) Expression of total Gimap5 and the variants in CD4+ and CD8+ T cells after activation for 24h with PMA/Ionomycin was measured using primers that amplify a common sequence fragment in both isoforms.

4.3. GIMAP5 variants co-localize similarly with cytoskeletal elements We have previously shown that over-expressed GIMAP5v2 colocalized with microtubules (Chen et al., 2013). To determine how the 2 variants and some regions of GIMAP5 protein were associated with microtubules, we expressed cherry-α-tubulin in HEK293T cells stably expressing EGFP-tagged GIMAP5 variants. As shown in Figure 4-3, both variants colocalized

with microtubules, with a significantly higher colocalization coefficient for GIMAP5v2. On the other hand, GIMAP5v2 did not colocalize with actin in HEK293T stained with phalloidin texas red to label actin filaments (Figures 3-4). Deletion of the TM domain resulted in a diffuse cytoplasmic staining and showed increased colocalization with microtubules, probably due to the loss of the restraints posed by the TM anchor (Figure 4-3). Accordingly, the expression of RFP-GIMAP5v2ΔTM followed in vivo did not show any vesicular pattern of staining when compared to the full-length protein (Figure 4-5). Thus, GIMAP5v2 associates significantly higher than GIMAP5v1 with microtubule structures and their association with actin filaments in HEK293T cells is not significant.

Figure 4- 3: Co-localization of GIMAP5 variants with microtubules. Stable transfectants of HEK293T cells expressing full-length and TM-deletion constructs of GIMAP5 tagged with EGFP were transiently transfected with cherry-α-tubulin and analyzed by confocal microscopy (A). Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient (B).

Distinct motor proteins are involved in the movement of organelles on microtubules (Hancock, 2014; Wade and Kozielski, 2000). Due to the possible implication of GIMAP5 in organelle movement, we investigated its colocalization with the molecular motor proteins, kinesin, and dynein that interact with microtubules (Hancock, 2014).

Figure 4- 4: Co-localization of GIMAP5 variants with actin filaments. Stably HEK293T cells expressing full-length and TM-deletion construct of GIMAP5 tagged with EGFP were labeled with phalloidin and analyzed by confocal microscopy (A). Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient (B).

Figure 4- 5: GIMAP5v2ΔTM diffuse cellular localization. HEK293T cells expressing RFP-GIMAP5v2ΔTM. Image extracted from live video acquisition under a 100x epifluorescence microscope.

Similarly, HEK293T cells were study for the capacity of GIMAP5 to colocalize with motor proteins kinesin and dynein. In the previously described stable cell lines for the expression of GIMAP5 variants and its mutants, significant colocalization of rGIMAP5v2 over rGIMAP5v1, occurred with kinesin but not with dynein, suggesting that GIMAP5 may be involved in kinesin-mediated retrograde cargo movement (Figure 4-6 and 3-7). Results for the TM mutants showed a similar colocalization with GIMAP5 as it was observed for microtubules, suggesting that the diffuse distribution of the protein without its anchorage region increases its colocalization coefficient with the cytoskeleton. As expected, when we analyzed the capacity of GIMAP5 to colocalize with the major motor protein on actin filaments, myosin, we observed no colocalization in HeLa cells (Figure 4-8).

Figure 4- 6: Co-localization of GIMAP5 variants with kinesin. Stably HEK293T cells expressing FLAG-tagged GIMAP5 constructs were transiently transfected with EYFP-KIF5C (kinesin) for 48 hours and analyzed by confocal microscopy. Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient (B).

To visualize the movement of GIMAP5 containing vesicles, HEK293T cells that stably express EGFP-tagged GIMAP5v2 were transfected with cherry-tagged α-tubulin, and the dynamics of GIMAP5 containing vesicles was assessed by epifluorescence microscopy. Microtubule- associated GIMAP5v2-containing vesicles showed directional movement along the microtubules (Figure 4-9). This result confirms our colocalization studies showing that GIMAP5 is associated with the cytoskeletal network.

Figure 4- 7: Co-localization of GIMAP5 variants with dynein. Stably HEK293T cells expressing FLAG-tagged GIMAP5v2 constructs were transiently transfected with EGFP-IC2-FL (dynein) for 48 hours and analyzed by confocal microscopy (A). Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient (B).

Figure 4- 8: Absence of co-localization of GIMAP5 with myosin. HeLa cells were transiently transfected with EGFP-NMHC-IIA (Myosin) and GIMAP5, RFP-GIMAP5v2 for 48 h previous to fixation and analysis by confocal microscopy. Bar represents 10 μm

Figure 4- 9: GIMAP5v2 expressing vesicles move along microtubules. HEK293T cells stably expressing EGFP-tagged GIMAP5v2 were transiently transfected with cherry-α tubulin. White and yellow arrows track the movement of particular vesicles. The vesicles are either filamentous or spherical. The speed of their movement is not uniform. Image sequences were extracted from live video under 100X magnification under epifluorescence microscopy. Bar represents 5 μm

4.4. GIMAP5v2, but not GIMAP5v1, regulates cellular Ca2+ While the absence of GIMAP5 results in the precocious death of T cells, its overexpression also induces apoptosis in T cell lines (Pino et al., 2009). In addition to apoptosis, T cells from Gimap5lyp/lyp rats showed diminished Ca2+ influx from the extracellular medium following activation through the T cell receptor (Ilangumaran et al., 2009). As Gimap5v2 was more abundant than Giamp5v1 in rat T lymphocytes, it is possible that Gimap5v2 mediates the regulation of Ca2+ homeostasis. To determine whether Gimap5v1 also regulates cellular Ca2+, we studied the Ca2+ flux in HEK293T cells expressing GIMAP5v1. We have shown previously that expression of GIMAP5v2 in HEK293T cells did not induce apoptosis but modulates Ca2+ flux in a manner reminiscent of the responses observed in T cells (Chen et al., 2013; Ilangumaran et al., 2009; Keita et al., 2007). In the absence of extracellular Ca2+, the wild-type GIMAP5v1 and GIMAP5v2, as well as the ΔTM constructs did not have an effect on thapsigargin (TG)-induced release of Ca2+ from the ER (Figure 4-10A), suggesting that GIMAP5 is not influencing Ca2+ release from the ER store.

Figure 4- 10: Full-length GIMAP5v2 regulates intracellular Ca2+ homeostasis. Cytosolic Ca2+ concentration following the addition of TG was measured using Fura-2 in HEK293T stable cell lines expressing empty vector or different GIMAP5 constructs following the addition of TG. A) Ca2+ release from the ER was measured in a medium containing 0mM Ca2+ and 0.5mM EGTA following the addition of TG. (B) The increase in cytosolic Ca2+ induced by release of the ER store and influx from the extracellular medium was measured following the addition of TG in the presence of 2mM Ca2+. For all experiments, cells were plated on coverslips 48h before analysis. Each experiment is an average of 40 to 60 cells. Representative data from 3 to 5 independent experiments with comparable results are shown. (C) The peak value for cytosolic Ca2+ influx shown in (B) is plotted as a bar graph and compared by Student’s t-test. * p<0.05

These observations are also in agreement with our previous report that Ca2+ release from the ER was not affected by the lyp mutation in rat T lymphocytes (Ilangumaran et al., 2009). On the other hand, TG-induced Ca2+ influx in the presence of extracellular Ca2+ was modestly but not significantly reduced in GIMAP5v1. However, a significant reduction was observed in cells expressing GIMAP5v2 but not in cells expressing GIMAP5v1ΔTM or GIMAP5v2ΔTM (Figure 4-10 B-C). Indicating that the N-terminal domain of GIMAP5v2 and the membrane anchor is required for regulating Ca2+ influx.

4.5. GIMAP5 influences mitochondrial Ca2+ uptake Engagement of TCR leads to the generation of IP3 that bind to their receptors, IP3R, present on the ER surface and results in calcium release from the ER. Following the emptying of the ER Ca2+, STIM1 that is no longer bound to Ca2+ in the ER oligomerizes and associates with the plasma membrane Ca2+ channels, which are referred to as store-operated calcium (SOC)

channels (Vig and Kinet, 2009). Mitochondria buffer the incoming Ca2+ and thus prevent premature negative feedback inhibition of these channels (Quintana and Hoth, 2012). We had observed defective accumulation of Ca2+ by mitochondria in T cells from Gimap5lyp/lyp rats following crosslinking of the T cell receptor. As a corollary, rGIMAP5v2 cells showed increased accumulation of mitochondrial Ca2+ (Chen et al., 2013). Given that microtubules and kinesin motors play a major role in the movement of organelles including that of mitochondria, it is possible that the interaction of GIMAP5 with microtubules and kinesin can modulate the movement of mitochondria and influence their ability to buffer the influx of Ca2+.

We have previously shown that the release of Ca2+ from the endoplasmic reticulum was not affected by Gimap5 mutation following cross-linking of the TCR complex or inhibition of the SERCA pump by thapsigargin (TG) in primary T cells (Ilangumaran et al., 2009). Similarly, GIMAP5 does not influence the content or the release of Ca2+ from the ER (Figure 4-10 A). Therefore, we assessed whether rGIMAP5v1 and the different deletion mutants affect the uptake of Ca2+ by mitochondria and indirectly Ca2+ homeostasis. Stable cell lines expressing the variants and mutants of GIMAP5 were loaded with Rhod2, a Ca2+ binding dye that targets mitochondria. Mitochondria were simultaneously labeled with Mitotracker green. Mitochondrial Ca2+ was assessed through determining the colocalization between Mitotracker green (green) and Rhod2 (red) fluorescence, as described previously (Chen et al., 2013). The colocalization between the red and the green fluorescence that reflects the

2+ 2+ mitochondrial Ca , [Ca ]m, was expressed in terms of Pearson’s coefficient. Following the addition of TG in the presence of 2mM Ca2+ containing buffer, rGIMAP5v2 showed an

2+ increase of [Ca ]m (Figure 4-11). In contrast, rGIMAP5v1 showed only a modest increase in

2+ [Ca ]m. Thus, the N-terminal domain of rGIMAP5v2 appears to regulate the mitochondrial Ca2+ uptake. In parallel, cells expressing C-terminal trans-membrane domain deletions

2+ rGIMAP5v1ΔTM and rGIMAP5v2ΔTM showed a comparable increase in [Ca ]m to that of control cells (Figure 4-11). In fact, the mitochondrial accumulation Ca2+ content was diminished in cells expressing the deletion constructs even after the addition of TG. These

observations suggest that the 32 amino acids at the N-terminal of rGIMAP5v2 play a major role in Ca2+ homeostasis as well as the transmembrane region.

Figure 4- 11: GIMAP5v2 promotes mitochondrial Ca2+ accumulation. Mitochondrial Ca2+ is expressed as the co-localization (Pearson’s coefficient) between Mitotracker green and Rhod-2 following the addition of TG in the presence of 2mM Ca2+. For all experiments, stably HEK293T cells were plated on coverslips 48 h before analysis. Each experiment is an average of 40 to 60 cells. Representative data from 3 to 5 independent experiments is shown.

4.6. GIMAP5v2 influence Mitochondrial Ca2+ content Even though T lymphocytes from Gimap5lyp/lyp rats display impaired mitochondrial Ca2+ uptake, this defect was not observed when the lymphocytes were permeabilized (Chen et al., 2013), suggesting that the primary defect in cellular Ca2+ homeostasis in these lymphocytes may not be at the mitochondrial level. To determine whether there were differences in the mitochondrial Ca2+ content in the resting state, we probed the mitochondrial content by releasing its Ca2+ using carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), that uncouples the mitochondrial membrane potential, in the absence of extracellular Ca2+. As shown in Figure 4-12A, the amount of Ca2+ released from the mitochondria in Gimap5lyp/lyp T lymphocytes was slightly lower than that observed in T lymphocytes from control rats. These observations suggest that the mitochondrial Ca2+ content may be reduced in T lymphocytes due to the lyp mutation. It is also possible that this reduction in the mitochondrial Ca2+ content is a reflection of the modest loss in

mitochondrial membrane potential ex vivo (Keita et al., 2007). To determine whether GIMAP5 intrinsically influences the mitochondrial Ca2+ stores directly, we assessed cytosolic Ca2+ released by FCCP in control and GIMAP5v2 expressing HEK293T cells. In the absence of extracellular Ca2+, the release of Ca2+ from mitochondria by FCCP was comparable between control and GIMAP5v2 expressing cells (Figure 4-12B). These observations suggest that GIMAP5 minimally influences the Ca2+ content of mitochondria at steady state. However, similar to the results obtained with TG, the entry of Ca2+ from extracellular milieu following FCCP was still significantly decreased in HEK293T cells expressing GIMAP5v2 (Chen et al., 2013). Thus, even if the Ca2+buffering capacity of mitochondria is higher in GIMAP5v2 expressing HEK293T cells as shown by us previously (Chen et al., 2013), the differences observed in Ca2+ influx from extracellular medium cannot be exclusively explained by alterations in the mitochondrial Ca2+ content in the steady state.

Figure 4- 12: Influence of GIMAP5v2 on Ca2+ release from mitochondria. Cytosolic Ca2+ concentration following the addition of FCCP (50 μM) was measured in the absence of extracellular Ca2+ in Fura-2 -loaded (A) CD4+ T cells purified from Gimap5lyp/lyp and control rats and in (B) Fura-2-loaded HEK293T stable cell lines expressing empty vector or GIMAP5v2. For all 55

experiments, cells were plated on coverslips 48h before analysis. Each experiment is an average of 40 to 60 cells. Representative data from 2 independent experiments are shown. The peak value for cytosolic Ca2+ influx for primary T cells is plotted as a bar graph and compared by Student’s t-test. * p<0.05.

GIMAP5 is localized on lysosomes and certain vesicles through the C-terminal anchor GIMAP5 influences the mitochondria’s capacity to properly regulate Ca2+, however, it does not colocalize with mitochondria (Keita et al., 2007) (Figure 4-13). The TM domain, which is common to both GIMAP5 variants, targets the protein to certain intracellular membranes. Human and murine GIMAP5 proteins have been reported to be present on lysosomes in T lymphocytes (Wong et al., 2010).

Figure 4- 13: GIMAP5v2 does not colocalize with mitochondria. Stably HEK293T cells for the expression of GIMAP5v2 were loaded with Mitotracker deep red and analyzed by confocal microscopy. The image to the right represents a zoom of the cell from the center. Bar represents 10 μm

Due to a combination of previous findings along with our observations (Figure 4-9) where GIMAP5 was found to be part of rounded and tubular like vesicle structures, we decided to further characterize its localization. First, we incubated the HEK293T stable cell lines for GIMAP5 expression with the lysosomal marker, Lysotracker red. Unexpectedly, neither GIMAP5 variant 1 nor variant 2 colocalized with Lysotracker, but interestingly we observed that the GIMAP5 vesicular structures contain the lysosomal marker in their lumen (Figure

4-14). We then, transiently transfected EGFP-GIMAP5 expressing HEK293T cells with LAMP1-mRFP, a known protein that resides principally in the lysosomal membrane. Since both proteins were fluorescently tagged, we monitored the cells in real-time. Figure 4-15 shows that both proteins shared the same vesicular structure and that both move along in the same lysosomal structures, demonstrating that rat GIMAP5 resides at the lysosomal membrane. To further characterize GIMAP5 lysosomal localization, we transfected both of the GIMAP5 variants, as well as their respective mutants without the transmembrane regions, with the lysosomal protein LAMP2. These mutants deleted for trans-membrane domain did not colocalize with LAMP2 (Figure 4-16), suggesting that GIMAP5 is anchored on the lysosomes through the C-terminal TM domain. Due to the potential role for GIMAP5 in regulating Ca2+ homeostasis, we transfected the cells with the recently discovered lysosomal resident protein, TPC2 (McCue et al., 2013), which is a Ca2+ channel in lysosomes. As expected, both GIMAP5 and TPC2 colocalize in the same vesicular structures (Figure 4- 17).

Figure 4- 14: Co-localization of GIMAP5v2 with Lysotracker Red. EGFP-tagged GIMAP5v2 or GIMAP5v1 expressing HEK293T cells lines were labeled with Lysotracker Red that accumulates in the lysosomal lumen and analyzed by confocal microscopy. Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient.

Figure 4- 15: Movement of GIMAP5v2 and LAMP1 expressing vesicles in HEK293T stable cells. HEK293T stable transfectants of EGFP-tagged GIMAP5v2 were transiently transfected with Lamp1- mRFP. Cells were viewed under a 100X epifluorescence microscope. In the images extracted from the movie, two cells stably transfected for EGFP-GIMAP5 can be seen, and the cell on the left shows the transient transfection for Lamp1-mRFP only.

In addition to its lysosomal localization, we have also observed that GIMAP5 was present on other vesicle-like structures that were not labeled by lysosomal markers. Several types of vesicles are present within the cells for different functions (Fukuda, 2008; Stenmark, 2009). The movement of these vesicles is tightly regulated, and they constantly dock and fuse with other vesicles or cellular membranes carrying and delivering various cargoes (Stenmark, 2009).

Figure 4- 16: GIMAP5 variants are anchored on the lysosomal membrane through the C- terminal transmembrane domain. Stable transfectants of HEK293T cells expressing full-length or C-terminal TM domain-deleted GIMAP5 constructs tagged with EGFP were labeled with (B) anti-LAMP2 antibody and analyzed by confocal microscopy. Bar represents 10 μm. Insets show the area analyzed for colocalization. Colocalization values are expressed as Pearson’s coefficient.

Figure 4- 17: GIMAP5 colocalizes with the lysosomal Ca2+ channel TPC2. Stable transfectants of HEK293T cells expressing full-length GIMAP5v2 constructs tagged with EGFP were transiently transfected with cherry-TPC2 and analyzed by confocal microscopy. Bar represents 10 μm. Insets show the area analyzed for colocalization. Colocalization values are expressed as Pearson’s coefficient.

Rab GTPases are the largest family of small GTPases, containing more than 60 members, and are present in different vesicular/intracellular membrane compartments (Pereira-Leal and Seabra, 2001). In addition to regulating vesicle trafficking, Rabs also serve to identify the different vesicle compartments in the endo-lysosomal system (Stenmark, 2009). Among all the various Rab proteins that have been identified, some have been reported as being enriched in certain types of endosomes. Early endosomes contain RAB5 and RAB4, late endosomes are enriched in RAB7, and RAB9 and recycling endosomes principally contain RAB11. Since GIMAP5 is present in different vesicular compartments apart from lysosomes, we decided to better characterize the other compartments where GIMAP5 was present by transfecting the cells with the more known and routinely used RAB proteins. In parallel, we also used two RABs that are present in trans-Golgi associated vesicles. We observed that GIMAP5 colocalized with the early endosomal Rabs 4 and 5, with the late endosomal RAB proteins 7 and 9, as well as with the recycling endosomal compartment protein RAB 11. In contrast, no colocalization was observed with the trans-Golgi vesicle RAB proteins 1 and 6 (Figure 4-18).

The above results indicate that GIMAP5 is inserted in the lysosomal membrane as well as in different compartments of the endolysosomal pathway through the C-terminal anchor and suggest that the N-terminal regions of GIMAP5 reside in the cytosol.

Figure 4- 18: GIMAP5 colocalizes with different vesicles of the endo-lysosomal system. HEK293T cells expressing EGFP-tagged GIMAP5v2 were transiently transfected with plasmids expressing pmRFP-Rab5, pmRFP-Rab7, pDSRed-Rab9, pDSRed-Rab11, HA-Rab1a, HA-Rab4 or HA- Rab6a. HA-tagged Rabs were labeled with anti-HA antibody followed by secondary anti-mouse antibody tagged with Alexa Fluor 633 and analyzed by confocal microscopy. Bar represents 10 μm. Colocalization values are expressed as Pearson’s coefficient

4.7. GPN-induced Ca2+ release is increased in the absence of GIMAP5v2 GIMAP5v2 localizes with lysosomal membrane proteins LAMP1 and TPC2 (Figure 4-16 and Figure 4-17). Similarly, GIMAP5v2 interacts with kinesin and the GIMAP5v2-containing lysosomes move along the microtubule network. Therefore it is possible that GIMAP5v2 might be involved in the regulation of lysosomal Ca2+ homeostasis. To address this hypothesis, we assessed the possibility that GIMAP5 influences lysosomal Ca2+ content. In fact, lysosomes can store up to 0.5mM of Ca2+ in their lumen (Lloyd-Evans et al., 2008; Morgan et al., 2011). Hydrolysis of Gly-Phe β-naphthylamide (GPN) within the lysosomes by cathepsin C results in osmotic lysis of the acidic compartment (Haller et al., 1996). Thus, the GPN-mediated release will be a reflection of the Ca2+ content of lysosomes. Treatment with GPN resulted in a higher cytosolic Ca2+ content in T lymphocytes from Gimap5lyp/lyp rats when compared to T cells from control rats (Figure 4-19A). When GPN was added in the presence of extracellular Ca2+, influx from extracellular milieu was observed in T lymphocytes suggesting that emptying the lysosomal stores can induce the Ca2+ channels to open on the plasma membrane in these cells (Figure 4-19B). Strikingly, Gimap5lyp/lyp T cells, despite showing increased lysosomal Ca2+ release (Figure 4-19A), displayed substantially reduced Ca2+ influx from the extracellular medium when compared to controls (Figure 4-19B).

Figure 4- 19: GPN-mediated release of Ca2+ is increased in the absence of GIMAP5. Peripheral CD4+ T cells purified from Gimap5lyp/lyp and control rats were loaded with Fura-2, and intracellular Ca2+ was measured as described. The arrow indicates the time of addition of GPN (100μM). Measurement of cytosolic Ca2+ following the addition of GPN in the absence (A) or presence (B) of extracellular Ca2+. The histograms represent the area under the curve (AUC) and the peak values. Student’s t-test ** p< 0.005. (C) Cytosolic Ca2+ was measured using Fura-2-labelled stable transfectants of the indicated GIMAP5 constructs. The cells were maintained in Ca2+ -free medium (0mM Ca2+ and 0.5mM EGTA) and GPN and TG were added sequentially as indicated before adding Ca2+ to the extracellular medium. (D) Ca2+ release from stable transfectants of the vector control or GIMAP5v2 following the addition of GPN in the presence of extracellular Ca2+.

To understand the mechanisms by which GIMAP5 influences lysosomal Ca2+ compartment, we probed the lysosomal Ca2+ content in HEK293T cells stably expressing different constructs of GIMAP5. The GPN-induced Ca2+ release was reduced in cells expressing GIMAP5v2, but not in cells expressing empty vector, GIMAP5v1, or GIMAP5v2ΔTM (Figure 3-19C). These observations suggest that the presence of full-length GIMAP5v2 is required and is sufficient to prevent the accumulation of Ca2+ by lysosomes. To determine whether the lysosomal and ER Ca2+ stores are related and to see if they influence each other, we sequentially released Ca2+ from lysosomes and ER (Figure 4-19C). The release of Ca2+ from the ER, after that of lysosomal Ca2+, was higher in cells expressing GIMAP5v2. Sequential

release of Ca2+ from lysosomes and ER in GIMAP5v2 expressing cells resulted in a greater influx of Ca2+ from the extracellular milieu when compared to that of control cells. As treatment with TG (Ilangumaran et al., 2009) or GPN alone (Figure 4-19D) resulted in reduced Ca2+ influx from the extracellular milieu in GIMAP5v2 expressing cells, it suggests that in HEK293T cells, the lysosomal and ER Ca2+ stores are independently regulated.

Figure 4- 20: GPN-induced lysosomes osmotic lysis is similar for Control and GIMAP5 expressing cells. HEK293T control cells and GIMAP5 stably expressing cells were incubated with Lysotracker. Next, the cells were visualized live under a confocal microscope and treated with GPN. Decreased of Lysotracker fluorescence after GPN treatment was measured using the Olympus confocal software and then plotted on the prism analysis software.

To discard the possibility that the stable expression of GIMAP5 in HEK293T cells may, in some way, influence the effect of GPN on lysosomes, control, and GIMAP5 stable cells were incubated with lysotracker red, which accumulates into the lysosomes, and treated with GPN. As showed in Figure 4-20, Lysotracker fluorescence intensity decreased at a similar rate for both control and GIMAP5 expressing cells. Due to the fragility of Gimap5lyp/lyp T lymphocytes, we could not carry out similar experiments in primary T cells. Nevertheless, our findings on the overexpression system lend support to the idea that dynamic interaction

between lysosomes and ER modulates the Ca2+ flux response (López Sanjurjo et al., 2014; Morgan et al., 2013).

Figure 4- 21: Nocodazole treatment increases the Ca2+ influx following GPN treatment. Cytosolic Ca 2+ was measured following addition of TG or GPN in the presence of extracellular Ca 2+ in T lymphocytes pretreated or not with nocodazole (2 µM) for 30 min.

4.8. Nocodazole treatment increases the Ca2+ influx following GPN treatment Mitochondrial movement on cytoskeletal elements to Ca2+ rich microdomains is required for the maintenance of the steady influx of the Ca2+ (Chen et al., 2013; Hajnóczky et al., 2002; Quintana et al., 2006). In T lymphocytes, soluble mediators such as anti-TCR antibodies or TG requires the movement of mitochondria on microtubules while movement on actin filaments is observed to maintain the Ca2+ influx at the immunological synapse (Chen et al., 2013; Quintana et al., 2006). Even though the capacity of mitochondria to take up Ca2+ is not defective in permeabilized Gimap5lyp/lyp T lymphocytes, they were not efficient in buffering the Ca2+ influx (Quintana et al., 2006) . In support, nocodazole treatment of T lymphocytes from control rats resulted in a substantial decrease in TG-induced Ca2+ influx through the plasma membrane while the minimal effect was observed in T lymphocytes from Gimap5lyp/lyp rats (Figure 4-21). As GIMAP5 appears to be involved in the interaction between lysosomes and microtubules (Figure 4-9), we measured Ca2+ influx through the plasma membrane following GPN treatment in T lymphocytes that were pre-treated with nocodazole. TG-induced Ca2+ influx was decreased as early as 2 min in control T lymphocytes, while no difference was observed in Gimap5lyp/lyp T lymphocytes (Figure 4-21). These observations complement our previous report that addition of nocodazole prevented mitochondrial Ca2+ uptake in T lymphocytes from controls, but not in Gimap5lyp/lyp T

lymphocytes (Chen et al., 2013; Quintana et al., 2006). To our surprise, we observed that the lysis of lysosomes and the consequent release of lysosomal Ca2+ did not influence Ca2+ influx from the extracellular milieu in both control and Gimap5lyp/lyp T lymphocytes until 6 min (Figure 4-21). At later time points, the Ca2+ influx was considerably increased in control T lymphocytes, while the mutant T lymphocytes showed a modest increase. These observations suggest that Ca2+ uptake by lysosomes, rather than mitochondrial translocation to Ca2+ rich microdomains acts as a brake on sustained Ca2+ influx through the plasma membrane and that GIMAP5 may have a role to play in this regulation.

4.9. Lysosomes accumulate Ca2+ following cross-linking of TCR Given that GIMAP5 appears to regulate lysosomal Ca2+ in T cells, we assessed the involvement of lysosomes in Ca2+ homeostasis during T cell activation. A steady influx of Ca2+ through the CRAC channel is maintained by the buffering of cytosolic Ca2+ by mitochondria (Hoth et al., 1997). Mitochondrial Ca2+ increases within 10 to 15 min following cross-linking of TCR on the cell surface (Chen et al., 2013; Quintana et al., 2006). To determine whether lysosomes contributed to the accumulation of Ca2+ following T cell activation, we assessed the lysosomal Ca2+ content at various time points following TCR stimulation by releasing their Ca2+ with GPN. CD4+ T cells from control and Gimap5lyp/lyp rats were stimulated with anti-TCR antibody R73 in the presence of Ca2+. At indicated time points, coverslips containing stimulated T cells were transferred to the Ca2+-free medium, and GPN was added to measure the amount of Ca2+ released from the lysosomes (Figure 4- 21A). The lysosomal Ca2+ content was consistently higher between 30 and 90 minutes following cross-linking of TCR in T cells from control and Gimap5lyp/lyp rats (Figure 4-22B-C). This suggests that lysosomal Ca2+ accumulation may be a late event following TCR activation. Strikingly, Gimap5lyp/lyp T cells showed increased TCR-induced lysosomal Ca2+ accumulation than control cells. To determine whether lysosomal Ca2+ accumulation was a general phenomenon following TCR stimulation, similar experiments were carried out on human and murine CD4+ T cells. In both cells, an increase in lysosomal Ca2+ content occurred at 30 minutes following TCR stimulation (Farnaz Ghobadi generated human and mice data that

replicated my finding in rats). These observations suggest that lysosomal Ca2+ accumulation is a late event after T cell stimulation and that GIMAP5 regulates lysosomal Ca2+ accumulation in the absence of TCR stimulation in naïve quiescent T cells.

Figure 4- 22: Lysosomes accumulate Ca2+ following activation through T cell receptor. A) Schematic representation of the experimental setup is indicated. Purified CD4+ T cells from (B, C) rats were plated on coverslips and stimulated with anti-TCR antibody R73 for rats for the shown duration. The cells were then loaded with Fura-2. The lysosomal Ca2+ content was probed with GPN in the absence of extracellular Ca2+. Representative data from one experiment is shown in B. The average of peak values from 3 independent experiments is shown in (C). ¶ p<0.05 between WT and Gimap5lyp/lyp unstimulated. * p<0.05; **p<0.01.

4.10. GIMAP5 variants interact with each other Given that rGIMAP5v1 and rGIMAP5v2 have the same transmembrane domains, it is not unexpected that they localized to the same vesicular structures when they were co- expressed in the same cell (data not shown). Previous studies have shown that other members of the GIMAP family of proteins were able to form homodimers or heterodimers (Schwefel, 2013). Human GIMAP2 has been shown to form homodimers or heterodimers with hGIMAP7. Since the two rGIMAP5 variants exhibited a different pattern of expression in primary cells, we analyzed their capacity to interact with each other. For this purpose, stable cell lines for the expression of Flag-GIMAP5 variant 1 or 2 were transiently transfected with myc-GIMAP5v2. Forty-eight hours post-transfection, cells were lysed and

the lysates were immunoprecipitated with anti-Myc antibodies. The immunoprecipitates were probed with anti-flag and anti-Myc antibodies. The data shown in 3-23 show that GIMAP5v2 can immunoprecipitate both variants, suggesting that both of the variants can form homo or heterodimers between themselves.

Figure 4- 23: GIMAP5 variants interact with each other. HEK293T cells expressing Flag-tagged GIMAP5v1 or GIMAP5v2 were transfected with Myc-tagged GIMAP5v2, lysed and immunoprecipitated with anti-Flag antibody. The lysates and the immunoprecipitates were blotted with anti-Myc antibody

5. DISCUSSION

Since the discovery and cloning of the GIMAP5 protein in the early 2000s, the overall view of how GIMAP5’s deficiency impact on the physiology of T cells remains unknown. Gimap5 was identified by positional cloning as the gene responsible for lymphopenia (Hornum et al., 2002; MacMurray et al., 2002). Recent studies have linked the absence or polymorphisms of the Gimap5 gene to other autoimmune diseases (Hellquist et al., 2007). In parallel, overexpression of this gene has also been associated with leukemias (Zenz et al., 2004). Despite the fact that Gimap5 alone has not been identified as the primary cause of a specific disease, cumulating evidence has shown that the absence of full-length GIMAP5 protein can impair the correct homeostasis of naïve T lymphocytes.

The GIMAP5 protein was initially observed to be mutated in BBDP rats, where it caused a significant reduction of the pool of naïve T cells in the periphery. Interestingly, mutations or deletions of the Gimap5 gene in mice not only recapitulate a major decrease of naïve T cells, but also show a more severe phenotype. The development of NK, B cells, as well as many hematopoietic progenitors, is affected in these mice (Barnes et al., 2010; Schulteis et al., 2008; Yano et al., 2014).

The findings described, provide a novel mechanism in the understanding of how the GIMAP5 protein influences naïve T cell survival. My results helped uncover new roles for the GIMAP5 protein and lysosomes as important regulators of Ca2+ homeostasis in lymphocytes. The data presented in this thesis demonstrates how the overexpression or absence of GIMAP5 impacts intracellular Ca2+ levels and dynamics by affecting the storage capacity of lysosomes and mitochondria, as well as the mitochondrial ability to uptake Ca2+. The ER and mitochondria are well known to impact and regulate Ca2+ homeostasis, but over the last decade, several groups have outlined the ability of lysosomes to store and importantly contribute to Ca2+ homeostasis. Importantly, up to 75% of genes in T cells

involved in survival and proliferation can be influenced by Ca2+ concentrations (Feske et al., 2001). Nevertheless, extracellular Ca2+ flux itself is not sufficient for the differential regulation of several genes, but a variety of thresholds are critical to trigger or induce specific instructions within the cell. Therefore, GIMAP5 can act as a multiple organelle Ca2+ storage capacity regulator.

5.1. Gimap5 expression and variants Previous studies have established that rats can express two variants of the Gimap5 gene. Variant 1 mRNA contains 1534 bp and codes for a 326 a.a protein, and variant 2 mRNA contains 1359 bp and codes for a 308 a.a protein, being the shorter and most abundant transcript (Andersen et al., 2004). In the BBDP rats, the frameshift mutation occurs in a region that is common for both transcripts, which indicates that two truncated proteins are produced as opposed to one. There is no substantial proof to suggest whether the endogenous truncated proteins have any residual function on the biology of T cells or if they are rapidly degraded. One study revealed that overexpression of the mutant protein could also induce apoptosis in T cells. However, it is not clear if the EGFP N-terminal tag used by this group conferred additional stability to the cloned truncated protein (Dalberg et al., 2007).

Due to GIMAP5’s importance in cellular homeostasis, we cloned for the first time the longer transcript, the variant 1. Variant 1 and variant 2 share over 90% of sequence identity, differing by only 32 amino acids at the N-terminal (Figure 3-1). Interestingly, two variants of GIMAP5 can also be generated in humans, whereas only one variant is expressed in mice (Nitta et al., 2006). Mice, however, possess a functional Gimap3, which is a pseudogene in rats and humans (MacMurray et al., 2002). Our RT-QPCR data confirmed what was previously reported for the Gimap5 transcripts of both variants (Andersen et al., 2004). Furthermore, in agreement with our previous observations that T cell activation transiently rescues Gimap5-deficient T cells from death (Ramanathan et al., 1998), expression of both variants is downregulated following T cell activation (Figure 3-2). These results indicate that

both variants are primarily regulating processes that can directly impact cell survival in naïve T cells. On the other hand, after T cells are activated, they become an entirely different population of cells with different metabolically needs as well as with distinct fates from naïve T cells. Decrease in Gimap5 expression after T cell activation supports its role and importance for naïve T cells. Recently, it has been shown that GIMAP1 protein which shares similarities with the GIMAP5 protein can have a half-life of 6 to 7 days (Datta et al., 2016). This longer half-life for GIMAP proteins may help in the transition from naïve T cells, where the GIMAP5 protein is critical, to the activated state, where the protein is no longer expressed. However, endogenous GIMAP5 protein half-life is still unknown. Because absence or overexpression of the GIMAP5 protein can be deleterious to T cells, we further characterized the differences between the two existing variants of the rat GIMAP5 protein using HEK293T stable transfection system.

Previously, we have shown that the GIMAP5 protein was able to colocalize with microtubules. We expand our previous observations in the present study by analyzing the two variants as well as their respective mutants where the transmembrane domain has been deleted. Pearson coefficient colocalization analysis shows that both GIMAP5 protein variants 1 and 2 and their TM mutant deletions were able to colocalize with microtubules, with a slightly higher colocalization for variant 2 over variant 1. In addition, both of the deletions importantly colocalized with microtubules (Figure 3-3). The diffuse distribution of the GIMAP5 mutants suggests that the removal of the transmembrane region may explain these results (Figure 3-4). Thereafter, when the GIMAP5 was analyzed for its capacity to colocalize with motor proteins kinesin and dynein, similar results were obtained. However, we observed that GIMAP5 variant 2 showed a more significant colocalization coefficient for kinesin than for dynein. As for actin filaments and its respective motor protein myosin, no significant colocalization was observed. These findings first suggest that the association in HEK293T cells expressing GIMAP5 seems to be primarily with microtubules and its respective motor proteins and not with the actin filaments. Secondly, GIMAP5 probably favors anterograde movement over microtubules, at least under the experimental

conditions used. The latest may suggest a role for GIMAP5 in directing the movement of organelles or other cargoes near the plasma membrane. Thirdly, the N-terminal region may be playing a major role in the force of interaction with microtubules and motor proteins, but this regulation is dependent on GIMAP5 anchorage to a membrane, as deleting the TM region increases the colocalization for both of the variants.

5.2. GIMAP5 protein localizes in different vesicle-like structures GIMAP5 colocalization with microtubules and motor proteins in addition to its diffuse pattern without its transmembrane region suggest anchorage to membranes as a valuable property for GIMAP5 localization. In our current and preceding studies, we have shown that GIMAP5 is not present in the mitochondria or the ER as others have reported (Nitta et al., 2006; Pandarpurkar et al., 2003; Sandal et al., 2003). To better understand its localization, EGFP-tagged GIMAP5 at the N-terminal was followed in vivo in stable cells. This fluorescent tool enabled us to confirm that GIMAP5 effectively moved along microtubule filaments. We also observed that EGFP-GIMAP5 was forming tubular and circle-like vesicles. These observations, in parallel with live and fixed colocalization with known lysosomal proteins LAMP1 and LAMP2, confirm and extend the previous report on the lysosomal localization of GIMAP5 (Wong et al., 2010). Moreover, the Lysotracker marker, which labels the lysosomal lumen, did not colocalize with the GIMAP5 protein. This, in addition to the observation that TM deleted mutants did not colocalize with lysosomal membrane proteins, allows us to conclude that GIMAP5 is anchored to lysosomes and other vesicles through its C-terminal TM region. We can, therefore, speculate that the N-terminal region may be facing the cytoplasm and can help the GIMAP5 protein interact with the cytoskeletal network or different adaptor proteins.

Furthermore, GIMAP5 colocalizes with proteins associated with the main vesicular compartments of the endolysosomal system, such as the early, late and recycling compartments, which suggest that it may be implicated in cargo trafficking. Indeed, several signaling proteins that are essential for survival and maintenance of naïve T cells in a

quiescent state, such as LAT and the TCR itself, are directed to their final destination or recycled through vesicle trafficking proteins. (Benzing et al., 2013; Finetti et al., 2014; Onnis et al., 2016). The capacity of RAB proteins to be switched from an activated to an inactivated state depending on their GTP or GDP association serves to direct the vesicles cargoes through the endo-lysosomal compartment (Jordens et al., 2005; Pfeffer, 2001). GIMAP5 does not hydrolyze GTP independently but can bind GTP. This can influence other RAB proteins and, as a consequence, cargo trafficking. Probably when GIMAP5 forms homodimers or heterodimers with other members of the GIMAP family of proteins and hydrolyze GTP, this active form can instruct cargo trafficking differently and regulate other RAB proteins present in the same compartment. It is possible that GIMAP5 localizes under specific conditions in different vesicular compartments to help guide critical signaling proteins to their final destination after TCR stimuli in naïve T cells via Ca2+ regulation. Synaptotagmin-7 can serve as an example of a protein that can influence TCR signaling under appropriate intracellular Ca2+ levels (Soares et al., 2013). Our immunoprecipitation results (Figure 3-22) presented GIMAP5’s ability to form homo/heterodimers, as shown for GIMAP2 and GIMAP7 (Schwefel et al., 2013). Thus, it is possible that GIMAP5 collaborates with other GIMAP family members by forming heterodimers, and can influence vesicular movement. GIMAP5’s implication in these functions remains to be determined. Similarly, it is possible that GIMAP5 regulates autophagy by interacting with other members of the GIMAP family.

5.3. GIMAP5 as a mediator of organelle Ca2+ regulation GIMAP5 protein deficiency is linked to defects in the survival of T cells. Our group has shown that intracellular Ca2+ flux is defective in T cells that lack Gimap5 (Ilangumaran et al., 2009). The regulation of cellular Ca2+ homeostasis by GIMAP5 may be an indirect effect as GIMAP5 does not possess any known Ca2+ binding EF-motifs in its structure, and does not seem to form a Ca2+ channel by itself. It is plausible that GIMAP5 interacts with ubiquitously expressed proteins that regulate Ca2+ responses in many cell types. Both endogenous and overexpressed GIMAP5v2 equivalently regulate cellular Ca2+. In order to maintain a

constant flux of Ca2+, the Ca2+ entry into the cytoplasm is buffered by different organelles. By reason of the defective Ca2+ influx from the extracellular media, we decided to assess whether this defect was a result of incapacity of certain organelles to buffer Ca2+.

5.4. GIMAP5 protein influences mitochondrial Ca2+ homeostasis Previously, we have shown that the absence of GIMAP5 decreases mitochondrial Ca2+ uptake in Gimap5 deficient T lymphocytes and that HEK293T stably expressing GIMAP5v2 had an increase in mitochondrial Ca2+ uptake (Chen et al., 2013). Following the entry of Ca2+ through the plasma membrane channels after TCR stimulation, mitochondria move on the microtubules to Ca2+ rich regions to uptake some of the incoming Ca2+ influx to prevent the premature closure of the CRAC channels by negative feedback (Quintana et al., 2006). In fact, mitochondrial movement on microtubules towards the immune synapse and rearrangement of actin filaments at these sites enables mitochondria to accumulate and contribute to Ca2+ signaling (Quintana et al., 2007; Schwindling et al., 2009). One study initially suggested that the GIMAP5 protein was associated with mitochondria (Nitta et al., 2006). However, our group has previously shown that GIMAP5 is affecting mitochondria from a different compartment (Keita et al., 2007). Our results confirm the lysosomal localization of rat GIMAP5. These results confirm and extend the observations made by Wong et al. (Wong et al., 2010) for human and murine GIMAP5. Also, we observed that GIMAP5 is present on vesicles from the early, late and recycling compartments (Figure 3- 18). The capacity of GIMAP5 to colocalize with microtubules, which are both near mitochondria, can explain why previously GIMAP5 was incorrectly localized to mitochondria. Furthermore, GIMAP5’s association with microtubules may explain the differential effects of the variants on the capacity of mitochondria to accumulate Ca2+. Similar to the consequences of calcium influx through the plasma membrane, only GIMAP5v2, not v1, influences mitochondrial Ca2+. In some way, the presence of the GIMAP5 protein variant 2 enables mitochondria to uptake more Ca2+ than control cells. As a consequence, the premature closure of CRAC channels occurs in HEK293T stable cells, which may explain why the presence of GIMAP5 decreases the extracellular Ca2+ flux in these cells. Interestingly, transmembrane deletion mutants of both variants showed no

significant effect on the capacity of mitochondria to uptake Ca2+. These results reflect, that even if the deletion mutants showed higher colocalization for microtubules, GIMAP5 anchoring on lysosomes is necessary to influence mitochondrial Ca2+ uptake. It is also plausible that GIMAP5 presence on lysosomes and association with microtubules helps establish some Ca2+ crosstalk/competition between organelles to keep adequate intracellular Ca2+ levels, as well as to traffic specific Ca2+ amounts to determined cell regions to initiate signaling processes.

It is surprising that the mitochondrial Ca2+ released by FCCP is not influenced by GIMAP5V2 (Figure 3-12). However, a similar experiment in T cells showed a subtle, but significant, decrease of Ca2+ release from mitochondria. Previous work in our group revealed that GIMAP5 deficient T cells had a decrease in mitochondrial potential, which plays a major role in maintaining correct Ca2+ concentrations and exchanges in mitochondria. This result may suggest that apart from their decreased capacity to accumulate Ca2+ after influx, mitochondria from GIMAP5 deficient T cells are initially impaired, which exacerbates their incapacity to contribute to maintaining Ca2+ homeostasis in T cells correctly. GIMAP5 as a new player for lysosomal Ca2+ homeostasis GIMAP5 affects Ca2+ homeostasis by impairing mitochondrial Ca2+ storage capacity, and more directly, by affecting lysosomal Ca2+ concentration in both stable cell lines as well as in primary T cells. During the present study, we expand the concept that GIMAP5 localizes to the lysosomes and is anchored by its TM region. Furthermore, we reveal that GIMAP5 expression in the cells contributes to regulating the amount of Ca2+ that lysosomes store. Similarly, we observed that this could dysregulate other organelles’ capacity to buffer Ca2+, like the ER, possibly due to the bidirectional communication that both organelles membranes share (López Sanjurjo et al., 2014; Morgan et al., 2013).

In HEK293T stable cell lines for GIMAP5v2, lysosomal Ca2+ is diminished, which increases the amount of Ca2+ available from ER after lysosomal Ca2+ release. NAADP is the most potent Ca2+-mobilizing second messenger, and it has been reported to release Ca2+ primarily from

lysosomes, which can then generate micro domains of Ca2+ rich regions that can induce IP3R to release Ca2+ from the ER and further impact the amount of Ca2+ influx from the extracellular medium (Guse, 2015). It is possible that the inability of lysosomes to take up Ca2+ in the presence of GIMAP5 disrupts the cross-talk between Ca2+ storage organelles, making it difficult for cells to counterbalance premature closure by negative feedback of CRAC channels. On the other hand, the absence of the TM domains that anchor GIMAP5v2 to the lysosomal membrane did not affect Ca2+ responses of HEK293T cells expressing GIMAP5v2ΔTM.

Lysosomal Ca2+ stores discharge can induce extra cellular Ca2+ flux by indirectly affecting other organelles such as the ER, and by the reported presence of STIM1 and STIM2 on these acidic compartments (Zbidi et al., 2011). In both stable and primary cells, lysosomal Ca2+ release in the presence of extracellular Ca2+ showed a total intracellular Ca2+ reduction when compared to control, similar to the reduction observed after ER depletion, although not as dramatic. These observations highlight the relative importance of the various Ca2+ stores in different cell types.

Current knowledge of the role of lysosomal Ca2+ in T cell homeostasis is insufficient. Lysosomal Ca2+, through NAADP activation, is implicated in the release of cytotoxic granules (Davis et al., 2012). Lysosomal storage disorders (LSDs) are associated with immune dysfunctions as a consequence of the abnormal accumulation of metabolic intermediates (Castaneda et al., 2008). However, it is not clear whether Ca2+ homeostasis is also affected in T lymphocytes from these patients. Similarly, lysosomal Ca2+ is also necessary for lysosome motility (Li et al., 2016). Mitochondrial dysfunction affects lysosomal activity and autophagy in T lymphocytes, driving T cell responses to a more proinflammatory response (Baixauli et al., 2015); however, the effects on lysosomal Ca2+ have not been fully studied. Deregulation of lysosomal functions are also associated with altered lysosomal Ca2+ content as translocation of the lysosomal biogenesis factor, TFEB, is dependent on Ca2+; therefore, increased lysosomal biogenesis can impact mitophagy and correct mTOR function

(Raimundo et al., 2016). The data presented here suggest that the lysosomal Ca2+ content of resting T cells is maintained at a low level in the presence of GIMAP5 and that it increases during later stages of T cell activation. IP3 generated following TCR stimulation empties the ER Ca2+ stores, and opens the ORAI/CRAC channels on the plasma membrane (Feske, 2007). The incoming Ca2+ generates rich Ca2+ microdomains that enable mitochondria that move on microtubules to buffer the entry Ca2+ (Quintana and Hoth, 2012). Mitochondria buffer the Ca2+ influx during the first 15 minutes following the opening of CRAC channels induced by the emptying of the ER Ca2+ (Hoth et al., 2000; Quintana et al., 2006). Our results suggest that in T lymphocytes, lysosomal Ca2+ storage capacity appears to be a late event that might add a level of fine-tuning to the vast genes that are dependent on different thresholds of Ca2+ concentration, which later impacts cell fate. However, because of their size and more rapid movement through the cell, simultaneous regulation with ER and mitochondria following Ca2+ influx cannot be discarded.

Our results also reveal the complex nature of the interaction between the various sub cellular Ca2+ stores that are present in a cell and a role for GIMAP5 in regulating their function in a cell type-specific manner. The Ca2+ released from the ER in Ca2+ hot spots is taken up by ER-associated mitochondria (Rizzuto, 1998). Lysosomes are also found in close association with ER, and NAADP-released Ca2+ can propagate to the ER and trigger a larger Ca2+ release (Kilpatrick et al., 2013). Similarly, the bi-directional Ca2+ exchange has been shown between ER and lysosomes (Morgan et al., 2013). In fact, this Ca2+ micro domain between lysosomes and the ER will be generated as a result of physical and functional membrane contact sites formed between both organelles (Penny et al., 2015). Crosstalk between organelles is a growing discipline, though not much is known about physical membrane contact sites between lysosomes and mitochondria in mammalian cells, other than for autophagy-related processes. In yeast, mitochondria and lysosome-related organelle vacuoles form vCLAMP (vacuole and mitochondria patch), which regulates lipid transport between them (Elbaz-Alon et al., 2014). Recently, these contacts appear to be regulated by a protein conserved among vertebrates, namely Lam6, which opens the door

for the study of this mechanism in mammalian cells (Elbaz-Alon et al., 2015). GIMAP5 may be playing a similar regulatory role for Ca2+ exchange. Interestingly, these vCLAMP sites are formed near the ER-mitochondria encounter structure (ERMES) (Hönscher et al., 2014). While the presence of lysosomal Ca2+ appears to be normal in the physiology of non-T cells, as evident from the experiments with HEK293T cells, it is not clear why lysosomal Ca2+ is maintained at low levels in T lymphocytes by GIMAP5. It is possible that this reflects the requirements for adequate Ca2+ delivery from mitochondria to maintain the energy requirements in T cells during the initial activation phase. Naïve T cell survival, where deficiency of GIMAP5 protein appears to be fatal, depends on a balanced homeostatic state. In this context, lysosomal Ca2+ content and signaling may also play a critical role in the regulation of autophagy-related mechanisms through the master transcriptional regulator of lysosomal biogenesis and autophagy (TFEB) (Medina et al., 2015). Naïve T cell metabolic status is key for their survival and proper differentiation, as KO mice for other autophagy regulator proteins, TSC1/2, had also showed impaired naïve T cell survival (Wu et al., 2011; Xie et al., 2012). Even though we have observed down-regulation of Gimap5 gene expression following activation, the half-life of the endogenous GIMAP5 protein in T cells is not known. It is possible that GIMAP5 protein downregulation is also associated with the activation and proliferation of T cells. Thus, turning down the expression of GIMAP5 in activated cells may permit cell cycle progression (Aksoylar et al., 2012).

5.5. The intermediary role of GIMAP5v1 The general pattern showed an intermediary role for GIMAP5 variant 1 when contrasted between control and GIMAP5 variant 2 stable cells. This set of results suggests a finer regulatory role for variant 1 in rats, and probably in humans, where two variants are also present. The conditions under which variant 1 may take the lead over variant 2 or the circumstances under which its expression is further upregulated remains to be determined. Additionally, GIMAP5 is capable of forming homo- and heterodimers, adding another layer of complexity to the GIMAP5 activity. Similar results have been shown for other members

of the GIMAP family, which have the capacity to interact with them (Schwefel et al., 2013). Whether GIMAP5 can also interact with other GIMAP proteins remains an open question.

GIMAP5 deficiency leads to lysosomes that have a higher basal amount of Ca2+ content, which in the end may misbalance correct crosstalk between organelles, thus resulting in an overall Ca2+ homeostasis defect that contributes to compromising naïve T cell survival. Further studies are needed to elucidate the mechanisms by which GIMAP5 regulates the lysosomal calcium storage capacity, and how this may influence other signaling pathways that rely on organelle homeostasis.

GIMAP5 influences naïve T cell survival through organelle calcium storage regulation. A) The squared region shows how mitochondria move to Ca2+ rich microdomains to buffer Ca2+ entry, absence of GIMAP5 impairs mitochondria Ca2+ uptake. B) GIMAP5 colocalizes with microtubules and motor proteins. TM mutant influence in a significant manner the ability of GIMAP5 to play its physiological role. C) GIMAP5 colocalizes with lysosomal membrane markers and influence the content of lysosomal Ca2+. Lysosomes as well as mitochondria play a critical role in naïve T cell survival. D and E) show future directions, membrane contact sites between organelles can be possibly influenced by GIMAP5. Also, trafficking of signaling molecules to the immune synapse may be regulated by the effect GIMAP5 can have on vesicles from the endolysosomal compartment.

PERSPECTIVES

In future experiments it will be interesting to understand how Ca2+ is exchanged between the organelles in the presence or absence of GIMAP5. These experiments can be carry out in the stably HEK293T cells by releasing Ca2+ in different orders from each of the compartments. In this way we can map the crosstalk bewtween the ER, mitochondria and lysosomes. In parallel, immunofluorescence experiments comparing the position of the organelles at time 0 and after stimuli for Ca2+ uptake or release can contribute to understand if GIMAP5 is affecting the contact sites between organelles.

Lysotracker florescence intensity was decreased at a similar rate after GPN treatment for control and GIMAP5 stably cells (Figure 4-20). However, initial fluoerescence intensity was different between both control and stably HEK293T cells. Because GIMAP5 influences lysosomal Ca2+ and this can impact the organelle pH, this may explain the difference in the amount of lysotracker that initially labelled the lysosomes. By using pH probes, it will be interesting to determine if effectively the presence of GIMAP5 influence the lysosomes pH. Vesicles move rapidly using the cytoskeletal network. Vesicle dynamics is essential not only for Ca2+ homeostasis but also to transport different signaling proteins to the surface of T cells (Martín-Cófreces et al., 2013). It will be also pertinent to labelled key signalling molecules as LAT, ZAP70 or Lck and follow them on GIMAP5 positive vesicles to investigate if GIMAP5 is playing a role in their turnover before and after T cell activation.

ACKNOWLEDGMENTS

A panoply of names come to my mind when is time for acknowledgments. Is clear that time itself is not the most precise way to measure how thankful you may be for someone. Several times we cross people for short moments in our lives, but those moments can highly impact our way of seeing things permanently. In this order of ideas, I will like to thank many of those people that had to cross my path during my graduate studies. To my graduate studies supervisor Dr. Sheela Ramanathan, I will like to thank for the opportunity you gave me to do my graduate studies in your research lab. Along with this adventure, I learned many valuable new lessons and reinforced some old ones that certainly will help me in my future. To the members, friends, and colleagues from Sheela and Ilan’s labs, for the moments we share, struggle and enjoy. Marian, Diwakar, Medhi, Xilin, Yirui, Alberto, Yuneyvi, Greg, Rajani, Chantal, Christopher, Sakina, Vola, Farnaz, Sakina, Maroua, Khan, Julien, Sonia, Veronique, thanks for the moments we share. To Dr. Ilangumaran for his inputs during the lab meetings as well as his welcoming’s with Dr. Ramanathan at their house, both of them always were a good host. I will also like to extend my thanks to the other students from the program of immunology. For the time and moments, we passed trying to solve our science and world problems: Aurelie, Olga, Emilie, Tara, Thomas, Fanny, Marie, Karine, Sarah and also the nice smile from Harsh, a nice guy who dreams stop too early. I will like to thank other PI’s for their input on my career. Thanks to Dr. Jana for her encouraging commentaries, to her husband Dr. Marek for showing that courtesy and gentle manners mix well everywhere. To Dr. Denis, for sharing his input on science. To Dr. Claire, Dr. Abdelaziz, Dr. Diane, Dr. Lee for taking some time to have a talk. To Dr. Patrick McDonald for entering into my committee at last minute, with an open mind and sincere advice to help me navigate when the waters were not at all calmed, thanks. To Dr. Benoit Leblanc, for transmitting his passion for science. To Dr. Eric Rousseau, who gave me my first opportunity to do an internship, thanks for your energy and motivation! To Dr. Pedro D’Orléans-Juste for his courses and advice, where I learned in deeper and more structured way the meaning of a Ph.D. To Dr. Viktor Steimle, who I first met on a bus unknowing he

will later become my undergrad immunology professor, my master’s mentor, a friend and a good example of person and scientist, thanks for all. To Dr. Christine Lavoie, special thanks for being there during my graduate studies, with a friendly face and door open to discuss science, my career plans, or my struggles, a big thank you for all the time and support you gave to me. Finally, I will like to thank my science colleague, my best friend, and my partner in life, Galaxia. Thanks for all the moments. We have both fight battles together, not only in science and academically, but also as human beings. We know that this step of our lives pushed us to unknown and not always easy to walk paths, but we have learned and become stronger together. Gracias mi amor. To our daughter who inspires us to show the best from us and gave us an extra reason to go forward, we love you Théia. To my parents and brothers who always support and encourage me, thanks for always been a wonderful family, I am glad I have the chance to have every one of you in my life. Lastly but not least to my family in law, who are here, in Canada and were ready to give a helping and warm hand for Gala and me.

Thanks to all!

82 REFERENCES

Ainbinder, A., Boncompagni, S., Protasi, F., Dirksen, R.T., 2015. Role of Mitofusin-2 in mitochondrial localization and calcium uptake in skeletal muscle. Cell Calcium 57, 14–24.

Akhmanova, A., Hammer, J., 2010. Linking molecular motors to membrane cargo. Current opinion in cell biology 22, 479–87.

Aksoylar, H.I., Lampe, K., Barnes, M.J., Plas, D.R., Hoebe, K., 2012. Loss of immunological tolerance in Gimap5-deficient mice is associated with loss of Foxo in CD4+ T cells. J. Immunol. 188, 146–54.

Andersen, U.N., Markholst, H., Hornum, L., 2004. The antiapoptotic gene Ian4l1 in the rat: genomic organization and promoter characterization. Gene 341, 141–8.

Armstrong, F., Grange, P., Gerby, B., Rouyez, M.-C., Calvo, J., Fontenay, M., Boissel, N., Dombret, H., Baruchel, A., Landman-Parker, J., Roméo, P.-H., Ballerini, P., Pflumio, F., 2009. NOTCH is a key regulator of human T cell acute leukemia initiating cell activity. Blood.

Arnaudeau, S., Kelley, W.L., Walsh, J.V., Demaurex, N., 2001. Mitochondria recycle Ca2+ to the endoplasmic reticulum and prevent the depletion of neighboring endoplasmic reticulum regions. J. Biol. Chem. 276, 29430–9.

Aulestia, F.J., Redondo, P.C., Rodríguez-García, A., Rosado, J.A., Salido, G.M.M., Alonso, M.T., García-Sancho, J., 2011. Two distinct calcium pools in the endoplasmic reticulum of - HEK293T cells. Biochem. J. 435, 227–35.

Baixauli, F., Acín-Pérez, R., Villarroya-Beltrí, C., Mazzeo, C., Nuñez-Andrade, N., Gabandé- Rodriguez, E., Ledesma, M.D., Blázquez, A., Martin, M.A., Falcón-Pérez, J.M., Redondo, J.M., Enríquez, J.A., Mittelbrunn, M., 2015. Mitochondrial Respiration Controls Lysosomal Function during Inflammatory T Cell Responses. Cell Metab. 22, 485–98.

Barnes, M.J., Aksoylar, H., Krebs, P., Bourdeau, T., Arnold, C.N., Xia, Y., Khovananth, K., Engel, I., Sovath, S., Lampe, K., Laws, E., Saunders, A., Butcher, G.W., Kronenberg, M., Steinbrecher, K., Hildeman, D., Grimes, H.L., Beutler, B., Hoebe, K., 2010. Loss of T cell and B cell quiescence precedes the onset of microbial flora-dependent wasting disease and intestinal inflammation in Gimap5-deficient mice. J. Immunol. 184, 3743–54.

Batters, C., Veigel, C., 2016. Mechanics and Activation of Unconventional Myosins. Traffic 17, 860–71.

Beck, A., Kolisek, M., Bagley, L.A., Fleig, A., Penner, R., 2006. Nicotinic acid adenine dinucleotide phosphate and cyclic ADP-ribose regulate TRPM2 channels in T lymphocytes. FASEB J. 20, 962–4.

Benzing, C., Rossy, J., Gaus, K., 2013. Do signalling endosomes play a role in T cell activation? The FEBS journal 280, 5164–76.

Berg, J.S., Powell, B.C., Cheney, R.E., 2001. A millennial myosin census. Mol. Biol. Cell 12, 780–94.

Bootman, M.D., Berridge, M.J., Roderick, H.L., 2002. Calcium signalling: more messengers, more channels, more complexity. Curr. Biol. 12, R563–5.

Brailoiu, E., Churamani, D., Cai, X., Schrlau, M.G., Brailoiu, G.C., Gao, X., Hooper, R., Boulware, M.J., Dun, N.J., Marchant, J.S., Patel, S., 2009. Essential requirement for two-pore channel 1 in NAADP-mediated calcium signaling. J. Cell Biol. 186, 201–9.

Brandt, J. van den, Fischer, H.J., Walter, L., Hünig, T., Klöting, I., Reichardt, H.M., 2010. Type 1 diabetes in BioBreeding rats is critically linked to an imbalance between Th17 and regulatory T cells and an altered TCR repertoire. J. Immunol. 185, 2285–94.

Brito, O.M. de, Scorrano, L., 2008. Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature 456, 605–10.

Bryantseva, S.A., Zhapparova, O.N., 2012. Bidirectional transport of organelles: unity and struggle of opposing motors. Cell Biol. Int. 36, 1–6.

Calcraft, P., Ruas, M., Pan, Z., Cheng, X., Arredouani, A., Hao, X., Tang, J., Rietdorf, K., Teboul, L., Chuang, K.-T., Lin, P., Xiao, R., Wang, C., Zhu, Y., Lin, Y., Wyatt, C., Parrington, J., Ma, J., Evans, Galione, A., Zhu, M., 2009. NAADP mobilizes calcium from acidic organelles through two-pore channels. Nature 459, 596–600.

Cambot, Aresta, Kahn-Perlès…, 2002. Human immune associated nucleotide 1: a member of a new guanosine triphosphatase family expressed in resting T and B cells.

Campello, S., Scorrano, L., 2010. Mitochondrial shape changes: orchestrating cell pathophysiology. EMBO Rep. 11, 678–84.

Carlier, M.F., Hill, T.L., Chen, Y., 1984. Interference of GTP hydrolysis in the mechanism of microtubule assembly: an experimental study. Proc. Natl. Acad. Sci. U.S.A. 81, 771–5.

Carrasco, S., Merida, I., 2004. Diacylglycerol-dependent binding recruits PKCtheta and RasGRP1 C1 domains to specific subcellular localizations in living T lymphocytes. Mol. Biol. Cell 15, 2932–42.

Carrette, F., Surh, C.D., 2012. IL-7 signaling and CD127 receptor regulation in the control of T cell homeostasis. Semin. Immunol. 24, 209–17.

Castaneda, J.A., Lim, M.J., Cooper, J.D., Pearce, D.A., 2008. Immune system irregularities in lysosomal storage disorders. Acta Neuropathol. 115, 159–74.

Chadwick, N., Zeef, L., Portillo, V., Boros, J., Hoyle, S., Doesburg, J.C. van, Buckle, A.-M.M., 2010. Notch protection against apoptosis in T-ALL cells mediated by GIMAP5. Blood Cells Mol. Dis. 45, 201–9.

Chadwick, N., Zeef, L., Portillo, V., Fennessy, C., Warrander, F., Hoyle, S., Buckle, A.-M.M., 2009. Identification of novel Notch target genes in T cell leukaemia. Mol. Cancer 8, 35.

Chan, S.M., Weng, A.P., Tibshirani, R., Aster, J.C., Utz, P.J., 2007. Notch signals positively regulate activity of the mTOR pathway in T cell acute lymphoblastic leukemia. Blood 110, 278–86.

Chandrasekhar, R., Alzayady, K., Wagner, L., Yule, D., 2016. Unique Regulatory Properties of Heterotetrameric Inositol 1,4,5-Trisphosphate Receptors Revealed by Studying Concatenated Receptor Constructs. Journal of Biological Chemistry 291, 4846–4860.

Chen, X.-L.L., Serrano, D., Ghobadi, F., Mayhue, M., Hoebe, K., Ilangumaran, S., Ramanathan, S., 2016. TCR and IL-7 Signaling Are Altered in the Absence of Functional GTPase of the Immune Associated Nucleotide Binding Protein 5 (GIMAP5). PLoS ONE 11, e0151837.

Chen, X.-L.L., Serrano, D., Mayhue, M., Hoebe, K., Ilangumaran, S., Ramanathan, S., 2015. GIMAP5 Deficiency Is Associated with Increased AKT Activity in T Lymphocytes. PLoS ONE 10, e0139019.

Chen, X.L., Serrano, D., Mayhue, M., Wieden, H.-J.J., Stankova, J., Boulay, G., Ilangumaran, S., Ramanathan, S., 2013. GTPase of the immune-associated nucleotide-binding protein 5 (GIMAP5) regulates calcium influx in T-lymphocytes by promoting mitochondrial calcium accumulation. Biochem. J. 449, 353–64.

Chen, Y., Sheng, Z.-H.H., 2013. Kinesin-1-syntaphilin coupling mediates activity-dependent regulation of axonal mitochondrial transport. J. Cell Biol. 202, 351–64.

Chen, Y., Yu, M., Dai, X., Zogg, M., Wen, R., Weiler, H., Wang, D., 2011. Critical role for Gimap5 in the survival of mouse hematopoietic stem and progenitor cells. J. Exp. Med. 208, 923–35.

Cheng, X., Shen, D., Samie, M., Xu, H., 2010. Mucolipins: Intracellular TRPML1-3 channels. FEBS Lett. 584, 2013–21.

Chi, H., 2012. Regulation and function of mTOR signalling in T cell fate decisions. Nat Rev Immunol 12, 325–338.

Churchill, Galione, 2001. NAADP induces Ca2+ oscillations via a two-pool mechanism by priming IP3- and cADPR-sensitive Ca2+ stores. The EMBO journal 20, 2666–71.

Ciucci, T., Bosselut, R., 2014. Gimap and T cells: a matter of life or death. Eur. J. Immunol. 44, 348–51.

Cousins, L., Graham, M., Tooze, R., Carter, C., Miller, J.R., Powrie, F.M., Macpherson, G.G., Butcher, G.W., 2006. Eosinophilic bowel disease controlled by the BB rat-derived lymphopenia/Gimap5 gene. Gastroenterology 131, 1475–85.

Cárdenas, C., Miller, R.A., Smith, I., Bui, T., Molgó, J., Müller, M., Vais, H., Cheung, K.-H.H., Yang, J., Parker, I., Thompson, C.B., Birnbaum, M.J., Hallows, K.R., Foskett, J.K., 2010. Essential regulation of cell bioenergetics by constitutive InsP3 receptor Ca2+ transfer to mitochondria. Cell 142, 270–83.

Dahéron, L., Zenz, T., Siracusa, L.D., Brenner, C., Calabretta, B., 2001. Molecular cloning of Ian4: a BCR/ABL-induced gene that encodes an outer membrane mitochondrial protein with GTP-binding activity. Nucleic Acids Res. 29, 1308–16.

Dalberg, U., Markholst, H., Hornum, L., 2007. Both Gimap5 and the diabetogenic BBDP allele of Gimap5 induce apoptosis in T cells. Int. Immunol. 19, 447–53.

Dammermann, W., Guse, A.H., 2005. Functional ryanodine receptor expression is required for NAADP-mediated local Ca2+ signaling in T-lymphocytes. J. Biol. Chem. 280, 21394–9.

Dammermann, W., Zhang, B., Nebel, M., Cordiglieri, C., Odoardi, F., Kirchberger, T., Kawakami, N., Dowden, J., Schmid, F., Dornmair, K., Hohenegger, M., Flügel, A., Guse, A.H., Potter, B.V., 2009. NAADP-mediated Ca2+ signaling via type 1 ryanodine receptor in T cells revealed by a synthetic NAADP antagonist. Proc. Natl. Acad. Sci. U.S.A. 106, 10678–83.

Datta, P., Webb, L.M., Avdo, I., Pascall, J., Butcher, G.W., 2016. Survival of mature T cells in the periphery is intrinsically dependent on GIMAP1 in mice. Eur. J. Immunol.

Davis, L., Morgan, A., Chen, J.-L., Snead, C., Bloor-Young, D., Shenderov, E., Stanton- Humphreys, M., Conway, S., Churchill, G., Parrington, J., Cerundolo, V., Galione, A., 2012. NAADP activates two-pore channels on T cell cytolytic granules to stimulate exocytosis and killing. Current biology : CB 22, 2331–7.

DELUCA, H.F., ENGSTROM, G.W., 1961. Calcium uptake by rat kidney mitochondria. Proc. Natl. Acad. Sci. U.S.A. 47, 1744–50.

Dion, C., Carter, C., Hepburn, L., Coadwell, W.J., Morgan, G., Graham, M., Pugh, N., Anderson, G., Butcher, G.W., Miller, J.R., 2005. Expression of the Ian family of putative

GTPases during T cell development and description of an Ian with three sets of GTP/GDP- binding motifs. Int. Immunol. 17, 1257–68.

Docampo, R., Moreno, S., 2011. Acidocalcisomes. Cell calcium 50, 113–9.

Dong, X.P., Shen, D., Wang, X., Dawson, T., Li, X., Zhang, Q., Cheng, X., Zhang, Y., Weisman, L.S., Delling, M., Xu, H., 2010. PI(3,5)P(2) controls membrane trafficking by direct activation of mucolipin Ca(2+) release channels in the endolysosome. Nat Commun 1, 38.

Duan, L., Reddi, A.L., Ghosh, A., Dimri, M., Band, H., 2004. The Cbl family and other ubiquitin ligases: destructive forces in control of antigen receptor signaling. Immunity 21, 7–17.

Dzhagalov, I., Dunkle, A., He, Y.-W.W., 2008. The anti-apoptotic Bcl-2 family member Mcl-1 promotes T lymphocyte survival at multiple stages. J. Immunol. 181, 521–8.

Elbaz-Alon, Y., Eisenberg-Bord, M., Shinder, V., Stiller, S., Shimoni, E., Wiedemann, N., Geiger, T., Schuldiner, M., 2015. Lam6 Regulates the Extent of Contacts between Organelles. Cell Reports 12, 7–14.

Elbaz-Alon, Y., Rosenfeld-Gur, E., Shinder, V., Futerman, A., Geiger, T., Schuldiner, M., 2014. A Dynamic Interface between Vacuoles and Mitochondria in Yeast. Dev Cell 30, 95–102.

Elder, Maclaren, 1983. Identification of profound peripheral T lymphocyte immunodeficiencies in the spontaneously diabetic BB rat. J Immunol Baltim Md 1950 130, 1723–31.

Erickson, H.P., 2007. Evolution of the cytoskeleton. Bioessays 29, 668–77.

Fabre, S., Carrette, F., Chen, J., Lang, V., Semichon, M., Denoyelle, C., Lazar, V., Cagnard, N., Dubart-Kupperschmitt, A., Mangeney, M., Fruman, D.A., Bismuth, G., 2008. FOXO1 regulates L-Selectin and a network of human T cell homing molecules downstream of phosphatidylinositol 3-kinase. J. Immunol. 181, 2980–9.

Feske, Giltnane, Dolmetsch, Staudt, Rao, 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nature immunology 2, 316–24.

Feske, S., 2013. Ca(2+) influx in T cells: how many ca(2+) channels? Front Immunol 4, 99.

Filadi, R., Greotti, E., Turacchio, G., Luini, A., Pozzan, T., Pizzo, P., 2015. Mitofusin 2 ablation increases endoplasmic reticulum-mitochondria coupling. Proc. Natl. Acad. Sci. U.S.A. 112, E2174–81.

Filén, J.-J., Filén, S., Moulder, R., Tuomela, S., Ahlfors, H., West, A., Kouvonen, P., Kantola, S., Björkman, M., Katajamaa, M., Rasool, O., Nyman, T., Lahesmaa, R., 2009. Quantitative proteomics reveals GIMAP family proteins 1 and 4 to be differentially regulated during human T helper cell differentiation. Molecular & cellular proteomics : MCP.

Filén, S., Lahesmaa, R., 2010. GIMAP Proteins in T-Lymphocytes. Journal of signal transduction.

Finetti, F., Patrussi, L., Masi, G., Onnis, A., Galgano, D., Lucherini, O., Pazour, G., Baldari, C., 2014. Immune synapse targeting of specific recycling receptors by the intraflagellar transport system. Journal of cell science.

Fingar, D., Blenis, J., 2004. Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 23, 3151– 3171.

Fink, P., 2012. The biology of recent thymic emigrants. Annual review of immunology 31, 31–50.

Fischer, H.J., Witte, A.-K.K., Walter, L., Gröne, H.-J.J., Brandt, J. van den, Reichardt, H.M., 2016. Distinct roles of T cell lymphopenia and the microbial flora for gastrointestinal and CNS autoimmunity. FASEB J. 30, 1724–32.

Forgac, M., 2007. Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nature Reviews Molecular Cell Biology 8, 917–929.

Foskett, J.K., White, C., Cheung, K.-H.H., Mak, D.-O.D.O., 2007. Inositol trisphosphate receptor Ca2+ release channels. Physiol. Rev. 87, 593–658.

Fracchia, K.M., Pai, C.Y., Walsh, C.M., 2013. Modulation of T Cell Metabolism and Function through Calcium Signaling. Front Immunol 4, 324.

Fransson, A., Ruusala, A., Aspenström, P., 2003. Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J. Biol. Chem. 278, 6495–502.

Fransson, S., Ruusala, A., Aspenström, P., 2006. The atypical Rho GTPases Miro-1 and Miro- 2 have essential roles in mitochondrial trafficking. Biochem. Biophys. Res. Commun. 344, 500–10.

Frederick, R., McCaffery, M., Cunningham, K., Okamoto, K., Shaw, J., 2004. Yeast Miro GTPase, Gem1p, regulates mitochondrial morphology via a novel pathway. The Journal of Cell Biology 167, 87–98.

Freeden-Jeffry, U. von, Vieira, P., Lucian, L.A., McNeil, T., Burdach, S.E., Murray, R., 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181, 1519–26.

Fukuda, 2008. Regulation of secretory vesicle traffic by Rab small GTPases. Cellular and molecular life sciences : CMLS 65, 2801–13.

Garrity, A., Wang, W., Collier, C., Levey, S., Gao, Q., Xu, H., 2016. The endoplasmic reticulum, not the pH gradient, drives calcium refilling of lysosomes. eLife 5.

Germain, R.N., 2002. T cell development and the CD4-CD8 lineage decision. Nat. Rev. Immunol. 2, 309–22.

Glater, E.E., Megeath, L.J., Stowers, R.S., Schwarz, T.L., 2006. Axonal transport of mitochondria requires milton to recruit kinesin heavy chain and is light chain independent. J. Cell Biol. 173, 545–57.

Golovina, V.A., Blaustein, M.P., 1997. Spatially and functionally distinct Ca2+ stores in sarcoplasmic and endoplasmic reticulum. Science 275, 1643–8.

Griffiths, 1999. Reversal of mitochondrial Na/Ca exchange during metabolic inhibition in rat cardiomyocytes. FEBS letters 453, 400–4.

Grimm, C., Hassan, S., Wahl-Schott, C., Biel, M., 2012. Role of TRPML and two-pore channels in endolysosomal cation homeostasis. J. Pharmacol. Exp. Ther. 342, 236–44.

Grynkiewicz, G., Poenie, M., Tsien, R.Y., 1985. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 260, 3440–50.

Gubbels Bupp, M.R., Edwards, B., Guo, C., Wei, D., Chen, G., Wong, B., Masteller, E., Peng, S.L., 2009. T cells require Foxo1 to populate the peripheral lymphoid organs. Eur. J. Immunol. 39, 2991–9.

Guse, A.H., 2015. Calcium mobilizing second messengers derived from NAD. Biochim. Biophys. Acta 1854, 1132–7.

Guse, A.H., Silva, C.P. da, Berg, I., Skapenko, A.L., Weber, K., Heyer, P., Hohenegger, M., Ashamu, G.A., Schulze-Koops, H., Potter, B.V., Mayr, G.W., 1999. Regulation of calcium signalling in T lymphocytes by the second messenger cyclic ADP-ribose. Nature 398, 70–3.

Guse, A.H., Wolf, I.M., 2016. Ca(2+) microdomains, NAADP and type 1 ryanodine receptor in cell activation. Biochim. Biophys. Acta 1863, 1379–84.

Görlach, A., Klappa, P., Kietzmann, T., 2006. The endoplasmic reticulum: folding, calcium homeostasis, signaling, and redox control. Antioxid. Redox Signal. 8, 1391–418.

Heath-Engel, H.M., Shore, G.C., 2006. Mitochondrial membrane dynamics, cristae remodelling and apoptosis. Biochim. Biophys. Acta 1763, 549–60.

Heikamp, E.B., Powell, J.D., 2012. Sensing the immune microenvironment to coordinate T cell metabolism, differentiation & function. Semin. Immunol. 24, 414–20.

Heinonen, M.T., Kanduri, K., Lähdesmäki, H.J., Lahesmaa, R., Henttinen, T.A., 2014. Tubulin- and actin-associating GIMAP4 is required for IFN-γ secretion during Th cell differentiation. Immunol. Cell Biol.

Heinonen, M.T., Laine, A.-P.P., Söderhäll, C., Gruzieva, O., Rautio, S., Melén, E., Pershagen, G., Lähdesmäki, H.J., Knip, M., Ilonen, J., Henttinen, T.A., Kere, J., Lahesmaa, R., 2015. GIMAP GTPase family genes: potential modifiers in autoimmune diabetes, asthma, and allergy. J. Immunol. 194, 5885–94.

Hellquist, A., Zucchelli, M., Kivinen, K., Saarialho-Kere, U., Koskenmies, S., Widen, E., Julkunen, H., Wong, A., Karjalainen-Lindsberg, M.-L.L., Skoog, T., Vendelin, J., Cunninghame- Graham, D.S., Vyse, T.J., Kere, J., Lindgren, C.M., 2007. The human GIMAP5 gene has a common polyadenylation polymorphism increasing risk to systemic lupus erythematosus. J. Med. Genet. 44, 314–21.

Henriques, C.M., Rino, J., Nibbs, R.J., Graham, G.J., Barata, J.T.T., 2010. IL-7 induces rapid clathrin-mediated internalization and JAK3-dependent degradation of IL-7Ralpha in T cells. Blood 115, 3269–77.

Hernández-Hoyos, Joseph, Miller, Butcher, 1999. The lymphopenia mutation of the BB rat causes inappropriate apoptosis of mature thymocytes. European journal of immunology 29, 1832–41.

Hirokawa, N., Takemura, R., 2005. Molecular motors and mechanisms of directional transport in neurons. Nature reviews. Neuroscience 6, 201–14.

Hogan, P.G., Lewis, R.S., Rao, A., 2010. Molecular basis of calcium signaling in lymphocytes: STIM and ORAI. Annu. Rev. Immunol. 28, 491–533.

Hornum, L., Rømer, J., Markholst, H., 2002. The Diabetes-Prone BB Rat Carries a Frameshift Mutation in Ian4, a Positional Candidate of Iddm1. Nestle Nutr Works Se 51, 1972–1979.

Hoth, M., Button, D.C., Lewis, R.S., 2000. Mitochondrial control of calcium-channel gating: a mechanism for sustained signaling and transcriptional activation in T lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 97, 10607–12.

Hoth, Penner, 1992. Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355, 353–6.

Hua, X., Thompson, C., 2001. Quiescent T cells: actively maintaining inactivity. Nature Immunology.

Huang, Z., Zhang, W., Gao, C., Ji, B., Chi, X., Zheng, W., Wang, H.L., 2016. Dysregulation of GTPase IMAP family members in hepatocellular cancer. Mol Med Rep 14, 4119–4123.

Huber, F., Boire, A., López, M.P., Koenderink, G.H., 2015. Cytoskeletal crosstalk: when three different personalities team up. Curr. Opin. Cell Biol. 32, 39–47.

Hönscher, C., Mari, M., Auffarth, K., Bohnert, M., Griffith, J., Geerts, W., Laan, M. van der, Cabrera, M., Reggiori, F., Ungermann, C., 2014. Cellular metabolism regulates contact sites between vacuoles and mitochondria. Dev. Cell 30, 86–94.

Ilangumaran, S., Forand-Boulerice, M., Bousquet, S.M., Savard, A., Rocheleau, P., Chen, X.L., Dupuis, G., Poussier, P., Boulay, G., Ramanathan, S., 2009. Loss of GIMAP5 (GTPase of immunity-associated nucleotide binding protein 5) impairs calcium signaling in rat T lymphocytes. Mol. Immunol. 46, 1256–9.

Jackson, Rassi, Crump, Haynes, Eisenbarth, 1981. The BB diabetic rat. Profound T cell lymphocytopenia. Nestle Nutr Works Se 30, 887–9.

Jacobs, S.R., Michalek, R.D., Rathmell, J.C., 2010. IL-7 is essential for homeostatic control of T cell metabolism in vivo. J. Immunol. 184, 3461–9.

Jameson, S., 2002. Maintaining the norm: T cell homeostasis. Nature reviews. Immunology 2, 547–56.

Jiang, Q., Li, W., Aiello, F., Mazzucchelli, R., Asefa, B., Khaled, A., Durum, S., 2004. Cell biology of IL-7, a key lymphotrophin. Cytokine & growth factor reviews 16, 513–33.

Jokinen, R., Lahtinen, T., Marttinen, P., Myöhänen, M., Ruotsalainen, P., Yeung, N., Shvetsova, A., Kastaniotis, A.J., Hiltunen, J.K., Öhman, T., Nyman, T.A., Weiler, H., Battersby, B.J., 2015. Quantitative changes in Gimap3 and Gimap5 expression modify mitochondrial DNA segregation in mice. Genetics 200, 221–35.

Jordens, I., Marsman, M., Kuijl, C., Neefjes, J., 2005. Rab proteins, connecting transport and vesicle fusion. Traffic (Copenhagen, Denmark) 6, 1070–7.

Keita, M., Leblanc, C., Andrews, D., Ramanathan, S., 2007. GIMAP5 regulates mitochondrial integrity from a distinct subcellular compartment. Biochem. Biophys. Res. Commun. 361, 481–6.

Khaled, A.R., Kim, K., Hofmeister, R., Muegge, K., Durum, S.K., 1999. Withdrawal of IL-7 induces Bax translocation from cytosol to mitochondria through a rise in intracellular pH. Proc. Natl. Acad. Sci. U.S.A. 96, 14476–81.

Kim, G.Y., Hong, C., Park, J.-H.H., 2011. Seeing is believing: illuminating the source of in vivo interleukin-7. Immune Netw 11, 1–10.

Kimura, M., Pobezinsky, L., Guinter, T., Thomas, J., Adams, A., Park, J.-H., Tai, X., Singer, A., 2013. IL-7 signaling must be intermittent, not continuous, during CD8+ T cell homeostasis to promote cell survival instead of cell death. Nature immunology 14, 143–51.

King, S.J., Brown, C.L., Maier, K.C., Quintyne, N.J., Schroer, T.A., 2003. Analysis of the dynein- dynactin interaction in vitro and in vivo. Mol. Biol. Cell 14, 5089–97.

Kirichok, Y., Krapivinsky, G., Clapham, D., 2004. The mitochondrial calcium uniporter is a highly selective ion channel. Nature 427, 360–4.

Klosowiak, J., Focia, P., Chakravarthy, S., Landahl, E., Freymann, D., Rice, S., 2013. Structural coupling of the EF hand and C-terminal GTPase domains in the mitochondrial protein Miro. EMBO reports 14, 968–974.

Kolomeisky, A.B., Fisher, M.E., 2007. Molecular motors: a theorist’s perspective. Annu Rev Phys Chem 58, 675–95.

Kolter, T., Sandhoff, K., 2005. Principles of lysosomal membrane digestion: stimulation of sphingolipid degradation by sphingolipid activator proteins and anionic lysosomal lipids. Annu. Rev. Cell Dev. Biol. 21, 81–103.

Korn, E.D., Carlier, M.F., Pantaloni, D., 1987. Actin polymerization and ATP hydrolysis. Science 238, 638–44.

Krogsgaard, M., Juang, J., Davis, M., 2007. A role for “self” in T cell activation. Seminars in immunology.

Krücken, J., Epe, M., Benten, Falkenroth, N., Wunderlich, F., 2005. Malaria-suppressible expression of the anti-apoptotic triple GTPase mGIMAP8. Journal of cellular biochemistry 96, 339–48.

Krücken, J., Schroetel, R.M., Müller, I.U., Saïdani, N., Marinovski, P., Benten, W.P., Stamm, O., Wunderlich, F., 2004. Comparative analysis of the human gimap gene cluster encoding a novel GTPase family. Gene 341, 291–304.

Kupfer, R., Lang, J., Williams-Skipp, C., Nelson, M., Bellgrau, D., Scheinman, R.I., 2007. Loss of a gimap/ian gene leads to activation of NF-kappaB through a MAPK-dependent pathway. Mol. Immunol. 44, 479–87.

Labrecque, N., Whitfield, L.S., Obst, R., Waltzinger, C., Benoist, C., Mathis, D., 2001. How much TCR does a T cell need? Immunity 15, 71–82.

Lang, J.A., Kominski, D., Bellgrau, D., Scheinman, R.I., 2004. Partial activation precedes apoptotic death in T cells harboring an IAN gene mutation. European Journal of Immunology.

Lau, Ramanathan, Poussier, 1998. Excessive production of nitric oxide by macrophages from DP-BB rats is secondary to the T-lymphopenic state of these animals.

Ledderose, C., Bao, Y., Lidicky, M., Zipperle, J., Li, L., Strasser, K., Shapiro, N.I., Junger, W.G., 2014. Mitochondria are gate-keepers of T cell function by producing the ATP that drives purinergic signaling. J. Biol. Chem. 289, 25936–45.

Lee, Aarhus, 2000. Functional visualization of the separate but interacting calcium stores sensitive to NAADP and cyclic ADP-ribose. Journal of cell science 113 Pt 24, 4413–20.

Lee, Y., Horie, Y., Wallace, G., Choi, Y., Park, J., Choi, J., Song, R., Kang, Y.-M., Kang, S., Baek, H., Kitaichi, N., Meguro, A., Mizuki, N., Namba, K., Ishida, S., Kim, J., Niemczyk, E., Lee, E., Song, Y., Ohno, S., Lee, E., 2012. Genome-wide association study identifies GIMAP as a novel susceptibility locus for Behcet’s disease. Ann Rheum Dis 72, 1510–6.

Lewis, 2001. Calcium signaling mechanisms in T lymphocytes.

Li, W.Q., Jiang, Q., Khaled, A.R., Keller, J.R., Durum, S.K., 2004. Interleukin-7 inactivates the pro-apoptotic protein Bad promoting T cell survival. J. Biol. Chem. 279, 29160–6.

Li, X., Rydzewski, N., Hider, A., Zhang, X., Yang, J., Wang, W., Gao, Q., Cheng, X., Xu, H., 2016. A molecular mechanism to regulate lysosome motility for lysosome positioning and tubulation. Nat. Cell Biol. 18, 404–17.

Liu, C., Wang, T., Zhang, W., Li, X., 2008. Computational identification and analysis of immune-associated nucleotide gene family in Arabidopsis thaliana. J Plant Physiol 165, 777– 787.

Liu, W., Xie, Y., Ma, J., Luo, X., Nie, P., Zuo, Z., Lahrmann, U., Zhao, Q., Zheng, Y., Zhao, Y., Xue, Y., Ren, J., 2015. IBS: an illustrator for the presentation and visualization of biological sequences. Bioinformatics 31, 3359–61.

Lloyd-Evans, E., Morgan, A., He, X., Smith, D., Elliot-Smith, E., Sillence, D., Churchill, G., Schuchman, E., Galione, A., Platt, F., 2008. Niemann-Pick disease type C1 is a sphingosine storage disease that causes deregulation of lysosomal calcium. Nature medicine 14, 1247– 55.

Lu, Q., Li, J., Zhang, M., 2014. Cargo recognition and cargo-mediated regulation of unconventional myosins. Acc. Chem. Res. 47, 3061–70.

Luzio, J.P., Parkinson, M.D., Gray, S.R., Bright, N.A., 2009. The delivery of endocytosed cargo to lysosomes. Biochem. Soc. Trans. 37, 1019–21.

López, E., Salido, G.M.M., Rosado, J.A., Berna-Erro, A., 2012. Unraveling STIM2 function. J. Physiol. Biochem. 68, 619–33.

López Sanjurjo, C.I., Tovey, S.C., Taylor, C.W., 2014. Rapid Recycling of Ca2+ between IP3- Sensitive Stores and Lysosomes. PLoS ONE 9, e111275.

López-Sanjurjo, C.I., Tovey, S.C., Prole, D.L., Taylor, C.W., 2013. Lysosomes shape Ins(1,4,5)P3-evoked Ca2+ signals by selectively sequestering Ca2+ released from the endoplasmic reticulum. J. Cell. Sci. 126, 289–300.

Macaskill, A.F., Rinholm, J.E., Twelvetrees, A.E., Arancibia-Carcamo, I.L., Muir, J., Fransson, A., Aspenstrom, P., Attwell, D., Kittler, J.T., 2009. Miro1 is a calcium sensor for glutamate receptor-dependent localization of mitochondria at synapses. Neuron 61, 541–55.

Macian, F., 2005. NFAT proteins: key regulators of T cell development and function. Nature Reviews Immunology.

MacLennan, D.H., Kranias, E.G., 2003. Phospholamban: a crucial regulator of cardiac contractility. Nat. Rev. Mol. Cell Biol. 4, 566–77.

MacMurray, Moralejo, Kwitek…, 2002. Lymphopenia in the BB rat model of type 1 diabetes is due to a mutation in a novel immune-associated nucleotide (Ian)-related gene.

Mahajan, V.S., Leskov, I.B., Chen, J.Z., 2005. Homeostasis of T cell diversity. Cell. Mol. Immunol. 2, 1–10.

Malissen, B., Bongrand, P., 2015. Early T cell activation: integrating biochemical, structural, and biophysical cues. Annual review of immunology 33, 539–561.

Mallik, R., Gross, S.P., 2004. Molecular motors: strategies to get along. Curr. Biol. 14, R971– 82.

Maravillas-Montero, J.L.L., Santos-Argumedo, L., 2012. The myosin family: unconventional roles of actin-dependent molecular motors in immune cells. J. Leukoc. Biol. 91, 35–46.

Marrack, Bender, Hildeman, Jordan, Mitchell, Murakami, Sakamoto, Schaefer, Swanson, Kappler, 2000. Homeostasis of alpha beta TCR+ T cells. Nature immunology.

Matza, D., Badou, A., Klemic, K.G., Stein, J., Govindarajulu, U., Nadler, M.J., Kinet, J.-P.P., Peled, A., Shapira, O.M., Kaczmarek, L.K., Flavell, R.A., 2016. T Cell Receptor Mediated Calcium Entry Requires Alternatively Spliced Cav1.1 Channels. PLoS ONE 11, e0147379.

Mazzucchelli, R.I., Warming, S., Lawrence, S.M., Ishii, M., Abshari, M., Washington, A.V., Feigenbaum, L., Warner, A.C., Sims, D.J., Li, W.Q., Hixon, J.A., Gray, D.H., Rich, B.E., Morrow, M., Anver, M.R., Cherry, J., Naf, D., Sternberg, L.R., McVicar, D.W., Farr, A.G., Germain, R.N., Rogers, K., Jenkins, N.A., Copeland, N.G., Durum, S.K., 2009. Visualization and identification of IL-7 producing cells in reporter mice. PLoS ONE 4, e7637.

McCue, H., Wardyn, J., Burgoyne, R., Haynes, L., 2013. Generation and characterization of a lysosomally targeted, genetically encoded Ca(2+)-sensor. The Biochemical journal 449, 449– 57.

Medina, D.L., Paola, S. Di, Peluso, I., Armani, A., Stefani, D. De, Venditti, R., Montefusco, S., Scotto-Rosato, A., Prezioso, C., Forrester, A., Settembre, C., Wang, W., Gao, Q., Xu, H., Sandri, M., Rizzuto, R., Matteis, M.A. De, Ballabio, A., 2015. Lysosomal calcium signalling regulates autophagy through calcineurin and TFEB. Nat. Cell Biol. 17, 288–99.

Mitchell, Chang, H.-Y., Daugherty, Fraser, Hunter, Lopez, McAnulla, McMenamin, Nuka, Pesseat, Sangrador-Vegas, Scheremetjew, Rato, Yong, S.-Y., Bateman, Punta, Attwood, Sigrist, Redaschi, Rivoire, Xenarios, Kahn, Guyot, Bork, Letunic, Gough, Oates, Haft, Huang, Natale, Wu, Orengo, Sillitoe, Mi, Thomas, Finn, 2015. The InterPro protein families database: the classification resource after 15 years. Nucleic Acids Research 43, D213–D221.

Mitchison, T., Kirschner, M., 1984. Dynamic instability of microtubule growth. Nature 312, 237–42.

Montero, M., Alonso, M.T., Carnicero, E., Cuchillo-Ibáñez, I., Albillos, A., García, A.G., García- Sancho, J., Alvarez, J., 2000. Chromaffin-cell stimulation triggers fast millimolar mitochondrial Ca2+ transients that modulate secretion. Nat. Cell Biol. 2, 57–61.

Montero, M., Alvarez, J., Scheenen, W.J., Rizzuto, R., Meldolesi, J., Pozzan, T., 1997. Ca2+ homeostasis in the endoplasmic reticulum: coexistence of high and low [Ca2+] subcompartments in intact HeLa cells. J. Cell Biol. 139, 601–11.

Morgan, A.J., Davis, L.C., Wagner, S.K., Lewis, A.M., Parrington, J., Churchill, G.C., Galione, A., 2013. Bidirectional Ca2+ signaling occurs between the endoplasmic reticulum and acidic organelles. J. Cell Biol. 200, 789–805.

Morgan, A.J., Platt, F.M., Lloyd-Evans, E., Galione, A., 2011. Molecular mechanisms of endolysosomal Ca2+ signalling in health and disease. Biochem. J. 439, 349–74.

Morlino, Barreiro, Baixauli, Robles-Valero, Gonzalez-Granado, Villa-Bellosta, Cuenca, Sanchez-Sorzano, Veiga, Martin-Cofreces, Sanchez-Madrid, 2014. Miro-1 Links Mitochondria and Microtubule Dynein Motors To Control Lymphocyte Migration and Polarity. Molecular and Cellular Biology 34, 1412–1426.

Mungamuri, S.K., Yang, X., Thor, A.D., Somasundaram, K., 2006. Survival signaling by Notch1: mammalian target of rapamycin (mTOR)-dependent inhibition of p53. Cancer Res. 66, 4715–24.

Müller, M.J., Klumpp, S., Lipowsky, R., 2008. Tug-of-war as a cooperative mechanism for bidirectional cargo transport by molecular motors. Proc. Natl. Acad. Sci. U.S.A. 105, 4609– 14.

Nitta, T., Nasreen, M., Seike, T., Goji, A., Ohigashi, I., Miyazaki, T., Ohta, T., Kanno, M., Takahama, Y., 2006. IAN family critically regulates survival and development of T lymphocytes. PLoS Biol. 4, e103.

Nitta, T., Takahama, Y., 2007. The lymphocyte guard-IANs: regulation of lymphocyte survival by IAN/GIMAP family proteins. Trends in immunology 28, 58–65.

Oh-hora, M., 2009. Calcium signaling in the development and function of T-lineage cells. Immunological reviews 231, 210–24.

Oh-hora, M., Rao, A., 2008. Calcium signaling in lymphocytes. Curr. Opin. Immunol. 20, 250– 8.

Ohi, R., Zanic, M., 2016. Ahead of the Curve: New Insights into Microtubule Dynamics. F1000Res 5.

Omilusik, K., Priatel, J., Chen, X., Wang, Y., Xu, H., Choi, K., Gopaul, R., McIntyre-Smith, A., Teh, H.-S., Tan, R., Bech-Hansen, T., Waterfield, D., Fedida, D., Hunt, S., Jefferies, W., 2009. The CaV1.4 Calcium Channel Is a Critical Regulator of T Cell Receptor Signaling and Naïve T Cell Homeostasis. Immunity 35, 349–60.

Ong, H.L., Souza, L.B. de, Zheng, C., Cheng, K.T., Liu, X., Goldsmith, C.M., Feske, S., Ambudkar, I.S., 2015. STIM2 enhances receptor-stimulated Ca2+ signaling by promoting recruitment of STIM1 to the endoplasmic reticulum-plasma membrane junctions. Sci Signal 8, ra3.

Onnis, A., Finetti, F., Baldari, C.T., 2016. Vesicular Trafficking to the Immune Synapse: How to Assemble Receptor-Tailored Pathways from a Basic Building Set. Front Immunol 7, 50.

Ouyang, W., Beckett, O., Flavell, R.A., Li, M.O., 2009. An essential role of the Forkhead-box transcription factor Foxo1 in control of T cell homeostasis and tolerance. Immunity 30, 358– 71.

Pandarpurkar, Wilson-Fritch, Corvera, Markholst, Hornum, Greiner, Mordes, Rossini, Bortell, 2003. Ian4 is required for mitochondrial integrity and T cell survival. Proceedings of the National Academy of Sciences of the United States of America 100, 10382–7.

Parekh, A., 2008. Mitochondrial regulation of store-operated CRAC channels. Cell calcium 44, 6–13.

Park, J.-H.H., Adoro, S., Lucas, P.J., Sarafova, S.D., Alag, A.S., Doan, L.L., Erman, B., Liu, X., Ellmeier, W., Bosselut, R., Feigenbaum, L., Singer, A., 2007. “Coreceptor tuning”: cytokine signals transcriptionally tailor CD8 coreceptor expression to the self-specificity of the TCR. Nat. Immunol. 8, 1049–59.

Pascall, J., Rotondo, S., Mukadam, A., Oxley, D., Webster, J., Walker, S., Piron, J., Carter, C., Ktistakis, N., Butcher, G., 2012. The immune system GTPase GIMAP6 interacts with the Atg8 homologue GABARAPL2 and is recruited to autophagosomes. PloS one 8, e77782.

Patel, S., Docampo, R., 2010. Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling. Trends in cell biology 20, 277–86.

Penny, C.J., Kilpatrick, B.S., Eden, E.R., Patel, S., 2015. Coupling acidic organelles with the ER through Ca2+ microdomains at membrane contact sites. Cell Calcium 58, 387–96.

Pereira-Leal, J.B., Seabra, M.C., 2001. Evolution of the Rab family of small GTP-binding proteins. J. Mol. Biol. 313, 889–901.

Peschon, J.J., Morrissey, P.J., Grabstein, K.H., Ramsdell, F.J., Maraskovsky, E., Gliniak, B.C., Park, L.S., Ziegler, S.F., Williams, D.E., Ware, C.B., Meyer, J.D., Davison, B.L., 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J. Exp. Med. 180, 1955–60.

Pfeffer, 2001. Rab GTPases: specifying and deciphering organelle identity and function.

Pino, S.C., O’Sullivan-Murphy, B., Lidstone, E.A., Yang, C., Lipson, K.L., Jurczyk, A., diIorio, P., Brehm, M.A., Mordes, J.P., Greiner, D.L., Rossini, A.A., Bortell, R., 2009. CHOP mediates endoplasmic reticulum stress-induced apoptosis in Gimap5-deficient T cells. PLoS ONE 4, e5468.

Pinton, P., Pozzan, T., Rizzuto, R., 1998. The Golgi apparatus is an inositol 1,4,5- trisphosphate-sensitive Ca2+ store, with functional properties distinct from those of the endoplasmic reticulum. EMBO J. 17, 5298–308.

Poirier, G.M., Anderson, G., Huvar, A., Wagaman, P.C., Shuttleworth, J., Jenkinson, E., Jackson, M.R., Peterson, P.A., Erlander, M.G., 1999. Immune-associated nucleotide-1 (IAN- 1) is a thymic selection marker and defines a novel gene family conserved in plants. J. Immunol. 163, 4960–9.

Polic, B., Kunkel, D., Scheffold, A., Rajewsky, K., 2001. How alpha beta T cells deal with induced TCR alpha ablation. Proc. Natl. Acad. Sci. U.S.A. 98, 8744–9.

Poussier, Nakhooda, Falk, Lee, Marliss, 1982. Lymphopenia and abnormal lymphocyte subsets in the “BB” rat: relationship to the diabetic syndrome. Endocrinology 110, 1825–7.

Qi, Q., Liu, Y., Cheng, Y., Glanville, J., Zhang, D., Lee, J.-Y.Y., Olshen, R.A., Weyand, C.M., Boyd, S.D., Goronzy, J.J.J., 2014. Diversity and clonal selection in the human T cell repertoire. Proc. Natl. Acad. Sci. U.S.A. 111, 13139–44.

Quintana, A., Hoth, M., 2012. Mitochondrial dynamics and their impact on T cell function. Cell Calcium 52, 57–63.

Quintana, A., Schwarz, E., Schwindling, C., Lipp, P., Kaestner, L., Hoth, M., 2006. Sustained activity of calcium release-activated calcium channels requires translocation of mitochondria to the plasma membrane. The Journal of biological chemistry 281, 40302–9.

Raffaello, A., Mammucari, C., Gherardi, G., Rizzuto, R., 2016. Calcium at the Center of Cell Signaling: Interplay between Endoplasmic Reticulum, Mitochondria, and Lysosomes. Trends Biochem. Sci. 41, 1035–1049.

Raimundo, N., Fernández-Mosquera, L., Yambire, K.F., Diogo, C.V.V., 2016. Mechanisms of communication between mitochondria and lysosomes. Int. J. Biochem. Cell Biol. 79, 345– 349.

Ramanathan, Norwich, Poussier, 1998. Antigen activation rescues recent thymic emigrants from programmed cell death in the BB rat. Journal of immunology (Baltimore, Md. : 1950) 160, 5757–64.

Ramanathan, Poussier, 2001. BB rat lyp mutation and type 1 diabetes.

Rizzuto, 1998. Close Contacts with the Endoplasmic Reticulum as Determinants of Mitochondrial Ca2+ Responses. Science 280, 1763–1766.

Rizzuto, Bernardi, Pozzan, 2000. Mitochondria as all-round players of the calcium game. The Journal of physiology 529 Pt 1, 37–47.

Rizzuto, Brini, Murgia, Pozzan, 1993. Microdomains with high Ca2+ close to IP3-sensitive channels that are sensed by neighboring mitochondria. Science (New York, N.Y.) 262, 744– 7.

Robey, E., Fowlkes, B.J., 1994. Selective events in T cell development. Annu. Rev. Immunol. 12, 675–705.

Rochman, Y., Spolski, R., Leonard, W., 2009. New insights into the regulation of T cells by gamma(c) family cytokines. Nature reviews. Immunology 9, 480–90.

Ronco, V., Potenza, D.M., Denti, F., Vullo, S., Gagliano, G., Tognolina, M., Guerra, G., Pinton, P., Genazzani, A.A., Mapelli, L., Lim, D., Moccia, F., 2015. A novel Ca2+-mediated cross-talk between endoplasmic reticulum and acidic organelles: implications for NAADP-dependent Ca2+ signalling. Cell Calcium 57, 89–100.

Ross, J., Ali, Warshaw, D., 2008. Cargo transport: molecular motors navigate a complex cytoskeleton. Current opinion in cell biology 20, 41–7.

Saftig, P., Klumperman, J., 2009. Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat. Rev. Mol. Cell Biol. 10, 623–35.

Sandal, T., Aumo, L., Hedin, L., Gjertsen, B.T.T., Døskeland, S.O., 2003. Irod/Ian5: an inhibitor of gamma-radiation- and okadaic acid-induced apoptosis. Mol. Biol. Cell 14, 3292–304.

Santo-Domingo, J., Demaurex, N., 2010. Calcium uptake mechanisms of mitochondria. Biochimica et biophysica acta 1797, 907–12.

Saunders, A., Webb, L.M., Janas, M.L., Hutchings, A., Pascall, J., Carter, C., Pugh, N., Morgan, G., Turner, M., Butcher, G.W., 2010. Putative GTPase GIMAP1 is critical for the development of mature B and T lymphocytes. Blood 115, 3249–57.

Schenk, U., Westendorf, A.M., Radaelli, E., Casati, A., Ferro, M., Fumagalli, M., Verderio, C., Buer, J., Scanziani, E., Grassi, F., 2008. Purinergic control of T cell activation by ATP released through pannexin-1 hemichannels. Sci Signal 1, ra6.

Schnell, S., Démollière, C., Berk, P. van den, Jacobs, H., 2006. Gimap4 accelerates T cell death. Blood 108, 591–9.

Schulteis, R.D., Chu, H., Dai, X., Chen, Y., Edwards, B., Haribhai, D., Williams, C.B., Malarkannan, S., Hessner, M.J., Glisic-Milosavljevic, S., Jana, S., Kerschen, E.J., Ghosh, S., Wang, D., Kwitek, A.E., Lernmark, A., Gorski, J., Weiler, H., 2008. Impaired survival of peripheral T cells, disrupted NK/NKT cell development, and liver failure in mice lacking Gimap5. Blood 112, 4905–14.

Schwefel, D., Arasu, B.S., Marino, S.F., Lamprecht, B., Köchert, K., Rosenbaum, E., Eichhorst, J., Wiesner, B., Behlke, J., Rocks, O., Mathas, S., Daumke, O., 2013. Structural insights into the mechanism of GTPase activation in the GIMAP family. Structure 21, 550–9.

Schwefel, D., Daumke, O., 2011. GTP-dependent scaffold formation in the GTPase of Immunity Associated Protein family. Small GTPases 2, 27–30.

Schwefel, D., Fröhlich, C., Eichhorst, J., Wiesner, B., Behlke, J., Aravind, L., Daumke, O., 2010. Structural basis of oligomerization in septin-like GTPase of immunity-associated protein 2 (GIMAP2). Proc. Natl. Acad. Sci. U.S.A. 107, 20299–304.

Settembre, C., Fraldi, A., Medina, D., Ballabio, A., 2013. Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nature Reviews Molecular Cell Biology 14, 283–296.

Shalapour, S., Deiser, K., Sercan, O., Tuckermann, J., Minnich, K., Willimsky, G., Blankenstein, T., Hämmerling, G.J.J., Arnold, B., Schüler, T., 2010. Commensal microflora and interferon-gamma promote steady-state interleukin-7 production in vivo. Eur. J. Immunol. 40, 2391–400.

Sheetz, M.P., 1996. Microtubule motor complexes moving membranous organelles. Cell Struct. Funct. 21, 369–73.

Sheridan, C., Martin, S.J., 2010. Mitochondrial fission/fusion dynamics and apoptosis. Mitochondrion 10, 640–8.

Shiao, Y.-M.M., Chang, Y.-H.H., Liu, Y.-M.M., Li, J.-C.C., Su, J.-S.S., Liu, K.-J.J., Liu, Y.-F.F., Lin, M.-W.W., Tsai, S.-F.F., 2008. Dysregulation of GIMAP genes in non-small cell lung cancer. Lung Cancer 62, 287–94.

Shin, J.-H.H., Janer, M., McNeney, B., Blay, S., Deutsch, K., Sanjeevi, C.B., Kockum, I., Lernmark, A., Graham, J., Arnqvist, H., Björck, E., Eriksson, J., Nyström, L., Ohlson, L.O., Scherstén, B., Ostman, J., Aili, M., Bååth, L.E., Carlsson, E., Edenwall, H., Forsander, G., Granström, B.W., Gustavsson, I., Hanås, R., Hellenberg, L., Hellgren, H., Holmberg, E., Hörnell, H., Ivarsson, S.-A.A., Johansson, C., Jonsell, G., Kockum, K., Lindblad, B., Lindh, A., Ludvigsson, J., Myrdal, U., Neiderud, J., Segnestam, K., Sjöblad, S., Skogsberg, L., Strömberg, L., Ståhle, U., Thalme, B., Tullus, K., Tuvemo, T., Wallensteen, M., Westphal, O., Aman, J., 2007. IA-2 autoantibodies in incident type I diabetes patients are associated with a polyadenylation signal polymorphism in GIMAP5. Genes Immun. 8, 503–12.

Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J., Thompson, J.D., Higgins, D.G., 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539.

Singaravelu, K., Nelson, C., Bakowski, D., Brito, O.M. de, Ng, S.-W.W., Capite, J. Di, Powell, T., Scorrano, L., Parekh, A.B., 2011. Mitofusin 2 regulates STIM1 migration from the Ca2+ store to the plasma membrane in cells with depolarized mitochondria. J. Biol. Chem. 286, 12189–201.

Singh, R., Cuervo, A.M., 2011. Autophagy in the cellular energetic balance. Cell Metab. 13, 495–504.

Smith, M., Pozo, K., Brickley, K., Stephenson, 2006. Mapping the GRIF-1 binding domain of the kinesin, KIF5C, substantiates a role for GRIF-1 as an adaptor protein in the anterograde trafficking of cargoes. The Journal of biological chemistry 281, 27216–28.

Soares, H., Henriques, R., Sachse, M., Ventimiglia, L., Alonso, M., Zimmer, C., Thoulouze, M.- I., Alcover, A., 2013. Regulated vesicle fusion generates signaling nanoterritories that control T cell activation at the immunological synapse. The Journal of experimental medicine 210, 2415–33.

Srikanth, S., Gwack, Y., 2013. Orai1-NFAT signalling pathway triggered by T cell receptor stimulation. Molecules and cells.

Stamm, O., Krücken, J., Schmitt-Wrede, H.-P.P., Benten, W.P., Wunderlich, F., 2002. Human ortholog to mouse gene imap38 encoding an ER-localizable G-protein belongs to a gene family clustered on chromosome 7q32-36. Gene 282, 159–67.

Starr, T., Jameson, S., Hogquist, K., 2002. Positive and negative selection of T cells. Annual review of immunology 21, 139–76.

Steigemann, P., Wurzenberger, C., Schmitz, M.H., Held, M., Guizetti, J., Maar, S., Gerlich, D.W., 2009. Aurora B-mediated abscission checkpoint protects against tetraploidization. Cell 136, 473–84.

100

Stenmark, H., 2009. Rab GTPases as coordinators of vesicle traffic. Nature reviews. Molecular cell biology 10, 513–25.

Stowers, R.S., Megeath, L.J., Górska-Andrzejak, J., Meinertzhagen, I.A., Schwarz, T.L., 2002. Axonal transport of mitochondria to synapses depends on milton, a novel Drosophila protein. Neuron 36, 1063–77.

Sun, 2000. Mucolipidosis type IV is caused by mutations in a gene encoding a novel transient receptor potential channel. Human Molecular Genetics 9, 2471–2478.

Surh, C.D., Sprent, J., 2008. Homeostasis of naïve and memory T cells. Immunity 29, 848– 62.

Suzuki, J., Kanemaru, K., Ishii, K., Ohkura, M., Okubo, Y., Iino, M., 2014. Imaging intraorganellar Ca2+ at subcellular resolution using CEPIA. Nature Communications 5, -.

Swain, S.L., 1983. T cell subsets and the recognition of MHC class. Immunol. Rev. 74, 129– 42.

Szabadkai, G., Bianchi, K., Várnai, P., Stefani, D. De, Wieckowski, M.R., Cavagna, D., Nagy, A.I.I., Balla, T., Rizzuto, R., 2006. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J. Cell Biol. 175, 901–11.

Tait, S., Green, D., 2010. Mitochondria and cell death: outer membrane permeabilization and beyond. Nature reviews. Molecular cell biology 11, 621–32.

Takada, K., Jameson, S., 2009. Naïve T cell homeostasis: from awareness of space to a sense of place. Nature reviews. Immunology 9, 823–32.

Takeda, S., Rodewald, H.R., Arakawa, H., Bluethmann, H., Shimizu, T., 1996. MHC class II molecules are not required for survival of newly generated CD4+ T cells, but affect their long-term life span. Immunity 5, 217–28.

Tan, J.T., Ernst, B., Kieper, W.C., LeRoy, E., Sprent, J., Surh, C.D., 2002. Interleukin (IL)-15 and IL-7 jointly regulate homeostatic proliferation of memory phenotype CD8+ cells but are not required for memory phenotype CD4+ cells. J. Exp. Med. 195, 1523–32.

Tanchot, C., Lemonnier, F.A., Pérarnau, B., Freitas, A.A., Rocha, B., 1997. Differential requirements for survival and proliferation of CD8 naïve or memory T cells. Science 276, 2057–62.

Thiel, M., Lis, A., Penner, R., 2013. STIM2 drives Ca 2+ oscillations through store-operated Ca 2+ entry caused by mild store depletion. The Journal of Physiology 591, 1433–1445.

Vig, Kinet, 2009. Calcium signaling in immune cells.

101

Vilimas, T., Mascarenhas, J., Palomero, T., Mandal, M., Buonamici, S., Meng, F., Thompson, B., Spaulding, C., Macaroun, S., Alegre, M.-L.L., Kee, B.L., Ferrando, A., Miele, L., Aifantis, I., 2007. Targeting the NF-kappaB signaling pathway in Notch1-induced T cell leukemia. Nat. Med. 13, 70–7.

Wang, C., Youle, R.J., 2009. The role of mitochondria in apoptosis*. Annu. Rev. Genet. 43, 95–118.

Wang, R., Green, D., 2012. Metabolic checkpoints in activated T cells. Nature immunology 13, 907–15.

Wang, X., Schwarz, T.L., 2009. The mechanism of Ca2+ -dependent regulation of kinesin- mediated mitochondrial motility. Cell 136, 163–74.

Webb, L.M., Datta, P., Bell, S.E., Kitamura, D., Turner, M., Butcher, G.W., 2015. GIMAP1 Is Essential for the Survival of Naïve and Activated B Cells In Vivo. J. Immunol.

Webb, L.M., Pascall, J.C., Hepburn, L., Carter, C., Turner, M., Butcher, G.W., 2014. Generation and characterisation of mice deficient in the multi-GTPase domain containing protein, GIMAP8. PLoS ONE 9, e110294.

Wegener, E., Oeckinghaus, A., Papadopoulou, N., Lavitas, L., Schmidt-Supprian, M., Ferch, U., Mak, T.W., Ruland, J., Heissmeyer, V., Krappmann, D., 2006. Essential role for IkappaB kinase beta in remodeling Carma1-Bcl10-Malt1 complexes upon T cell activation. Mol. Cell 23, 13–23.

Wei, Q., Adelstein, R.S., 2000. Conditional expression of a truncated fragment of nonmuscle myosin II-A alters cell shape but not cytokinesis in HeLa cells. Mol. Biol. Cell 11, 3617–27.

Woehrle, T., Yip, L., Elkhal, A., Sumi, Y., Chen, Y., Yao, Y., Insel, P.A., Junger, W.G., 2010. Pannexin-1 hemichannel-mediated ATP release together with P2X1 and P2X4 receptors regulate T cell activation at the immune synapse. Blood 116, 3475–84.

Wofford, J.A., Wieman, H.L., Jacobs, S.R., Zhao, Y., Rathmell, J.C., 2008. IL-7 promotes Glut1 trafficking and glucose uptake via STAT5-mediated activation of Akt to support T cell survival. Blood 111, 2101–11.

Wolf, I.M., Diercks, B.-P.P., Gattkowski, E., Czarniak, F., Kempski, J., Werner, R., Schetelig, D., Mittrücker, H.-W.W., Schumacher, V., Osten, M. von, Lodygin, D., Flügel, A., Fliegert, R., Guse, A.H., 2015. Frontrunners of T cell activation: Initial, localized Ca2+ signals mediated by NAADP and the type 1 ryanodine receptor. Sci Signal 8, ra102.

Wong, V.W., Saunders, A.E., Hutchings, A., Pascall, J.C., Carter, C., Bright, N.A., Walker, S.A., Ktistakis, N.T., Butcher, G.W., 2010. The autoimmunity-related GIMAP5 GTPase is a lysosome-associated protein. Self Nonself 1, 259–268.

102

Wu, Q., Liu, Y., Chen, C., Ikenoue, T., Qiao, Y., Li, C.-S.S., Li, W., Guan, K.-L.L., Liu, Y., Zheng, P., 2011. The tuberous sclerosis complex-mammalian target of rapamycin pathway maintains the quiescence and survival of naïve T cells. J. Immunol. 187, 1106–12.

Xie, D.-L., Wu, J., Lou, Y.-L., Zhong, X.-P., 2012. Tumor suppressor TSC1 is critical for T cell anergy. Proceedings of the National Academy of Sciences of the United States of America.

Yang, H., Wang, X., Zhang, Y., Liu, H., Liao, J., Shao, K., Chu, Y., Liu, G., 2013. Modulation of TSC-mTOR signaling on immune cells in immunity and autoimmunity. Journal of cellular physiology 229, 17–26.

Yang, K., Chi, H., 2012. mTOR and metabolic pathways in T cell quiescence and functional activation. Seminars in immunology 24, 421–8.

Yang, K., Chi, H., 2013. Tuning mTOR activity for immune balance. The Journal of clinical investigation 123, 5001–4.

Yang, K., Neale, G., Green, D.R., He, W., Chi, H., 2011. The tumor suppressor Tsc1 enforces quiescence of naïve T cells to promote immune homeostasis and function. Nat. Immunol. 12, 888–97.

Yano, K., Carter, C., Yoshida, N., Abe, T., Yamada, A., Nitta, T., Ishimaru, N., Takada, K., Butcher, G.W., Takahama, Y., 2014. Gimap3 and Gimap5 cooperate to maintain T cell numbers in the mouse. Eur. J. Immunol. 44, 561–72.

Yao, Z., Cui, Y., Watford, W.T., Bream, J.H., Yamaoka, K., Hissong, B.D., Li, D., Durum, S.K., Jiang, Q., Bhandoola, A., Hennighausen, L., O’Shea, J.J., 2006. Stat5a/b are essential for normal lymphoid development and differentiation. Proc. Natl. Acad. Sci. U.S.A. 103, 1000– 5.

Yip, L., Woehrle, T., Corriden, R., Hirsh, M., Chen, Y., Inoue, Y., Ferrari, V., Insel, P.A., Junger, W.G., 2009. Autocrine regulation of T cell activation by ATP release and P2X7 receptors. FASEB J. 23, 1685–93.

Zadeh, Greiner, Wu, Tausche, Goldschneider, 1995. Abnormalities in the export and fate of recent thymic emigrants in diabetes-prone BB/W rats. Autoimmunity 24, 35–46.

Zampese, E., Pizzo, P., 2012. Intracellular organelles in the saga of Ca2+ homeostasis: different molecules for different purposes? Cell. Mol. Life Sci. 69, 1077–104.

Zbidi, H., Jardin, I., Woodard, G., Lopez, J., Berna-Erro, A., Salido, G., Rosado, J., 2011. STIM1 and STIM2 are located in the acidic Ca2+ stores and associates with Orai1 upon depletion of the acidic stores in human platelets. The Journal of biological chemistry 286, 12257–70.

103

Zenz, T., Roessner, A., Thomas, A., Fröhling, S., Döhner, H., Calabretta, B., Dahéron, L., 2004. hIan5: the human ortholog to the rat Ian4/Iddm1/lyp is a new member of the Ian family that is overexpressed in B-cell lymphoid malignancies. Genes Immun. 5, 109–16.

Zhang, L., Zhang, H., Li, L., Yi, X., Rao, E., Miao, Z., Chen, H., Sun, L., Li, H., Liu, G., Zhao, Y., 2011. TSC1/2 signaling complex is essential for peripheral naïve CD8+ T cell survival and homeostasis in mice. PloS one 7, e30592.

Zhong, X.-P.P., Guo, R., Zhou, H., Liu, C., Wan, C.-K.K., 2008. Diacylglycerol kinases in immune cell function and self-tolerance. Immunol. Rev. 224, 249–64.

Zweifach, Lewis, 1993. Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores. Proceedings of the National Academy of Sciences of the United States of America 90, 6295–9.

104

ANNEXES

Construction of deletion mutants of GIMAP5 To further study which regions of the protein are important in the role of GIMAP5, a set of different deletion mutants were generated by PCR cloning (Figure 5-1). Initially, all the constructions were tagged with a Flag tag at N-terminal and cloned into the pIRESpuro3 vector, which contains a puromycin resistant gene that enables the establishment of stable cells. Once the cloning sequences were verified, each one of the mutants was transfected into HEK293T cells. 48 hours post-transfection, cells were lysed and the presence of the transfected protein was confirmed by western blot.

Figure 5- 1: Schematic representation of other the different deletion mutants from GIMAP5v1. GIMAP5 deletions were made in the C-terminal and transmembrane domains by PCR cloning. AIG, AIG1-type guanine nucleotide-binding; C-C, coiled-coiled; TM, transmembrane domain. All constructs were tagged at the N-terminus with Flag.

105

Figure 5- 2: Protein expression of the different deletion mutants of GIMAP5. HEK293T cells were transiently transfected with 1µg of plasmid cDNA of each deletion mutant created and 48 hours after transfection cells were lysed and protein were extracted and detected by western blot using an anti-flag antibody.

After protein expression was confirmed by western blot, HEK293T cells were again transfected and 48 hours after transfection 2µg/ml of puromycin were added to the culture media in order to establish stable cell lines. Culture medium containing puromycin was changed every 3 days. When cells were reaching 70 to 80% confluency, cells were transferred to a new petri dish containing DMEM medium in addition to puromycin. After 3 weeks, we assumed that all the cells in the petri dish contained the transfected construction. As western blot analysis cannot completely confirm that the cells are expressing the protein, cells were fixed and analyzed by confocal microscopy with a secondary fluorescent antibody labeling the Flag tag. Similarly, cellular localization of the different mutants generated was analyzed by confocal microscopy. As shown in Figure 4, all the cells were expressing the protein constructs. However, we observed differences in the cellular localization of the protein. Interestingly, the punctuate-like appearance of the protein did not change much up to deletion of 40 a.a. On the other hand, deletion mutants where 60 to 100 a.a at the N-terminal were missing showed a more filament-like appearance. When all of the AIG1 domain was practically removed, as shown by the deletion of 150 and 200 a.a, the protein began to agglomerate in different parts of the cell. Lastly, for the mutants without a TM region, a more diffuse cytosolic localization was observed.

106

Figure 5- 3: Stable HEK293T cells stable for the expression of different mutants of the GIMAP5 protein. Protein expression of the different mutants in fixed cells prepared for confocal microscopy. All cells were incubated with a primary anti-flag antibody and with a secondary Alexa-488 antibody.

These set of results suggest that compromising the integrity of the AIG1 domain is important for the localization of GIMAP5. Over 100 a.a. deletion resulted in protein agglomerates. Finally, as confirmed by other results, the absence of the transmembrane region delocalized the protein to a diffuse phenotype into the cytosol, underlying the importance for the GIMAP5 protein to be anchored to a specific membrane in order to function properly.

107