Host-microbe interactions in brine shrimp Artemia cultured under gnotobiotic and conventional rearing conditions
Niu Yufeng
Thesis submitted in fulfillment of the requirements for the degree of
Doctor (PhD) in Applied Biological Sciences: Environmental Technology
Part of the work done during the PhD is being submitted as a patent application. Therefore, non UGent jury members will be asked to sign a confidential disclosure agreement, and all draft versions of the manuscript are to be treated as confidential material.
Promoter:
Prof. Dr. ir. Peter Bossier (Ghent University);
Prof. Dr. ir. Tom Van de Wiele (Ghent University);
Prof. Dr. Shuanglin Dong (Ocean University of China)
Yufeng Niu. Host-microbe interactions in brine shrimp Artemia cultured under gnotobiotic and conventional rearing conditions. Dissertation, Ghent University, Belgium.
Dutch translation of the title: Gastheer-microbe interacties in het pekelkreeftje Artemia in gnotobiotische en conventionele condities
ISBN: 978-90-5989-709-0
The author and the promoters give the authorisation to consult and copy parts of this work for personal use only. Every other use is subject to the copyright laws. Permission to reproduce any material contained in this work should be obtained from the author.
Yufeng Niu was funded by the Chinese Scholarship Council (CSC) and Special Research Fund (BOF) of Ghent University (BOF12/DC1/013; 01DI1312)
TABLE OF CONTENTS
LIST OF ABBREVIATIONS AND UNITS ...... I
PART I INTRODUCTION AND LITERATURE REVIEW
CHAPTER 1 INTRODUCTION AND THESIS OUTLINE
1. INTRODUCTION ...... 1
2. THESIS OUTLINE ...... 23
CHAPTER 2 MICROBIAL MANAGEMENT FOR SUSTAINABLE AQUACULTURE: NEEDS FOR MORE
KNOWLEDGE ON HOST-MICROBE INTERACTION
1. INTRODUCTION ...... 25
2. SUMMARY ...... 41
PART II ARTEMIA-MICROBE INTERACTION ASSOCIATED WITH
PROBIOTICS
CHAPTER 3 A METHOD FOR THE SPECIFIC DETECTION OF RESIDENT BACTERIA IN BRINE SHRIMP
LARVAE ARTEMIA FRANCISCANA
1. INTRODUCTION ...... 44
2. MATERIALS AND METHODS ...... 44
3. RESULTS AND DISCUSSION ...... 49
CHAPTER 4 BACILLUS SP. LT3 IMPROVES THE SURVIVAL OF GNOTOBIOTIC BRINE SHRIMP (ARTEMIA
FRANCISCANA) LARVAE CHALLENGED WITH VIBRIO CAMPBELLII BY ENHANCING THE INNATE
IMMUNE RESPONSE AND BY DECREASING THE ACTIVITY OF SHRIMP-ASSOCIATED VIBRIOS
1. INTRODUCTION ...... 57
2. MATERIALS AND METHODS ...... 58
3. RESULTS ...... 65
4. DISCUSSION ...... 72
PART III ARTEMIA-MICROBE INTERACTION ASSOCIATED WITH HEAT
SHOCK PROTEIN INDUCING COMPOUND
CHAPTER 5 EFFECT OF HEAT SHOCK PROTEIN INDUCER--TEX-OE® ON BRINE SHRIMP ARTEMIA
FRANCISCANA LARVAE UNDER SUB-OPTIMAL REARING CONDITION
1. INTRODUCTION ...... 81
2. MATERIALS AND METHOD ...... 83
3. RESULT ...... 88
4. DISCUSSION ...... 96
CHAPTER 6 A PLANT-BASED HEAT SHOCK PROTEIN INDUCING COMPOUND MODULATES
HOST-PATHOGEN INTERACTIONS BETWEEN ARTEMIA FRANCISCANA AND VIBRIO CAMPBELLII
1. INTRODUCTION ...... 105
2. MATERIALS AND METHODS ...... 107
3. RESULT ...... 112
4. DISCUSSION ...... 119
PART IV DISCUSSION AND CONCLUSION
CHAPTER 7 GENERAL DISCUSSION, CONCLUSION AND FUTURE PERSPECTIVES
1. INTRODUCTION AND MAJOR RESULTS ...... 125
2. PROBIOTICS ELICIT HOST IMMUNE RESPONSES ...... 127
3. FUTHER INVESTIGATION ON PROBIOTICS MODE OF ACTION ...... 133
4. SUMMARY ...... 138
5. POSSIBLE FUTURE WORK ...... 139
PART V APPENDIX
APPENDIX A SUPPLEMENTAL TABLES & FIGURES
TABLE: CADIDATES FOR HOUSEKEEPING GENE OF ARTEMIA FRANCISCANA ...... 147
FIGURE: LUMINAL AND RESIDENT GUT MICROBIAL COMMUNITY OF ARTEMIA AFTER THE PRETREATMENT OF HSPI
(TEX-OE®) ...... 148
APPENDIX B REFERENCES
REFERENCES ...... 149
APPENDIX C SUMMARY/SAMENVATTING
SUMMARY ...... 181
SAMENVATTING ...... 184
APPENDIX D CURRICULUM VITAE
CURRICULUM VITAE ...... 187
PART VI ACKNOWLEDGEMENT
ACKNOWLEDGEMENT ...... 191
LIST OF ABBREVIATIONS AND UNITS
°C Degree celsius
% Percentage
μg Microgram
μL Microlitre g Relative centrifugal force or G force
± Approximately
/ Per
β-glucan Beta-glucans
AID Activation-induced cytidine deaminase
ANOVA Analysis of variance
BFT Biofloc technology
C3 Complement component 3 cDNA Complementary deoxyribonucleic acid cfu Colony forming unit
DABCO 1,4-diazobicyclo-2.2.2-octane
DCs Dendritic cells
DNA Deoxyribonucleic acid
FAO Food and Agricultural Organization of the United Nations
i
FASW Filtered and autoclaved seawater
FTS Flow through system g Gram g/L Gram per liter
GART Gnotobiotic Artemia test system
GenBank Genetic sequence database of the National Institute of Health, USA
GF Germ free h Hour
Hsps Heat shock proteins
Hspi Heat shock protein inducer
IL1 Interleukin 1
ILCs Innate lymphoid cells iNKT Invariant natural killer T cells
L Litre
LAB Lactic Acid Bacteria
LB Luria-Bertani
LVS3 Bacterial strain isolated by Laurent Verschuere
ii
MA Marine agar 2216
MC Microbiota
MCC Microbiota composition
MCF Mucoid colony forming mRNA ribonucleic acid
MHC Major Histocompatibility Complex
NMCF Non-mucoid-colony forming
NK cells Natural killer cells
OD Optical density
P Statistical p-value
PCR Polymerase chain reaction
PD-1 Programmed cell death-1
PO Phenoloxidase proPO Prophenoloxidase
PSA Polysaccharide A
RAS Recirculating aquaculture system
RT-PCR Real time-polymerase chain reaction rpm Rotations per minute
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
iii
SFB Segmented filamentous bacteria
SPF Specific pathogen-free
TLR Toll like receptor
TNF Tumor necrosis factor
Th17 cells T helper cells 17
Treg Regulatory T cells
iv
PART I
INTRODUCTION AND LITERATURE REVIEW
CHAPTER 1
Introduction and thesis outline
Introduction and thesis outline
1. Introduction
World’s aquaculture status
The world population of 7.2 billion in mid-2013 is projected to increase by almost one billion people within the next twelve years, according to official United Nations population estimates. This drastic population expansion is placing higher pressure on the daily demand of food resources including the increasing demand for fish consumption. On the other hand, according to FAO statistics, the global consumption of fish has hit a record high, reaching an average of 17 kg per person in 2011 and is expected to reach 19.6 kg in 2021. However, globally, production from capture fisheries has leveled off at around 90 million tones since 2001 as most of the main fishing areas have reached their maximum potential. Sustaining fish supplies from capture fisheries will, therefore, not be able to meet the growing global demand for aquatic food. Capture fisheries is not likely to recover without effective and adequate conservation strategies.
In the course of half a century or so, aquaculture has expanded from being almost negligible to fully comparable with capture production in terms of feeding people in the world (Fig. 1-1). It is now believed that aquaculture has the potential to make a significant contribution to this increasing food demand and to provide safe and quality aquatic food. According to FAO data, in 2010, global production of farmed food fish was 59.9 million tonnes, up by 7.5 percent from 55.7 million tonnes in 2009 (32.4 million tonnes in 2000). Farmed food fish include finfishes, crustaceans, molluscs, amphibians (frogs), aquatic reptiles (except crocodiles) and other aquatic animals (such as sea cucumbers, sea urchins, sea squirts and jellyfishes) that are indicated as fish throughout this document. The reported grow-out production from aquaculture is almost entirely destined for human consumption. In the last three decades (1980–2010), world food fish production of aquaculture has expanded by almost 12 times, with an average annual rate of 8.8 percent. Aquaculture enjoyed high average annual growth
1 Chapter 1 rates of 10.8 percent and 9.5 percent in the 1980s and 1990s, respectively, but has since slowed down to an annual average of 6.3 percent. In addition to total production, the diversity of aquaculture species has also increased. According to FAO, the number of species in aquaculture production statistics increased to 541 species and species groups in 2010, including 327 finfishes (5 hybrids), 102 molluscs, 62 crustaceans, 6 amphibians and reptiles, 9 aquatic invertebrates and 35 algae (Fig. 1-2).
Figure. 1-1. Trends in world aquaculture and capture production (million tonnes) Source: (FAO, 2012).
2 Introduction and thesis outline
Figure. 1-2. Production of major species or species group from aquaculture in 2010 (FAO, 2012).
Although aquaculture is one of the fastest growing food producing industries,
3 Chapter 1 according to FAO projections, it is estimated that in order to maintain the current level of per capita consumption, global aquaculture production will need to reach 80 million tons by 2050. To achieve this goal, stable or even accelerating development of aquaculture is required. This will need to be accomplished through further intensification and commercialization of the current aquaculture facilities
(Bondad-Reantaso et al., 2005). On the other hand, in the progress of intensification of aquaculture, a deteriorating culturing environment within aquaculture systems often leads to frequent diseases outbreak which cause mass mortalities and economic loss.
Meanwhile, when controlling the occurrence of disease, the misuse of antibiotics and chemotherapeutic compounds in aquaculture practice has led to pollution within the aquacultural system and in the environment. This pollution has become a primary constrain to the further development of the aquaculture industry. The increased incidence of disease occurrence and/or outbreaks due to the deteriorating culturing environment within the aquaculture systems and unsustainable practices used for disease control have become one of the obstacles for the development of the aquaculture industry.
Disease and disease control strategies in aquaculture
Disease in aquaculture
The fast development of aquaculture industry by e.g. intensification and expansion has rendered most aquaculture ecological systems fragile (Piedrahita, 2003).
Intensification of aquaculture systems will often lead to insufficient oxygen supply, accumulation of metabolic waste, injury and wounding due to high culture density, and expose the aquatic animals to long term stressors that can significantly affect the health of the cultured animal (Ashley, 2007). Aquatic animals subjected to stressors are reported to show decreased growth performance, reduced immune response and increased susceptibility to diseases (Iguchi et al., 2003).
Disease outbreaks in various parts of the world have brought tremendous
4 Introduction and thesis outline economic loss to aquaculture industry. According to FAO, disease outbreaks in recent years have affected farmed Atlantic salmon in Chile, oysters in Europe, and marine shrimp farming in several countries in Asia, South America and Africa, resulting in partial or sometimes total loss of production. In 2010, aquaculture in China suffered production losses of 1.7 million tonnes caused by natural disasters, diseases and pollution. Disease outbreaks, such as white spot syndrome virus (WSSV), virtually wiped out marine shrimp farming production in Mozambique in 2011 (FAO, 2012) .
Disease in aquaculture occurs in all fish and shrimp life stages during culture, resulting from the proliferation of pathogenic and opportunistic microorganisms. Fish and shrimp can be affected by various pathogens including protozoa, fungi, and viruses
(Lightner and Redman, 1998). However, bacteria belonging to the Vibrio spp. (such as
V. campbellii, V. harveyi, V. parahaemolyticus, V. alginolyticus, V. anguillarum, V. vulnificus, etc.) are widely accepted to be the most serious pathogens, causing massive mortalities of cultured aquatic animals worldwide (Toranzo et al., 2005; Austin and
Zhang, 2006). In many cases, vibrios are opportunists, only causing disease when the host organism is immune suppressed or otherwise subjected to physiological stressors
(Peddie, 2005). Although vibriosis is reported in various kinds of farmed animals
(Table. 1-1), the most serious problems have been reported in penaeid shrimp culture.
In recent years, a new disease named early mortality syndrome (EMS), first reported in
2009, has led to serious production loss in the affected area including south China,
Vietnam, Malaysia and Thailand (Tran et al., 2013). A more descriptive name for the acute phase of the disease was proposed as acute hepatopancreatic necrosis syndrome
(AHPNS). According to the study of Tran et al. (2013), the AHPNS has a bacterial etiology and pathogenic isolates have been identified as members of the Vibrio harveyi clade, most closely related to V. parahaemolyticus.
In the traditional disease control concept, it was suggested that minimizing possible pathogenic bacteria (by using antibiotics for example) in the culture environment would provide safer living condition for the aquatic animal. However, in
5 Chapter 1 some area where insufficient guidance on the use of antibiotics was implemented, the massive and / or excessive prophylactic use of antibiotics may compromise the efficacy of antibiotic treatments (Karunasagar et al., 1994; Akinbowale et al., 2006). Moreover, in some cases, antibiotic resistance can be horizontally transferred to other bacteria, thus, jeopardizing the surrounding environment (Cabello, 2006). On the other hand, it should be noted that disease-causing microorganisms are ubiquitous in the natural environment and that the co-existence of host and pathogens is often observed with no or little adverse effect towards the host (Olafsen, 2001); while disease incidence is often higher in intensive aquaculture system (Iguchi et al., 2003). This is attributed to deteriorative water quality leading to an impaired health and weakened immune response of the host. On the other hand, the high contact rate in an intensive aquaculture system will also lead to faster spread of the diseases.
6 Introduction and thesis outline
Table. 1-1. Vibriosis caused by different Vibrio spp. in aquaculture organisms *(Baruah, 2012).
Causative organism Host organisms Disease characteristics References V. campbellii Fish Cobia (Rachycentron canadum) Gastroenteritis and mass mortality Liu et al. (2004) / V. harveyi Grouper (Epinephelus coiodes) Gastroenteritis and mass mortality Lee et al. (2002) Red drum (Scaienops ocellatus) Gastroenteritis and mass mortality Liu et al. (2003) Salmonids Up to 100% mortality Zhang and Austin (2000) Sea horse (Hippocampus sp.) Hemorrhages with > 90% Alcaide et al. (2001) Summer flounder (Paralichthys dentatus) Necrotizing enteritis Soffientino et al. (1999) Grouper (Epinephelus awoara) Acute mortalities Qin et al. (2006) Brown spotted grouper (Epinephelus tauvina) Mortalities Saeed (1995) Milkfish (Chanos chanos) Eye disease Ishimaru and Muroga (1997) Opaque white corneas Kraxberger-Beatty et al. (1990) Common snook (Centropomus undecimalis) Zorrilla et al. (2003) Sole (Solea senegalensis) Moderate mortalities Molluscs European abalone (Haliotis tuberculata) Up to 80% mortality Nicolas et al. (2002) Japanese abalone (Sulculus diversicolor) Mass mortality Nishimori et al. (1998) Pearl oyster (Pinctada maxima) Mass mortality Pass et al. (1987) Crustacean Brine shrimp (Artemia franciscana) Between 45 and 80% mortality Soto-Rodriguez et al. (2003) Kuruma prawn (Penaeus japonicas) High mortality Liu et al. (1996) Ridgeback prawn (Sicyonia ingentis) Detachment of mid gut epithelium Martin et al. (2004) resulting in up to 55% mortality Rock lobster (Jasus verreauxi) Up to 75% mortality Diggles et al. (2000) Tiger shrimp (Penaeus monodon) Mass mortality Karunasagar et al. (1994) White shrimp (Litopenaeus vannamei) Up to 85% mortality in nauplii Aguirre-Guzman et al. (2004) Marine shrimp (Penaeus merguiensis) 70-100% mortality Sae-Oui et al. (1987)
7 Chapter 1
V. Fish Iberian tooth carp (Aphanius iberus), External haemorrhage, tail rot and high mortality Alcaide et al. (1999) parahaemolyticus amberjack (Seriola dumerili) and eel (Anguilla anguilla) Molluse Japanese abalone (Heliostis diversicolor) Mass mortality Lee et al. (2001) Crustaceans L. vanamei Gill necrosis, lethargy and significant mortality Black coloration on the carapace, red discoloration Freshwater prawn of the exoskeleton, loss of appendages within 6 days (Macrobrachium rosenbergii) and 80% mortality Mass mortality
P. monodon V. alginolyticus Fish Gilthead seabream (Sparus aurata) and sea Significantly mortality Kahla-Nakbi et al. (2006) bass (Dicentrarchus labrax) Silver sea bream (Sparas sarba) Mortality (10-60%) Li et al. (1999) Molluscs Red abalone (Haliotis rufescens) High mortalities Cai et al. (2006) Japanese abalone (Heliostis diversicolor) Mass mortality with ulcers in the mantle Liu et al. (2001) Mass mortality Carpet shell calms (Ruditapes decussates) Gomez-Leon et al.(2005) Crustaceans M. rosenbergii Mortalities of 80-100% Jayaprakash et al. (2006) P. monodon and P. japonicus Mass mortality Lee et al. (1996a, b) V. Fish Coho salmon (Oncorhynchus kisutch) Mortalities of 80-100% Jia et al. (2000) anguillarum Atlantic halibut (Hippoglossus hippoglossus) Significant mortality Bowdena et al. (2002) Rainbow trout (Oncorhynchus mykiss) Penetration through skin, biofilm formation Croxatto et al. (2007) Significant mortality
8 Introduction and thesis outline
Sea bass (Dicentrarchus labrax) Mortalities of 60-100% Dierckens et al. (2008) Atlantic cod (Gadus morhua) Engelsen et al. (2008), Septicaemia and high mortality Knappskog et al. (1993) Turbot (Scophthalmus maximus) Grisez et al. (1996), Olsson et al. (1998) Molluscs Peruvian scallop (Argopecten purpuratus) High mortality (about 70%) Riquelme et al. (1995) Blue mussel (Mytilus galloprovincialis) Induce oxidative stress Canesi et al. (2010) Crustaceans Brine Shrimp (Artemia franciscana) Significant mortality Defoirdt et al. (2005) Marine shrimp (Penaeus stylirostris) Stress related mortality Katzen et al. (1984) Tiger prawn (Penaeus monodon) Immune suppression
*Only selected Vibrio species causing diseases in commercially important aquaculture organisms are listed. Beside these, other strains of Vibrio may also cause Vibriosis in aquaculture organisms. Many Vibrio spp. are also zoonotic. They cause diseases in human, and are the common causes of mortality among terrestrial life. For instance, the increasing incidence of infection such as skin infection, conjunctivitis, ear infection by V. alginolyticus in humans has been linked to exposure to seawater and/or feeding of uncooked seafoods (Schmidt et al., 1979). In addition, in humans, V. vulnificus infection is the most common fish-derived Vibrio infection, and the major route of exposure has been reported to be through puncture wounds and ingestion (Lehane and Rawlin, 2000). Clinical signs of such infections in humans are necrotizing fasciitis, edema, and swelling in the immediate area of the puncture wound (Tang et al., 2006). Septicemia after ingestion of V. vulnificus (typically in shellfish) results in death in 50% to 60% of clinically affected humans (Oliver, 2005).
9 Chapter 1
Disease control strategies
‘The aquatic environment is more supportive to pathogenic bacteria independently of their host than the terrestrial environment and consequently, pathogens can reach high densities around the animals and invade the host by various routes, such as through attachment to the exterior skin, the digestive tract, gills and through the wounds due to physical trauma (Defoirdt et al., 2011). Therefore, aquaculture animals suffer more from highly unexpected mortality attributed to bacterial disease or detrimental host-microbe interaction (Attramadal et al., 2012d). To cope with the disease outbreak and minimize its impact on the aquaculture production and economic loss, preventive and curative strategies against diseases have been explored and applied. The health of aquaculture animals are affected by various abiotic and biotic factors from 3 major levels: 1) the culture environment (water) where the animals live; 2) the health status of the animals (under stress or not, immunity status); 3) the microbiota both resident in the culture environment and in the animal (gastrointestinal tract). Strategies aiming at disease control have been developed for each of these levels.
1）Disease control in the culture environment level— the ‘clean water strategy’
Unlike terrestrial animals, aquatic animals live in water and the constant contact with (pathogenic) bacteria is inevitable. As mentioned above, bacterial diseases have brought disastrous losses to the aquaculture industry, thus various ‘cleaning strategies’ (water disinfection by UV, ozonation and antibiotics) have been explored in order to minimize the microorganisms in the water and to provide a ‘clean’ environment for the animals.
Antibiotic application is, among those strategies, the most popular and intensive studied approach to cope with bacterial diseases. In the past decades, antibiotics have been widely applied to control the bacterial load in order to prevent diseases. According to an early report by Holmström and colleagues in Thailand, the majority of fish farmers being interviewed (56 in 76) used antibiotics. More than 10 different antibiotics were used, and most of the farmers used the antibiotics prophylactically, some on a
10 Introduction and thesis outline daily basis. (Holmström et al., 2003). In Table. 1-2, an overview is given on the major classes of antibiotics used in aquaculture (Defoirdt et al., 2011). Although the overall use of antibiotic in animal production is decreasing, according to the recent report of WHO (2014), the use of antibiotics for disease prevention and as growth promoter in the sector of animal production, including aquaculture, are still significant. In some countries, the total amount of antibiotics used in animal production has exceeded the quantity used in the treatments of diseases in human. Despite the large efforts made for the surveillance of the use of antibiotics all over the world, systematic data in the field of aquaculture in some countries are still limited (WHO, 2014). In general, as mentioned in the same report, most developed countries including the the European Union (EU) have well-established national and international surveillance systems for antibiotic use, whereas in other developing area such as southeast Asia, systematic efforts to obtain such data are still undertaken. Although available evidences suggest that now the amount of antimicrobials used in aquaculture in most developed countries is limited, large quantities of antimicrobials are still used for prophylactic purposes in aquaculture, often in countries with insufficient regulations and limited enforcement for the authorization of antimicrobial agents (Buschmann et al., 2012; FWO, 2006).
Indeed, the use of antibiotics initially brought great success in controlling bacterial diseases, however, the wide prophylactic use of antibiotics in aquaculture in the past has resulted in antibiotic resistant pathogens. Karunasagar et al (1994), for instance, reported mass mortality in Penaeus monodon larvae caused by Vibrio harveyi strains with multiple resistance to cotrimoxazole, chloramphenicol, erythromycin and streptomycin. As a consequence, antibiotic treatments, in some cases, are less effective due to the antibiotic resistance bacteria. Moreover, the use of antibiotics might raise biosafety issues, as the resistance genes have been found located on transferable plasmids and integrons in pathogenic bacteria (Moriarty, 1999). These resistance determinants can be horizontally transferred to other antibiotic-sensitive bacteria not only in the aquatic environment but even to bacteria from the terrestrial environment (FWO, 2006; Cabello et al., 2013). In addition, the application of broad disinfection
11 Chapter 1 strategies targets not only the pathogenic bacteria but also destroys the beneficial microbes. Thus, for more effective treatment of bacterial disease and the sustainable development of aquaculture, there is an urgent need for alternatives to antibiotics in aquaculture.
12 Introduction and thesis outline
Table. 1-2. The different classes of antibiotics used in aquaculture, their importance for human medicine and examples of (multi) resistant pathogenic bacteria isolated from aquaculture settings (Bondad-Reantaso et al., 2005). Importance for Multipleb Drug classes Example Resistant bacteria Isolated from Reference human medicinea resistance? Aminoglycosides Critically Streptomycin Edwardsiella ictulari yes Diseased striped catfish (Dung et al., 2008) importan (Pangasianodon hypophthalmus), Vietnam Amphenicols Important Florfenicol Enterobacter spp. Yes Freshwater salmon farms, Chile (Fernández‐ and Alarcón et al., Pseudomonas spp. 2010) Beta-lactams Critically Amoxicillin Vibrio spp., Yes Different aquaculture settings, (Akinbowale et al., important Aeromonas spp. Australia 2006) and Edwardsiella tarda Beta-lactams Critically Ampicillin Vibrio harveyi Yes Shrimp farms and coastal waters, (Teo et al., 2000) important Indonesia Fluoroquinolones Critically Enrofloxacin Tenacibaculum Yes Diseased turbot (Scophthalmus (Avendaño-Herrera important maritimum maximus) and sole (Solea et al., 2008) senegalensis), Spain and Portugal Macrolides Critically Erythromycin Salmonella spp Yes Marketed fish, China (Broughton and important Walker, 2009) Nitrofurans Critically Furazolidone Vibrio anguillarum Yes Diseased sea bass and sea bream, (Smith and important Greece Christofilogiannis, 2007) Nitrofurans Important Nitrofurantoin Vibrio harveyi Yes Diseased penaeid shrimp, Taiwan (Liu et al., 1996)
13 Chapter 1
Quinolones Critically Oxolinic acid Aeromonas spp., Yes Pond water, pond sediment and tiger (Tendencia and de important Pseudomonas spp. shrimp (Penaeus monodon), la Peña, 2001) and Vibrio spp. Philippines Sulphonamides Important Sulphadiazine Aeromonas spp. Yes Diseased katla (Catla catla), mrigel (Das et al., 2009) (Cirrhinus mrigala) and punti (Puntius spp.), India Tetracyclines Highly important Tetracycline Aeromonas Yes Water from mullet and tilapia farms, (Ishida et al., 2010) Hydrophila Egypt Tetracyclines Highly important Oxytetracycline Aeromonas Yes Atlantic salmon (Salmo salar) (McIntosh et al., Salmonicida culture facilities, Canada 2008b) a On the basis of World Health Organisation Expert Consultations on ‘Critically Important Antimicrobials for Human Medicine’(Heuer et al., 2009) bResistance to antibiotics belonging to different classes in at least one of the isolates.
14 Introduction and thesis outline
2）Disease control at the host level— Enhancement of the host health status and disease resistance
In intensive aquaculture environments, aquatic animals are usually subjected to many stressors and rendering them more ‘susceptible’ to infection by pathogens (Ashley, 2007). In most cases, minimizing the amount of pathogens without disturbing the normal microbiota is not possible. Thus, treatments focusing on the aquaculture animals, aiming at increasing their resistance for pathogens are another effective approach. An enhanced resistance can be achieved by stimulation of the non-specific or innate immune system and/or by triggering the specific immune response.
Immunostimulants have been widely applied to obtaining a higher innate immune response of the aquatic host. An immunostimulant is a naturally occurring compound that modulates the immune system by increasing the host’s non-specific resistance against diseases that in the most circumstances are caused by pathogens (Bricknell and Dalmo, 2005). In aquaculture, different kinds of dietary supplementation of immunostimulants have been investigated, for example, beta-glucans (Lin et al., 2011), dietary nucleotides (Nicolas et al., 2007), yeast (Sarlin and Philip, 2011), bacterial cell wall components (Skalli et al., 2013) and heat shock proteins (Baruah et al., 2011). Promising results with immunostimulants have been widely reported, however, there are still concerns related to possible immune-suppression and the detrimental impact on the development of the immune system by the administration of immunostimulants (Bricknell and Dalmo, 2005).
Vaccines against bacterial diseases in aquaculture have also been investigated and applied. Vaccination provides a specific antigen and thus triggers the specific immune system to protect animals against infections at a later stage (Sakai, 1999). Although many studies on vaccination in aquaculture have been carried out, a limited amount of vaccines for use in aquaculture is commercially available. As the immune system of crustaceans and fish larvae is limited to the non-specific immune system, these animals cannot be vaccinated to show specific protection at some later stage. Several recent
15 Chapter 1 reports, using mainly insect or crustacean models, have suggested that the invertebrate innate immune system may be capable of some form of immune memory, described as ‘immune priming’ (Moret, 2006) or ‘line specific immune memory’ (Kurtz and Franz, 2003). More studies focussing on these ‘priming mechanisms’ are needed to profit from this capability in aquaculture invertebrates and in fish larvae production.
Molecular chaperones or heat shock proteins (Hsp), have cytoprotective functions. These functions include the folding of nascent polypeptides, assembly/disassembly of multi-subunit oligomers, translocation of proteins across intracellular membranes, process of endocytosis, regulation of apoptosis and cytoskeletal organization (Schmitt et al., 2007). Hsp70 is induced by environmental stressors to repair partially denatured proteins, facilitate the degradation of irreversibly denatured proteins and inhibit protein aggregation, thus to protect cells from harmful environmental stresses (Parsell and Lindquist, 1993). In addition, Hsp70 facilitates immune responses against many diseases as demonstrated in a wide variety of experimental models in vitro and in vivo (Tsan and Gao, 2009; Joly et al., 2010). It has also been reported that feeding the brine shrimp larvae with eukaryotic or prokaryotic Hsp70 is stimulating the innate immune response (such as prophenoloxidase) providing subsequent protection against a challenge by a pathogen (Baruah et al., 2011). These findings suggest that Hsp70 has a potential prophylactic modality for controlling bacterial diseases in animals.
The elicitation of Hsp70 overexpression and transfection of Hsp genes has been largely studied as a potential disease control and management strategy in aquaculture (Sung et al., 2007; Roberts et al., 2010; Baruah et al., 2012). Recently, some compounds have been reported to induce Hsps within the host (Ohtsuka et al., 2005; Sõti et al., 2005; Westerheide and Morimoto, 2005). Among those compounds, Tex-OE®, a patented extract from the skin of the prickly pear fruit, Opuntia ficus indica, has been reported to enhance the expression of Hsp70 in animal tissues without any adverse effect. This extract was originally developed as a stress/fatigue modulating compound for divers working in seaweed aquaculture in Malta (Guttierez et al., 2005).
16 Introduction and thesis outline
Later studies showed that pre-exposure to Tex-OE® can rapidly stimulate the production of Hsps and the Hsps levels induced were also higher than those in unexposed animals (Balucci, 2005). Recent studies have demonstrated that the products can protect animals against various abiotic stressors including lethal temperature, hypersalinity, ammonia toxicity and transportation stress (Roberts et al., 2010; Baruah et al., 2012; Sung et al., 2012). Although limited information is available on the constitution of Tex-OE®, several studies have been performed to investigate the nutritional content of the plant, Opuntia ficus indica, discussing the putative active compound responsible for its pharmatheutical application (Kaur et. al., 2012; Feugang et. al., 2006).
Although, the application of heat shock proteins and their inducers has shown potentiality in disease control, the exact action mode needs to be thoroughly understood and the potential interaction with the microbes in the environment needs to be further investigated.
3）Disease control at the microbial level
Distinct from terrestrial animals, aquatic hosts are in contact with a high quantity and diversity of microbes. A close and continuous host-microbe interaction stands in every aquaculture environment. However, this interaction is still far from understood (Olafsen, 2001). Various strategies have been investigated to manipulate the micro-organisms in the aquaculture environment. Some of those strategies are proposed to minimize the load of pathogens in the environment, such as the application of antibiotics as described above; some strategies aim at interfering with the virulence system of the pathogens, such as quorum sensing (Pande et al, 2013); other strategies focus on utilizing the beneficial effect of the microbes (Daniels et al, 2013).
Antibiotic application is a traditional approach in bacterial disease control. As mentioned above, the application of antibiotics initially brought great help in bacterial disease control. However, the emergence of antibiotic resistant bacteria has made this traditional approach ineffective and has brought potential risk to the surrounding
17 Chapter 1 environment. Moreover, due to its broad-spectrum effect, not only the pathogenic bacteria were killed, but also the normal microbiota associated with the animal is put under pressure. The disruption of intestinal microbiota homeostasis which leads to enhanced susceptibility to infection has been reported (Ivanov and Honda, 2012) .
Quorum sensing disruption is a novel strategy in combating bacterial disease . Quorum sensing (QS), bacterial cell-to-cell communication, is a gene regulation mechanism by which bacteria co-ordinate the expression of certain genes in response to the presence of small signal molecules, such as acylated homoserine lactones (AHL) (Natrah et al., 2011; Pande et. al., 2013; Defoirtd et al., 2006). In most pathogenic bacteria containing a quorum sensing system, quorum sensing has been found to regulate virulence gene expression and consequently, considerable research effort these days is directed towards the development of quorum sensing-disrupting techniques.
The QS system may be inactivated by inhibiting signaling molecule synthesis, blocking the QS response regulators without activating them, or by inactivation/degradation of the signaling molecules, resulting in decreased virulence of aquaculture pathogens (Defoirdt et al., 2004). Marine algae and marine bacteria have been reported to show QS disruption effect (Rasch et al., 2004; Teasdale et al., 2009). Although many results suggest QS disruption to be a promising disease control strategies, so far, the studies have been limited to laboratory experiments under controlled conditions like the ones described by Defoirdt et al. (2006). More (and especially field) studies on quorum sensing disruption will be needed to promote its application in aquaculture.
Applications of probiotics are currently a popular technique to manipulate the microbiota associated with the gastro-intestinal tract of the host. Major efforts have been put into the isolation of beneficial bacteria from the aquaculture system (Balcázar et al., 2006; Cerezuela et al., 2011; Dimitroglou et al., 2011). The use of probiotics or beneficial bacteria, which control pathogens through a variety of mechanisms, is increasingly viewed as an alternative to antibiotic treatment. Verschuere et al. (2000) suggested the definition for probiotics ‘a live microbial adjunct which has a beneficial 18 Introduction and thesis outline effect on the host by modifying the host-associated or ambient microbial community, by ensuring improved use of the feed or enhancing its nutritional value, by enhancing the host response towards disease, or by improving the quality of its ambient environment’.
There are many reports on the beneficial effect of probiotics from both Gram-negative and Gram-positive bacteria in aquaculture production. Brunt and Austin (2005) showed that the incorporation of the Aeromonas sobria strain GC2 with the feed at 5 × 107 cells g−1 could protect rainbow trout against the challenge by Lactococcus garvieae and Streptococcus iniae. In the work of Granados-Amores et al. (2012), the combination of P. aeruginosa and B. cepacia beneficially influenced the growth and survival of Lions-pay scallop, N. subnodosus, spat. Planas et al. (2006) reported that Roseobacter 27-4 could controlled V. anguillarum infection in turbot, Scophthalmus maximus L., larvae. As for Gram-positive bacteria, Bacillus. sp are among the most studied and reported probiotics. There has been considerable success with the use of endospore forming members of Bacillus either as feed additives or for improving the water quality (Hong et al., 2005; Newaj‐Fyzul et al., 2007; Bagheri et al., 2008). Bandyopadhyay and Mohapatra (2009) reported on the immunostimulatory effect of Bacillus circulans PB7, helping against A. hydrophila infection. Zokaeifar et al. (2012) reported enhancement of growth performance, digestive enzymes production and release, immune gene expression and increased disease resistance of white shrimp, Litopenaeus vannamei by using live preparations of Bacillus subtilis. Similarly, two strains of B. subtilis were reported to improve growth, digestive enzyme activity, resistance to V. harveyi and up-regulation of immune gene expression when fed in equal proportions to juvenile white shrimp for 8-weeks at 108 cells g−1 of feed (Zokaeifar et al., 2012). In addition, Salinas et al. (2005) reported that B. subtilis can be used as a probiotic for gilthead sea bream, S. aurata larvae.
Although the beneficial effect and successful application of probiotics have been intensively documented, the exact mode of action of those microbes is still not well understood. Many studies have suggested different modes of action of probiotics in the
19 Chapter 1 aquatic host, including adhesion sites competition, particularly in the gastro-intestinal tract (Lazado et al., 2011; Korkea‐aho et al., 2012), ability to antagonize pathogens (Sun et al., 2010; Luis-Villaseñor et al., 2011), improving the digestibility of feed (Wang, 2007; Ten Doeschate and Coyne, 2008), improving host health status by providing essential nutrients, e.g. fatty acids (Vine et al., 2006), vitamin B12 (Irianto and Austin, 2002), and stimulation of the immune response (Kim and Austin, 2006; Tseng et al., 2009; Pai et al., 2010).
Large number of studies have suggested great potential of probiotics in aquaculture, however, many questions remain unanswered. Just to name a few, e.g. how can probiotics survive in the aquatic environment under the unscrupulous competition from other microbes; how can probiotics persist in the intestinal tract of the aquatic host; what is the exact mechanism of the beneficial effect towards the host? There are even concerns that the probiotics from gram-negative bacteria could acquire virulence genes from pathogens by horizontal transfer.
Prebiotics are defined as ‘non-digestible food ingredients that beneficially affect the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon’(Gibson et al., 2004). Nowadays, the majority of prebiotics sold in the market are non-digestible oligosaccharides. Inulin, fructo-oligosaccharides (FOS), galacto-oligosaccharides (GOS), lactulose and polydextrose are recognized as well-established prebiotics, whereas isomaltooligosaccharides (IMO), xylooligosaccahrides (XOS), and lactitol are categorized as emerging prebiotics (Sabater-Molina et al., 2009; Xu et al., 2009; Femia et al., 2010). Current research on prebiotics has demonstrated their diverse health implications. The beneficial effects being reported include gut health maintenance, colitis prevention, cancer inhibition, immune-potentiation, cholesterol removal, reduction of cardiovascular disease, prevention of obesity and constipation, restoration of vaginal ecosystem, bacteriocin production. (Patel and Goyal, 2012). The success of prebiotics in aquaculture animals has also been reported, e.g. Yilmaz et al. (2007) reported the enhanced growth performance and increased villi length of rainbow trout by dietary supplementation of
20 Introduction and thesis outline mannan oligosaccharides (MOS), Li and Gatlin III (2004) reported the enhanced immune response of hybrid striped bass to Streptococcus iniae infection; in addition, prebiotics application are also observed to modulate the intestinal microbiota for example by stimulating the growth of some well-known beneficial microbes like Lactic Acid Bacteria ( LAB ) (Ringø et al., 2010; Dimitroglou et al., 2011). Although reports on the beneficial effect of prebiotics application exist, the underlying action mode is still waiting to be fully decoded.
In summary, comparing to terrestrial animals, higher amount of microbes exist in the aquatic environment and continuously interact with the aquatic animals. As shown in Fig. 1-3, three major compartments, the farmed animal, the microbes and the environment, comprise the aquaculture system. It is anticipated that a comprehensive and reciprocal interaction stands among each compartment. As described above, novel strategies such as heat-shock protein induction, immunostimulants, QS, probiotics and prebiotics, have been explored and applied for disease control in aquaculture. Those strategies target either directly the host (heat-shock protein induction or immunostimulants) or the microbes associated with the host (probiotics). However, knowledge on the detailed impacts of those treatments on either the host or microbes is limited. In early studies performed under conventional rearing conditions, it was difficult to investigate these effects precisely, due to the interference of natural microbiota in the system.
In this thesis, we try to study such interactions by the use of a gnotobiotic brine shrimp larva model system. In general, we further investigated the direct impact of probiotic administration and heat shock induction on both the aquatic animal and the microbes associated with the animal (Fig. 1-3). For example: what is the direct link between probiotics and the host; how can probiotics interact with the microbes including pathogens associated with the host; can a treatment of the host, such as heat-shock protein induction, affect the intestinal microbes and/or the microbes in the culture environment?
21 Chapter 1
Figure. 1-3. Host-microbe interactions in the aquaculture system. Aquaculture practices targeting accidently or purposely at any compartment of the system may trigger a comprehensive and reciprocal effect among each compartment in the system, as indicated by the double arrows between the 3 compartments. In different chapters of the PhD thesis, we used a gnotobiotic Artemia model system to demonstrate the specific effects of biotreatments. For example, in chapter 4 we demonstrated the direct effect of probiotics on the host and on the microbes; in chapter 5 and 6, we studied the direct effect of HSPs induction on the gut microbiota, environmental microbes and the gene expression of the host.
22 Introduction and thesis outline
2. Thesis outline
Overall aim
Using a gnotobiotic brine shrimp larvae system to gain more knowledge on the interactions among each compartment, as illustrated by Fig. 1-3, of an aquaculture system.
Specific aims
To study the direct impact of bio-treatments, such as probiotic administration and heat shock induction, on both the brine shrimp larvae and the microbes associated with the larvae.
In order to accomplish these specific aims the thesis is divided in several chapters.
Chapter 2 (Literature overview) gives an overview of the current knowledge on the function of the intestinal microbial community of the animals, particularly, the interaction between commensal bacteria and the immune response of the host. This chapter also discusses the possibilities to manipulate the microbiota within the aquaculture system potentially benefiting the health of the animal.
In the study of host-microbe interactions, the resident bacteria are considered prime contributors to long-lasting effects. Resident bacteria are persistently present in the gut, whereas transient bacteria do not form a stable population. However, separating or specifically targeting resident bacteria is not always easy. As in Chapter 3 (A method for the specific detection of resident bacteria in brine shrimp larvae), we present a simple and efficient protocol for detecting brine shrimp larvae Artemia franciscana gut resident bacteria, alleviating the interference of exterior and gut transient bacteria during DGGE analysis.
As in Chapter 4 (Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged with Vibrio campbellii by enhancing the innate immune response and by decreasing the activity of shrimp-associated Vibrios), a Bacillus sp. LT3 was used to investigate the direct
23 Chapter 1
impact of probiotics on the immune response of the aquatic animals by using gnotobiotic brine shrimp larvae as a model. The method as developed in chapter 3 was applied to study the outcome of Vibrio-Bacillus co-exposure protocols on microbial interactions and host microbial interaction in the gastrointestinal tract of the larvae.
As in Chapter 5 (The effect of a novel heat shock protein inducing compound, Tex-OE®, on brine shrimp Artemia reared under sub-optimal rearing conditions), Tex-OE®, was used as a model to investigate the interaction of immunostimulants and the immune response of the aquatic animals by using gnotobiotic brine shrimp larvae as a model. The protective effect of this compound was investigated in the conventional system as an extension of the earlier study. The impact of Tex-OE® on the innate immune response was investigated. As discussed in chapter 2, the application of immunostimulants may influence the colonization of bacteria and formation of the endogenous microbiota. Thus, the method as developed in chapter 3 was applied to study the steering effect of Tex-OE® on the intestinal microbiota.
Chapter 6 (A plant-based heat shock protein inducing compound modulates host-pathogen interactions between Artemia franciscana and Vibrio campbellii) is an extension of last chapter to study the interaction of immunostimulants and the bacteria, pathogens in particular, in the aquaculture system. As in most studies of immunostimulants, the immune response and host tolerance are the primary concerns. The impacts of immunostimulants on the bacteria in the surrounding environment were often overlooked and the possible impacts on the pathogen behavior are even rarely reported. Thus, in this chapter, we investigated the effect of Tex-OE® administration on the growth, Hsp70 production, virulence factor of bacteria in the culture system.
In Chapter 7, we summarize the overall findings obtained in this thesis. Conclusions are drawn and possibilities for future research are proposed.
24
CHAPTER 2
Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction
Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction
1. Introduction
The development of aquaculture, especially the sector of larvae production, is severely hampered by the frequent occurrence of bacterial disease causing losses totaling hundreds of millions of dollars per year (FAO, 2012). Traditionally, the application of antibiotics has brought great success in the control of bacterial diseases outbreaks in aquaculture. However now, prophylactic use of antibiotics in the aquaculture production is under severe scientific and public scrutiny because their use has been linked to the development of antibiotic-resistant pathogenic bacteria, which pose a great threat to human health and surrounding environments (Smith et al., 2003; Hoa et al., 2011). As a consequence, considerable efforts have been put into investigating alternatives for antibiotics to control bacterial disease in general and in aquaculture more specifically.
Recently, steering of microbial community composition (MCC) in the rearing environment, especially the MC associated with the aquatic animal has been investigated as a mean of reducing the presence of opportunistic pathogens, potentially bringing beneficial effects towards the animals. The gastro-intestinal (GI) tract is considered the most important and intimate site of host-microbe interaction and is also the major portal of entry for endogenous microbiota (for instance for new-born larvae) and for pathogen invasion (Elbal et al., 2004; Ninawe and Selvin, 2009). Recent studies have given us a deeper understanding of the importance of endogenous microbiota in mediating immunological development and functionality, particularly at the mucosal interface within the gastrointestinal tract (GI tract) (Ivanov and Honda, 2012; Gomez et al., 2013). In this respect, steering MCC within the GI tract of the aquatic host has received great attention, including the application of probiotics and prebiotics as dietary additives (Picchietti et al., 2007; Aly et al., 2008; Denev et al., 2009; Zhang et al., 2009). However, most of the studies mainly focused either on antagonistic strategies towards pathogens or the growth improvement and/or immune modulation on the aquatic host. A limited number of studies described the impact of probiotic or
25 Chapter 2 prebiotic administration on the GI MC and the interaction between the modulated MC of the host. In this review, we present a brief overview of the current knowledge on the MC associated with the gastro-intestinal tract and how the MC interacts with the immune system of the host. The possible impact of the current steering strategies for MCC of the GI tract and its perspective as therapeutic tool in aquaculture are discussed.
Approaches to study microbial community composition (MCC)
Investigations into the possibility to manipulate MCC in the aquaculture environment or in the host are becoming more prominent. Although beneficial effects of MCC modulations towards the host have been observed, limited information on the steering effect towards the MCC in the environment or associated with the host was provided. Indeed, the primary concern of the scientists and/or fish farmers has stayed with the health status of the aquaculture animals and accordingly, less attention has been paid to the MCC in the environment or associated with the animal. On the other hand, the limited knowledge on host-microbe interaction and on host associated MC can partially be attributed to the lack of effective tools to study the MCC.
Historically, our understanding of the endogenous microbiota was limited by reliance on culture-based methods. The traditional culture dependent techniques for enumeration are time consuming and less than 1% of the total microbial community can be cultivated furthermore it is not feasible to assess species richness merely based on colony morphology (Hovda et al., 2007; Navarrete et al., 2010) Fjellheim et al. (2012) studied the diversity of the microbiota in 15 Atlantic cod (Gadus morhua L.) larvae from three different hatcheries with variable food type and water treatment by using both culture dependent and independent approaches. In their study, considerably higher richness and diversity was observed with culture independent approach (T-RFLP) than with culture dependent approach (phenotypic characterization). To further study the structure and abundance of bacterial populations in the host and to gain more insight and understanding of microbial management, more techniques on microbial community analysis were developed in the past decades.
26 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction
In recent years, culture-independent, molecular methods have been applied to study intestinal microbiology, complementing culture-based studies and resulting in an increased appreciation of the complexity of the community. The molecular techniques rely on sequence comparisons of nucleic acids (DNA and RNA) avoiding the bias due to cultivability (Possemiers et al., 2004). The molecular techniques allow identification and quantification of community members, and to study MCC fluctuation over time. In addition, analysis of the expression of functional genes combining with the use of stable isotopes and biomarkers, allows monitoring the metabolic activities of groups or individual microorganisms in situ. (Zoetendal et al., 2004). The predominant molecular methods employed in studying intestinal microbiota have been fingerprint-style methods, particularly denaturing gradient gel electrophoresis (DGGE) (Dowd et al., 2008) and terminal-restriction fragment length polymorphism (T-RFLP) (Roeselers et al., 2011). More recently, researchers realize that the fingerprinting techniques, such as DGGE, T-RFLP might have an insufficient accuracy leading to an incomplete description of the microbial communities (Xing and Ren, 2006). In this regard, an innovative next-generation sequencing method by analyzing 16S rRNA variable tags has been developed recently. This method can provide additional novel and reliable information of taxonomic identification of microbes (Huber et al., 2007) present in MC.
As shown in Table. 2-1, by using the molecular technique, the complexity of the microbial community related to the aquatic environment and in association with the aquatic host could be further revealed. While very informative, it would be interesting to see that these types of studies are supplemented with relevant information in relation to function and the host-microbe interaction.
27 Chapter 2
Table. 2-1. Studies on microbes associated with aquaculture species using molecular technique Study Method & result Reference
Interaction between PCR-DGGE revealed that the dominant bacteria (McIntosh et al., the live feed species associated with Artemia or rotifer such as 2008a) associated microflora Arcobacter sp. Pseudoalteromonas sp. and and that of cod larvae Alteromonas sp. are not able to colonzie the cod receiving such feed larvae
Previously undescribed bacteria group , such as Arcobacter and Colwellia, associated with cod eggs and rotifers were detected:
Investigation of the Dominant species detected by DGGE included (Hovda et al., 2007) intestinal microbiota Lactobacillus spp., Lactococcus sp., Bacillus sp., of Atlantic salmon by Photobacterium phosphoreum, Acinetobacter sp., DGGE and culture Pseudomonas sp. and Vibrio sp., based method. Dominant species detected by culture-based method: Vibrio sp., Acinetobacter sp. and Pseudomonas sp.
Microbial diversity of 16S rRNA clone library revealed previously (Kim et al., 2007) intestinal contents and unrecognized genera, ie Erwinia, Serratia, mucus in rainbow Rahnella, Ralstonia, Veillonella, trout Porphyromonas, Capnocytophage, Cetobacterium and Prevotella. Distinguish MC in gut content and gut mucus.
Intestinal microbial Next generation sequencing shows high variation (Star et al., 2013) species composition in of the intestinal microbial species composition wild Atlantic cod among eleven individuals. The shared OTUs caught at a single belong to the orders of Vibrionales, which location quantitatively dominate the Atlantic cod intestinal microbiota, followed by variable numbers of Bacteroidales, Erysipelotrichales, Clostridiales, Alteromonadales and Deferribacterales.
Intestinal microbiota and commensals
Thanks to advances in the microbial community analyzing tools and the creation of germ-free (GF) animal models, more attention has been put into the study of the function of individual or groups of bacteria. In those studies, the function of bacteria in
28 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction the gut has attracted large interest.
Depending on the colonization ability, bacteria in the gut can be considered either transient or permanent (Harris et al., 1993). Transient bacteria are usually incapable of permanent colonization in the intestine. The prevalent environmental conditions or competition by other bacteria such as resident microbiota will limit the colonization of transient bacteria. According to Ivanov and Honda (2012) many feed-associated microbes and dietary additive microbes, including pathogens and conventional commercial probiotics, are part of this category. In most cases, the transient bacteria are just passing through the intestinal tract and they do not establish a mutualistic relationship with the host.
In contrast to transient bacteria, permanent bacteria are resident in the intestine of the host. More importantly, they have developed evolutionary adaptations to establish a permanent and mutualistic relationship with the host. In most cases they have coevolved with the host and live ‘preferably’ in close association with the host rather than a free-living style. These microorganisms are termed as the ‘commensal microorganisms’. Commensal colonization brings many physiological, metabolic and immunological benefits to the host (Li et al., 2007). Some specific examples include harvesting of nutrients from food, providing essential vitamins and producing biofilms that block pathogen entrance (Maynard et al., 2012).
Commensal bacteria and the immune response of the host
Over the last few years, studies on how the microbiota shapes the immune system of host, including human and aquatic species, became apparent in the literature (Gómez and Balcázar, 2008; Round and Mazmanian, 2009). As it is the case with terrestrial animals, the interactions between the gut MC and the aquatic host (e.g. fish and invertebrates) are integral in mediating the development, maintenance and effective functionality of the intestinal mucosa, including the immune response(Garcia-Garcia et al., 2013; Gomez et al., 2013).
The large number of commensals can provide immune protection in several ways.
29 Chapter 2
They can defend their territory by directly combating invading pathogens or by an immunostimulating process, i.e. mobilizing host antimicrobial immune defense. They can also affect host immunity in a more inconspicuous, but equally important, way by directing the development of the host immune system. As described in the studies on terrestrial animals and humans, commensals stimulate general recruitment of immune cells to the mucosa, as well as generation and maturation of organized gut-associated lymphoid tissues (Macpherson and Harris, 2004). They also stimulate protective epithelial cell functions, such as mucus and antimicrobial peptide secretion (Hooper and Macpherson, 2010). In aquaculture, at the early larval stage, commensal and favorable bacteria in the GI tract play an important role in the stimulation of the immune system, morphological development and fundamental mucosal function. This has been demonstrated by comparing gut differentiation and gene expression of germ free and conventionally reared zebrafish larvae (Rawls et al., 2004; Pham et al., 2008).
As the importance of commensal microbiota in regulating the immune system of the host is now well appreciated, more studies have been carried out to investigate the underlining mechanism. Compared to invertebrates, more aspects of commensal interaction with the immune system have been unraveled in vertebrates.
Commensal-immune interaction in vertebrates
Development and recruitment of immune cells are generally regulated by commensal microbiota. Under normal conditions, the commensal microbiota affect the development and function of various immune cell populations. As demonstrated by many studies conducted with the mice model, commensal microbiota are involved in the development of IgA-secreting plasma cells, Th17 cells, regulatory T (Treg) cells, invariant natural killer T (iNKT) cells, NK cells, macrophages, dendritic cells (DCs), and innate lymphoid cells (ILCs) (Honda and Littman, 2012). In GF or antibiotic-treated mice, the percentages of both Tregs and Th17 cells are markedly reduced, and expression of the immune-suppressive cytokine IL-10 in Treg cells is severely reduced (Ivanov et al., 2008; Atarashi et al., 2011). Interestingly, these reductions are quickly restored by transplantation of intestinal or fecal microbiota from 30 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction conventionally raised/specific pathogen-free (SPF) mice. By affecting the development of immune cells, the commensal microbiota shapes the immune landscape in the gut and provides both proinflammatory and anti-inflammatory signaling.
Although, various members of the commensal microbiota can contribute to the similar function towards the development of the host immune system, studies on some specific groups have been intensively reported. Among those microbial lineages, segmented filamentous bacteria (SFB) are the most popular example of the immunostimulatory role of commensal bacteria. SFB are found in the intestinal tract of diverse species. They are a group of uncultivable spore-forming bacteria of the phylum Firmicultes, within the order Clostridiales. The presence of SFB can stimulate the production of Th17 cells which is critical for antibacterial (Ivanov et al., 2009) and antifungal defense (Conti et al., 2009). Besides immune stimulating effects provided by particular microbes such as SFB, anti-inflammatory effects are also reported to be associated with the gut bacterium, Bacteroides fragilis, a well-studied bacterium which provides anti-inflammatory signals in the gut. The polysaccharide A (PSA) of this bacterium is a zwitterionic molecule with the capability to bind Major Histocompatibility Complex (MHC) class II proteins (Surana and Kasper, 2012). It has also been reported to stimulate TLR2 to induce regulatory T cells and, thus, reduce the inflammatory arm of the host–commensal interaction promoting the colonization of the gut by B. fragilis (Round et al., 2011). Meanwhile, induction of IL-10 by B. fragilis seems to play a central role in the anti-inflammatory process of the host. Recently it was also reported that IL-10-negative mice are more susceptible to intra-abdominal infection than the control IL-10-sufficient animals (Cohen-Poradosu et al., 2011). Another popular commensal bacterium, which is used in the study of the suppression of inflammatory responses, is Clostridium. The commensal bacteria belonging to the genus Clostridium assist in the accumulation of FoxP3+ Tregs in the colon, which play a significant anti-inflammatory role dealing with the microbiota (Atarashi et al., 2011).
The responses of immune cell subsets may also be affected by microbiota. For example, gut microbiota provide an environment for the functional maturation of IgA+
31 Chapter 2 plasma cells by inducing the generation of iNOS+ IgA+ plasma cells (Fritz et al., 2011). iNOS+ IgA+ plasma cell plays important role in the enhancement of IgA+ plasma cell development and the host defense against enteric pathogens (Fritz et al., 2011) Commensal bacteria also affect the function of natural killer cells (NK cells) function. Even though NK cell numbers are normal in GF mice, NK cell priming and antiviral activity is deficient in the absence of microbiota (Ganal et al., 2012). Besides the reports on terrestrial animals, the immune regulating effects of intestinal microbiota on aquatic animals have also been reported, e.g. in zebrafish larvae, where the intestinal microbiota are involved in the fortification of immune response (Rawls et al., 2004) by stimulating the production and activation of neutrophils (Bates et al., 2007).
Commensal-immune interaction in invertebrates
Compared to the vertebrates, the immune mechanisms involved in invertebrates have been less investigated and as a consequence, the interaction of intestinal commensal bacteria and the host immune response are also poorly understood. Unlike the vertebrate, innate immunity composes the sole host defense mechanisms in non-vertebrates, which lack the highly specific mechanisms of adaptive immunity. Recent advances in comparative immunology reveal similarities between vertebrate immunity, and the innate immune mechanisms involved in the defense mechanism of invertebrates, including pathogen recognition, immune cell activation and immunity effectors (Garcia-Garcia et al., 2013). As in the case of vertebrates, the immunomodulatory effects of intestinal commensals are also reported in many studies on invertebrates. In the invertebrate model organism, Drosophila interplays between its immune system and the microbiota it contains. In this organism the renewal of the gut epithelium is an essential mechanism of defense against oral bacterial infection. The renewal of gut stem cells is regulated by the interplay between specific bacteria and the oxidative burst that is induced upon infection (Buchon et al., 2009). In addition, a tightly-regulated expression of Drosophila antimicrobial peptides in the gut seems to be required for the maintenance of a healthy gut microbiota (Ryu et al., 2008). Bumble bee (Bombus terrestris) workers exhibited higher numbers of the parasite Crithidia bombi
32 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction
(a highly virulent natural pathogen), when they lacked a normal microbiota (Koch and Schmid-Hempel, 2011). To make the story more complicated, in gypsy moth Lymantria dispar, Bacillus thuringiensis- induced death seems to depend on the presence of a normal gut microbiota, because antibiotic treatment of the larvae before Bacillus thuringiensis infection reduces host death (Broderick et al., 2010).
As defined and discussed above, in both vertebrates and invertebrates, commensal bacteria modulate immune homeostasis by affecting the development, differentiation, or effector function of different immune cell subsets. Of course, commensal bacteria are not the only microbes that can interact with the immune system of the host. The invasion of foreign bacteria and pathogens could also trigger the immune response. However, the immune changes induced by commensals possess several characteristics that distinguish them from conventional immune responses against pathogens. The response induced by commensals are usually restricted to a certain immune cell subset while a pathogen invasion will induce a full cascade of proinflammatory immune responses. Most importantly, ‘the effects of commensals are subtle and do not present as overt immune changes, such as immune deficiency or inflammation’ (Ivanov and Honda, 2012). In contrast, the immune response induced by a pathogen invasion is usually part of the general tissue damaging inflammatory immune response with induction and infiltration of multiple inflammatory subsets (Ivanov and Honda, 2012). Thus, the effects of commensals are fundamentally different from those of pathogens.
In summary, commensal microbiota provide diverse signals for activation and suppression of the immune system. Ideally, these organisms will be able to induce broader changes to the microbial ecosystem and have the ability to maintain a balanced microbiota and recover the intestinal microbial composition when it is not in the homeostatic status (dysbiosis).
Aquaculture practices affect host microbiota
The host gut MC and the environment MC share a constant interaction within the aquaculture system. Since the host MC is known to affect the development and function
33 Chapter 2 of the host immune system, any manipulation of the MCC in the system will have a potential impact on the host MC and the immune development and response. However, most of the studies investigating microbial modulation focus on the beneficial effect brought by the bio-treatments (including probiotics/prebiotics) or improvement of the colonization of certain well-known beneficial bacteria, such as Lactobacillus. Very limited studies describe the impact of these treatments on the overall composition and stability of the intestinal microbiota. Actually, as illustrated in Fig. 2-1, many aquaculture practices that are adopted to benefit the health of the aquatic animal may disturb the normal intestine microbiota.
Figure. 2-1. Effect of aquaculture practices on the intestinal microbial community of the host. Disinfection of the culture environment will lead to (more or less) broader removal of microbes and may interfere with the heterogeneity of the host intestinal MC. Treatments like application of immunostimulants targeting the host can elicit immune responses that affect the colonization of the gut. Continuous addition of probiotics in the environment or in the diets may lead to long term colonization which may interfere with the normal host gut MC. Meanwhile, the modulated host gut MC may have reciprocal reaction towards the host immune response.
Disinfection and antibiotics are commonly applied in intensive aquaculture to prevent the over growth of pathogens and disease outbreak. Aquaculture often involves artificial spawning and fertilization of fish eggs. In most cases, the eggs may be sterilized by various disinfection techniques such as UV-irradiation, ozonization, membrane filtration, and antibiotics. It is presumed that those bacteria from the environment of the broodstock or in association with the eggs will significantly affect the formation of pioneer gut MC of the developing larvae. As discussed earlier, the gut
34 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction
MCC may influence the development and response of the immune system (Forberg et al., 2012). In addition, the overall disinfection will reduce the microbial heterogeneity in the rearing environment, thus providing less diverse gut MC candidates. It is suggested that a high diversity and evenness may contribute to the well-functioning of the MC (Wittebolle et al., 2009). Meanwhile, it is more difficult for a pathogen to invade a community with evenly distributed members relative to the community with a few dominant members (Ley et al., 2006).It is also suggested that interfering with the MCC stability in the culture environment may hamper the health of the farmed animal (Attramadal et al., 2012b). Thus, comparing to the completely ‘clean’ water, a rearing environment containing more diverse and stable MC would be more recommendable for aquaculture practices (Attramadal et al., 2012a).
Probiotics/prebiotics are reported to improve the health status and colonization of beneficial bacteria in aquaculture animals. Beyond the direct beneficial effect such as, antagonism towards pathogens, assistance to nutrients absorption, brought by the application of probiotics, alterations of the fish gut MCC has been demonstrated (Vendrell et al., 2008; Løvmo Martinsen et al., 2011). There are also studies reporting that the continuing application of probiotic cells will lead to their long term colonization in the intestinal tract (Merrifield et al., 2010), Similarly, the persistence of some probiotics after switching the probiotic-supplemented diets to non-supplemented diets was also reported. As demonstrated by Balcázar et al. (2007), Lactobacillus sakei and Leuconostoc mesenteroides displayed the ability to persist within the rainbow trout intestine after reverting to non-supplemented diets. Together with the studies mentioned above, other similar studies have demonstrated that the application and the colonization of probiotic cells can alter the indigenous GI MCC as well as total population levels of the intestinal bacteria (Geraylou et al., 2013; Ramos et al., 2013). In addition, Forberg et al. (2012) demonstrated that the colonization of gnotobiotic cod larvae by specific bacterial strains can lead to different expression levels of the complement component 3 gene (C3), which is considered to be involved in the first line of defense against pathogenic bacteria (Boshra et al., 2006). Hence it might be possible
35 Chapter 2 that colonization by probiotics in the early larval stage may affect the initial colonization and formation of normal MC in the digestive tract, which subsequentially may alter the host innate immune response. Indeed, the persistence in the digestive tract is a requisite for probiotics and no study has shown a negative effect on host immune response due to probiotic colonization. However, some probiotics are not necessarily a member of the indigenous gut MC of the host and continuous addition of such microbes into the rearing system may interfere with the homeostasis of the host gut MCC. At least, it would be necessary to document the modulatory effect of probiotics on the gut MCC, because the composition of gut MCC will also modulate the homeostasis of the host immune system (Ivanov and Honda, 2012).
The immunomodulation of larval animals has been suggested as a potential method for improving survival by increasing the innate responses of the developing animals (Bricknell and Dalmo, 2005). There are many reports on the successful application of immunostimulants in aquaculture, such as use of glucans and nucleotides in the diets of salmon, sea bass and sea bream (Bagni et al., 2000; Burrells et al., 2001). Although promising results of immunostimulants have been widely reported, there are still concerns on the possible immune-suppression and the detrimental impact on the development of immune system by the administration of immunostimulants. There are studies suggesting that the feeding of immunostimulants to immunologically matured fish is beneficial, providing improved protection against bacteria (Anderson and Siwicki, 1994; Dalmo, 2000). Conversely, in larval animals, whose immune system is still under development, risk of applying immunostimulants may occur. It has been suggested that immunomodulating a larval animal before its immune system is fully formed may adversely affect the development of a normal immune response (Bricknell and Dalmo, 2005). In addition, as mentioned previously, the larval stage is also crucial for the formation of indigenous intestinal MC which has large impact on the development and function of immune cells of the animal. Accordingly, the impact of immunostimulants on larval animals may also influence the primary colonization of the bacteria from the environment. Although, studies specifically looking into this issue are
36 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction rarely reported, it has been demonstrated in a mice model that a knock-in mutation of activation-induced cytidine deaminase (AID) (AIDG23S) leads to excessive proliferation of anaerobic bacteria in the small intestine (Wei et al., 2011). Similar overgrowth of microbiota was also reported in programmed cell death-1 (PD-1)-deficient mice (Kawamoto et al., 2012). Thus, in addition to the beneficial effect of immunostimulation, it should be taken into consideration that immunostimulation may also interfere with the formation of indigenous microbiota.
Strategic microbial management in aquaculture system
The health status of aquaculture animals is significantly affected by both the composition of microbiota and the behavior of those microbes in the aquatic environment. Thus, a strategic microbial community management in the aquaculture system could focus on both the modulation of MCC and manipulation of microbial behavior.
Manipulating the MCC in the water
Attramadal et al. (2012a) demonstrated that a stable and well-functioning microbiota is crucial to the of aquatic animals. Traditional flow through systems (FTS) provides fish tanks with water containing relatively little organic matter and few bacteria (Attramadal et al., 2012a). In the FTS system, disinfection of the intake water is often performed to minimize the potential pathogenic bacteria in the rearing system. But simultaneously, this procedure temporarily diminishes the competition among bacteria in the rearing system. Meanwhile, a higher bacterial carrying capacity (CC) in the fish tanks often exists due to high densities of fish. It was suggested by Attramadal et al. (2012a) that the enriched and perturbed environment with reduced competition promotes r-selection, i.e. opportunists (Hess-Erga et al., 2010). Based on the ecological theory of r/K-selection (MacArthur, 1967), a microbial community with a high share of fast-growing (r-strategic bacteria) is believed to be detrimental for fish larvae (Vadstein, 1993); while a microbial mature water containing less opportunists is suggested to be more beneficial for the health of aquaculture animals(Vadstein, 1993; Skjermo and
37 Chapter 2
Vadstein, 1999).
In practice, a recirculating aquaculture system (RAS) may provide a culture environment resident with more K-selected bacteria. In a RAS aquaculture system, microbial maturation of intake water is a well-documented strategy that counteracts the destabilizing forces through controlled microbial re-colonization (Vadstein, 1993; Skjermo and Vadstein, 1999). In the study of Attramadal et al. (2012a) a higher evenness, diversity and lower fraction of opportunists in the RAS was observed relative to the FTS, culturing the same group of Atlantic cod, Gadus morhua. Meanwhile, the fish larvae performance was also better in the RAS than in the FTS. These findings suggest that RAS operation has a beneficial stabilizing and maturing effect on the development of the MC compared to FTS. In practice, RAS are widely used to reduce water consumption and energy use, and to control waste emission. In addition to those aspects, RAS should be more explored as a strategy in the microbial management of marine hatcheries.
Manipulating the phenotype (behavior) of the microbes in the culturing environment
Manipulating the phenotype (behavior) of the microbes is yet another possible direction for microbial control in aquaculture systems. Many studies have reported phenotypic shifts in bacteria (Bossier and Verstraete, 1996; Drenkard and Ausubel, 2002; Kussell et al., 2005). In Comamonas testosteroni, Bossier and Verstraete (1996) found two types of colonies on Luria-Bertani (LB) agar plates, namely colonies with mucoid appearance and colonies with a nonmucoid appearance. Also in that study, in absence of agitation and in contact with a glass surface, a culture with predominantly non-mucoid-colony forming (NMCF) cells very rapidly shifted to a culture dominated by mucoid colony forming (MCF) cells. These findings suggested that the phenotypic character could be manipulated by changing the culturing mode. More interestingly, Phuoc et al. (2009) compared the virulence of luminescent and non-luminescent isogenic Vibrios towards gnotobiotic Artemia franciscana larvae and specific pathogen-free Litopenaeus vannamei shrimp. They reported that the non-luminescent isogenic strains obtained by a dark and static culture condition are less virulent than the 38 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction luminescent strain towards Artemia. However, these differences of virulence were not observed in tests on shrimp. The findings suggest that there is a potential beneficial effect by manipulating the phenotype of microbes in the environment.
‘Microorganisms in the rearing environment may live with a planktonic mode or an adhesive mode, such as biofilm. Biofilms are assemblages of microorganisms, encased in a matrix, that function as a cooperative consortium’ (McDougald et al., 2012). It is now well acknowledged that the biofilm mode of life is a common to most microorganisms in nature. Biofilm formation is a developmental process initiated when bacteria attach to a surface, followed by clonal growth, attachment of free-swimming microorganisms, and the production of an extracellular matrix (Davey and O'toole, 2000). Meanwhile, microorganisms may shift between these two living modes depending on the environmental factors, such as surface for attachment, nutrients and oxygen (Sawyer and Hermanowicz, 2000; Thormann et al., 2005; Hinsa-Leasure et al., 2013) Moreover, the heterogeneity and variation of gene expression, morphology, phenotype of the identical bacterial species are common in different developmental stages of biofilm (McDougald et al., 2012), Thus, there are possibilities to change the living mode of environmental microbes and modulate their phenotypic characteristics by manipulating the environmental factors in the system.
In an interesting study demonstrated by Attramadal et al. (2012c), they reported the beneficial effect on cod larvae performance by clay particles addition into the rearing tank. They observed low microbial abundance and lower share of opportunists in the tanks receiving clay which, as they suggested, contribute to the health of the larvae. As mentioned above, manipulating the environment conditions may change the living mode (planktonic or biofilm mode) of microbes in the environment and consequently modulating the microbial phenotypic character even virulence. Thus, in the study by Attramadal et al. (2012c), the addition of clay particles might also serve as an attaching substrate for the formation of biofilms by the microbes in the rearing environment. The biofilm formation based on the clay particles may reduce the free-living opportunists in the water. In addition, the biofilm formation may
39 Chapter 2 sequentially altered the phenotype and behavior of certain microbes including opportunists, which may provide a less aggressive environment for the fish larvae. Although, no direct evidence were reported regarding the modulation of microbial phenotype benefiting the host, the findings discussed above have brought us novel possibilities for microbial management in aquaculture system.
Biofloc technology (BFT) is another way of manipulating the MCC.
Biofloc technology is a technique of enhancing water quality through bacterial development enhanced by the addition of extra carbon to the aquaculture system, through an external carbon source or elevated carbon content of the feed (Crab et al., 2012). By manipulating the environmental effectors, such as organic carbon source, organic rate, dissolved oxygen, microorganisms could be modulated to grow in a floc structure (De Schryver et al., 2008). If carbon and nitrogen are well balanced in the rearing system, ammonium in addition to organic nitrogenous waste will be converted into bacterial biomass in a BFT aquaculture system (Schneider et al., 2005).
The BFT aquaculture system has several outcompeting advantages compared to the conventional aquaculture system. A) by adding external carbon source into the system, high nitrogen utilization rate by heterotrophic bacteria occurs and the nitrogen removal efficiency is significantly higher than the traditional denitrifying system (Crab et al., 2007). B) when the C/N ratio is well balanced, the nitrogen accumulated nitrogenous waste in the diets and other organic matters can be upgraded as bacterial protein and serve as in situ feed for aquatic animals (Schneider et al., 2005). In addition to the direct contribution to the food availability by BFT, the nutritional structure of bioflocs could also be manipulated by applying different organic carbon source in the system. As suggested by Crab et al. (2012), different organic carbon sources can stimulate specific bacteria, and hence can influence the microbial composition of the bioflocs and thereby also their nutritional property (Crab, 2010). For example, bioflocs grown on glycerol tend to have a higher n−6 fatty acids content when compared to bioflocs grown on acetate or glucose (Crab et al., 2010a). C) biofloc technology has the potential as a disease control measure. It was reported that bioflocs grown on glycerol 40 Microbial management for sustainable aquaculture: needs for more knowledge on host-microbe interaction were able to protect gnotobiotic brine shrimp (Artemia franciscana) against pathogenic Vibrio harveyi, and that the beneficial effect was likely due to interference with the pathogen's quorum sensing system (Crab et al., 2010b). Another interesting exploration of biofloc application was to accumulate the bacterial storage compound poly-β-hydroxybutyrate (PHB). PHB and PHB accumulating bacteria have been shown before to protect different aquaculture animals from bacterial infections (Defoirdt et al., 2007; De Schryver et al., 2010). It has been reported that by including the PHB-accumulating bacteria in the biofloc, the PHB level in bioflocs can be improved and it exert protection to the animals against bacterial infection (Halet et al., 2007). Based on the studies discussed above, biofloc technology is a good example of microbial manipulation strategy from the level of both microbial behavior and composition, which can improve the water condition and benefit the health of the cultured animal.
2. Summary
As mentioned above, the aquaculture practices, including water disinfection, antibiotics use, probiotics and immunostimulant administration, may all lead to changes of microbial community composition and/or microbial behavior in the rearing water and/or the intestine of the animals. Larval animals upon hatching have a sterile intestinal tract awaiting the colonization of various bacteria originating from the rearing water. Thus, aquaculture practices during the larval stage may affect the initial colonization by bacteria of the digestive tract of the larvae and subsequently affect the formation of the intestinal MC. As discussed earlier, the intestinal MC plays an import role in regulating the immune system and disease tolerance. In this context, it is important to study the comprehensive impact of a bio-treatment, such as probiotics or immunostimulants, on the MCC and bacterial activity both in the culture environment and associated with the animal.
41 Chapter 2
42
PART II
ARTEMIA-MICROBE INTERACTION ASSOCIATED WITH PROBIOTICS
CHAPTER 3
A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
Chapter 3
A method for the specific detection of resident bacteria in brine
shrimp larvae Artemia franciscana
Redrafted from:
Yufeng Niu, Tom Defoirdt, Anamaria Rekecki, Wim Van den Broeck, Shuanglin Dong, Patrick Sorgeloos, Nico Boon, Peter Bossier
(2012)
Journal of Microbiological methods 89 (1):33-37
ABSTRACT
In this study, we describe an easy but efficient method to specifically target the intestinal resident microbiota in brine shrimp larvae during DGGE analysis, hereby excluding the interference of both transient (luminal) bacteria and body surface bacteria. This effective technique has several advantages over alternative methods, with respect of ease of use and rapidity.
43 Chapter 3
1. Introduction
In the study of host-microbe interactions, the resident bacteria are considered prime contributors to long-lasting effects. Harris (1993) proposed a conceptual model that differentiates between transient and resident gut microflora associated with invertebrates. Resident bacteria are persistently present in the gut, whereas transient bacteria do not form a stable population. However, separating or specifically targeting resident bacteria is not always easy. Nowadays, DGGE has become a popular molecular technique for the assessment of intestinal microbial biodiversity (Brunvold et al., 2007, Luo et al., 2006, Merrifield et al., 2009). In larger animals, the gut can be dissected and the gut could be scraped or washed to remove food or transient bacteria. However, with animals of smaller size, such as Artemia, dissection is difficult. Thus, during DGGE analysis, in most cases, whole DNA extracts of the animal are taken into account and this can result in the detection of only the dominating transient (luminal) intestinal bacteria, whereas, the resident bacteria are undistinguishable from background patters. For this reason, we aimed at developing a simple and efficient protocol for screening Artemia gut resident bacteria by alleviating the interference of exteriors and gut transient bacteria during DGGE analysis.
2. Materials and methods
2.1 Bacterial strains and Preparation
Seven different bacteria strains. LVS3, ISO8=GR8, ISO10=GR10, ISO11=GR11, LT3, LT12, V.campbellii LMG 21363 (abbreviated as VC) (Defoirdt et al., 2010, Makridis et al., 2005, Marques et al., 2005), were used in this study. All strains were preserved at -80 oC in Marine Broth 2216 (Difco Laboratories, Detroit, MI. USA) with 20% sterile glycerol. The bacterial strains were initially grown at 28 oC for 24 h on Marine Agar (Difco Laboratories, Detroit, MI. USA) and then to log phase in Marine Broth by incubation at 28 oC with continuous shaking. Bacteria were harvested by centrifugation (15min; ±2200 x g). The supernatant was discarded and the pellets were resuspended in 20ml FASW. Bacterial densities were determined by spectrophotometry (OD 550), assuming that an optical density of 1.000 corresponds to
44 A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
1.2 x 10 9 CFU/ml, according to the Mc Farland standard (BioMerieux, Marcy L’Etoile, France). All the bacteria strans were applied to Artemia at the concentration of 106 mL-1.
2.2 Axenic hatching of brine shrimp larvae Artemia franciscana
Axenic larvae were obtained following decapsulation and hatching. Briefly, 2.5 g of brine shrimp cysts originating from the Great Salt Lake (field collection), Utah, USA (EG Type, batch 21452, INVE Aquaculture, Dendermonde, Belgium) were hydrated in 89 ml of distilled water for 1 h. Sterile cysts and larvae were obtained via decapsulation using 3.3 ml NaOH (32%) and 50 ml NaOCl (50%). During the reaction, 0.22 µm filtered aeration was provided. All manipulations were carried out under a laminar flow hood and all tools were autoclaved at 121 oC for 20 min. The -1 decapsulation was stopped after about 2 min by adding 50 ml Na2S2O3 at 10 g l . The aeration was then terminated and the decapsulated cysts were washed with filtered (0.2 µm) and autoclaved artificial seawater containing 35 g l-1 of instant ocean synthetic sea salt (Aquarium Systems, Sarrebourg, France). The cysts were suspended in 1-l glass bottles containing filtered and autoclaved artificial seawater and incubated for 28 h on a rotor at 4 rpm at 28 oC with constant illumination of approximately 2000 lux. The emerged larvae reached stage II (at which time they start ingesting bacteria) were collected.
2.3 Fluorescence microscope and GFP labelled bacteria
LVS3 and VC were used for Fluorescence microscope examines. Both bacterial strains were labelled with plasmid as described by (Anderse et al., 1998, Boon et al., 2001, Rekecki et al., 2012).
The larval which needs for fluorescence microscope analysis was fixed by 4% paraformaldehyde for 1 h and then individually mounted on glass slides with a solution of glycerine and 1, 4-diaza-bicyclo [2, 2, 2]-octane (DABCO) (ACROS Organics, Geel, Belgium), and then examined, using the Fluorescence microscope: Olympus BX61 Fluorescence microscope (Olympus Belgium N.V., Aartselaar, Belgium) with the filter cube U-MWIB2. This allowed for visually inspecting the presence of the GFP-labelled bacteria in the larval intestinal tract.
45 Chapter 3
2.4 Cellulose treatment
In this study, cellulose particles were applied to purge the transient bacteria out from the intestine track of Artemia. After enrichment with bacteria, the larvae were cultured in a cellulose suspension (1.5 gl-1) (Sigma, type 20) for 4 hours. By examining under the fluorescent microscope, it can be confirmed whether the purging effect of cellulose can remove the transient bacteria.
2.5 DNA extraction and PCR-DGGE
From each sample, 120 nauplii were taken for DNA extraction. DNA was extracted using the Blood and Tissue Kit (Qiagen). A nested PCR strategy was used. For the external PCR amplification we used the primer Eub8F, 5’-agagtttgatcmtggctcag-3’ and the broad coverage primer 984yR, 5’-gtaaggttcytcgcgt-3’. The 338F-GC/518R primer set was used for the internal PCR amplification. PCR reaction and DGGE were performed as described previously by Bakke et al. (2011).
2.6 Experimental design
The study consists of three major parts. First, a method is presented to wash bacteria adhering to the exterior surface. Secondly, a method is developed to purge the transient (luminal) bacteria. Finally, the two methods are combined, allowing alleviating the interference of exterior and transient bacteria, targeting only resident bacteria in the gut of brine shrimp nauplii. A schematic view of the method and outline is presented in Fig. 3-1.
46 A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
Figure. 3-1. Schematic view of experiment outline. FASW: Filtered and autoclaved sea water.
2.61 Washing procedure of removing exterior bacteria
In the first phase, a washing procedure was developed to wash away the bacteria adhering to the exterior surface of the brine shrimp. The absence of exterior bacteria was confirmed by DGGE. Bacteria-free brine shrimp (Artemia franciscana) were harvested. 18 hours after hatching, instar I nauplii were collected in 500 ml glass bottles at a density of 1 nauplii ml-1. Half of the nauplii were killed by freezing in 10 ml 0.2 µm filtered and autoclaved seawater (FASW) for 1 hour at -20°C. After thawing, dead nauplii were exposed to a mixture of seven different bacteria for 3 hours: LVS3, ISO8, ISO10, ISO11, LT3, LT12, VC. As a control, live instar I nauplii were also exposed to the same bacteria. They were all added at a concentration of 106 ml-1. After bacterial exposure, the nauplii were collected by filtering through a sterile 100 μm filter and subsequently rinsed for 30 seconds with 20ml 1% benzalkonium chloride solution (Huys et al., 2001), followed by rinsing twice for 30 seconds with FASW. Axenically hatched nauplii which were not subjected to bacterial exposure were used as negative control. From each treatment, 120 nauplii were taken for DNA extraction. The polymerase chain reaction (PCR) and denaturing gradient gel electrophoresis (DGGE) were performed to indicate the presence or absence of
47 Chapter 3 exterior bacteria.
2.62 Purging the transient bacteria
In the second phase, a method was developed to purge transient bacteria from the intestinal tract using cellulose particles. The purging effect of cellulose was confirmed by fluorescence microscope.
Brine shrimp larvae were harvested. Twenty-eight hours after hatching instar II nauplii were collected and subsequently enriched with LVS3 or VC (Marques et al., 2006) for 12 hours. Both bacterial strains were labelled with the green fluorescent protein (GFP) by conjugation. After enrichment with these bacteria, the nauplii were cultured in a cellulose suspension (1.5 gl-1) (Sigma, type 20) for 4 hours. Brine shrimp are non-selective particle filter feeders grazing on particles smaller than 50 µm (Dobbeleir et al., 1980). By feeding the instar II nauplii with sterile cellulose particles, the transient bacteria were purged by means of the cellulose. Nauplii loaded with bacteria but receiving no cellulose were used as control group. The same washing procedure was then applied to all the nauplii. The whole larval body was individually mounted on glass slides with a solution of glycerine and 1,4-diaza-bicyclo [2, 2, 2]-octane, and then examined, using a fluorescence microscope with the filter cube U-MWIB2. This allowed verifying for the presence of the GFP-labelled bacteria in the larval intestinal tract (Rekecki et al., 2012).
2.63 Apply the washing and purging methods to detect the resident bacteria
Finally, the washing procedure combined with the cellulose purging treatment was applied on brine shrimp larvae to investigate the capability of different bacteria to become resident in brine shrimp larvae as verified by PCR-DGGE.
Axenically hatched instar II nauplii were collected and kept in 2 L glass bottle with 1.5 L FASW at a density of 1 nauplii ml-1. Sterile aeration was provided throughout the experiment. Then a mixture of bacteria (the same as in washing experiment, see also Fig. 3-2) was added to the nauplii, each at a concentration of 106 cells ml-1. Samples of 240 nauplii were taken 2, 4, 8, 16 and 24 hours, respectively,
48 A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana after the start of the bacteria exposure. Firstly, cellulose treatment was applied to half of the nauplii for purging the gut transient bacteria. The other half of the nauplii were kept as control group which did not receive the cellulose treatment. Then, the washing procedure was applied to the nauplii for both the cellulose-treated group and the control group to remove bacteria attached to the exterior surface of the nauplii. The washed nauplii were then subjected to DGGE analysis.
3. Results and discussion
3.1 Remove the exterior bacteria by washing procedure
As can be observed from the DGGE fingerprinting patterns, the bacterial bands that were present in the treatments without washing Fig. 3-2 (C, E) were absent in the washing treatments Fig. 3-2 (B, D). Instar I nauplii has an axenic intestinal tract, because it does not take up food as its digestive system is not functional yet; it thrives completely on its yolk reserves (Benesch, 1969). Thus, all the bacteria detected by DGGE should be attached to the exterior surface of the Artemia body. This result confirmed that the washing procedure can successfully wash away the bacteria attaching to the exterior surface of Artemia nauplii. The bands indicated by the arrows in Fig. 3-2 are also present when DNA is amplified from axenically hatched Artemia (Fig. 3-2, F and G). They are absent in the amplification of pure bacterial DNA (Fig. 3-2. A). Therefore, it is suggested that these bands are unspecific Artemia amplification products of the PCR approach. Because these unspecific bands share no overlap with the targeted bacterial bands, they are not interfering with the overall interpretation of the result.
49 Chapter 3
Figure. 3-2. Removal of exterior bacteria by the washing procedure. Lane A, mixture of PCR amplification products from the seven bacteria; Lane B, dead nauplii subjected to the washing procedure; Lane C, dead nauplii not subjected to the washing procedure; Lane D, live nauplii subjected to the washing procedure; Lane E, live nauplii not subjected to the washing procedure; Lane F, axenic nauplii subjected to the washing procedure as negative control for the washing procedure; Lane G, axenic nauplii not subjected to the washing procedure as negative control for axenity of instar I nauplii. *The bands indicated by the arrows in Fig. 3-2 are also present when DNA is amplified from axenically hatched Artemia (F, G). They are absent in the amplification of pure bacterial DNA (A). Therefore, it is suggested that these bands are unspecific Artemia amplification products of the PCR approach. Because these unspecific bands share no overlap with the targeted bacterial bands, they are not interfering with the overall interpretation of the result.
3.2 Removal of transient bacteria by cellulose purging
After cellulose treatment, LVS3 was purged from the shrimp gut (Fig. 3-3 E and F). In contrast, a significant level of VC was still detected after cellulose purging (Fig. 3-3 G and H). This observation was expected as it was shown before that this strain attaches to the brine shrimp intestinal epithelium (Gunasekara et al., 2011). This result confirmed that the cellulose treatment could purge transient bacteria.
50 A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
Figure. 3-3. Removal of transient bacteria by cellulose. Picture A and B, untreated nauplii enriched with LVS3; Picture C and D, untreated nauplii enriched with VC; Pictures E and F, cellulose treated nauplii enriched with LVS3; Pictures G and H, cellulose treated nauplii enriched with VC. * Picture H was taken with lower magnification than picture D, which can provide a larger visual scale. This allowed better illustrating that after cellulose treatment a considerate amount of VC still resident in the gut.
According to the results shown above, the exterior bacteria and gut transient bacteria could be subsequently removed from Artemia nauplii by a washing procedure and cellulose purging treatment.
3.3 Investigate the capability of different bacteria to become resident in brine shrimp larvae
The DGGE banding patterns of the pure strains used in this experiment are presented in Fig. 3-4 (A to G). Lane H is the mixture of PCR products from these bacteria and it indicates that amplification products of the strains LT3 and LT12 have the same electrophoretic mobility. From 2 to 8 hours, the cellulose treatment group and the control group showed the same pattern (Fig. 3-4 Lane L, M, N, Q, R, S): VC was the most dominant bacteria and other bacteria were hardly detected. After 16 hours, more bacteria were detected in both cellulose treatment group and control group and VC, ISO10 and ISO11 were shown as dominant (Fig. 3-4 Lane O, T).
51 Chapter 3
Interestingly, after 24 hours, VC were shown as the only dominant bacteria in the control group while ISO 10 and ISO11 were not detected (Fig. 3-4 Lane P); whereas, in cellulose treatment group, VC, ISO 10 and ISO11 were still shown as dominant (Fig. 3-4 Lane U). The bands indicated by the arrows represent some DNA amplification products only present in Artemia samples and control amplification (see also Fig. 3-2). It is absent when amplifying pure bacterial DNA. Therefore, it is suggested that these bands are unspecific amplifications of the PCR approach. Because the pattern of these bands shares no overlap with the targeted bands, they are not inferring with the interpretation of the results.
Figure. 3-4. The ability of different bacteria to become resident in the gut of Artemia. Lane A to G, seven pure bacteria culture; Lane H, mixture of PCR amplification products from the seven bacteria; Lane I, Marker; Lane J, negative control of filtered autoclaved sea water; Lane K, negative control of cellulose; Lane L to P, control group from 2 to 24 hours; Lane Q to U, cellulose purging treatment group from 2 to 24 hours. *The bands indicated by the arrows represent some DNA amplification product only present in Artemia samples and control amplification (See also Fig. 3-2). They are absent when amplifying pure bacterial DNA. Therefore, it is suggested that this bands are either artificial or unspecific amplification of the nested PCR approach and they are not interfering with the interpretation of the experiment.
52 A method for the specific detection of resident bacteria in brine shrimp larvae Artemia franciscana
In general, the results indicate that VC, ISO10 and ISO11 have a stronger ability to become resident in the Artemia gut than the other bacteria in this experiment. From 2 to 8 hours, VC was shown as the only dominant species, which might suggest an insufficient development of adhesion sites in the gut during such an early stage and/or a stronger ability of VC than other bacteria to become part of the resident microbiota. After 16 and 24 hours, more bacteria besides VC were able to become resident in the gut. However, after 24 hours, VC was the only dominant bacteria in the non-purged control group whereas, in cellulose-purged treatment group, ISO 10 and ISO11 were also shown as dominant. This could be explained by the fact that VC constituted a very large part of the luminal microbial community masking the presence of ISO10 and ISO11. This interpretation suggests again that transient bacteria might bias the detection of resident bacteria. As in this case, if unjustifiably interpreted, VC would be regarded as the only dominant resident bacteria in the gut after 24 hours and the diversity of resident bacteria in Artemia gut would have been underestimated.
The unspecific bands indicated by the arrows in Fig 3-2 and Fig 3-4 showed the same pattern in every sample, including the axenic Artemia. Meanwhile, those bands were absent in the pure bacteria DNA sample. In addition, the Artemia were rinsed repetitively by sterile sea water to remove the attaching bacteria. Furthermore, by plating on marine agar, the Artemia was checked to be axenic after hatching. Based on the reasons mentioned above, we assumed that those bands shown on the DGGE gel were probably due to the unspecific amplification of the Artemia DNA or artificial factors during the PCR process. Indeed, it is still possible that those bands were caused by contamination during the handling, as only 1% of the total bacteria can be grown on a nutrient medium. Thus, to further confirm the origin of those bands in the future study, one should extract the DNA of the corresponding bands from the DGGE gel and sequence them to check the origin.
In conclusion, in this study, we have developed a simple and effective method to specifically target the intestinal resident microbiota in brine shrimp larvae during DGGE analysis. The interference of exteriors and gut transient bacteria could be alleviated by sequentially removing bacteria attached to the external surfaces (washing procedure) and transient (luminal) intestinal bacteria (purging effect of cellulose). Although laser-capture-micro-dissection (LCM) is feasible to isolate gut
53 Chapter 3 specimen from small animal, considering its cost and complexity of handling when dealing with multiple samples, it is still not a routine when studying general microbiota in the gut of aquatic animals.
This approach is of high importance as the brine shrimp model is frequently used in studies on host-microbe interactions. Through this method, the composition of the resident bacterial community could be revealed, which consequently contributes to a better understanding of host-microbe interactions.
Acknowledgements
This work was funded by China Scholarship Council, Project ‘Probiont induced functional responses in aquatic organisms’ by the Foundation for Scientific Research-Flanders (FWO) (project number: G.0491.08), and the European Community's Seventh Framework Programme (FP7/2007-2013) under grant agreement No. 227197 Promicrobe ‘Microbes as positive actors for more sustainable aquaculture’.
54
CHAPTER 4
Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged with Vibrio campbellii by enhancing the innate immune response and by decreasing the activity of shrimp-associated Vibrios
Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii
Chapter 4
Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia
franciscana) larvae challenged with Vibrio campbellii by enhancing the innate
immune response and by decreasing the activity of shrimp-associated Vibrios
ABSTRACT
Bacteria belonging to the genus Bacillus are amongst the most intensively studied group of bacteria for use as probiotics in aquaculture. However, the exact mechanism of action of these bacteria is often not well described, and the microbiota that are naturally present in cultures of test organisms often compromise the interpretation of the results. The present study aimed to evaluate the putative probiotic effect of Bacillus sp. LT3 in a model system with gnotobiotic brine shrimp (Artemia franciscana) larvae. The strain significantly increased the survival of brine shrimp larvae challenged with V. campbellii when administered 6 h before the challenge. Under these conditions, LT3 was able to attach to the brine shrimp gastrointestinal tract and to decrease the in vivo activity of V. campbellii (bioluminescence as an indication) associated with brine shrimp larvae. In order to investigate the effect of the Bacillus strain on the innate immune system of the brine shrimp larvae, prophenoloxidase (proPO) and transglutaminase (tgase) mRNA levels were monitored, while heat shock protein 70 (hsp70) mRNA levels were measured as an indicator of physiological stress. Interestingly, 12h after challenge, the proPO mRNA level in the larvae pre-treated with LT3 and challenged with V. campbellii was approximately 8-fold higher (p < 0.01) than in the other treatments. Further, a decreased expression of tgase gene and heat shock protein 70 gene suggested that pretreatment with LT3 results in less stress and tissue damage in the brine shrimp larvae upon V. campbellii challenge. These results indicate that Bacillus sp. LT3 could
55 Chapter 4 improve the survival of brine shrimp larvae when challenged with pathogenic V. campbellii, both by decreasing the in vivo activity of the pathogen and by priming the innate immune response through activating the proPO system.
56 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii
1. Introduction
The crustacean aquaculture industry is a high-value activity worldwide. The annual production of crustaceans was recently estimated to have reached 5 million metric tons and to be worth US$ 22.7 billion (FAO, 2010). However, this high-value global industry, which is dominated by the aquaculture of penaeid shrimp species, is significantly impacted by diseases, including (luminescent) Vibriosis (Defoirdt et al., 2007a). According to reports by the United Nations’ Food and Agriculture Organization (FAO), disease is now considered to be the most constraining factor in the shrimp culture sub-sector, causing losses totaling hundreds of millions of dollars and exerting impacts on biodiversity (FAO, 2010).
Traditionally, diseases caused by microorganisms have been treated with antibiotics. However, the non-judicious and prophylactic use of these compounds has resulted in the development of the resistance in fish bacterial pathogens or in the normal microbiota from the fish (Cabello, 2006; Kiang and Tsokos, 1998). These antibiotic resistant pathogens have, in some cases, compromised the efficacy of the antibiotic treatments and raise bio-safty issues in the surrounding environment (WHO, 2014). As a consequence, alternative treatments to controlling infectious diseases, including the use of probiotics, are increasing (Fjellheim et al., 2010; Spanggaard et al., 2001; Zhang et al., 2012).
Probiotics are living organisms, which provide health benefits beyond their mere nutritive value when administered in adequate amounts (Balcazar et al., 2006). Probiotic bacteria can benefit the host through various strategies, such as improved feed value, enzymatic contribution to digestion, production of growth-promoting factors, inhibition of the growth and/or virulence of pathogenic microorganisms, and an increased immune response (Okumura, 2007). Bacteria belonging to the genus Bacillus are amongst the most intensively studied group of bacteria for use as probiotics in aquaculture (Bowden et al., 2012; Nimrat et al., 2012), and have been used to improve the growth performance of aquatic animals and for aquaculture
57 Chapter 4 disease management (Balcázar and Rojas-Luna, 2007; Keysami et al., 2012; Shen et al., 2010; Tseng et al., 2009).
Bacillus species have been reported to produce a wide range of extra-cellular substances and antimicrobial peptides against a variety of microorganisms (Korenblum et al., 2005; Morikawa et al., 1992; Perez et al., 1993), and to improve the innate immune response (Baruah et al., 2011; Soderhall and Cerenius, 1998). The defense of invertebrates, such as brine shrimp, mostly relies on innate immunity, which includes phagocytosis, encapsulation, nodule formation, blood coagulation, clot formation through transglutaminase activity and melanisation through the prophenoloxidase cascade (Vazquez et al., 2009). It has also been documented that molecular chaperones, especially Hsp70, play a crucial role in protection to a wide range of abiotic and biotic stressors (Baruah et al., 2012; Todgham et al., 2005).
Our lab has previously reported the isolation and identification of Bacillus strains with the ability to degrade N-acylhomoserine lactones (AHLs), one of the major types of quorum sensing molecules involved in the regulation of virulence factor production in many bacterial pathogens (Defoirdt et al., 2004). The aim of the current study is to investigate the putative probiotic potential of one of the strains, Bacillus sp. LT3, using gnotobiotic brine shrimp (Artemia fransiscana) larvae as model organisms. The gnotobiotic system allows to eliminate or distinguish the effect of the microbiota that is naturally present in any type of aquatic environment (Marques et al., 2004). More specifically, we investigated the effect of the putative probiotic on the immune response and hsp70 gene expression of brine shrimp larvae (with and without challenge with luminescent Vibrios), the in vivo bioluminescence of the pathogen in association with the larvae (as an indication of pathogen activity), and the attachment of the larvae by both the probiotic strain and the pathogen.
2. Materials and Methods
2.1 Bacterial strains
The Bacillus sp. strain LT3 (Defoirdt et al., 2011) was used as potential 58 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii probiotics. The pathogenic strain V. campbellii LMG 21363 was used in challenge tests. Aeromonas sp. strain LVS3 (Verschuere et al., 1999) was used as feed for brine shrimp larvae. All strains were preserved at -80 oC in Marine Broth 2216 (Difco Laboratories, Detroit, MI. USA) with 20% sterile glycerol.
2.2 Preparation of bacterial cells, cell-free supernatant (CFS) and dead bacterial cells
The bacterial strains LT3, LMG 21363 and LVS3 were initially grown at 28 oC for 24 h on Marine Agar (Difco Laboratories, Detroit, MI. USA) and then to log phase in Marine Broth by incubation at 28 oC with continuous shaking. Bacterial cells and supernatant were collected after centrifuging the cultures at 3500 x g for 20 min. The bacterial cells used in the experiments were then carefully re-suspended in filtered autoclaved seawater (FASW). The CFS was prepared by filter-sterilizing the supernatant over a 0.22-µm filter. Dead bacterial cells were obtained by autoclaving the bacterial cells suspension at 121 oC for 20 min. Bacterial cell numbers were determined spectrophotometrically at 550 nm according to the McFarland standard (BioMerieux, Marcy L’Etoile, France), with an OD of 1.000 corresponding to 1.2 x 109 cells ml-1.
2.3 The effect of LT3 cell-free supernatant (CFS) on the growth of V. campbellii
CFS was collected from 3, 6, 12 and 24h old LT3 cultures, respectively. One ml aliquot from each CFS was then transferred to separate flasks containing 5 ml of fresh marine broth, before inoculating each flask with 100 µl of a 12h old V. campbellii culture (each treatment in triplicate). The V. campbellii cultures were incubated at 28 oC on an orbital shaker at 20 rev min-1 and samples were taken from each flask at 2, 4, 8, 12, 24 and 36 h for determining the growth of V. campbellii, by measuring absorbance at 550 nm with a Tecan Infinite 200 microplate reader (Tecan, Mechelen, Belgium).
2.4 Axenic hatching of brine shrimp larvae
Axenic larvae were obtained following decapsulation and hatching. Briefly, 2.5 59 Chapter 4 g of brine shrimp cysts originating from the Great Salt Lake (field collection), Utah, USA (EG Type, batch 21452, INVE Aquaculture, Dendermonde, Belgium) were hydrated in 89 ml of distilled water for 1 h. Sterile cysts and larvae were obtained via decapsulation using 3.3 ml NaOH (32%) and 50 ml NaOCl (50%). During the reaction, 0.22 µm filtered aeration was provided. All manipulations were carried out under a laminar flow hood and all tools were autoclaved at 121 oC for 20 min. The
-1 decapsulation was stopped after about 2 min by adding 50 ml Na2S2O3 at 10 g l . The aeration was then terminated and the decapsulated cysts were washed with filtered (0.2 µm) and autoclaved artificial seawater containing 35 g l-1 of instant ocean synthetic sea salt (Aquarium Systems, Sarrebourg, France). The cysts were suspended in 1-l glass bottles containing filtered and autoclaved artificial seawater and incubated for 28 h on a rotor at 4 rpm at 28 oC with constant illumination of approximately 2000 lux. The emerged larvae reached stage II (at which time they start ingesting bacteria) were collected.
2.5 Impact of LT3 on the in vivo bioluminescence of V. campbellii associated with brine shrimp larvae
Luminescence of V. campbellii associated with the larvae was determined every 6 h for a total period of 36 h following the method of Defoirdt and Sorgeloos (2012). Groups of 30 larvae (instar II) were distributed into 50 ml sterile falcon tubes containing 30 ml of FASW. LT3 was added to the rearing water at 106 cells ml-1 for 6 h prior to addition of V. campbellii (at 107 cells ml-1). Control treatments consisted of (i) Vibrio challenge only, (ii) LT3 only and (iii) no bacterial addition. Bioluminescence was measured every 6 h after challenge. At each time point, the larvae were collected and rinsed with FASW to remove the remaining V. campbellii in the rearing water. After rinsing, 200 µl aliquots with five larvae or without larvae were transferred into the wells of a 96-well plate and bioluminescence was measured with a Tecan Infinite 200 microplate reader. Every treatment was analysed in triplicate. The luminescence of V. campbellii associated with larvae was determined by
60 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii measuring luminescence of the wells containing the larvae and by correcting with bioluminescence of wells containing washing water of the same treatment.
2.6 Brine shrimp larvae survival studies
In total, three separate survival studies were conducted. In the first study, a dose response relationship of LT3 was determined. To this end, groups of 30 larvae (instar II) were transferred to sterile 40 ml glass tubes that contained 30 ml of FASW. The larvae were inoculated with increasing concentrations of LT3 (105, 106 and 107 cell ml-1) for 6 h and then challenged with V. campbellii at 107 cells ml-1. The amount of spent medium transferred into each treatment was balanced by adding a complementary volume of LT3 CFS. The larvae were fed with autoclaved LVS3 at 107cells ml-1. The larvae in the control group received only autoclaved LVS3 cells and LT3 CFS.
The second study involved verifying whether live cells were needed for the protective effect of LT3. The LT3 dose that gave the best protection (with the highest brine shrimp larvae survival) in the dose-response study was used. The larvae (instar II) were initially incubated with active or dead (autoclaved) LT3 cells for 6 h and then challenged with V. campbellii at 107 cells ml-1. The larvae either fed with only dead LVS3 at 107cells ml-1 or fed with dead LVS3 and live LVS3 (same dose as LT3) were used as controls. All treatments received autoclaved LVS3 at 107 cells ml-1 as feed.
In the third study, the effect of adding live LT3 cells at different time points (6 h prior to, 6 h after or simultaneously with V. campbellii) was determined. Autoclaved LVS3 were fed to the larvae in all the treatments. Live LT3 and autoclaved LVS3 were applied at 107 cells ml-1. All treatments were carried out in triplicate.
The survival of larvae was scored after 36 h of V. campbellii challenge in all the three studies. All manipulations were performed under a laminar flow hood. The germfree property of brine shrimp larvae used in all the survival assays was verified by spread-plating 100 ml of the hatching water on Marine Agar followed by incubating at 28 oC for 5 days.
61 Chapter 4
2.7 Assay of prophenoloxidase (proPO), transglutaminase (tgase) and heat shock protein 70 (hsp70) gene expression by reverse transcriptase realtime PCR
After 28 h incubation at 28 oC, swimming larvae were collected, counted volumetrically and transferred to 1-L sterile glass bottles. The larvae were incubated for 6 h with an optimized dose of active LT3 cells prior to V. campbellii challenge at 107 cells ml-1 or challenged with V. campbellii but not incubated with LT3. Non-challenged larvae fed with dead LVS3 or pre-incubated with LT3 were used as controls. Each treatment was carried out in triplicate. Samples containing 0.1 g of live larvae were harvested from all treatments and controls 6, 12, 24, 36 h after addition of V. campbellii, rinsed in cold distilled water, immediately frozen in liquid nitrogen and stored at -80 oC.
Total RNA was extracted from the larvae using TRIzol® (Invitrogen, Merelbeke, Belgium) according to the manufacturer’s instructions. Extracts were treated with RNase-free DNase to remove DNA contamination, after which the RNA was quantified spectrophotometrically (NanoDrop Technologies, Wilmington, DE, USA). RNA quality was confirmed by electrophoresis. First strand cDNA was synthesized from 1 µg total RNA using the RevertAid™ H minus First strand cDNA synthesis kit (Fermentas Gmbh, Germany) according to the manufacturer’s instructions.
The expression of proPO, tgase and hsp70 genes in brine shrimp was analyzed by realtime PCR using a pair of specific primers as shown in Table. 4-1 The realtime PCR amplifications were carried out in a total volume of 25 µl, containing 5.5 µl of nuclease free water, 1 µl of each primer, 12.5 µl of Maxima SYBR Green qPCR Master mix (Fermentas, Cambridgeshire) and 5 µl of cDNA template. Realtime PCR was performed in a One Step realtime PCR instrument (Applied Biosystems) using a four-step amplification protocol: initial denaturation (10 min at 95 oC); 40 cycles of amplification and quantification (15 s at 95 oC, 30 s at 60 oC, and 30 s at 72 oC); melting curve (55-95 oC with a heating rate of 0.10 oC s-1 and a continuous
62 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii fluorescence measurement) and cooling (4 oC). The β-actin gene was used as a reference gene.
Table. 4-1. Specific primers used for real-time quantitative polymerase chain reaction analysis of brine shrimp prophenoloxidase (proPO), transglutaminase (tgase), heat shock protein 70 (hsp70) and β-actin.
Gene Sequences of forward and reverse primers
(5’-3’) proPO tctgcaaggaggatttaagga
tgactgacaaaggagatgggac
Tgase tctctccgtgtctctccaaaag
ccccacaagaagcatctgaag hsp70 cgataaaggccgtctctcca
cagcttcaggtaacttgtccttg
β-actin agcggttgccatttcttgtt
ggtcgtgacttgacggactatct
In each pair, forward primers are presented first followed by the reverse primer
Relative quantification of target gene transcripts was done following the 2-ΔΔCT method as described previously (Okumura, 2007). The real-time PCR was validated by amplifying serial dilutions of cDNA synthesized from 1 µg of RNA isolated from
Artemia samples. Serial dilutions of cDNA were amplified, ΔCT (average CT value of target -average CT value of β-actin) was calculated for the different dilutions and plotted against the cDNA concentration. The slope of the graph was almost equal to 0 for all of the target genes. Therefore, the amplification efficiency of reference and the target genes was considered to be equal. The expression of the target genes was normalized to the endogenous control (β-Actin) by calculating ΔCT:
ΔCT = CT, target - CT, β-Actin
63 Chapter 4
and expressed relative to a calibrator control by calculating ΔΔCT:
ΔΔCT=ΔCT-ΔCT, calibrator
The brine shrimp larvae in the first measuring time points (6h) fed with dead LVS but not challenged by V. campbellii was used as the calibrator.
The relative expression was then calculated as:
Relative expression =2 –ΔΔCT
2.8 Determination of inhibition of V. campbellii attachment by strain LT3
Active LT3 cells were fed to brine shrimp larvae 6 h prior to or at the same time of V. campbellii LMG 21363. 24 hours after challenge, the larvae were collected to check the attachment of LT3 and VC by PCR-DGGE. The transient bacteria were removed by a cellulose purging method as previously described by Niu et al. (2012) . The amplification of bacterial DNA and Denaturing Gradient Gel Electrophoresis was carried out by following the procedure described in De Schryver et al. (2011). The amplification of brine shrimp DNA was avoided by using the nested-PCR procedure described by Bakke et al. (2010).
2.9 Statistical analysis
Survival data were arcsin transformed to satisfy normality and homoscedasticity requirements as necessary and then subjected to one-way analysis of variances followed by Duncan’s multiple range tests using the SPSS software, version 14.0 to determine significant differences among treatments. Results for gene expression quantification are presented as fold expression relative to brine shrimp β-Actin. The brine shrimp larvae in the first measuring time pointes (6h) fed with dead LVS3 but not challenged by V. campbellii was regarded as 1.0 and thereby the expression ratio of the other treatments was expressed in relation to the control. Significant differences in expression among control and treatments were analyzed by one-way analysis of
64 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii variances followed by Duncan’s multiple range tests. Significance level was set at p < 0.01.
3. Results
3.1 Impact of Bacillus sp. LT3 on the survival of Artemia challenged with Vibrio campbellii LMG 21363
To investigate whether Bacillus sp. LT3 could protect brine shrimp larvae against pathogenic V. campbellii, the larvae were treated with different doses (107, 106, 105 cells ml-1) of LT3 6h prior to challenge. All doses of LT3 significantly improved the survival of challenged larvae (Fig. 4-1). Administration of LT3 culture at the dose of 107 cells ml-1 provided the best protection, with no significant difference in survival between challenged larvae treated with LT3 and unchallenged larvae. Note that all treatments received the same dose of feed (autoclaved LVS3 cells) and cell-free supernatant of LT3.
Figure. 4-1. Survival of brine shrimp larvae 36 h after challenge with V. campbellii LMG 21363. The larvae were fed with dead LVS3 at 107 cells ml-1 and treated with LT3 at either 107 or 106 or 105 cells ml-1 6h before challenge. All treatments were carried out in triplicate. Treatments with different letters are significantly different (p < 0.01).
In a second experiment, we aimed at investigating whether live LT3 cells were required for the protective effect observed in the first experiment. Brine shrimp larvae
65 Chapter 4 were either incubated with live LT3 or dead LT3 at 107 cells ml-1 for 6 h prior to V. campbellii challenge. As a control, the same was done with Aeromonas sp. LVS3. In addition to the live or dead LT3 or LVS3 cells added as treatments, dead LVS3 cells at 107 cells ml-1 were added to all the treatments as a feed. As shown in Fig. 4-2, only live LT3 cells were able to protect the larvae from V. campbellii LMG 21363.
Figure. 4-2. Survival of brine shrimp larvae after 36 h of challenge with V. campbellii LMG 21363. The larvae were treated with either live or dead Bacillus sp. LT3, or live or dead Aeromonas sp. LVS3 6 h prior to challenge. Dead LVS3 was used as feed in all the treatments. All the bacteria were applied at 107 cells ml-1. All treatments were carried out in triplicate. Different letters indicate significant differences (p < 0.01).
In the previous experiments, we found that live LT3 could prevent mortality caused by V. campbellii LMG 21363 (i.e. when the LT3 cells were added 6 h prior to V. campbellii challenge). In a third experiment, we aimed at investigating whether addition of the strain also had a curative effect (i.e. when added at the moment of challenge or 6h after challenge). As shown in Fig. 4-3, protection was only observed if the larvae were treated with LT3 cells before challenge.
66 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii
Figure. 4-3. Survival of brine shrimp larvae after 36 h of challenge with V. campbellii LMG 21363 (VC). LT3 cells were added either 6 h prior to challenge (LT3 before VC), at the moment of challenge (LT3 with VC), or 6 h after challenge (LT3 after VC). Dead LVS3 (107 cells ml-1) was used as feed in all the treatments. All treatments were carried out in triplicate. Different letters indicate significant differences (p < 0.01).
3.2 The effect of Bacillus sp. LT3 supernatants on V. campbellii growth in vitro
Cell-free supernatants (CFS) were collected from different time points during LT3 growth (3, 6, 12 and 24h) and added to V. campbellii cultures in order to investigate whether the strain produced any growth-inhibitory substances. However, no significant effect of LT3 CFS on the growth kinetics of V. campbellii was observed (data not shown), indicating that the strain did not produce any extracellular substance that inhibits growth of V. campbellii.
3.3 Bacillus LT3 and V. campbellii attachment of brine shrimp and impact of LT3 on in vivo bioluminescence activity of brine shrimp-associated V. campbellii
We used our previously established DGGE-based protocol to investigate the attachment of LT3 and V. campbellii in the intestine of brine shrimp larvae, in which luminal bacteria and gut content are removed by purging with cellulose particles. DGGE analysis showed that when LT3 and V. campbellii were applied simultaneously,
67 Chapter 4
LT3 was almost undetected (Fig. 4-4). Interestingly, when Artemia was pre-incubated with LT3, the LT3 bands were as dominant as the V. campbellii bands.
Figure. 4-4. DGGE patterns indicating attachment of LT3 and V. campbellii LMG 21363 in brine shrimp larvae intestine. Lane A: pure culture of LT3; Lane B: pure culture of V. campbellii LMG 21363; Lane C: mixture of the pure culture of LT3 and V. campbellii LMG 21363; Lane D, E, F: three replicates representing the larvae pre-incubated with LT3 for 6 hours before challenge; Lane G, H, I: three replicates representing the larvae inoculated with LT3 and V. campbellii LMG 21363 simultaneously.
Bioluminescence of luminescent Vibrios is a sensitive indicator of their activity, which is moreover linked to virulence. Therefore, to determine the effect of LT3 on the V. campbellii activity in vivo, the luminescence of brine shrimp-associated V. campbellii (without or with LT3 addition 6h prior to challenge) was measured every 6 h. The in vivo bioluminescence of V. campbellii showed a peak at 18 to 24 h in the absence of LT3, while it was significantly reduced when the larvae were treated with LT3 (Fig. 4-5). Meanwhile, no significant bioluminescence was detected in the axenic group and the group treated with LT3 only.
68 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii
Figure. 4-5. In vivo bioluminescence of V. campbellii LMG 21363 associated with 5 brine shrimp larvae. The larvae were either or not challenged with V. campbellii LMG 21363 (VC), and either or not treated with LT3 (6h prior to challenge). Error bars represent the standard deviation of 3 replicates. For each time point, different letters indicate a statistical difference of bioluminescence (p < 0.01).
3.4 Innate immune response of brine shrimp larvae after treatment with Bacillus sp. LT3
In the following experiment, we investigated the innate immune response due to LT3 treatment by measuring the relative gene expression of the prophenoloxidase (proPO) and transglutaminase (tgase) genes at different time points after challenge with V. campbellii (LT3 was added 6h prior to challenge). As shown in Fig. 4-6, the proPO mRNA level slightly increased throughout the experiment in the axenic control and the proPO mRNA level at 36 h post challenge was significantly higher than it was after 6 h of challenge (p < 0.01). Meanwhile, throughout the experiment, the proPO gene expression maintained at the same level in the larvae either only treated with LT3 or only challenged with V, campbellii. Interestingly, after 12 h of challenge, proPO mRNA levels in larvae that were pre-treated with LT3 followed by V. campbellii challenge were approximately 8-fold higher (p < 0.01) than in the other treatments and then decreased to the same level as the other treatments 24h after challenge.
69 Chapter 4
Figure. 4-6. Relative expression of prophenoloxidase (proPO) in brine shrimp larvae, either or not challenged with V. campbellii LMG 21363 (VC), and either or not treated with Bacillus sp. LT3 6h prior to challenge. All treatments were fed with dead LVS3 cells (107cells ml-1). proPO mRNA levels were expressed relative to β-actin, The expression in the axenic control at the 6h point was set at 1, and the other data points were normalized accordingly using the 2 –ΔΔCT method. Bars indicate the standard error of three replicates. Significant differences among the treatments are indicated by different letters (p < 0.01).
As shown in Fig. 4-7，6 h after challenge, a significantly higher expression of tgase was observed in the larvae only treated with LT3 or only challenged with V. campbellii or pre-treated with LT3 before challenge comparing to the axenic control (p < 0.01). 12h after challenge, the tgase mRNA level was significantly up-regulated in all the treatments when compared to 6h post challenge, however, no significant differences were observed among treatments. Interestingly, 24 and 36-h post challenge, the tgase gene was significantly up-regulated in the larvae challenged with V. campbellii (p < 0.01).
70 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii
Figure. 4-7. Relative expression of transglutaminase (tgase) in brine shrimp larvae, either or not challenged with V. campbellii LMG 21363 (VC), and either or not treated with Bacillus sp. LT3 6h prior to challenge. All treatments were fed with dead LVS3 cells (107cells ml-1). tgase mRNA levels were expressed relative to β-actin. The expression in the axenic control at the 6h point was set at 1, and the other data points were normalized accordingly using the 2 –ΔΔCT method. Bars indicate the standard error of three replicates. Significant differences among the treatments are indicated by different letters (p < 0.01).
3.5 Heat shock protein 70 (hsp70) gene expression in brine shrimp after treatment with Bacillus sp. LT3
It has been reported in previous studies that induction of heat shock protein Hsp70 could provide sequential protection to brine shrimp larvae against Vibrio campbellii challenge (Baruah et al., 2011). Therefore, in this experiment, we also investigated whether LT3 could affect hsp70 gene expression. As shown in Fig. 4-8, 12h after challenge, hsp70 gene expression was significantly up-regulated in all the treatments comparing to 6h after challenge; moreover, the hsp70 mRNA level in the larvae challenged with V. campbellii was significantly higher than in the other treatments (p < 0.01). 24h after challenge, the hsp70 gene expression in the larvae challenged with V. campbellii was still higher than in the other treatments (although levels were lower than those at the 12 h point). Finally, no significant differences were observed after 36h.
71 Chapter 4
Figure. 4-8. Relative expression of hsp70 gene in brine shrimp larvae, either or not challenged with V. campbellii LMG 21363 (VC), and either or not treated with Bacillus sp. LT3 6h prior to challenge. All treatments were fed with dead LVS3 cells (107cells ml-1). Hsp70 mRNA levels were expressed relative to β-actin. The expression in the axenic control at the 6h measuring point was set at 1, and the other data points were normalized accordingly using the 2 –ΔΔCT method. Bars indicate the standard error of three replicates. Significant differences among the treatments are indicated by different letters (p < 0.01).
4. Discussion
The use of probiotics has been reported as a worthy practice for aquaculture in order to control pathogens and/or to enhance the immune responses of the host (Balcazar et al., 2006; Pérez et al., 2010; Verschuere et al., 2000). Although several studies have demonstrated the beneficial effects of probiotics on cultured crustaceans, such as shrimp (Liu et al., 2009; Shen et al., 2010; Wang, 2007), the exact mechanism of action is often not well described, and the natural microbiota often compromise the interpretation of the results (Tinh et al., 2008). In order to avoid this kind of bias, in this study, a gnotobiotic model system with brine shrimp larvae was applied to test the potential probiotic effect of Bacillus strain LT3. We found that the strain significantly improved survival of brine shrimp larvae challenged to pathogenic V. campbellii if it was administered 6h before challenge. Because all the treatments received the same volume of LT3 culture supernatants, we could exclude the possibility that the protection was due to an extracellular compound produced by the strain during the
72 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii pre-culture. Moreover, as autoclaved LT3 cells did not confer protection, we could conclude that the probiotic effect of LT3 is associated with live cells.
In a further series of experiments，we investigated the impact of the Bacillus strain on the pathogenic V. campbellii strain. Although previous studies have reported that the production of antagonistic substances by probiotic Bacillus species was responsible for their protective effects (Okumura, 2007; Soderhall and Cerenius, 1998), strain LT3 did not show any growth inhibitory effect towards V. campbellii in vitro. Moreover, the strain did not prohibit the pathogen from attaching to brine shrimp larvae. In fact, LT3 was only able to attach to the larvae if it was administered 6h before challenge, which is also consistent with the observation that the strain only offered protection if administered prior to challenge. Furthermore, pre-treatment of brine shrimp larvae with Bacillus LT3 decreased the in vivo bioluminescence of V. campbellii associated with brine shrimp larvae. Bioluminescence is a sensitive measure of activity in general and quorum sensing activity of luminescent Vibrios in specific (Defoirdt and Sorgeloos, 2012). Therefore, our observations suggest that Bacillus LT3 decreases activity of V. campbellii in vivo rather than inhibiting its growth, and this might be one of the factors contributing to the protective effect of strain LT3. In view of the problems associated with the development and spread of antibiotic resistance, scientists are recently arguing that with respect to controlling bacterial disease we need to shift our focus from killing to ‘disarming’ the pathogens, a strategy that has been termed antivirulence therapy (Clatworthy et al., 2007; Defoirdt, 2013b). Compared to antibacterial therapies, the major advantages of this strategy are that it does not affect the harmless microbiota and that the selective pressure to develop resistance will probably be lower (though not absent) (Defoirdt, 2013a).
In addition to its effect on the pathogen, we also studied the effect of Bacillus sp. LT3 on the immune defense of the brine shrimp host. In invertebrates including brine shrimp, immunity mostly relies on innate immune defenses. We focused on prophenoloxidase (proPO) and transglutaminase (tgase) gene expression as these two
73 Chapter 4 genes are important constituents of the innate immune repertoire of crustaceans, and are responsible for melanisation and coagulation, respectively. ProPO-activating system constitutes a major component of the innate immune system of crustaceans, serving as an important second defense line of the host with fast response against pathogen invasion (Cerenius et. al., 2004). There are ample evidences that the proPO-activating system is stimulated by cell wall components, including LPS and peptidoglycan, from microorganisms (Okumura, 2007; Soderhall and Cerenius, 1998). Consistent with this, we observed a twofold up-regulation of proPO gene expression in brine shrimp larvae receiving LT3 and/or or V. campbellii when compared to the axenic control after 6h of exposure. Compared to the early studies (Liu et al., 2010; Zokaeifar et al., 2012), the proPO gene up-regulation in our study was minor. However, the stronger proPO gene response in the study of Liu and Zokaeifar may be associated with the high dose of Bacillus (108 or 109 cells ml-1) and the challenge via injection. Interestingly, in the group where the larvae were exposed to LT3 for 6h before V. campbellii challenge, a significantly higher expression of proPO was observed after 12h of challenge when compared to the larvae challenged with V. campbellii without pretreatment, suggesting a priming effect (i.e. increased innate immune activity after first exposure to an immunomodulating agent). Baruah et al. (2011) also demonstrated that previous exposure to heat shock protein 70 resulted in up-regulation of the proPO gene in brine shrimp Artemia franciscana larvae when challenged with V. campbellii. Although many studies, including ours, showed significant interaction between the proPO gene regulation and the pathogens infection, the use of this gene as a marker for immune response against pathogen invasion cannot be rightfully extrapolated. Other studies also showed the noneffectiveness of pathogen infection on the stimulation of proPO genes (Decaestecker et. al., 2011). The pathogen infection and proPO gene regulation was suggested to tbe host-pathogen specific and condition dependent (Decaestecker et. al., 2011). In addition, multiple proPO genes were reported in insects and shrimp (Wang et. al, 2011; Amparyup et. al., 2009), suggesting different action modes of these defensive
74 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii genes. Thus in the future studies, using proPO gene as a maker to evaluate the host immune response, the selection of the right host-pathogen mole and the screening of responsible proPO gene are of crucial importance.
The second immune factor we investigated, the transglutaminase (tgase) gene, is involved in the coagulation or clot formation, one of the most important innate immune responses in crustaceans. Its quickness and efficiency in forming a physical barrier to avoid the loss of body fluid and prevent the dissemination of microbes into the haemocoel is essential for the survival of invertebrates. We observed significantly higher tgase gene expression in the larvae that were only subjected to V. campbellii challenge (24 and 36h after challenge) when compared to the other treatments. This result is consistent with the previous studies demonstrating that Vibrio infection can increase tgase expression (Defoirdt et al., 2007b). Interestingly, no significant up-regulation of tgase was observed in the larvae pre-treated with LT3 followed by V. campbellii challenge. Gunasekara et al. (2012) previously reported that V. campbellii LMG 21363 caused damage to the brine shrimp gut epithelium. Based on the observations made in this study, we hypothesize that pre-treatment of LT3 resulted in priming of potent defense proteins (e.g. the proPO system as manifested by an increased expression of proPO), which upon challenge probably prevented tissue damage caused by V. campbellii and thus less need for haemolymph clotting (as reflected in the lower level of tgase expression in larvae pretreated with LT3 followed by challenge with V. campbellii).
Molecular chaperones, especially heat shock protein 70 (Hsp70), play a crucial role in the quality control of proteins and have protective effects under detrimental conditions caused by a wide range of abiotic and biotic stressors (Roberts et al., 2010). A previous study reported that induction of Hsp70 in Artemia through a non-lethal heat shock is associated with subsequent protection against virulent Vibrios (Sung et al., 2007). However, in our study, no significant up-regulation of Hsp70 gene by LT3 administration was observed which indicated that the protection was not exerted through the induction of Hsp70. Meanwhile, a lower hsp70 gene expression level in
75 Chapter 4 the brine shrimp larvae treated with LT3 before V. campbellii challenge was observed (when compared to larvae challenged with V. campbellii without pretreatment), suggesting that LT3 treatment reduced the stress (tissue damage) associated with V. campbellii infection.
In our study, only one reference gene (β-actin) was used to calculate the expression of the targeted genes. It is now recommended that more than one reference gene should be provided to calculate the relative expression of a target gene (Fernandes et. al., 2008). However, β-actin is a well-known reference gene for Artemia and a well-established reference gene in the previous work of our lab (Baruah et. al., 2011). In addition, other reference genes for Artemia franciscana were not available when we performed these experiments. In this context, we chose only β-actin gene as our reference gene. Throughout the experiments, the β-actin gene was shown to be stable among different treatments.
As the genome of Artemia franciscana is available in our lab, baseline studies could be carried out to select more candidates for the housekeeping genes of Artemia franciscana. Appendix A-Table 1 provides the examples o candidates for housekeeping genes of Artemia franciscana).
In conclusion, the results presented in this paper showed that Bacillus strain LT3 can improve the survival of brine shrimp larvae when challenged with pathogenic V. campbellii, both by decreasing the in vivo activity of the pathogen and by priming the innate immune response through activating the proPO system. A decreased expression of transglutaminase and heat shock protein 70 further suggests that pretreatment with LT3 results in less stress and tissue damage in the brine shrimp larvae upon V. campbellii challenge.
Acknowledgments
This study was supported by Ghent University, Belgium (PhD-BOF scholarship to Niu Yufeng), Ghent University project ‘Host microbial interactions in aquatic production’ (BOF12/GOA/022) and Research Foundation Flanders (FWO, Belgium)
76 Bacillus sp. LT3 improves the survival of gnotobiotic Artemia challenged with V. campbellii projects (1.5.013.12.N and FWO3E02013000201). TD and KB are postdoctoral fellows of FWO.
77 Chapter 4
78
PART III
ARTEMIA-MICROBE INTERACTION ASSOCIATED WITH HEAT SHOCK PROTEIN INDUCING COMPOUND
CHAPTER 5
Effect of Heat Shock Protein Inducer--Tex-OE® on Brine shrimp Artemia franciscana larvae under sub-optimal rearing condition
Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Chapter 5
Effect of Heat Shock Protein Inducer Tex-OE® on Brine shrimp Artemia franciscana larvae under sub-optimal rearing conditions
ABSTRACT
In aquaculture production systems, many potential pathogens, such as bacteria, fungi and viruses, co-exist with the farmed animals without causing a negative impact on production. However, some opportunistic bacteria may lead to acute diseases if farmed animals become stressed, resulting in significant industry losses. Recently, the compound Tex-OE®, a patented extract from the skin of the prickly pear fruit, Opuntia ficus indica, was reported to enhance the production of Hsp70 in animal tissues without any adverse effect, protecting the animal against various abiotic stressors. In our lab, studies have been carried out on gnotobiotic brine shrimp Artemia franciscana to investigate the mode of action of this compound. However, the effect of this compound on the immune response and the microbial communities of the animals reared under conventional condition were not reported. In this study, we try to evaluate the effect of Tex-OE® on Artemia cultured under a sub-optimal and non-gnotobiotic rearing conditions by using different administration strategies. The survival of Artemia was significantly increased by pretreatment of Tex-OE® at 160 μl l-1 for 1 h in filter autoclaved sea water or by inoculating the Tex-OE® of 160 μl l-1 in the rearing water. Pretreatment of Tex-OE® under conventional condition did not confer protection to Artemia. Tex-OE® pretreatment elicited the innate immune response of Artemia by enhancing the prophenoloxidase gene expression. In addition, Tex-OE® pretreatment reduced the richness and evenness of gut resident microbial community of Artemia. From these results, it was demonstrated that the compound Tex-OE® has the potential to be used as a health improving and immunostimulating strategy in aquaculture systems. However, care has to be taken in
79 Chapter 5 the dose and application strategies, as over exposure of this compound may lead to negative effect on the animals.
80 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
1. Introduction
Disease outbreaks are considered as a significant constraint for aquaculture development in many countries (Defoirdt et al., 2011; FAO, 2012). Traditionally, the use of antibiotics has partially alleviated the problem of bacterial diseases in aquaculture organisms. However their massive (mis)use has led to the development of (multiple) antibiotic-resistant bacteria (Cabello, 2006). As a consequence, antibiotic treatment at present is often ineffective to treat bacterial diseases, moreover, the antibiotic-resistant bacteria due to the use of antibiotics might horizontally transfer the antibiotic-resistant gene to the bacteria in the surrounding environment (Hoa et al., 2011). In this context, many novel approaches, such as probiotics administration, immunostimulation and heat shock proteins (Hsps) induction, have been investigated as alternatives to antibiotics for effective control of bacterial infections (Roberts et al., 2010; Ringø, 2011; Pandiyan et al., 2013).
A series of studies have shown stress-tolerant induction associated with heat shock proteins (Hsps) stimulation in non-aquacultural animals (Sejerkilde et al., 2003; Collins and Clegg, 2004; Todgham et al., 2005). In line with these findings, the application of molecular chaperones or Hsps, particularly Heat shock protein 70 (Hsp70), has been suggested as a potential health improving and anti-stress strategy in aquaculture (Roberts et al., 2010). Recently, Pro-Tex®, which contains the active compound Tex-OE®, a patented extract from the skin of the prickly pear fruit, Opuntia ficus indica, has been reported to act as a non-stressful precursor that induces high levels of endogenous or host-derived Hsps in animal tissues (Roberts et al., 2010). This extract was originally developed as a stress/fatigue modulating compound for divers working in seaweed aquaculture in Malta (Guttierez et al., 2005). Later studies showed that pre-exposure to Tex-OE® can rapidly stimulate the production of Hsps and the Hsps levels induced were also higher than those in unexposed animals (Balucci, 2005). Several studies have investigated the effect of Tex-OE® on aquaculture animals. In the study performed by Camilleri (2002), raised Hsps level
81 Chapter 5 was observed in angel fish, Pterophyllum scalare, pre-treated with Tex-OE® and the pre-treatment also provided protection against several toxic compound. Besides the tolerance against toxic compound, Tex-OE® prestimulation also increased the survival of salmon and sea bream, Sparus aurata after the infection by V. anguillarum (ElFituri, 2009). In another study of Sung et al. (2012), the author demonstrated that Tex-OE® pre-exposure increased the survival of common carp, Cyprinus carpio L. for 20% over the non-exposed controls during lethal ammonia challenge. In addition to the studies on fish, a recent study from Baruah et al. (2012) performed on brine
® shrimp Artemia franciscana larvae, demonstrated that pretreatment with Tex-OE at 40μl l-1 for 1 h could significantly enhance the production of Hsp70 and provide subsequent protection to Artemia against abiotic stressors such as thermal challenge under gnotobiotic condition. The findings obtained from this study under gnotobiotic conditions have provided strong evidence that the beneficial effect of Tex-OE® administration is associated with Hsp70 induction. Based on the reports of the anti-stress effect of Tex-OE®, it has been commercially applied to reduce transportation stress in fish (Roberts et al., 2010). It has also been suggested to have the potential of countering anticipated stress during various aquaculture operations (Baruah et al., 2012). However, in the aquaculture system, constant interaction stands between the host and microbiota in the rearing system (Olafsen, 2001). So any change, such a Hspi application, may influence the host gut microbial community and mediate the host immune response, eventually affecting the health of the animal (Forberg et al., 2012; Ivanov and Honda, 2012). Thus, to further explore the application of Tex-OE®, it is necessary to study the impact of this compound on the host immune response and the microbes associated with the host.
In this study, as an extension of the study of Baruah et al. (2012), we try to evaluate the effect of this compound on Artemia in a sub-optimal and non-gnotobiotic rearing conditions by using different administration strategies. To further investigate the impact of this compound on the Artemia, we tested the effect of Tex-OE® on the innate immune response of Artemia by measuring the immune related genes
82 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions expression. In addition, we also investigated whether Tex-OE® pre-treatment could interfere with the gut microbial community of Artemia.
2. Materials and method
2.1 Brine shrimp Artemia fransiscana larvae rearing water preparation
The rearing water for the Artemia used in this experiment was obtained from the, 6,000-l recirculation system for P. vannamei in the Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Belgium. Water temperature was kept at 27 ± 1℃and salinity at 35 ± 1 g l-1. Biofiltration and regular water changes kept total ammonia-N below 0.5 mg l-1 and nitrite-N below 0.15 mg l-1. The room was illuminated 12 h per day by dimmed TL-light. As shown in Table. 5-1, the preliminary tests showed that the survival of Artemia incubated in the shrimp rearing water for 36h was significantly lower than the Artemia reared in filter autoclaved sea water (FASW). Thus, in this study, the shrimp rearing water was used as a sub-optimal medium for rearing Artemia and to investigate the effect of Tex-OE®.
Table. 5-1. Survival of Artemia incubated in sterile sea water and shrimp rearing water. Incubation water Survival of Artemia (%) filter autoclaved sea water (FASW) 84 ± 6.5 shrimp rearing water 55 ± 9.3
2.2 Axenic hatching of Artemia
Axenic Artemia were obtained following decapsulation and hatching (Baruah et al., 2010). Briefly, 2.5 g of brine shrimp larvae cysts originating from the Great Salt Lake (field collection), Utah, USA (EG Type, batch 21452, INVE Aquaculture, Dendermonde, Belgium) were hydrated in 89 ml of distilled water for 1 h. Sterile cysts and nauplii were obtained via decapsulation using 3.3 ml NaOH (32%) and 50 ml NaOCl (50%). During the reaction, 0.22 µm filtered aeration was provided. All manipulations were carried out under a laminar flow hood and all tools were autoclaved at 121 oC for 20 min. The decapsulation was stopped after about 2 min by
83 Chapter 5
-1 adding 50 ml 10 g L Na2S2O3. The aeration was then terminated and the decapsulated cysts were washed with filtered (0.2 µm) and autoclaved artificial seawater (FASW) containing 35 g 1 L-1 of instant ocean synthetic sea salt (Aquarium Systems, Sarrebourg, France). The cysts were suspended in 1-L glass bottles containing FASW and incubated for 28 h on a rotor at 4 rpm at 28 oC with constant illumination of approximately 27 μE m-2 sec-1. To produce InstarII nauplii, the stage at which they start to ingest bacteria. The nauplii were then harvested on a 100 μm sieve and washed with FASW.
2.3 Administration of Tex-OE® on Artemia
The compound Tex-OE® (hereafter referred to as ‘Hspi’ for Hsp-inducing compound), supported in food grade ethanol, was kindly provided by Bradan Ltd Campbeltown. It was stored at room temperature until use. To investigate the effect of Hspi on Artemia incubated under a sub-optimal condition, two separate experiments were carried out.
The first experiment determined the dose-response of Hspi administration. For that, Hspi were administrated with 3 different strategies: (i) PA strategy, in which the Artemia were pre-treated for a fixed time (1h) in FASW with increasing concentrations of Hspi (20, 40, 80, 160, 320 μl l-1) or with absolute ethanol (320 μl l-1) alone as control. After the pretreatment the Artemia were then rinsed repetitively with FASW followed by incubation in shrimp rearing water. (ii) PX strategy, in which the Artemia were pre-treated for 1h in shrimp rearing water with the same concentrations of Hspi as used in the PA strategy or with absolute ethanol alone as control. After the pretreatment, the Artemia were then rinsed repetitively with FASW followed by incubation in new shrimp rearing water. (iii) CI strategy, in which the Artemia were incubated with Hspi or with absolute ethanol in shrimp rearing water by using the same concentrations as used in the other strategies. A negative control was maintained without the addition of Hspi and ethanol. The survival of the Artemia was scored 36 h post incubation in the shrimp rearing water.
84 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
The second experiment determined the time-response of Hspi pre-treatment by using the PA and PX strategy. For that, the Artemia were pre-treated with the Hspi (40 or 160 μl l-1) or absolute ethanol (160 μl l-1) in FASW or shrimp rearing water for different time periods (1, 2 or 4h). The Artemia were then rinsed and incubated in shrimp rearing water by following the procedure described in the experiment above. Negative controls were also maintained without the treatment of Hspi and ethanol. The survival of the Artemia was scored 36 h post incubation in the shrimp rearing water.
2.4 Impact of Hspi pre-treatment (PA) on the innate immune response of Artemia.
Artemia were pre-treated with Hspi of 160 µl l-1 for 1 hour or with absolute ethanol of 160 µl l-1 as the ethanol control. After the pre-treatment, the Artemia were rinsed with FASW repetitively and transferred to shrimp rearing water. The larvae were then subjected to incubation in the shrimp rearing water for 36 h and the samples were collected at 3, 6, 9, 12, 24, 36h during incubation for the study of immune gene expression. Artemia receiving no Hspi and ethanol were kept as negative control. Each treatment was carried out in triplicate. Samples containing 0.1 g of live larvae were harvested from all treatments and controls, rinsed in cold distilled water, immediately frozen in liquid nitrogen and stored at -80 oC.
Total RNA was extracted from the Artemia using TRIzol® (Invitrogen, Merelbeke, Belgium) according to the manufacturer’s instructions. Extracts were treated with RNase-free Dnase (Dnase I, Fisher scientific, Aalst, Belgium) to remove DNA contamination, after which the RNA was quantified spectrophotometrically (NanoDrop Technologies, Wilmington, DE, USA). RNA quality was confirmed by electrophoresis. Single strand cDNA was synthesized from 1 µg total RNA using the Revert Aid™ H minus First strand cDNA synthesis kit (Fermentas Gmbh, Germany) according to the manufacturer’s instructions.
The expression of the prophenoloxidase (proPO) gene and the transglutaminase (tgase) gene in the treated Artemia was analyzed by realtime PCR using a pair of
85 Chapter 5 specific primers as shown in Table. 5-2. The realtime PCR amplifications were carried out in a total volume of 25 µl, containing 9.7 µl of nuclease free water, 0.4 µl of each primer (0.3 μM), 12.5 µl of Maxima SYBR Green qPCR Master mix
(Fermentas, Cambridgeshire containing 2.5mM MgCl2) and 2 µl of cDNA template. Realtime PCR was performed in a One Step realtime PCR instrument (Applied Biosystems) using a four-step amplification protocol: initial denaturation (10 min at 95 oC); 40 cycles of amplification and quantification (15 s at 95 oC, 30 s at 60 oC, and 30 s at 72 oC); melting curve (55-95 oC with a heating rate of 0.10 oC s-1 and a continuous fluorescence measurement) and cooling (4 oC). The β-actin gene was used as a house keeping gene.
Relative quantification of target gene transcripts was done following the 2-ΔΔCT method as described (Okumura, 2007). The real-time PCR was validated by amplifying serial dilutions of cDNA synthesized from 1 μg of RNA isolated from
Artemia samples. Serial dilutions of cDNA were amplified, ΔCT (average CT value of target –average CT value of β-actin) was calculated for the different dilutions and plotted against the cDNA concentration. The slope of the graph was almost equal to 0 for all of the target genes. Therefore, the amplification efficiency of reference and the target genes was considered to be equal. The expression of the target genes was normalized to the endogenous control (β-Actin) by calculating ΔCT:
ΔCT = CT, target – CT, β-Actin and expressed relative to a calibrator control by calculating ΔΔCT:
ΔΔCT=ΔCT-ΔCT, calibrator
Gene expression in brine shrimp larvae at the first sample points (3h) was used calibrator.
The relative expression was then calculated as:
Relative expression =2 –ΔΔCT
86 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Table. 5-2. Specific primers used for real-time quantitative polymerase chain reaction analysis of brine shrimp prophenoloxidase (proPO) gene, transglutaminase (tgase) gene, heat shock protein 70 (hsp70) gene and β-actin gene. Gene Sequences of forward and reverse primers (5’-3’) proPO tctgcaaggaggatttaagga tgactgacaaaggagatgggac Tgase tctctccgtgtctctccaaaag ccccacaagaagcatctgaag β-actin agcggttgccatttcttgtt ggtcgtgacttgacggactatct
In each pair, forward primers are presented first followed by the reverse primer
2.5 Impact of Hspi pretreatment on intestinal microbial community composition of Artemia
When collecting the samples for the innate immunity gene expression, 0.1 g of Artemia were pooled from each treatment for the analysis of the intestinal microbial community composition (MC) by PCR-DGGE. The composition of the luminal MC and resident MC were analyzed as previously described in Chapter 3. The extraction and the amplification of bacterial DNA and Denaturing Gradient Gel Electrophoresis was carried out by following the procedure described in Chapter 3. The amplification of Artemia DNA was avoided by using the nested-PCR procedure described in Chapter 3.
2.6 Statistical analysis and DGGE gel processing
Survival data were arcsin transformed to satisfy normality and homoscedasticity requirements as necessary and then subjected to one-way analysis of variances followed by Duncan’s multiple range tests using the SPSS software, version 14.0 to determine significant differences among treatments. Two–way ANOVA was performed to determine the interaction between the experimental factors. Results for gene expression quantification are presented as fold expression relative to brine
87 Chapter 5 shrimp β-Actin gene. The gene expression in brine shrimp larvae at the first sampling point (3h) was regarded as 1.0 and thereby the expression ratio of the other treatments was expressed in relation to the control. Significant differences in expression among control and treatments were analyzed by one-way analysis of variances followed by Duncan’s multiple range tests. Significance level was set at p < 0.05.
The processing of the DGGE fingerprinting patterns was performed with Bionumerics version 5.1 software (Applied Maths, Belgium). This program converts band profiles to histograms, where the peaks correspond to DGGE bands. Peak areas, whose values reflect the intensities of the bands, were exported to Excel spread sheets and used for statistical analysis. To normalize for variations in amounts of PCR product loaded in the wells, individual peak areas for DGGE bands were divided by the sum of the peak areas for the respective DGGE profile. Bray–Curtis similarities (Bray and Curtis, 1957) were used to compare DGGE profiles of samples, and was calculated based on square root transformed, normalized peak areas to reduce the impact of strong bands. The richness of the microbial community was calculated based on the number of bands in each sample and the evenness of the microbial community was visualized by using the Pareto–Lorenz curves Marzorati et al. (2008).
3. Result
3.1 Effect of Hspi on survival
Test 1: Dose-effect of Hspi on survival
In this initial study, the effect of varying doses of Hspi supplied to Artemia with different strategies was investigated. As shown in Fig. 5-1 (PA), Hspi supplied by PA strategy significantly increased the survival at 40, 80 and 160 µl l-1 as compared to the controls, while there was only significant increase of survival at 40 µl l-1 for the PX strategy (Fig. 5-1 PX) and at 80 and 160 µl l-1 for CI strategy (Fig. 5-1 CI). The highest Hspi concentration 320 µl l-1 did not increase the Artemia survival for all three application strategies.
88 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Figure. 5-1. Survival (%) of Artemia 36 h after incubation in shrimp rearing water. The Artemia were pre-treated by Hspi with different strategies. PA: Artemia were pre-treated by Hspi or by absolute ethanol (320 µl l-1) in FASW. They are then rinsed repeatedly with FASW and allowed to recover in FASW for 1 h followed by incubation in shrimp rearing water. PX: Artemia were pre-treated by Hspi or absolute ethanol (320 µl l-1) in shrimp rearing water and then rinsed, recovered and incubated in shrimp rearing water following the procedure of the PA strategy. CI, Artemia were incubated with Hspi or absolute ethanol (320 µl l-1) in shrimp rearing water. In all strategies, Artemia only treated with ethanol and Artemia receiving no Hspi and ethanol served as controls. Columns represents mean ± SD of five replicates. Different letters indicate significant difference (p < 0.05).
Test 2: Time-effect of Hspi on survival
In this experiment, we evaluated the effect of Hspi pre-treatment duration in PA and PX strategies. The CI strategy was not considered in this experiment, because it was a continuous incubation strategy. Artemia were pre-treated with the highest and the lowest doses that showed significant effect in PA and PX strategies from the last dose-effect experiment (40 and 160 μl l-1). To investigate the effect of pretreatment time, the Artemia were pretreated with Hspi for 1 h, 2 h or 4 h. As shown in Table. 5-3, pretreatment of Hspi with PA strategy at both 40 and 160 μl l-1 significantly improved the survival of Artemia in the shrimp rearing water (p < 0.05, one-way ANOVA) as compared to the ethanol controls (except for pretreatment with Hspi at 160 μl l-1 for 4h). Both Hspi concentration and pretreatment time significantly
89 Chapter 5 affected the survival of Artemia in shrimp rearing water (p < 0.05, two-way ANOVA). However, no interaction was noted (p > 0.05, two-way ANOVA) between these two factors on the survival of Artemia.
When pretreating the Artemia with Hspi following the PX strategy, the dose 40 μl l-1 did not significantly improve the survival of Artemia in the shrimp rearing water (p > 0.05, one-way ANOVA) as compared to the ethanol controls (Table. 5-4). Moreover, pretreatment of Hspi at the dose of 160 μl l-1 for 1 or 2 or 4h led to adverse effect on the survival of Artemia (Table. 5-4). Hspi concentration significantly affected the survival of Artemia in shrimp rearing water; while pretreatment time did not exert significant effect on the survival (p < 0.05, two-way ANOVA). Two– factorial analysis on the factors Hspi concentration and pretreatment time did not reveal interaction between the two (p > 0.05).
Table. 5-3. Survival of Artemia 36h post incubation in shrimp rearing water. The Artemia were treated with Hspi at different doses and for different time by PA strategy.
Treatments Survival of Artemia (%) Hspi concentration (µl l-1) Pretreatment time (h) 0 (ethanol 160 µl l-1) 1 34±5 de 0 (ethanol 160 µl l-1) 2 25±5 e 0 (ethanol 160 µl l-1) 4 28±5 e 40 1 58±10 ab 40 2 56±7 abc 40 4 48±1 1 bc 160 1 64±8 a 160 2 54±5 abc 160 4 43±3 cd Hspi concentration factor Significant p < 0.05 Pretreatment time factor Significant p < 0.05 Interaction Not significant p > 0.05
Values are average ± SE, n = 3. Significant differences among all the treatments were analyzed by one-way ANOVA. Different superscript letters within columns denote significant differences (p < 90 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
0.05). Two–way ANOVA was performed to determine the interaction between the experimental factors in experiment
Table. 5-4. Survival of Artemia 36h post incubation in shrimp rearing water. The Artemia were treated with Hspi at different doses and for different time by the PX strategy
Treatments Survival of Artemia (%) Hspi concentration (µl l-1) Pretreatment time (h) 0 (ethanol 160 µl l-1) 1 39±5 ab 0 (ethanol 160 µl l-1) 2 34±4 abc 0 (ethanol 160 µl l-1) 4 36±8 abc 40 1 46±5 a 40 2 41±8 ab 40 4 32±4 bc 160 1 26±10 c 160 2 26±5 c 160 4 23±3 c Hspi concentration factor Significant p < 0.05 Pretreatment time factor Not significant p > 0.05 Interaction Not significant p > 0.05
Values are average ± SE, n = 3. Significant differences among all the treatments were analyzed by one-way ANOVA. Different superscript letters within columns denote significant differences (p < 0.05). Two–way ANOVA was performed to determine the interaction between the experimental factors
As demonstrated in the tests above, Hspi pretreatment or incubation can improve the survival of Artemia in the shrimp rearing water. Next we carried out a series of experiments to evaluate the effect of Hspi on the innate immune response and gut microbial community of the Artemia. To focus on the effect of Hspi on the Artemia and rule out the microbial interference during the Hspi treatment, in the following experiments, we only investigated the effect of Hspi by pretreatment in FASW (PA strategy). The PX and CI strategies were not applied, as in those strategies the Hspi
91 Chapter 5 affected the host and microbes at the same time. The dose 160 µl l-1 was chosen for the following experiments, as it was the dose that provided the highest survival in previous tests.
3.2 The effect of Hspi pretreatment on the innate immune response of Artemia
To determine whether Hspi pretreatment affects the innate immune response, temporal expression of the proPO and tgase was analyzed by real time-PCR. Artemia were pre-treated with 160 µl l-1 Hspi or absolute ethanol for 1 h and rinsed repetitively with FASW. After 1h recovery in FASW, the Artemia were then incubated in shrimp rearing water.
As illustrated in Fig. 5-2, at 3 and 6 h post incubation, the proPO gene expression in Hspi-pretreated Artemia were not significantly different from the negative control or the ethanol control. However, 9 h post incubation, the proPO gene expression was 0.5 fold higher than the controls (p < 0.05); moreover, 12 h post incubation, the Hspi-pretreated Artemia exhibited a significant (p < 0.05) 2.1 fold increase in the proPO gene level. Until 24 h post incubation, it was still 1.4 fold higher than in the controls (p < 0.05). At 36 h post challenge, the expression level declined and no significant differences relative to the controls were observed.
As shown in Fig. 5-3, 3h post incubation in the shrimp water, the tgase mRNA level in the Hspi-pretreated Artemia was significantly higher than in the controls. However, 6 h after incubation, tgase gene was significantly down-regulated in both the ethanol and Hspi pre-treated group. The tgase gene was significantly downregulated in all the treatments and control after 9 h of incubation in shrimp rearing water.
92 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Figure. 5-2. Relative expression of proPO gene in Artemia pre-treated with either Hspi or ethanol. The proPO gene expression levels were expressed relative to β-actin. The expression in the control 3h post incubation was set at 1. The Artemia were pre-treated with Hspi of 160 µl l-1 for 1 h or with absolute ethanol of 160 µl l-1 as the ethanol control. Artemia received no Hspi and ethanol was kept as negative control. Bars indicate the standard error of three replicates. Significant differences among the treatments are indicated by different letters (p < 0.05).
Figure. 5-3. Relative expression of tgase gene in Artemia pre-treated with either Hspi or ethanol. The tgase gene expression levels were expressed relative to β-actin., The expression in the control 3h post incubation was set at 1. The Artemia were pre-treated with Hspi of 160 µl l-1 for 1 h or with absolute ethanol of 160 µl l-1 as the ethanol control. Artemia received no Hspi and ethanol
93 Chapter 5 was kept as negative control. Bars indicate the standard error of three replicates. Significant differences among the treatments are indicated by different letters (p < 0.05).
3.3 Effect of Hspi pretreatment on the gut microbial community composition of Artemia
The effects of Hspi pretreatment on the gut resident microbial community and luminal microbial community were distinguished by a cellulose gut purging procedure. Fig. 5-4 shows the average Bray–Curtis similarities between treatments in microbial communities. The similarities among the resident microbiota round from 0. 45 to 0.5, whereas this was only 0.1 to 0.2 for the luminal microbiota.
The richness was calculated to estimate the total diversity of the sample being analyzed. Here, we use richness index to determine the species abundance of gut microbial community in each treatment. As illustrated in Fig. 5-5, Hspi pretreatment resulted in a resident microbial community with lower richness relative to the ethanol pretreatment and the control. The richness of luminal microbial community in all the treatments and control are similar.
Finally, the Pareto-Lorenz (PL) curves were constructed from the microbial fingerprints of each sample to compare the evenness of the gut microbial community from the Artemia in all treatments. The more the PL curve deviates from the diagonal (the theoretical perfect evenness line), the less even the structure of the studied community (Marzorati et al., 2008). As shown in Fig. 5-6, pre-treatment with Hspi resulted in a resident microbial community that was less even compared to the ethanol pretreatment and the control. The evenness of the luminal microbial community was similar for all the treatments.
94 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Figure. 5-4. Average Bray–Curtis similarities between the resident gut microbial community and luminal microbial community in the Artemia from different treatments. Hspi: Artemia pretreated with Hspi; Ethanol: Artemia pretreated with ethanol; Control: larvae received no treatment.
Figure. 5-5. Richness of the resident gut microbial community and luminal microbial community of the Artemia from different treatments. Hspi: Artemia pretreated with Hspi; Ethanol: Artemia pretreated with ethanol; Control: Artemia received no treatment.
95 Chapter 5
Figure. 5-6. Evenness of the resident gut microbial community and luminal microbial community of the Artemia from different treatments. Pareto-Lorenz curves derived from the microbial fingerprint pattern were used to assess the evenness visially.
4. Discussion
Hspi increased the survival of Artemia reared under sub-optimal condition
In previous work from Baruah et al. (2012), the Hsp inducer (Hspi) was demonstrated to elicit the overproduction of Hsp70 and improve the survival of brine shrimp Artemia franciscana larvae against subsequent abiotic stressors in the gnotobiotic system. According to unpublished data of Baruah et al., this Hspi—(Tex-OE®) may lead to the production of reactive oxygen species (ROS) both in the environment and in Artemia. The Hsp70 production elicited by the the Hspi may then be associated with this ROS producing characteristic. In our study, we further evaluated the effects of this Hspi on Artemia reared under a non-gnotobiotic sub-optimal condition by using different administration strategies.
The first administration strategy (PA) consisted of pretreating the Artemia with Hspi under axenic condition. The doses of 40 µl l-1, 80 µl l-1 or 160 µl l-1 could significantly improve the survival of Artemia subsequently maintained in shrimp rearing water. A dose, 160 µl l-1, provided the best protection in this administration strategy. Our dose is higher than the optimal dose (40 μl l-1) reported in the work of Baruah et al. (2012). This is probably due to the multiple stressors existing in the
96 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions shrimp rearing water requiring more Hsps production. However, pretreatment of Hspi for 1h with a higher dose (320 μl l-1) did not result in an increased survival of the Artemia. In the study of Baruah et al. (2012), the induction of Hsp70 by this Hspi in Artemia is both dose and time dependent. Higher dose or longer pre-treatment time resulted in higher production of Hsp70 in Artemia. Extracellular Hsp70 are regarded as danger signal molecules in response to environmental stressors (Chen and Cao, 2010). Accordingly, pretreatment of the Hspi with higher concentration (320 μl l-1) may lead to an ‘overstressed’ condition rendering the animal more susceptible to the stressors in the rearing system (Iwama et al., 2011). Similarly, pre-treating the Artemia with Hspi at 160 μl l-1 for 4 h reduced the survival as well. Thus, although, Hspi pretreatment could improve the survival of Artemia in shrimp rearing water, overexposure to Hspi by means of concentration or duration, may lead to negative effect towards the animal.
The second administration strategy (PX) involved the pretreatment of Hspi in shrimp rearing water. This strategy did not improve the survival of the Artemia as much as the pretreatment under axenic condition (PA strategy). Maximum survival in this strategy was achieved at a dose of 40 μl l-1; while raising the concentration of Hspi or extending the pretreatment time resulted in a reduced survival. As the only difference between strategy PA and PX is the presence or absence of microbes in the pre-treatment environment, these results suggested a potential impact of Hspi on the microbial activity in the environment. The interaction of Hspi with the microbes in the environment is discussed in the next chapter.
In the third administration strategy (CI), Hspi was inoculated while maintaining the Artemia in the shrimp rearing water. Dosing Hspi at the concentration of 160 μl l-1 provided the best protection for Artemia as compared to the controls. As discussed in PX strategy, pretreatment of Hspi at 80 and 160 μl l-1 in shrimp water may lead to negative effect on the Artemia. Interestingly, when incubating the Artemia with Hspi at 160 μl l-1, the survival was significantly improved.
The overall results discussed above suggested a dual role of Hspi in the shrimp 97 Chapter 5 rearing water. The improvement of Artemia survival by pretreatment under axenic condition indicated a direct impact of Hspi on the host. The decrease of Artemia survival by pretreatment in shrimp rearing water points in the direction of an interaction of Hspi and the microbes in the environment. In this chapter, we investigated the effect of Hspi on Artemia; while the interaction of Hspi and the environmental microbes and pathogens are discussed in the next chapter. The mechanistic detail of the host or microbe responses as induced by this compound was not determined in this study, because the active compound(s) is not disclosed by the manufacturing company.
Effect of Hspi on the innate immune response of Artemia
Modulation of the host immune response by (extracellular) Hsps has been demonstrated in several studies including both vertebrates (mammals, fish, etc) and invertebrates (like Artemia, shrimps, Drosophila etc) (Feder and Hofmann, 1999;
Roberts et al., 2010; Sung et al., 2011). As the Hspi are known to induce Hsp70 production in the host, we then investigated the direct effect of this compound on the innate immune response of Artemia reared under a sub optimal condition (the shrimp rearing water).
The proPO system is an integral component of the immunity of crustaceans such as Artemia. It protects the animal against invading pathogens by its role in cuticular melanization, sclerotisation, wound healing, encapsulation and killing of pathogens (Cerenius et al., 2008). Our result showed that pretreatment of the axenic Artemia with Hspi at 160 μl l-1 for 1 h resulted in a higher proPO expression of the Artemia upon contact with natural microbiota in the shrimp rearing water. In a previous study performed by Baruah et al. (2011), it was demonstrated that feeding axenic Artemia with either Artemia Hsp70 or the E. coli Hsp70 equivalent DnaK, each overproduced in E. coli, enhanced the proPO system, at both mRNA and protein activity levels upon the V. campbellii challenge. Thus, we may assume that the proPO enhancement observed in our experiment is associated with the Hsp70 inducing property of this
98 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions
Hspi compound.
In the study of Baruah et al. (2011), it was also shown that the successive exposure to Hsp70 and V. campbellii led to the enhancement of proPO system; while Artemia receiving only Hsp70 showed no effect on the proPO system. In their study, the Hsp70 exposure and pathogen challenge was synergistically stimulating the proPO expression. Thus in our study, the proPO stimulation by Hspi may be associated with microbes in the environment as well. The ProPO system is known to be stimulated by cell wall components (e.g. lipopolysaccharide, peptidoglycan) from microorganisms (Söderhäll and Cerenius, 1998; Okumura, 2007; Amparyup et al., 2012). However, the proPO up-regulation level in Artemia during the initial contact with microbes (3, 6, 9 hs) is significantly lower as compared to later incubation phase (12, 24 hs). This observation indicated that besides the presence of microbes, other factors may mediate the proPO response.
Transglutaminase is involved in the coagulation or clot formation, one of the most important innate immune responses in crustaceans. Its quickness and efficiency in forming a physical barrier to avoid the loss of body fluid and prevent the dissemination of microbes into the haemocoel is essential to the survival of invertebrates (Martin et al., 1991; Chen et al., 2005) . In our result, tgase expression was significantly higher in all treatments at the initial phase (3 and 6 h post incubation) as compared to later phase (9 to 36 h post incubation). This observation may be associated with stress and tissue damage during the rinsing and transportation procedure. The expression of tgase in all treatments and control was down regulated after 6 h, as stress and damage may be healed during the incubation. In addition, 3 h post incubation, Hspi induced significantly higher tgase expression in the Artemia relative to the controls. This increment of tgase gene expression may be associated with Hspi pre-treatment. Tgase gene was reported to be activated upon tissue damage and cell stressors such as oxidative stress and inflammatory cytokines (Kopacek et al., 1993; Ientile et al., 2007). As mentioned above, this Hspi may lead to the production of reactive oxygen species (ROS) in the environment and in the animal. Thus, the
99 Chapter 5 oxidative stress caused by Hspi may also enhance the expression of tgase.
The overall results demonstrate that Hspi can have a direct impact on the immune response of Artemia. Pretreatment of Hspi may prime the immune response (proPO) of Artemia for stronger reaction towards subsequent environmental stressors, which may contribute to the survival of Artemia in the sub-optimal rearing environment.
Effect of Hspi pretreatment on gut microbial community composition of Artemia
Different composition of both resident gut microbial community and luminal microbial community in Artemia were observed among all the treatments (Fig. 5-4). In general, the resident microbiota showed a higher similarity between the treatments than the luminal microbiota, suggesting a potential selection of the host on resident microbial community establishment. In addition, Hspi pretreatment resulted in a resident gut microbial community with lower richness (Fig. 5-5) and evenness (Fig. 5-6) relative to the other treatments and control. It seems that Hspi pretreatment favored the colonization of some bacteria. Because the Hspi pretreatment was performed under axenic condition and the remaining compound was rinsed away before exposing the Artemia to the microbes in the rearing water, we can postulate that the modulation of the immune response of the Artemia by Hspi may influence the first colonization of the microbes. Several studies have demonstrated the involvement of Hsps in the regulation of immune response (Pockley, 2003; Robert, 2003). On the other hand, in the studies performed on vertebrates, some commensal bacteria, such as B. fragilis and Clostridium, were reported to facilitate their colonization by producing anti-inflammatory factors, such as IL-10 producing regulatory T cells (Tregs) (Round and Mazmanian, 2010; Round et al., 2011; Ivanov and Honda, 2012). Although such host-microbe interactions in invertebrates are not frequently reported, it is possible that the enhancement of the immune response by Hspi may limit the colonization of some microbes while favoring the colonization of others that can produce anti-inflammatory factors, The selection on such microbes that are capable of handling the environment with an increased immunologic activity may result in low
100 Effect of Heat Shock Protein Inducer Tex-OE® on Artemia under sub-optimal rearing conditions richness and evenness of the resident gut microbial community composition. Further studies are needed to clarify the mechanism of interaction between Hspi, the host immune response and the host resident microbial community. Our analysis was based on pooled samples from three biological replicates (due to insufficient Artemia in each replicates). Thus, the microbial community composition profile represented an average value. However, the overall trends observed may indicate that the gut microbial community composition of Artemia is influenced by Hspi. As presented in Appendix A-figure 1, the Hspi pretreatment lead to distinguished luminal microbiota among different treatments; while the resident microbiota composition among different treatments was less distinguished. The high similarity of the resident microbiota may be associated with the host-selection on the colonized bacteria.
Conclusion
The overall results have demonstrated that the Hsp inducing compound Tex-OE® can improve the survival of Artemia franciscana reared under a sub-optimal condition. The survival of Artemia was significantly increased by pretreatment of Hspi at 160 μl l-1 for 1 h in FASW or by inoculating the Hspi of 160 μl l-1 in the shrimp rearing water. The survival improvement may be associated with the elicitation of the innate immune response of Artemia, as verified by prophenoloxidase gene expression. In addition, Hspi may interact with the microbes in the rearing environment and in Artemia, affecting the composition of the resident gut microbial community of Artemia. It has been widely acknowledged that the gut microbiota considerably contribute to the development and the health of the animal. Thus it will be interesting to perform further studies on how health-improving products, such as Hspi compound, may modulate the host immune response and interact with the gut microbiota of aquaculture animals.
101 Chapter 5
102
CHAPTER 6
A plant-based heat shock protein inducing compound modulates host-pathogen interactions between Artemia franciscana and Vibrio campbellii
A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
Chapter 6
A plant-based heat shock protein inducing compound modulates host-pathogen
interactions between Artemia franciscana and Vibrio campbellii
Redrafted from
Yufeng Niu1, Parisa Norouzitallab1, Kartik Baruah, Shuanglin Dong, Peter Bossier
(2014)
Aquaculture 430:120-127
ABSTRACT
Induction of heat shock proteins (e.g. Hsp70) has been considered as a potential disease control and health management strategy in aquaculture. Recently, the compound Tex-OE®, a patented extract from the skin of the prickly pear fruit, Opuntia ficus indica, was reported to enhance the production of Hsp70 in animal tissues without any adverse effect, protecting the animal against various abiotic stressors. Most of the studies on this compound, however, primarily focused on the positive effects at the level of the host while the effects on the microorganisms in the culture environment were often overlooked. In our study, we aimed at evaluating the effect of this compound on Artemia-Vibrio interaction. Pretreatment with Tex-OE® conferred significant protection to the shrimp against V. campbellii in a conventional rearing system. However, continuous exposure to Tex-OE® markedly interfered with the growth and behavior of the microbes in the rearing environment and adversely affected the health of the shrimp. In vitro experiments provided unequivocal evidence that continuous exposure with Tex-OE® modulated the virulence (such as hemolytic and caseinase activity) of V. campbellii. Pretreatment of the Vibrio also increased
103 Chapter 6 their virulence in an Artemia challenge assay. From these results, it can be suggested that the compound Tex-OE® has the potential to be used as a disease control tool in aquaculture systems, however, care has to be taken in the delivery strategy of such compound in an open culture system characterized by a high concentration of potential pathogens associated with the host.
104 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
1. Introduction
According to reports by the United Nations’ Food and Agriculture Organization (FAO), Vibriosis - bacterial disease caused by Vibrios – has been one of the most constraining factors for sustainable (marine) aquaculture, causing economic losses amounting to billions of dollars (Defoirdt et al., 2007; FAO, 2012). In intensive aquaculture systems, fish and shellfish especially at their larval stages, are often exposed to a multitude of stressful conditions, which eventually make them more susceptible to microbial infections (Smith et al., 2003). The traditional application of antibiotics initially brought great help in combating Vibriosis in aquaculture animals. However, the emergence of antibiotic-resistant bacteria due to indiscriminate use of antibiotics has made this traditional approach ineffective and unsustainable due to their potential risk to the surrounding environment as well as to the human health (Hoa et al., 2011). As an alternative to antibiotics, various anti-infective strategies, such as probiotics and immunostimulants, have been suggested and many are in the process of development. Experimental studies (including farm trials) have shown that they are effective in protecting aquaculture animals against bacterial infections (Merrifield et al., 2010; Roberts et al., 2010).
The molecular chaperone heat shock protein 70 (Hsp70) has been shown to control bacterial diseases, including Vibriosis, in experimental (aquaculture) animals (Baruah et al., 2010, 2011; Sung et al., 2013). Hsp70 is a highly conserved protein which is expressed constitutively under normal physiological conditions, however, their expression is up-regulated by various stressors, such as cold, heat, UV radiation, toxins, pathogens, nutritional deficiency, protein degradation, hypoxia, acidosis, microbial damage or indeed any cellular stress (Roberts et al., 2010). It performs essential biological functions under normal and stressful physiological conditions and these functions include the folding of nascent polypeptides, assembly/disassembly of multi-subunit oligomers, translocation of proteins across intracellular membranes, regulation of apoptosis and cytoskeletal organization, repair of partially denatured
105 Chapter 6 proteins, degradation of irreversibly denatured proteins and inhibit protein aggregation, and other processes that enhance the survival of normal and diseased cells (Parsell and Lindquist, 1993). Previous studies in a wide variety of experimental models have reported that Hsp70 elicits protective immune responses against many (bacterial) diseases (Joly et al., 2010; Tsan and Gao, 2009). For instance, feeding of recombinant Hsp70 to the brine shrimp Artemia franciscana larvae (Baruah et al., 2011, 2013) or in vivo induction of Hsp70 within Artemia by pretreating the shrimp with the Hsp-inducing compound Tex-OE®, extracted from the skin of the prickly pear fruit, Opuntia ficus indica (Baruah et al. unpublished data), was shown to increase the prophenoloxidase innate immune response in the larvae and provide sequential protection against pathogenic Vibrios (Baruah et al., 2011). Besides Vibrios, this Hsp70-inducing compound was also shown to protect fish and shrimp against various abiotic stressors including lethal temperature, hypersalinity, ammonia toxicity and transportation stress (Baruah et al., 2012; Roberts et al., 2010; Sung et al., 2012). These findings suggest that Hsp70 or the compounds inducing Hsp70, pending thorough verification, could be used as a disease control agent in aquaculture. It is to be noted that most of the earlier studies on the Hsp70-inducing compound focused primarily on the positive effects at the level of the host. Only on rare occasions, the effects of these compounds on the microbial communities in the culture environment were described. On occasion, its effect on host-associated Vibrio’s has been investigated.. The impact of the Hsp70-inducing compound on the phenotypic characteristics (such as virulence factor production) of the pathogen and on microbial-host interaction is often overlooked. In this study, we aimed to evaluate (i) whether the compound Tex-OE® affects the Artemia host in inducing resistance to V. campbellii in a conventional rearing system and (ii) the impact of this compound on the pathogen response, focusing mainly on their growth, and production of Hsp70 (DnaK) and virulence factors.
106 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
2. Materials and methods
2.1. Bacteria strains and culture conditions
Two bacterial strains were used in this study. The pathogenic strain V. campbellii LMG21363 was used for Artemia challenge assays and for determining the effect of Hsp70-inducing compound on the Vibrio response. Aeromonas sp. strain LVS3 (Verschuere et al., 1999), after autoclaving, was used as feed for Artemia. All strains were preserved at -80 oC in Marine Broth 2216 (Difco Laboratories, Detroit, MI. USA) with 20% sterile glycerol. The bacterial strains, LMG 21363 and LVS3 were initially grown at 28 oC for 24 h on Marine Agar (Difco Laboratories, Detroit, MI. USA) and then to log phase in Marine Broth by incubation at 28 oC with continuous shaking prior to use.
2.2. Artemia rearing water
The rearing water for Artemia used in this experiment was obtained from a whiteleg shrimp Penaeus vannamei recirculating culture system. The water quality parameters were analyzed using standard protocols and were found within the optimum range for P. vannamei rearing.
2.3. Axenic hatching of Artemia
Axenic Artemia were obtained following decapsulation and hatching (Baruah et al., 2010). Briefly, 2.5 g of Artemia cysts originating from the Great Salt Lake (field collection), Utah, USA (EG Type, batch 21452, INVE Aquaculture, Dendermonde, Belgium) were hydrated in 89 ml of distilled water for 1 h. Sterile cysts and nauplii were obtained via decapsulation using 3.3 ml NaOH (32%) and 50 ml NaOCl (50%). During the reaction, 0.22 µm filtered aeration was provided. All manipulations were carried out under a laminar flow hood and all tools were autoclaved at 121 oC for 20 min. The decapsulation was stopped after about 2 min by adding 50 ml Na2S2O3 at 10 g l-1. The aeration was then terminated and the decapsulated cysts were washed with filtered (0.2 µm) and autoclaved artificial seawater (FASW) containing 35 g 1 l-1 of
107 Chapter 6 instant ocean synthetic sea salt (Aquarium Systems, Sarrebourg, France). The cysts were suspended in 1-l glass bottles containing FASW and incubated for 28 h on a rotor at 4 rpm at 28 oC with constant illumination of approximately 27 µE m-2 sec-1. The emerged nauplii reaching stage II, at which time they start ingesting bacteria, were collected.
2.4. In vivo treatment of Artemia with Hsp-inducing compound
The compound Tex-OE® (hereinafter referred to as ‘Hspi’ for Hsp-inducing compound), supported in food grade ethanol, was kindly provided by Bradan Ltd. (Campbeltown, UK) It was stored at room temperature until use.
Two species of the brine shrimp larvae, Artemia franciscana and Artemia pathenogenetica (Megalon Embolon, Greece) were used as testing organism. In total, three separate studies were performed. In the first study, the protective effect of Hspi on Artemia against V. campbellii in the conventional rearing system was evaluated. Two different strategies for administration of Hspi were followed: pretreatment and continuous exposure. In the pretreatment strategy, the Artemia were initially treated with Hspi (20, 40, 80, 160 µl l-1) or with absolute ethanol (160 µl l-1) alone as negative control in sterile sea water for 1 h. Then the pretreated Artemia were rinsed repeatedly with sterile sea water, allowed to recover in sterile sea water for 1 h, transferred to shrimp rearing water and then challenged with V. campbellii at 107 cells ml-1 for 36 h. While in the continuous exposure strategy, the Artemia were treated continuously (meaning that the Hspi compound was not washed away) with the same concentration of Hspi or absolute ethanol as in the pre-treatment strategy in the shrimp rearing water. In addition, the Artemia were challenged with V. campbellii at 107 cells ml-1. For both the administration strategies, controls were maintained without the addition of Hspi or ethanol. Dead LVS3 at 107 cells ml-1 were fed to the Artemia of all groups. The survival of the Artemia was scored 36 h after challenge.
The second study aimed to determine the toxicity of Hspi. To this end, the Artemia were distributed in the shrimp rearing water and then Hspi was added at
108 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii increasing concentrations (20, 40, 80 and 160 µl l-1). Artemia that received absolute ethanol (160 µl l-1) alone served as (negative) control. No Vibrio challenge was performed. The survival of the Artemia was scored 36 h after addition of the compound.
In the third experiment, the impact of Hspi on the phenotypic characteristics of V. campbellii was determined by carrying out in vivo and in vitro (see sections below) studies. In the in vivo study, the Artemia hatched under gnotobiotic conditions were challenged with V. campbellii (107 cells ml-1) that were previously treated with different concentrations of Hspi (20, 40, 80 and 160 µl l-1) or with absolute ethanol (160 µl l-1) alone for 6 h. The Vibrio that received no Hspi or ethanol was kept as control. Dead LVS3 at 107 cells ml-1 were fed to the Artemia of all groups. The survival of the Artemia was scored 36 h after challenge.
In all the above three studies, the final ethanol concentration (160 µl l-1) in the control and Hspi treated groups corresponded to the amount added in the treatment with highest Hspi concentration.
2.5. Effect of Hspi on the growth and bioluminescence of V. campbellii in Marine Broth medium
For each treatment, aliquots of the overnight grown V. campbellii were transferred to three separate flasks containing 5 ml of fresh Marine Broth to obtain an optical density at 550 nm (OD550) of approximately 0.1. In one treatment, an optimized dose of Hspi (160 µl l-1) was added to the Vibrio culture in each flask. In the other two treatments, which were used as control groups, Vibrio were grown in Marine Broth added with absolute ethanol (160 µl l-1) or not. All the cultures were incubated at 28 oC on an orbital shaker at 20 rev min-1. Vibrio samples were taken from each flask, each in triplicates, at every 2 h interval for determination of growth, by measuring OD550 with a Tecan Infinite 200 micro plate reader (Tecan, Belgium). From the same sample, V. campbellii luminescence was simultaneously measured as described previously (Defoirdt and Sorgeloos, 2012).
109 Chapter 6
2.6. Effect of Hspi on the growth of total heterotrophic bacteria in the shrimp rearing water and V. campbellii in sterile sea water
Shrimp rearing water was inoculated with 160 µl l-1 of Hspi or absolute ethanol. Total bacterial growth was checked at 0, 4, 8, 12 and 16 h after Hspi or ethanol addition by plating the water samples on Marine Agar. The shrimp water was diluted with a 10-fold dilution series and 2 dilution series were used for plating with 3 replicates for each dilution.
Overnight grown V. campbellii was diluted to an OD550 of approximately 0.1 with Marine Broth. The bacteria were added to 30 ml of FASW at 107 cells ml-1 concentration. Simultaneously, Hspi or absolute ethanol at 160 µl l-1 was added and the culture was incubated at 28 °C. The growth of V. campbellii was checked at regular intervals in a similar fashion as described above for total heterotrophic bacteria.
2.7. Virulence factor assay
2.7.1. Lipase and phospholipase assays
The lipase and phospholipase activities were measured by a modification of the method described by Liuxy et al. (1996) and Austin et al. (2005), respectively. Agar plates for lipase and phospholipase assays were prepared by supplementing Marine Agar with 1% Tween 80 (Sigma–Aldrich, Belgium) and 1% egg yolk emulsion (Sigma–Aldrich, Belgium), each sterilized separately at 121 °C for 5 min prior to mixing. The development of opalescent zones around the colonies was observed and the diameter of the zones was measured after 2–4 days of incubation at 28 °C.
2.7.2. Caseinase, gelatinase and hemolysin assays
The caseinase, gelatinase and hemolysin assays were performed as described previously (Austin et al., 2005; Liuxy et al., 1996; Zhang and Austin, 2000) with some modifications. The caseinase assay plates were prepared by mixing double strength Marine Agar with a 4% skim milk powder suspension (Oxoid, Hampshire,
110 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
UK), each sterilized separately at 121 °C for 5 min. Clearing zones surrounding the bacterial colonies were measured after 2 days of incubation. Gelatinase assay plates were prepared by mixing 0.5% gelatin (Sigma–Aldrich, Belgium) with Marine Agar. After incubation for 7 days, saturated ammonium sulfate (80%) was poured over the plates and after 2 min, the diameters of the clearing zones around the colonies were measured. Hemolytic assay plates were prepared by supplementing Marine Agar with 5% defibrinated sheep blood (Oxoid, Hampshire, UK) and clearing zones were measured after 2 days of incubation.
2.8. Analysis of DnaK production
V. campbellii was initially grown at 28 oC for 24 h on Marine Agar and then to log phase in Marine Broth. The culture medium was supplemented with an increasing concentration of Hspi (20, 40, 80 or 160 µl l-1) or with 160 µl l-1 of absolute ethanol, followed by incubation at 28 °C for 6 h. The culture medium without supplement was used as a control. V. campbellii culture (1 ml) from each treatment was collected and centrifuged at 4000 x g for 15 min. The pellets obtained were rinsed once with FASW and then homogenized by rapid agitation with 0.1 mm diameter glass beads in cold buffer K (150 mM sorbitol, 70 mM potassium gluconate, 5 mM MgCl2, 5 mM
NaH2PO4, 40 mM HEPES, pH 7.4) containing protease inhibitor cocktail (Sigma-Aldrich, Inc. USA). Subsequent to centrifugation at 2200 x g for 1 min at 4 °C, supernatant protein concentrations were determined by the Bradford method (Bradfrod 1976). Supernatants were then combined with loading buffer, vortexed, heated at 95 °C for 5 min, centrifuged at 4000 x g for 1 min and then electrophoresed in 10% SDS-PAGE gels, with each lane receiving equivalent amounts of protein. Gels were transferred to polyvinylidene fluoride membrane (BioRad Immun-BlotTM PVDF) for antibody probing. Membrane was incubated with blocking buffer [50 ml of 1x phosphate buffered saline containing 0.2% (v/v) Tween-20 and 5% (w/v) bovine serum albumin] for 1 h at room temperature and then with rabbit polyclonal antibody raised against the ATPase domain of E. coli DnaK (a generous gift from Dr. Bernd Bukau, ZMBH) at the recommended dilution of 1:2500. Horseradish peroxidase
111 Chapter 6 conjugated goat anti-rabbit IgG was used as the secondary antibody at the recommended dilution of 1:5000. Detection was done with 0.7 mM diaminobenzidine tetrahydrochloride dihydrate (DAB) in association with 0.01% (v/v) H2O2 in 0.1 m Tris-HCl (pH 7.6).
2.9. Statistical analysis
Survival data were arcsin transformed to satisfy normality and homocedasticity requirements as necessary. Data on survival, virulence factor and bacterial growth were then subjected to one-way analysis of variances followed by Duncan’s multiple range tests using the statistical software Statistical Package for the Social Sciences version 14.0 to determine significant differences among treatments. Significance level was set at p < 0.05.
3. Result
3.1. Test 1: Effect of Hspi pre-treatment on the survival of Artemia reared in a conventional system and challenged with V. campbellii
To determine the pretreatment effect of Hspi on the protection of Vibrio-challenged Artemia in a conventional (shrimp rearing water) system, the Artemia were pretreated with different doses of Hspi and then challenged with V. campbellii. As shown in Fig. 6-1, A. franciscana larvae pretreated with Hspi at concentrations ranging between 20 and 80 µl l-1 did not exhibit significant (p > 0.05) improvement in the survival compared with the ethanol control. However, at a dose of 160 μl l-1, a significant increase in the survival of the Artemia compared with the controls was observed. In case of the Artemia strain Megalon Embolon, a significant improvement in the survival of the Vibrio-challenged Artemia compared with the (ethanol) control was noted already at the low dose of Hspi (20 µl l-1). Further increase in the Hspi dose (> 20 µl l-1) did not further increase the larval survival compared with the group pretreated with 20 µl l-1 Hspi, however, the survival was significantly higher than the controls.
112 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
Figure. 6-1. Survival (%) of A. franciscana and Artemia Megalon Embolon 36 h after challenge with V campbellii. Axenic Artemia were pretreated with different doses of Hspi (20, 40, 80 and 160 µl l-1) or with 160 µl l-1 absolute ethanol (as one of the controls) for 1 h. They are then rinsed repeatedly with sterile seawater and allowed to recover for 1 h. Artemia not pretreated with Hspi and/or ethanol served as another control. The Artemia were then challenged with V. campbellii at 107 cells ml-1 in shrimp rearing water. Dead LVS3 (107 cells ml-1) were provided as feed for the Artemia. Data in each survival test represent the mean ± standard error of five replicates. Error bars with different alphabet letters (capital and small letters for A. franciscana and Megalon Embolon, respectively) indicate significant difference (p < 0.05).
3.2. Test 2: Effect of continuous exposure of Hspi on the survival of Artemia reared in a conventional system and challenged with V. campbellii.
Next, the possibility that continuous exposure of Hspi protects the Artemia against V. campbellii was verified using the same doses of Hspi as in the test described above. Continuous exposure of the Artemia to Hspi at concentration between 20 and 160 µl l-1 did not confer protection to the Vibrio-challenged Artemia (Fig. 6-2). In fact, at doses between 20 and 80 µl l-1, Hspi had a negative effect on the survival of the Artemia.
113 Chapter 6
Figure. 6-2. Survival (%) of A. franciscana and Artemia Megalon Embolon 36 h after challenge with V campbellii. Axenic Artemia were incubated with either Hspi (20, 40, 80 and 160 µl l-1) or with 160 µl l-1 of absolute ethanol (as one of the controls) for 1 h. Artemia not incubated with Hspi and/or ethanol served as another control. The Artemia were then challenged with V. campbellii at 107 cells ml-1 in shrimp rearing water. Dead LVS3 (107 cells ml-1) were provided as feed for the Artemia. Data in each survival test represent the mean ± standard error of five replicates. Error bars with different alphabet letters (capital and small letters for A. franciscana and Megalon Embolon, respectively) indicate significant difference (p < 0.05).
3.3. Test 3: Toxicity of Hspi on the Artemia
To determine if continuous exposure to Hspi has a toxic effect on Artemia, the larvae were incubated continuously with an increasing concentration of Hspi in the shrimp rearing water as described in test 1. No additional Vibrio challenge was performed. Hspi appeared to have no adverse impact on the survival of the Artemia, indicating that it is non-toxic to the Artemia among the doses tested (data not shown).
3.4. Microbial responses to Hspi treatment
3.4.1. Effect of Hspi on the growth and bioluminescence of V. campbellii in Marine Broth medium
Next, we investigated the direct impact of Hspi incubation on the growth and bioluminescence of V. campbellii in the Marine Broth medium. To this end, V.
114 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii campbellii culture was incubated with the optimal dose of Hspi (160 μl l-1) for a period of 16 h. Hspi exposure had no significant impact on the growth and bioluminescence of V. campbellii (data not shown).
3.4.2. Effect of Hspi on the growth of V. campbellii in sterile sea water and of heterotrophic bacteria in shrimp rearing water
In the following experiment, V. campbellii was incubated with Hspi or absolute ethanol at a concentration of 160 µl l-1 in sterile sea water. In addition to this, shrimp rearing water was inoculated with Hspi or absolute ethanol at 160 µl l-1 and then the growth of V. campbellii and total heterotrophic bacteria was measured at specific time interval by plating the culture water on Marine Agar. As shown in the figures, incubation of the bacteria with Hspi significantly stimulated the growth of V. campbellii in sterile sea water (Fig. 6-3) and of heterotrophic bacteria in shrimp rearing water (Fig. 6-4).
Figure. 6-3. Growth of V. campbellii in sterile sea water with or without Hspi or absolute ethanol, added at a concentration of 160 µl l-1. Results are expressed as mean ± standard error of three replicates. Error bars with different alphabet letters indicate significant difference (p < 0.05).
115 Chapter 6
Figure. 6-4. Growth of total heterotrophic bacteria in shrimp rearing water with or without Hspi or absolute ethanol, added at a concentration of 160 µl l-1. Results are expressed as mean ± standard error of three replicates. Error bars with different alphabet letters indicate significant difference (p < 0.05).
3.4.3. Impact of Hspi on in vitro production of virulence factors in V. campbellii
To determine the effect of Hspi on the production of virulence factors in V. campbellii, an in vitro study was carried out by incubating V. campbellii with different doses of Hspi for a period of 6 h in Marine Broth medium, followed by plating the culture on specific agar. To continuously incubate the V. campbellii with Hspi, the same concentrations of Hspi were also added into the agar. As shown in Fig. 6-5, the caseinase and hemolytic activities of V. campbellii incubated with Hspi at concentrations ranging between 20 and 80 µl l-1 were not significantly different from that of the (ethanol) control. However, a significant increase in the activity of caseinase (Fig. 6-5 A) and hemolysin (Fig. 6-5 C) was recorded due to exposure of V. campbellii to a higher dose of Hspi (160 µl l -1) compared to the control and ethanol control groups. Conversely, the lipase activity was significantly decreased at the highest dose (160 µl l-1) of Hspi treatment (Fig. 6-5 B). No significant differences in the activity of gelatinase and phospholipase of V. campbellii due to Hspi exposure were observed (Fig. 6-5 D and E).
116 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
Figure. 6-5. Activities of (A) caseinase, (B) lipase, (C) hemolysin, (D) gelatinase, and (E) phospholipase of V. campbellii incubated with Hspi for 48 h. The activities of the virulent determinants were expressed as the ratio of clear zone (mm) and colony diameter (mm). Results are expressed as mean ± standard error of three replicates. Error bars with different alphabet letters indicate significant difference (p < 0.05).
3.4.4. Induction of DnaK by Hspi in V. campbellii
To further study the response of V. campbellii to Hspi, we investigated the 117 Chapter 6 induction of DnaK in V. campbellii in vitro by carrying out Western Blot analysis on the protein extracts from the V. campbellii cultured for 6 h in the presence of different doses of Hspi. As shown in Fig. 6-6, there was a constitutive production of DnaK in the control and the production was almost the same to that in the ethanol-treated control group. However, Hspi treatment at a concentration as low as 20 µl l-1 markedly increased DnaK production compared with the controls. The maximal effect was observed at a dose of 160 µl l-1.
Figure. 6-6. Induction of DnaK in V. campbellii by Hspi. V. campbellii were incubated with different doses of Hspi (20, 40, 80 or 160 μl l-1) or with absolute ethanol alone (160 μl l-1) as ethanol control (Ethanol) for 6 h. V. campbellii not pretreated with Hspi and/or ethanol served as control. Thirty microgram of bacterial protein was loaded in each lane. Molecular mass standards (M) in kilodaltons on the left.
3.5. Virulence of Hspi -pretreated V. campbellii towards Artemia
To further verify the effect of Hspi on the virulence of V. campbellii, we next determined the in vivo effect of Hspi-pretreated V. campbellii on the survival of Artemia. As illustrated in Fig. 6-7, pretreatment of V. campbellii with Hspi at a dose ranging from 20 to 80 µl l-1 did not significantly affect the survival of the Artemia. However, at the dose of 160 µl l-1, Hspi-pretreated V. campbellii significantly reduced the survival of both Artemia franciscana and Megalon embolon compared to the controls.
118 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii
Figure. 6-7. Survival (%) of A. franciscana and Megalon Embolon 36 h after challenge with Hspi-pretreated V. campbellii. Artemia were challenged with V. campbellii (107 cells ml-1) that were pretreated with different concentrations of Hspi (20, 40, 80 or 160 μl l-1). The larvae challenged with untreated V. campbellii or those challenged with ethanol-treated V. campbellii served as controls. The nauplii were fed with autoclaved LVS3 at 107 cells ml-1. Results are expressed as the mean of five replicates ± standard errors. Error bars with different alphabet letters indicate significant difference (p < 0.05).
4. Discussion
Artificial manipulation of the Hsp70 levels has been demonstrated to be a promising approach for combating a variety of abiotic and pathogenic biotic stressors in aquaculture animals (Baruah et al., 2011; Kong et al., 2011; Sung et al., 2012). In an earlier study performed by Baruah et al. (2012), the brine shrimp A. franciscana pretreated with the Hsp70-inducing compound Tex-OE® were markedly protected against abiotic stressor-lethal heat shock or salinity stress, in a germ free system. Here, by using two strains of Artemia (larvae) as model organisms, we could clearly demonstrate that Hspi pretreatment significantly protected the Artemia against pathogenic V. campbellii in a conventional (i.e., shrimp rearing water) system. This finding is in agreement with a previous study in which pre-stimulation of salmon and
119 Chapter 6 gilthead sea bream with Hspi were reported to provide protection against V. anguillarum infection to both fishes (El Fituri, 2009). However, when the delivery strategy of Hspi was switched from pretreatment exposure to continuous exposure, no protective effect of Hspi against V. campbellii was observed. On the contrary, an adverse effect of Hspi was observed. These observations could be explained by the fact that Hspi at the tested doses might have an (direct) effect on the standing microbial communities, including V. campbellii, in the rearing water. For instance, it might have increased the growth of bacteria and/or stimulated virulence factors production, which in turn might have negatively interfered with the performance of Artemia.
In a further series of experiments, we investigated the impact of Hspi on the pathogen responses in terms of growth and virulence factors production. Hspi appeared to have (to a limited extent) a growth stimulating effect on V. campbellii in sterile sea water and also on the heterotrophic bacteria in the shrimp rearing water, suggesting that the Hspi compound might have been utilized by the microbes to proliferate. One may also argue that the ethanol content and not the Hspi compound in the plant extract might have contributed to the growth of bacteria in the culture water, as the bacteria load in the Hspi treatment and the ethanol control was similar after 16h (Fig. 6-4). According to a recent study performed by Baruah et al. (2012), the Hspi (TEX-OE®) is supported in absolute ethanol at the concentration of 3.76g/L. As the active compound accounts less than 1% of the Hspi, almost equal amount of the absolute ethanol was inoculated in the Hspi treatment as well. Accordingly, the overall carbon source in the Hspi treatment and the ethanol control was almost equal, leading to similar carrying capacity for the bacterial load. This might explain that no significant difference of the bacteria load was observed between the Hspi treatment and the ethanol control at 16h. On the other hand, from 8 to 12 h, the faster bacterial growth in the Hspi treatment was observed. This results suggested that, despite the similar carrying capacity between the Hspi treatment and the ethanol control, the active compound in Hspi may have stimulated the faster growth of certain bacteria in
120 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii the rearing water. However, as the active contend in Hspi is not disclosed, we cannot give further discussion on the growth stimulation mechanism.
As observed in this study, no adverse effect was observed on the non-challenged Artemia continuously exposed to Hspi in the shrimp rearing water (Test 3, data not shown). Thus, the higher bacterial load in the rearing water due to Hspi may not be the primary cause for the ineffectiveness of Hspi treatment. Alternatively, Hspi might affect Vibrio activity, negatively affecting Artemia.
To substantiate these assumptions, we investigated the effect of Hspi on the production of virulence factors (such as caseinase, lipase, hemolysin, gelatinase and phospholipase) in V. campbellii. Caseinase and gelatinase are a group of proteases that are able to degrade casein and gelatin, respectively, and the production of these proteases facilitates the infection of pathogens by damaging the host tissue (Ruwandeepika et al., 2012). Previous studies have shown that the production of proteases by Vibrios was linked to pathogenesis towards fish and shrimp (Kahla-Nakbi et al., 2009; Rui et al., 2009). Consistent with this, we observed a significant increase in the activity of caseinase (while the activity of gelatinase was not affected) of V. campbellii due to continuous exposure to Hspi. Besides having an effect on caseinase activity, Hspi also markedly enhanced the production of hemolysin in V. campbellii. Hemolysin is arguably the most important and widely distributed virulence factor among pathogenic Vibrios (Wong et al., 2012). There is ample evidence that hemolysin is toxic to erythrocytes and other cell types as well (Rowe and Welch, 1994) and that this toxin infects the host cells either by forming pores or by breaking down cell membranes (Sun et al., 2007). It is also reported to be involved in pathogenesis of aquatic animals due to the anemic response that has been observed in infected fish (Clauss et al., 2008; Zhang et al., 2001). In addition to the impact on the virulence factors mentioned above, there was also a decrease in the activity of lipase, another putative virulence factor, in V. campbellii due to continuous exposure to Hspi. However, the role of lipases in the pathogenesis of Vibrios towards aquatic animals is unclear yet (Ruwandeepika et al., 2012). Based on the observations made
121 Chapter 6 in this study, it can be suggested that the decrease in the survival of Vibrio-challenged Artemia continuously exposed to Hspi is associated with the interference of Hspi with production of the virulence determinants in V. campbellii, particularly, enhancing the activity of caseinase and hemolysin. The increment of these lytic enzymes may contribute to inflicting host tissues damages, allowing the pathogen to obtain nutrients and to spread through the tissues. In our study, only few virulence factors, such as lytic enzymes, of V. campbellii were investigated. It is possible that together with caseinase and hemolysin, production of other virulence factors due to continuous Hspi exposure might contribute to the pathogenesis of V. campbellii and subsequently lower survival of Vibrio-challenged Artemia.
A previous study reported that Hspi induces Hsp70 production in Artemia (Baruah et al., 2012). In our study, we demonstrated that Hspi induces Hsp70 in V. campbellii (commonly known as DnaK) as well. There are evidences showing that when induced by environmental stressors, Hsp70 are involved in the homeostasis and biogenesis of protein, thereby protecting cells from harmful environmental stressors (Guisbert and Morimoto, 2013; Parsell and Lindquist, 1993). Accordingly, the induced DnaK, as observed in our study, might have contributed to the robustness of V. campbellii, resulting in stronger tolerance of the pathogen towards the arsenals of the host defense system. Several lines of studies have reported that Hsps also play an important role in regulating the virulence of pathogens (Chakrabarti et al., 1999; Gophna and Ron, 2003). For instance, Hoffman and Garduno (1999) reported that surface associated Hsp60 and Hsp70 of an ulcer-causing bacterium, Helicobacter pylori, mediate attachment to gastric epithelial cells. The increased expression of these Hsps following acid shock correlates with both increased bacterial adhesion and inflammation of the gastric mucosa. Yamaguchi et al. (1997) also showed that Hsp60 mediates the adhesion of H. pylori to human gastric epithelial cells. In addition, Chakrabarti et al. (1999) also suggested that Dnak production may interfere with virulence factor production of V. cholera. Based on these compendiums of evidences, it can be suggested that bacterial Hsp70 (DnaK) induced by continuous exposure of V.
122 A heat shock protein inducing compound modulates host-pathogen interactions between Artemia and V. campbellii campbellii to Hspi may lead to a higher stress tolerance and virulence of V. campbellii rendering the Artemia more susceptible to infection.
Having seen that Hspi induced the expression of virulent determinants in V. campbellii in vitro, we next carried out an in vivo survival assay to confirm the impact of Hspi on the virulence of V. campbellii. Interestingly, our results showed that V. campbellii pretreated with Hspi (160 µl l-1) led to a significantly higher mortality of Artemia compared to Artemia challenged with non-treated V. campbellii. One may argue that the higher dose of Hspi may lead to faster V. campbellii growth and result in higher mortality. However, it should be noted that all the Artemia were challenged with the same dose of V. campbellii, thus, the higher mortality is more likely to be associated with an enhanced virulence and robustness of V. campbellii.
In conclusion, the overall results provide strong evidence that administration of the Hspi compound by pre-treatment confers significant protection to Artemia against V. campbellii in a conventional rearing system. In contrast, continuous exposure to this compound appeared to have a detrimental effect on Artemia, probably due to the enhanced virulence of certain pathogens or opportunists in the rearing system. Thus, when applying this compound for disease control or for stress mitigation purpose, its interaction with the microbiota in the fish/shrimp culture system needs to be considered. To lower the risk of stimulating pathogenic bacteria in aquaculture system or their activity, the rearing water is recommended to be disinfected prior to the addition of such compound. To our knowledge, this is the first experimental evidence indicating that bio-treatments such as heat-shock protein manipulation may interact with the microbes in the rearing system and negatively affect the health of the animal. Further research should focus on investigating how health promoting compounds, especially those that are directly applied in the fish/shrimp rearing water, affect as well the microbiota in the rearing environment or even in the host. It can be stated that an Hspi compound may affect the host but also the associated microbial community modulating the effectiveness of any therapeutic or prophylactic treatment.
123 Chapter 6
Acknowledgments
The authors acknowledge financial support from Ghent University, Belgium (PhD-BOF scholarship to Niu Yufeng and Parisa Norouzitallab), GOA project entitled ‘Host microbial interaction in aquatic production (project number: 01G02212) and the Belgian Science Policy Office (Belspo) project entitled ‘AquaStress’, project number: IUAPVII/64/Sorgeloos. Dr. Kartik Baruah is a postdoctoral fellow of Research Foundation Flanders (FWO), Belgium.
124
PART IV
DISCUSSION AND CONCLUSION
CHAPTER 7
General discussion, conclusion and future perspectives
General discussion, conclusion and future perspectives
1. Introduction and major results
Host-microbe interactions in aquatic animals exist on multiple levels. Natural microbiota in the rearing environment can confer direct effect on the animals by adhesion on the mucus and external surface of the body. On the other hand, aquatic larvae start drinking before the yolk sac is consumed, thus bacteria can enter the digestive tract before active feeding commences. The bacteria entering the larvae may lead to transient contact with the digestive tract or long term colonization and may ultimately form the local microbial community composition in the gut of the larvae. Naturally, the biomass and composition of gut microbiota may change with the variation of physical and chemical conditions in the environment (such as temperature, salinity, PH and organic matter). In an aquaculture rearing system, the aquaculture practices can affect the gut microbial community as well. As illustrated by Fig. 2-1, disease control and health improving treatments such as using antibiotics, immunostimulants and probiotics on single compartment of an aquaculture system may trigger a comprehensive cascade of host-microbe interactions in the complete system and will eventually have a potential impact on the host gut microbiota. As discussed in chapter 2, interactions between the gut microbiota and the aquatic host are integral in mediating the development, maintenance and effective functionality of the intestinal mucosa, including the immune response (Garcia-Garcia et al., 2013; Gomez et al., 2013). Thus, there is an urgent need to ‘re-examine’ the treatments from the perspective of an integral host-microbe interaction. This means to establish the direct link between microbe and host immune response; to investigate the steering effect on gut microbiota by treatments performed on the host; to study the potential impact of treatments on the environmental microbes and the reciprocal effect on the host. However, these interactions are far from completely understood due to the existence of complex microbiota under the conventional experimental condition.
In this thesis, a gnotobiotic brine shrimp Artemia franciscana model (GART) was used. This GART system has previously been used to study nutritional and
125 Chapter 7 immunostimulatory properties of yeast (Marques et al., 2006) and algae (Marques et al., 2004), probiotic characteristics (Marques et al., 2005). In this study the GART system was used to investigate the host-microbe interactions when a probiotic or a heat-shock protein-inducing compound was administrated to Artemia. Some major accomplishments made in this work are listed below.
This work provided more information on the mode of action of probiotics on aquatic animals (chapter 4).
In this work, we demonstrated the direct effect of a probiotic on the innate immune response of an invertebrate aquatic species by using gnotobiotic brine shrimp larvae. The pretreatment with the probiotic strain LT3 significantly enhanced the innate immune response of the larvae by elevating the prophenoloxidase gene expression at 12h post challenge by V. campbellii.
The interactions between the probiotic and the pathogen were demonstrated. The pretreatment of LT3 resulted in a decrease in in vivo bioluminescence of V. campbellii associated with the larvae, indicating a decreased in vivo activity of this pathogen due to the probiotic pretreatment. Moreover, LT3 pretreatment led to colonization of this probiotic strain in the digestive tract of the larvae, competing for adhesion sites with the pathogen.
In this thesis, for the first time, we investigated host-microbe interactions elicited by a heat-shock protein induction approach (chapter 5 and 6).
The immunostimulating effect of the heat-shock protein inducing compound, Tex-OE® (hereafter referred as Hspi), in a conventional rearing system was demonstrated. The pretreatment of Hspi could enhance the prophenoloxidase gene expression of brine shrimp larvae and improve the survival of the larvae in the conventional rearing system (chapter 5).
Meanwhile, a steering effect on the gut microbiota of the larvae by Hspi pretreatment was demonstrated (chapter 5). This steering effect suggested an interaction between the host immune response and microbial colonization.
126 General discussion, conclusion and future perspectives
We demonstrated, for the first time, that a treatment (such as heat-shock protein induction) targeting the aquatic animal can influence the behavior of microbes in the culture environment and interfere with the host-pathogen interaction (chapter 6).
The direct addition of Hspi at 160 µl l-1 can stimulate the growth of microbes in the culture environment.
V. campbellii incubated with Hspi showed significantly increased hemolytic activity and heat shock protein production leading to significantly higher mortality of brine shrimp larvae compared to non-treated V. campbellii. This result suggested that direct inoculation of Hspi may not only increase the growth of bacteria in the rearing environment but may also enhance the virulence and robustness of pathogens rendering the animal more susceptible to infection.
2. Probiotics elicit host immune responses
As mentioned in previous chapters, immunostimulating and disease resistant efficacy on animals treated with probiotics have been reported frequently. In a study performed on patients infected by vancomycin-resistant Enterococcus spp. (VRE), it was demonstrated that the presence of Barnesiella intestihominis, an abundant colonic anaerobe, alleviated the VRE infection (Taur et al., 2012). In a similar study performed on mice, re-colonization of B. intestihominis containing microbiota on VRE infected mice can eliminate the dominance of VRE (Ubeda et al., 2013). In aquaculture species, plenty of studies exist demonstrating disease resistance induction by probiotics (Farzanfar, 2006; Dimitroglou et al., 2011). Despite the apparent benefit of probiotic application, a key area that remains unclear is the mechanisms that mediate host benefits. In most of these studies, it is unclear whether this antagonism is mediated by the probiotic itself or whether the presence of probiotic bacteria contribute to the (re)establishment of a healthy, complex and protective microbiota.
Thanks to the progress in the use of germ free (GF) animal models, it is now
127 Chapter 7 revealed that colonization by microbes have direct impact on host immune response. Activation of immune related genes and expression of antimicrobial molecules by probiotic have not been reported frequently. In the studies of GF mice, colonization of B. thetaiotaomicron and Bifidobacterium longum led to significantly higher expression of type I IFN-induced GTPases which are associated with resistance to viral infection (Sonnenburg et al., 2006). In the same study, B. thetaiotaomicron colonization also enhanced the expression of the antimicrobial C‑type lectins REGIIIγ and REGIIIβ in the large intestine. Similarly, the immunostimulating effect by microbial colonization is reported in aquatic animals. In a transcriptomic analysis in zebrafish performed by Rawls et al. (2004), it was demonstrated that some immune genes were expressed in specific response to certain microorganisms. In the study of Forberg et al. (2012), the authors demonstrated that specific expression of immune related genes, such as component 3 (C3), is not only related to the presence of specific bacteria but also depended on the activity of the bacteria. As mentioned above, increasing evidences are showing that microbes can directly regulate the immune response of the host. However, due to the lack of GF animal models and limited knowledge on the immune system of non-vertebrates, most studies mentioned above focused on vertebrates.
Improved immune responses in shrimp, following probiotic administration, are also reported. Shrimp, Litopenaeus vannamei, fed a higher concentration of the probiotic (E208) exhibited significant increases in phenoloxidase activity and phagocytic activity (DengYu et al., 2009). In a recent study of NavinChandran et al. (2014), the shrimp (Penaeus monodon) fed with probiotic supplemented diets also showed higher response of immunological parameters such as total haemocyte count, phenoloxidase activity, respiratory burst activity, lysozyme activity compared to control shrimp. However, due to the presence of natural microbiota under those experimental conditions, it was not clear whether those probiotics have a direct effect on the host immune response or an indirect effect through the interaction with other gut microbes in the host.
In chapter 3, by using the GART system, a direct effect of a probiotic strain LT3
128 General discussion, conclusion and future perspectives on the immune response of brine shrimp larvae was demonstrated. As shown in Fig. 3-6, incubation with the probiotic strain LT3 can elicit a significantly higher prophenoloxidase (proPO) gene expression, especially triggered by a subsequent encounter with V. campbellii. There is ample evidence that the proPO-activating system is stimulated by cell wall components, including LPS (lipopolysaccharide), from microorganisms (Söderhäll and Cerenius, 1998; Okumura, 2007). Consistent with this, we observed a twofold up-regulation of proPO gene expression in the larvae receiving LT3 and/or V. campbellii when compared to the axenic control after 6h of exposure. This finding is in agreement with previous studies in which Bacillus species were reported to be able to induce the innate immune system (including proPO) of crustaceans (Liu et al., 2010; Zokaeifar et al., 2012). Interestingly, in the group where the larvae were exposed to LT3 for 6h before V. campbellii challenge, a significantly higher expression of proPO was observed after 12h of challenge when compared to the larvae challenged with V. campbellii without pretreatment. In addition to proPO gene, a significantly higher expression of transglutaminase gene (tgase) was observed in the larvae that were only subjected to V. campbellii challenge (24 and 36h after challenge) when compared to the other treatments. However, no significant up-regulation of tgase was observed in the larvae pre-treated with LT3 followed by V. campbellii challenge. It is hypothesized that pre-treatment of LT3 resulted in pre-activation of potent defense proteins (e.g. the proPO system as manifested by an increased expression of proPO), which upon challenge probably prevented tissue damage caused by V. campbellii and thus less need for haemolymph clotting (as reflected in the lower level of tgase expression in larvae pretreated with LT3 followed by challenge with V. campbellii). In addition, a decreased expression of heat-shock protein 70 gene suggested that pretreatment with LT3 resulted in less stress and tissue damage in the brine shrimp larvae upon the challenge.
In this study, we only examined two immune genes, the proPO and tgase, however, more immune related genes may be involved in the interaction with LT3 and V. campbellii. In any case, our results provide strong evidence that microbe can elicit
129 Chapter 7 direct impact on the host immune response of non-vertebrate species such as brine shrimp.
Host immune responses primed by probiotics
As discussed above, the pre-incubation by LT3 can elicit a stronger proPO gene expression in a subsequent encounter with the virulent V. campbellii. This finding suggests that probiotics may not only trigger a simultaneous immune response but can also pre-condition the immune system for coming stressors including infection by pathogens. In agreement with our findings, Baruah et al. (2011) also demonstrated that previous exposure to heat shock protein 70 resulted in up-regulation of the proPO gene in brine shrimp Artemia franciscana larvae challenged with V. campbellii. This pre-conditioning on host immune response was also reported in vertebrates. In a recent study of Galindo-Villegas et al. (2012), they observed a similar phenomenon on GF zebrafish. In their study, the larvae were cultured in a conventional condition (CONR) or germ free condition (GF). Seventy two hour post fertilization, the larvae in the CONR group pretreated with V. anguillarum DNA (vDNA) showed significant increasing of IL-1β gene expression, by more than 12-fold as compared with the treated GF group or more than 30-fold compared with the CONR group without vDNA pretreatment. Paulert et al. (2010) defined ‘priming’ as induction of increased resistance in an organism after previous exposure to an immunomodulating compound or sub lethal dose of a micro-organism. However, the mechanism of such priming effect is still not clear.
The studies by Cerenius and Söderhäll (2004) have suggested that the proPO is mainly located inside the haemocytes of crustaceans. Those haemocytes respond to immunostimulants or bacterial exposure by degranulation of mature haemocytes within the peripheral circulation and causing the release of a variety of potent defense proteins (like PO) into the haemocoel (Hauton et al., 2007). In the study of Sung et al. (2001), the total number of circulating hemocytes of freshwater prawn Macrobrachium rosenbergii dropped dramatically and the PO activity increased in the early hours post-
130 General discussion, conclusion and future perspectives infection of Aeromonas spp, followed by recovery at 24-48 h. They also suggested that the mass reduction of hemocytes in hemolymph might be caused by hemocytes migrating to infectious tissue to agglutinate and/or phagocytize invaders. Thus, in our study, it could be postulated that the pre-exposure of probiotics (LT3) lead to more active mobilization of haemocytes. The aggregated haemocytes in the infected tissue due to faster mobilization may then be responsible for a higher elicitation of proPO gene expression. In the study of Galindo-Villegas et al. (2012), they monitored the recruitment of neutrophils to the wounding site and the gene expression of inflammatory mediators after the transection of the tip of zebrafish larvae. They demonstrated a faster and more robust recruitment of neutrophils to the injury site in the CONR group as compared to the GF group after the tail transection along with a rapid induction of pro-inflammatory genes.
In our study, the pretreatment of LT3 could enhance the proPO-activating system upon the challenge of V. campbellii. It would be interesting to investigate the long-term effect of continuous administration of LT3 on the immune response of Artemia. Immune suppression or immune fatigue by continuous administration of immunostimulating compounds, such as (1–3)-β-d-glucan extracted from yeast cell wall, have been reported in the larval stage of aquatic animals (Sajeevan et. al., 2008; Bricknell et. al., 2005). Approaches such as discontinuous administration and alternate use of different stimulating compound to reduce the immune suppressive effect were also reported (Bai et. al. 2013). However, immune fatigue associated with probiotics was less reported. Various commensal bacteria harbor in the gut of the animals. Some of those bacteria stimulate proinflammatory factors in the host while others exert antiinflammtory effect on the host (Ivanov et. al., 2012). Thus to maintain an immune-homeostasis, the aquatic animals must have evolved a sophisticated interaction with microbes existing in the rearing environment. Moreover, the impact of a probiotic on the immune system may be more comprehensive than a pure immunostimulating compound, as the probiotic may possess diverse action modes and interact with the local microbiota associated with the host. From this context, it is very
131 Chapter 7 difficult to investigate the long-term immunomodulatory effect of a probiotic, especially in a conventional system. The fundamental information in the gnotobiotic system may provide more basic knowledge on the application of probiotics for the modulation of the immune response.
Probiotics induced host-microbe interaction in aquaculture environment
In earlier studies, the regulation of host development and defense mechanisms are often attributed to the overall gut microbiota and the recognition of virulence factors of pathogenic bacteria (Bates et al., 2007; Cheesman et al., 2011; Ivanov and Honda, 2012). However, as illustrated in Fig. 7-1, by using GART system, we demonstrated that probiotic in the rearing environment can directly affect the host immune response even before the formation of indigenous gut microbiota. Moreover, the host immune system influenced by the probiotics may exert specific responses towards other microbes in the environment. As shown in chapter 4, LT3 pretreatment enhanced the colonization of this probiotic strain and reduced the in vivo bioluminescence of V. campbellii associated with the host. In this chapter, we only demonstrated the effect of LT3 pretreatment on proPO, tgase and hsp70 expression, however, we cannot rule out the possibility that LT3 pretreatment may trigger broader immune response, leading to the reduced pathogen activity. The strengthened immune response combined with the competition of adhesion sites by LT3 can restrict the invasion of the pathogen. Similarly, in the aquaculture environment, the same action mode of probiotics may apply to the colonization of other microbes. The continuous administration of probiotics in the aquaculture rearing system may reduce the accessibility of adhesion site in the host for other microbes in the environment; meanwhile, the immune response of the host elicited by the probiotics may also interfere with the colonization of environmental animals. Thus, in aquaculture systems, probiotics administration might have potential impact on the formation of indigenous gut microbiota in cultured animals.
132 General discussion, conclusion and future perspectives
Figure. 7-1. Possible use of the gnotobiotic Artemia system to study host-microbe interaction. Complex host microbe interaction exists in aquaculture systems. By using gnotobiotic Artemia system, the complex interaction can be simplified to the bilateral interaction between host and microbe. Probiotics induce host immune responses, which then reciprocally affect the colonization of environmental microbes in the host.
3. Further investigation on probiotics mode of action
The microbe mediated host-microbe interactions are complicated. Host responses such as gene expression and immune related cytokines production are reported to have high specificity towards microbial species. For instances, in human and mice, regulatory T cells (Tregs) function and differentiation are mediated by Bacteorides fragilis and intestinal Clostridia (Ivanov and Honda, 2012). It was also reported that specific bacteria can induce a specific gene expression profile in the host (Forberg et al., 2012). Thus, the probiotic specific function is another area to be explored. The specific host response may be attributed to the microbe-associated molecular patterns of the microbes and probiotics. Thus, it would be interesting and necessary to characterize the cellular and molecular mechanisms responsible for the action mode of specific probiotics. Not many of the conventional probiotic microorganisms are part of the normal microbiota of a specific host. Accordingly, the colonization and persistence of those microbes in the host is a bottleneck for the function of those probiotics. In this context, the investigation of molecular mechanisms responsible for the host-microbe interaction may lead to the application of small molecules to deliver the beneficial
133 Chapter 7 effect of probiotics. In this case, the use of probiotics will be less constrained by the colonization and activity of live bacteria.
Modulation of the host immune response alters the colonization by environmental microbes
As discussed in chapter 2, disease control treatments on the host level, such as immunostimulants and heat-shock protein (Hsps) induction, have been intensively studied as alternatives to antibiotic use for disease control. However, in most studies, the immune response and the beneficial effect on the host are the primary focus. The impacts of treatments on the gut microbiota and environmental microbiota were often overlooked. In chapter 5 we evaluated the immunomodulatory effect of a Hsp inducing compound, Hspi on brine shrimp larvae reared in a non-gnotobiotic system. Its impact on the gut microbiota of the larvae was investigated. In chapter 6, we demonstrated the effect of this Hspi compound on the bacteria in the rearing environment.
In chapter 4, we showed that probiotic LT3 can enhance the immune response of brine shrimp larvae in a gnotobiotic system. In chapter 5, the axenicaly hatched brine shrimp larvae was pretreated with Hspi and then incubated in shrimp rearing water (non-gnotobiotic condition). Our result showed a higher proPO expression in the Hspi-pretreated larvae as compared to the control (Fig. 4-4). The result confirmed that the Hspi compound could enhance the immune response in a conventional rearing system with the presence of natural microbial communities.
In the following study, we confirmed that pre-treatment with Hspi lead to a lower richness and evenness of the gut microbiota in Hspi-pretreated larvae as compared to the control (chapter 5, Fig. 5-7 and Fig. 5-8). Because the Hspi pre-treatment was performed in GF condition and the remaining compound was rinsed away before exposing the larvae to microbiota in the rearing water, we can suggest that the immunostimulative effect of Hspi can interfere with the composition of gut microbial community composition of the the larvae. However, the mechanism of such steering
134 General discussion, conclusion and future perspectives effect by Tex-OE® needs further investigation.
One hypothesis is that the alteration of resident gut microbial community composition induced by Hspi may associate with the induction of Hsp70. As discussed in chapter 2, extracellular Hsp70 being released into the tissue is regarded as damage-associated molecular pattern (DAMPs), which can elicit the host immune response. The interactions between DMAPs and Toll-like receptors (TLRs), which lead to pro-inflammatory response, have been documented (Jiang et al., 2005; Wu et al., 2007; Galloway et al., 2008). In addition, the activation of TLRs, such as TLR2 and TLR4 by Hsps were also reported (Zhang et al., 2009; Lee et al., 2012). Although, the studies mentioned above mainly focused on terrestrial vertebrates, much resemblance of the innate immune response between vertebrates and non-vertebrates were reported (Garcia-Garcia et al., 2013). The mechanisms of Hsp70 induced immune response in invertebrates were not often reported. However, in the study of Baruah et al., (2011), Hsp70 was demonstrated to enhance the proPO system of brine shrimp larvae after sequential exposure to V. campbellii. In vertebrates such as human and mice, some commensal bacteria, such as B. fragilis and Clostridium, were reported to facilitate their colonization by producing anti-inflammatory factors, such as IL-10 producing regulatory T cells (Round and Mazmanian, 2010; Round et al., 2011; Ivanov and Honda, 2012). Besides the cases mentioned above, there might be other bacteria that are capable to establish a mutualistic relationship with the host by alleviating the host inflammatory response. It has been demonstrated by Baruah et al. (2012) that the pre-treatment of Hspi compound (Tex-OE®) can induce overproduction of Hsp70 in the brine shrimp Artemia franciscana. As discussed above, the overproduction of Hsp70 may lead to enhanced immune response of the host such as pro-inflammation. It is possible that the enhancement of immune response such as inflammation action induced by Hspi may limit the colonization of some microbes while favor the colonization of other microbes that can induce the anti-inflammation factor of the host.
The results presented here provide a strong indication that immune modulation in aquaculture animals may lead to a change of the gut microbiota. It is possible that in
135 Chapter 7 later life cycle, the diets or other environmental factor will further modulate the gut microbiota (Olafsen, 2001; Sung et al., 2001), but at least, in our study, we confirmed that the gut microbiota can be modulated by immunostimulants during the larvae stage of the animal.
Impact of Hspi on environmental microbes
In most studies on immunostimulants, the primary interest is the host immune response and disease resistance. The potential direct effect of those compounds on the environmental microbes including pathogens is mostly ignored. However, it is necessary to investigate whether a certain immunostimulating treatment may affect microbial behavior in the rearing environment. As in some cases, traces of those compounds may significantly affect the microbial activity in the environment. For example, bath delivery is probably the only option to immunostimulate yolk sac larvae that have not opened their mouth. In such case, the addition of an organic compound such as an immunostimulant may lead to the increase of organic load and interfere with the quantity and activity of the bacteria in the system.
As demonstrated in Fig. 6-2, inoculation of Hspi in the conventional systems failed to protect the larvae against later V. campbellii challenge while a successful protection against the same pathogen was obtained by pre-treating the animal in a GF condition. Those results suggested a strong host-microbe interaction triggered by Tex-OE® inoculation in the rearing environment.
As shown by Fig. 6-4, Hspi stimulated the growth of total heterotrophic bacteria in the conventional rearing system. Moreover, the in vitro test indicated that Tex-OE® increased hemolysis and caseinase production of V. campbellii. Hemolysin is an important and widely distributed virulence factor among pathogenic Vibrios (Wong et al., 2012). They are toxic to erythrocytes and other cell types as well (Rowe and Welch, 1994). The hemolysin in the extracellular products (ECP) of V. anguillarum was also suggested to be involved in pathogenesis of aquatic animals due to the anemic response that was observed in infected fish. The results presented here give a strong indication
136 General discussion, conclusion and future perspectives that Hspi can stimulate growth and virulence of pathogens in the rearing environment. As demonstrated in Fig. 6-7, we observed that V. campbellii pre-treated by Tex-OE® caused more severe mortality of brine shrimp larvae in the gnotobiotic system compared to un-treated V. campbellii. The higher mortality may be associated with the higher hemolytic activity of V. campbellii pre-treated by Hspi. In this study, the impact of Hspi on V. campbellii virulence factor production was monitored in vitro. However, in order to confirm the link between the more severe mortality and the increased virulence, quantification of the virulence gene expression of V. campbellii in association with the brine shrimp larvae incubated with or without Hspi should be performed.
According to the unpublished data of Baruah et al., this Hspi (Tex-OE®) was demonstrated to produce reactive oxygen species (ROS). ROS was reported to be the signal to regulate biofilm dispersal (McDougald et al., 2011). Similarly, the ROS produced by Hspi may also serve as a signal affecting the behavior of microbes in the environment. In addition, variation of gene expression potentially resulting in variant phenotypic character of an identical microbe is common during different stage of biofilm establishment and/or dispersal (McDougald et al., 2011). Thus, the ROS production induced by Hspi application may have a direct effect on V. campbellii or other opportunists for instance by influencing the alternation between adherent and free living forms. Phuoc et al. (2009) reported that by culturing luminescent Vibrios in a dark and static condition, a non-luminescent isogenic strain could be obtained. They reported that the non-luminescent isogenic strains obtained by a dark and static culture condition (adhesive living mode) are less virulent than the luminescent strain (suspended living mode) towards Artemia. Thus, it is possible that Hspi may lead to phenotypic shift of the microbes in the rearing environment and result in more aggressive environment for the host.
As demonstrated in Fig. 7-2, the overall results in chapter 5 & 6 provide strong evidence that, depending on the administration manner, immunostimulation may trigger the comprehensive host-microbe interaction in every compartment of the
137 Chapter 7 aquaculture system. In addition, when designing an immunostimulating product, investigating the impact on environmental microbes and certain well known pathogens are necessary.
Figure. 7-2. Use of the GART system for the study of host-microbe interactions. Complex host microbe interaction exists in aquaculture system. By using GART, the complex interaction can be simplified to the bilateral interaction between host and microbe. Immunostimulants induce host immune responses which may indirectly affect the colonization of environmental microbes in the host.
4. Summary
As illustrated in Fig. 7-3, by using the gnotobiotic brine shrimp model, we documented the host-microbe interactions elicited by probiotics (LT3) or by the Hspi. In addition, we demonstrated that direct inoculation of Hspi in the rearing water did not provide protection to brine shrimp larvae against the challenge of V. campbellii, probably due to the stimulation of Hspi on the growth and virulence factors of the pathogens in the rearing water.
138 General discussion, conclusion and future perspectives
Figure. 7-3. Gnotobiotic system demonstrates the host-microbe interactions between each compartment of the complete aquaculture system. Probiotics and immunostimulants may directly trigger the host immune response; probiotics may affect the gut microbiota by direct colonization; immunostimulants may affect the gut microbiota by inducing immune responses that favor or restrict the colonization of some bacteria; immunostimulating compounds may have direct impact on the growth or other traits of the bacteria in the environment, which may then affect the health of the aquatic animal.
5. Possible future work
Determination of more immune related genes of Artemia franciscana
In this thesis, we investigated the impact of probiotics (LT3) and Hspi on the immune response of Artemia by focusing on two immune genes, prophenoloxidase gene and transglutaminase gene. However, we cannot rule out the possibility that more innate immune mechanisms, such as the production of antimicrobial peptides, release of reactive oxygen species and phagocytosis, are involved upon probiotic and Hspi treatment, conferring protection to the Artemia. Thanks to the recently established Artemia genome, we are able to identify more immune genes of Artemia franciscana, to generate a more complete profile of Artemia immune response upon the stimulation by different biotreatments and the infection by different pathogens.
139 Chapter 7
Investigate whether probiotics such as LT3 can stimulate HSP70 production
HSP70 is produced by the host to reduce the cellular damage caused by various stressors. Meanwhile, the HSP70 level could also be used as a marker to evaluate the stress status of the animals. In chapter 3, the probiotic LT3 was shown to confer protection to Artemia against V. campbellii challenge, by enhancing the proPO-activating system and reducing the pathogen activity. The lower Hsp70 gene expression of LT3-treated Artemia after the challenge by Vibrio indicated a less stressed condition of the animals, which was in agreement with the higher survival of the Artemia treated by the probiotics. On the other hand, in chapter 5, the Hspi have been demonstrated to stimulate early production of Hsp70, conferring protection to the Artemia against sequential stressors (Baruah et al., 2012). In the future work, it would be interesting to investigate whether the administration of probiotics such as LT3 can stimulate early HSP70 production. This study will provide more fundamental knowledge on the mode of action of probiotics.
Determination of the steering effect on gut microbiota by different treatments
Pattern recognition receptors (PRRs) are involved in Immune response induced by probiotics or microbe-based immunostimulants. Using the PRRs, the host can recognize the specific features of a microorganism termed microbe-associated molecular patterns (MAMPs). In studies performed on mice and mammals, it has been suggested that Toll-like receptors (TLRs) and NOD-like receptors (NLRs) are crucial innate immune receptors for the general detection of bacteria (Ivanov and Honda, 2012). Cerf-Bensussan and Gaboriau-Routhiau (2010) showed that loss of TLRs inhibits immune activation of intestinal epithelial cell (IEC). It was suggested that the activation of TLRs or NLRs will lead to the release of a wide range of pro-inflammatory factors interfering with the colonization of microbes. There are studies suggesting that TLRs are mainly involved in the immunomodulatory effect of the commensals other than affecting the composition of commensals (Ubeda et al., 2012) but Round et al. (2011) demonstrated the colonization of a commensal mediated by TLR2 pathway. On the
140 General discussion, conclusion and future perspectives other hand, deficiencies in NOD1, NOD2, Nlrp3, and Nlrp6 have all been shown to affect the gut microbial composition (Bouskra et al., 2008; Petnicki-Ocwieja et al., 2009; Elinav et al., 2011; Henao-Mejia et al., 2012). In the review of Garcia-Garcia et al. (2013), same PRRs like TLRs, resembling inflammatory process are also reported in non-vertebrates. Thus, in non-vertebrates, such as brine shrimp, probiotics or certain immunostimulants (dead bacteria or bacterial components) may regulate the host immune response and gut microbiota through a similar mechanism mediated by PRRs.
The extracellular Hsps are potential immunological danger signals (Moseley, 1998). In mammals, it has been shown that after being released, these extracellular Hsps can induce the production of pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β and IL-6 and chemokine’s (Gao and Tsan, 2004). Several other studies have suggested that Hsps may also trigger the immune response through the activation of TLRs (Asea, 2008; Zhang et al., 2009; Lee et al., 2012). However, studies on the Hsps modulatory effect on the gut microbiota are limited. According to our results (chapter 5), Hsps mediated immune responses may also modulate the gut microbial community composition.
Although probiotics, immunostimulants and heat shock protein induction can all lead to immune responses that benefit the host and modulate the gut microbial community composition, heterogeneity of immune responses mediated by different treatments may exist. Thus, this may lead us to the question whether different treatments such as probiotics, hsp inducing compound or other immunostimulants may steer the initial formation of host gut microbiota to a different direction. Indeed, it has been reported that (Olafsen, 2001) diets or environmental microbiota have strong shaping force on the host microbiota. However, as for larval animals, microbe colonization starts before the exogenous feeding, thus, the formation of the host gut microbial community mainly depends on the host selection or the colonization related capacity of the microbes (adhesive ability, ability to evade from, or suppress, or tolerate the host’s immune response). The early immune response elicited by probiotics or by immunostimulants may add extra forces in this natural host-microbe interaction.
141 Chapter 7
As shown in Fig. 7-4, by using the GART model, different treatments, such as probiotics incubation or immunostimulation or heat shock protein induction can be performed before exposing the animals to the natural or a known microbial community. With this approach, the host immune responses are activated by the same or different mechanisms in absence of environmental microbes. Thus, sequential incubation of these larvae in the same environment can further reveal the steering effect of different treatments on the gut microbiota.
Figure. 7-4. Use GART to study the steering effect of different treatments on the gut microbiota (MC). Treatments such as probiotic administration, Hsps induction, immunostimulants administration may drive the gut microbiota of brine shrimp larvae to different directions. The larvae carrying different gut microbiota may then be collected for further study of the function of these gut microbiota. Nevertheless, strong host selection may also lead to uniform gut microbiota.
Study the function of microbiota induced by different treatments
The defense system of in-vertebrates is limited to their innate immune response. Thus, implication of long-term protection, such as vaccination, against specific
142 General discussion, conclusion and future perspectives pathogen is difficult in in-vertebrates. As discussed earlier, the innate immune system of in-vertebrates can detect the invasion of pathogens by recognizing the PAMPs or MAMPs and trigger a wide range of responses to trap or kill the pathogens. By using immunostimulating approaches, the innate immune response can be temporally enhanced or pre-activated for an up coming infection. However, this immunostimulating effect is often transient (unless provided continuously or with a pulse strategy). Meanwhile, there is also the potential risk when applying immunostimulating approaches to immunologically immature animals. On the other hand, in every life cycle, the gut microbiota regulate the immune homeostasis of the host and provide various mechanisms in restricting the invasion or damage by other pathogens (Ivanov and Honda, 2012). As discussed previously, modulating the host immune response may simultaneously interfere with the formation of gut microbiota, especially in the larval stage when the immune system has not been fully developed. Following this, in the long run, modulating a well-functioning gut microbiota in the host is more sustainable as a health management strategy and this may be achieved by modulating the host immune system.
As in humans, the transplants of microbiota from healthy host fecal matter may lead to beneficial or therapeutic effects in the diseased host (Khoruts and Sadowsky, 2010). However, the mechanism of the beneficial effect associated by this microbial transplantation is not clear. In aquaculture animals especially in-vertebrate species, few such studies have been considered. In order to design the possible therapeutic approach based on gut microbiota manipulation, it is necessary to compare the function of gut microbiota with different composition. As illustrated in Fig. 7-4, if different immune modulating approaches may steer the host gut microbiota differently, then sequential test could be performed to study the effect of the steered gut microbiota on, for example, disease resistance, inhibition against pathogen colonization, effect on host digestive function. Although in this approach the gut microbiota are steered by the treatments, however, host-selection will play crucial role in the colonization of the different bacteria as well. Thus, future application of single or mixed microbes derived
143 Chapter 7 from these microbiota should have better compatibility with the host.
Prime the gut microbiota in larvae animals.
Commensals may induce resistance or tolerance to many diseases, because an community is evolutionarily established to sustain a healthy immune state (Chervonsky, 2012; Ivanov and Honda, 2012). In adult animals the stable gut microbiota has been formed and the matured immune system is also in shape, thus, the animals are less susceptible to environmental changes and pathogen infections. However, in the larval stage, the initial colonization is strongly affected by the environmental microbiota. Although host selection exists, the primary colonization is strongly determined by the microbial community in the environment and the random entrance of bacteria as well.
In the review of Ivanov and Honda (2012), the negative effect on the host, such as chronic inflammation or metabolic syndrome due to perturbation in the commensal composition is defined as ‘dysbiosis’. They also pointed out that once established, the dysbiotic microbiota might be a highly stable complex and therefore refractory to treatment with individual transient probiotic strains. Moreover, the dysbiotic microbiota may be transplantable to GF or even conventionally raised animals (Elinav et al., 2011; Henao-Mejia et al., 2012). Thus, in an aquaculture system, it is necessary to steer the gut microbiota in the direction that benefits the animal health and prevent the generation of such ‘dysbiotic’ microbiota.
As discussed in earlier sections, it is interesting to steer different gut microbiota and compare the functional property of those gut microbiota by using the gnotobiotic Artemia system. If a beneficial gut microbiota was observed, then in theory, efforts could be put to stimulate the colonization of the beneficial microbiota, on the level of both the host and the environment, e.g., by simultaneously using an appropriate steering method (which was shown to generate a beneficial microbiota) and inoculating the beneficial microbiota or members of the microbiota into the rearing environment. In this approach, we are not only focusing on the immunostimulating effect which benefits the animal for a shorter time only. On the contrary, we could steer the establishment of
144 General discussion, conclusion and future perspectives a beneficial commensal microbiota which can benefit the health of the host continuously.
Indeed, despite promising data from animal models, a limited number of probiotics was rationally isolated from the commensal microbiota with the purpose of stimulating specific immune response of the host immune system or to fix a particular commensal dysbiosis. With our approach as mentioned above, there is a possibility to identify more robust therapeutic organisms that are compatible to the host and can affect the host immune system in a well-controlled fashion. Yet difficulties still exist in such studies. For example, it needs to be distinguished whether the health improving effects observed on the animal is associated with the composition of the gut microbiota or due to the immune enhancement in the initial immunomodulatory procedure. Thus it would be necessary to first carry out experiments to determine the endurance of immunostimulating effect in the absence of gut microbiota in GF animals. Ideally, we might provide better chances for the larvae to establish a normal and well-functional microbiota.
A function-oriented microbial management
As discussed early in the thesis, microbiota associated with aquatic animal plays an essential role in gut development, nutrient metabolism and immune response. Due to the stochastic colonization of the larvae by microbes, the formation of a normal and well-functioning intestinal microbiota is not always guaranteed. To insure a more stable and bio-secure microbiota in the rearing system, techniques like RAS and water maturation have been applied. With these techniques, a microbial resources with minimal concentration of pathogens and opportunists, such as microbiota dominated by K-selectors , are offered to the animal for colonization. These microbial management techniques are generally more quality-oriented strategies, providing the larvae with a living environment containing ‘high quality’ microbiota. Now we are aware that the colonization by specific microbes may modulate the host response differently, thus it is possible to steer a more positive host-microbe interaction by a
145 Chapter 7 function-oriented microbial management.
Currently aquaculture feeds are delicately sorted according to the species and life stage of animals. Similar to the delicate demand of nutrition profile, gut microbiota of the host may shift along with the life cycle. The different nutritional demand or physiological process in different life cycle of a farmed species may also indicate specific host-microbe interactions that are involved. From this perspective, it would be worthwhile to establish a local ‘microbe-function archive’ by carrying out more studies to determine specific indigenous microbes or microbiota that are associated with a healthy animal. Thus, more probiotic or commensal microbes should be isolated and applied according to their ‘code’ of certain species and even life stages. Those indigenous microbes can be supplied to the animal by incorporation with the feed or inoculation in the rearing water. After all, using a beneficial microbe that is well tailored for specific needs sounds more reasonable than using a probiotic that may not even be compatible with the host. A quality-oriented microbial management such RAS can ensure that the animal lives in a healthy environment, while a future function-oriented microbial management may provide the animal with the right microbe at the right time.
146
PART V
APPENDIX
APPENDIX A
Supplemental Tables & Figures
Supplemental Tables & Figures
Table 1: Candidates of housekeeping genes of Artemia franciscana
Gene Full name
GAPDH glyceraldehyde-3-phosphate dehydrogenase
G6pd glucose-6-phosphate dehydrogenase
18S rRNA 18s ribosomal RNA
b2m beta-2-microglobulin
β-Actin Beta-actin
HPRT Hypoxanthine-guanine phosphoribosyltransferase
tuba1 tubulin alpha 1
elfa elongation factor 1 alpha
tbp tata box binding protein
* We use β-actin gene as the reference gene for measuring the relative expression of the target genes. β-actin is a well-known reference gene and a well-established reference gene for Artemia in the previous work of our lab (Baruah et. al., 2011). However, it is recommended that more than one reference gene should be provided to calculate the relative expression of a target gene (Fernandes et. al., 2008). Although other reference genes of Artemia were not available when we carried out this PhD study, future baseline studies could be carried out to select more candidates for the housekeeping genes of Artemia franciscana based on the Artemia genome.
147 Appendix A
Figure 1: DGGE fingerprints of the luminal and resident gut microbial community of Artemia after the pretreatment of Hspi (Tex-OE®). This figure provides a view of the overall gut microbiota of Artemia 36 h after the pretreatment of Hspi.
A: resident gut microbiota of Artemia pretreated with Hspi; B: resident gut microbiota of Artemia in the negative control; C: resident gut microbiota of Artemia pretreated with ethanol; D: luminal gut microbiota of Artemia pretreated with Hspi; E: luminal gut microbiota of Artemia pretreated with ethanol; F: luminal gut microbiota of Artemia in the negative control.
148
APPENDIX B
References
References
References
Akinbowale, O.L., Peng, H., and Barton, M.D. (2006) Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. Journal of Applied Microbiology 100: 1103-1113.
Aly, S.M., Abdel-Galil Ahmed, Y., Abdel-Aziz Ghareeb, A., and Mohamed, M.F. (2008) Studies on Bacillus subtilis and LactoBacillus acidophilus, as potential probiotics, on the immune response and resistance of Tilapia nilotica (Oreochromis niloticus) to challenge infections. Fish & Shellfish Immunology 25: 128-136.
Amparyup, P., Charoensapsri, W., Tassanakajon, A. (2009) Two prophenoloxidases are important for the survival of Vibrio harveyi challenged shrimp Penaeus monodon. Developmental & Comparative Immunology 33: 247-256.
Amparyup, P., Sutthangkul, J., Charoensapsri, W., and Tassanakajon, A. (2012) Pattern Recognition Protein Binds to Lipopolysaccharide and β-1,3-Glucan and Activates Shrimp Prophenoloxidase System. Journal of Biological Chemistry 287: 10060-10069.
Anderson, D.P., and Siwicki, A.K. (1994) Duration of protection against Aeromonas salmonicida in brook trout immunostimulated with glucan or chitosan by injection or immersion. The Progressive Fish-Culturist 56: 258-261.
Asea, A. (2008) Heat shock proteins and toll-like receptors. In Toll-like receptors (TLRs) and innate immunity: Springer, 111-127.
Ashley, P.J. (2007) Fish welfare: current issues in aquaculture. Applied Animal Behaviour Science 104: 199-235.
Atarashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwahara, T., Momose, Y. et al. (2011) Induction of colonic regulatory T cells by indigenous Clostridium species. Science 331: 337-341.
149 Appendix B
Attramadal, K.J., Salvesen, I., Xue, R., Øie, G., Størseth, T.R., Vadstein, O., and Olsen, Y. (2012a) Recirculation as a possible microbial control strategy in the production of marine larvae. Aquacultural Engineering 46: 27-39.
Attramadal, K.J.K., Øie, G., Størseth, T.R., Alver, M.O., Vadstein, O., and Olsen, Y. (2012b) The effects of moderate ozonation or high intensity UV-irradiation on the microbial environment in RAS for marine larvae. Aquaculture 330-333: 121-129.
Attramadal, K.J.K., Tøndel, B., Salvesen, I., Øie, G., Vadstein, O., and Olsen, Y. (2012c) Ceramic clay reduces the load of organic matter and bacteria in marine fish larval culture tanks. Aquacultural Engineering 49: 23-34.
Austin, B., Austin, D., Sutherland, R., Thompson, F., Swings, J., (2005) Pathogenicity of vibrios to rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii. Environmental Microbiology 7: 1488-1495.
Austin, B., and Zhang, X.H. (2006) Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates. Letters in Applied Microbiology 43: 119-124.
Avendaño-Herrera, R., Núñez, S., Barja, J.L., and Toranzo, A.E. (2008) Evolution of drug resistance and minimum inhibitory concentration to enrofloxacin in Tenacibaculum maritimum strains isolated in fish farms. Aquaculture International 16: 1-11.
Bagheri, T., Hedayati, S.A., Yavari, V., Alizade, M., and Farzanfar, A. (2008) Growth, survival and gut microbial load of rainbow trout (Onchorhynchus mykiss) fry given diet supplemented with probiotic during the two months of first feeding. Turkish Journal of Fisheries and Aquatic Sciences 8: 43-48.
Bagni, M., Archetti, L., Amadori, M., and Marino, G. (2000) Effect of Long-term Oral Administration of an Immunostimulant Diet on Innate Immunity in Sea Bass (Dicentrarchus labrax). Journal of Veterinary Medicine, Series B 47: 745-751.
150 References
Balcázar, J.L., Blas, I.d., Ruiz-Zarzuela, I., Cunningham, D., Vendrell, D., and Múzquiz, J.L. (2006) The role of probiotics in aquaculture. Veterinary Microbiology 114: 173-186.
Balcázar, J.L., De Blas, I., Ruiz‐Zarzuela, I., Vendrell, D., Girones, O., and Muzquiz, J.L. (2007) Enhancement of the immune response and protection induced by probiotic lactic acid bacteria against furunculosis in rainbow trout (Oncorhynchus mykiss). FEMS Immunology & Medical Microbiology 51: 185-193.
Balucci, C.A. (2005) Studies on the Properties of an Extract of Opuntia ficus indica. PhD thesis, University of Malta, 376: 751-756.
Bandyopadhyay, P., and Mohapatra, P.K.D. (2009) Effect of a probiotic bacterium Bacillus circulans PB7 in the formulated diets: on growth, nutritional quality and immunity of Catla catla (Ham.). Fish Physiology and Biochemistry 35: 467-478.
Baruah, K., Ranjan, J., Sorgeloos, P., and Bossier, P. (2010) Efficacy of heterologous and homologous heat shock protein 70s as protective agents to Artemia franciscana challenged with Vibrio campbellii, Fish & Shellfish Immunology 29: 733-739.
Baruah, K., Ranjan, J., Sorgeloos, P., MacRae, T.H., and Bossier, P. (2011) Priming the prophenoloxidase system of Artemia franciscana by heat shock proteins protects agains Vibrio campbellii challenge. Fish & Shellfish Immunology 31: 134-141.
Baruah, K. (2012) Induced heat shock protein production protects Artemia against vibriosis, PhD thesis, Ghent, Belgium: Ghent University. Faculty of Bioscience Engineering, 7-10.
Baruah, K., Norouzitallab, P., Roberts, R.J., Sorgeloos, P., and Bossier, P. (2012) A novel heat-shock protein inducer triggers heat shock protein 70 production and protects Artemia franciscana nauplii against abiotic stressors. Aquaculture 334: 152-158.
Baruah, K., Norouzitallab, P., Shihao, L., Sorgeloos, P., Bossier, P., (2013) Feeding truncated heat shock protein 70s protect Artemia franciscana against virulent Vibrio campbellii challenge. Fish & Shellfish Immunology 34: 83-191.
151 Appendix B
Bates, J.M., Akerlund, J., Mittge, E., and Guillemin, K. (2007) Intestinal alkaline phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell host & Microbe 2: 371-382.
Bondad-Reantaso, M.G., Subasinghe, R.P., Arthur, J.R., Ogawa, K., Chinabut, S., Adlard, R. et al. (2005) Disease and health management in Asian aquaculture. Veterinary Parasitology 132: 249-272.
Boshra, H., Li, J., and Sunyer, J. (2006) Recent advances on the complement system of teleost fish. Fish & Shellfish Immunology 20: 239-262.
Bossier, P., and Verstraete, W. (1996) Comamonas testosteroni colony phenotype influences exopolysaccharide production and coaggregation with yeast cells. Applied and Environmental Microbiology 62: 2687-2691.
Bouskra, D., Brézillon, C., Bérard, M., Werts, C., Varona, R., Boneca, I.G., and Eberl, G. (2008) Lymphoid tissue genesis induced by commensals through NOD1 regulates intestinal homeostasis. Nature 456: 507-510.
Bray, J.R., and Curtis, J.T. (1957) An ordination of the upland forest communities of southern Wisconsin. Ecological Monographs 27: 325-349.
Bricknell, I., and Dalmo, R.A. (2005) The use of immunostimulants in fish larval aquaculture. Fish & Shellfish Immunology 19: 457-472.
Broderick, N.A., Raffa, K.F., and Handelsman, J. (2010) Chemical modulators of the innate immune response alter gypsy moth larval susceptibility to Bacillus thuringiensis. BMC Microbiology 10: 129.
Broughton, E.I., and Walker, D.G. (2009) Prevalence of antibiotic-resistant Salmonella in fish in Guangdong, China. Foodborne Pathogens and Disease 6: 519-521.
Brunt, J., and Austin, B. (2005) Use of a probiotic to control lactococcosis and streptococcosis in rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases 28: 693-701.
152 References
Buchon, N., Broderick, N.A., Chakrabarti, S., and Lemaitre, B. (2009) Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila. Genes & Development 23: 2333-2344.
Burrells, C., Williams, P., and Forno, P. (2001) Dietary nucleotides: a novel supplement in fish feeds: Effects on resistance to disease in salmonids. Aquaculture 199: 159-169.
Buschmann,. A.H., Tomova, A., Lo´pez, A., Maldonado, M.A., Henrı´quez, L.A., Ivanova, L., et al. (2012) Salmon Aquaculture and Antimicrobial Resistance in the Marine Environment. PLoS ONE 7: doi:10.1371/journal.pone.0042724.
Cabello, F.C. (2006) Heavy use of prophylactic antibiotics in aquaculture: a growing problem for human and animal health and for the environment. Environmental Microbiology 8: 1137-1144.
Camilleri, T. (2002) The prophylactic effect of TEX-OE® in angelfish (Pterophyllum scalare) against stress caused by ammonia, nitrite and chlorine. B. Sc Hons thesis. University of Malta.
Cerenius, L., and Söderhäll, K. (2004) The prophenoloxidase-activating system in invertebrates. Immunological Reviews 198: 116-126.
Cerenius, L., Lee, B.L., and Söderhäll, K. (2008) The proPO-system: pros and cons for its role in invertebrate immunity. Trends in Immunology 29: 263-271.
Cerezuela, R., Meseguer, J., and Esteban, M. (2011) Current knowledge in synbiotic use for fish aquaculture: a review. Journal of Aquaculture Reseach & Development 3: 1-7
Cerf-Bensussan, N., and Gaboriau-Routhiau, V. (2010) The immune system and the gut microbiota: friends or foes? Nature Reviews Immunology 10: 735-744.
Chakrabarti, S., Sengupta, N., Chowdhury, R., 1999. Role of DnaK in in vitro and in vivo expression of virulence factors of Vibrio cholerae. Infection and Immunity 67: 1025-1033.
153 Appendix B
Cheesman, S.E., Neal, J.T., Mittge, E., Seredick, B.M., and Guillemin, K. (2011) Epithelial cell proliferation in the developing zebrafish intestine is regulated by the Wnt pathway and microbial signaling via Myd88. Proceedings of the National Academy of Sciences 108: 4570-4577.
Chen, M.Y., Hu, K.Y., Huang, C.C., and Song, Y.L. (2005) More than one type of transglutaminase in invertebrates? A second type of transglutaminase is involved in shrimp coagulation. Developmental & Comparative Immunology 29: 1003-1016.
Chen, T., and Cao, X. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. European journal of Immunology 40: 1541-1544.
Chervonsky, A.V. (2012) Intestinal commensals: influence on immune system and tolerance to pathogens. Current Opinion in Immunology 24: 255-260.
Clauss, T.M., Dove, A.D., Arnold, J.E., 2008. Hematologic disorders of fish. Veterinary Clinics of North America: Exotic Animal Practice 11: 445-462.
Cohen-Poradosu, R., McLoughlin, R.M., Lee, J.C., and Kasper, D.L. (2011) Bacteroides fragilis–stimulated interleukin-10 contains expanding disease. Journal of Infectious Diseases 204: 363-371.
Collins, C.H., and Clegg, J.S. (2004) A small heat-shock protein, p26, from the crustacean Artemia protects mammalian cells (Cos-1) against oxidative damage. Cell Biology International 28: 449-455.
Conti, H.R., Shen, F., Nayyar, N., Stocum, E., Sun, J.N., Lindemann, M.J. et al. (2009) Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis. The Journal of Experimental Medicine 206: 299-311.
Crab, R., Avnimelech, Y., Defoirdt, T., Bossier, P., and Verstraete, W. (2007) Nitrogen removal techniques in aquaculture for a sustainable production. Aquaculture 270: 1-14.
154 References
Crab, R. (2010) Bioflocs Technology: An Integrated System for the Removal of Nutrients and Simultaneous Production of Feed in Aquaculture. Ghent, Belgium: Ghent University. Faculty of Bioscience Engineering.
Crab, R., Chielens, B., Wille, M., Bossier, P., and Verstraete, W. (2010a) The effect of different carbon sources on the nutritional value of bioflocs, a feed for Macrobrachium rosenbergii postlarvae. Aquaculture Research 41: 559-567.
Crab, R., Lambert, A., Defoirdt, T., Bossier, P., and Verstraete, W. (2010b) The application of bioflocs technology to protect brine shrimp (Artemia franciscana) from pathogenic Vibrio harveyi. Journal of Applied Microbiology 109: 1643-1649.
Crab, R., Defoirdt, T., Bossier, P., and Verstraete, W. (2012) Biofloc technology in aquaculture: Beneficial effects and future challenges. Aquaculture 356-357: 351-356.
Dalmo, R. (2000) Immunostimulatory β (1,3)-D-glucans; prophylactic drugs against threatening infectious diseases of fish. In: Bioactive Carbohydrate Polymers: Springer: 95-106.
Daniel, C.L, Merrifield, D., Ringø, E., Davies,. S. (2013) Probiotic, prebiotic and synbiotic applications for the improvement of larval European lobster (Homarus gammarus) culture. Aquaculture 416-417: 396-406.
Darshanee Ruwandeepika, H.A., Sanjeewa Prasad Jayaweera, T., Paban Bhowmick, P., Karunasagar, I., Bossier, P., Defoirdt, T., (2012) Pathogenesis, virulence factors and virulence regulation of vibrios belonging to the Harveyi clade. Reviews in Aquaculture 4: 59-74.
Das, A., Saha, D., and Pal, J. (2009) Antimicrobial resistance and in vitro gene transfer in bacteria isolated from the ulcers of EUS-affected fish in India. Letters in Applied Microbiology 49: 497-502.
Davey, M.E., and O'toole, G.A. (2000) Microbial biofilms: from ecology to molecular genetics. Microbiology and Molecular Biology Reviews 64: 847-867.
155 Appendix B
Decaestecker, E., Labbe, P., Ellegaard, L., Allen, J., Little, T. (2011) Candidate innate immune system gene expression in the ecological model Daphnia. Developmental & Comparative Immunology 35: 1068-1077
De Schryver, P., Crab, R., Defoirdt, T., Boon, N., and Verstraete, W. (2008) The basics of bio-flocs technology: the added value for aquaculture. Aquaculture 277: 125-137.
De Schryver, P., Sinha, A.K., Kunwar, P.S., Baruah, K., Verstraete, W., Boon, N. et al. (2010) Poly-β-hydroxybutyrate (PHB) increases growth performance and intestinal bacterial range-weighted richness in juvenile European sea bass, Dicentrarchus labrax. Applied Microbiology and Biotechnology 86: 1535-1541.
Defoirdt, T., Boon, N., Bossier, P., and Verstraete, W. (2004) Disruption of bacterial quorum sensing: an unexplored strategy to fight infections in aquaculture. Aquaculture 240: 69-88.
Defoirdt, T., Crab, R., Wood, T.K., Sorgeloos, P., Verstraete, W., and Bossier, P. (2006) Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates. Applied and environmental microbiology 72: 6419-6423.
Defoirdt, T., Boon, N., Sorgeloos, P., Verstraete, W., Bossier, P. (2007a) Alternatives to antibiotics to control bacterial infections: luminescent vibriosis in aquaculture as an example. Trends in Biotechnology 25: 472-479.
Defoirdt, T., Halet, D., Vervaeren, H., Boon, N., Van de Wiele, T., Sorgeloos, P. et al. (2007b) The bacterial storage compound poly-β-hydroxybutyrate protects Artemia franciscana from pathogenic Vibrio campbellii. Environmental Microbiology 9: 445-452.
Defoirdt, T., Sorgeloos, P., and Bossier, P. (2011) Alternatives to antibiotics for the control of bacterial disease in aquaculture. Current Opinion in Microbiology 14: 251-258.
156 References
Defoirdt, T., Sorgeloos, P., (2012) Monitoring of Vibrio harveyi quorum sensing activity in real time during infection of brine shrimp larvae. The ISME Journal 6: 2314-2319.
Denev, S., Staykov, Y., Moutafchieva, R., and Beev, G. (2009) Microbial ecology of the gastrointestinal tract of fish and the potential application of probiotics and prebiotics in finfish aquaculture. International Aquaculture Research 1: 1-29.
DengYu, T., PeiLin, H., SungYan, H., ShengChi, C., YaLi, S., ChiuShia, C., and ChunHung, L. (2009) Enhancement of immunity and disease resistance in the white shrimp, LitoPenaeus vannamei, by the probiotic, Bacillus subtilis E20. Fish & Shellfish Immunology 26: 339-344.
Dimitroglou, A., Merrifield, D.L., Carnevali, O., Picchietti, S., Avella, M., Daniels, C. et al. (2011) Microbial manipulations to improve fish health and production–a Mediterranean perspective. Fish & Shellfish Immunology 30: 1-16.
Dowd, S., Sun, Y., Secor, P., Rhoads, D., Wolcott, B., James, G., and Wolcott, R. (2008) Survey of bacterial diversity in chronic wounds using pyrosequencing, DGGE, and full ribosome shotgun sequencing. BMC Microbiology 8: 43.
Drenkard, E., and Ausubel, F.M. (2002) Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature 416: 740-743.
Dung, T.T., Haesebrouck, F., Tuan, N.A., Sorgeloos, P., Baele, M., and Decostere, A. (2008) Antimicrobial susceptibility pattern of Edwardsiella ictaluri isolates from natural outbreaks of bacillary necrosis of Pangasianodon hypophthalmus in Vietnam. Microbial Drug Resistance 14: 311-316.
Elbal, M., Garcıa Hernandez, M., Lozano, M., and Agulleiro, B. (2004) Development of the digestive tract of gilthead sea bream (Sparus aurata L.). Light and electron microscopic studies. Aquaculture 234: 215-238.
ElFituri, A.A. (2009) The Possible Role of TEX-OE in the Pathogenesis of Vibriosis. MSc thesis, University of Malta: 97.
157 Appendix B
Elinav, E., Strowig, T., Kau, A.L., Henao-Mejia, J., Thaiss, C.A., Booth, C.J. et al. (2011) NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. Cell 145: 745-757.
FAO (2006) Report of a joint FAO/OIE/WHO expert consultation on antimicrobial use in aquaculture and antimicrobial resistance : Seoul, Republic of Korea, 13-16 June.
FAO (2010) The State of World Fisheries and Aquaculture. FAO Fisheries Department, Food and Agriculture Organization of the United Nations, Rome, Italy.
FAO (2012) The State of World Fisheries and Aquaculture. FAO Fisheries Department, Food and Agriculture Organization of the United Nations, Rome, Italy.
Farzanfar, A. (2006) The use of probiotics in shrimp aquaculture. FEMS Immunology & Medical Microbiology 48: 149-158.
Feder, M.E., and Hofmann, G.E. (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annual Review of Physiology 61: 243-282.
Feugang, J.M, Konarski, P., Zou, D., Stintzing, FC., Zou, C. (2006) Nutritional and medicinal use of Cactus pear (Opuntia spp.) cladodes and fruits. Frontiers in Bioscience 11: 2574-2589.
Femia, A.P., Salvadori, M., Broekaert, W.F., François, I.E., Delcour, J.A., Courtin, C.M., and Caderni, G. (2010) Arabinoxylan-oligosaccharides (AXOS) reduce preneoplastic lesions in the colon of rats treated with 1, 2-dimethylhydrazine (DMH). European Journal of Nutrition 49: 127-132.
Fernández-Alarcón, C., Miranda, C., Singer, R., Lopez, Y., Rojas, R., Bello, H. et al. (2010) Detection of the floR Gene in a Diversity of Florfenicol Resistant Gram-Negative Bacilli from Freshwater Salmon Farms in Chile. Zoonoses and Public Health 57: 181-188.
158 References
Fernandes, J.M.O., Momments, M., Hagen, Ø., Babiak, I., Solberg, C. (2008) Selection of suitable reference genes for real-time PCR studies of Atlantic halibut development. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 150: 23-32.
Fjellheim, A.J., Playfoot, K.J., Skjermo, J., and Vadstein, O. (2012) Inter‐individual variation in the dominant intestinal microbiota of reared Atlantic cod (Gadus morhua) larvae. Aquaculture Research 43: 1499-1508.
Forberg, T., Vestrum, R.I., Arukwe, A., and Vadstein, O. (2012) Bacterial composition and activity determines host gene-expression responses in gnotobiotic Atlantic cod (Gadus morhua) larvae. Veterinary Microbiology 157: 420-427.
Fritz, J.H., Rojas, O.L., Simard, N., McCarthy, D.D., Hapfelmeier, S., Rubino, S. et al. (2011) Acquisition of a multifunctional IgA+ plasma cell phenotype in the gut. Nature 481: 199-203.
Galindo-Villegas, J., García-Moreno, D., de Oliveira, S., Meseguer, J., and Mulero, V. (2012) Regulation of immunity and disease resistance by commensal microbes and chromatin modifications during zebrafish development. Proceedings of the National Academy of Sciences 109: E2605-E2614.
Galloway, E., Shin, T., Huber, N., Eismann, T., Kuboki, S., Schuster, R. et al. (2008) Activation of hepatocytes by extracellular heat shock protein 72. American Journal of Physiology-Cell Physiology 295: C514-C520.
Ganal, S.C., Sanos, S.L., Kallfass, C., Oberle, K., Johner, C., Kirschning, C. et al. (2012) Priming of natural killer cells by nonmucosal mononuclear phagocytes requires instructive signals from commensal microbiota. Immunity 37: 171–186.
Gao, B., and Tsan, M.-F. (2004) Induction of cytokines by heat shock proteins and endotoxin in murine macrophages. Biochemical and Biophysical Research Communications 317: 1149-1154.
159 Appendix B
Garcia-Garcia, E., Galindo-Villegas, J., and Mulero, V. (2013) Mucosal immunity in the gut: the non-vertebrate perspective. Developmental & Comparative Immunology 40: 278–288.
Geraylou, Z., Souffreau, C., Rurangwa, E., De Meester, L., Courtin, C., Delcour, J. et al. (2013) Effects of dietary arabinoxylan-oligosaccharides (AXOS) and endogenous probiotics on the growth performance, non-specific immunity and gut microbiota of juvenile Siberian sturgeon (Acipenser baerii). Fish & Shellfish Immunology 35: 766– 775.
Gibson, G.R., Probert, H.M., Van Loo, J., Rastall, R.A., and Roberfroid, M.B. (2004) Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutrtion Research Reviews 17: 259-275.
Gomez, G.D., and Balcázar, J.L. (2008) A review on the interactions between gut microbiota and innate immunity of fish. FEMS Immunology & Medical Microbiology 52: 145-154.
Gomez, D., Sunyer, J.O., and Salinas, I. (2013) The mucosal immune system of fish: The evolution of tolerating commensals while fighting pathogens. Fish & Shellfish Immunology 35: 1729–1739.
Gophna, U., Ron, E.Z. (2003) Virulence and the heat shock response. International Journal of Medical Microbiology 292: 453-461.
Granados‐Amores, A., Campa‐Córdova, Á.I., Araya, R., Mazón‐Suástegui, J.M., and Saucedo, P.E. (2012) Growth, survival and enzyme activity of lions-paw scallop (Nodipecten subnodosus) spat treated with probiotics at the hatchery. Aquaculture Research 43: 1335-1343.
Guisbert, E., Morimoto, R.I. (2013) The regulation and function of the heat shock response, In: Protein Quality Control in Neurodegenerative Diseases. Springer: 1-18.
160 References
Guttierez, G., Saliba, C., and Serrar, M. (2005) Eléments de biologie cellulaire en milieu hyperbare. L’Annuaire de la plongée sous-marine, 6éme édition, VAV édition: 88-90.
Halet, D., Defoirdt, T., Van Damme, P., Vervaeren, H., Forrez, I., Van de Wiele, T. et al. (2007) Poly-β-hydroxybutyrate-accumulating bacteria protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii. FEMS Microbiology Ecology 60: 363-369.
Hauton, C., Brockton, V., and Smith, V. (2007) Changes in immune gene expression and resistance to bacterial infection in lobster (Homarus gammarus) post-larval stage VI following acute or chronic exposure to immune stimulating compounds. Molecular Immunology 44: 443-450.
Henao-Mejia, J., Elinav, E., Jin, C., Hao, L., Mehal, W.Z., Strowig, T. et al. (2012) Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 482: 179-185.
Hess-Erga, O.-K., Blomvågnes-Bakke, B., and Vadstein, O. (2010) Recolonization by heterotrophic bacteria after UV irradiation or ozonation of seawater; a simulation of ballast water treatment. Water Research 44: 5439-5449.
Heuer, O.E., Kruse, H., Grave, K., Collignon, P., Karunasagar, I., and Angulo, F.J. (2009) Human health consequences of use of antimicrobial agents in aquaculture. Clinical Infectious Diseases 49: 1248-1253.
Hinsa-Leasure, S.M., Koid, C., Tiedje, J.M., and Schultzhaus, J.N. (2013) Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces. Applied and Environmental Microbiology 79: 3967-3973.
Hoa, P.T.P., Managaki, S., Nakada, N., Takada, H., Shimizu, A., Anh, D.H. et al. (2011) Antibiotic contamination and occurrence of antibiotic-resistant bacteria in aquatic environments of northern Vietnam. Science of the Total Environment 409: 2894-2901.
161 Appendix B
Hoffman, P., Garduno, R. (1999) Surface-associated heat shock proteins of Legionella pneumophila and Helicobacter pylori: roles in pathogenesis and immunity. Infectious Diseases in Obstetrics and Gynecology 7: 58-63.
Holmström, K., Gräslund, S., Wahlström, A., Poungshompoo, S., Bengtsson, B.E., and Kautsky, N. (2003) Antibiotic use in shrimp farming and implications for environmental impacts and human health. International Journal of Food Science & Technology 38: 255-266.
Honda, K., and Littman, D.R. (2012) The microbiome in infectious disease and inflammation. Annual Review of Immunology 30: 759-795.
Hong, H.A., Duc, L.H., and Cutting, S.M. (2005) The use of bacterial spore formers as probiotics. FEMS Microbiology Reviews 29: 813-835.
Hooper, L.V., and Macpherson, A.J. (2010) Immune adaptations that maintain homeostasis with the intestinal microbiota. Nature Reviews Immunology 10: 159-169.
Hovda, M.B., Lunestad, B.T., Fontanillas, R., Rosnes, J.t. (2007) Molecular characterisation of the intestinal microbiota of farmed Atlantic salmon (Salmo salar L.). Aquaculture 272: 581-588.
Huber, J.A., Welch, D.B.M., Morrison, H.G., Huse, S.M., Neal, P.R., Butterfield, D.A., and Sogin, M.L. (2007) Microbial population structures in the deep marine biosphere. Science 318: 97-100.
Ientile, R., Caccamo, D., and Griffin, M. (2007) Tissue transglutaminase and the stress response. Amino Acids 33: 385-394.
Iguchi, K.i., Ogawa, K., Nagae, M., and Ito, F. (2003) The influence of rearing density on stress response and disease susceptibility of ayu ( Plecoglossus altivelis ). Aquaculture 220: 515-523.
Irianto, A., and Austin, B. (2002) Probiotics in aquaculture. Journal of Fish Diseases 25: 633-642.
162 References
Ishida, Y., Ahmed, A.M., Mahfouz, N.B., Kimura, T., El-Khodery, S.A., Moawad, A.A., and Shimamoto, T. (2010) Molecular analysis of antimicrobial resistance in gram-negative bacteria isolated from fish farms in Egypt. The Journal of Veterinary Medical Science/the Japanese Society of Veterinary Science 72: 727-734.
Ivanov, I.I., Frutos, R.d.L., Manel, N., Yoshinaga, K., Rifkin, D.B., Sartor, R.B. et al. (2008) Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host & Microbe 4: 337-349.
Ivanov, I.I., Atarashi, K., Manel, N., Brodie, E.L., Shima, T., Karaoz, U. et al. (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485-498.
Ivanov, I.I., and Honda, K. (2012) Intestinal commensal microbes as immune modulators. Cell Host & Microbe 12: 496-508.
Iwama, G.K., Pickering, A., Sumpter, J., and Schreck, C. (2011) Fish stress and health in aquaculture: Cambridge University Press. 73-80
Jiang, D., Liang, J., Fan, J., Yu, S., Chen, S., Luo, Y. et al. (2005) Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nature Medicine 11: 1173-1179.
Joly, A.-L., Wettstein, G., Mignot, G., Ghiringhelli, F., Garrido, C. (2010) Dual role of heat shock proteins as regulators of apoptosis and innate immunity. Journal of Innate Immunity 2: 238-247.
Kahla-Nakbi, A.B., Chaieb, K., Bakhrouf, A. (2009) Investigation of several virulence properties among Vibrio alginolyticus strains isolated from diseased cultured fish in Tunisia. Diseases of Aquatic Organisms 86: 21-28.
Karunasagar, I., Pai, R., Malathi, G., and Karunasagar, I. (1994) Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture 128: 203-209.
163 Appendix B
Kaur, M., Kaur, A. and Sharma, R. (2012) Pharmacological actions of Opuntia ficus indica: A Review. Journal of Applied Pharmaceutical Science 2: 15-18.
Kawamoto, S., Tran, T.H., Maruya, M., Suzuki, K., Doi, Y., Tsutsui, Y. et al. (2012) The inhibitory receptor PD-1 regulates IgA selection and bacterial composition in the gut. Science 336: 485-489.
Khoruts, A., and Sadowsky, M. (2010) Therapeutic transplantation of the distal gut microbiota. Mucosal Immunology 4: 4-7.
Kim, D.H., and Austin, B. (2006) Innate immune responses in rainbow trout (Oncorhynchus mykiss,Walbaum) induced by probiotics. Fish & Shellfish Immunology 21: 513-524.
Kim, D.H., Brunt, J., and Austin, B. (2007) Microbial diversity of intestinal contents and mucus in rainbow trout (Oncorhynchus mykiss). Journal of Applied Microbiology 102: 1654-1664.
Koch, H., and Schmid-Hempel, P. (2011) Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proceedings of the National Academy of Sciences 108: 19288-19292.
Kong, X.C., Zhang, D., Qian, C., Liu, G.T., Bao, X.Q. (2011) FLZ, a novel HSP27 and HSP70 inducer, protects SH-SY5Y cells from apoptosis caused by MPP+. Brain Research 1383: 99-107.
Kopacek, P., Hall, M., and Soderhall, K. (1993) Characterization of a clotting protein, isolated from plasma of the freshwater crayfish Pacifastacus leniusculus. European Journal of Biochemistry 213: 591-597.
Korkea-aho, T., Papadopoulou, A., Heikkinen, J., von Wright, A., Adams, A., Austin, B., and Thompson, K. (2012) Pseudomonas M162 confers protection against rainbow trout fry syndrome by stimulating immunity. Journal of Applied Microbiology 113: 24-35.
164 References
Kurtz, J., and Franz, K. (2003) Innate defence: evidence for memory in invertebrate immunity. Nature 425: 37-38.
Kussell, E., Kishony, R., Balaban, N.Q., and Leibler, S. (2005) Bacterial persistence a model of survival in changing environments. Genetics 169: 1807-1814.
Lazado, C.C., Caipang, C.M.A., Brinchmann, M.F., and Kiron, V. (2011) In vitro adherence of two candidate probiotics from Atlantic cod and their interference with the adhesion of two pathogenic bacteria. Veterinary Microbiology 148: 252-259.
Lee, K.H., Jeong, J., and Yoo, C.G. (2012) Positive feedback regulation of heat shock protein 70 (Hsp70) is mediated through Toll-like receptor 4-PI3K/Akt-glycogen synthase kinase-3β pathway. Experimental Cell Research 319: 88-95.
Ley, R.E., Peterson, D.A., and Gordon, J.I. (2006) Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 124: 837-848.
Li, P., and Gatlin III, D.M. (2004) Dietary brewers yeast and the prebiotic Grobiotic™ AE influence growth performance, immune responses and resistance of hybrid striped bass (Morone chrysops × M. saxatilis) to Streptococcus iniae infection. Aquaculture 231: 445-456.
Li, P., Burr, G.S., Gatlin, D.M., Hume, M.E., Patnaik, S., Castille, F.L., and Lawrence, A.L. (2007) Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of pacific white shrimp, LitoPenaeus vannamei, cultured in a recirculating system. The Journal of Nutrition 137: 2763-2768.
Lightner, D., and Redman, R. (1998) Shrimp diseases and current diagnostic methods. Aquaculture 164: 201-220.
Lin, S., Pan, Y., Luo, L., and Luo, L. (2011) Effects of dietary β-1, 3-glucan, chitosan or raffinose on the growth, innate immunity and resistance of koi (Cyprinus carpio koi). Fish & Shellfish Immunology 31: 788-794.
165 Appendix B
Liu, K.-F., Chiu, C.-H., Shiu, Y.-L., Cheng, W., and Liu, C.-H. (2010) Effects of the probiotic, Bacillus subtilis E20, on the survival, development, stress tolerance, and immune status of white shrimp, LitoPenaeus vannamei larvae. Fish & Shellfish Immunology 28: 837-844.
Liu, P., Lee, K., and Chen, S. (1996) Susceptibility of different isolates of Vibrio harveyi to antibiotics. Microbios 91: 175-180.
Liuxy, P.C., Lee, K.K., Chen, S.N., 1996. Pathogenicity of different isolates of Vibrio harveyi in tiger prawn, Penaeus monodon. Letters in Applied Microbiology 22: 413-416.
Løvmo Martinsen, L., Salma, W., Myklebust, R., Mayhew, T.M., and Ringø, E. (2011) Carnobacterium maltaromaticum vs. Vibrio (Listonella) anguillarum in the midgut of Atlantic cod (Gadus morhua L.): an ex vivo study. Aquaculture Research 42: 1830-1839.
Luis-Villaseñor, I.E., Macías-Rodríguez, M.E., Gómez-Gil, B., Ascencio-Valle, F., and Campa-Córdova, Á.I. (2011) Beneficial effects of four Bacillus strains on the larval cultivation of LitoPenaeus vannamei. Aquaculture 321: 136-144.
MacArthur, R.H. (1967) The theory of island biogeography: Princeton University Press, Princeton, NJ.
Macpherson, A.J., and Harris, N.L. (2004) Interactions between commensal intestinal bacteria and the immune system. Nature Reviews Immunology 4: 478-485.
Marques, A., Dhont, J., Sorgeloos, P., and Bossier, P. (2004) Evaluation of different yeast cell wall mutants and microalgae strains as feed for gnotobiotically grown brine shrimp Artemia franciscana. Journal of Experimental Marine Biology and Ecology 312: 115-136.
Marques, A., Dinh, T., Ioakeimidis, C., Huys, G., Swings, J., Verstraete, W. et al. (2005) Effects of bacteria on Artemia franciscana cultured in different gnotobiotic environments. Applied and Environmental Microbiology 71: 4307-4317.
166 References
Marques, A., Dhont, J., Sorgeloos, P., and Bossier, P. (2006) Immunostimulatory nature of β-glucans and baker's yeast in gnotobiotic Artemia challenge tests. Fish & Shellfish Immunology 20: 682-692.
Martin, G.G., Omori, J.E.H.S., Chong, C., Hoodbhoy, T., and McKrell, N. (1991) Localization and roles of coagulogen and transglutaminase in hemolymph coagulation in decapod crustaceans. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry 100: 517-522.
Marzorati, M., Wittebolle, L., Boon, N., Daffonchio, D., and Verstraete, W. (2008) How to get more out of molecular fingerprints: practical tools for microbial ecology. Environmental Microbiology 10: 1571-1581.
Maynard, C.L., Elson, C.O., Hatton, R.D., and Weaver, C.T. (2012) Reciprocal interactions of the intestinal microbiota and immune system. Nature 489: 231-241.
McDougald, D., Rice, S.A., Barraud, N., Steinberg, P.D., and Kjelleberg, S. (2011) Should we stay or should we go: mechanisms and ecological consequences for biofilm dispersal. Nature Reviews Microbiology 10: 39-50.
McIntosh, D., Cunningham, M., Ji, B., Fekete, F.A., Parry, E.M., Clark, S.E. et al. (2008) Transferable, multiple antibiotic and mercury resistance in Atlantic Canadian isolates of Aeromonas salmonicida subsp. salmonicida is associated with carriage of an IncA/C plasmid similar to the Salmonella enterica plasmid pSN254. Journal of Antimicrobial Chemotherapy 61: 1221-1228.
McIntosh, D., Ji, B., Forward, B.S., Puvanendran, V., Boyce, D., and Ritchie, R. (2008) Culture-independent characterization of the bacterial populations associated with cod (Gadus morhua L.) and live feed at an experimental hatchery facility using denaturing gradient gel electrophoresis. Aquaculture 275: 42-50.
Merrifield, D.L., Dimitroglou, A., Foey, A., Davies, S.J., Baker, R., Bøgwald, J., Castex, M., Ringø, E., 2010. The current status and future focus of probiotic and prebiotic applications for salmonids. Aquaculture 302: 1-18.
167 Appendix B
Moret, Y. (2006) ‘Trans-generational immune priming’: specific enhancement of the antimicrobial immune response in the mealworm beetle, Tenebrio molitor. Proceedings of the Royal Society B: Biological Sciences 273: 1399-1405.
Moriarty, D.J. (1999) Disease control in shrimp aquaculture with probiotic bacteria. In Proceedings of the 8th International Symposium on Microbial Ecology: 237-243.
Moseley, P.L. (1998) Heat shock proteins and the inflammatory response. Annals of the New York Academy of Sciences 856: 206-213.
Nan, B., Zhang, W.B, Mai, K.S., Gu, M., Xu, W. (2013) Effects of continuous and alternate administration of β-glucan and mannan-oligosaccharide on the growth, immunity and resistance against Vibrio splendidus of sea cucumber Apostichopus japonicus (Selenka). Aquaculture 44: 1613-1624.
Natrah, F., Defoirdt, T., Sorgeloos, P., and Bossier, P. (2011) Disruption of bacterial cell-to-cell communication by marine organisms and its relevance to aquaculture. Marine Biotechnology 13: 109-126.
NavinChandran, M., Iyapparaj, P., Moovendhan, S., Ramasubburayan, R., Prakash, S., Immanuel, G., and Palavesam, A. (2014) Influence of probiotic bacterium Bacillus cereus isolated from the gut of wild shrimp Penaeus monodon in turn as a potent growth promoter and immune enhancer in P. monodon. Fish & Shellfish Immunology 36: 38-45.
Newaj‐Fyzul, A., Adesiyun, A., Mutani, A., Ramsubhag, A., Brunt, J., and Austin, B. (2007) Bacillus subtilis AB1 controls Aeromonas infection in rainbow trout (Oncorhynchus mykiss, Walbaum). Journal of Applied Microbiology 103: 1699-1706.
Nicolas, J., Gatesoupe, F., Froueli, S., Bachere, E., and Gueguen, Y. (2007) What alternatives to antibiotics are conceivable for aquaculture. Inra Productions Animales 20: 253-258.
Ninawe, A., and Selvin, J. (2009) Probiotics in shrimp aquaculture: avenues and challenges. Critical Reviews in Microbiology 35: 43-66.
168 References
Ohtsuka, K., Kawashima, D., Gu, Y., and Saito, K. (2005) Inducers and co-inducers of molecular chaperones. International Journal of Hyperthermia 21: 703-711.
Okumura, T. (2007) Effects of lipopolysaccharide on gene expression of antimicrobial peptides (penaeidins and crustin), serine proteinase and prophenoloxidase in haemocytes of the Pacific white shrimp, LitoPenaeus vannamei. Fish & Shellfish Immunology 22: 68-76.
Olafsen, J.A. (2001) Interactions between fish larvae and bacteria in marine aquaculture. Aquaculture 200: 223-247.
Pai, S.S., Anas, A., Jayaprakash, N.S., Priyaja, P., Sreelakshmi, B., Preetha, R. et al. (2010) Penaeus monodon larvae can be protected from Vibrio harveyi infection by pre-emptive treatment of a rearing system with antagonistic or non-antagonistic bacterial probiotics. Aquaculture Research 41: 847-860.
Pande, G.S.J, Scheie, A.A., Benneche, T., Wille, M., Sorgeloos, P., Bossier, P., Defoirdt,. T. (2013) Quorum sensing-disrupting compounds protect larvae of the giant freshwater prawn Macrobrachium rosenbergii from Vibrio harveyi infection. Aquaculture 406-407: 121-124.
Pandiyan, P., Balaraman, D., Thirunavukkarasu, R., George, E.G.J., Subaramaniyan, K., Manikkam, S., and Sadayappan, B. (2013) Probiotics in aquaculture. Drug Invention Today 5: 55-59.
Parsell, D., and Lindquist, S. (1993) The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annual Review of Genetics 27: 437-496.
Patel, S., and Goyal, A. (2012) The current trends and future perspectives of prebiotics research: a review. 3 Biotech 2: 115-125.
Paulert, R., Ebbinghaus, D., Urlass, C., and Moerschbacher, B. (2010) Priming of the oxidative burst in rice and wheat cell cultures by ulvan, a polysaccharide from green
169 Appendix B macroalgae, and enhanced resistance against powdery mildew in wheat and barley plants. Plant Pathology 59: 634-642.
Peddie, S., Wardle, R (2005) Crustaceans: the impact and control of vibriosis in shrimp culture worldwide. Aquacult Health 2: 4-5.
Petnicki-Ocwieja, T., Hrncir, T., Liu, Y.-J., Biswas, A., Hudcovic, T., Tlaskalova-Hogenova, H., and Kobayashi, K.S. (2009) Nod2 is required for the regulation of commensal microbiota in the intestine. Proceedings of the National Academy of Sciences 106: 15813-15818.
Pham, L.N., Kanther, M., Semova, I., and Rawls, J.F. (2008) Methods for generating and colonizing gnotobiotic zebrafish. Nature Protocols 3: 1862-1875.
Phuoc, L.H., Defoirdt, T., Sorgeloos, P., and Bossier, P. (2009) Virulence of luminescent and non-luminescent isogenic vibrios towards gnotobiotic Artemia franciscana larvae and specific pathogen-free LitoPenaeus vannamei shrimp. Journal of Applied Microbiology 106: 1388-1396.
Picchietti, S., Mazzini, M., Taddei, A.R., Renna, R., Fausto, A.M., Mulero, V. et al. (2007) Effects of administration of probiotic strains on GALT of larval gilthead seabream: immunohistochemical and ultrastructural studies. Fish & Shellfish Immunology 22: 57-67.
Piedrahita, R.H. (2003) Reducing the potential environmental impact of tank aquaculture effluents through intensification and recirculation. Aquaculture 226: 35-44.
Planas, M., Pérez-Lorenzo, M., Hjelm, M., Gram, L., Uglenes Fiksdal, I., Bergh, Ø., and Pintado, J. (2006) Probiotic effect in vivo of Roseobacter strain 27-4 against Vibrio (Listonella) anguillarum infections in turbot (Scophthalmus maximus L.) larvae. Aquaculture 255: 323-333.
Pockley, A.G. (2003) Heat shock proteins as regulators of the immune response. The Lancet 362: 469-476.
170 References
Possemiers, S., Verthé, K., Uyttendaele, S., and Verstraete, W. (2004) PCR-DGGE-based quantification of stability of the microbial community in a simulator of the human intestinal microbial ecosystem. FEMS Microbiology Ecology 49: 495-507.
Ramos, M., Weber, B., Gonçalves, J., Santos, G., Rema, P., and Ozório, R. (2013) Dietary probiotic supplementation modulated gut microbiota and improved growth of juvenile rainbow trout (Oncorhynchus mykiss). Comparative biochemistry and physiology Part A, Molecular & Integrative Physiology 162: 302-307.
Rasch, M., Buch, C., Austin, B., Slierendrecht, W.J., Ekmann, K.S., Larsen, J.L. et al. (2004) An Inhibitor of Bacterial Quorum Sensing Reduces Mortalities Caused by Vibriosis in Rainbow Trout (Oncorhynchus mykiss, Walbaum). Systematic and Applied Microbiology 27: 350-359.
Rawls, J.F., Samuel, B.S., and Gordon, J.I. (2004) Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota. Proceedings of the National Academy of Sciences of the United States of America 101: 4596-4601.
Ringø, E., Olsen, R., Gifstad, T., Dalmo, R., Amlund, H., HEMRE, G.I., and Bakke, A. (2010) Prebiotics in aquaculture: a review. Aquaculture Nutrition 16: 117-136.
Ringø, E. (2011) Use of immunostimulants and nucleotides in aquaculture: a review. Journal of Marine Science: Research & Development. doi:10.4172/2155-9910.1000104
Robert, J. (2003) Evolution of heat shock protein and immunity. Developmental & Comparative Immunology 27: 449-464.
Roberts, R., Agius, C., Saliba, C., Bossier, P., and Sung, Y. (2010) Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. Journal of Fish Diseases 33: 789-801.
171 Appendix B
Roeselers, G., Mittge, E.K., Stephens, W.Z., Parichy, D.M., Cavanaugh, C.M., Guillemin, K., and Rawls, J.F. (2011) Evidence for a core gut microbiota in the zebrafish. The ISME Journal 5: 1595-1608.
Round, J.L., and Mazmanian, S.K. (2009) The gut microbiota shapes intestinal immune responses during health and disease. Nature Reviews Immunology 9: 313-323.
Round, J.L., and Mazmanian, S.K. (2010) Inducible Foxp3+ regulatory T-cell development by a commensal bacterium of the intestinal microbiota. Proceedings of the National Academy of Sciences 107: 12204-12209.
Round, J.L., Lee, S.M., Li, J., Tran, G., Jabri, B., Chatila, T.A., and Mazmanian, S.K. (2011) The Toll-like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science 332: 974-977.
Rowe, G.E., Welch, R.A. (1994) Assays of hemolytic toxins. Methods in Enzymology 235: 657-667.
Rui, H., Liu, Q., Wang, Q., Ma, Y., Liu, H., Shi, C., Zhang, Y. (2009) Role of alkaline serine protease asp in Vibrio alginolyticus virulence and regulation of its expression by luxO-luxR regulatory system. Journal of Microbiology and Biotechnology 19: 431.
Ryu, J.-H., Kim, S.-H., Lee, H.-Y., Bai, J.Y., Nam, Y.-D., Bae, J.-W. et al. (2008) Innate immune homeostasis by the homeobox gene caudal and commensal-gut mutualism in Drosophila. Science Signaling 319: 777.
Sabater-Molina, M., Larqué, E., Torrella, F., and Zamora, S. (2009) Dietary fructooligosaccharides and potential benefits on health. Journal of Physiology and Biochemistry 65: 315-328.
Sajeevan, T.P., Philip, R., Bright Singh, I.S. (2009) Dose/frequency: A critical factor in the administration of glucan as immunostimulant to Indian white shrimp Fenneropenaeus indicus. Aquaculture 287: 248-252.
Sakai, M. (1999) Current research status of fish immunostimulants. Aquaculture 172: 63-92.
172 References
Salinas, I., Cuesta, A., Esteban, M., and Meseguer, J. (2005) Dietary administration of LactoBacillus delbrüeckii and Bacillus subtilis, single or combined, on gilthead seabream cellular innate immune responses. Fish & Shellfish Immunology 19: 67-77.
Sarlin, P., and Philip, R. (2011) Efficacy of marine yeasts and baker's yeast as immunostimulants in FenneroPenaeus indicus: A comparative study. Aquaculture 321: 173-178.
Sawyer, L., and Hermanowicz, S. (2000) Detachment of Aeromonas hydrophila and Pseudomonas aeruginosa due to variations in nutrient supply. Water Science and Technology 41: 139-145.
Schmitt, E., Gehrmann, M., Brunet, M., Multhoff, G., and Garrido, C. (2007) Intracellular and extracellular functions of heat shock proteins: repercussions in cancer therapy. Journal of Leukocyte Biology 81: 15-27.
Schneider, O., Sereti, V., Eding, E., and Verreth, J. (2005) Analysis of nutrient flows in integrated intensive aquaculture systems. Aquacultural Engineering 32: 379-401.
Sejerkilde, M., Sørensen, J.G., and Loeschcke, V. (2003) Effects of cold-and heat hardening on thermal resistance in Drosophila melanogaster. Journal of Insect Physiology 49: 719-726.
Skalli, A., Castillo, M., Andree, K.B., Tort, L., Furones, D., and Gisbert, E. (2013) The LPS derived from the cell walls of the Gram-negative bacteria Pantoea agglomerans stimulates growth and immune status of rainbow trout (Oncorhynchus mykiss) juveniles. Aquaculture 416-417: 272-279.
Skjermo, J., and Vadstein, O. (1999) Techniques for microbial control in the intensive rearing of marine larvae. Aquaculture 177: 333-343.
Smith, D., Johnson, J., Harris, A., Furuno, J., Perencevich, E., and Morris Jr, J. (2003) Assessing risks for a pre-emergent pathogen: virginiamycin use and the emergence of streptogramin resistance in Enterococcus faecium The Lancet Infectious Diseases 3: 241-249.
173 Appendix B
Smith, P., and Christofilogiannis, P. (2007) Application of Normalised Resistance Interpretation to the detection of multiple low-level resistance in strains of Vibrio anguillarum obtained from Greek fish farms. Aquaculture 272: 223-230.
Smith, V.J., Brown, J.H., Hauton, C. (2003) Immunostimulation in crustaceans: does it really protect against infection? Fish & Shellfish Immunology 15: 71-90.
Söderhäll, K., and Cerenius, L. (1998) Role of the prophenoloxidase-activating system in invertebrate immunity. Current Opinion in Immunology 10: 23-28.
Sonnenburg, J.L., Chen, C.T., and Gordon, J.I. (2006) Genomic and metabolic studies of the impact of probiotics on a model gut symbiont and host. PLoS Biology 4: 413.
Sõti, C., Nagy, E., Giricz, Z., Vígh, L., Csermely, P., and Ferdinandy, P. (2005) Heat shock proteins as emerging therapeutic targets. British Journal of Pharmacology 146: 769-780.
Star, B., Haverkamp, T.H., Jentoft, S., and Jakobsen, K.S. (2013) Next generation sequencing shows high variation of the intestinal microbial species composition in Atlantic cod caught at a single location. BMC Microbiology 13: 248.
Sun, B., Zhang, X.-H., Tang, X., Wang, S., Zhong, Y., Chen, J., Austin, B. (2007) A single residue change in Vibrio harveyi hemolysin results in the loss of phospholipase and hemolytic activities and pathogenicity for turbot (Scophthalmus maximus). Journal of Bacteriology 189: 2575-2579.
Sun, Y.Z., Yang, H.L., Ma, R.L., and Lin, W.Y. (2010) Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish & Shellfish Immunology 29: 803-809.
Sung, H.H., Hsu, S.F., Chen, C.K., Ting, Y.Y., and Chao, W.L. (2001) Relationships between disease outbreak in cultured tiger shrimp (Penaeus monodon) and the composition of Vibrio communities in pond water and shrimp hepatopancreas during cultivation. Aquaculture 192: 101-110.
174 References
Sung, Y., Roberts, R., and Bossier, P. (2012) Enhancement of Hsp70 synthesis protects common carp, Cyprinus carpio L., against lethal ammonia toxicity. Journal of Fish Diseases 35: 563-568.
Sung, Y., MacRae, T.H., Sorgeloos, P., and Bossier, P. (2011) Stress response for disease control in aquaculture. Reviews in Aquaculture 3: 120-137.
Sung, Y., Liew, H.J., Bolong, A.M.A., Wahid, E.A., MacRae, T.H. (2013) The induction of Hsp70 synthesis by non‐lethal heat shock confers thermotolerance and resistance to lethal ammonia stress in the common carp, Cyprinus carpio. Aquaculture Research DOI: 10.1111/are.12116.
Surana, N.K., and Kasper, D.L. (2012) The yin yang of bacterial polysaccharides: lessons learned from B. fragilis PSA. Immunological Reviews 245: 13-26.
Taur, Y., Xavier, J.B., Lipuma, L., Ubeda, C., Goldberg, J., Gobourne, A. et al. (2012) Intestinal domination and the risk of bacteremia in patients undergoing allogeneic hematopoietic stem cell transplantation. Clinical Infectious Diseases 55: 905-914.
Teasdale, M.E., Liu, J., Wallace, J., Akhlaghi, F., and Rowley, D.C. (2009) Secondary metabolites produced by the marine bacterium HaloBacillus salinus that inhibit quorum sensing-controlled phenotypes in gram-negative bacteria. Applied and Environmental Microbiology 75: 567-572.
Ten Doeschate, K., and Coyne, V. (2008) Improved growth rate in farmed Haliotis midae through probiotic treatment. Aquaculture 284: 174-179.
Tendencia, E.A., and de la Peña, L.D. (2001) Antibiotic resistance of bacteria from shrimp ponds. Aquaculture 195: 193-204.
Teo, J.W., Suwanto, A., and Poh, C.L. (2000) Novel β-lactamase genes from two environmental isolates of Vibrio harveyi. Antimicrobial Agents and Chemotherapy 44: 1309-1314.
175 Appendix B
Thormann, K.M., Saville, R.M., Shukla, S., and Spormann, A.M. (2005) Induction of rapid detachment in Shewanella oneidensis MR-1 biofilms. Journal of Bacteriology 187: 1014-1021.
Todgham, A.E., Schulte, P.M., and Iwama, G.K. (2005) Cross-Tolerance in the Tidepool Sculpin: The Role of Heat Shock Proteins. Physiological and Biochemical Zoology 78: 133-144.
Toranzo, A.E., Magariños, B., and Romalde, J.L. (2005) A review of the main bacterial fish diseases in mariculture systems. Aquaculture 246: 37-61.
Tran, L., Nunan, L., Redman, R.M., Mohney, L.L., Pantoja, C.R., Fitzsimmons, K., and Lightner, D.V. (2013) Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Diseases of Aquatic Organisms 105: 45-55.
Tsan, M.-F., and Gao, B. (2009) Heat shock proteins and immune system. Journal of Leukocyte Biology 85: 905-910.
Tseng, D.-Y., Ho, P.-L., Huang, S.-Y., Cheng, S.-C., Shiu, Y.-L., Chiu, C.-S., and Liu, C.-H. (2009) Enhancement of immunity and disease resistance in the white shrimp, LitoPenaeus vannamei, by the probiotic, Bacillus subtilis E20. Fish & Shellfish Immunology 26: 339-344.
Ubeda, C., Bucci, V., Caballero, S., Djukovic, A., Toussaint, N.C., Equinda, M. et al. (2013) Intestinal microbiota containing Barnesiella species cures vancomycin-resistant Enterococcus faecium colonization. Infection and Immunity 81: 965-973.
Ubeda, C., Lipuma, L., Gobourne, A., Viale, A., Leiner, I., Equinda, M. et al. (2012) Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. The Journal of Experimental Medicine 209: 1445-1456.
176 References
Vadstein, O., Øie, G., Olsen, Y., Salvesen, I., Skjermo, J., Skjåk-Bræk, G. (1993) A strategy to obtain microbial control during larval development of marine fish. In Fish Farming Technology: 69-75.
Vendrell, D., Luis Balcázar, J., de Blas, I., Ruiz-Zarzuela, I., Gironés, O., and Luis Múzquiz, J. (2008) Protection of rainbow trout (Oncorhynchus mykiss) from lactococcosis by probiotic bacteria. Comparative Immunology, Microbiology and Infectious Diseases 31: 337-345.
Verschuere, L., Rombaut, G., Huys, G., Dhont, J., Sorgeloos, P., Verstraete, W., 1999. Microbial control of the culture of Artemia juveniles through preemptive colonization by selected bacterial strains. Applied and Environmental Microbiology 65: 2527-2533.
Verschuere, L., Rombaut, G., Sorgeloos, P., and Verstraete, W. (2000) Probiotic bacteria as biological control agents in aquaculture. Microbiology and Molecular Biology Reviews 64: 655-671.
Vine, N.G., Leukes, W.D., and Kaiser, H. (2006) Probiotics in marine larviculture. FEMS Microbiology Reviews 30: 404-427.
Wang, Y.-B. (2007) Effect of probiotics on growth performance and digestive enzyme activity of the shrimp Penaeus vannamei. Aquaculture 269: 259-264.
Wang, Z.X, Lu, A., Li, X., Shao, Q., Beerntsen, B.T., Liu, C., et al. (2011) Experimental Parasitology 127: 135-141.
Wei, M., Shinkura, R., Doi, Y., Maruya, M., Fagarasan, S., and Honjo, T. (2011) Mice carrying a knock-in mutation of Aicda resulting in a defect in somatic hypermutation have impaired gut homeostasis and compromised mucosal defense. Nature Immunology 12: 264-270.
Westerheide, S.D., and Morimoto, R.I. (2005) Heat shock response modulators as therapeutic tools for diseases of protein conformation. Journal of Biological Chemistry 280: 33097-33100.
177 Appendix B
WHO (2014) Antimicrobial resistance: global report on surveillance. World Health Organization, April 2014.
Wittebolle, L., Marzorati, M., Clement, L., Balloi, A., Daffonchio, D., Heylen, K. et al. (2009) Initial community evenness favors functionality under selective stress. Nature 458: 623-626.
Wong, S.K., Zhang, X.-H., Woo, N. (2012) Vibrio alginolyticus thermolabile hemolysin (TLH) induces apoptosis, membrane vesiculation and necrosis in sea bream erythrocytes. Aquaculture 330: 29-36.
Wu, H., Chen, G., Wyburn, K.R., Yin, J., Bertolino, P., Eris, J.M. et al. (2007) TLR4 activation mediates kidney ischemia/reperfusion injury. Journal of Clinical Investigation 117: 2847-2859.
Xing, D., and Ren, N. (2006) Common problems in the analyses of microbial community by denaturing gradient gel electrophoresis (DGGE). Wei Sheng Wu Xue Bao 46:331-5
Xu, B., Wang, Y., Li, J., and Lin, Q. (2009) Effect of prebiotic xylooligosaccharides on growth performances and digestive enzyme activities of allogynogenetic crucian carp (Carassius auratus gibelio). Fish Physiology and Biochemistry 35: 351-357.
Yamaguchi, H., Osaki, T., Kurihara, N., Taguchi, H., Hanawa, T., Yamamoto, T., Kamiya, S. (1997) Heat-shock protein 60 homologue of Helicobacter pylori is associated with adhesion of H. pylori to human gastric epithelial cells. Journal of Medical Microbiology 46: 825-831.
Yik Sung, Y., Van Damme, E.J., Sorgeloos, P., and Bossier, P. (2007) Non-lethal heat shock protects gnotobiotic Artemia franciscana larvae against virulent Vibrios. Fish & Shellfish Immunology 22: 318-326.
Yilmaz, E., Genc, M.A., and Genc, E. (2007) Effects of dietary mannan oligosaccharides on growth, body composition, and intestine and liver histology of
178 References rainbow trout, Oncorhynchus mykiss. Israeli Journal of Aquaculture-Bamidgeh 59: 182-188.
Zhang, L., Mai, K., Tan, B., Ai, Q., Qi, C., Xu, W. et al. (2009) Effects of dietary administration of probiotic Halomonas sp. B12 on the intestinal microflora, immunological parameters, and midgut histological structure of shrimp, FenneroPenaeus chinensis. Journal of the World Aquaculture society 40: 58-66.
Zhang, X.H., Austin, B. (2000) Pathogenicity of Vibrio harveyi to salmonids. Journal of Fish Diseases 23: 93-102.
Zhang, X.-H., Meaden, P., Austin, B. (2001) Duplication of hemolysin genes in a virulent isolate of Vibrio harveyi. Applied and Environmental Microbiology 67: 3161-3167.
Zhang, Z.-Y., Zhang, Z., and Schluesener, H. (2009) Toll-like receptor-2, CD14 and heat-shock protein 70 in inflammatory lesions of rat experimental autoimmune neuritis. Neuroscience 159: 136-142.
Zoetendal, E.G., Collier, C.T., Koike, S., Mackie, R.I., and Gaskins, H.R. (2004) Molecular ecological analysis of the gastrointestinal microbiota: a review. The Journal of Nutrition 134: 465-472.
Zokaeifar, H., Balcázar, J.L., Saad, C.R., Kamarudin, M.S., Sijam, K., Arshad, A., and Nejat, N. (2012) Effects of Bacillus subtilis on the growth performance, digestive enzymes, immune gene expression and disease resistance of white shrimp, LitoPenaeus vannamei. Fish & Shellfish Immunology 33: 683-689.
179 Appendix B
180
APPENDIX C
Summary/Samenvatting
Summary/Samenvatting
Summary
Diseases outbreaks are considered as a significant constrain for aquaculture development in many countries. Traditionally, the use of antibiotics has partially alleviated the problem of bacterial diseases in aquaculture organisms. However their massive (mis)use has led to the development of (multiple) antibiotic-resistant bacterium. As a consequence, antibiotic treatments at present are often ineffective to handle bacterial diseases. Moreover, the use of antibiotics might raise biosafety issues to humans and surrounding environments. In this context, many novel approaches, such as probiotics, immunostimulants and Hsp70 induction, have been investigated as alternatives to antibiotics for effective control of bacterial infections. Those approaches target on either the microbes associated with the host (probiotics) or directly on the host (heat-shock protein induction or immunostimulants). However, knowledge on detailed impact of those treatments is limited. For example: what is the direct link between probiotics and the host; how can probiotics interact with microbes including the pathogens associated with the host; can a treatment targeting the host, such as heat-shock protein induction or immunostimulation, affect the intestinal microbes and/or the microbes in the culture environment?
In this thesis, we have tried to develop a simple and efficient protocol for detecting brine shrimp Artemia franciscana larvae gut resident bacteria. As demonstrated in chapter 3, the interference of external and gut transient bacteria could be alleviated by sequentially removing bacteria attached to the external body surface (washing procedure) and transient (luminal) intestinal bacteria (purging effect of cellulose). This approach is of high importance as the brine shrimp model is frequently used in studies on host-microbe interactions. Through this method, the composition of the resident bacterial community could be revealed, which consequently contributes to a better understanding of host-microbe interactions.
In chapter 4, the direct effect of probiotics on the innate immune response of brine shrimp Artemia franciscana larvae was analyzed. For that, the temporal changes in the
181 Appendix C expression of prophenoloxidase (proPO), transglutaminase (tagse) and hsp70 gene in the larvae incubated with probiotics (LT3) and challenged with V. campbellii were analyzed. The results showed that LT3 can directly modulate the host innate immune response when administered 6h before the challenge. Under these conditions, 12h after being challenged, the proPO mRNA level in the larvae pre-treated with LT3 and challenged with V. campbellii was approximately 8-fold higher (p < 0.01) than in the other treatments. Further, a decreased expression of tgase gene and heat-shock protein 70 gene suggested that pretreatment with LT3 results in less stress and tissue damage in the brine shrimp larvae upon V. campbellii challenge. In addition, LT3 was able to colonize the brine shrimp gastrointestinal tract and to decrease the in vivo activity of V. campbellii (bioluminescence as an indication) associated with the larvae. These results demonstrate that probiotics may directly elicit the host immune response and interact with the microbes, such as pathogens, in the rearing environment.
In chapter 5, the assumption that modulating the host immune response may steer the gut microbial community composition of the host was verified. It could be observed that Hsp70 induction, by Tex-OE®, can elicit a significantly higher expression of the proPO gene of brine shrimp larvae when exposing the axenic hatched larvae to microbes in the conventional rearing system. Besides proPO gene, tgase gene of the larvae was also up-regulated by Tex-OE® pre-treatment, 3h after incubation in the conventional rearing system. In addition, Tex-OE® pre-treatment led to a resident gut microbial community composition with lower richness and evenness as compared to the microbial community of the control group.
Finally, in chapter 6, we evaluate the effect of Tex-OE® on the growth and behavior of the microbes in the rearing environment. For that brine shrimp larvae was incubated with Tex-OE® in the conventional rearing system and challenged by V. campbellii. In another experiment, the axenic hatched larvae were challenged by V. campbellii which was initially incubated with Tex-OE®. The results showed that continuous incubation with Tex-OE® may stimulate growth of microbes in the rearing environment. In addition, Tex-OE® incubation resulted in higher hemolysin and
182 Summary/Samenvatting caseinase production of V. campbellii in vitro. Moreover, higher mortality was observed in the larvae challenged with the V. campbellii pre-incubated with Tex-OE®. Thus, continuous incubation with Tex-OE® may interfere growth and behavior of the microbes in the rearing environment and adversely affect the of the larvae.
In conclusion, the work presented in this thesis indicates that disease control strategies, such as probiotic administration and Hsp70 induction, can trigger the overall host-microbe interaction in every compartment of the aquaculture system. Probiotics or Hsp70 induction can directly modulate the host immune response. On the other hand, the modulation on the host immune response may influence the composition of gut microbial community. In addition, the probiotics or immunostimulating compound may also directly interact with the microbes in the rearing system, resulting indirect impact on the of the host.
183 Appendix C
Samenvatting
De verdere ontwikkeling en uitbreiding van aquacultuur wordt in vele landen bemoeilijkt door het uitbreken van ziekten. Traditioneel wordt dit probleem aangepakt met antibiotica, en het onoordeelkundig gebruik van antibiotica heeft geleid tot bacteriën met (meervoudige) antibioticumresistentie, met ineffectiviteit van antibiotica en verhoogde gezondheidsrisico’s voor mens en omgeving als gevolg. Recent werden verschillende nieuwe benaderingen voor een effectieve bestrijding van bacteriële infecties onderzocht als alternatief voor antibiotica, zoals probiotica, immuunstimulanten en Hsp70 inductie. Deze benaderingen richten zich ofwel op de microben geassocieerd met de gastheer (probiotica), ofwel op de gastheer zelf (heat-shock protein inductie en immuunstimulanten). Helaas is de kennis over de impact van deze behandelingen beperkt. Bijvoorbeeld: wat is de directe link tussen probiotica en de gastheer; hoe kunnen probiotica interageren met microben, waaronder de gastheer-geassocieerde pathogenen; kan een behandeling die gericht is op de gastheer, zoals heat-shock protein inductie en immunostimulie, van invloed zijn op de intestinale microben en/of de microben in het kweekwater?
In dit proefschrift hebben we geprobeerd om een eenvoudig en efficiënt protocol te ontwikkelen om intestinale bacteriën in Artemia franciscana larven op te sporen. Zoals aangetoond in hoofdstuk 3, kan de interferentie van andere bacteriën dan deze die met de gastheer geassocieerd zijn in de darm (residente intestinale bacteriën) worden verminderd door het achtereenvolgens verwijderen van bacteriën aan het externe lichaamsoppervlak (wasproces) en van transiente intestinale bacteriën (laxerend effect van cellulose). Deze aanpak is heel belangrijk aangezien het Artemia model vaak wordt gebruikt in onderzoek van gastheer-microbe interacties. Via deze methode kan de samenstelling van de gemeenschap van residente intestinale bacteriën bestudeerd worden, en deze kennis kan vervolgens bijdragen tot een beter begrip van gastheer- microbe interacties.
In hoofdstuk 4 werd het effect van probiotica op de aangeboren immuunrespons
184 Summary/Samenvatting van Artemia franciscana larven onderzocht. Daarvoor werden de veranderingen in de tijd van de expressie van profenoloxidase (proPO), transglutaminase (tgase) en het heat-shock protein 70 (hsp70) gen geanalyseerd in larven die geïncubeerd werden met probiotica (Bacillus sp. LT3) en gechallenged met Vibrio campbellii. De resultaten toonden aan dat LT3 de gastheer aangeboren immuunrespons positief kan beinvloeden wanneer het probioticum 6 uur voor de challenge wordt toegediend. Onder deze omstandigheden was het proPO mRNA niveau in de larven voorbehandeld met LT3 en gechallenged met V. campbellii 12u post-challenge ongeveer 8 keer hoger (p < 0.01) dan in de andere behandelingen. Voorts suggereert de verminderde expressie van het tgase gen en het hsp70 gen dat voorbehandeling met LT3 leidt tot minder stress en weefselschade in de larven na challenge met V. campbellii . Bovendien kon LT3 het spijsverteringskanaal van de larven koloniseren en de in vivo activiteit van met larven geassocieerde V. campbellii verminderen (bioluminescentie als indicatie). Deze resultaten tonen aan dat probiotica de immuunrespons van de gastheer kan versterken en dat probiotica interageren met gastheer-geassocieerde pathogenen.
In hoofdstuk 5 werd de veronderstelling dat de samenstelling van de microbiële gemeenschap van de darm kan gestuurd worden door het beïnvloeden van de immuunrespons van de gastheer geverifieerd. Hsp70 inductie door Tex-OE® leidde tot een significant hogere expressie van het proPO gen in axenische larven na blootstelling aan microben uit een conventioneel kweeksysteem. Tevens werd het tgase gen van de larven opgereguleerd door Tex-OE® voorbehandeling na 3 uur incubatie in het conventionele kweeksysteem. Tenslotte leidde de Tex-OE® voorbehandeling tot een minder rijke en meer homogeen verdeelde gemeenschap van residente intestinale bacteriën dan in de controlegroep.
Tenslotte werd in hoofdstuk 6 het effect geëvalueerd van Tex-OE® op de groei en het gedrag van de microben in het kweekmilieu. Hiervoor werden Artemia larven geïncubeerd met Tex-OE® in het conventionele kweeksysteem en gechallenged met V. campbellii. In een volgend experiment werden axenisch ontluikte larven gechallenged met V. campbellii die voorbehandeld waren met Tex-OE® . De resultaten toonden aan
185 Appendix C dat een continue incubatie met Tex-OE® de groei van microben in het kweek milieu kan bevorderen. Bovendien resulteerde Tex-OE® in een hogere hemolysine en caseinase productie van V. campbellii in vitro. Er werd tevens een hogere sterfte waargenomen bij de larven die gechallenged werden met V. campbellii die voorbehandeld was met Tex-OE®. Continue incubatie met Tex-OE® kan blijkbaar interfereren met de groei en het gedrag van de microben in het kweekmilieu en zo het welzijn van de larven nadelig beïnvloeden.
Het onderzoek dat in dit proefschrift wordt gepresenteerd toont aan dat ziekte-bestrijdingsstrategieën, zoals het toedienen van probiotica en Hsp70 inductie, de gastheer-microbe interactie in elk onderdeel van het aquacultuur systeem kan beïnvloeden. Probiotica en Hsp70 inductie kunnen de immuunrespons van de gastheer beïnvloeden. Anderzijds kan deze beïnvloeding van de immuunrespons de samenstelling van microbiële gemeenschap van de darm veranderen. Bovendien kunnen probiotica en immuunstimulerende stoffen ook rechtstreeks met de microben in het kweekmilieu interageren, wat onrechtstreeks eveneens het welzijn van de gastheer kan beinvloeden.
186
APPENDIX D
Curriculum Vitae
Curriculum Vitae
Curriculum Vitae
Personal information
Name: Niu Yufeng
Date of birth June 2nd, 1983, China
Nationality Chinese
Email [email protected]
Education
2009 to present Ph.D research in Applied Biological Sciences, Laboratory of Aquaculture & Artemia Reference Center (ARC), Faculty of Bioscience Engineering, Ghent University
Ph.D thesis: Host-microbe interaction in gnotobiotic aquaculture food chain
2006 to 2009 Master Degree: The Key Laboratory of Mariculture, college of fisheries, Ocean University of China
Master thesis: Preliminary study of the bacteria flora in sea cucumber ponds with different culturing methods
2002 to 2006 Bachelor Degree: Aquaculture, college of fisheries, Huazhong Agriculture University
2003 to 2006 Second Bachelor Degree: Marketing, Wuhan University
187 Appendix D
Experience in organizations
2011 to 2012 National Coordinator in Belgium, EAS (European Aquaculture Society) student group
2011 to present Executive council member of CEYC (China-Europe Youth Exchange Center)
Publications
International publications
Yufeng Niu, Tom Defoirdt, Anamaria Rekecki, Wim Van den Broeck, Shuanglin Dong, Patrick Sorgeloos, Nico Boon, Peter Bossier (2012). A method for the specific detection of resident bacteria in brine shrimp larvae, Journal of Microbiological Methods, 89: 33-37
Yufeng Niu, Parisa Norouzitallab, Kartik Baruah, Peter Bossier. (2014) A plant-based heat shock protein inducing compound modulates host-pathogen interactions between Artemia franciscana and Vibrio campbellii, Aquaculture, 430: 120-127
Yufeng Niu, Tom defoirdt, Kartik Baruah, Tom Van de Wiele, Peter Bossier. Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged with Vibrio campbellii by enhancing the innate immune response and by decreasing the activity of shrimp-associated vibrios (submitted to the Journal of Veterinary Microbiology)
National publications
Yufeng Niu, Xiangli Tian, Zongjun Du, Shuanglin Dong, 2009. Comparative study on seasonal variation of heterotrophic bacteria flora associated with intestine of sea cucumber (Apostichopus japonicus) in feeding and unfeeding ponds. Journal of Anhui Agricultural Sciences, (27), 13113-13117
188 Curriculum Vitae
Chuanxin Qing, Shuanglin Dong, Yufeng Niu, Xiangli Tian, Fang Wang, Yunwei Dong, 2009.The effect of different Bottom substrates on the growth and survival of sea cucumber (Apostichopus japonicus). Periodical of Ocean University of Chian, 39 (3), 392-396
Participation to international conference and training course larvi 2013 conference, Ghent, Belgium (2-5/09/2013) A NOVEL HEAT SHOCK INDUCER PROTECTS ARTEMIA IN THE CONVENTIONAL REARING SYSTEM (Poster presentation)
AQUA 2012 conference, Prague, Czech Republic (1-5/09/2012) SPECIFIC DETECTION OF RESIDENT BACTERIA IN BRINE SHRIMP LARVAE (oral presentation)
Microbial community management in aquaculture (PhD course & Training school) (20-22/08/2012) (Poster presentation)
MSc Students Supervised
Name: Rhaodaora Cheryl Montoya MSc in Aquaculture, Faculty of Degree Bio-engineering, Ghent University, Belgium The protective effect of a novel heat Title shock protein inducer on Artemia in a conventional rearing system
Name Diem Nguyen MSc in Aquaculture, Faculty of Degree Bio-engineering, Ghent University, Belgium Effect of microbial communities on the Tittle enrichment process in Artemia
189 Appendix D
190
PART VI
ACKNOWLEDGEMENT
Acknowledgement
Acknowledgement
First I want to express my greatest gratitude to my adored mentor Prof. Dr. ir.
Peter Bossier for his guidance throughout my doctoral studies in Ghent University. I deeply appreciate all his contributions of time, ideas, and funding to my PhD. The joy and enthusiasm he has for his research was contagious and motivational for me, even during tough times in the PhD pursuit. Also, my sincere appreciations for his constant support, understanding and patience especially during the very stressful moments of my PhD life in a foreign country. Special thanks to Prof. Dr. ir Nico Boon and Prof.
Dr. ir Tom Van de Wiele, my co-promoters from Laboratory of Microbial Ecology and
Technology (LabMet), for the research collaboration and the guidance and advices on the microbial ecology related work and reviewing the chapters in my thesis. Truly, without their assistance, this PhD would not have been accomplished. I also give my deepest gratitude to Prof. Dr. Patrick Sorgeloos from Ghent University and Prof. Dr.
Dong Shuanglin from Ocean University of China, for offering me this opportunities to pursue my PhD at the Lab of Aquaculture and Artemia Reference Center (ARC).
Deep gratitude to beloved Mama Magda, as she offered me the great help with accommodation and everything when I first arrived in Gent. If it is not for her, I would have not even found a room for living to start my PhD life in Gent.
A special gratitude also goes to Dr. Tom Deforidt, Dr. Baruah Kartik and Dr.
Peter De Schryver, for their advices on my research work and contributions in my writing. I am also grateful to Pro. Wim Van den Broeck and Dr. Anamaria Rekecki
191 Acknowledgement
(Department of Morphology, Ghent University) for their help in collaboration and contributions to my writing.
Special thanks to Caroline and Alex, our dearest secretaries, for their constant help and patience to all kinds of issues during my living in Ghent.
I also want to extent my acknowledgement to all the ARC members for their support in solving all the administrative issues and also for their assistance in carrying out the experiments. Special thanks to Sebastiaan Vanopstal and Bart Van Delsen who used to be the staff of ARC, thanks for their help during their days in ARC.
A special gratitude to my dearest fellow colleagues who shared all the up and down moments during my PhD: Lenny, Pande, Joseph, Toi, Thai, Dr. Natrah Ikhsan,
Mohamed El Magsodi, Spyros Nikolakakis and other sandwich PhD colleagues.
Special thanks to Li Xuan, Yang Qian, Hu Bing, Parisa, Sofie who has contribute to my research work and all the happy moments. Special thanks also goes to Chinese
Scholarship Council and Ghent University who have funded me to finish my research work.
Finally, I would like to give my deepest gratitude to my family for their constant support. Especially, I owe the biggest thank to my beloved wife, Mrs Cao Jun, for her understanding in my happy but difficult PhD life. Her trust and confidence in me has helped to reduce much stress from my shoulder. I am the luckiest man to have her as a part of my life, experiencing the wonderful days in Belgium and certainly enjoying the rest of our life.
192 Acknowledgement
Words are not enough to express my gratitude. Again, I want to send my greatest appreciation to all the people who have helped me during this unforgettable PhD life in ARC.
Gent, 2th Febuary, 2014
Niu Yufeng
193 Acknowledgement
194