Phosphorylation of the M2 Protein of Influenza a Virus Is Not Essential for Virus Viability

VIROLOGY 252, 54±64 (1998) ARTICLE NO. VY989384

Phosphorylation of the M2 Protein of Influenza A Virus Is Not Essential for Virus Viability

Joanne M. Thomas, Mark P. Stevens, Neil Percy,1 and Wendy S. Barclay2

School of Animal and Microbial Sciences, University of Reading, Whiteknights, UK RG6 6AJ Received May 14, 1998; returned to author for revision June 12, 1998; accepted August 18, 1998

M2 is a minor component of the influenza A virus envelope. The cytoplasmic tail of the M2 protein is posttranslationally modified in the infected cell by palmitylation and phosphorylation. The primary site for phosphorylation of the M2 cytoplasmic tail is serine 64, which is highly conserved yet not required for the activity of the M2 ion channel. Using an exogenous incorporation assay, we have shown that incorporation of M2 into virus particles is type-specific and does not require phosphorylation of the cytoplasmic tail. In addition, phosphorylation of the cytoplasmic tail is not required for the directional transport of M2 in polarized MDCK cells. Using a reverse genetics and reassortment procedure, we generated a virus (Ra) specifically mutated in segment 7 such that the M2 cytoplasmic tail could no longer be phosphorylated. The virus was found to grow as well as wild-type virus in tissue culture and in eggs, was stable on passage in these systems, and possessed no second-site mutations in the engineered RNA segment. In vivo Ra replicated in Balb/c mice at least as well as the parent strain A/WSN/33. These studies indicate that phosphorylation of the M2 cytoplasmic tail is not required for in vitro or in vivo replication of influenza A virus. © 1998 Academic Press

INTRODUCTION tion for the cytoplasmic tail of 54 amino acids has yet to The M2 protein of influenza A virus is a small integral be assigned, although the length and sequence of this membrane protein and a minor component of the virion region are well conserved among influenza A virus iso- envelope (Lamb et al., 1985). M2 possesses an ion chan- lates (Fig. 1a), suggesting that an evolutionary pressure nel activity that is activated in the low pH environment of exists to maintain them. In particular, this region contains the endosome after the virus enters the cell (Hay et al., a number of serine residues, which serve as sites for 1992; Pinto et al., 1992). The consequent acidification of phosphorylation, and a cysteine at residue 50, which the virion interior stimulates the dissociation of the inter- receives fatty acid modification (see Fig. 1a). However, nal virus components in preparation for replication (Mar- neither of these posttranslational modifications is re- tin and Helenius, 1991). Influenza B and C viruses pos- quired for the activity of the ion channel (Holsinger et al., sess similar small membrane proteins, termed NB and 1995; Pinto et al., 1992). The extreme carboxyl-terminal CM2, respectively (Betakova et al., 1996; Brassard et al., four residues are completely conserved, and deletion of 1996; Hongo et al., 1997; Pekosz and Lamb, 1997), which a single amino acid from this terminus results in virus may be functionally homologous to M2. However, these attenuation. Furthermore, it has not been possible to proteins share no sequence homology and are encoded recover viruses with five or 10 residues deleted from the by different strategies (Shaw and Choppin, 1984; Shih C terminus (Castrucci and Kawaoka, 1995). In contrast, and Krug, 1996; Yamashita et al., 1988). the cytoplasmic tails of the other two virion envelope M2 is translated from a spliced message derived from proteins, haemagglutinin (HA) and neuraminidase (NA), RNA segment 7, which also encodes the matrix protein can be deleted both individually or simultaneously with- M1 (Lamb et al., 1981). The M2 protein has an amino- out loss of virus viability (Garcia-Sastre and Palese, 1995; terminal ectodomain of 25 residues, which was recently Jin et al., 1997). Incorporation of HA into influenza parti- shown to be important for incorporation of the protein cles is not a type-specific event because influenza A into the influenza virus envelope (Park et al., 1998). The virus HA proteins are incorporated into influenza B virus transmembrane domain of 19 hydrophobic residues pos- particles after double infection of cells (Sklyanskaya et sesses the ion channel activity that can be blocked by al., 1985). Whether the NA proteins also show phenotypic the antiviral agent amantadine (Duff et al., 1994). A func- mixing is not known, although it is noteworthy that an influenza A virus has been recovered in which the sequence of the cytoplasmic tail of NA was exchanged for 1 Present address: Celsis Limited, Cambridge Science Park, Milton that of an influenza B virus NA protein (Bilsel et al., 1993). Road, Cambridge, UK CB4 4FX. 2 To whom reprint requests should be addressed. Fax: 44 (1189) The incorporation of M2 or NB proteins into heterotypic 316671. E-mail: [email protected]. particles has not previously been investigated.

The site of fatty acid modification at cysteine ,ء .FIG. 1. (a) Amino acid sequence alignment of the cytoplasmic tail domain of a number of M2 proteins 50. Serines that serve as sites for phosphorylation are indicated by arrows. Swiss-prot accession numbers are shown in bold. (b) Amino acid sequences of the cytoplasmic tails of A/WSN/33 M2 and the phosphorylation mutant M2 proteins P-2 and P-1-2.

During influenza A virus infection, high levels of M2 tained only unphosphorylated M2 could be isolated us- accumulate at the surface of infected cells, yet the pro- ing a reverse genetics procedure. tein is present at low frequency in the virus envelope (Zebedee and Lamb, 1988). This discrepancy implies that RESULTS only a subset of M2 molecules within the cell are incorporated into particles. In the current study, we asked Incorporation of exogenous M2 proteins into virus whether phosphorylation of the M2 cytoplasmic tail reg- particles ulates incorporation of M2 molecules into particles and To detect incorporation of M2 protein into virus parti- hence controls viral assembly. We tested whether un- cles, we took advantage of the fact that the A/WSN/33 phosphorylated M2 protein would be incorporated into M2 migrates more slowly than M2 of A/PR/8/34 (Panay- influenza virus particles in an exogenous incorporation otov and Schlesinger, 1992) under nonreducing SDS± assay. In parallel, we examined whether the incorpora- PAGE. We established a Madin±Darby canine kidney tion of M2 is type-specific by asking whether M2 can be (MDCK) cell line that stably expresses the A/WSN/33 M2 incorporated into influenza B virus particles. We have protein. M2 expression at the cell surface was detected also ascertained whether the phosphorylation status of by immunohistochemical staining using the 14C2 mono- M2 affects its directional transport in polarized cells clonal antibody as primary antibody. The levels of ex- because phosphorylation of other proteins has been pression of M2 protein in these cells were similar to implicated in their targeting (Casanova et al., 1990; Jones those found late in infection (Fig. 2a, lanes 6 and 7). et al., 1995). We next infected these cells with the A/PR/8/34 strain Finally, bearing in mind the acute sensitivity of the of influenza A virus at a high m.o.i. and analyzed the virus to deletions of the M2 cytoplasmic tail and the released virus for incorporation of exogenous M2 protein conservation of the posttranslational modifications in by Western blot, also using 14C2 (Fig. 2a). In virus re- this domain, we investigated whether a virus that con- leased from cells expressing the exogenous M2 protein, 56 THOMAS ET AL.

tein NB was readily seen (Fig. 2b, lanes 1 and 2). NB is visible as a single species in this experiment because the glycosylated species in released virus have been digested with endo-F and the B/Lee/40 infected cell lysate used as a control was generated in the presence of tunicamycin. These results demonstrate that incorporation of M2 protein into influenza virus particles is a type-specific event. The primary site for phosphate addition on the A/Udorn/72 M2 cytoplasmic tail is at serine residue 64 (Holsinger et al., 1995). This residue, and the surrounding consensus for modification, is conserved in the M2 sequences accumulated to date (Fig. 1a). It has been demonstrated that modified M2 proteins. which are unable to phosphorylate serine 64, use other serines for phosphorylation (Holsinger et al., 1995). The A/WSN/33 M2 protein contains two serines in the cytoplasmic domain at posi- tions 64 and 71. To investigate the role of phosphate moieties on the M2 cytoplasmic tail, we established stable and clonal cell lines that expressed M2 proteins mutated (by serine-to-alanine substitutions) at serine 71 (P-2) and at both serines 64 and 71 (P-1±2) (Fig. 1b). It is interesting to note that we were not able to establish a cell line expressing M2 mutated at serine 64 alone (P-1), although we could detect expression of this protein after transient transfection (data not shown). After infection of cells expressing either the P-2 or P-1±2 mutant M2 proteins, we monitored the M2 species in released virus by Western blotting. Only tetrameric

FIG. 2. Analysis of purified A/PR/8/34 and B/Lee/40 virus particles to detect incorporation of exogenous A/WSN/33 M2. (a) Purified A/PR8/34 virus (lanes 1 and 2) or B/Lee/40 virus (lanes 3 and 4) were analyzed for incorporation of exogenous M2 by 15% SDS±PAGE under nonreducing conditions followed by Western blot using the 14C2 monoclonal antibody. M2 of A/WSN/33 migrates more slowly under these conditions than the M2 of A/PR/8/34, and this difference is highlighted by analyz- ing M2 oligomers. The migrations of A/WSN/33 M2 dimers and tetramers are indicated by the lysate prepared from cells stably expressing M2 (MDCK-M2) (lane 6, a). The migrations of the A/PR/8/34 M2 dimers and tetramers are indicated by the A/PR/8/34 infected cell lysate (lane 7, b). No M2 species are detected in MDCK cells, which are neither transfected or infected (lane 5) or have been infected with influenza B/Lee/40 (lane 8). (b) Purified B/Lee/40 was analyzed by 20% SDS± PAGE under denaturing conditions followed by Western blotting to detect NB with polyclonal rabbit anti-NBHIS sera (lanes 1 and 2). The migration of NB under these conditions is indicated by the B/Lee/40 FIG. 3. Analysis of A/PR/8/34 to detect incorporation of exogenous infected cell lysate (lane 6). MDCK cells infected with B/Lee/40 were wild-type and mutant M2s after infection of MDCK and MDCK cells incubated for 12 h in serum-free media containing 2.5 ␮g/ml tunicamy- expressing wild-type M2 (MDCK-M2) or the mutant M2 proteins P-2 cin to prevent glycosylation of NB. (MDCK-P-2) and P-1-2 (MDCK-P-1±2). Purified A/PR/8/34 was subjected to 15% SDS±PAGE under nonreducing conditions and Western blotting using 14C2 to detect M2. The migrations of the wild-type A/WSN/33 and mutant M2 tetramers are indicated by the MDCK-M2 (a, we could clearly detect both a slow and a fast migrating lane 6), MDCK-P-2 (a, lane 7), and MDCK-P-1-2 (b, lane 8) cell lysates. M2 species, indicating that the exogenous A/WSN/33 M2 The M2 tetramers of A/PR/8/34 are marked c (lane 9). A fourth species protein had been incorporated (Fig. 2a, lane 2). When the of M2 (d), which runs with the expected mobility of M2 dimers, is detected in the M2-expressing cell lysates and in the A/PR/8/34- same cells were infected with B/Lee/40, no M2 was infected cell lysate (lanes 6±9). This species of M2 is absent from Cleaved species of both A/WSN/33 and ,ء .(detected in released virus (Fig. 2a, lane 4), although purified virus (lanes 1±4 incorporation of the functionally homologous type B pro- A/PR/8/34 M2 as described by Panayotov and Schlesinger (1992). INFLUENZA A VIRUS M2 PHOSPHORYLATION 57

FIG. 4. Cell surface localization of wild-type M2 and the phosphorylation mutants P-2 and P-1-2. Cells were grown to confluency on DATA filters. Surface distribution was determined by treating either surface of unfixed and nonpermeabilized cells with the 14C2 monoclonal antibody as a primary antibody. This was followed by a ␤-galactosidase conjugated anti-mouse secondary antibody and, finally, incubation at 37°C with X-Gal substrate until staining of the cell surfaces could be detected. forms of M2 are shown in Fig. 3 because the small primary antibody, indicating that for both wild-type and differences in migration between the M2 proteins are mutant M2 proteins, transport was exclusively directed more easily seen with this analysis. Both singly phos- to the apical domain (Fig. 4). Thus phosphorylation of M2 phorylated and unphosphorylated forms of M2 were does not influence directional transport and cannot ac- identified in released virions (Fig. 3, lanes 3 and 4). We count for the discrepancy in expression levels in the also analyzed whether the mutant M2s were incorpo- infected cell compared with the amount of M2 incorporated into B/Lee/40 particles, and confirmed that as for rated into budding particles. the wild-type protein, incorporation was type-specific (data not shown). Generation of an M2 phosphate-minus mutant by reverse genetics and analysis of phosphorylation Transport of M2 in polarized epithelial cells of its proteins The phosphorylation state of some proteins controls We next asked whether there may be a role for M2 directional transport in polarized epithelial cells phosphorylation that would be apparent only in the con- (Casanova et al., 1990; Jones et al., 1995). Wild-type M2 is text of the virus. We therefore attempted to rescue a directed to the apical surface, where influenza virus transfectant virus in which the serine residues at both budding occurs (Hughey et al., 1992). To determine position 64 and 71 of A/WSN/33 M2 were replaced by whether phosphorylation plays a role in M2 targeting, alanine. The A/WSN/33 M2 protein is naturally resistant MDCK cells expressing either the wild-type or mutant M2 to the ion channel-blocking agent amantadine, and we proteins were cultivated on DATA filters to allow selective took advantage of this observation in designing a rescue access to either the apical or basolateral surface. Sur- protocol. A synthetic RNA representing the mutated face expression of M2 was determined by staining either P-1±2 segment was transfected as RNP complexes into surface of the unfixed cells using 14C2. Staining was cells previously infected with an amantadine-sensitive detected only when the apical membranes had received virus, A/Eng/42/72. Progeny transfectant viruses were 58 THOMAS ET AL. selected in the presence of inhibitory concentrations of amantadine. A silent change that creates a unique SacI restriction enzyme site within codon 96 of the M2 message was introduced into the cDNA such that viruses derived from transfected RNAs could be identified by cleavage of their segment 7 RT-PCR products by SacI. In this way, a transfectant virus was identified in one of the four plaques picked after transfection of the phosphate- minus mutated RNA. Screening of the other three viruses showed that they did not contain the tagging mutation, and they are believed to be spontaneous escape mutants of the helper virus that have gained resistance to the antiviral agent (data not shown). The transfectant virus was plaque purified three times in the presence of amantadine and propagated in both MDCK cells and eggs. Viral RNA from purified virus grown in cells or eggs was used as template for RT-PCR of the entire segment 7 RNA. This product was cloned into pUC19 and se- quenced. No changes were present in the RNA other than those that had been engineered (data not shown). The virus can grow to high titres in tissue culture and in eggs and was stable over at least six passages in these systems. To confirm that the mutations introduced into the transfectant virus did abolish phosphorylation of M2, we con- ducted 32P-orthophosphate-labeling experiments of the phosphate-minus virus and labeled proteins from the helper A/Eng/42/72 and A/WSN/33 viruses as controls. FIG. 5. Immunoprecipitation of M2 and NP from labeled infected cell M2 and NP proteins were immunoprecipitated from ly- lysates. MDCK cells were infected with the phosphate-minus transfec- sates of metabolically labeled infected cells. Fig. 5a tant virus (P-), the helper virus A/Eng/42/72, and A/WSN/33. Infected shows that although M2 from both A/Eng/42/72 and cells were labeled using 32P-orthophosphate or 35S-methionine and A/WSN/33 viruses was labeled with 32P-orthophosphate -cysteine. Cell lysates were immunoprecipitated either with a monoclonal antibody to NP or with 14C2. (a) Immunoprecipitation of 32P- (lanes 2 and 4), M2 from the transfectant phosphate- orthophosphate-labeled infected cell lysates with 14C2 (lanes 1±4) or minus virus was not (lanes 1 and 3). A similar amount of antibody to NP (lanes 6±9). (b) Immunoprecipitation of 35S-methionine M2 was labeled with radioactive cysteine and methio- and -cysteine-labeled infected cell lysates with 14C2 (lanes 1±4) or nine for each virus (Fig. 5b, lanes 1±4), and orthophos- antibody to NP (lanes 6±9). As control, a B/Lee/40-infected cell lysate phate labeling of NP was observed in all infected lysates was incubated with 14C2 antibody (B, a and b, lane 5). (Fig. 5a, lanes 6±9). curve of the Ra virus was generated after infection at Isolation of a reassortant virus lacking 37°C of Madin±Darby bovine kidney (MDBK) cells at an phosphorylation sites in M2 and growth m.o.i. of 0.001 (Fig. 6). The virus showed no defect in in Madin±Darby bovine kidney cells replication in these permissive cells in comparison with The transfectant virus described above contained 7 the control virus A/WSN/33. segments derived from A/Eng/42/72 (H3N2) with seg- Growth of the Ra virus in vivo ment 7 derived from A/WSN/33 (H1N1). It has been previously observed that the M1 protein of H1 or H3 To determine whether removal of the sites for phos- subtypes can affect growth of virus in tissue culture phorylation of the M2 cytoplasmic tail affects the in vivo (Yasuda et al., 1994). Therefore, to assess whether there replication and virulence of influenza A virus, 6-week-old had been any subtle changes in phenotype as a result of Balb/c mice were inoculated with Ra or the control strain the phosphate-minus mutation in M2 and to distinguish A/WSN/33. The weight and disease status of individual these from growth differences related to M1, we gener- mice were followed over an 7-day period. Both groups of ated a reassortant virus Ra with the phosphate-minus infected mice lost weight compared with age-matched mutations in segment 7 in an A/WSN/33 background. control animals at a similar rate (data not shown). Death The plaques produced by the Ra virus at 37°C were occurred slightly earlier in the mice infected with Ra wild type in size and appearance. A multistep growth virus, and this difference was statistically significant by a INFLUENZA A VIRUS M2 PHOSPHORYLATION 59

the apical side (Hughey et al., 1992). In this study, we investigated the transport of M2 phosphorylation mutants in polarized epithelial cells. By preventing phosphorylation at serine 71 or at both serines 64 and 71, no differences in cell surface expression were seen (Fig. 4). Furthermore, both the wild-type and mutant proteins were transported to the cell surface at the same rate (data not shown). We conclude that the phosphorylation state of the cytoplasmic tail of M2 does not control its intracellular transport. Cytoplasmic tail phosphorylation on some proteins can control their interactions with cytosolic components. In the context of the influenza A virus M2 protein, such FIG. 6. Multistep growth analysis of the Ra reassortant virus com- interactions might be involved in viral assembly, possibly pared with wild-type A/WSN/33 virus in MDBK cells. MDBK cells were through binding to the matrix protein M1. Earlier genetic infected with reassortant (Œ) or wild-type virus (F) at an m.o.i. of 0.001. At various times after infection, cell supernatants were quantified by evidence had suggested a functional relationship be- end point titration in MDBK cells. tween M2 and M1. The anti-M2 monoclonal antibody 14C2 was shown to inhibit virus budding (Hughey et al., 1995). Furthermore, virus mutants that escape inhibition Student's unpaired t test to a level of P Ͻ 0.005 (Table 1). by this M2-specific antibody have sequence changes in All infected animals were dead by 7 days after inocula- either the M2 ectodomain (the antibody epitope), the M2 tion with either virus. cytoplasmic tail, or M1 (Zebedee and Lamb, 1989). Inter- On day 3 after virus administration, lungs were re- estingly, one of the changes seen in the M2 cytoplasmic moved from five mice infected with each virus, and the tail was a mutation of the serine at position 71, a site in amount of virus was quantified to assess the level of in the correct consensus for phosphorylation. It has also vivo replication of each virus (Table 1). The titres of virus been shown that the escape mutants with sequence in the lungs of mice infected with Ra virus were ϳ0.5 changes in M1 display a different morphology, suggesting that the M1/M2 relationship might control virion mor- log10-fold higher than in lungs of mice infected with A/WSN/33 virus; again, this difference was significant phology (Roberts et al., 1998). On the other hand, in two (P Ͻ 0.005). Three plaques of Ra virus isolated from the separate studies, coexpression of M2 (or HA or NA) did lung of an infected mouse were amplified on MDBK cells, not increase the proportion of M1 that associates with and the viral RNA was extracted. Sequencing of the M2 membranes (Kretzschmar et al., 1996; Zhang and Lamb, cytoplasmic tail region of segment 7 of these viruses 1996), whereas a third report showed that HA or NA revealed that there had been no reversion of the serine- could enhance M1 membrane association (Enami and to-alanine mutations, nor indeed were there any other Enami, 1996). The latter study did not assess the effect of changes of sequence in this region during in vivo repli- M2 coexpression. cation (data not shown). We hypothesized that phosphorylation might control Taken together, these data indicate that the loss of phosphorylation on the cytoplasmic tail of M2 has not TABLE 1 compromised the ability of the virus to replicate in the mouse lung. Replication and Pathogenicity of Wild-Type A/WSN/33 Influenza A Virus or Ra M2 Phosphorylation Mutant Virus in Mice

DISCUSSION Virus titre in the lung Time to death

as TCID50/lung as h p.i. Six of the influenza A virus proteins (NP, NS1, NS2, M1, Virus (number of animals) (number of animals) PA, and M2) are reported to be phosphoproteins. The phosphorylation state of NP and M1 is known to control A/WSN/33 5.30 Ϯ 0.22 142.3 Ϯ 28.1 their intracellular distribution (Bui et al., 1996; Neumann (n ϭ 5) (n ϭ 14) et al., 1997). Phosphorylation and dephosphorylation Ra 5.81 Ϯ 0.19 117.0 Ϯ 16.7 (n ϭ 5) (n ϭ 16) events also control the direction of transport of cellular proteins such as the polymeric immunoglobulin receptor Note. Six week-old male Balb/c mice were infected intranasally with (pIgR) and the protease furin in polarized epithelial cells 25 ␮l of the A/WSN/33 virus or Ra virus containing 7.5 ϫ 105 pfu. Virus (Casanova et al., 1990; Jones et al., 1995). Influenza titres in the lungs were determined 3 days after infection by assaying infectivity in MDBK cells. Values shown are mean Ϯ SD. Statistical viruses bud exclusively from the apical membrane of significance for the differences between A/WSN/33 and Ra effects was polarized cells, and it is known that M2, a structural calculated using a Student's unpaired t test. For lung titres, this value component of the virus, is transported predominately to was P Ͻ 0.005, and for time to death, the value also was P Ͻ 0.005. 60 THOMAS ET AL. incorporation of M2 into virus particles. However, we case, suggesting that it is not the phosphate moiety but show here that unphosphorylated M2 is efficiently incor- specific sequences in M2 that direct the type-specific porated into virus particles (Fig. 3, compare band a in incorporation. Indeed, a recent study by Park et al. (1998) lane 2 with band b in lane 4). Furthermore, it is unlikely demonstrated that the M2 ectodomain is required for that unphosphorylated M2 is incorporated by forming incorporation of a chimeric protein into influenza A virus hetero-oligomers with a phosphorylated species pro- particles. These authors hypothesized that this region of vided by the infecting A/PR/8/34 virus because we were M2 might interact with the HA ectodomain or transmem- able to recover a transfectant virus whose M2 cannot be brane domain. To be compatible with the present data, phosphorylated. The amount of M2 incorporated into the this model would require that M2 does not interact with envelope of this recombinant virus is not different from the equivalent sequences of influenza B virus HA. that for wild-type virus (data not shown). This result In addition, we used a reverse genetics procedure to confirms that phosphate is not required for M2 incorpo- generate a mutant virus that is unable to phosphorylate ration. It remains a possibility that phosphorylation actu- the M2 cytoplasmic tail. Neither the transfectant virus nor ally prevents M2 incorporation. Indeed, some other en- a reassortant virus (Ra) with the same mutated RNA veloped viruses use a dephosphorylation event at the segment, could phosphorylate M2. In addition, the phos- plasma membrane to trigger the interaction of core com- phate-minus viruses showed little phenotypic difference ponents with envelope proteins, enabling envelopment in MDCK cells, MDBK cells, or eggs compared with and budding to occur. The E2 protein of Sindbis virus control viruses. It is likely that the pressures exerted on requires phosphorylation to release its cytoplasmic tail viruses replicating in the whole host organism are differ- from the plasma membrane followed by a dephosphor- ent from those in the highly permissive in vitro systems. ylation event, which allows the cytoplasmic tail to inter- Indeed, the conservation of phosphorylation sites within act with the nucleocapsid and assembly to occur (Liu the M2 sequence over time suggests that there is an and Brown, 1993). In the case of duck hepatitis B virus, advantage conferred by possessing phosphorylated M2 assembly is believed to be a result of dephosphorylation that has not been detected here. Other negative-strand of the core protein because phosphorylated core protein RNA viruses encode viral proteins or possess protein could not be detected in purified virions (Pugh et al., modifications that are not essential for in vitro viability 1989). To our knowledge, it has not been previously (Bukreyev et al., 1997; Kato et al., 1997; Radecke and demonstrated that the phosphorylated species of M2 is Billeter, 1996; Sakaguchi et al., 1997). In some of these incorporated into particles. Our preliminary experiments cases, the mutation has subsequently been shown to demonstrated that 32P-orthophosphate-labeled M2 is as- attenuate virus pathogenesis in vivo (Bukreyev et al., sociated with purified virions (data not shown). The issue 1997; Kato et al., 1997). In other situations, there was an of how the levels of incorporation of M2 into the envelope enhancement of replication or pathogenicity in mice. For are controlled remains unresolved. Interestingly, it was example, an influenza A virus lacking cysteine residues recently demonstrated that the HA transmembrane do- in M2 replicated to higher titres in the mouse upper main sequence determines its transport to specific areas respiratory tract (Castrucci et al., 1997), and an engi- of the cell membrane termed sphingolipid rafts, which neered VSV in which the gene order was rearranged differ in lipid composition from other plasma membrane killed mice at a lower dose than the wild type (Wertz et regions (Scheiffele et al., 1997). Presumably, these are al., 1997). It is conceivable that viruses that kill more the sites of influenza virus assembly and budding. It may slowly have a subtle evolutionary advantage over more be that M2 is not delivered efficiently to these areas and pathogenic variants because the potential for transmis- thus not physically available for efficient incorporation sion might be increased. Our studies have shown that into particles along with HA and NA. This possibility is loss of phosphorylation on M2 has not compromised the currently under investigation. Regardless of the mecha- replication of influenza virus in vivo. Indeed, higher viral nism, the virus has evolved to limit the amount of M2 titres were recovered from lungs of mice infected with Ra allowed in the particle for a reason. It is tempting to than from those infected with the control virus A/WSN/33. speculate that too many ion channels might overacidify Furthermore, the mice infected with equivalent amounts the virion interior with deleterious effects on the internal of virus were killed more quickly by the virus in which the proteins and the uncoating mechanism. M2 protein was not phosphorylated. In future work, we We demonstrated in this study that unlike the situation intend to determine the basis for this difference. for the other influenza A virus envelope proteins, HA and NA, M2 incorporation into virions is type-specific. The NB METHODS AND MATERIALS protein of influenza B virus is thought to be the functional Viruses and cells homolog of M2, although it is not phosphorylated (Bras- sard and Lamb, 1996). Therefore, we tested whether an Influenza viruses A/WSN/33, A/PR/8/34, A/Eng/42/72, unphosphorylated M2 protein would be incorporated into and B/Lee/40 were cultivated in 10-day-old embryonated influenza B virus envelopes. However, this was not the chicken eggs at 37°C or 34°C for influenza type A or B INFLUENZA A VIRUS M2 PHOSPHORYLATION 61 viruses, respectively. Allantoic fluids were harvested 2 0.5% bovine serum albumin (BSA) and 0.02% sodium days after inoculation. Virus stocks were titrated on azide as a primary antibody and a ␤-galactosidase-con- MDCK cells and stored at Ϫ70°C. MDCK and MDBK jugated anti-mouse secondary antibody (Harlan Sera- cells were routinely passaged in Eagle's minimal essen- lab), followed by incubation with X-gal substrate. Colo- tial medium (EMEM) (GIBCO BRL) supplemented with nies expressing exogenous M2 at levels comparable to 10% heat-inactivated FCS (GIBCO BRL). those seen in infected cells were amplified and main- tained in selective media. DNA cloning Preparation of whole cell lysates and infected cell Segment 7 of A/WSN/33 was cloned as a cDNA be- lysates tween the EcoRI and XbaI restriction sites of the multiple cloning site of pUC19, after RT-PCR from vRNA using For whole cell lysates, MDCK and MDCK cells ex- primers EKFlu (5Ј-gcgcgaattcctcttcgAGCAAAAGCAG-3Ј) pressing the wild-type and mutant M2s were grown to and AllfluPCR (5Ј-aagcttctagaattaaccctcactaaaAGTAGA- confluency in 35-mm dishes. Cells were washed in ice- AACAAGGTAGTTTTTTACTCGAGCTCTATG-3Ј; lowercase cold PBS and incubated with lysis buffer (100 mM NaCl, letters denote noninfluenza residues included for cloning 50 mM iodoacetamide, 1% Nonidet-P40, 0.1% SDS, 0.5% purposes), giving the plasmid pT3WSNMMut1. In vitro sodium deoxycholate, 20 mM Tris±HCl, pH 7.5) on ice for transcription of Ksp632I linearized pT3WSNMMut1 by T3 10 min. polymerase produces an RNA with an authentic segment For infected cell lysates, MDCK cells were infected at 7 terminus and a silent mutation at nucleotide 96 (G3C), an m.o.i. of 3 with A/PR/8/34 or B/Lee/40 and incubated which creates an SacI restriction enzyme site as a tag. for 12 h at 37°C or 34°C, respectively. Lysates were To create cDNAs encoding M2 proteins with mutations of stored at Ϫ20°C. B/Lee/40 was amplified in the pres- serine to alanine at amino acids 64 and 71, or 64 or 71 ence of 2.5 ␮g/ml tunicamycin (Sigma). alone, PCR mutagenesis was performed on template pT3WSNMMut1 using primers M2P-(5Ј-TTCAAATCATTT- Generation and purification of virus incorporating ATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCTT/GCT- exogenous M2 proteins ACGGAAGGAGTGCCAGAGT/GCTATG-3Ј) and AllfluPCR. MDCK cells expressing wild type or the mutant M2s The products were digested with NsiI and SacI and were infected with A/PR/8/34 or B/Lee/40 at an m.o.i. of cloned into pT3WSNMMut1 digested with the same en- 3. Virus was allowed to adsorb for1hattheappropriate zymes. Mutations were confirmed by sequencing and temperature. Cells were washed twice in PBS and incu- plasmids containing one or both mutations were named bated in serum-free EMEM including 2 ␮g/ml trypsin pT3WSNMP-1, pT3WSNMP-2, and pT3WSNMP-1±2. (Worthington Biochemical). After incubation at the appro- priate temperature for 48 h, supernatants containing re- Cell lines for the expression of A/WSN/33 M2 and leased virus were harvested. Cell debris was removed the mutant proteins P-2 and P-1±2 by centrifugation at 10,500g in a benchtop microfuge for The plasmid pT3WSNMMut1 or plasmids containing 15 min. Virus was pelleted from the supernatants through the mutations encoding serine-to-alanine changes de- cushions of 30% sucrose in NTE (100 mM NaCl, 10 mM scribed above were used as template for PCR with prim- Tris±HCl, pH 7.4, 1 mM EDTA) by ultracentrifugation at ers M2START (5Ј-cccgggtctagatcATGAGTCTTTCTAACC- 45,000 rpm using an SW55 rotor (Beckman) at 4°C for 90 GAGGTCGAAACGCCTATCAGAAACGAATGGGGGTGC-3Ј) min. Virus was resuspended in TMK (10 mM KCl, 1.5 mM and M2STOP (5Ј-cccgggggatccgaattcTTACTCCAGCTCT- MgCl2, 10 mM Tris±HCl, pH 7.4) containing 1 mM phe- ATG-3Ј), generating cDNAs corresponding to the M2 nylmethylsulfonyl fluoride (Sigma) and 2 ␮g/ml aprotinin spliced mRNAs. These products were subcloned into the (Sigma) and stored at Ϫ20°C until analysis. mammalian expression vector pEE6.hcmv.Neo (Bebbing- Analysis of virus to detect the incorporation of ton, 1991) between the XbaI and EcoRI restriction en- exogenous M2 zyme sites downstream of the hCMV promoter. MDCK cells were transfected using Pfx-2 lipofection Purified virus and cell lysates were analyzed by reagent (InVitrogen) with 2 ␮g of pEE6.Neo.M2, SDS±PAGE using 15% or 20% acrylamide gels under pEE6.Neo.P-1M2, pEE6.Neo.P-2M2, or pEE6.Neo.P-1-2M2 nonreducing or reducing conditions for detection of encoding the wild-type M2 or the phosphorylation mu- M2 and NB, respectively. Proteins were transferred tants P-1, P-2, and P-1-2 (Fig. 1b). Stably expressing onto PVDF membranes (Immobilon P; Millipore) and colonies were selected in EMEM supplemented with probed either for M2, with 14C2 diluted in 2% Marvel 10% FCS and 500 ␮g/ml geneticin sulfate (GIBCO BRL). milk protein in PBS containing 0.1% Tween 20, or for Expressing colonies were screened by blue cell assay NB, using a rabbit polyclonal antiserum generated to a (Ward et al., 1994) using an anti-M2 monoclonal antibody, histidine-tagged cytoplasmic tail fragment of NB ex- 14C2 (kindly supplied by R. A. Lamb), diluted in PBS plus pressed in Escherichia coli. Primary antibodies bound 62 THOMAS ET AL. to M2 or NB were detected with anti-mouse or anti- At 8 h p.i., cells were washed with either phosphate- rabbit HRPO-conjugated secondary antibodies (Amer- free EMEM or PBS for orthophosphate or methionine± sham), respectively. Proteins were visualized using an cysteine labeling, respectively, and lysed in a total vol- ECL detection system (Amersham) and exposure to ume of 500 ␮l of lysis buffer. Cell lysates were passed photographic film. three times through a fine-gauge syringe, and nuclei and membranes were pelleted by centrifugation at 80,000 Cell surface expression of M2 and mutant M2 rpm in a Tw2 rotor of a Beckman benchtop ultracentri- proteins in polarized epithelial cells fuge for 30 min at 4°C. Next, 200 ␮l of clarified cytoplas- MDCK cells stably expressing the wild-type M2 and mic extracts were incubated at 4°C overnight with either the phosphorylation mutants were grown to confluency 2 ␮l of 14C2 or 5 ␮l of anti-NP monoclonal antibody on DATA filters (0.4-␮m pore size; Costar). Blue cell (Harlan Sera-lab). Protein G±agarose (30 ␮l) previously assay was performed on unfixed, nonpermeabilized washed in lysis buffer was added, and tubes were ro- cells. The cells were probed on either the apical or tated for 30 min at room temperature. Agarose beads, to basolateral surface for expression of the M2 proteins which antibodies and antigens were bound, were using 14C2 as a primary antibody, followed by a second- washed five times with lysis buffer and resuspended in ary anti-mouse antibody conjugated to ␤-galactosidase 30 ␮l of Laemmli's buffer containing the reducing agent (Harlan Sera-lab). Finally, cells were incubated in X-Gal ␤-mercaptoethanol. Immune precipitates were analyzed substrate at 37°C (Ward et al., 1994). by 15% SDS±PAGE. Gels were treated with Amplify (Am- ersham) before drying and exposure to ␤-max hyperfilm Generation and identification of transfectant viruses (Amersham). RNP transfections were performed in MDBK cells es- Generation of the reassortant virus Ra lacking sentially as described previously (Enami et al., 1990; phosphorylation sites in M2 Enami and Palese, 1991). A/Eng/42/72 was selected from a panel of potential H3N2 helper viruses because it A virus with seven RNA segments from A/WSN/33 and showed clear inhibition of plaque formation in the pres- segment 7 containing the engineered mutation was gen- ence of 100 mM amantadine HCl (Sigma). The trans- erated by reassorting the transfectant virus with ts51 fected segment 7 is derived from the A/WSN/33 strain, (obtained from Dr. Gary Whittaker, Cornell University). which encodes an M2 ion channel that is naturally aman- Ts51 is a derivative of A/WSN/33 that contains a point tadine resistant. After three rounds of plaque purification mutation in the M1 gene, rendering the virus temperature of potential transfectant viruses in the presence of aman- sensitive (Whittaker et al., 1995). The transfectant virus tadine, individual plaques were amplified in MDCK cells was exposed to UV irradiation (wavelength 220 nm) for to produce virus stocks. Viral RNA was extracted from 3 20 min at a distance of 10 cm to destroy infectivity and, ml of tissue culture supernatant as described previously in particular, target the large RNA segments. This prep- (Stevens and Barclay, 1998). Viral RNA was subjected to aration was used to infect MDCK cells that had previ- RT-PCR using primer M2RT (5Ј-GGCTATGGAGCAAATG- ously been infected with a high m.o.i. of ts 51 virus. After GCTGG-3Ј) complementary to nucleotides 587±607 of overnight incubation at 39°C, the supernatants were segment 7 for RT and primers M2seq (5Ј-CCTATCA- plaqued in MDBK cells. Plaques were picked and ampli- GAAACGAATGGGGG-3Ј) complementary to nucleotides fied and then screened by RT-PCR for the presence of the 742±772 with Allflupcr for PCR. The product of 315 bp was SacI tag and by analysis of protein migration by SDS± digested with SacI, and cleavage into two fragments of PAGE to confirm that only segment 7 had been trans- 58 and 257 bp confirmed the presence of the restriction ferred (data not shown). site tag and that the vRNA was derived from a transfec- Growth of the Ra virus in MDBK cells tant virus. MDBK cells were infected with the Ra virus and 32 35 P-Orthophosphate and S-methionine and -cysteine A/WSN/33 control virus at an m.o.i. of 0.001 and incu- labeling and immunoprecipitation of virus bated at 37°C. Culture supernatants were harvested at MDCK cells were incubated overnight in phosphate- various times after infection, and the titer of released free EMEM and then infected with virus at an m.o.i. of virus was established by plaque assay in MDBK cells. Ͼ3. At 5 h p.i., 5 mCi of 32P-orthophosphate was added Growth of the Ra virus in vivo to the medium, and incubation continued for an additional 3 h. For methionine and cysteine labeling, at 4 h Six-week-old Balb/c mice were inoculated intranasally p.i., duplicate dishes were incubated in methionine- and under halothane anaesthesia with 7.5 ϫ 105 pfu of the Ra cysteine-free media (Sigma) for 1 h. Then, 10 ␮Ci of virus or A/WSN/33 in a volume of 25 ␮l. The weight and 35S-methionine and -cysteine was added, and incubation disease status of individual mice were monitored over an was continued for an additional 3 h. 7-day period. On day 3 after virus administration, five INFLUENZA A VIRUS M2 PHOSPHORYLATION 63 mice infected with each virus were killed by exposure to neuraminidase protein of influenza A virus does not play an impor- carbon dioxide, and the lungs were removed for virus tant role in the packaging of this protein into viral envelopes. Virus quantification. Lung homogenates were prepared by Res. 37, 37±47. Hay, A. J. (1992). The action of adamantamines against influenza A grinding in the presence of Ͻ100 ␮m sterile glass beads viruses: inhibition of the M2 ion channel protein. Semin. Virol. 3, (Sigma) and 250 ␮l of PBS containing 0.5% BSA. Homog- 21±30. enates of each lung were clarified by centrifugation at Holsinger, L. J., Shaughnessy, M. A., Micko, A., Pinto, L. H., and Lamb, 10,500g in a microfuge for 5 min, and the amount of virus R. A. (1995). Analysis of the posttranslational modifications of the was titrated by infectivity assay on MDBK cells. TCID influenza virus M2 protein. J. Virol. 69, 1219±1225. 50 Hongo, S., Sugawara, K., Murai, Y., Kitame, F., and Nakamura, K. (1997). values were calculated using the Spearman±Karber for- Characterization of a second protein (CM2) encoded by RNA seg- mula. Statistical significance was calculated using Stu- ment 6 of influenza C virus. J. Virol. 71, 2786±2792. dent's unpaired t test. Hughey, P. G., Compans, R. W., Zebedee, S. L., and Lamb, R. A. (1992). Expression of the influenza A virus M2 protein is restricted to apical surfaces of polarized epithelial-cells. J. Virol. 66, 5542±5552. ACKNOWLEDGMENTS Hughey, P. G., Roberts, P. C., Holsinger, L. J., Zebedee, S. L., Lamb, R. A., and Compans, R. W. (1995). Effects of antibody to the influenza A We thank Professor Nigel Dimmock for advice concerning mouse virus M2 protein on M2 surface expression and virus assembly. experiments. This work has been funded by a Leverhulme project grant Virology 212, 411±421. to W.S.B. No. F239/Z. J.T. is a recipient of a BBSRC special studentship. Jin, H., Leser, G. P., Zhang, J., and Lamb, R. A. (1997). Influenza virus We are very grateful to Mr. Trevor Jenkinson at the University of Reading hemagglutinin and neuraminidase cytoplasmic tails control particle Bioresource Unit for his assistance and advice and to Professor Jeff shape. EMBO J. 16, 1236±1247. Almond for many fruitful discussions. Jones, B. G., Thomas, L., Molloy, S. S., Thulin, C. D., Fry, M. D., Walsh, K. A., and Thomas, G. (1995). Intracellular trafficking of furin is REFERENCES modulated by the phosphorylation state of a casein kinase-II site in its cytoplasmic tail. EMBO J. 14, 5869±5883. Bebbington, C. R. (1991). Expression of antibody genes in nonlymphoid Kato, A., Kiyotani, K., Sakai, Y., Yoshida, T., and Nagai, Y. (1997). The mammalian cells. Methods Enzymol. 2, 136±145. paramyxovirus, Sendai virus, V protein encodes a luxury function Betakova, T., Nermut, M. V., and Hay, A. J. (1996). The NB protein is an required for viral pathogenesis. EMBO J. 16, 578±587. integral component of the membrane of influenza B virus. J. Gen. Kretzschmar, E., Bui, M., and Rose, J. K. (1996). Membrane association Virol. 77, 2689±2694. of influenza virus matrix protein does not require specific hydropho- Bilsel, P., Castrucci, M. R., and Kawaoka, Y. (1993). Mutations in the bic domains or the viral glycoproteins. Virology 220, 37±45. cytoplasmic tail of influenza A virus neuraminidase affect incorpora- Lamb, R. A., Lai, C.-J., and Choppin, P. W. (1981). Sequences of mRNAs tion into virions. J. Virol. 67, 6762±6767. derived from genome RNA segment & of influenza A virus: colinear Brassard, D. L., Leser, G. P., and Lamb, R. A. (1996). Influenza B virus and interrupted mRNAs code for overlapping proteins. Proc. Natl. NB glycoprotein is a component of the virion. Virology 220, 350± Acad. Sci. USA 78, 4170±4174. 360. Lamb, R. A., Zebedee, S. L., and Richardson, C. D. (1985). Influenza virus Bui, M., Whittaker, G., and Helenius, A. (1996). Effect of M1 protein and M2 protein is an integral membrane protein expressed on the infect- low pH on nuclear transport of influenza virus ribonucleoproteins. ed-cell surface. Cell 40, 627±633. J. Virol. 70, 8391±8401. Liu, N., and Brown, D. T. (1993). Phosphorylation and dephosphorylation Bukreyev, A., Whitehead, S. S., Murphy, B. R., and Collins, P. L. (1997). events play critical roles in Sindbis virus maturation. Virology 196, Recombinant respiratory syncytial virus from which the entire SH 703±711. gene has been deleted grows efficiently in cell culture and exhibits Martin, K., and Helenius, A. (1991). Nuclear transport of influenza virus site-specific attenuation in the respiratory tract of the mouse. J. Virol. ribonucleoproteins: the viral matrix protein (M1) promotes export and 71, 8973±8982. inhibits import. Cell 67, 117±130. Casanova, J. E., Breitfeld, P. P., Ross, S. A., and Mostov, K. E. (1990). Naim, H. Y., and Roth, M. G. (1994). Characteristics of the internalization Phosphorylation of the polymeric immunoglobulin receptor is re- signal in the Y543 influenza virus hemagglutinin suggest a model for quired for its efficient transcytosis. Science 248, 742±745. recognition of internalization signals containing tyrosine. J. Biol. Castrucci, M. R., Hughes, M., Calzoletti, L., Donatelli, I., Wells, K., Chem. 269, 3928±3933. Takada, A., and Kawaoka, Y. (1997). The cysteine residues of the M2 Neumann, G., Castrucci, M. R., and Kawaoka, Y. (1997). Nuclear protein are not required for influenza A virus replication. Virology import and export of influenza virus nucleoprotein. J. Virol. 71, 238, 128±134. 9690±9700. Castrucci, M. R., and Kawaoka, Y. (1995). Reverse genetics system for Panayotov, P. P., and Schlesinger, R. W. (1992). Oligomeric organization generation of an influenza A virus mutant containing a deletion of the and strain-specific proteolytic modification of the virion M2 protein of carboxyl-terminal residue of M2 protein. J. Virol. 69, 2725±2728. influenza A H1N1 viruses. Virology 186, 352±355. Duff, K. C., Gilchrist, P. J., Saxena, A. M., and Bradshaw, J. P. (1994). Park, E. K., Castrucci, M. R., Portner, A., and Kawaoka, Y. (1998). The M2 Neutron-diffraction reveals the site of amantadine blockade in the ectodomain is important for its incorporation into influenza A virions. influenza A M2 ion-channel. Virology 202, 287±293. J. Virol. 72, 2449±2455. Enami, M., and Enami, K. (1996). Influenza virus hemagglutinin and Pekosz, A., and Lamb, R. A. (1997). The CM2 protein of influenza C virus neuraminidase glycoproteins stimulate the membrane association of is an oligomeric integral membrane glycoprotein structurally analo- the matrix protein. J. Virol. 70, 6653±6657. gous to influenza A virus M2 and influenza B virus NB proteins. Enami, M., Luytjes, W., Krystal, M., and Palese, P. (1990). Introduction of Virology 237, 439±451. site-specific mutations into the genome of influenza virus. Proc. Natl. Pinto, L. H., Holsinger, L. J., and Lamb, R. A. (1992). Influenza virus M2 Acad. Sci. USA 87, 3802±3805. protein has ion channel activity. Cell 69, 517±528. Enami, M., and Palese, P. (1991). High-efficiency formation of influenza Pugh, J., Zweidler, A., and Summers, J. (1989). Characterization of the virus transfectants. J. Virol. 65, 2711±2713. major duck hepatitis B virus core particle protein. J. Virol. 63, 1371± Garcia-Sastre, A., and Palese, P. (1995). The cytoplasmic tail of the 1376. 64 THOMAS ET AL.

Radecke, F., and Billeter, M. A. (1996). The nonstructural C protein is not Almond, J. W. (1994). Decay-accelerating factor CD55 is identified as essential for multiplication of Edmonston B strain measles virus in the receptor for echovirus-7 using CELICS, a rapid immune-focal cultured cells. Virology 217, 418±421. cloning method. EMBO J. 13, 5070±5074. Roberts, P. C., Lamb, R. A., and Compans, R. W. (1998). The M1 and M2 Wertz, G. W., Perepelitsa, V. P., and Ball, L. A. (1997). Attenuation of proteins of influenza A virus are important determinants in filamen- replication and virulence of a non-segmented negative strand RNA tous particle formation. Virology 240, 127±137. virus by rearrangement of the gene order. 10th International Confer- Sakaguchi, T., Kiyotani, K., Kato, A., Asakawa, M., Fujii, Y., Nagai, Y., and ence on Negative Strand Viruses, Dublin, Ireland, abstract 110. Yoshida, T. (1997). Phosphorylation of the Sendai virus M protein is Whittaker, G., Kemler, I., and Helenius, A. (1995). Hyperphosphorylation not essential for virus replication either in vitro or in vivo. Virology of mutant influenza matrix protein, M1, causes its retention in the 235, 360±366. nucleus. J. Virol. 69, 439±445. Scheiffele, P., Roth, M. G., and Simons, K. (1997). Interaction of Yamashita, M., Krystal, M., and Palese, P. (1988). Evidence that the influenza virus haemagglutinin with sphingolipid-cholesterol matrix protein of influenza C virus is coded for by a spliced mRNA. membrane domains via its transmembrane domain. EMBO J. 16, J. Virol. 62, 3348±3355. 5501±5508. Yasuda, J., Bucher, D. J., and Ishihama, A. (1994). Growth-control of Shaw, M. W., and Choppin, P. W. (1984). Studies on the synthesis of the influenza A virus by M1 protein: analysis of transfectant viruses influenza B virus NB glycoprotein. Virology 139, 178±184. carrying the chimeric M gene. J. Virol. 68, 8141±8146. Shih, S. R., and Krug, R. M. (1996). Novel exploitation of a nuclear function by influenza virus: the cellular Sf2/Asf splicing factor con- Zebedee, S. L., and Lamb, R. A. (1988). Influenza A virus M2 protein: trols the amount of the essential viral M2 ion-channel protein in monoclonal antibody restriction of virus growth and detection of M2 infected cells. EMBO J. 15, 5415±5427. in virions. J. Virol. 62, 2762±2772. Sklyanskaya, E. I., Varich, N. L., Amvrosieva, T. V., and Kaverin, N. V. Zebedee, S. L., and Lamb, R. A. (1989). Growth restriction of influenza A (1985). Virions and intracellular nucleocapsids produced during virus by M2 protein antibody is genetically linked to the M1 protein. mixed heterotypic influenza infection of MDCK cells. J. Virol. 53, Proc. Natl. Acad. Sci. USA 86, 1061±1065. 679±683. Zebedee, S. L., Richardson, C. D., and Lamb, R. A. (1985). Characterization Stevens, M. P., and Barclay, W. S. (1998). The N-terminal extension of of the influenza virus M2 integral membrane protein and expression at the influenza B virus nucleoprotein is not required for nuclear accu- the infected cell surface from cloned cDNA. J. Virol. 56, 502±511. mulation or the expression and replication of a model RNA. J. Virol. Zhang, J., and Lamb, R. A. (1996). Characterization of the membrane 72, 5307±5312. association of the influenza virus matrix protein in living cells. Virol- Ward, T., Pipkin, P. A., Clarkson, N. A., Stone, D. M., Minor, P. D., and ogy 225, 255±266.