Detection and Quantification of Phytophthora Species Which Are

Detection and quantiﬁcation of Phytophthora species which are associated with root-rot diseases in European deciduous forests by species-speciﬁc polymerase chain reaction

1 2 3 3 4 By R. SCHUBERT *, G. BAHNWEG *, J. NECHWATAL ,T.JUNG ,D.E.L.COOKE , 4 1 2 2 J. M. DUNCAN ,G.MU¨LLER-STARCK ,C.LANGEBARTELS ,H.SANDERMANN JR and 3 W. OßWALD

1Faculty of Forest Sciences, Section of Forest Genetics, Ludwig-Maximilians-University Munich, Am Hochanger 13, D-85354 Freising, Germany (R. Schubert for correspondence); 2GSF-National Research Center for Environment and Health, Institute of Biochemical Plant Pathology, Ingoldsta¨dter Landstr. 1, D-85764 Neuherberg, Germany; 3Faculty of Forest Sciences, Institute of Forest Botany, Phytopathology, Ludwig-Maximilians- University Munich, Am Hochanger 13, D-85354 Freising, Germany; 4Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK

Summary Oligonucleotide primers were developed for the polymerase chain reaction (PCR)-based detection of selected Phytophthora species which are known to cause root-rot diseases in European forest trees. The primer pair CITR1/CITR2, complementing both internal transcribed spacer regions of the ribosomal RNA genes, gave a 711 bp amplicon with Phytophthora citricola. The Phytophthora cambivora specific primer pair CAMB3/CAMB4, producing a 1105 bp amplicon, as well as the Phytophthora quercina specific primer pair QUERC1/QUERC2, producing a 842 bp amplicon, were derived from randomly amplified polymorphic DNA (RAPD)-fragments presented in this paper. All three primer pairs revealed no undesirable cross-reaction with a diverse test collection of isolates including other Phytophthora species, Pythium, Xerocomus, Hebeloma, Russula, and Armillaria. Under the PCR conditions described the detection of a well discernable amplicon was possible down to 100 pg (P. cambivora), 4 pg (P. quercina), and 2 pg (P. citricola) target DNA. This diagnostic PCR system was able to detect P. citricola, P. quercina, and P. cambivora in seedlings of pendunculate oak (Quercus robur) and European beech (Fagus sylvatica) which were artificially infected under controlled conditions.

1 Introduction Several episodes of oak decline have been observed in different European regions, starting from 1878 (reviewed by DELATOUR 1983; SIWECKI and LIESE 1991; LUISI et al. 1993). Dis- tinctly visible above and below-ground symptoms, including yellowing, dieback of branches and parts of the crown, the formation of leaf clusters, necrotic rootlets, and a signiﬁcantly reduced number of living ﬁne root tips are well documented. The phenomenon of oak decline has been recognized for a long time as a multifactorial disease (MANION 1981) with predisposing factors (e.g. inappropriate site, climatic conditions, industrial pollution), inciting factors (e.g. drought, frost, snow, defoliation by insects), and contributing factors (e.g. secondary pathogens). The isolation of single Phytophthora species from Quercus ilex

Received: 17.4.1998; accepted: 29.7.1998; editor: C. Delatour * These authors have contributed equally to this work.

U. S. Copyright Clearance Center Code Statement: 0300–1237/99/2903–0169 $14.00/0 170 R. Schubert et al.

L., Quercus suber L., Quercus cerris L., Quercus rubra L., Quercus pubescens Willd., Quercus petraea (Matt.) Liebl., and Quercus robur L. confirmed the assumption that in some cases Phytophthora spp. are involved in oak decline (BRASIER 1993; BLASCHKE 1994; JUNG 1996; JUNG and BLASCHKE 1996; JUNG et al. 1996). There are more than 60 species in the genus Phytophthora and most of them are wide- spread destructive soil-borne root pathogens infecting crop plants, shrubs, and trees (reviewed by ERWIN and RIBEIRO 1996). The classical taxonomy of Phytophthora is based on sporangial and sexual structures (NEWHOOK et al. 1978; STAMPS et al. 1990). Isozymes, as well as various kinds of nucleic acid analyses have recently been used in order to elucidate the phylogenetic relationships among different Phytophthora species (MILLS et al. 1991; OUDEMANS et al. 1994; CRAWFORD et al. 1996; COOKE and DUNCAN 1997). Detection and quantification of Phytophthora species in soil samples and diseased plant materials is traditionally performed by baiting techniques with selective hosts (for example apple or lemon fruit) or by direct plating onto selective agar media. Species identification is based on morphological and physiological characters. These approaches are time-consuming and require considerable knowledge of the genus (TSAO 1983). The success of such an approach may depend on several factors, including interference from fast-growing secondary microflora (TSAO 1990) and seasonal changes in pathogenic activity (HORNER and WILCOX 1996). Serological methods using enzyme-linked antibodies have been established for the detection of selected Phytophthora species (e.g. MILLER et al. 1997), but cross- reactions with other species and reduced sensitivity, especially in dark-rooted woody plants, still prevent an extensive application (for detailed information see MILLER 1996). Alter- natively, species-specific oligonucleotide hybridization probes were developed in order to differentiate Phytophthora parasitica Dastur, Phytophthora capsici Leonian, Phytophthora cinnamomi Rands, Phytophthora megakarya Brasier and Griffin, and Phytophthora palmivora var. heterocystica Babacauh (GOODWIN et al. 1989; LEE et al. 1993; JUDELSON and MESSENGER-ROUTH 1996). Hybridization, however, is a time-consuming and expensive procedure even though radioactively labelled DNA markers can be replaced by non- radioactive probes. Rapid, simple and reliable identification of Phytophthora species has successfully been achieved using the polymerase chain reaction (PCR), i.e. the in vitro synthesis of a diagnostic DNA marker fragment by a bacterial polymerase after the annealing of sequence specific oligonucleotide primers with the fungal target. For this purpose PCR primer pairs complementing the internal transcribed spacer (ITS) regions of ribosomal RNA genes were constructed in an attempt to detect Phytophthora infestans (Mont.) de Bary, Phytophthora erythroseptica Pethybridge, and Phytophthora nicotianae Breda de Haan in infected potatoes (TOOLEY et al. 1997). The internal transcribed spacer (ITS) regions ITS1 and ITS2 of the ribosomal RNA genes were routinely used for the detection and/or identification of plant pathogenic fungi (NAZAR et al. 1991; XUE et al. 1992; JOHANSON and JEGER 1993; TISSERAT et al. 1994). The evolutionary conservation of the 18S RNA, the 5.8S RNA, and the 28S RNA genes supported the cloning of both ITS sequences, which lie between the coding ribosomal RNA genes, over a broad range of organisms using universal PCR primers (WHITE et al. 1990). On the other hand, sequence variation among the untranslated ITS sequences is often high enough in order to distinguish between different species. Further- more, the ribosomal RNA genes are organized in highly repetitive chromosomal units (for review see APPELS and HONEYCUTT 1986). This feature yields increased PCR sensitivity in comparison with target sequences representing single-copy genes. Alternatively, P. nicotianae was discovered in inoculated tobacco and tomato plants using PCR on the basis of elicitin gene primers (LACOURT and DUNCAN 1997). Phytophthora citricola Sawada, originally isolated from rotting orange fruits in Taiwan (Sawada 1927), is now known to produce root-rot and trunk canker on many economically important shrubs, e.g. Rhododendron catawbiense Michx. (HOITING and SCHMITTHENNER 1969), Humulus lupulus L. (PICHLMAIER and ZINKERNAGEL 1992), and trees, e.g. Persea Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 171 americana Miller (EL-HAMALAWI and MENGE 1994) and Aesculus hippocastanum L. (WERRES et al. 1995). Phytophthora cambivora (Petri) Buisman was first isolated by PETRI (1917) and has been recognized as the causal agent of ink disease and root-rot of Castanea sativa Mill. and Fagus sylvatica L. in Great Britain (DAY 1938). It was further isolated from Aesculus hippocastanum L. (BRASIER and STROUTS 1976) and Malus pumila Miller (JEFFERS and ALD- WINCKLE 1988). Phytophthora quercina Jung was recently discovered in rotting roots of Q. petraea (Matt.) Liebl. and Q. robur L. (JUNG 1996; JUNG et al. 1999). Moreover, the mentioned Phytophthora spp. have been frequently isolated from both, natural infected oak and beech stands at different sites in Germany, Switzerland, Hungary, Italy, France, and Slovenia (JUNG 1996; JUNG and BLASCHKE 1996; JUNG et al. 1996). In view of the importance of these Phytophthora spp. as the primary cause of root-rot diseases, an extensive screening of European forest stands and nursery material would be an indispensable element in disease control. The new DNA markers for the PCR-based detection and quantification of P. citricola, P. cambivora, and P. quercina, presented in this paper, are a first milestone in the establishment of a diagnostic tool which aims at the verification of contamination in situ by Phytophthora species in complex forest ecosystems.

2 Materials and methods 2.1 Fungal isolates and cultural conditions The isolates of Phytophthora, Pythium, Xerocomus, Hebeloma, Russula, Armillaria, and Heterobasidion used in primer speciﬁcity testing, their culture numbers, sources, hosts, and origins are listed in Table 1. A few additional isolates were used in inoculation experiments and are described there. Phytophthora isolates and other fungi were maintained at 15°C in 1 ml sterile distilled water on 2% w/v malt extract agar (Merck, Darmstadt, Germany) plugs punched out of an overgrown Petri dish with a reversed sterile pasteur pipette. Mycelia for DNA extraction were grown in 15 ml liquid 2% w/v malt extract broth at 20°C. Cultures for the production of infectious zoospores were grown on V8-juice agar at 20°C.

2.2 Artificial seedling inoculation under controlled conditions Seeds of pedunculate oak (Q. robur) and European beech (F. sylvatica) were placed in plastic containers (room temperature) on moistened sterile vermiculite or on wet filter paper for 2 weeks. After washing (demineralized water), the germinating seeds with 1–3 cm long radicles were transferred to Parafilm-sealed glass test tubes completely filled with autoclaved tap- water (20 ml). The seedling roots were inserted through a hole in the Parafilm. After 2 weeks of incubation in the dark (room temperature) the primary roots had reached a length of 15– 20 cm (oak) and 10–15 cm (beech), respectively. The seedlings were then ready for infection. Infection studies were performed with isolates of P. citricola (CIT 23, Table 1, and CIT 55, from Fagus sylvatica, Bavaria), P. quercina (QUE 3 and QUE 4, both from Quercus robur, Bavaria) and P. cambivora (CAM 5, Table 1) employing two different methods. A: The seedlings were placed upright in 100 ml glass test tubes (oak) or 50 ml glass flasks (beech) containing autoclaved demineralized water and five agar plugs which had been obtained from the growing edges of 1-week-old V-8 agar Phytophthora cultures. The glass vessels were sealed previously with Parafilm and the roots of the seedlings were inserted through a hole in the Parafilm. The root tips never directly contacted the agar plugs. B: Seedlings were placed in 1 litre plastic boxes (10 cm × 20 cm × 8 cm), containing 250 ml of autoclaved, demineralized water and five agar plugs derived from the above-mentioned 172 R. Schubert et al. beck, Germany ¨ Germany Indonesia ? Germany Germany USA Hungary Bavaria, Germany Italy Bavaria, Germany Bavaria, Germany Lu Bavaria, Germany Germany Iran Hungary Italy Switzerland Germany Bavaria, Germany Bavaria, Germany Bavaria, Germany Bavaria, Germany Iran Trinidad Germany Bavaria, Germany Spessart, Germany Germany Spessart, Germany Slovenia Quercus robur Quercus robur Quercus robur Beta vulgaris Solanum tuberosum Gypsophila paniculata ?? Gerbera jamesonii Quercus petraea Quercus petraea Fagus sylvatica Capsicum annuum Erica gracilis Citrus sinensis Nicotiana tabacum Quercus robur Quercus robur Quercus robur Quercus robur Quercus petraea Quercus robur Quercus robur Quercus robur Quercus robur Quercus robur Quercus petraea Quercus robur Theobroma cacao Rhododendron Chamaecyparis lawsoniana Malus sylvestris Fragaria 1 3 6 2 and other fungi used to verify specificity of primers Pythium, , Phytophthora 62637 DSMZ Pgm 1 IBP 62679 DSMZ 62682 DSMZ CAM 5CAM 2 IFB IFB 62643CAM 3 DSMZ IFB 62673 DSMZ 62674GON 8 DSMZ IFB GON 2 IFB GON 3 IFB 62669 DSMZ 330262654 DSMZ DSMZ 3123 DSMZ 304.29 CBS CIT 11CIT 33CIT 23CIT 24CIT 3562662 IFB CIT IFB 7 IFB IFB IFB DSMZ IFB CIT 29CIT IFB 26 IFB CIT 28CIT 27CIT 40 IFB IFB IFB CIT 30 IFB 62687 DSMZ Isolates of Table 1. Phytophthora cactorum Phytophthora drechsleri Phytophthora gonapodyides Phytophthora cryptogea Phytophthora erythroseptica Phytophthora gonapodyides Phytophthora gonapodyides Phytophthora lateralis Phytophthora megasperma Phytophthora palmivora Phytophthora nicotianae Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citrophthora Phytophthora cryptogea Phytophthora citricola Phytophthora citricola Phytophthora cambivora Phytophthora cambivora Phytophthora capsici Phytophthora cinnamomi Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora citricola Phytophthora cactorum Phytophthora cambivora 1 4 5 6 7 8 9 2 3 No.Phytophthora Organism Culture No. Source Host Origin 24 26 23 25 27 28 29 30 32 31 13 14 15 16 17 19 20 21 22 12 18 10 11 Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 173 ttingen, Germany ¨ Bavaria, Germany Germany Germany Germany Tharandt, Germany Netherlands Italy Go Germany Germany Bavaria, Germany Bavaria, Germany Bavaria, Germany Hungary Germany Germany Tharandt, Germany Pyrus communis Begonia Quercus robur Picea abies Euphorbia pulcherrima Quercus petraea Quercus ilex Quercus robur Picea abies Picea abies Zea mays Euphorbia pulcherrima Cyclamen persicum Picea abies Picea abies Picea abies Abies alba ? Finland 5 4 Table 1.—continued 62968 DSMZ 6271462956 DSMZ DSMZ 62987 DSMZ 1829 DSMZ ? ? QUE 5 IFB (seedlings) GSF 2728 DSMZ 62946 DSMZ QUE 7QUE 9 IFB IFB FS5 GSF ANA 3 IFB (cell culture) GSF 62950 DSMZ A1/5/19 TUD A1/4/2 TUD GSF2 GSF A1/5/41 TUD HA(FS)1 GSF A1/4/6 TUD Pythium debaryanum Pythium anandrum Phytophthora syringae Pythium intermedium Pythium irregulare Pythium paroecandrum Phytophthora quercina Xerocomus badius Pythium ultimum Armillaria mellea Picea abies Heterobasidion annosum Phytophthora parasitica Phytophthora quercina Phytophthora quercina Fagus sylvatica Armillaria ostoyae Russula ochroleuca Hebeloma mesophaeum Armillaria mellea Armillaria ostoyae DSMZ: German Collection ofIFB: Microorganisms Ludwig-Maximilians-University and of Cell Munich, Cultures,CBS: Institute Braunschweig, Centraalbureau of Germany. voor Forest Schimmelcultures, BotanyGSF: Baarn, and GSF-Research The Forest Center Netherlands. Pathology, for Freising,TUD: Environment Germany. Technical and University Health, Dresden, InstituteIBP: Institute of University of Biochemical of Forest Plant Freiburg, Botany, Pathology, Institute Tharandt, Neuherberg, of Germany. Germany. Plant Biochemistry, Freiburg, Germany. 39 Pythium 38 37 40 41 42 36 Mycorrhizal fungi 44 43 Root and butt rot49 fungi 48 Isolate numbers are identical to lane numbers of Fig. 2. 53 No.33 Organism Culture No. Source Host1 2 3 4 5 6 Origin 34 35 Trees 47 52 46 45 50 51 174 R. Schubert et al.

Phytophthora cultures. Seeds, young shoots and cotyledons were arranged on the top of a Petri-dish-cover inside the box in such a way that only their roots were submerged in water. Care was taken to avoid direct contact between the roots and the agar plugs. Containers were closed loosely with their lids to prevent excessive evaporation. Controls were set up with autoclaved demineralized water only. All test vessels were kept in daylight at 18°C. After 3 days, visible disease symptoms began to develop. Re-isolation of Phytophthora spp. used for inoculation was carried out to conﬁrm the infection. For this purpose small pieces of symptomatic tissues (oak: roots and root tips; beech: roots, hypocotyls and cotyledons) were washed with demineralized water, dried on ﬁlter paper and plated onto a selective agar medium containing hymexazol (JUNG et al. 1996). Agar plates were incubated at 20°C in the dark and examined microscopically every subsequent day. The developing Phytophthora colonies were transferred to and maintained on V-8 agar.

2.3 DNA extraction of plant material and of fungal mycelia The DNA extraction of artiﬁcially infected seedling materials was done from 3 to 25 days after inoculation using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Roots and root tips of oak as well as different test tissues of beech (roots, hypocotyls, and cotyledons) were extracted separately. Samples (15–100 mg wet weight) were ground in liquid nitrogen employing a mortar and pestle, and were transferred immediately to 2.0 ml Eppendorf tubes containing 400 ml of lysis buffer and 2.5 mg of polyvinylpolypyrrolidone (Sigma; No. P6755). Alternatively, probes were ground directly in the Eppendorf tubes using liquid nitrogen and a glass rod. The lysis buffer (Qiagen) provided was complemented with 50 mM ascorbic acid. After binding on a silicagel column (Qiagen), DNA was eluted according to the manufacturer’s instructions and stored (4°C) until used for PCR. The modiﬁed Qiagen-procedure was also utilized to extract DNA from Phytophthora mycelium in order to provide a positive control for diagnostic PCR. DNA was also extracted from tree roots as described by BAHNWEG et al. (1998) in order to reduce the inhibitory effects of recalcitrant plant metabolites on the PCR. For this purpose root samples were collected at the grounds of the GSF-National Research Center from approximately 20-year-old oaks (Q. robur) and from 3-year-old beeches (F. sylvatica). The same method was used in order to extract DNA from the mycelia of Phytophthora, Pythium, Xerocomus, Hebeloma, Russula, Armillaria, and Heterobasidion.

2.4 PCR primers, DNA amplification and product analysis Nucleotide sequences of important primers used in this study are summarized in Table 2. Ribosomal ITS fragments were amplified employing primer pair ITS1/ITS4 as described by WHITE et al. (1990). Random amplified polymorphic DNA (RAPD)-PCR was performed in 25 ml reactions containing 50 mM KCl, 2.0 mM MgCl2,10mM Tris/HCl, pH 9.0, 100 mM each dNTP (Amersham Pharmacia Biotech, Freiburg, Germany), 0.2 mM of a RAPD primer (Operon Technologies Inc., Alameda, CA, USA: primers OPA-1 – OPA-20), 0.4 mg BSA (DNase-free, Amersham Pharmacia Biotech), 1 unit of Taq DNA polymerase (Amersham Pharmacia Biotech), and approximately 25 ng template DNA. Reaction components were set up in bulk mixtures (master mix) in order to minimize pipetting steps and risk of DNA contamination. Twenty-four microlitre aliquots of the master mix were pipetted into 96- well thermowells, template DNA was added in a volume of 1 ml, and 25 ml silicon oil (Type 3; Merck, Darmstadt, Germany) were overlaid to prevent evaporation of the final 25 ml reaction volume. The thermocycler (Uno, Biometra, Go¨ ttingen, Germany) conditions were: initial denaturation at 94°C (3 min), annealing of RAPD primers at 40°C (1 min), and primer Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 175

Table 2. Nucleotide sequences of the oligonucleotide primers used in this study

Primer Nucleotide sequence Source —––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– ITS1 5?TCCGTAGGTGAACCTGCGG3? WHITE et al. 1990 ITS4 5?TCCTCCGCTTATTGATATGC3? WHITE et al. 1990 OPA-1 5?CAGGCCCTTC3? OPERON Technologies OPA-2 5?TGCCGAGCTG3? OPERON Technologies OPA-3 5?AGTCAGCCAC3? OPERON Technologies OPA-4 5?AATCGGGCTG3? OPERON Technologies OPA-5 5?AGGGGTCTTG3? OPERON Technologies OPA-6 5?GGTCCCTGAC3? OPERON Technologies OPA-7 5?GAAACGGGTG3? OPERON Technologies OPA-8 5?GTGACGTAGG3? OPERON Technologies OPA-9 5?GGGTAACGCC3? OPERON Technologies OPA-10 5?GTGATCGCAG3? OPERON Technologies OPA-11 5?CAATCGCCGT3? OPERON Technologies OPA-12 5?TCGGCGATAG3? OPERON Technologies OPA-13 5?CAGCACCCAC3? OPERON Technologies OPA-14 5?TCTGTGCTGG3? OPERON Technologies OPA-15 5?TTCCGAACCC3? OPERON Technologies OPA-16 5?AGCCAGCGAA3? OPERON Technologies OPA-17 5?GACCGCTTGT3? OPERON Technologies OPA-18 5?AGGTGACCGT3? OPERON Technologies OPA-19 5?CAAACGTCGG3? OPERON Technologies OPA-20 5?GTTGCGATCC3? OPERON Technologies CITR1 5?TCTTGCTTTTTTTGCGAGCC3? this paper CITR2 5?CGCACCGAGGTGCACACAAA3? this paper CAMB3 5?GTGACGTAGGTTCATCTGCT3? this paper CAMB4 5?GTGACGTAGGCCAAAATAACA3? this paper QUERC1 5?GTGATCGCAGGAGTGCTCTT3? this paper QUERC2 5?GTGATCGCAGTAAGAAATGAGT3? this paper

extension at 72°C (2 min), followed by 35 cycles of 94°C (30 s), 40°C (45 s) and 72°C (2 min). A final elongation was performed for 5 min at 72°C to ensure a double-stranded amplicon. After addition of 5 ml gel loading buffer, the PCR products were analysed by horizontal agarose gel electrophoresis. The above-mentioned 25 ml reaction containing 0.1–200 ng template DNA and 0.2 mM of each primer were also used for amplification of diagnostic Phyto- phthora-specific marker fragments under the following PCR conditions: initial denaturation at 94°C (3 min), annealing of primers at 62°C (1 min), and primer extension at 72°C (2 min), followed by 30 cycles of 94°C (30 s), 62°C (1 min) and 72°C (2 min). A final elongation was performed for 5 min at 72°C. After addition of 5 ml gel loading buffer, the amplicons were analysed by horizontal agarose gel electrophoresis as described previously (SCHULZE et al. 1997). Amounts of amplified DNA were quantified by image analysis using the ImageMaster VDS system and ImageMaster 1D Elite software (version 2.0; Amersham Pharmacia Biotech).

2.5 Cloning of PCR products and DNA sequencing

Speciﬁc PCR bands were extracted from the ethidium bromide stained agarose gel using the QIAquick gel extraction kit (Qiagen) according to the manufacturer’s instructions. Two microlitre gel-isolated DNA (300 ng) were mixed with 1 ml EcoRV-cutted Novagen’s pT7 Blue T-vector (50 ng), 1 ml10×ligation buffer (Novagen), 0.5 ml 100 mM DTT, 0.5 ml10mM 176 R. Schubert et al.

Fig. 1.—continued next page Identiﬁcation of Phytophthora species associated with root-rot diseases by species-speciﬁc PCR 177

Fig. 1. Genomic nucleotide sequences representing the ITS regions and the 5.8S rDNA of the nuclear ribosomal RNA gene repeat of P. gonapodyides isolate GON 3 (numbered from 1 to 876), P. quercina isolate QUE 7 (numbered from 1 to 861), and P. citricola isolate CIT 7 (numbered from 1 to 818) aligned to the sequence of P. cambivora isolate CAM 2 (numbered from 1 to 889). The asterisks represent nucleotides identical to those in the P. cambivora sequence. Multiple alignment was calculated with the HIBIO DNASIS version 2.1 program from HITACHI according to the HIGGINS–SHARP Algorithm (1988). Gaps (–) were introduced for maximum matching of the nucleotide sequences. The u marks the 5? start of the ITS1 region, the ITS2 region, the 5.8S rDNA gene and the 28S rDNA gene, respectively. The 3? ends of the 18S rDNA gene, the 5.8S rDNA gene, the ITS1 region, and the ITS2 region, respectively, are indicated by the y. The underlined nucleotide sequences were used for the development of the PCR primer pair CITR1/CITR2 speciﬁc for the detection of P. citricola. These sequence data are submitted to the EMBL library under the accession numbers AJ007040 (CAM2), AJ007368 (GON3), AJ007369 (QUE7), and AJ007370 (CIT7)

ATP, 4.5 ml nuclease-free water and 0.5 ml (1 unit) T4 DNA ligase (Novagen) and incubated at 16°C for 12 h. Competent NovaBlue Escherichia coli K12 cells (provided by Novagen) were transformed with a 1 ml aliquot of the ligation reaction according to the manufacturer’s instructions. Recombinant bacterial cells were selected after overnight incubation at 37°C on LB agar plates containing 50 mg/ml ampicillin, 15 mg/ml tetracycline, 35 ml of 50 mg/ml X-gal (dissolved in dimethyl formamide) and 20 ml 100 mM IPTG. The DNA of randomly picked recombinant pT7 Blue T-plasmid derivatives was prepared from liquid bacterial cultures using the Qiagen plasmid mini kit and Qiagen-tip 20 columns. Plasmids were sequenced (both DNA strands) by an oligonucleotide walking strategy employing the Cy5-AutoRead sequencing kit and the Cy5-dATP labelling mix (Amersham Pharmacia Biotech). Fluorescence-labelled dideoxy chain-terminated fragments were detected by an ALFexpress automated laser sequencer (Amersham Pharmacia Biotech). Clone-speciﬁc oligonucleotides were synthesized by Gibco/Brl (Karlsruhe, Germany).

3 Results 3.1 Development of a P. citricola-speciﬁc DNA marker

The ITS1/ITS4-ampliﬁed internal transcribed spacer regions ITS1 and ITS2 were cloned and sequenced as well as the 5.8S rRNA gene of the ribosomal RNA gene repeat of the following Phytophthora isolates: P. citricola CIT 7, P. cambivora CAM 2, P. gonapodyides GON 3 and P. quercina QUE 7, respectively. The multiple alignment of the nucleotide 178 R. Schubert et al.

Fig. 2. PCR-based detection of P. citricola, P. cambivora, and P. quercina DNA using the species- speciﬁc oligonucleotide primer pairs CITR1/CITR2 [A], CAMB3/CAMB4 [B], and QUERC1/QUERC2 [C]. The lane numbers of the agarose gels correspond with the no. of isolates given in Table 1. No cross ampliﬁcation occurred with any of the other species examined. The 800 bp fragment of the DNA marker is indicated

sequences is depicted in Fig. 1. Based on the DNA regions of greatest sequence dissimilarity the primer pair CITR1/CITR2 (5?-TCT TGC TTT TTT TGC GAG CC-3? and 5?-CGC ACC GAG GTG CAC ACA AA-3?, respectively) was selected for the detection of P. citricola. This primer combination yielded the predicted 711 bp PCR product from all 13 P. citricola isolates tested during this study (Fig. 2A). But no visible PCR products were obtained from any of the other Phytophthora and fungal species summarized in Table 1. Note that the selected primer pair CITR1/CITR2 had no undesirable cross-reaction with P. citrophthora, P. capsici and P. cryptogea, all of which are known to be closely related to P. citricola based on ITS1 and ITS2 sequences of the ribosomal RNA gene repeat (COOKE and DUNCAN 1997).

3.2 Development of species-specific DNA markers for P. cambivora and P. quercina Attempts to design species-specific primers for P. cambivora and P. quercina were initially unsuccessful due to the lack of sufficient sequence differences of the ITS sequences of these species. Examinations of putative specific primers complementing both ITS regions of the ribosomal RNA gene repeat always yielded cross amplification with other species of the Phytophthora test collection, with Pythium and even with Armillaria spp. (data not shown). However, screening of RAPD primers (OPA-1 – OPA-20) revealed one amplicon unique to P. cambivora in the case of OPA-8 and one amplicon unique to P. quercina in the case of OPA-10, respectively. Both discriminating RAPD bands were excised from the agarose gel, cloned and sequenced (nucleotide sequences are shown in Fig. 3). The nucleotide sequences obtained from both ends of the cloned subgenomic fragments were used to construct species-specific PCR primers. These were CAMB3 and CAMB4 (5?-GTG ACG TAG GTT CAT CTG CT-3? and 5?-GTG ACG TAG GCC AAA ATA ACA-3?, respectively) yielding a 1105 bp P. cambivora-specific amplicon (Fig. 2B). A P. quercina-specific amplicon of 842 bp (Fig. 2C) was obtained with the primers QUERC1 and QUERC2 (5?- GTG ATC GCA GGA GTG CTC TT-3? and 5?-GTG ATC GCA GTA AGA AAT GAG T-3?, respectively).

3.3 Quantiﬁcation and sensitivity of detection

Dilution series of genomic DNAs of P. quercina, P. cambivora, and P. citricola were prepared using TE-buffer (10 mM Tris/1 mM EDTA, pH 8.0) to determine the sensitivity of Identiﬁcation of Phytophthora species associated with root-rot diseases by species-speciﬁc PCR 179

Fig. 3. Nucleotide sequences of cloned RAPD fragments of P. cambivora isolate CAM2 (numbered from 1 to 1105) and P. quercina isolate QUE7 (numbered from 1 to 842). The subgenomic fragments revealed several short open reading frames for protein translation on both DNA strands (data not shown). However, no significant homologies with known genes from other organisms could be identified using the ISREC-EPFL Blast server in Lausanne, Switzerland (http://ulrec3.unil.ch/.). The underlined nucleotide sequences were used for the development of the PCR primer pairs CAMB3/CAMB4 and QUERC1/QUERC2 specific for the detection of P. cambivora and P. quercina, respectively. These sequence data are submitted to the EMBL library under the accession numbers AJ007371 (CAM2) and AJ007372 (QUE7)

Fig. 4. PCR-based detection of P. cambivora DNA dilutions with primers CAMB3/CAMB4, P. quercina DNA dilutions with primers QUERC1/QUERC2, and P. citricola DNA dilutions with primers CITR1/CITR2, respectively. The available amounts of Phytophthora template DNA in each PCR following dilution with TE-buffer are indicated in each lane of the agarose gel. The 800 bp fragment of the DNA ladder is marked 180 R. Schubert et al.

Fig. 5. Quantification of P. citricola-specific amplicons (as indicated in pg) in DNA extracts of artificially infected oak seedling roots 3, 10, 14, and 17 days after inoculation with isolate CIT 23. After 30 PCR cycles using primer pair CITR1/CITR2, the products were separated in an agarose gel and volumes of the DNA bands were determined by image analysis. Based on different amounts of P. citricola DNA (from 2 pg to 200 ng), a standard curve was calculated (see diagram). The infected oak probes tested were within the linear range of the calibration Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 181 detection. Concentrations of undiluted DNA preparations were 40 ng/ml(P. quercina), 100 ng/ml(P. cambivora), and 200 ng/ml(P. citricola). Based on 30 PCR cycles, detection of a well-discernable amplicon was possible down to 100 pg (P. cambivora), 4 pg (P. quercina), and 2 pg (P. citricola) target DNA (Fig. 4). In the presence of 100 ng oak DNA, however, sensitivity of detection was 10 times lower (data not shown). For this experiment oak DNA was isolated from adult roots (20-year-old trees) according to BAHNWEG et al. (1998). Aliquots of the oak DNA were mixed with the Phytophthora DNA dilutions and PCR was carried out. On the other hand, no reduced sensitivity of Phytophthora DNAs was obtained in the presence of 100 ng beech DNA (data not shown). The beech DNA was extracted from roots of 3-year-old plants according to BAHNWEG et al. (1998) and aliquots were mixed with the diluted Phytophthora DNAs in order to perform diagnostic PCR. Furthermore, DNA was isolated from oak seedlings according to BAHNWEG et al. (1998) after artificial infection with P. citricola isolate CIT 23. After PCR using primer pair CITR1/CITR2 and agarose gel electrophoresis, the diagnostic amplicons were quantified by image analysis. Based on 1 mg (wet weight) plant tissue which was always extracted, samples taken from seedling roots 3, 10, 14, and 17 days after artificial inoculation revealed amounts of 2, 18, 23, and 140 pg P. citricola DNA, respectively (Fig. 5). The amount of amplicon produced is dependent on the amount of target DNA in a sample (SIMON et al. 1992) and can therefore be used for the quantification of the pathogen in host tissues.

3.4 Detection of Phytophthora spp. in both artificially infected oak and beech seedlings Beech seedlings were inoculated with P. citricola and oak seedlings were infected with P. quercina, P. cambivora, and P. citricola, respectively, under the controlled conditions described in section 2.2. One to 2 days after the beginning of the experiment, sporangia were observed on the mycelium-covered agar plugs used for inoculation. On the third day the host plants revealed the first visible disease symptoms. Oak seedlings showed brownish discoloration on the root tips and on the elongation zone of the main root, as well as on lateral roots (Fig. 6A). Beech seedlings were primarily attacked in the collar region and showed brownish-black rotting symptoms. In this case the rot rapidly expanded up the hypocotyl and reached the cotyledons within a few days (Fig. 6B). Infected beech seedlings were dead 1 week after the inoculation, although infection symptoms on the roots themselves were not very pronounced. In contrast, oak seedlings revealed weaker disease symptoms which were restricted to roots under the specific conditions tested. Oaks were still alive at the end of the experiment. Uninfected controls remained healthy. Re-isolation of the Phytophthora spp. from infected tissues was successfully carried out confirming infection by the different pathogens (data not shown). The time-consuming standard DNA isolation protocol (BAHNWEG et al. 1998) was replaced by the modified Qiagen procedure presented in this paper in order to handle many samples. After DNA extraction of infected oak seedlings as well as beech seedlings, 40 PCR cycles were performed using the species-specific primer pairs CITR1/CITR2, CAMB3/CAMB4, and QUERC1/QUERC2. The predicted diagnostic PCR products were observed 3 days after inoculation with P. citricola, P. cambivora, and P. quercina (Fig. 7 and Fig. 8) concurrent with the occurrence of disease symptoms. However, detection of infection was also possible prior to the appearance of disease symptoms in P. citricola-infected beech seedlings (Fig. 7, lanes 8, 10, 11) as well as in oak seedlings which were inoculated with P. cambivora (Fig. 8B lane 5) and P. quercina (Fig. 8C lane 5). Diagnostic amplicons were detected in nearly all DNA samples obtained from symptomatic tissues (main roots, lateral roots, and root tips of oak seedlings and beech seedlings; beech hypocotyls and cotyledons). No amplicons were derived from DNA samples of uninoculated controls. 182 R. Schubert et al.

Fig. 6. A: Oak seedling artiﬁcially infected with P. citricola isolate CIT 23 under controlled conditions, showing dark discoloration on the root tip 14 days after inoculation. B: Three beech seedlings artiﬁcially infected with P. citricola isolate CIT 55, 4 days after inoculation (right) and two uninoculated control seedlings (left). Infected seedlings show different stages of decay, with the rot (dark discoloration) expanding up the hypocotyl and reaching the cotyledones (far right)

Fig. 7. PCR-based detection of P. citricola DNA extracted from beech seedlings which were artificially infected with isolate CIT 55 under controlled conditions. Inoculation experiments were performed according to method B (slot no. 1–6) and method A (slot no. 7–11) as described in ‘Materials and methods’. The following tissue samples were analysed: (1) symptomatic main root, 3 days after inoculation; (2) symptomatic hypocotyl, 3 days after inoculation; (3) symptomatic cotyledon, 3 days after inoculation; (4) symptomatic main root, 4 days after inoculation; (5) main root showing faint symptoms, 4 days after inoculation; (6) symptomatic main root, 6 days after inoculation; (7) symptomatic main root, 4 days after inoculation; (8) main root revealing no symptoms, 4 days after inoculation; (9) symptomatic main root, 5 days after inoculation; (10) main root revealing no symptoms, 5 days after inoculation; (11) main root revealing no symptoms, 6 days after inoculation; (12) uninoculated control seedling; (13) P. citricola control DNA; (14) PCR control reaction without any DNA. The fragment size of the amplicon in bp derived from a DNA marker fragment is given at the left margin Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 183

Fig. 8. PCR-based detection of P. citricola DNA [A], P. cambivora DNA [B], and P. quercina DNA [C] extracted from oak seedlings which were artificially infected under controlled conditions with isolate CIT 23, CAM 5, and QUE 3/QUE 4, respectively. Inoculation experiments were performed according to method A (labelled by *) and method B (unlabelled) as described in ‘Materials and methods’. The following tissue samples were analysed: A: 1*) symptomatic main root, 18 days after inoculation; 2*) symptomatic main root, 19 days after inoculation; 3*) symptomatic main root, 21 days after inoculation; 4*) symptomatic main root, 25 days after inoculation; (5) symptomatic main root, 3 days after inoculation; (6) symptomatic main root, 5 days after inoculation; (7) symptomatic main root, 7 days after inoculation; (8) symptomatic main root, 11 days after inoculation; (9) P. citricola control DNA; (10) PCR control reaction without any DNA. B: (1) PCR control reaction without any DNA; (2) uninoculated control seedling; (3) symptomatic main root, 3 days after inoculation; (4) symptomatic main root, 4 days after inoculation; (5) main root revealing no symptoms, 4 days after inoculation; (6) symptomatic main root, 7 days after inoculation; (7) symptomatic main root, 8 days after inoculation; (8) P. cambivora control DNA. C: (1) PCR control reaction without any DNA; (2) symptomatic main root, 3 days after inoculation; (3) symptomatic fine root, 6 days after inoculation; (4) symptomatic main root, 7 days after inoculation; (5) main root revealing no symptoms, 7 days after inoculation; (6) symptomatic fine root, 10 days after inoculation; (7) P. quercina control DNA. The fragment sizes of the amplicons in bp derived from DNA marker fragments are given at the right margin

4 Discussion

Oaks and beeches are dominant tree species in European broad-leaved forests (e.g. HUNTLEY 1990; MUHS and VON WU¨ HLISCH 1992) and are increasingly endangered by damage from complex environmental stress, including air pollution and pathogen attack. For instance, inventories in Bavaria revealed damaged crowns for 48% of oak trees and 28% of beech trees (ANONYMOUS 1997a). Such a dramatic decline and the frequent isolation of Phy- tophthora spp. from both injured oak and beech roots prompted the development of species- specific primers for the PCR-based detection of the species involved, P. cambivora, P. citricola, and P. quercina. A rapid, simple and reliable identification system will be necessary for a large-scale screening of natural stands in order to investigate the significance of 184 R. Schubert et al.

Phytophthora infections in the decline of beech and oak. On the other hand, oaks and beeches represent the most important deciduous species raised in nurseries because reforestation with these species is common practice. It is becoming increasingly important now for reforestation to use a Phytophthora pathogen-free plant stock. In the case of Q. robur and Q. petraea for example, 89 652 kg of seeds were harvested in Germany from July 1996 to June 1997 in order to produce forest reproductive material. Moreover, 29 927 kg of oak seeds were imported during this time from different countries (ANONYMOUS 1997b). In conjunction with image analysis or real time quantitative PCR (GIBSON et al. 1996), the molecular techniques described are potential tools for the specific detection and quantification of Phytophthora root diseases of beech and oak. Such techniques have been established for other root and butt rot fungi (e.g. Armillaria spp.) and were successfully used for field tests in spruce forests in the East Ore Mountains (SCHULZE et al. 1997). Species-specific PCR primer pairs have been established for several Phytophthora spp. (JUDELSON and MESSENGER-ROUTH 1996; LACOURT and DUNCAN 1997; TOOLEY et al. 1997). Primer specificity, however, has been recognized as a critical point. Strong cross-amplification of putative P. infestans-specific ITS primers was observed with the closely related P. mirabilis Galindo and Hohl and P. phaseoli Thaxter (TOOLEY et al. 1997) and also with P. cactorum (Leb. and Cohn) Schroeter (TROUT et al. 1997). Weak amplification also occurred with additional species. The recently reported ITS primer (LEE et al. 1993), recognizing all Phytophthora spp., revealed in the present experiments the cross reactions with some Pythium species (data not shown). In contrast, the specificity of the Phytophthora primer pairs presented in this study was tested using a broad collection of other species which are known to be associated with tree roots. For many Phytophthora spp., ITS sequences may not be the best tool to develop species- specific PCR primers due to the relatively low sequence diversities observed in the genomic region of this genus. The ITS2 sequences are well conserved among different Phytophthora species, whereas the ITS1 sequences showed more variation (for detailed information see COOKE and DUNCAN 1997). Some Phytophthora spp., however, revealed two large deletions within their ITS regions. These deletions were confirmed by sequencing the Phytophthora isolate CIT 7. Based on such unique sequence peculiarities, the P. citricola-specific primer set CITR1/CITR2 selected had no cross reactions with the strongly related species P. citrophthora (R. E. Smith and E. H. Smith) Leonian, P. capsici, and P. cryptogea Pethybridge and Lafferty. Only P. inflata Caroselli and Tucker, originally described as the causal agent of pit canker of elm trees, has ITS sequences nearly identical to P. citricola (D. E. L. Cooke, unpublished). Sequencing of additional genomic regions will be necessary in order to find out if P. inflata is a distinct species differing phylogenetically from P. citricola. Moreover, P. inflata is characterized by semipapillate broad sporangia and infections have only been reported from Ulmus americana L., U. fulva Mich., Sambucus tenuifolium, and Syringa vulgaris (CAROSELLI and TUCKER 1949; HALL et al. 1992). In contrast, P. citricola has highly variable shapes of sporangia and is known to attack many economically important host plants including oaks and beeches. The present results further demonstrate that cloning and sequencing of discriminating RAPD-fragments represent an alternative approach in order to construct species-specific PCR primer pairs outside the intergenic sequences of the ribosomal genes. PCR conditions used in this study were sufficient to detect between 2 pg and 100 pg purified Phytophthora DNA. According to TOOLEY and THERRIEN (1987) 10 pg of DNA are roughly the equivalent of 10–20 P. infestans nuclei. If the amount of DNA per nucleus is comparable with other Phytophthora species, this would indicate that the DNA equivalent of approximately 2–4 (P. citricola) to 100–200 (P. cambivora) nuclei per reaction would be necessary for PCR- based detection of these pathogens. The detection limit of P. cambivora DNA using the RAPD-derived PCR marker was reduced by approximately two orders of magnitude in comparison with the ITS-based amplification of P. citricola DNA. Such a decreased sensitivity of so-called SCAR (sequence-characterized amplified region) markers would be Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 185 expected if their threshold target copy number was significantly lower than the high threshold target copy number of the repetitively organized ITS sequences. On the other hand, the PCR detection limit of purified P. quercina DNA was almost that of P. citricola, indicating that the copy number of the cloned subgenomic RAPD fragment of P. quercina is likely highly repetitive. In spite of the limitation in sensitivity of detection of P. cambivora, this diagnostic PCR detected P. cambivora in artificially infected seedlings after the third day of inoculation just as well as P. citricola and P. quercina. The reduced PCR-based detection of P. citricola DNA in the presence of oak DNA indicates that for infected adult oak roots DNA isolation protocols need to be further improved in order to remove PCR inhibitors. The sensitivity of detection may, of course, be further enlarged by increasing the number of cycles or by using nested PCR primers (STARK et al. 1998). Furthermore, Phytophthora spores could be separated from infested soil samples and tested for DNA extraction in order to overcome the difficulties that were encountered with adult oak roots.

Acknowledgements

We would like to thank Marion WENIG (GSF), and Eliane ESCHER (University of Munich) for excellent technical assistance.

Re´sume´ De´tection et quantification par PCR espe`ce spećifique, d’espe`ces de Phytophthora associeés a` des maladies racinaires chez des feuillus forestiers europeéns Des amorces de PCR ont e´te´ de´finies pour de´tecter des espe`ces de Phytophthora connues pour provoquer des maladies racinaires chez des arbres forestiers europeéns. Le couple d’amorces CITR1/CITR2, de´finies dans la re´gion des espaceurs internes transcrits (ITS) de l’ADN ribosomal, ont permis d’amplifier un fragment de 711 pb avec Phytophthora citricola. Le couple d’amorces CAMB3/CAMB4, spećifique de Phytophthora cambivora, qui produit un fragment de 1105 pb, et le couple d’amorces QUERC1/QUERC2, spećifique de Phytophthora quercina, qui produit un fragment de 842 pb, ont e´te´ de´finis a` partir de fragments RAPD pre´sente´s dans cet article. Les trois couples d’amorces n’ont pas amplifie´ de fragments a` partir d’une collection d’isolats divers incluant d’autres espe`ces de Phytophthora, ainsi que Pythium, Xerocomus, Hebeloma, Russula et Armillaria. Dans les conditions de PCR dećrites, la de´tection d’un amplifiat discernable e´tait possible avec aussi peu d’ADN que 100 pg (P. cambivora), 4 pg (P. quercina) et 2 pg (P. citricola). Notre diagnostic base´ sur la PCR s’est re´ve´le´ capable de de´tecter P. citricola, P. quercina et P. cambivora dans des semis de Quercus robur et de Fagus sylvatica qui avaient e´te´ infecte´s artificiellement en conditions controˆ leés.

Zusammenfassung Nachweis und Quantifizierung von baumpathogenen Phytophthora-Arten mit Hilfe der Polymerase- Kettenreaktion Es wurden artspezifische Oligonukleotidprimerpaare zum Nachweis von solchen Phytophthora-Arten entwickelt, die in europaïschen Laubwa¨ldern Wurzelfaüle verursachen. Auf der Grundlage der transkribierten, internen Spacersequenzen der ribosomalen DNA-Repetitionseinheit ist das Primerpaar CITR1/CITR2 entwickelt worden, daß ein 711 Basenpaare umfassendes, fu¨ r Phytophthora citricola- DNA spezifisches PCR-Produkt liefert. Das Primerpaar CAMB3/CAMB4 liefert ein 1105 Basenpaare langes Amplifikat mit Phytophthora cambivora-DNA, und das Primerpaar QUERC1/QUERC2 erzeugt ein 842 Basenpaare umfassendes PCR-Produkt mit Phytophthora quercina-DNA. Beide PCR- Primerpaare wurden aus der DNA-Sequenz von artspezifischen RAPD-Fragmenten abgeleitet, welche mit Primern zufa¨lliger Nukleotidfolge erzeugt worden sind. Die Artspezifita¨t aller neu entwickelten PCR-Primerpaare wurde mit einer breiten Kollektion anderer Mikroorganismen getestet. Unter den beschriebenen Reaktionsbedingungen waren 100 pg (P. cambivora), 4 pg (P. quercina) bzw. 2 pg (P. citricola) genomische DNA ausreichend, um sichtbare Amplifikate zu erhalten. Daru¨ berhinaus konnten 186 R. Schubert et al. die betreffenden PCR-Produkte in ku¨ nstlich infizierten Buchen-und Eichenkeimlingen am dritten Tag nach der Infektion mit P. cambivora, P. quercina und P. citricola nachgewiesen werden.

References

ANONYMOUS, 1997a: Waldzustandsbericht 1997. Bayerische Landesanstalt fu¨ r Wald und Forstwirt- schaft, Freising-Weihenstephan, 63 pp. ANONYMOUS, 1997b: Erhebung zur Versorgungssituation forstliches Vermehrungsgut im Bundes- gebiet. (Erfassungszeitraum 01.07. 1996–30.06. 1997). Bundesanstalt fu¨ r Landwirtschaft und Erna¨h- rung. Frankfurt-am-Main. 81 pp. APPELS, N.; HONEYCUTT, R. L., 1986: rDNA: evolution over a billion years. In: DNA Systematics, Vol. 2. Ed. by DUTTA, S. K. Boca Raton, FL: CRC Press. pp. 81–135. BAHNWEG, G.; SCHULZE, S.; MO¨ LLER, E. M.; ROSENBROCK, H.; LANGEBARTELS, C.; SANDERMANN, H., 1998: DNA isolation from recalcitrant materials such as tree roots, bark, and forest soil for the detection of fungal pathogens by PCR. Anal. Biochem. 262, 79–82. BLASCHKE, H., 1994: Decline symptoms on roots of Quercus robur. Eur. J. For. Path. 24, 386–398. BRASIER, C. M., 1993: Phytophthora cinnamomi as a contributory factor in European oak declines. In: Recent Advances in Studies on Oak Decline. Proc. Int. Cong., 13–18 September, 1992, Selva di Fassano (Brindisi), Italy. Ed. by LUISI, N.; LERARIO, P.; VANNINI, A. B. Bari: Tipolitografia– Putignano. pp. 49–57. –; STROUTS, R. G., 1976: New records of Phytophthora on trees in Britain I. Phytophthora root rot and bleeding canker of horse chestnuts (Aesculus hippocastanum L.). Eur. J. For. Path. 6, 129–136. CAROSELLI, N. E.; TUCKER, C. M., 1949: Pit canker of elm. Phytopathology 39, 481–488. COOKE, D. E. L.; DUNCAN, J. M., 1997: Phylogenetic analysis of Phytophthora species based on ITS1 and ITS2 sequences of the ribosomal RNA gene repeat. Mycol. Res. 101, 667–677. CRAWFORD, A. R.; BASSAM, B. J.; DRENTH, A.; MACLEAN, D. J.; IRWIN, J. A. G., 1996: Evolutionary relationships among Phytophthora species deduced from rDNA sequence analysis. Mycol. Res. 100, 437–443. DAY, R., 1938: Root-rot of sweet chestnut and beech caused by species of Phytophthora. Forestry 12, 101–116. DELATOUR, C., 1983: Les de´pe´rissements de cheˆnes en Europe. Rev. For. France 35, 265–282. EL-HAMALAWI, Z. A.; MENGE, J. A., 1994: Avocado trunk canker disease caused by Phytophthora citricola: investigation of factors affecting infection and disease development. Plant Dis. 78, 260– 264. ERWIN, D. C.; RIBEIRO, O. K., 1996: Phytophthora diseases worldwide. St. Paul, MN: APS Press. 562 pp. GIBSON, U. E. M.; HEID, C.; WILLIAMS, P. M., 1996: A novel method for real time quantitative RT- PCR. Genome Res. 6, 995–1001. GOODWIN, P. H.; KIRKPATRICK, B. C.; DUNIWAY, J. M., 1989: Cloned DNA probes for identification of Phytophthora parasitica. Phytopathology 79, 716–721. HALL, G.; DOBSON, S.; NICHOLLS, C., 1992: First record of Phytophthora inflata in the United Kingdom. Plant Path. 41, 95–97. HIGGINS, D. G.; SHARP, P. M., 1988: CLUSTAL: a package for performing multiple sequence align- ments on a microcomputer. Gene 73, 237–244. HOITING,H.A.J.;SCHMITTHENNER, A. F., 1969: Rhododendron wilt caused by Phytophthora citricola. Phytopathology 59, 708–709. HORNER, I. J.; WILCOX, W. F., 1996: Temporal changes in activity and dormant spore populations of Phytophthora cactorum in New York apple orchard soils. Phytopathology 86, 1133–1139. HUNTLEY, B., 1990: European vegetation history: palaeovegetation maps from pollen data-13 000 year BP to present. Biol. J. Linn. Soc. 58, 247–276. JEFFERS, S. N.; ALDWINCKLE, H. S., 1988: Phytophthora crown rot of apple trees: sources of Phy- tophthora cactorum and P. cambivora as primary inoculum. Phytopathology 78, 328–335. JOHANSON, A.; JEGER, M. J., 1993: Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots on banana and plantain. Mycol. Res. 97, 670–674. JUDELSON, H. S.; MESSENGER-ROUTH, B., 1996: Quantitation of Phytophthora cinnamomi in avocado roots using a species-specific DNA probe. Phytopathology 86, 763–768. JUNG, T., 1996: Untersuchungen zur Phytophthora- Erkrankung europaïscher Eichenarten mit beson- derer Beru¨ cksichtigung der Stieleiche (Quercus robur L.): Ein Beitrag zur Kla¨rung des Pha¨nomens Eichensterben. Dissertation, Ludwig Maximilians University of Munich. 150 pp. –; BLASCHKE, H., 1996: Phytophthora root rot in declining forest trees. Phyton (Horn, Austria) 36, 95–101. –; –; NEUMANN, P., 1996: Isolation, identification and pathogenicity of Phytophthora species from declining oak stands. Eur. J. For. Path. 26, 253–272. Identification of Phytophthora species associated with root-rot diseases by species-specific PCR 187

–; COOKE,D.E.L.;BLASCHKE, H.; DUNCAN, J. M.; OSSWALD, W., 1999: Phytophthora quercina sp. nov., a new species causing root rot of European oak species. Mycol. Res. in press. LACOURT, I.; DUNCAN, J. M., 1997: Specific detection of Phytophthora nicotianae using the polymerase chain reaction and primers based on the DNA sequence of its elicitin gene ParA1. Eur. J. Plant Path. 103, 73–83. LEE, S. B.; WHITE, T. J.; TAYLOR, J. W., 1993: Detection of Phytophthora species by oligonucleotide hybridization to amplified ribosomal DNA spacers. Phytopathology 83, 177–181. LUISI, N.; LERARIO, P.; VNNINI, A. (eds), 1993: Recent advances in studies on oak decline. In: Proc. Int. Cong., 13–18 September. Selva di Fassano (Brindisi), Italy. Bari: Tipolitografia-Putignano. 541 pp. MANION, P. D., 1981: Tree disease concepts. Englewood Cliffs, NJ: Prentice-Hall. 399 pp. MILLER, S. A., 1996: Detecting propagules of plant pathogenic fungi. Adv. Bot. Res. 23, 73–102. –; MADDEN, L. V.; SCHMITTHENNER, A. F., 1997: Distribution of Phytophthora spp. in field soils determined by immuno-assay. Phytopathology 87, 101–107. MILLS, S. C.; FO¨ RSTER, H.; COFFEY, M. D., 1991: Taxonomic structure of Phytophthora cryptogea and P. drechsleri based on isozyme and mitochondrial DNA analyses. Mycol. Res. 95, 31–48. MUHS,H.J.;VON WU¨ HLISCH, G., 1992: Research on the improvement of beech in the last decade. In: Proc. Int. Congr. on beech, Pamplona. Ed. by ELENA-ROSSELLO, Investigacion Agraria, Systemas y Recorsos Forestales. Publicaciones del Ministerio de Agriculturo, Pesca y Alimentacion. Instituto Nacional de Investigacion y Tecnologia Agraria y Mineria, Madrid. pp. 63–89. NAZAR, R. N.; HU, X.; SCHMIDT, J.; CULHAM, D.; ROBB, J., 1991: Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens. Phys. Mol. Plant Path. 39, 1–11. NEWHOOK, F. J.; WATERHOUSE, G. M.; STAMPS, D. J., 1978: Tabular key to the species of Phytophthora DE BARY. Mycological Paper 143. Kew: Commonwealth Mycological Institute. 20 pp. OUDEMANS, P.; FO¨ RSTER, H.; COFFEY, M. D., 1994: Evidence for distinct isozyme subgroups within Phytophthora citricola and close relationships with P. capsici and P. citrophthora. Mycol. Res. 98, 189–199. PETRI, L., 1917: Ricerche sulla morfologia e biologia della Blepharospora cambivora, parasitica del Castagno. Atti. R. Accad. Lincei, Rend. Cl. Sci. Fis. Mat. Nat. Ser.5,26,297–299. PICHLMAIER, J.; ZINKERNAGEL, V., 1992: Phytophthora citricola (SAWADA) als Erreger der Stockfaüle des Hopfens. Zeitschr. Pflanzenkrankh. Pflanzensch. 99, 505–518. SAWADA, K., 1927: Descriptive catalogue of the Formosan fungi. III. Rep. Dep. Agric. Gov. Res. Inst. Formosa Bull. 27, 1–62. SCHULZE, S.; BAHNWEG, G.; MO¨ LLER, E. M.; SANDERMANN, H., 1997: Identification of the genus Armillaria by specific amplification of an rDNA-ITS fragment and evaluation of genetic variation within A. ostoyae by rDNA-RFLP and RAPD analysis. Eur. J. For. Path. 27, 225–239. SIMON, L.; LE´ VESQUE, C.; LALONDE, M., 1992: Rapid quantitation by PCR of endomycorrhizal fungi colonizing roots. PCR Meth. Appl. 2, 76–80. SIWECKI, R.; LIESE, W. (eds), 1991: Oak decline in Europe. In: Proc. Int. Symp., 15–18 May, 1990, Kornik, Poland. Poznan´ : Panstwowe Wydawnictwo Rolnicze i Lesńe. 360 pp. STAMPS, D. J.; WATERHOUSE, G. M.; NEWHOOK, F. J.; HALL, G. S., 1990: Revised tabular key to the species of Phytophthora. 2nd edn., Mycological Papers 162. Wallingford, Oxfordshire, England: CAB International Mycological Institute. 28 pp. STARK, K. D.; NICOLET, Y.; FREY, Y., 1998: Detection of Mycoplasma hypopneumoniae by air sampling with a nested PCR assay. Appl. Environ. Microbiol. 64, 543–548. TISSERAT, N. A.; HULBERT, S. H.; SAUER, K. M., 1994: Selective amplification of rDNA internal transcribed spacer regions to detect Ophiosphaerella korrae and O. herpotricha. Phytopathology 84, 478–482. TOOLEY, P. W.; BUNYARD, B. A.; CARRAS, M. M.; HATZILOUKAS, E., 1997: Development of PCR primers from internal transcribed spacer region 2 for detection of Phytophthora species infecting potatoes. Appl. Environ. Microbiol. 63, 1467–1475. –; THERRIEN, C. D., 1987: Cytophotometric determination of the nuclear DNA content of 23 Mexican and 18 non-Mexican isolates of Phytophthora infestans. Exp. Mycol. 11, 19–26. TROUT, C. L.; RISTAINO, J. B.; MADRITCH, M.; WANGSOMBOONDEE, T., 1997: Rapid detection of Phytophthora infestans in late blight-infected potato and tomato using PCR. Plant Dis. 81, 1042– 1048. TSAO, P. H., 1983: Factors affecting isolation and quantitation of Phytophthora from soil. In: Phy- tophthora. Its biology, taxonomy, ecology, and pathology. Ed. by ERWIN, D.C.; BARTNICKY- GARCIA, S.; TSAO, P.H. St Paul MN: The American Phytopathological Society. pp. 219–236. –, 1990: Why many phytophthora root rots and crown rots of tree and horticultural crops remain undetected. Bull. Oepp/Eppo Bull. 20, 11–17. WERRES, S.; RICHTER, J.; VESER, I., 1995: Untersuchungen von kranken und abgestorbenen Roß- kastanien (Aesculus hippocastanum L.) im o¨ ffentlichen Gru¨ n. Nachrichtenbl. Deut. Pflanzenschutzd. 47, 81–85. 188 R. Schubert et al.

WHITE, T. J.; BRUNS, T.; LEE, S.; TAYLOR, J., 1990: Ampliﬁcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR protocols: A Guide to Methods and Applications. Ed. by INNIS, M. A.; GELFAND, D. H.; SNINSKY, J. J.; WHITE, T. J. New York: Academic Press Inc. pp. 315–321. XUE, B.; GOODWIN, P. H.; ANNIS, S. L., 1992: Pathotype identiﬁcation of Leptosphaeria maculans with PCR and oligonucleotide primers from ribosomal internal transcribed spacer sequences. Phys. Mol. Plant Path. 41, 179–188.